text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
an apparatus is disclosed for measuring the stiffness modulus over time of an aggregate column constructed by tamping the column with a vertically reciprocating driving force . the deflection at the top of the column is measured in real time during construction , and dynamic deflection measurements are processed using a computer program that filters the data to provide a smoothed modulus curve . the system includes a processing system to process data as described hereafter and a sensing system . the system of the invention can use micro - electro - mechanical - systems (โ mems โ) technology to determine the position of a tamper during construction . as is well known , mems is the integration of mechanical elements , sensors , actuators , and electronics on a silicon substrate through microfacrication . as shown in fig1 a , separately positioned sensors 12 determine the position of a tamper and its hammer 51 during construction , and show a data processor 14 , having a display or other like device like a printer , located in an operator &# 39 ; s cockpit of a tamping apparatus 10 of the invention . while fig1 a generally illustrates exemplary positioning of sensors 12 and data processor 14 , it will be appreciated that the positioning of the sensors 12 will be determined by the type of sensors system employed . thus , for example , if a system such as that commercially available under the name trimble gcs is employed , the manufacturer of such systems will direct the location of the sensors . in the case of the device 10 shown in fig1 b , in an exemplary embodiment , a pitch and roll sensor may be installed near the base of the boom . the sensor may be oriented with the longitudinal axis parallel to the boom centerline . a boom angle sensor may be installed on a side face of the boom 63 and oriented with the longitudinal axis parallel to line 39 from the boom / body pivot point 17 to the boom / stick pivot point 19 . a stick angle sensor may be installed on a side face of stick 61 and oriented with the longitudinal axis parallel to line 45 from the boom / stick pivot 19 to the boom / hammer pivot 23 . if a system available under the name trimble gcs600 is used , the sensors are connected to the data processor 14 in accordance with the specifications for such a system . in accordance with fig1 b , a hammer 51 applies dynamic energy to a column being constructed . the dynamic energy results in high frequency vibration of the system during tamping . mems sensors which may be employed , detect the exact position of stick 61 and boom 63 of the tamping apparatus 10 at a high frequency to track dynamic response of the system , and describe the machine orientation . as is explained hereafter with reference to the figures , the hammer 51 position is plotted over time during compaction of a single lift . three phenomena are observed , i . e ., 1 ) the hammer 51 moves downward during tamping , 2 ) there is variability in position of the hammer 51 during tamping and the variability is caused by the vibrations caused by the hammer 51 during tamping , and 3 ) the overall rate of downward deflection reduces with time . a vertically reciprocating driving force is induced by a hydraulically powered tamper attached to the hammer 51 of an excavator and tamping apparatus 10 as shown in fig1 b . in an exemplary embodiment , the following dimensions of the tamping apparatus 10 components shown in fig1 b , are measured and known : 1 . the length of the machine ( lm ) 11 is the horizontal distance from the boom / body pivot point 17 to the point of body rotation 31 . 2 . the height of the machine ( hm ) 13 is the vertical distance from the boom / body pivot point 17 to the bottom of the machine tracks ( ground ) 27 . 3 . the length of the boom ( bl ) 15 is the distance from the boom / body pivot point 17 to the boom / stick pivot point 19 . 4 . the length of the stick ( sl ) 21 is the distance from the boom / stick pivot point 19 to the stick / hammer pivot point 23 . 5 . the boom / body angle ( gamma โ ฮณ ) 25 is the angle formed by the bottom of the machine tracks ( ground ) 27 and the line 29 between the point of body rotation 31 and boom / body pivot point 17 . 6 . the distance of the machine ( dm ) 33 is the distance from the point of body rotation 31 to the boom / body pivot point 17 . the tamping apparatus 10 may use mems technology employed in an angle sensing system using gauges , for example , such as one commercially available under the name trimble gcs600 system , assembled on components of the tamping apparatus 10 in a conventional manner , to measure machine orientation angles in real time . the angles are measured relative to the horizon with respect to tamping apparatus 10 in which the following measurements are used : 1 . the boom angle ( alpha โ ฮฑ ) 35 is the angle between the horizon line 37 and the line 39 between the boom / body pivot point 17 and the boom / stick pivot point 19 . 2 . the stick angle ( beta โ ฮฒ ) 41 is the angle between the second horizon line 43 and the line 45 between the boom / stick pivot point 19 and the stick / hammer pivot point 23 . 3 . the longitudinal slope ( ls ) 47 is the angle between the horizon and the longitudinal axis of the machine body . 4 . the cross slope ( cs ) is the angle between the horizon and the transverse axis of the tamping apparatus 10 body ( not shown in fig1 b ). vibrations resulting from the operation of the hammer 51 of the tamping apparatus 10 for compaction influence the sensors on the tamping apparatus 10 which are used to measure the angles , and result in variations in angle measurements . the angle measurements are processed to account for this induced variation by applying a filtering algorithm to produce filtered angle measurements . the filter can use a parks - mcclellan equiripple algorithm that makes use of the remez exchange algorithm to produce an optimal linear phase filter approximating a desired frequency response , in a manner apparent to those of ordinary skill based on the disclosure herein . smooth deflection plots are generated as disclosed herein through the algorithm which allows for interpretation of the data . the filter is generated using the remez ( n , f , a , w ) command in matlab , wherein : n + 1 = number of filter taps . f = frequency band edges as fractions of the nyquist frequency . a = desired frequency response values at the band edges . w = weights to be applied to the pass and stop bands . in an exemplary embodiment , the filter employed is a 35 point filter generated by : remez ( 34 , [ 0 0 . 01 0 . 1 1 ], [ 1 1 0 0 ], [ 1 . 3 ]), as is illustrated in fig3 . the resulting filter is scaled so that the direct current (โ dc โ) response is exactly 1 by : 1 . 0 . 007125044906646 2 . 0 . 005943054100178 3 . 0 . 008199587605973 4 . 0 . 010822522399877 5 . 0 . 013794983660447 6 . 0 . 017073009490180 7 . 0 . 020603266578722 8 . 0 . 024304546620220 9 . 0 . 028097813618765 10 . 0 . 031881797182137 11 . 0 . 035555749201273 12 . 0 . 039019795063257 13 . 0 . 042150954045455 14 . 0 . 044871906212448 15 . 0 . 047082607397000 16 . 0 . 048719345391338 17 . 0 . 049721660761634 18 . 0 . 050064711528905 19 . 0 . 049721660761634 20 . 0 . 048719345391338 21 . 0 . 047082607397000 22 . 0 . 044871906212448 23 . 0 . 042150954045455 24 . 0 . 039019795063257 25 . 0 . 035555749201273 26 . 0 . 031881797182137 27 . 0 . 028097813618765 28 . 0 . 024304546620220 29 . 0 . 020603266578722 30 . 0 . 017073009490180 31 . 0 . 013794983660447 32 . 0 . 010822522399877 33 . 0 . 008199587605973 34 . 0 . 005943054100178 35 . 0 . 007125044906646 the filter response is plotted on a linear scale in fig4 and on a logarithmic scale in fig5 . as also shown in the figures , examples of the raw angles and the filtered response angles are shown in fig6 and 7 for boom angle alpha and stick angle beta , respectively . the filtered response of the four measured angles ( ฮฑ , ฮฒ , cs , and ls ) and the known machine dimensions are used in real time to calculate the height of the stick / hammer pivot point ( hs ) 53 . as shown in fig1 b , the value of hs 53 at any point in time is the sum of the height of the machine ( vm ) 55 and the vertical distance ( dv ) 57 between the boom / body pivot point 17 and the stick / hammer pivot point 23 . referring to fig1 b , the following calculations apply : vm =โ{ square root over ( lm 2 + hm 2 )}* sin ( ls + ฮณ ) at the start of the column lift compaction process , the apparatus 10 includes a system that measures the angles at the aforedescribed locations , determines the filtered response of each angle , and calculates the initial height of stick ( hs 0 ). during the compaction process , the apparatus calculates the height of the stick at time t ( hs t ), preferably , approximately nine times per second . the calculated hs t is further filtered based on a 27 point moving average and used to calculate the time modulus ( m t ), as shown in fig8 . the time modulus is inverse of the slope of the filtered hs versus time curve . the effect of the data filters is to reduce the variability of the calculated hs t values sufficiently to provide calculated m t values that are meaningful . fig9 shows the effect of filtering the angle measurements on the calculated hs values , while the effect of filtering the hs values is shown in fig1 . the effect of the data filters on the calculated m t values is shown in fig1 . the hs versus time curve is highly variable when hs is calculated using the raw angle measurements , referencing fig9 , and the magnitude of the slope of the curve is large . the time modulus ( m t ) is the inverse of the slope of the hs versus time curve , and thus the values of m t calculated when no filtering is applied are consistently small and difficult to interpret . values of m t calculated using filtered angles and filtered hs values represent the underlying phenomenon and is therefore meaningful as a real - time measure of column lift stiffness . accordingly , once deflection is reduced to a predetermined amount ( a smaller amount ) as determined from the calculations , compaction can cease and a new lift added as appropriate . referring to the prior description , the use of commercially available systems for excavators such as the trimble gcs 600 system for measuring elevation is possible . in addition , other components which can be used include , for example , one available under the name , panasonic toughbook u1 pc , and customized data filtering and recording software as is evident to those of ordinary skill from the prior description . as will be appreciated , in practice , the invention involves the measurement of angles of the tamping apparatus stick and boom 61 and 63 , and resolving of the respective angles to obtain the tamper elevation . elevation is typically measured approximately ten ( 10 ) times per second and recorded in a raw data form . the software algorithm previously described is used to filter the data ( that accounts or corrects for tamper vibration , etc .) as shown in the attached figures . the generated curves are analogous to stiffness of the lift and when the slope of the curves reach a certain pre - defined angled , it is determined that the target modulus has been reached . for example , as shown in fig8 , the time modulus at a tamping time at 14 seconds is 2 . 7 seconds / inch . at a tamping time of 17 seconds , the time modulus value increases to 7 . 1 seconds / inch . if the target threshold time modulus of 7 seconds / inch is established for the design , the lift would need to be tamped approximately 17 seconds to reach the modulus criterion . in various operating and project site environments , the typical process will involve the testing of a load column to get the target base point for that particular site . this site specific data is then used on production columns throughout the construction process . the modulus testing process is performed during construction of each lift and provides the quality control necessary to confirm that each column meets design standards . the invention also includes the use of standardized data recording hardware , and a pressure switch on a hydraulic line , to start / stop the data recording , identification of a lift quality metric , providing a hammer operating status indicator , and the use of a hammer plumbness sensor . a pier quality metric may also be identified from a combination of each lift quality metric . the foregoing detailed description of embodiments refers to the accompanying drawings , which illustrate specific embodiments of the invention . other embodiments having different structures and operations do not depart from the scope of the present invention . the term โ the invention โ or the like is used with reference to certain specific examples of the many alternative aspects or embodiments of the applicants &# 39 ; invention set forth in this specification , and neither its use nor its absence is intended to limit the scope of the applicants &# 39 ; invention or the scope of the claims . this specification is divided into sections for the convenience of the reader only . headings should not be construed as limiting of the scope of the invention . it will be understood that various details of the present invention may be changed without departing from the scope of the present invention . furthermore , the foregoing description is for the purpose of illustration only , and not for the purpose of limitation .
| 4 |
methods and apparatuses for semi - planar avalanche photodetectors ( apds ) are disclosed . in the following description numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be apparent , however , to one having ordinary skill in the art that the specific detail need not be employed to practice the present invention . in other instances , well - known materials or methods have not been described in detail in order to avoid obscuring the present invention . reference throughout this specification to โ one embodiment โ or โ an embodiment โ means that a particular feature , structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , appearances of the phrases โ in one embodiment โ or โ in an embodiment โ in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures or characteristics may be combined in any suitable manner in one or more embodiments . in addition , it is appreciated that the figures provided herewith are for explanation purposes to persons ordinarily skilled in the art and that the drawings are not necessarily drawn to scale . moreover , it is appreciated that the specific example doping concentrations , thicknesses and materials or the like that are described in this disclosure are provided for explanation purposes and that other doping concentrations , thicknesses and materials or the like may also be utilized in accordance with the teachings of the present invention . fig1 is a diagram illustrating generally a cross - section view of a system 102 including a semi - planar avalanche photodetector ( apd ) 101 according to an example of the present invention . in the illustrated example , light or an optical beam 123 is directed from an optical source 139 to apd 101 . depending on the specific application , optical beam 123 may originate from or may be reflected from optical source 139 . in one example , optical beam 123 may optionally be directed or focused from optical source 139 directly to apd 101 or may be directed through an optical element 137 to apd 101 . it is appreciated that one or more apds 101 may be used in a variety of applications and configurations . for instance , depending on the specific application , it is appreciated that apd 101 may be employed individually to for example detect a signal encoded in lower power optical beam 123 in telecommunications . in another example , apd 101 may be one of a plurality of apds arranged in an array or grid to sense images or the like . for example , an array apd &# 39 ; s arranged in a grid may function to sense images , similar to a complementary metal oxide semiconductor ( cmos ) sensor array or the like . in one example , optical element 137 may include a lens or other type of refractive or diffractive optical element such that an image is directed or focused on array of apds 101 with illumination including optical beam 123 . optical beam 123 may include visible light , infrared light and / or a combination of wavelengths across the visible through infrared spectrum or the like . in the illustrated example , apd 101 is functionally a combination of a photodiode that converts optical signal into electrical signal and an amplifier that multiplies the detected signal with gain . as shown , apd 101 includes a mesa structure 103 including a first type of semiconductor material 111 proximate to and separated from a planar region 105 including a second type of semiconductor material 113 . as shown in the example , mesa structure 103 includes an absorption region and planar region 105 includes a separate multiplication region 109 . in the illustrated example , the first type of semiconductor material includes an intrinsic germanium region 125 and the second type of semiconductor material includes a p doped silicon region 115 adjoining an n doped silicon region 117 as shown . in the example , an external bias voltage v + 135 may be applied to the apd 101 through a contact 121 coupled to the planar region 105 and a contact 122 coupled to mesa structure 103 . in one example , contact 122 is coupled to the mesa structure 103 at a p doped region of the first type of semiconductor material 127 and contact 121 is coupled to the planar region 105 at an n + doped region of the second type of semiconductor material 119 , which help improve the ohmic contact of contacts 121 and 122 to the apd 101 in accordance with the teachings of the present invention . in the example shown in fig1 , it is noted that the n + doped region 119 is illustrated to be a region confined or centered underneath the mesa structure 103 . as will be illustrated in another example shown fig2 , it is appreciated that the n + doped region can also be a uniform layer throughout the planar region 105 . for instance , in such an example , the n + doped region 119 could be a highly n + doped silicon substrate layer defined in the planar region 105 in accordance with the teachings of the present invention . referring back to the example illustrated in fig1 , it is noted that the first type of semiconductor material is shown as germanium . it is appreciated that in another example , the first type of semiconductor material may include ingaas or another suitable type of material in accordance with the teachings of the present invention . in the example shown in fig1 , apd 101 includes two regions in terms of electric field strength โ one is in absorption region 107 of mesa structure 103 , in which a low electric field is created with the application of the external bias voltage v + 135 to apd 101 . the other electric field region is in the multiplication region 109 of the planar region 105 , in which a high electric field is created at the pn junction interface between the p doped silicon region 115 and the n doped silicon region 117 in accordance with the teachings of the present invention . in operation , free charge carriers or electron - hole pairs are initially photo - generated in the absorption region 107 in mesa structure 103 by the incident photons of optical beam 123 if the photon energy is equal to or higher than the band gap energy of the semiconductor material ( e . g . germanium or ingaas ) inside low electric field absorption region 107 . these photo - generated charge carriers are illustrated in fig1 as holes 131 and electrons 133 . with the application of the external bias voltage v + 135 to apd 101 resulting in the low electric field in mesa structure 103 , the holes 131 are accelerated towards contact 122 coupled to the mesa structure 103 while the electrons 133 are accelerated towards contact 121 out from the mesa structure 103 into the planar region 105 in accordance with the teachings of the present invention . it is noted that the speed performance of apd 101 is improved by having mesa structure 103 localize the low electric field in the absorption region 107 in accordance with the teachings of the present invention . electrons 133 are separated from holes 131 as they injected as a result of the low electric field in the absorption region 107 into the high electric field in multiplication region 109 as a result of the pn junction interface between the p and n doped silicon region 115 and 117 . impact ionization occurs as electrons 133 gain enough kinetic energy and collide with other electrons in the semiconductor material in multiplication region 109 resulting in at least a fraction of the electrons 133 becoming part of a photocurrent . a chain of such impact ionizations leads to carrier multiplication in accordance with the teachings of the present invention . avalanche multiplication continues to occur until the electrons 133 move out of the active area of the apd 101 to contact 121 . therefore , with the low electric field absorption region 107 part of the apd 101 included in a mesa structure 103 and with the high electric field multiplication region 109 included in a planar region 105 as shown , a โ semi - planar โ apd 101 is realized in accordance with the teachings of the present invention . in other words , with the combination of a planar structure for planar region 105 for the silicon portion of apd 101 , and a mesa structure 103 for the germanium portion of apd 101 , a semi - planar apd 101 is realized . in the illustrated example , with the combination of a planar structure of the silicon portion and a mesa structure for the germanium or ingaas portion of apd 101 , benefits of having both planar and mesa structures may be realized in accordance with the teachings of the present invention . for example , by having the planar region 105 for the silicon , apd 101 has low dark current , increased reliability and uniform avalanche gain in accordance with the teachings of the present invention . in addition , by having the mesa structure 103 for the germanium or ingaas , apd 101 has high speed and low crosstalk between any neighboring pixels in arrays of apds since the low electric field is confined in the mesa structure 103 in accordance with the teachings of the present invention . in addition , with a semi - planar apd 101 , where one material , such as silicon , is included in the multiplication region 109 and another material , such as germanium or ingaas , is included in the absorption region 107 allows different processing and design techniques that can be optimized for each specific region and / or material in accordance with the teachings of the present invention . for instance , in one example , germanium may be epitaxially grown using selective growth germanium on tope of the silicon of planar region 105 . mesa structure 103 can then be etched with the etching being stopped at the silicon of planar region 105 . by etching the mesa structure 103 and stopping the etching at the silicon , a mesa structure 103 including the absorption region 107 is provided while maintaining planar region 105 with a multiplication region 109 including silicon in accordance with the teachings of the present invention . thus , in the specific example illustrated in fig1 , a germanium on silicon , or ge โ si , apd 101 is illustrated where the germanium mesa structure 103 includes the absorption region 107 , which has low electric field ; while silicon is in the multiplication agent in which high electric field is concentrated under the central p doped region 115 . in one example , due to the curvature of the central p doped region 115 , the high electric field peaks along the edge of the center p doped region 115 . fig1 also illustrates an optional guard ring structure 129 that may included in apd 101 , which in the example is shown as a floating guard ring having a p doped silicon region disposed in the silicon of planar region 105 . fig2 is another diagram illustrating an example of a tilt view of the cross - section of the semi - planar apd 101 shown in fig1 with mesa structure 103 having absorption region 107 disposed over planar region 105 having multiplication region 109 in accordance with the teachings of the present invention . in the example illustrated in fig2 , it is noted that the n + doped region 119 is a uniform highly doped silicon layer throughout the planar region 105 , as mentioned previously . as shown the example illustrated in fig2 , guard ring structure 129 is a floating guard ring including p doped silicon disposed in the silicon of planar region 105 surrounding the mesa structure 103 in accordance with the teachings of the present invention . thus , in the example , the guard ring structure 129 is at or proximate to the interface between the absorption region 107 and the multiplication region 109 of apd 101 in accordance with the teachings with the present invention . in the illustrated example , guard ring structure 129 provides the structure to help reduce or prevent premature breakdown in the multiplication region 109 at the device periphery . in one example , guard ring structure 129 may be included using ion implantation , diffusion or another suitable technique . it is appreciated that a โ sandwiched โ guard ring structure as illustrated is made possible the semi - planar structure of the apd 101 as such a structure would not be possible with a mesa only device . in addition , it is noted that by having multiplication region 109 in a planar region 105 , sensitivity to side walls passivation , which can cause undesired leakage current due to the high electric field in the multiplication region 109 is eliminated in accordance with the teachings of the present invention . the above description of illustrated embodiments of the invention , including what is described in the abstract , is not intended to be exhaustive or to be limitation to the precise forms disclosed . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes , various equivalent refinements and modifications are possible , as those skilled in the relevant art will recognize . indeed , it is appreciated that any specific wavelengths , dimensions , materials , times , voltages , power range values , etc ., are provided for explanation purposes and that other values may also be employed in other embodiments in accordance with the teachings of the present invention . these modifications can be made to embodiments of the invention in light of the above detailed description . the terms used in the following claims should not be construed to limit the invention to the specific embodiments disclosed in the specification and the claims . rather , the scope is to be determined entirely by the following claims , which are to be construed in accordance with established doctrines of claim interpretation .
| 8 |
this invention relates to compositions of a drug with a water soluble polymer which has been treated with a wetting sufficient amount of a wetting agent selected from anionic and cationic surfactants . in preferred embodiments the composition is a solid , usually a powder , which is then compounded into suitable solid dosage forms for oral administration . griseofulvin is a known antibiotic which has been found useful in the treatment of certain fungus diseases of plants , man and animals . griseofulvin as discussed in the background of this invention is also known as a poorly soluble or water soluble drug , which in vivo provides a low order of bioavailability when administered orally . thus the composition of the instant invention is particularly useful for griseofulvin and drugs of a similar nature such as certain steroids and antibiotics which due to their low aqueous solubility and / or high melting point are poorly absorbed . illustrative of such drugs are medrogestone ; progesterone ; estradiol ; 10 , 11 - dihydro - 5h - dibenzo [ a , d ] cycloheptene - 5 - carboxamide ; 5h - dibenzo [ a , d ] cycloheptene - 5 - carboxamide and the like . the compositions of this invention , as will soon be appreciated , further permit the formulation of solid dosage forms which may contain high concentrations of the particular drug , such as griseofulvin , with no concomitant loss of bioavailability usually associated with such high concentrations . these compositions thus allow the preparation of elegant solid dosage forms . the compositions of this invention are also resistant to agglomeration of the drug particles or the tendency of the drug in storage to produce undesirable crystal formation which adversely affects bioavailability of the drug . polymers useful in this invention include water soluble polymers which are nontoxic and pharmacologically acceptable , particularly for oral administration . illustrative of polymers , found suitable in this invention include polyvinylpyrrolidone , hydroxypropyl methyl cellulose , hydroxypropyl cellulose , methyl cellulose , block co - polymers of ethylene oxide and propylene oxide , and polyethylene glycol . generally these polymers are commercially available over a broad range of average molecular weights . for example , polyvinylpyrrolidone ( pvp ) is a well known product produced commercially as a series of products having mean molecular weights ranging from about 10 , 000 to 700 , 000 . prepared by reppe &# 39 ; s process : 1 , 4 - butanediol obtained in the reppe butadiene synthesis is dehydrogenated over copper at 200 ยฐ forming ฮณ - butyrolactone ; reaction with ammonia yields pyrrolidone . subsequent treatment with acetylene gives the vinyl pyrrolidone monomer . polymerization is carried out by heating in the presence of h 2 o 2 and nh 3 . debell et al ., german plastics practice ( springfield , 1946 ); hecth , weese , munch . med . wochenschr . 1 943 , 11 ; weese , naturforschung & amp ; medizin 62 , 224 ( wiesbaden 1948 ), and the corresp vol . of fiat review of german science . monographs : general aniline and film corp ., pvp ( new york , 1951 ); w . reppe , polyvinylpyrrolidon ( monographie zu &# 34 ; angewandte chemie &# 34 ; no . 66 , weinheim / bergstr ., 1954 ). generally available commercial grades have average molecular weights in the range of 10 , 000 to 360 , 000 , for example , general aniline and film corporation ( gaf ) markets at least four viscosity grades available as k - 15 , k - 30 , k - 60 , and k - 90 which have average molecular weights of about 10 , 000 , 40 , 000 , 160 , 000 and 360 , 000 , respectively . the k - values are derived from viscosity measurements and calculated according to fikentscher &# 39 ; s formula ( kline , g . m ., modern plastics 137 no . 1945 ). similar commercial products are available from basf - wyandotte . selection of a particular polymer with its characteristic molecular weight will in part depend on its ability to form suitable dosage forms with the particular drug . thus , in preparing solid dosages , whether in powder , tablet or capsule units , the composition of this invention should be readily grindable or pulverizable , or in the form of free - flowing powders . a second consideration in the selection of a particular polymer derives from the limitations inherent in the use of specific equipment with polymers of increasingly higher viscosity . for example in forming the drug - polymer solution or mixture , complete dissolution or mixing could be inhibited utilizing blenders , mixer or the like , which are inadequate by reason of low shear or proper baffles to form a uniform and homogeneous drug - polymer solution or mixture . depending on the process employed for forming of the drug - polymer mixture , another consideration in the selection of a particular polymer is that the polymer be mutually soluble in solvents for the particular drug . the wetting agents found most suitable for the present invention are those selected from anionic or cationic surfactants . in addition , to those cited in the summary of this disclosure , other suitable surfactants of the anionic variety are illustrated by sodium stearate , potassium stearate , sodium oleate and the like . the compositions of this invention are prepared in a step by step process . in the first step , a mixture or solution of the drug witht the water soluble polymer is formed . the mixture can be formed in a solvent or solvent mixture which is a mutual solvent for both the drug and the polymer . alternatively , the drug - polymer , solvent mixture can , at this stage , be coated onto lactose . where the drug and the polymer are not subject to degradation at elevated temperatures , the drug - polymer mixture may also be formed by melt mixing . any volatile solvent in which the drug is soluble is suitable for forming the drug - polymer mixture . for griseofulvin , suitable solvents would include methylene chloride , methylene chloride - ethanol , chloroform , acetone , methyl ethyl ketone and combinations thereof . the most suitable polymer for forming the melt mixture with a drug such as griseofulvin is hydroxypropyl cellulose . after the drug - polymer mixture or solution has been formed in a solvent it is dried by spray - drying , flash evaporation or air drying . commercially , spray - drying is most practical since the dried mixture is already in powder form . in the case of the melt mixture drying the drug - polymer mixture is defined as cooling . the melt - mix product is then ground or milled into powder form in preparation for the next step ; grinding or milling may also be necessary for dried solvent formed mixtures . the powdered drug - polymer mixture is then treated with a wetting sufficient amount of a primarily aqueous wetting solution containing a wetting agent selected from anionic and cationic surfactants . this wetting treatment is accomplished by forming a slurry , wet granulation or paste mixture of the powdered drug - polymer with the wetting solution . the wetting solution treatment can be achieved with small incremental additions of the wetting solution or a larger single - shot treatment . the wetting solution treatment apparently fulfills two roles : crystallization of any amorphous regions into ultramicrosize crystals , and the breakup of clusters of such crystals so that they disperse spontaneously when exposed to water . also , the role of the primarily aqueous solution for the wetting agent treatment is to distribute the wetting agent to surfaces of the drug , whether or not the drug is amorphous or crystalline . when the employment of more than one polymer is desired , separate drug - polymer mixtures for each polymer are usually prepared which are then initimately blended with each either in dry form prior to or after the wetting solution treatment . the treated mixture is then dried as earlier described and , if necessary , it is milled , screened or ground prior to formulating into suitable dosage forms with pharmaceutically acceptable excipients . it will be again appreciated by those skilled in the art that while the invention is illustrated with particularly water insoluble drugs , the composition and method of this invention is also applicable to more soluble drugs in need of enhanced bioavailability . in such instances a broader range of solvents and polymers including the natural gums may be employed to form the drug - polymer mixture . the concentrations of drug found useful in the drug - polymer mixture of this invention range from the lowest therapeutically effective amount of the drug up to about 90 to 95 % of the drug . thus , in griseofulvin - polymer mixtures , the concentration of griseofulvin ranges from about 0 . 1 % by weight to about 90 - 95 % by weight . in order to form pharmaceutically elegant dosage forms for high dose drugs , the concentration of the drug should be at least 50 % by weight of the drug - polymer mixture . in especially preferred embodiments the concentration of drug in the drug polymer mixture will range from about 50 % to about 80 % by weight . the required concentration for the wetting agent ( or surfactant ) in the primarily aqueous wetting solution is a wetting sufficient amount . this amount further depends on whether incremental or single - shot wetting treatments are employed and on whether a slurry or paste treatment is contemplated . generally , small incremental treatments will require less wetting agent than a larger single shot treatment and a paste treatment will require more wetting agent than a slurry . in any case , it has been found that satisfactory results are obtained when the amount of wetting agent comprises from about 0 . 025 % to about 2 . 0 % by weight of the dried drug polymer mixture and preferrably from about 0 . 1 % or 0 . 2 % to about 1 . 0 % by weight . while higher concentrations of the wetting agent may be satisfactorily employed , no additional advantages in terms of dissolution and / or bioavailability are obtained . it has also been found that when a griseofulvin - polymer , melt mixture has been wetted and crystallized from an aqueous sorbitol solution , enhanced dissolution rates was obtained , however the rate of dissolution was still less that those mixtures treated with a wetting agent . the rate of dissolution of the powdered materials was determined by one of three methods . all three methods gave equivalent results and only the results of method 1 outlined below are used herein unless otherwised noted . method ( 1 ) a sample containing 20 mg of griseofulvin was dissolved into 1 liter of a 0 . 02 % polysorbate 80 aqueous solution at 37 ยฐ c . the solution was monitored by a flow cell in a spectrophotometer set at 295 nm . method ( 2 ) a sample containing 500 mg griseofulvin was dissolved in 10 liters of 0 . 15 % sodium lauryl sulfate in water at 37 ยฐ c . method ( 3 ) a sample containing 125 mg griseofulvin was dissolved in 24 liters of water at 37 ยฐ c . for examples 2 - 5 the wetting agent solution employed was as follows : 2 . 5 g of sodium lauryl sulfate ( sls ) were dissolved into 500 ml of a mixture of 100 ml of water and 400 ml of ethyl alcohol or 0 . 25 g of sodium lauryl sulfate were dissolved into 50 ml of a mixture of 10 ml of water and 40 ml of ethyl alcohol . this example describes the preparation of ultramicrocrystalline griseofulvin . the method consists of flash evaporation of a solution containing 10 g of griseofulvin and 10 g of polyvinylpyrrolidone ( povidone ยฎ k - 30 , u . s . p .- from gaf corp .) dissolved in 200 ml of methylene chloride . the evaporation was done on a rotating evaporator at 35 ยฐ- 45 ยฐ c . in a closed system ( vacuum ). about 4 - 5 ml of the solution to be evaporated was placed in a 100 ml round bottom flask , then placed on the evaporator . upon evaporation of solvent , the material was deposited onto the wall of the flask . the dried material was found to be amorphous by x - ray diffraction . next , this amorphous material was treated with the sls solution . to 2 g of powder , 0 . 125 ml of the solution was added with constant mixing and the solvent was allowed to dry . this was repeated six more times until a total of 0 . 875 ml of solution had been added . microscopic observation and dissolution data showed that ultramicrocrystalline griseofulvin was formed by this method and has a much faster dissolution rate into water at 37 ยฐ c ., than microsized griseofulvin or untreated amorphous material table 1______________________________________ dissolution profile of griseofulvin into water at 37 ยฐ c . thedissolved griseofulvin , unless otherwise specified , is expressedin mg / liter over an elapsed time period in minutes . sample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 11 . 2 11 . 7 11 . 9 12 . 0 12 . 2 12 . 52 2 . 5 3 . 8 4 . 8 6 . 5 8 . 7 9 . 83 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - flash evaporated griseofulvin : pvp ( 50 % griseofulvin ) treated with sls solution . 2flash evaporated griseofulvin : pvp ( 50 % 3 - microsized griseofulvin table 1 -- this example describes the preparation of ultramicrocrystalline griseofulvin by coating a solution of griseofulvin and polyvinylpyrrolidone onto lactose then treating the powder with a solution of sodium lauryl sulfate . a solution was prepared by dissolving 1 g of griseofulvin and 1 g of polyvinylpyrrolidone into 8 ml of methylene chloride . all this solution was coated successively in 1 ml portions onto 2 g of lactose and allowed to dry . the material formed by this method was crystalline by x - ray diffraction . next 1 ml of the sls solution was added to the 4 g of powder and allowed to dry . microscopic observation and dissolution data showed that the griseofulvin formed by this method was ultramicrocrystalline and had a much faster dissolution rate into water at 37 ยฐ c ., than microsized griseofulvin . table 2______________________________________sample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 10 . 8 11 . 6 11 . 8 11 . 9 12 . 0 12 . 02 7 . 0 8 . 7 9 . 7 10 . 5 11 . 5 11 . 53 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - griseofulvin : pvp ( 50 : 50 ) coated onto lactose and treated with sls solution . 2griseofulvin : pvp ( 50 : 50 ) coated onto lactose . 3microsized griseofulvin this example describes the preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone then treating with powder with a solution of sodium lauryl sulfate . a solution of 50 g of griseofulvin and 50 g of polyvinylpyrrolidone dissolved in 2 liters of methylene chloride was spray dried at room temperature . a mixture of 1 ml of the sls solution and 2 g of the powder was dried . microscopic observation and dissolution data showed the griseofulvin formed by this method to be ultramicrocrystalline and has a much faster dissolution rate into water at 37 ยฐ c . than microsized griseofulvin . table 3______________________________________sample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 10 . 5 10 . 7 10 . 8 11 . 0 11 . 0 11 . 02 3 . 2 4 . 4 5 . 6 8 . 1 9 . 9 10 . 43 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - spray dried griseofulvin : pvp ( 1 : 1 ) treated with sls solution . 2spray dried griseofulvin : pvp ( 1 : 1 ) 3 - microsized griseofulvin this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at room temperature . to 2 g of the powder , 3 / 4 ml of the sls solution was added in six 0 . 125 ml increments and dried between additions . microscopic observation and dissolution data showed that the griseofulvin formed by this method was ultramicrocrystalline and had a much faster dissolution rate into water at 37 ยฐ c . than microsized griseofulvin . table 4______________________________________sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . 15 min . ______________________________________1 10 . 0 10 . 9 11 . 5 12 . 0 12 . 5 12 . 7 -- 2 2 . 5 3 . 9 4 . 9 6 . 5 9 . 0 10 . 4 -- 3 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2 -- 4 1 . 9 3 . 5 4 . 6 6 . 3 8 . 6 -- 9 . 75 1 . 8 3 . 0 4 . 0 5 . 8 8 . 1 -- 9 . 36 1 . 9 3 . 1 4 . 3 6 . 0 8 . 6 -- 9 . 7______________________________________ 1 - spray dried griseofulvin : pvp ( 70 : 30 ) treated with sls solution . 2spray dried griseofulvin : pvp ( 70 : 30 ). 3microsized griseofulvin 4 - spray - dried griseofulvin : pvp treated with the nonionic polysorbate 80 . griseofulvin : pvp : nonionic ( 69 . 7 : 29 . 7 : 0 . 5 ) 5spray dried griseofulvin : pvp treated with the nonionic block copolymer of ethylene oxide and propylene oxide ( pluronic ยฎ f77 ) griseofulvin : pvp : nonionic ( 69 . 7 : 29 . 7 : 0 . 5 ) 6spray dried griseofulvin : pvp treated with the nonionic isooctyl phenoxy polyethoxy ethanol . griseofulvin pvp : nonionic ( 69 . 7 : 29 . 7 : 0 . 5 ) table 5______________________________________dissolution profilesample 1 min . 2 min . 3 min . 5 min . 10 min . 14 min . ______________________________________1 10 . 0 10 . 9 11 . 5 12 . 0 12 . 5 12 . 72 6 . 9 8 . 7 9 . 7 10 . 4 11 . 3 -- 3 6 . 0 7 . 0 7 . 3 7 . 7 8 . 0 -- 4 1 . 6 2 . 7 3 . 4 4 . 7 7 . 0 8 . 2______________________________________ 1 - spray dried griseofulvin : pvp ( 70 : 30 ) treated 2 - dorsey laboratories &# 39 ; grispeg ( trademark ) for griseofulvin composition i peg 6000 . 3schering laboratories &# 39 ; fulvicin p / g ( trademark ) for griseofulvin composition in peg 6000 . 4microsized griseofulvin . in the samples evaluated in tables 6 - 8 , the following further describes their preparation . two grades of hydroxypropyl cellulose were used , klucel ยฎ ef and klucel ยฎ lf ( hercules ), the former preferred for its lower viscosity . coarse griseofulvin , spray dried lactose , sorbitol , and sodium lauryl sulfate were the other ingredients . the solvents were methylene chloride and absolute ethanol , u . s . p . grade . crystallinity of griseofulvin preparations were judged by visual microscopic observation under crossed polarizers , or by x - ray diffraction assay . a glass melting tube immersed in a hot oil bath was used to melt together various amounts of griseofulvin and klucel . after complete melting and mixing , the liquid mixture was rapidly chilled under a cold water tap , while rotating the tube horizontally so as to distribute the liquid over the inside walls . after solidification , the tube was further cooled in a dry ice bath , which fractured the product and allowed its removal from the glass tube . the chunky product was ground to a powder in a micromill . typically , an amount of powdered melt mixture was intimately mixed with an equal weight of an aqueous solution containing , by weight , about 22 % sorbitol and 13 % ethanol . this was vigorously mixed and worked with a spatula , until the doughy mixture acquired the consistency of a smooth cream or paste . the paste was allowed to dry , and the dry chunky product was ground in a mortar . solution for spray drying were prepared by dissolving griseofulvin and klucel in a mixture of methylene chloride and ethanol . an anhydro laboratory spray dryer no . 3 was used , and the solution was spray dried at room temperature . typically , a weight of spray dried powder ( whether amorphous or crystalline ) was intimately mixed with about 0 . 9 weight of a 1 . 5 % aqueous solution of sodium lauryl sulfate . the solution could also contain ethanol and sorbitol or lactose , but this was found to be unnecessary . the doughy mixture was vigorously mixed and worked with a spatula , until it became a smooth paste . then , about 0 . 25 weight of lactose was added , and mixed until again smooth . the paste was spread and dried at around 85 ยฐ c . the elevated temperature coagulated the wet paste into granules , which could be stirred and mixed at times during drying , to diminish caking . the dry product was milled and passed through a 60 or 80 mesh screen . the product contained about 1 % sodium lauryl sulfate . treatment of spray dried mixtures with sodium lauryl sulfate solution , without pasting about 2 . 0 g of spray dried griseofulvin - klucel ยฎ mixture was placed in a mortar , then treated successively with six 0 . 125 ml portions of a wetting solution , allowing enough drying between portions to prevent the powder from becoming pasty . the wetting solution contained 5 mg / ml sodium lauryl sulfate in a mixture of 4 parts ethanol - 1 part water , by volume . the final granular powder contained about 0 . 2 % sodium lauryl sulfate . crystallization of spray dried powders with sodium lauryl sulfate solution on a 1 kg scale were achieved in a hobart mixer , equipped with a small bowl and a pastry blade . lactose was added to the paste , then the mixture was spread on trays and dried at 85 ยฐ c . the chunky , partially caked product was milled and screened . ______________________________________ spray dried mixtures of griseofulvin & amp ; hydroxypropyl cellulose ( klucel )ยฎ composition of solutionsolids griseofulvin solventcontent content volume ( g / l of (% of ratio crystallinitysolvent ) solids ) ( mecl . sub . 2 / etoh ) of product______________________________________100 50 7 / 1 mostly amorphous 50 75 9 / 1 amorphous167 75 8 . 6 / 1 crystalline200 80 7 / 1 crystalline______________________________________ table 6______________________________________dissolution profile . sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 15 min . 20 min . ______________________________________1 4 . 1 8 . 0 9 . 2 10 . 8 12 . 6 13 . 4 13 . 72 1 . 5 2 . 7 3 . 4 4 . 7 7 . 0 8 . 4 9 . 23 0 . 5 1 . 0 1 . 3 2 . 0 3 . 2 4 . 2 5 . 0______________________________________ 1 - melt mixture of griseofulvin ( 75 %) klucel ยฎ ( 25 %), crystallized with sorbitol solution 2 - micronized griseofulvin 3 - melt mixture of griseofulvin ( 83 %) klucel ยฎ ( 17 %), amorphous . table 7______________________________________sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 15 min . 20 min . ______________________________________1 2 . 0 3 . 6 4 . 7 6 . 5 9 . 8 11 . 4 12 . 82 2 . 0 3 . 6 4 . 7 6 . 5 9 . 2 10 . 5 11 . 83 1 . 5 2 . 7 3 . 4 4 . 7 7 . 0 8 . 4 9 . 24 0 . 8 1 . 5 2 . 0 2 . 8 4 . 7 5 . 8 6 . 5______________________________________ 1 - spray dried griseofulvin ( 75 %) klucel ยฎ ( 25 %) mixture , amorphous . 2 - spray dried griseofulvin ( 50 %) klucel ยฎ ( 50 %) mixture , mostly amorphous . 3 - micronized griseofulvin . 4spray dried griseofulvin ( 80 %) klucel ยฎ ( 20 %) mixture crystalline . table 8______________________________________sam - ple 1 min . 2 min . 3 min . 5 min . 10 min . 15 min . 20 min . ______________________________________1 6 . 2 11 . 1 11 . 5 12 . 0 12 . 5 12 . 7 12 . 82 6 . 2 10 . 2 11 . 0 11 . 6 12 . 1 12 . 2 12 . 33 1 . 5 2 . 7 3 . 4 4 . 7 7 . 0 8 . 4 9 . 2______________________________________ 1 - spray dried mixture of griseofulvin : pvp ( 70 : 30 ), treated with sls solution ./ 2 spray dried mixture of griseofulvin : klucel ยฎ ( 75 : 35 ), crystallized with sodium lauryl sulfate solution . 3micronized griseofulvin this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and hydroxypropyl methyl cellulose and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 40 g of hydroxypropyl methylcellulose 80 g of griseofulvin and 200 ml of methanol dissolved into 2 liters of methylene chloride was spray dried at r . t . the dried material was found to be amorphous by x - ray diffraction . to 4 g of the powder , 4 ml of a solution containing 1 . 5 g sodium lauryl sulfate dissolved into 100 ml of h 2 o was mixed in , and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method and has a much faster dissolution rate into water at 37 ยฐ c ., then microsized griseofulvin or untreated amorphous material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and methylcellulose and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 40 g of methylcellulose ( 15 cps ) and 120 g of griseofulvin , and 200 ml of methanol dissolved into 2 liters of methylene chloride was spray dried at r . t . the dried material was found to be partly amorphous and partly crystalline by x - ray diffraction . to 4 g of the powder , 4 ml of a 1 . 5 % sodium lauryl sulfate solution was added and mixed in . the mixture then was dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and poly ( oxypropylene ) poly ( oxyethylene ) block copolymer ( pluronic ยฎ f77 basf wyandotte corp .) and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 100 g of the block copolymer and 100 g griseofulvin dissolved into 2 liters of methylene chloride was spray dried at rt , to 4 g of the powder , 2 ml of a 1 . 5 % sodium lauryl sulfate was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyethylene glycol and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 100 g of griseofulvin and 100 g of polyethylene glycol 6000 dissolved into methylene chloride was spray dried . to 4 g of the powder , 2 ml of a 1 . 5 % sodium lauryl sulfate solution was added , mixed and dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution containing griseofulvin and hydroxypropyl methylcellulose and then treating the powder with a solution of sodium lauryl sulfate . a solution containing 40 g of hydroxypropyl methylcellulose , 160 g of griseofulvin and 100 ml of ethanol dissolved into 2 liters of methylene chloride was spray dried . to 2 g of powder , 0 . 125 ml of sodium lauryl sulfate wetting solution ( see above example no . 7 ) was added with constant mixing and the solvent was allowed to dry . this was repeated five more times until a total of 0 . 750 ml of solution had been added . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of benzalkonium chloride . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 1 % aqueous solution of benzalkonium chloride was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of sodium laurate . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 2 % aqueous solution of sodium laurate was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ultramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of dioctyl sodium sulfosuccinate . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 1 % aqueous solution of dioctyl sodium sulfosuccinate was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . this example describes preparation of ulramicrocrystalline griseofulvin by spray drying a solution of griseofulvin and polyvinylpyrrolidone and then treating the powder with a solution of bis ( 2 - hydroxyethyl ) oleylamine . a solution of 70 g of griseofulvin and 30 g of polyvinylpyrrolidone dissolved into 2 liters of methylene chloride was spray dried at rt . to 4 g of the powder , 2 ml of a 2 % aqueous solution of bis ( 2 - hydroxyethyl ) oleylamine was added , mixed and then dried . microscopic observation and dissolution data shows that ultramicrocrystalline griseofulvin was formed by this method , and it has a much faster dissolution rate then microsized griseofulvin or untreated material . table 9__________________________________________________________________________the results of dissolution studies on the samples prepared by examples7 - 15are listed below . the unit of expression for this table is percent ofsaturation achievedin time expressed in minutes . wt . % wet - gris - poly - ting eoful - percent of saturation - time min . polymer wetting agent mer agent vin 1 2 3 4 5 10 15 20 25__________________________________________________________________________none - griseoful - none none none 100 % 14 . 8 22 . 3 30 . 3 36 . 8 42 . 6 64 . 5 76 . 1 83 . 1 86 . 5vin microsizedpolyvinyl - sodium lauryl 49 . 9 0 . 2 49 . 9 92 . 9 99 . 2 100 . 6 101 . 3 101 . 9pyrrolidone sulfatepolyvinyl - sodium lauryl 29 . 9 0 . 2 69 . 9 91 . 6 97 . 0 98 . 8 99 . 4 99 . 6 100 . 0pyrrolidone sulfatepolyvinyl - sodium lauryl 9 . 9 0 . 2 89 . 9 60 . 7 70 . 0 89 . 0 83 . 9 85 . 8 91 . 6 93 . 5 94 . 8 95 . 6pyrrolidone sulfatepolyvinyl - benzalkonium 29 . 8 0 . 5 69 . 7 75 . 7 87 . 2 92 . 6 95 . 3 97 . 0 99 . 3 100pyrrolidone chloridepolyvinyl - dioctyl sodium 29 . 8 0 . 5 69 . 7 86 . 5 92 . 9 95 . 5 96 . 8 97 . 4 98 . 3 99 . 8pyrrolidone sulfosaccinatepolyvinyl - sodium laurate 29 . 7 1 . 0 69 . 3 53 . 5 65 . 2 72 . 3 77 . 4 81 . 9 90 . 3 94 . 8pyrrolidonepolyvinyl - bis ( 2 - hydroxy - 29 . 7 1 . 0 69 . 3 74 . 2 83 . 9 88 . 6 91 . 6 93 . 2 97 . 4 100 . 00 100 . 6pyrrolidone ethyl ) oleyl aminehydroxypropyl sodium lauryl 24 . 9 0 . 2 74 . 9 85 . 4 93 . 2 96 . 7 98 . 3 99 . 3 101 . 9cellulose sulfatehydroxypropyl sodium lauryl 19 . 9 0 . 2 79 . 9 61 . 9 71 . 6 77 . 4 81 . 5 84 . 5 94 . 2 99 . 4 101 . 9 109 . 0cellulose sulfatehydroxypropyl sodium lauryl 32 . 8 1 . 5 65 . 8 36 . 8 49 . 0 57 . 4 69 . 8 67 . 7 88 . 4 101 . 3 108 . 4 112 . 9methyl cellulose sulfatepolyethylene sodium lauryl 49 . 6 0 . 7 99 . 6 71 . 2 83 . 2 89 . 6 92 . 9 94 . 5 98 . 3 99 . 4 99 . 6glycol sulfatepolyoxyethylene sodium lauryl 44 . 6 0 . 7 49 . 6 43 . 2 56 . 7 63 . 8 68 . 6 72 . 3 81 . 3 85 . 4 87 . 7 89 . 0polyoxypropylene sulfatecopolymer__________________________________________________________________________ * saturation 11 . 6 mg liter . the relative bioavailability of the composition of this invention with two different polymer mixtures and that of one marketed ultramicrosize griseofulvin dosage form was studied in humans . the urinary excretion of the major griseofulvin metabolite 6 - desmethyl griseofulvin ( 6 - dmg ) was determined for all three dosage forms following the administration of 250 mg of griseofulvin ( in the form of 125 mg tablets ) to 15 healthy adult volunteers divided into three groups using a crossover experimental design . the total tablet weight for each of the 125 mg dosages was 350 mg . the compositions of the invention were represented by spray dried griseofulvin mixtures with either polyvinylpyrrolidone or hydroxypropyl cellulose both treated with sls . the marketed product evaluated was schering &# 39 ; s fulvicin ยฎ p / g which is perceived as providing maximum bioavailability or absorption following oral administration . the results indicated that there were no statistically significant differences between the 3 dosage forms evaluated . the cumulative mean for all groups expressed in mg of either free or total 6 - dmg found in the urine for each of the three dosages was as follows : ______________________________________ gris - hydroxypropyl marketed gris - pvp cellulose product free total free total free total______________________________________0 - 24 hours 48 : 6 75 . 8 50 . 3 81 . 1 48 . 9 76 . 724 - 48 hours 19 . 1 30 . 0 20 . 7 33 . 3 19 . 5 37 . 10 - 48 hours 68 . 7 105 . 8 71 . 0 114 . 4 68 . 4 113 . 8______________________________________ in a second bioavailability study conducted with 4 healthy adult volunteers , dosage forms containing 500 mg of micronized griseofulvin were administered in the form of a single tablet or 2 capsules each containing 250 mg of micronized griseofulvin . since griseofulvin is not a dose dependent drug , twice the amount of the 6 - dmg metabolite should be excreted over that of a 250 mg dosage of griseofulvin . ______________________________________ 500mg griseofulvin 500mg griseofulvin tablet as 2 ร 250mg capsules free total free total______________________________________0 - 24 hours 34 . 4 35 . 5 38 . 0 54 . 724 - 48 hours 63 . 5 104 . 2 64 . 4 102 . 80 - 48 hours 97 . 9 157 . 9 102 . 4 157 . 5______________________________________ typical direct compression tablet formulations may be prepared as follows for 125 mg dosage forms having a final tablet weight of 350 mg . ______________________________________a . 1 . griseofulvin at 59 . 5 % in mixture with hydroxypropyl cellulose , sls treated 210 . 0 g2 . microcrystalline cellulose 87 . 0 g3 . lactose , edible 32 . 0 g4 . sodium starch glycolate 17 . 5 g5 . magnesium stearate u . s . p . 3 . 5 g theoretical tablet weight 350 mg . b . 1 . griseofulvin at 67 . 5 % in pvp mixture treated with sls 185 . 0 g2 . microcrystalline cellulose 87 . 0 g3 . lactose , edible 67 . 0 g4 . sodium starch glycolate 17 . 5 g5 . magnesium stearate 3 . 5 g theoretical tablet weight 350 g______________________________________ in both a and b , ingredients 1 - 4 were blended together until uniform , passed through a screen , blended with ingredient 5 and compressed at the correct tablet weight . the dissolution profile for the compressed tablets demonstrated further that there was no significant difference in dissolution for the formulated tablet as compared with the unformulated powdered material .
| 0 |
with reference to fig1 , a monitoring device 10 , according to a preferred embodiment of the invention , is placed in position to commence analysis over the wound 11 . the device has to be placed close enough to the target wound to ensure clear high resolution imagery is available and also to maximize the effectiveness of other wound analysis components in the device . in this example the wound 11 is on a patient &# 39 ; s right forearm . fig2 shows a viewfinder / display screen 20 at the rear of the monitoring device 10 , with the device positioned to give the operator a clear image of the wound 11 . the viewfinder / display screen 20 is used to verify that the wound 11 is in the frame of the view finder / display screen 20 and can be easily captured and analyzed by the device 10 . a sensor 30 located in the device 10 as shown in fig3 , is designed to measure the distance 31 from the wound 11 thereby establishing a base line distance parameter upon which other variables can be calculated such as changes in surface contours and topography . this sensor 30 is also used to provide three dimensional imaging of the wound 11 detecting swelling and providing an assessment of the wound &# 39 ; s 11 relative size . fig4 shows a reference grid 40 being visually projected by a laser source projector 41 onto the arm 42 . this reference grid 40 can be visually seen and measured by the device 10 . the grid can be used to determine if the laser source projector 41 , and hence the device 10 , is at a different angle or distance from the subject wound 11 to that of the previous , base line analysis session . the reference grid system provides for repeatability of sensing and image recording between the first base line recording session and subsequent recording sessions . the size of this reference grid 40 combined with the measurement of distance 31 between the device 10 and wound 11 as described above and shown in fig3 , allows for an accurate calculation of variables such as distance and angle of the device 10 relative to the wound 11 , and eliminates erroneous diagnosis due to a difference between measurements taken at various times during the treatment process . the laser source projector 41 could additionally be configured to act as a cauterizing laser source . by this means small pockets of infection on some wounds could be cauterized as part of a sensing and image recording session . fig5 shows a thermal imaging temperature sensor 50 of device 10 , measuring the ambient temperature 51 of the environment in which monitoring of the wound 11 takes place . this is used to establish a baseline for other measurements which rely on temperature readings related to the wound and surrounding body surface . at the same time an optical sensor 52 measures the light level and hue of the environment , allowing these variables to be taken into account when diagnosing skin discoloration in and around the wound 11 . device 10 may further incorporate a self - adjusting flash 60 as shown in fig6 , which utilizes the light level measurement taken as described above and shown in fig5 to ensure an optimal and consistent light balance for color evaluation across all data collected relative to a single wound . fig7 shows a first set of images 70 being displayed after capture . the device 10 displays the results on the view finder / display screen 20 and saves the image - set together with a patient identifier , time , date , distance and ambient temperature as measured . this grouped information is used collectively to compare with results from other sessions of grouped data taken at other times and used to analyse what is happening to the wound . fig8 shows how wound colours 80 are recorded in the set of images and displayed on the view finder / display screen 20 . one example of how wound colour is used in wound management is to determine the progress of a bruise where discolouration is clearly a sign of the progress or decay of the wound . fig9 illustrates a thermal image 90 of the wound being displayed on the screen 20 . wound temperatures are measured by the sensor 50 as described above and shown in fig5 . the measured temperatures are recorded in an image set . small variations in temperature in the wound 11 are recorded and help in the assessment of many wound conditions including , but not limited to , signs of tissue death , known in the art as necrosis , and infection . fig1 shows an example of how the set of images 100 can be compiled and presented on the view finder / display screen 20 as a semi transparent layer 100 on top of real - time imagery 101 of the wound 11 and can be analyzed by the device . fig1 shows the analysis and compiled images 110 being displayed on the view finder / display screen 20 as a semi transparent layer which then allows the operator to make clinical treatment decisions based on the comparison of the previous data and image set with the current condition of the wound 11 . as shown in fig1 , when subsequent images are taken at later dates for diagnosis of the healing progress , the device 10 can be used to monitor this progress . the device retrieves data from the previous patient assessment , displaying this on the semi transparent layer on view finder / display screen 20 . the same distance and aspect from the wound are achieved using the saved distance measurement and projected grid as described above and shown in fig1 to 4 . the user is guided by a semi - transparent version of the previous images 120 to adjust the position of the device over the wound 11 . when the grid 40 in the saved image 120 is aligned with the marker shown in current diagnosis 123 , the steps described above and shown in fig5 to 10 are repeated for a comparative diagnosis . fig1 shows that the device has analyzed changes in color , temperature and relative size of the wound 11 . analytical data is then displayed 130 , 131 on the screen 20 to assist the operator . in this example , analysis 132 has determined that the wound is smaller and that the surface temperature of the wound has reduced and deduced that the chance of infection is unlikely . all data is saved with patient identification for records , analysis and ongoing treatment . the system of the invention provides the ability to monitor and record wounds over time . it also enables systematic multi - sensing assessment of a wound , supporting the early detection of pathologies to improve patient outcomes . it is anticipated that the frequency of use will depend on the pathology of individual patients , with some wounds requiring monitoring every shift ( 8 hrs ) in a hospital setting . the following sets out a method of use in a typical wound monitoring process . the user &# 39 ; s id is input . the patient &# 39 ; s id and the location of the wound or wounds are input . each wound has a record specific to it . time and date are appended to the record automatically . the user positions the device over the wound to be measured , recorded and analysed . by using the screen as reference , the user ensures that the wound is in - frame . the device measures the distance from the wound and projects a grid onto the wound . the device focuses and records a visual image in 3d and a thermal image . the images are stored separately , and can be viewed individually or as composite . a combination of image collection setting and distance from the wound can be used to calculate the surface area of the wound . if thermal readings or colour analysis suggest the likelihood of infection , the device signifies the risk . the user &# 39 ; s id is input . the patients id and the location of the wound or wounds are selected from a list . time and date are appended to the record automatically . the user positions the device over the wound to be measured , recorded and analysed . previous image and live input from the screen , and ; previous measurement of distance of the device from specific locations on the patient &# 39 ; s body , using the projected grid and the patient as reference the user ensures that the device is positioned similarly to the initial image capture . this creates a series of images to enable slight corrections within the device cpu , such that an accurate comparison of wound size , colour and temperature is possible . changes in wound size , colour and / or temperature may signal the likelihood of pathologies or healing . initially , the device will alert the user to these changes . in time , clinical trials and ongoing analysis will inform a diagnostic capability in the device . changes will also be aligned to treatment records enabling improvements in wound care more broadly . high definition , high sensitivity thermal analysis will also enable the detection of early - stage infection and early treatment thereby ameliorating or preventing progress of the wound to a serious and / or chronic infection . with reference to fig1 there is illustrated in block diagram form the main components and their interconnection of a data acquisition device 150 suited to implement the system described above . in this instance the data acquisition device 150 includes a digital processor and display 151 in communication with a memory 154 which stores data corresponding to patient details , treatment history , comparative analysis , wound location and wound condition ( monitored progressively and repeatedly over time at predetermined time intervals ). a number of primary sensing components are also in communication with the processor and display 151 including a range finder 152 which acquires and transmits data corresponding to distance to a target location ( in this instance a wound ). again , distance data is sent at predetermined intervals on a repeated basis thereby to build a time referenced profile of conditions at the target site . a suitable range finder device particularly suited to wound data acquisition at close range ( that is under 1 m in range but at high resolution ) as contemplated in embodiments described above . also in communication with the processor and display 151 is laser pattern generator 153 which , in the preferred instances described above , projects a grid pattern onto the target site at the range determined by the rangefinder 152 . in a preferred form the grid is a rectilinear array of squares having sides having lengths in the range 0 to 5 mm depending on specific application thereby to provide a clear point of reference for an observer . the range finder 152 and laser pattern generator 153 collectively provide data feeds to processor and display 151 as what may be broadly described as targeting data including distance of the data acquisition device 150 from its target site and the relative location of the target site , in this instance a wound , in three - dimensional space . also in communication with the processor and display 151 is thermal imaging device 155 . this device fundamentally records heat signature at the target site at the designated range on a repeated basis at predetermined intervals . in a preferred form the thermal imaging device comprises a heat sensor with a macro lens which permits focus onto the target site and acquisition of thermal imaging data in the under 1 m range including more preferably the 0 to 20 cm range . also in communication with the processor and display 151 is 3 - d imaging device 156 which records colour data and size data at the target site with reference to the data provided by the targeting elements 152 , 153 . again these recordings are made at predetermined intervals on a repeated basis thereby to provide time sequence data and as a consequence change data ( first derivative ). the thermal imaging device 155 and 3 - d imaging device 156 comprise diagnostic elements which provide data relating to size , colour , heat signature and change in size , colour and heat signature which processor 151 references against the targeting element data from rangefinder 152 and laser pattern generator 153 thereby to build a time referenced profile of data concerning the target site , in this instance of the wound . with reference to fig1 there is illustrated a flow chart sequence 200 which can be programmed into the processor and display 151 of fig1 whereby initial data capture 203 includes patient identification , operator identification , wound location and time and date data for providing core reference date for a capture sequence . this data is input into processor 151 ( see fig1 ) either via a touch sensitive display or other keypad input . data is then progressively acquired from the devices described with reference to fig1 including targeting coordinates 204 and detailed diagnostic data 205 . this data acquisition enables a reference framework 201 to be built by processor 151 in the form of record identity 206 , image repeatability ( particularly with reference to the grid pattern provided by the laser ) 207 and diagnostic element data 208 . the sequence is repeated 202 as a series of subsequent data captures 202 at predetermined intervals on a repeated basis . in a preferred form the intervals are equal . in an alternative form the intervals may not be equal but extrapolation algorithms may then be used to normalise the data for example so as to map it to what would be expected for equal time interval data acquisition . thus , at predetermined intervals , the data captures repeat the patient id acquisition 209 , the targeting coordinates data 210 and the 3 - d image and related detailed data 211 thereby to present a relative wound condition summary 212 over time . in the first preferred embodiment described above all the components for analysis are in the one device . an alternative embodiment could have these components separated but connected to one central data processing unit . for example multiple analysis devices of the same type could be used at different times but the results could be coordinated to achieve the same synchronized diagnosis . in the first preferred embodiment described above all the measurements required for diagnosis are taken in one session . in alternative embodiments measurements could be taken continuously or at intervals of any length . in the first preferred embodiment described above images are taken at high definition quality commonly used in digital cameras . an alternative embodiment could use much higher resolution , allowing diagnosis even up to microscopic levels . in the first preferred embodiment described above the projected reference marker shown in fig4 is a grid . in an alternative embodiment a different size or shape projection than that used in the drawings could be used with the intent of being able to determine changes in size and angle . the first preferred embodiment described above uses changes in color , heat , size and contour of the wound to make an analysis . an alternative embodiment could use just three of these to perform an analysis . the first preferred embodiment described above is a single , purpose designed module that can be cleaned to minimize infection risk . an alternative embodiment could see the functionality separated out into separate modules . while this may be harder to sanitize it may also deliver advantages in terms of ease of replacement with component failure . the first preferred embodiment described above takes temperature measurements and three dimensional images simultaneously , allowing multiple evaluations to be conducted to enable an accurate clinical appraisal . an alternative embodiment could collect measurements from approximately the same time , using multiple devices and still deliver relatively usable analysis . the above describes only some embodiments of the present invention and modifications , obvious to those skilled in the art , can be made thereto without departing from the scope and spirit of the present invention .
| 0 |
fig1 depicts a suture anchor 10 according to the present invention . it comprises in gross an inner body 12 having a distal end 14 and proximal end 16 and a cannulated outer body 18 having a distal end 20 , proximal end 22 and a cannulation 24 therethrough . towards the outer body proximal end 22 the cannulation 24 bears internal threads 26 which decrease in internal diameter at the proximal end 22 . on its exterior surface 28 the outer body 18 bears barb shaped annular flanges 30 to assist in bone fixation . the inner body 12 has an annular flange 32 at its distal end 14 with a groove 34 therethrough passing over the distal end 14 . at its proximal end 16 the inner body 12 has exterior threads 36 which mate with the inner body threads 26 . a pair of radially extending projections 38 extend from the inner body 12 toward the outer body 18 at its distal end 20 . the tolerance between the projections 38 and the outer body 18 should be close enough to prevent suture 39 from passing therebetween . a tool receiving recess 40 on the inner body proximal end 16 mates with a driver head 42 ( such as for instance a hex driver ) on a distal end of a driver 44 . just proximal thereof on the driver 44 are threads 46 which mate with the threads 26 on the outer body 18 . the threads 46 have a reduced major diameter at a proximal portion 48 which in its starting configuration as shown in fig1 sits adjacent the decreased internal diameter of the outer body thread 26 at their proximal end 22 . the driver 44 operates within a tube 50 having a distal end 52 abutting the outer body proximal end 22 with distally projecting tangs 53 extending into slots 54 in the outer body proximal end . this interface assists in maintaining the position of the anchor 10 as it is employed , by resisting both rotation and proximal withdrawal thereof . turning also now to fig2 , two or more of the stress relief slots 54 extend axially into the outer body 18 from its proximal end 22 . this allows the proximal end to be made from somewhat brittle materials yet still be able to expand outwardly radially to provide fixation . both the inner body 12 and outer body 18 are preferably formed of a bioabsorbable material such as biocryl rapide available from depuy mitek , inc . of raynham , mass . biocryl rapide is a bioabsorbable polymer formed of homogenous blend of tricalcium phosphate ( tcp ) and polylactic / polyglycolic acid ( plga ). other suitable materials include without limitation peek , pla , titanium , stainless steel , metals , polymers and other biocompatible materials . turning also now to fig3 to 7 , use of the suture anchor 10 will be described . the anchor 10 is sterile and packaged in bacteria proof packaging ( not shown ) pre - loaded onto the driver 44 and pre - loaded with a suture capture device 56 comprising an elongated filament 58 having a suture capture loop 60 at one end . one example is the chia percpasser available from depuy mitek , inc . of raynham , mass . the loop 60 in fig3 is shown adjacent the anchor 10 for ease of display but in practice sufficient length of the filament 58 would extend from the anchor 10 to allow suture 39 to be pulled out of a cannula ( not shown ) through which the procedure is being endoscopically performed . the suture 39 would be loaded into the suture capture loop 60 exterior of the patient and the cannula . a tab 62 may be placed on an opposite end of the filament 58 . ( this is also shown adjacent the anchor 10 for ease of display but would more conveniently be positioned outside of the cannula .) when the tab is pulled the loop 60 with the suture 39 captured therein is drawn down between the inner body 12 and outer body 18 pulling the suture 39 with it . the path of the suture 39 after passing between the inner body 12 and outer body 18 goes through the groove 34 to assist in sliding . additional sutures can also be employed , such as additional suture loops in the suture capture loop 60 or addition suture loops each with their own suture capture device . the anchor 10 with the suture 39 therein is now inserted into a pre - drilled hole 64 in a bone 66 to which a piece of soft tissue 68 is to be attached as shown in fig4 . the anchor 10 is positioned in the hole 64 such that the suture passes into the anchor 10 at one of the stress relief slots 54 . the suture 39 is shown looped through the soft tissue 68 but other arrangements are possible such as extending from another anchor ( not shown and typically of a different configuration than anchor 10 ) which is positioned in the bone 66 below the soft tissue 68 and up through the soft tissue 68 to the anchor 10 , such as in a dual row rotator cuff repair . also , the path from the soft tissue 68 through the anchor 10 could be reversed . free ends 70 of the suture 39 are drawn through the anchor 10 to position the soft tissue 68 and properly tension the suture 39 ( see fig5 ). the tube 50 of the driver 44 holds the anchor 10 down and prevents rotation of the outer body 18 while the driver 44 is rotated to rotate the inner body 18 ( see fig6 ). as the threads 46 of the driver 44 pass through the reduced inner diameter proximal portion 22 of the outer body 18 it causes it to expand outwardly radially to engage the bone 66 and reduces the stress on the inner body 18 . preferably , the relaxed condition of the outer body 18 is slightly expanded radially and as it is inserted into the hole 64 it is compressed slightly inwardly ; the expansion by the threads 46 move it back to its relaxed configuration thus reducing internal stress . as the rotation continues the threads 36 of the inner body move into the reduced inner diameter proximal portion 22 to keep the outer body proximal end 22 radially expanded . the projections 38 on the inner body 12 cause the suture 39 to wrap around the inner body 12 . the suture 39 feeds in from the free ends 70 , not from the soft tissue 68 so that the position of the soft tissue 68 and the tension on the suture 39 between the anchor 10 and the soft tissue 68 remains substantially unchanged as the inner body 12 is rotated . after sufficient rotation the driver 44 is disengaged from the anchor 10 and removed leaving the suture 39 locked to the anchor 10 by virtue of its being wrapped around the inner body 12 and the outer body proximal end 22 is expanded outwardly into the bone 66 to lock the anchor 10 thereto ( see fig7 and 8 ). tests have shown three to five turns providing good locking of the suture 39 . fig9 and 10 illustrate a further preferred embodiment of the invention which is essentially similar to that depicted in fig1 and 2 . like parts are denoted with like numerals with the addition of a prime symbol (โฒ). it comprises a suture anchor 10 โฒ having an inner body 12 โฒ and cannulated outer body 18 โฒ having a short internal thread 24 โฒ. the inner body 12 โฒ has an annular flange 32 โฒ at its distal end 14 โฒ with a groove 34 โฒ. it also carries radially extending projections 38 โฒ. fig9 especially more clearly illustrates how a driver receiving tube 50 โฒ abuts a proximal end 22 โฒ of the outer body 18 โฒ with distally projecting tangs 53 โฒ extending into stress relief slots 54 โฒ. a loop of suture 39 โฒ has free ends which pass into the outer body 18 โฒ from its proximal end 22 โฒ, preferably through one of the stress relief slots 54 โฒ, passes down between the inner body 12 โฒ and outer body 18 โฒ and between the projections 38 โฒ, out of the outer body 18 โฒ through its distal end 20 โฒ, through the groove 34 โฒ on the inner body 12 โฒ at its distal end 14 โฒ and then back into the outer body 18 โฒ between it and the inner body 12 โฒ and also again between the projections 38 โณ and finally exit through the opposing stress relief slot 54 โฒ. this embodiment is used similarly to the previous one . however , the groove 34 โฒ assists in wrapping the suture 39 โฒ around the inner body 12 โฒ and one could even dispense with the projections 38 โฒ due to the wrapping action provided by the groove 34 โฒ. various modifications and alterations of this invention will be apparent to those skilled in the art without departing from the scope and spirit of this invention . it should be understood that the invention is not limited to the embodiments disclosed herein , and that the claims should be interpreted as broadly as the prior art allows .
| 0 |
the present invention relates to toy guns in general and more particularly to those that utilize a spring - driven plunger and compressed air to project paper , confetti , fiber , or fluid . for decades toy guns with different functions have been popular with both children and adults . air guns powered by a spring and compressed air are among the most common types of toy guns . among the projectiles available are balls , darts , missiles , disks , arrows , and water . many prior inventions involve toy guns driven by a spring and possibly compressed air as well . most projectiles in these cases consist of relatively rigid materials such as metal , glass , plastic , or foam , and all tend to remain an integrated unit after being launched and during flight . when fluid is projected , it is in the form of relatively continuous flows . each of the following toy guns is in the form of a โ gun .โ u . s . pat . no . 183 , 124 ( butterweck ) discloses a toy gun which ejects a spherical projectile from the barrel utilizing a contracted spring as the sole source of power . its trigger is designed to catch on a piston in the barrel . u . s . pat . no . 1 , 339 , 949 ( egts ) discloses a double - barreled toy gun which launches a small spherical projectile from the first barrel , using an extended spring in the second barrel as the power source . u . s . pat . no . 1 , 488 , 995 ( mccollom ) also discloses a double - barreled toy gun , which compresses air by the movement of a spring and a plunger in the two barrels , discharging a missile - shaped projectile . its trigger catches on the middle portion of a spring to hold the gun in a state ready for firing . u . s . pat . no . 1 , 575 , 644 ( schmidt ) discloses a toy gun with a trigger as its source of power , utilizing both a spring and compressed air as agents . when the trigger is pressed , the power is transferred through a series of mechanisms to contract a spring within the barrel . when the trigger is released , the potential energy of the spring ejects the projectile . u . s . pat . no . 2 , 321 , 077 ( gora et al ) discloses a toy gun within whose barrel is a spring that is compressed by the tail of a dart . the contracted spring is held by a trigger , the release of which ejects the projectile . u . s . pat . no . 2 , 630 , 108 ( white ) discloses a toy gun that projects ping - pong balls utilizing the potential energy of a contracted spring and compressed air as an agent . u . s . pat . no . 2 , 652 , 822 ( griffith ) discloses a toy gun , with a rod and a spring , which projects a ping - pong ball like projectile by utilizing the energy produced by dragging the rod and compressing the spring . u . s . pat . no . 2 , 725 , 869 ( barber ) discloses a long gun , which uses a plunger to generate compressed air and to eject a ball - shaped projectile . the following projectors are in the form of a long cylinder and use a spring or compressed air to generate power for the projection . u . s . pat . no . 1 , 556 , 846 ( kovacs ) discloses a launching tube containing a rod that is drawn to contract a spring . u . s . pat . no . 2 , 600 , 883 ( king ) discloses an apparatus in which a rod is drawn to contract a spring , which once released , is able to fire balls . u . s . pat . no . 4 , 335 , 701 ( bozich ) discloses a projector that ejects a baseball , utilizing a spring as the power source and a long rod as an agent for transmitting the power . u . s . pat . no . 5 , 058 , 561 ( starr ) discloses a launching tube , which manually ejects cylindrical projectiles such as empty beverage cans using compressed air as an agent . the following two patents emphasize the visual effects of projectiles in dark surroundings . u . s . pat . no . 5 , 415 , 151 ( fusi ) involves a bullet - shaped phosphor - containing projectile that creates clear visual effects in darkness . the invention discloses a round capsule containing a phosphor - containing fluid . however , the purpose of the art is to keep the projectile visible in flight and to leave a luminous mark on targets the projectile strikes . as such , the projectile remains integrated in flight until it reaches the target . u . s . pat . no . 6 , 048 , 280 ( palmer / palmer ) discloses a toy gun that projects a dart using as an agent compressed air generated by a drawn rod and a released spring . the gun contains a flash lamp to create the fluorescent effects of the propelled projectile . the above - mentioned launching devices have at least one of the following features , which differentiate them from the present invention : 1 ) the appearance of a โ gun ,โ 2 ) horizontal โ shooting โ as the primary function , 3 ) rigid projectiles such as balls , darts , beverage cans , and special bullets that stay integrated during flight , 4 ) a target for shooting . projectiles in all above - mentioned devices remain integrated after being ejected . having one or more of these characteristics renders past inventions unsuitable for usage at large social gatherings . the present invention is entirely dissimilar from above - mentioned apparatuses . the device is to be used for leisure . the primary function of the present invention is to project and disseminate soft and non - integrated materials contained in a cartridge , generally vertically and without aiming at a target . additionally , the outside surface of the present invention can be covered with fluorescent materials for decorative purposes . a flag may also be attached to the upper section of the launching tube . these and other features could be appropriate at sporting or music events , wedding ceremonies , holiday celebrations , parties , or other large social gatherings . in consideration of disadvantages of known types of toy gun devices , whose primary purposes are to horizontally project various hard projectiles that remain integrated after being ejected , the present invention is a new type of projecting device , which may be held in the hand and may project , usually vertically , soft projectiles such as paper disks , confetti , or fluid . the general purpose of the present invention is to provide a new , simply constructed device that โ projects โ for visual pleasure but does not โ shoot .โ none of these advantages and new features have been shown or suggested in the prior art projecting devices . for this purpose , the present invention consists of two sections of a launching tube , a plunger , a spring , a trigger , and a cartridge , which will be described with all details later . a primary object of the present invention is to provide a projecting device capable of launching , usually vertically , soft projectiles such as paper disks , confetti , or fluid for visual pleasure . another object is to provide a cartridge with a variety of possible contents , including but not limited to paper disks , confetti , and fluid , which may be treated with fluorescent materials in order to create pleasant visual effects in the dark . letters or words could also be printed on paper disks . the disks could also display messages such as fortunes . alternatively , they could show numbers and be used for drawing lots . to create a cheerful atmosphere , the substances being projected may also be scented . a further object is to provide a projecting device not in the form of a โ gun โ but that of a long stick , the cross section of which may be circular , triangular , rectangular , or any other shape . the advantage of a stick - like structure is that additional adaptations are possible . for instance , the device may be used as a flagpole . another object is to provide a simply - constructed and inexpensive projecting device . the simplicity of the structure makes this device affordable and easy to use . still another object is to provide a light - weight , simply - operated , and easy - to - carry projecting device able to be held in one hand . a further object is to provide a projecting device for repeated use . an additional object is to provide a projecting device at a much larger scale , with the same structure as formerly described , in order to meet various demands on different occasions . another object is to provide a horizontal complex of projecting devices , with combined or separate triggers in order to eject projectiles from more than one device simultaneously . [ 0025 ] fig3 is a sectional view of the present invention where the upper section of the launching tube is folded to the side and the cartridge is being loaded . [ 0026 ] fig4 is a perspective view of the present invention after the projection . [ 0027 ] fig5 is an enlarged perspective view of the trigger shown in fig4 . [ 0028 ] fig6 is a perspective view of the plunger shown in fig2 - 3 . [ 0029 ] fig7 is an exploded view of the cartridge and its contents after they are expelled from the launching tube . fig1 - 4 show the present invention 10 completely . as shown in fig2 the present projecting device 10 consists of a lower section 11 of the launching tube , an upper section 12 of the launching tube , a plunger 13 , a spring 14 , a cartridge 15 , a pulling string 16 , a trigger 17 , a v - shaped pivot component 18 , and a hook 19 . as shown in fig1 - 4 , the lower section 11 and the upper section 12 of the launching tube have the same diameter . the two sections are connected with a v - shaped pivot component and a hook . as shown in fig1 , and 4 , the lower section 11 and the upper section 12 are in rectilinear state immediately before , during and after the launching of the projectile . as shown in fig3 before the user inserts the cartridge 15 and pulls back on the string 16 , the upper section 12 folds to the side , forming with the lower section 11 a โ 7 โ shape . then , the user loads a cartridge 15 into the upper section 12 . as shown in fig2 - 3 , within the lower section 11 are the plunger 13 , the spring 15 , and the string 16 . a long screw 22 is installed near the end of the lower section 11 . the trigger 17 is installed on the outside surface of the lower section 11 . as shown in fig2 the top of the lower section 11 has a inner collar flange 31 designed to keep the plunger 13 within the lower section 11 as the plunger 13 moves upward , driven by the released spring 14 . thus , the diameter of the plunger 13 should be slightly smaller than the lower section of the launching tube 11 so that the plunger 13 can smoothly slide and reciprocate within the tube . as shown in fig6 the plunger 13 has a main body 32 which may move smoothly within the lower section 11 . the plunger 13 also has a top portion 33 , the diameter of which is smaller than that of the main body 32 . when the plunger 13 is released , the top portion 33 directly hits the bottom of the cartridge 15 . the lower portion 34 of the plunger 13 also has a diameter much smaller than that of the main body 32 so that the lower portion 34 can be inserted into the spring 14 . the string 16 goes through a loop 30 found on the bottom of the lower portion 34 . as shown in fig2 , and 6 , the upper end of the spring 14 surrounds the lower portion 34 of the plunger 13 . a screw 22 keeps the rear end of the spring 14 from being pressured out of the lower section 11 of the tube when the string 16 is pulled . as shown in fig1 - 4 , the string 16 , connected to the plunger 13 by the loop 30 , is used to pull the plunger 13 downwards . fig3 shows the user pulling on the string 16 . near its lower end the string 16 is knotted 21 in order to prevent the lower end of the string 16 from receding into the tube . when the spring 14 releases and the string 16 is moving upwards , the screw 22 stops the string 16 at the knot 21 , and the rear end of the string 16 remains outside of the launching tube . as shown in fig1 - 4 and in particular detail in fig5 a trigger 17 is installed on the outside surface of the lower section 11 of the launching tube , on the same side as the hook 19 . the upper end of the trigger 17 digs into a gap 23 in the surface of the launching tube . when the string 16 is pulled backwards , the front of the trigger 17 , affected by a leaf spring 26 , enters into the launching tube and blocks the upward motion of the spring 14 by stopping the upper end of the plunger 13 and allowing the projecting device 10 to enter a ready - to - launch state . the trigger 17 is connected and fixed to a support base 24 by a long screw 25 . the leaf spring 26 is installed between the trigger 17 and the support base 24 in order for the front of the trigger 17 to automatically be pushed into the launching tube and block the upper end of the plunger 13 while it is pulled downwards . as shown in fig1 - 4 , the v - shaped pivot component 18 includes a triangular flange 27 at the top of the lower section 11 and a triangular flange 28 on the bottom of the upper section 12 . as shown in fig2 the front of the hawk - beak hook 19 locks the flange 29 at the top of the lower section 11 , which is in rectilinear state with the upper section 12 . as shown in fig3 the user must forcibly fold the upper section 12 to the side , disconnecting the hawk - beak hook 19 from the flange 29 , in order to load the cartridge 15 into the open end of the upper section 12 . at this time , the lower section 11 and the upper section 12 of the launching tube are connected by the pivot 18 . as shown in fig2 , and 7 , the user must insert the cartridge 15 into the open end of the upper section 12 of the launching tube before the projection . as shown in fig7 the cartridge 15 consists of a container 50 holding paper disks 51 , an adhesive piece of paper 52 for sealing the front end of the cartridge 15 , and a piece of cardboard 53 for blocking the rear end of the cartridge 15 . the container 50 has a rear end with an extended ridge outside 54 and inside 56 . the dashed line 55 shows the conjunction at which the wall of the container 50 connects to the ring that gives it an outer 54 and inner ridge 56 . lucky phrases and numbers for drawing lots may be printed on the paper disks 51 , or fluorescent materials may be added to create pleasing visual effects in the dark . the adhesive piece of paper 52 is sticky on the edges in order to keep all contents within the container 50 . the solidity of the adhesive paper 52 should be such that the contents may leave the container 50 freely once compressed air hits the bottom of the cartridge 15 . if the contents of the cartridge 15 are paper disks 51 or confetti , a piece of cardboard 53 is used on the bottom of the cartridge 15 . if the content is a fluid , waterproof plastic adhesive tape should be used on the bottom of the cartridge 15 in order to keep the fluid within the container 50 without leaking . the solidity of the waterproof plastic should be such that allows the expulsion of the fluid when compressed air hits the bottom of the cartridge 15 . as shown in fig2 the lower section 11 and the upper section 12 of the launching tube , the plunger 13 , and the trigger 17 may use pvc as the raw material for injection processing . the plunger 13 is a hollow cylinder . the leaf spring 26 is u - shaped , with resilience to become straight . as shown in fig3 the user folds the upper section 12 of the launching tube to the side , disconnecting the hawk - beak hook 19 from flange 29 , allowing the upper section 11 and the lower section 12 of the launching tube to change from a rectilinear state to a โ 7 โ shape , connected by the v - shaped pivot 18 . the user then inserts the cartridge 15 into the upper section 12 in direction a until the outside ridge 54 of the cartridge 15 is closely pressed to the bottom of the upper section 12 of the launching tube . then , as in fig3 the user pulls the string 16 in direction b to contract the spring 14 into a ready - to - launch state , where the front end of the trigger 17 , affected by the resilience of the leaf spring 26 , digs into a gap 23 in the launching tube , blocking the plunger 13 . the user then restores the upper section 12 to a rectilinear state with the lower section 11 , allowing the entire projecting device 10 to enter a state fully ready for projection . as shown in fig1 when the user presses the trigger 17 in direction a , the plunger 12 , pushed by the spring 14 , moves upwards inside the launching tube in direction b . compressed air in the launching tube propels the paper disks 51 or other contents into flight from the launching tube . although the above description of the present invention includes illustrations and detailed explanations , it does not limit the present invention within the illustrations and descriptions . some changes and modifications may take place within the scope of the present invention without modifying its basic principles .
| 0 |
hereinafter , a power supply system for an electric vehicle according to an embodiment of the present invention will be described with reference to fig1 and 2 . fig1 is a diagram illustrating the configuration of a power supply system for an electric vehicle according to embodiment 1 of the present invention . fig2 is a block diagram illustrating the configuration of the power supply system for an electric vehicle . in fig2 , a solid arrow represents the flow of signals and a dotted arrow represents the flow of power . as shown in fig1 , the power supply system for an electric vehicle according to an embodiment of the present invention includes power supply apparatus 2 installed in a road and electric vehicle 3 supplied with power from power supply apparatus 2 . more specifically , electric vehicle 3 is charged with power supplied from power supply apparatus 2 through the use of power receiving apparatus 4 . electric vehicle 3 in embodiment 1 of the present invention is a vehicle obtaining a thrust by electricity and includes an electric motor that generates , with power , a driving force transmitted to wheels . the electric motor is driven with power of power storage section 42 ( see fig2 ). the power stored in the power storage section 42 is supplied from the outside of electric vehicle 3 . examples of electric vehicle 3 in the present invention include an ev ( electric vehicle ) that is driven using only an electric motor and a plug - in hybrid vehicle that is driven using an engine and an electric motor and that enables power storage section 42 to be supplied with power from a power supply outside electric vehicle 3 . detailed configurations of power supply apparatus 2 and power receiving apparatus 4 will be described below . power supply apparatus 2 includes power supply section 21 that supplies power to power receiving section 41 of electric vehicle 3 in a non - contact manner , vehicle detecting section 22 that detects the entrance of electric vehicle 3 to a predetermined range on a road , power supply - side communication section 23 that communicates with electric vehicle 3 , and power supply - side control section 24 that controls sections of power supply apparatus 2 . electric vehicle 3 can be charged in a non - contact manner by stopping in a predetermined range ( hereinafter , referred to as โ chargeable area b โ) on road surface a in fig1 . fig1 shows an example where electric vehicle 3 a is going to enter chargeable area b and electric vehicle 3 b stops in the vicinity of electric vehicle 3 a . when electric vehicle 3 a enters chargeable area b , power supply apparatus 2 sets up a communication with electric vehicle 3 a and supplies power to electric vehicle 3 a . at this time , it is necessary for power supply apparatus 2 to control a communication not to be set up with electric vehicle 3 b stopping in the vicinity thereof . the sections of power supply apparatus 2 will be described in detail below . power supply section 21 generates power and supplies the generated power to electric vehicle 3 in a non - contact manner . it is preferable that power supply section 21 be installed in the vicinity of the road surface of a road . power supply section 21 includes a power supply coil and a coil driving circuit that drives the power supply coil . the coil driving circuit drives the power supply coil by applying a pulse of a predetermined frequency to the power supply coil . the predetermined frequency ( chopper frequency ) of the pulse is controlled by power supply - side control section 24 . a magnetic field proportional to the current is generated in the power supply coil using the pulse as excitation current . an electromotive force is generated in the power receiving coil of power receiving section 41 by the magnetic field , and power is supplied from power supply section 21 to power receiving section 41 . here , it is assumed that the magnitude of power supplied from power supply section 21 when electric vehicle 3 enters chargeable area b is defined as first power value pa and the magnitude of power supplied from power supply section 21 after a communication between power supply apparatus 2 and electric vehicle 3 is set up is defined as second power value pb . first power value pa is such power as to have no influence on a human body . here , the โ such power as to have no influence on a human body โ means such a small magnitude of power to have no influence on animals or the like present around power supply section 21 . second power value pb means a magnitude which is larger than first power value pa and which enables power receiving section 41 to charge power storage section 42 . for example , first power value pa is about several w to several tens w , and second power value pb is about several kw to several tens kw . vehicle detecting section 22 is a sensor used to determine whether electric vehicle 3 enters chargeable area b . vehicle detecting section 22 transmits the determination result on whether electric vehicle 3 enters chargeable area b to power supply - side control section 24 . vehicle detecting section 22 includes , for example , an infrared sensor that detects whether an object is present within a predetermined distance . a plurality of the infrared sensors are disposed at facing positions on the boundary of chargeable area b . vehicle detecting section 22 determines that electric vehicle 3 enters chargeable area b , when all the infrared sensors detect an object . in another example of vehicle detecting section 22 , an imaging camera imaging a vehicle may be installed around the road and may detect that electric vehicle 3 enters or leaves chargeable area b by the use of an image captured with the imaging camera . power supply - side communication section 23 wirelessly communicates with vehicle - side communication section 43 of electric vehicle 3 to be described later . power supply - side communication section 23 is controlled by power supply - side control section 24 . power supply - side communication section 23 includes an antenna receiving rf waves and a modulation and demodulation section modulating or demodulating a received signal . power supply - side communication section 23 is always supplied with power . it is preferable that power supply - side communication section 23 be installed around a surface of a road . in the present invention , the communication method is not particularly limited , but a communication method of performing a short - distance communication of which the communication distance is several meters can be preferably used . this is because power supply - side communication section 23 needs only to be able to communicate with vehicle - side communication section 43 of electric vehicle 3 ( electric vehicle 3 entering chargeable area b ) to be supplied with power from power supply section 21 , and needs to prevent a communication with electric vehicle 3 b stopping in the vicinity of electric vehicle 3 a to be supplied with power , for example , as shown in fig1 . examples of the communication method applicable to the present invention include zigbee ( registered trademark ), wireless lan , and communications using specified low power bands . power supply - side control section 24 controls power supply section 21 on the basis of the detection result from vehicle detecting section 22 and information received by power supply - side communication section 23 . specifically , when vehicle detecting section 22 detects that electric vehicle 3 enters chargeable area b , power supply - side control section 24 sets the magnitude of power to be supplied from power supply section 21 to first power value pa . power supply - side control section 24 then causes power supply - side communication section 23 to transmit and receive data in order to set up a communication between power supply - side communication section 23 and vehicle - side communication section 43 . when the communication is set up , power supply - side control section 24 sets the magnitude of power to be supplied from power supply section 21 to second power value pb . details of the control performed by power supply - side control section 24 will be described later . power receiving apparatus 4 includes power receiving section 41 that receives power supplied from power supply section 21 of power supply apparatus 2 , power storage section 42 that stores power received by power receiving section 41 , vehicle - side communication section 43 that communicates with power supply - side communication section 23 , and vehicle - side control section 44 that controls power receiving section 41 and vehicle - side communication section 43 . the sections of power receiving apparatus 4 will be described in detail below . power receiving section 41 is installed on the bottom surface of the vehicle body of electric vehicle 3 and includes a power receiving coil and a rectifier circuit . it is preferable that power receiving section 41 is installed on the bottom surface of electric vehicle 3 facing the road . the surface of the power receiving coil is covered with a synthetic resin or the like . the power receiving coil is a coil formed , for example , in a coplanar shape and can receive power from power supply section 21 through electromagnetic induction . the power received through electromagnetic induction is input to the rectifier circuit , is converted into dc current therein , and is output to power storage section 42 . power storage section 42 stores power received by power receiving section 41 . a secondary battery ( such as a nickel - hydrogen secondary battery or a lithium ion secondary battery ) having a high energy density or a capacitor having large capacity is used as power storage section 42 . the power stored in power storage section 42 serves as a power source for driving the wheels of electric vehicle 3 and is used to operate an electric motor . the power stored in power storage section 42 is used as power for operating accessories such as a car navigation apparatus and a car audio apparatus , electrical components such as power windows , an etc ( registered trademark ), and an ecu ( electronic control unit ), and the like , in addition to the electric motor . vehicle - side communication section 43 wirelessly communicates with power supply - side communication section 23 of power supply apparatus 2 . vehicle - side communication section 43 is controlled by vehicle - side control section 44 . vehicle - side communication section 43 includes an antenna for receiving rf waves and a modulation and demodulation section for modulating or demodulating a received signal . it is preferable that vehicle - side communication section 43 be installed on the bottom surface of electric vehicle 3 facing the road . accordingly , the antenna is preferably a planar antenna not protruding from the bottom surface of electric vehicle 3 . in the present invention , the communication method is not particularly limited , but a communication method of performing a short - distance communication of which the communication distance is about several meters can be preferably used . vehicle - side communication section 43 is started up on the basis of power received by power receiving section 41 . specifically , vehicle - side communication section 43 is started when power of first power value pa or more is supplied from power supply section 21 to power receiving section 41 , and operates with the power output from power receiving section 41 . after being started up , vehicle - side communication section 43 performs a process of setting up a communication with power supply - side communication section 23 . vehicle - side communication section 43 operates with power received by power receiving section 41 until the communication is set up , and operates with power of power storage section 42 after the communication is set up . vehicle - side communication section 43 is in a communication standby state after the communication is set up . since vehicle - side communication section 43 operates with power received by power receiving section 41 until the communication is set up , it is possible to start the communication without using the power of power storage section 42 . vehicle - side control section 44 controls vehicle - side communication section 43 and power receiving section 41 of power receiving apparatus 4 . specifically , vehicle - side control section 44 controls power receiving section 41 to prepare reception of power and causes vehicle - side communication section 43 to transmit and receive data so as to set up a communication between power supply - side communication section 23 and vehicle - side communication section 43 . details of the control performed by vehicle - side control section 44 will be described later . vehicle - side control section 44 and power supply - side control section 24 include a cpu , a rom , and a ram . the cpu performs various operations , outputting of control signals , and the like by executing a program stored in the rom . the cpu uses the ram as a work area during execution of the program . the processing operations of the power supply system for an electric vehicle having the above - mentioned configuration will be described below with reference to fig3 to fig5 . fig3 is a diagram illustrating the operation of the power supply apparatus . fig4 is a diagram illustrating the operation of the power receiving apparatus . fig5 is a diagram illustrating a communication setup process . first , the operation of the power supply apparatus will be described with reference to fig3 . in โ start โ of fig3 , power supply section 21 does not supply power . power supply - side control section 24 first determines whether electric vehicle 3 enters chargeable area b on the basis of the detection result from vehicle detecting section 22 ( s 10 ). when electric vehicle 3 does not enter chargeable area b ( no in s 10 ), power supply - side control section 24 performs the process of s 10 again . when electric vehicle 3 enters chargeable area b ( yes in s 10 ), power supply - side control section 24 controls power supply section 21 so that power supply section 21 supplies power of first power value pa ( s 11 ). power supply - side communication section 23 performs a process of setting up a communication with vehicle - side communication section 43 of electric vehicle 3 entering chargeable area b ( s 12 ). details of this process will be described later . after the communication is set up in s 12 , power supply - side control section 24 controls power supply section 21 so that power supply section 21 supplies power of second power value pb ( s 13 ). when power supply section 21 supplies power of second power value pb in s 13 , electric vehicle 3 starts receiving power . after the supply of power is started in s 13 , power supply - side control section 24 determines whether electric vehicle 3 leaves chargeable area b ( s 14 ). when the electric vehicle leaves chargeable area b ( yes in s 14 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). this process is performed regardless of whether the charging of electric vehicle 3 is ended . this is because when electric vehicle 3 is being charged but electric vehicle 3 moves for a certain reason , power supply section 21 supplying power of second power value pb is exposed , which is dangerous . when electric vehicle 3 does not leave chargeable area b ( no in s 14 ), power supply - side control section 24 determines whether power supply - side communication section 23 receives a power supply stop signal from vehicle - side communication section 43 ( s 15 ). when the power supply stop signal is received ( yes in s 15 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). on the other hand , when the power supply stop signal is not received ( no in s 15 ), power supply - side control section 24 performs the process of s 14 again . when the process of s 16 is ended , the same state as โ start โ of fig3 is obtained . the operation of power receiving apparatus 4 will be described below with reference to fig4 . first , vehicle - side control section 44 prepares power receiving section 41 to receive power of first power value pa ( s 20 ). this preparation is a process for enabling power receiving section 41 to receive power . this preparation is started , for example , when the speed of a vehicle becomes lower than or equal to a predetermined speed . this is because the charging operation when a vehicle travels at a high speed cannot be normally considered . when the process of s 20 is ended , vehicle - side control section 44 determines whether vehicle - side communication section 43 is started up ( s 21 ). vehicle - side communication section 43 is started up when power receiving section 41 receives power of first power value pa . when vehicle - side communication section 43 is not started up ( no in s 21 ), vehicle - side control section 44 repeatedly performs the process of s 21 . after power receiving section 41 receives power of first power value pa to start up vehicle - side communication section 43 ( yes in s 21 ), vehicle - side communication section 43 performs a process of setting up a communication with power supply - side communication section 23 of power supply apparatus 2 ( s 22 ). details of this process will be described later . when power receiving section 41 receives power of first power value pa in s 21 and s 22 , vehicle - side communication section 43 operates with power output from power receiving section 41 . after the communication is set up in s 22 , vehicle - side control section 44 prepares power receiving section 41 to receive power of second power value pb ( s 23 ). this preparation includes , for example , a process of turning on a relay ( not shown ) connecting power receiving section 41 and power storage section 42 . after the communication is set up in s 22 , vehicle - side control section 44 switches the power source for vehicle - side communication section 43 so that vehicle - side communication section 43 operates with power supplied from power storage section 42 as a power source . this is because after the communication is set up once , it is preferable that the power source be switched to power storage section 42 which can stably supply power , to stabilize the communication . when the process of s 23 is ended , power receiving section 41 starts receiving power from power supply section 21 . vehicle - side control section 44 determines whether power storage section 42 is fully charged during the reception of power ( s 24 ). when it is determined that power storage section 42 is not fully charged ( no in s 24 ), vehicle - side control section 44 performs the process of s 24 again after a predetermined time passes , in order for power receiving section 41 to consecutively receive power . when it is determined that power storage section 42 is fully charged ( yes in s 24 ), vehicle - side control section 44 causes vehicle - side communication section 43 to transmit a power supply stop signal ( s 25 ). the power supply stop signal is a signal used for causing power supply section 2 to stop the supply of power of second power value pb from power supply section 21 . when the charging is continuously performed even after power storage section 42 is fully charged , overcharging occurs to cause overheating of power storage section 42 and degradation in lifetime . therefore , the supply of power is stopped by the use of the power supply stop signal . after transmitting the power supply stop signal , vehicle - side control section 44 performs a power reception ending process . here , the power reception ending process includes , for example , a process of turning off a relay ( not shown ) connecting power receiving section 41 and power storage section 42 . the communication setup process will be described below with reference to fig5 . the left flowchart in fig5 represents the power supply - side process ( s 12 ) and the right flowchart represents the vehicle - side process ( s 22 ). after vehicle - side communication section 43 is started up in s 21 , vehicle - side control section 44 generates a random number ( s 221 ). then , vehicle - side control section 44 generates predetermined time ttest and predetermined power value ptest on the basis of the random number ( s 222 ). predetermined time ttest and predetermined power value ptest are values to be set for power supply apparatus 2 . vehicle - side control section 44 determines that the communication with power supply apparatus 2 is set up when power supply section 21 provides power of predetermined power value ptest after predetermined time ttest passes . here , predetermined time ttest is a time of about several seconds . when this time is excessively long , it takes a lot of time to start the supply of power . on the other hand , when this time is excessively short , power supply apparatus 2 cannot respond . predetermined power value ptest is a value greater than first power value pa and smaller than second power value pb and is about several w to several tens kw . when power value ptest is excessively great , the periphery of power supply section 21 is affected . when the power value is excessively small , vehicle - side communication section 43 cannot be started up . for example , when it is assumed that vehicle - side control section 44 generates a random number of 8 bits ( 0 to 255 ) in s 221 , vehicle - side control section 44 can divide the above - mentioned preferable ranges of predetermined time ttest and predetermined power value ptest into 256 equal parts and select a numerical value corresponding to the generated random number . it is assumed that multiple power supply apparatuses 2 are installed in parallel and electric vehicles 3 stops on respective power supply apparatuses 2 and are charged . then , when predetermined time ttest and predetermined power value ptest of neighboring vehicles are set to the same value , the correspondence between power supply apparatuses 2 and electric vehicles 3 may be erroneously determined . by using the random number , it is possible to actively avoid the state where predetermined time ttest and predetermined power value ptest of neighboring vehicles have the same values . vehicle - side control section 44 then generates a request signal including predetermined time ttest and predetermined power value ptest and causes vehicle - side communication section 43 to transmit the request signal ( s 223 ). the request signal transmitted from vehicle - side communication section 43 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether power supply - side communication section 23 receives the request signal within predetermined time tlimit after power supply section 21 starts the supply of power of first power value pa in s 11 ( s 121 ). predetermined time tlimit is , for example , about several seconds . when the request signal is not received within predetermined time tlimit ( no in s 121 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). when it is considered that a vehicle passes through chargeable area b after the supply of power of first power value pa is started , the subsequent supply of power of first power value pa causes power waste . therefore , when a response is not received within a predetermined time , it is preferable to determine that there is no power supply target and stop the supply of power . when the request signal is received within predetermined time tlimit ( yes in s 121 ), power supply - side control section 24 controls power supply section 21 on the basis of predetermined time ttest and predetermined power value ptest included in the request signal . specifically , after predetermined time ttest passes from when power supply - side communication section 23 receives the request signal , the power supplied from power supply section 21 is controlled to be predetermined power value ptest ( s 122 ). vehicle - side control section 44 determines whether the power received by power receiving section 41 is predetermined power value ptest after predetermined time ttest passes from when transmitting the request signal ( s 224 ). when the power is not power value ptest ( no in s 224 ), vehicle - side control section 44 determines that a communication with power supply apparatus 2 is not set up , and returns the process flow to start of fig4 . on the other hand , when the power is predetermined power value ptest ( yes in s 224 ), vehicle - side control section 44 determines that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up , and performs a control for causing vehicle - side communication section 43 to transmit a power supply start signal ( s 225 ). then , vehicle - side control section 44 performs the process of s 23 . the power supply start signal transmitted from vehicle - side communication section 43 in s 225 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether the power supply start signal is received within predetermined time tlimit after the supply of power in s 122 is started ( s 123 ). when the power supply start signal is not received within predetermined time tlimit ( no in s 123 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). on the other hand , when the power supply start signal is received within predetermined time tlimit ( yes in s 123 ), power supply - side control section 24 determines that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is setup up , and performs a control for causing power supply section 21 to supply power of second power value pb in the process of s 13 . the reason of determining whether the power supply start signal is received within predetermined time tlimit is the same as described in s 121 . when the request signal is received within predetermined time tlimit in s 121 ( yes in s 121 ), power supply - side control section 24 may determine that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up . in this case , the calculation of predetermined power value ptest in s 222 and the transmission of predetermined power value ptest in s 223 become unnecessary . power supply - side control section 24 performs a control such that power supplied from power supply section 21 becomes second power value pb after predetermined time ttest passes from when the request signal is received in s 122 . when the supplied power is second power value pb in s 224 , vehicle - side control section 44 determines that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up . the processes of s 225 and s 123 are unnecessary . a variation in power value supplied from power supply section 21 will be described below with reference to fig6 . fig6 is a timing diagram in embodiment 1 of the present invention . time t 0 represents the โ start โ state of fig3 , and the power value supplied from power supply section 21 is zero at this time . time t 1 represents a state where a vehicle enters chargeable area b ( yes in s 10 ), and the magnitude of the power supplied from power supply section 21 is first power value pa . since the magnitude of the power supplied from power supply section 21 is first power value pa , vehicle - side communication section 43 is started up ( yes in s 21 ) and vehicle - side communication section 43 transmits a request signal ( s 223 ). when power supply - side communication section 23 receives the request signal within predetermined time tlimit after a vehicle enters chargeable area b at time t 2 ( s 121 ), power supply - side control section 24 controls power supply section 21 so that the supplied power is set to predetermined power value ptest included in the request signal at the time point where predetermined time ttest included in the request signal passes from t 2 to t 3 ( s 122 ). when it is confirmed that the supplied power is set to predetermined power value ptest at the time point where predetermined time ttest passes after the transmission of the request signal at time t 3 ( yes in s 224 ), vehicle - side control section 44 transmits a power supply start signal ( s 225 ). power supply - side control section 24 controls power supply section 21 so that the supplied power is set to second power value pb from t 3 to t 4 ( s 123 ). when the vehicle leaves chargeable area b ( yes in s 14 ), or when power storage section 42 is fully charged , power supply - side control section 24 causes power supply section 21 to stop the supply of power ( after t 4 ). in this way , in the power supply system according to this embodiment , power supply - side control section 24 performs a control for causing power supply section 21 to supply power of first power value pa when vehicle detecting section 22 detects that electric vehicle 3 enters chargeable area b . in this state , when it is determined that a communication between power supply - side communication section 23 and vehicle - side communication section 43 is set up , the system performs a control for causing power supply section 21 to supply power of second power value pb . accordingly , it is possible to accurately associate electric vehicle 3 supplied with power from power supply apparatus 2 , with electric vehicle 3 communicating with power supply apparatus 2 . additionally , since vehicle - side communication section 43 of electric vehicle 3 is started up on the basis of first power value pa smaller than second power value pb for supplying power to electric vehicle 3 , it is possible to improve safety without discharging high power to the periphery of power supply section 21 of power supply apparatus 2 . it has been stated in this embodiment that vehicle - side communication section 43 is operated with the power supplied to power receiving section 41 until a communication is set up and is operated with the power of power storage section 42 after the communication is set up . however , the present invention is not limited to this example , but vehicle - side communication section 43 may be always operated with power supplied from power storage section 42 as a power source . at this time , vehicle - side communication section 43 is started up with a signal indicating reception of power of first power value pa or larger output from power receiving section 41 as a trigger . accordingly , since vehicle - side communication section 43 can be always in a communication standby state , it is possible to shorten the time until a communication is started , compared with the case where vehicle - side communication section 43 is started up with power supplied from power receiving section 41 . it has been stated in this embodiment that in s 223 , vehicle - side control section 44 generates a request signal including predetermined time ttest and predetermined power value ptest generated in s 222 and causes vehicle - side communication section 43 to transmit the generated request signal . however , the present invention is not limited to this example , but only any one of predetermined time ttest and predetermined power value ptest may be transmitted . when only predetermined time ttest is transmitted , the processes of s 122 and s 224 of fig5 can be performed without any change by causing power supply apparatus 2 and power receiving apparatus 4 to share a predetermined value of predetermined power value ptest . when only predetermined power value ptest is transmitted , power supply - side control section 24 controls power supply section 21 on the basis of predetermined power value ptest included in the request signal just after receiving the request signal . vehicle - side control section 44 determines whether the power received by power receiving section 41 is predetermined power value ptest in s 224 , just after transmitting the request signal . it is preferable that power receiving section 41 and vehicle - side communication section 43 be installed on the bottom surface of electric vehicle 3 facing the road , and power supply section 21 and power supply - side communication section 23 be installed in the vicinity of the road surface of the road . accordingly , only by locating electric vehicle 3 on the road surface in which power supply section 21 and power supply - side communication section 23 are installed , vehicle - side communication section 43 can be easily started up . since electric vehicle 3 serves as a shielding member , it is possible to prevent a communication with a different electric vehicle . hereinafter , a power supply system for an electric vehicle according to embodiment 2 of the present invention will be described with reference to fig7 . fig7 is a diagram illustrating a communication setup process in embodiment 2 of the present invention . in fig7 , the same steps as described with reference to fig5 in embodiment 1 will be referenced by the same reference numerals and description thereof will not be repeated . embodiment 2 is different from embodiment 1 , in that it is determined whether a communication is set up on the basis of chopper frequency ftest instead of power value ptest in embodiment 1 . the chopper frequency is an on - off cycle of current when ac current is generated from a dc power source by repeating on - off of current . vehicle - side control section 44 can acquire chopper frequency ftest by measuring the output of power receiving section 41 through the use of a dedicated measuring circuit . as shown in fig7 , vehicle - side control section 44 calculates time ttest and chopper frequency ftest on the basis of a random number ( s 216 ) subsequently to s 211 as described above , and causes vehicle - side communication section 43 to transmit a request signal including time ttest and chopper frequency ftest ( s 217 ). power supply - side control section 24 performs a control for causing power supply section 21 to supply power so as to achieve chopper frequency ftest after time ttest passes , in response to the request signal received by power supply - side communication section 23 ( s 124 ). vehicle - side control section 44 determines whether the power received by power receiving section 41 in time ttest after the transmission of the request signal has chopper frequency ftest ( s 218 ). when it is determined that the power has chopper frequency ftest ( yes in s 218 ), vehicle - side control section 44 determines that a communication is set up and causes vehicle - side communication section 43 to transmit a power supply start signal ( s 215 ). as described above , the power supply system according to this embodiment determines whether a communication is set up on the basis of chopper frequency ftest . when power value ptest is measured as described in embodiment 1 , the absolute value of power is measured and an error may therefore be included in the power due to attenuation dependent on the distance . on the other hand , the measured value of chopper frequency ftest does not depend on the distance but is constant . accordingly , it is possible to reduce the measurement error in comparison with the case where power value ptest is used , by using chopper frequency ftest . it has been stated in this embodiment that vehicle - side control section 44 generates the request signal including predetermined time ttest and chopper frequency ftest generated in s 216 and causes vehicle - side communication section 43 to transmit the generated request signal in s 217 . however , the present invention is not limited to this example , but only any one of predetermined time ttest and chopper frequency ftest may be transmitted . when only predetermined time ttest is transmitted , the processes of s 124 and s 218 of fig7 can be performed without any change by causing power supply apparatus 2 and power receiving apparatus 4 to share a predetermined value of chopper frequency ftest . when only chopper frequency ftest is transmitted , power supply - side control section 24 controls power supply section 21 on the basis of chopper frequency ftest included in the request signal just after receiving the request signal . vehicle - side control section 44 determines whether the power received by power receiving section 41 has chopper frequency ftest in s 218 , just after transmitting the request signal . hereinafter , a power supply system for an electric vehicle according to embodiment 3 of the present invention will be described with reference to fig8 . fig8 is a block diagram illustrating the configuration of the power supply system for an electric vehicle according to embodiment 3 of the present invention . in fig8 , solid arrows represent the flow of signals and dotted arrows represent the flow of power . in fig8 , the same elements as described with reference to fig2 in embodiment 1 will be referenced by the same reference numerals and description thereof will not be repeated . it has been stated in embodiment 1 that vehicle - side communication section 43 is operated with power received by power receiving section 41 until a communication is set up between vehicle - side communication section 43 and power supply - side communication section 23 , and is operated with power stored in power storage section 42 as a power source after the communication is set up . on the contrary , in embodiment 3 , vehicle - side communication section 43 is always operated with power received by power receiving section 41 as a power source . accordingly , in fig8 , the supply of power from power storage section 42 to vehicle - side communication section 43 in fig2 is deleted . in embodiment 1 , vehicle - side communication section 43 is operated with power of power storage section 42 after a communication is set up . this means that the power which is first received by power receiving section 41 and then stored in power storage section 42 is used . when power is once stored in power storage section 42 and the power is used , loss is necessarily caused in the power . in embodiment 3 , since power is directly supplied from power receiving section 41 to vehicle - side communication section 43 without storing the power in power storage section 42 after a communication is set up , it is possible to operate vehicle - side communication section 43 with small power loss . in embodiment 4 , an example where multiple power supply apparatuses supply power of first power values pa different from one another will be described . hereinafter , a power supply system for an electric vehicle according to embodiment 4 of the present invention will be described with reference to fig9 and fig1 . fig9 is a diagram illustrating the configuration of the power supply system for an electric vehicle according to embodiment 4 of the present invention . fig1 is a diagram illustrating a communication setup process in embodiment 4 of the present invention . the configurations of power supply apparatus 2 and power receiving apparatus 4 in this embodiment are the same as described with reference to fig2 in embodiment 1 . in fig9 , three power supply apparatuses 2 a , 2 b , and 2 c are shown . power supply section 21 a of power supply apparatus 2 a supplies power of first power value pa 1 to electric vehicle 3 a when electric vehicle 3 a enters chargeable area b 1 . power supply section 21 b of power supply apparatus 2 b supplies power of first power value pa 2 to electric vehicle 3 b when electric vehicle 3 b enters chargeable area b 2 . power supply section 21 c of power supply apparatus 2 c supplies power of first power value pa 3 to electric vehicle 3 c when electric vehicle 3 c enters chargeable area b 3 . first power values pa 1 , pa 2 , and pa 3 are about several w to several tens w and are different from each other . the communication setup process will be described below with reference to fig1 . the left flowchart in fig1 represents a power supply - side process ( s 12 ) and the right flowchart represents a vehicle - side process ( s 22 ). after vehicle - side communication section 43 is started up in s 21 , vehicle - side control section 44 generates a request signal including the power value received by power receiving section 41 and a vehicle identification number and causes vehicle - side communication section 43 to transmit the generated request signal ( s 41 ). the request signal transmitted from vehicle - side communication section 43 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether the power value included in the request signal is substantially equal to first power value pa supplied from power supply section 21 in s 11 ( s 31 ). the term โ substantially equal โ means that the power value included in the request signal belongs to a predetermined range including first power value pa . when the power value included in the request signal is not equal to first power value pa supplied from power supply section 21 ( no in s 31 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). this is because it is thought in this case that electric vehicle 3 supplied with power from power supply apparatus 2 is not matched with electric vehicle 3 communicating with power supply apparatus 2 . when the power value included in the request signal is substantially equal to first power value pa supplied from power supply section 21 ( yes in s 31 ), power supply - side control section 24 generates a response signal including the vehicle identification number included in the request signal and causes power supply - side communication section 23 to transmit the generated response signal ( s 32 ). in this case , it is thought that the electric vehicle supplied with power from the power supply apparatus is matched with the electric vehicle communicating with the power supply apparatus . vehicle - side control section 44 determines whether vehicle - side communication section 43 receives the response signal including its own vehicle identification number before predetermined time ttest passes from when transmitting the request signal ( s 42 ). when the response signal is not received ( no in s 42 ), vehicle - side control section 44 determines that a communication with power supply apparatus 2 is not set up and returns the flow of processes to start of fig4 . when the response signal is received ( yes in s 42 ), vehicle - side control section 44 determines that a communication is set up between power supply - side communication section 23 and vehicle - side communication section 43 , and performs a control for causing vehicle - side communication section 43 to transmit a power supply start signal ( s 43 ). then , vehicle - side control section 44 performs the process of s 23 . the power supply start signal transmitted from vehicle - side communication section 43 in s 43 is received by power supply - side communication section 23 . power supply - side control section 24 determines whether the power supply start signal is received within predetermined time tlimit after the supply of power in s 11 is started ( s 33 ). when the power supply start signal is not received within predetermined time tlimit ( no in s 33 ), power supply - side control section 24 causes power supply section 21 to stop the supply of power ( s 16 ). when the power supply start signal is received within predetermined time tlimit ( yes in s 33 ), power supply - side control section 24 determines that a communication is set up between power supply - side communication section 23 and vehicle - side communication section 43 , moves the flow of processes to s 13 , and performs a control for causing power supply section 21 to supply power of second power value pb . as described above , in the power supply system according to this embodiment , power supply - side control section 24 performs a control for causing power supply section 21 to supply power of first power value pa when vehicle detecting section 22 detects that electric vehicle 3 enters chargeable area b . at this time , power supply sections 21 a , 21 b , and 21 c supply power of first power values pa ( pa 1 , pa 2 , and pa 3 ) different from each other . in this state , when determining that a communication is set up between power supply - side communication section 23 and vehicle - side communication section 43 , power supply - side control section 24 performs a control for causing power supply section 21 to supply power of second power value pb . accordingly , it is possible to accurately associate electric vehicle 3 supplied with power from power supply apparatus 2 , with electric vehicle 3 communicating with power supply apparatus 2 . in this embodiment , first power values pa ( pa 1 , pa 2 , and pa 3 ) may be fixedly assigned to power supply apparatuses 2 ( 2 a , 2 b , and 2 c ), respectively , or may be assigned to power supply apparatuses 2 ( 2 a , 2 b , and 2 c ) in patterns determined depending on the time for supplying power , respectively . the patterns of first power values pa differ depending on power supply apparatuses 2 . in this case , vehicle - side control section 44 generates a request signal including the pattern of first power value pa received by power receiving section 41 instead of generating the request signal including the power value received by power receiving section 41 in s 41 . when the pattern of first power value pa included in the request signal is substantially equal to the pattern of first power value pa supplied from power supply section 21 of power supply apparatus 2 in s 32 , power supply - side control section 24 generates a response signal including the vehicle identification number included in the request signal and causes power supply - side communication section 23 to transmit the generated response signal . first power values pa ( pa 1 , pa 2 , and pa 3 ) may vary in power receiving section 41 due to positional mismatch between power supply section 21 and power receiving section 41 . by causing the first power value pa to temporally vary in patterns different depending on power supply apparatuses 2 , it is possible to accurately associate therewith electric vehicle 3 communicating with power supply apparatus 2 with temporal variation of the power value , even when variation occurs in the absolute value of first power value pa received by power receiving section 41 . the disclosure of japanese patent application no . 2010 - 223759 , filed on oct . 1 , 2010 , including the specification , drawings and abstract , is incorporated herein by reference in its entirety . the present invention can be suitably used for a power supply system for an electric vehicle that supplies power from a power supply apparatus to an electric vehicle in a non - contact manner , and an electric vehicle and a power supply apparatus that are used for the system .
| 7 |
according to the present invention , it is important to add other metal to a platinum catalyst . in general , it is said that , in an alloy catalyst , the characteristics of component metal elements are developed depending on a composition of the alloy . the other metal is added to platinum in an amount of from 0 . 01 to 500 % by weight , preferably from 0 . 1 to 300 % by weight , based on the weight of platinum , to make the most of the features of platinum . although the concentration of an alloy which is held on a support can vary in the wide range of from 0 . 05 to 5 % by weight based on the weight of the support , the concentration of from 0 . 5 to 2 % by weight can be recommended . suitable supports used in the present invention include activated carbon , alumina , zirconia , titania , etc . while a particle size of the support gives less effect on the reaction , it is preferably in the range of from 0 . 1 to 100 mm . in the reduction of 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifluoroethane , the ratio of hydrogen to the starting material can vary in a wide range . usually a stoichiometric amount of hydrogen is used to remove a halogen atom . however , hydrogen may be used in much more than the stoichiometric amounts , for example , in an amount of 4 moles or more per one mole of the starting materials . the reaction is carried out at or above atmospheric pressure . the reaction temperature is in the range of from 0 ยฐ to 450 ยฐ c ., preferably from 50 ยฐ to 300 ยฐ c . it is appropriate to carry out the reaction in a gas phase or a liquid phase . in the case of the gas phase reaction , the contact time is usually from 0 . 1 to 300 sec , particularly from 1 to 30 sec . the present invention will be illustrated by means of examples hereinafter . to a platinum catalyst containing 0 . 5 % by weight of the platinum held on activated carbon , an aqueous solution of cucl 2 which amount corresponds to 1 % by weight of the activated carbon was added , followed by the dropwise addition of 0 . 2 ml of formalin . the resulting mixture was aged at a temperature of 50 ยฐ c . for 5 hours . then water in it was distilled off under a reduced pressure and the residue was dried at 100 ยฐ c . for a day . 18 cc of the catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 22 cc / min . and 44 cc / min ., respectively . the reaction temperature was 110 ยฐ c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 0 . 1 % by weight of silver on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using agno 3 and the reaction was carried out . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 0 . 1 % by weight of tellurium on a platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using tecl 2 and hydrogen chloride , and the reaction was carried out . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 0 . 1 % by weight of gold on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using aucl 3 and the reaction was carried out . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of zinc on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using zncl 2 . 16 . 5 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length , and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 12 cc / min . and 44 cc / min ., respectively . the reaction temperature was 110 ยฐ c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of chromium on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using cr ( no 3 ) 3 . 9h 2 o . 16 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length , and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 32 . 8 cc / min . and 65 . 8 cc / min ., respectively . the reaction temperature was 130 ยฐ c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of thallium on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using tlcl 3 . 13 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifuoroethane which had been previously vaporized and hydrogen gas were introduced in the tube at rates of 18 . 4 cc / min and 36 . 7 cc / min , respectively . the reaction temperature was 130 ยฐ c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . in the similar method to that in example 1 , an alloy catalyst containing 2 % by weight of molybdenum on the platinum catalyst in which 0 . 5 % by weight of platinum had been held on activated carbon was prepared using ( nh 4 ) 6 mo 7 o 24 . 4h 2 o . 14 . 5 cc of the alloy catalyst thus prepared was packed in a sus 316 reaction tube of 2 cm in inner diameter and 40 cm in length and the tube was heated by an electric furnace while passing nitrogen gas therethrough . after the predetermined temperature was reached , the nitrogen flow was stopped and 1 , 1 , 1 - trichloro - 2 , 2 , 2 - trifluoroethane which had been previously vaporized and hydrogen gas were introduced to the tube at rates of 33 . 2 cc / min . and 66 . 3 cc / min ., respectively . the reaction temperature was 200 ยฐ c . the resulting gas mixture was washed with water and dried over calcium chloride . then it was analyzed by gas chromatography . the results are given in table 1 . table 1______________________________________example no . conversion of 113a (%) selectivity of 123 (%) ______________________________________1 94 912 97 963 87 864 93 905 55 936 86 857 42 928 50 96______________________________________
| 2 |
in the description that follows , like components are marked throughout the specification and drawings with the same reference numerals , respectively . the drawing figures are not necessarily to scale . certain features of the invention may be shown exaggerated in scale or in somewhat schematic form and some details of conventional elements may not be shown in the interest of clarity and conciseness . referring now to fig1 , floating platform 10 is positioned above a field of subsea wellheads 14 . floating platform 10 is secured on location by mooring system 11 that allows the platform to be positioned at any location within watch circle 13 . attached to some of subsea wellheads 14 are subsea trees 16 . also seen on bottom 15 is distribution control and monitoring station 22 , which is coupled to subsea trees 16 by flying leads 24 . floating platform 10 is connected to subsea trees 16 through risers 12 . floating platform 10 performs distribution control and monitoring functions for subsea trees 16 through umbilicals 26 that terminate in subsea umbilical termination ( sut ) assemblies including an electrical and hydraulic subsea umbilical termination assembly 18 and a chemical subsea umbilical termination assembly 20 . the subsea umbilical termination assemblies 18 and 20 are connected to distribution control and monitoring station 22 through flying leads 28 and 30 , respectively . referring now to fig2 , an electro - hydraulic multiplex control system for controlling subsea trees 16 from floating platform 10 ( fig1 ) is seen . topside primary control station 200 , hydraulic power unit 202 , master control station 203 , blowout preventer control system 205 , and injection unit 206 are all disposed on floating platform 10 . topside primary control station ( pcs ) 200 communicates to master control station 203 through communications link 200 a . master control station 203 includes an electrical power unit ( epu ) and an uninterruptible power supply ( ups ). master control station 203 and hydraulic power unit ( hpu ) 202 are coupled to electrical - hydraulic umbilical line 26 that terminates on sea floor 15 in electrical - hydraulic umbilical termination assembly 18 , which is connected to distribution , control , and monitoring ( dcm ) station 22 through electrical - hydraulic flying lead 30 . electrical - hydraulic flying lead 30 provides electric control signals and pressurized hydraulic fluid to dcm station 22 , which comprises subsea distribution unit 22 d and control unit 22 e that includes control modules 22 c and hydraulic accumulator package 22 a . a variety of subsea control modules 22 c and accumulator packages 22 a that are alternative embodiments of the invention will occur to those of skill in the art without need for further description . control unit 22 e is connected to subsea tree 16 by electrical flying lead 24 e that carries electrical signals between the control unit and the subsea tree . distribution unit 22 d is connected to subsea tree 16 by hydraulic control flying lead 24 h that provides hydraulic communication between the distribution unit and the subsea tree . chemical injection unit 206 is connected through chemical umbilical 26 c to chemical injection umbilical termination assembly 20 on bottom 15 . chemical injection umbilical termination assembly 20 is connected to subsea distribution unit 22 d by chemical flying lead 28 . chemical injection is provided to subsea tree 16 by flying lead 24 c . also seen in fig2 is a bop ( blowout preventer ) control system 205 that resides on floating platform 10 and is connected to electrical - hydraulic umbilical 26 . various bop control systems 205 will occur to those of skill in the art , as will various chemical injection units 206 , all of which are example embodiments of the invention and require no further explanation . likewise , flying leads 28 , 30 , 24 c , 24 e , and 24 h , will be understood by those with skill in the art without further elaboration , and installation of such flying leads between the termination assemblies 18 and 20 , and subsea distribution unit 22 , will also be understood by those of skill in the arts to be accomplished in various example embodiments of the invention by using a remote operated vehicle ( rov โ not shown ). likewise , the connections of flying leads 24 c , 24 e , and 24 h , between subsea distribution unit 22 and subsea tree 16 are accomplished in various example embodiments of the invention through the use of an rov . referring now to fig3 , an alternative embodiment is seen in which topside pcs 200 is connected to hydraulic power unit 202 , well control panel 204 , and chemical injection unit 206 . hydraulic power unit 202 and chemical injection unit 206 are also connected to well control panel 204 . thus , well control panel 204 controls , from floating platform 10 , subsea trees 16 on bottom 15 . such control is accomplished through electrical umbilical 26 e and hydraulic umbilical 26 h . electrical umbilical 26 e is connected to electrical subsea umbilical termination assembly 18 e and control unit 22 e , as shown . likewise , hydraulic umbilical 26 h is connected to distribution unit 22 d . well control panel 204 communicates with chemical injection unit 206 , which is connected to chemical injection umbilical 26 c for umbilical communication with chemical injection umbilical termination assembly 20 . the subsea distribution unit 22 is connected to the chemical injection umbilical termination assembly 20 via chemical injection flying lead 28 . subsea distribution unit 22 d provides hydraulic communication to subsea tree 16 through hydraulic flying lead 24 h and chemical injection communication to subsea tree 16 through flying lead 24 c . control 22 e provides electrical communication to subsea tree 16 through flying lead 24 e . although not shown in fig2 and 3 , it will be understood by those of skill in the art that multiple wells 16 are controlled , as seen in fig1 , through a single set of distribution control and monitoring components . thus , the need for a single umbilical to each subsea tree 16 is eliminated and multiple wells are controlled , monitored , or have fluids distributed to them through single umbilicals 26 e , 26 h , and 26 c . at the same time , simplified risers 12 ( fig1 ) connect in a substantially vertical manner to subsea trees 16 , allowing for insertion and removal of various tools useful in drilling , production , and work - over . such insertion and removal of tools is not possible in systems in which production occurs through conduits that communicate to a central distribution control or monitoring station on the sea - floor , due to the acute angle between the well bore and the fluid conduit . referring now to fig4 , still another embodiment of well control is seen in which direct control to each well is accomplished . in the fig4 embodiment , pcs 200 communicates with chemical injection unit 206 , hydraulic power unit 202 , and well control panel 204 . in the illustrated embodiment , a single umbilical 26 is used for all electrical , hydraulic , and chemical injection functions and is separate from riser 12 . riser 12 and umbilical 26 are connected directly to subsea trees 16 , as shown . referring now to fig5 , a system and method of installation of an umbilical 26 with riser 12 to a tree 16 is seen . tree connector 500 and guide sleeve 502 are mounted on deck 510 of floating platform 10 ( fig1 ). umbilical 26 comprises a flexible , reel - held conduit that is supported by turndown sheave 520 and spooled on reel 504 . umbilical 26 is fed from reel 504 through turndown sheave 520 , guide sleeve 502 , and tree connector 500 . from tree connector 500 , umbilical 26 is fed through the keel 525 of floating platform 10 at guide sleeve 504 . through the use of an rov , umbilical 26 is connected to subsea tree 16 . referring now to fig6 , a more detailed view of a direct control of subsea trees 16 is seen . umbilical 26 ( hydraulic or electro - hydraulic in an alternative embodiment ) is supported by umbilical tensioner 600 . umbilical 26 is attached to hose reel 612 and control / hydraulic unit 614 as will be understood by those of skill in the art . umbilical 26 passes through umbilical tensioner 600 and tree connector 500 to which surface tree 604 is attached . a flow line 606 is connected to the top of surface tree 604 and supported by flow line tensioner 608 . flow line 606 terminates in topside equipment 610 as well be understood by those of skill in the arts . referring now to fig7 , a more detailed view of a well in a drilling mode being controlled by multiplex systems of the type seen in fig2 and 3 is illustrated . a pressure control device , such as surface blowout preventer 700 , is connected to a drilling or work - over riser 710 that is , in turn , connected to a subsea blowout preventer 720 through tieback connector 722 . subsea blowout preventer 720 is mounted on wellhead 14 by tree connector 726 . surface blowout preventer 700 is mounted on floating platform 10 ( fig1 ) that can be positioned directly above wellhead 14 by moving the platform within its watch circle by the adjustment of the platform &# 39 ; s mooring system . subsea blowout preventer 720 has various controls , as are known to those of skill in the art , which are coupled to subsea distribution unit 22 by flying leads 24 . subsea distribution unit 22 includes subsea control module 22 c and subsea accumulator package 22 a . in various embodiments , subsea accumulator package 22 a includes a high - pressure accumulator , a low - pressure accumulator , and a โ return โ pressure accumulator . subsea distribution unit 22 is mounted on subsea distribution unit docking platform 728 and is connected to floating platform 10 ( fig1 ) via umbilicals 26 ( as described in reference to fig2 and 3 ). referring now to fig8 , the well of fig7 is shown in a production mode being controlled by the same multiplex system . a pressure control device , such as surface tree 800 , is connected to tubing riser 12 , which is connected to riser connecter 812 and subsea tree 16 as is understood by those of skill in the art . subsea tree 16 includes master valves 816 and annulus valves 818 for access and control of the annulus between tubing 820 of wellhead 14 and the other components of the wellhead . control and instrumentation junction plate 825 , which serves as a connector for subsea flying lead 24 . referring now to fig9 , an example embodiment is shown with the well in a work - over configuration . a pressure control device , such as surface blowout preventer or tree 900 , resides on floating platform 10 ( fig1 ), and work - over riser 910 is connected to tie - back connector 922 . subsea blowout preventer 720 is connected to subsea tree 16 via tree connector 726 and subsea flying lead umbilical 24 is connected to control and instrumentation junction plate 825 and subsea distribution unit 22 . as in the drilling mode of fig7 , floating platform 10 ( fig1 ) that can be positioned directly above wellhead 14 by moving the platform within its watch circle by the adjustment of the platform &# 39 ; s mooring system . while a specialized subsea distribution unit 22 is useful in some embodiments for production , and a specialized subsea distribution unit 22 is useful in other example embodiments for drilling or work - over configurations , the examples seen in fig7 - 9 show a common type of subsea distribution unit 22 having similar components . this allows for efficiencies in that the control and distribution functions for drilling , work - over , and production , are provided in one unit on the sea floor that can interface with a variety of equipment , such as risers 710 , 810 , and 910 , subsurface blowout preventer 720 , and subsea tree 16 . likewise , subsea flying lead umbilical 24 may include all control lines for all three operational modes or any combination of two modes . examples of the controls provided in various embodiments include : bop control , connector lock / unlock , tree control , dssv control , chemical injection , annulus monitoring , instrumentation communication , and others . referring now to fig1 , an example embodiment of the subsea tree with an exterior production master valve is seen , in which riser connector 1000 attaches to subsea tree 1002 that includes sea plug 1004 . master valves 1006 a and 1006 b control access on either side of sea plug 1004 . annulus access valves 1010 a , 1010 b , and 1010 c control access to the subsea tree annulus on each side of sea plug 1004 . in various operational situations , pressure in an annulus can increase to an unacceptable level . in such cases , it is desirable both to monitor the annulus ( e . g ., through annulus valves 1010 a - c ), and / or to provide fluids ( e . g ., drilling mud or cement ) into the annulus through valves 1010 a - c . likewise , should the annulus line attach to annulus access valve 1010 a be insufficient to carry the desired fluid into the annulus ( for example , in embodiments in which the annulus line is sized merely for monitoring ), then master valves 1006 a and 1006 b are manipulated such that a fluid ( e . g ., cement ) is pumped down through a riser ( connected to riser connecter 1000 ) and into annulus access passage 1011 . annulus access valves 1010 a - c are manipulated such that the fluid then passes through annulus access passage 1012 into annulus 1020 . from the illustrated embodiment , and the above description , it will be understood by those of skill in the art how various other annulus control and access operations are performed through manipulation of master valves 1006 a and b and annulus access valves 1010 a - c . referring now to fig1 , an alternative embodiment of a subsea tree is seen in which the valves are integral with a spool piece . rather than have master valves 1006 a and 1006 b controlling flow line access passage 1030 master valves 1106 a and 1106 b control the flow line 1101 directly . referring now to fig1 , still a further alternative embodiment is seen in which a subsea tree with a vertical annulus and production string is illustrated . flow line 1201 is controlled by production master valves 1206 a and 1206 b housed within subsea tree 1202 . also within subsea tree 1202 is cross - over valve 1250 which controls flow and a cross - over access passage 1252 that , in turn , controls communication between annulus access passage 1254 and flow line 1201 . annulus master valve 1256 is provided an annulus access passage 1254 for providing access to annulus 1020 . referring now to fig1 , a hydraulic accumulator package is seen in which accumulator 1301 and accumulator 1302 are in connection with hydraulic supply line 1304 and hydraulic return line 1306 through hydraulic control valve 1308 ( located on the bottom ). accumulators 1301 and 1302 are also in communication with another hydraulic control valve 1310 , which is located on the topside . as seen , 1308 and 1310 are two - position , single - throw valves . other valves will occur to those of ordinary skill in the art as alternative examples . supply pressure source 1312 is connected through valve 1310 to accumulator 1301 and through valve 1308 to hydraulic supply line 1304 , which is connected to the various well - control systems described above . the use of subsea accumulators as illustrated provides for multiple efficiencies in the hydraulic operations . referring now to fig1 , an example of dcm station 22 from fig1 is seen . dcm station 22 comprises hydraulic connectors 1401 , electrical connectors 1403 , accumulator bank 1405 , subsea control modules 1406 , electro - hydraulic umbilical connector 1407 , and injection umbilical connectors 1409 a - b . hydraulic connectors 1401 and electrical connectors 1403 provide termination connection points for a plurality of hydraulic and electric flying leads that are connected to individual wellheads . accumulator bank 1405 includes a plurality of hydraulic accumulators that store a predetermined volume of hydraulic fluid at a selected pressure . there may be fewer accumulators than there are connectors for flying leads because not all wells will require hydraulic circuit control with significant accumulators at the same time . subsea control modules 1406 house the various electrical circuits and control systems that connect to electrical connectors 1403 . an electrical - hydraulic umbilical connection 1407 connects to an electro - hydraulic flying lead that provides electrical signal and hydraulic communication with a floating platform . likewise , injection connectors 1409 a and 1409 b are provided for the connections needed for the chemical injection flying leads . thus , dcm station 22 , through control modules 1406 and the multiplexers and valve - selectable manifolds disposed within the station , provides electrical and fluid communication between a plurality of distributed wells and a single floating installation so as to control equipment disposed on the wellheads as well as fluid injection capabilities . the above description is given by way of example only and not intended to limit the scope of the invention as claimed . other examples will occur to those of skill in the art , which are within the scope of the invention .
| 4 |
the improvements to capacitance diaphragms are disclosed herein with respect to exemplary embodiments of a system and a method . the embodiments are disclosed for illustration of the system and the method and are not limiting except as defined in the appended claims . although the following description is directed to a particular embodiment of a capacitance diaphragm gauge , it should be understood that the disclosed system and method can be applied to other embodiments of capacitance diaphragm gauges . fig1 illustrates a front perspective view of an exemplary capacitance diaphragm gauge ( cdg ) 100 , which is installable into a pneumatic system ( not shown ) to measure the pressure within the system . in particular , the cdg is used to measure very low pressures resulting from evacuation of the pneumatic system . fig2 illustrates a rear perspective view of the cdg of fig1 which is rotated 180 ยฐ from the view in fig1 . fig3 illustrates a cross - sectional view of the cdg taken along the line 3 - 3 in fig1 . in the illustrated embodiment , the cdg 100 comprises a hollow , generally cylindrical body structure 110 , which extends between a first end surface 112 ( fig1 ) and a second end surface 114 ( fig2 ). a first cylindrical tube 120 extends from the first end surface . the first cylindrical tube provides pneumatic access to a first inner cavity 122 ( fig3 ) of the cdg . the first cylindrical tube is connectable to the pneumatic system ( not shown ) to allow the pressure of the system to be applied to the first inner cavity . as shown in fig2 , a diaphragm 130 within the cylindrical body structure 110 separates the first inner cavity 122 from a second inner cavity 132 . the diaphragm is sealed around its peripheral edges with respect to an inner surface 134 of the cylindrical body structure so that the first inner cavity is pneumatically isolated from the second inner cavity by the diaphragm . the diaphragm is also electrically connected to the cylindrical body structure , which is electrically connected to a ground reference , as discussed below . in certain embodiments , the diaphragm 130 comprises inconel ยฎ alloy 750 or another suitable material . in certain embodiments , the diaphragm has a thickness that can range from approximately 0 . 001 inch ( 0 . 025 mm ) to approximately 0 . 015 inch ( 0 . 38 mm ). the first inner cavity 122 also includes a baffle 136 that is positioned between the diaphragm and the first cylindrical tube 120 . the baffle reduces the deposition of contaminants onto the surface of the diaphragm that faces the first inner cavity . an electrode assembly 140 is positioned within the second inner cavity 132 between the diaphragm 130 and the second end surface 114 . the electrode assembly comprises a mounting structure 142 , which is secured to the inner surface 134 of the cylindrical body structure 110 . the mounting structure of the electrode assembly is not sealed around the peripheral edges . accordingly , both sides of the electrode assembly are at the same pressure within the second inner cavity . at least one electrode 144 is mounted on one side of the electrode assembly mounting structure . in particular , the electrode is mounted on the side of the mounting structure that faces the diaphragm . the electrode is electrically connected through the mounting structure . a conductor 146 extends from the mounting structure to a port 150 that extends through the second end surface 114 of the cylindrical body structure 110 . the port 150 includes a second cylindrical tube 152 that extends outwardly from the second end surface . the conductor extends beyond the end of the second cylindrical tube . the conductor extends through a plug 154 that hermetically seals the second cylindrical tube around the conductor . although described herein with respect to one electrode on the electrode assembly , one skilled in the art will appreciate that the electrode assembly may include more than one electrode . see , for example , u . s . pat . no . 4 , 823 , 603 to ferran et al ., which discloses two concentric fixed electrodes . u . s . pat . no . 4 , 823 , 603 is incorporated herein by reference . in the illustrated embodiment , a central portion 160 of the second end surface 114 extends outwardly to form an extended cavity portion 162 of the second inner cavity 132 . the extended portion of the second inner cavity houses a getter 164 . the getter functions in a conventional manner to remove small amounts of gas that may be released by the inner surface of the second inner cavity . a third cylindrical tube 170 extends from the second end surface 114 of the cylindrical body structure 110 . initially , the entire length of the third cylindrical tube is uniformly cylindrical . the third cylindrical tube is connected to a vacuum evacuation system ( not shown ) to evacuate the gases from the second inner cavity 132 to create a desired low pressure within the second inner cavity . after the evacuation process is completed , an end portion 172 of the third cylindrical tube is crimped as shown in fig1 to seal the second inner cavity to maintain the evacuated condition of the second inner cavity . as illustrated in the cross - sectional view of fig3 , the diaphragm 130 is a thin metallic plate that separates the first inner cavity 122 from the second inner cavity 132 . as discussed above , the second inner cavity is evacuated so that the absolute pressure within the second inner cavity is very low ( e . g ., approximately 10 โ 9 torr ). the pressure within the first inner cavity is determined by the pressure px of the system ( not shown ) to which the first cylindrical tube 120 is connected . when the pressure within the first inner cavity is substantially equal to the pressure within the second inner cavity , the diaphragm will not be deflected and will maintain the substantially flat shape shown by the solid cross - hatched profile ( labeled as 130 in fig3 ). if the pressure px on the system side of the diaphragm ( i . e ., the pressure in the first inner cavity ) exceeds the pressure in the second inner cavity , the center of the diaphragm will be deflected toward the second inner cavity and the diaphragm will bow into the second inner cavity as illustrated by a first dashed cross - hatched profile 130 โฒ in fig3 . if the pressure px on the system side of the diaphragm is less than the pressure in the second inner cavity , the center of the diaphragm will be deflected toward to the first inner cavity and the diaphragm will bow into the first inner cavity as illustrated by a second dashed cross - hatched profile 130 โณ in fig3 . in each case , the amount of the deflection will be determined by the pressure differential between the first and second inner cavities . the amount of deflection is also determined in part by the material properties of the diaphragm ( e . g ., the stiffness of the diaphragm ). as is well known in the art , the diaphragm 130 forms a first , movable plate of a variable capacitor . the electrode 144 on the electrode support structure 142 forms a second , fixed plate of the variable capacitor . when the diaphragm 130 is in the undeflected initial state , the capacitance of the variable capacitor has a first ( initial ) value determined by the initial distance between the diaphragm and the electrode . when the pressure px increases , the diaphragm is deflected toward the second inner cavity and thus toward the fixed electrode as illustrated by the first dashed cross - hatched profile 130 โฒ. the deflection reduces the distance between the diaphragm and the electrode , which increases the capacitance of the variable capacitor . when the pressure px decreases , the diaphragm is deflected toward the first inner cavity and thus away from the fixed electrode as illustrated by the second dashed cross - hatched profile 130 โณ. the deflection increases the distance between the diaphragm and the electrode , which decreases the capacitance of the variable capacitor . as discussed below , the capacitance is monitored and the increases and decreases in capacitance are used to determine corresponding increases and decreases in the system pressure px . the cdg is initially calibrated by monitoring the changes in capacitance as a plurality of known values of the pressure px are applied to the cdg . fig4 illustrates a simplified exemplary system 200 for monitoring the capacitance of the variable capacitor formed by the diaphragm 130 and the fixed electrode 144 of fig3 . the system comprises a first capacitor 210 and a second capacitor 212 . the first capacitor comprises the variable capacitor formed by the diaphragm and the fixed electrode . accordingly , a first electrode ( the diaphragm ) of the first capacitor is identified with the reference number 130 , and a second electrode ( the fixed electrode ) of the first capacitor is identified with the reference number 144 . the second capacitor is a conventional fixed capacitor . the second capacitor has a first electrode 214 and a second electrode 216 . the first electrode 130 of the first capacitor 210 and the first electrode 214 of the second capacitor 212 are connected to a ground reference 218 . the second electrode 144 of the first capacitor is connected to a first terminal 224 of a center - tapped output ( secondary ) winding 222 of a transformer 220 . the second electrode 216 of the second capacitor is connected to a second terminal 226 of the output winding of the transformer . a center - tap terminal 228 of the output winding of the transformer provides a signal output on a line 230 . in the illustrated embodiment , the first electrode ( diaphragm ) 130 of the first ( variable ) capacitor 210 is mechanically and electrically connected to the cylindrical body structure 110 . the cylindrical body structure is electrically connected to the ground reference 218 when installed in the system having the pressure to be measured , thus providing the electrical connection of the diaphragm to the ground reference . the second electrode 144 of the first ( variable ) capacitor is connected to the second terminal of the transformer via the conductor 146 of fig3 . in the illustrated embodiment , the capacitance of the second capacitor 212 is fixed . the capacitance of the second ( fixed ) capacitor is selected to be approximately equal to the initial capacitance between the diaphragm 130 and the fixed electrode 144 ( e . g ., the initial capacitance of the first ( variable ) capacitor 210 ) when the system pressure px in the first inner cavity 122 is approximately equal to the pressure in the second inner cavity 132 as discussed above with respect to fig3 . the transformer 220 has an input ( primary ) winding 240 having a first terminal 242 and a second terminal 244 . the first terminal is connected to the ground reference 218 . the second terminal is connected to a high frequency signal source 246 operating , for example , at a frequency of approximately 50 kilohertz as represented by an ac waveform 248 . the electrical conductor 230 connects the center tap 228 of the output winding 222 of the transformer 220 to an input 254 of an ac pressure measuring circuit 250 via an ac coupling capacitor 252 . the ac pressure measuring circuit provides an output signal ( output ) on an output signal line 256 . in the illustrated embodiment , the ac pressure measuring circuit 250 comprises an amplifier 260 and a demodulator 262 . the signal on the center tap 228 of the output winding 222 of the transformer 220 is applied to an input 270 of the amplifier via the ac coupling capacitor 252 . the amplifier preferably has a very high input impedance so that substantially zero current flows into the input of the amplifier . an output 272 of the amplifier provides an amplified output signal to an input 274 of the demodulator . an output 276 of the demodulator provides the output signal on the output signal line 256 . the output signal is responsive to the variations in the capacitance of the first ( variable ) capacitor 210 . accordingly , the output signal varies in response to changes in the system pressure px . the signal generated by the high frequency signal source 246 is applied to the input ( primary ) winding 240 of the transformer 220 . the applied signal is coupled to the secondary winding 222 and induces a high frequency voltage across the secondary winding . the induced voltage is applied across the series connection of the first ( variable ) capacitor 210 and the second ( fixed ) capacitor 212 . the voltage across each capacitor is inversely proportional to the respective capacitance of the capacitor . since the capacitance of the second ( fixed ) capacitor is substantially constant , the voltage across the first ( variable ) capacitor varies in accordance with the deflection of the diaphragm 130 caused by differential pressure across the diaphragm between the first inner cavity 122 and the second inner cavity 132 of the cdg 100 . because one electrode of each of each capacitor is electrically connected to the ground reference 218 , a difference in the voltages across the two capacitors appears as a voltage differential across the output winding between the first input terminal 224 and the second input terminal 226 of the output winding of the transformer . the voltage differential across the output winding 222 of the transformer 220 causes a voltage to appear on the center tap 228 of the output winding that is referenced to the ground reference 218 and that is proportional to the differences in the capacitance between the first ( variable ) capacitor 210 and the second ( fixed ) capacitor 212 . the voltage on the center tap 228 of the output winding 222 of the transformer 220 is applied via the conductor 230 and the ac coupling capacitor 252 to the input 270 of the amplifier 260 . the amplifier amplifies the center tap voltage and provides the amplified signal as an output signal on the output 272 . the output signal from the amplifier is a time - varying signal at the frequency of the signal source 246 with an amplitude that is proportional to the difference in capacitance of the first ( variable ) capacitor 210 , which varies in response to changes in the pressure differential across the diaphragm 130 . accordingly , the amplitude of the time - varying signal output of the amplifier changes in response to changes in the pressure differential across the diaphragm . the time - varying signal generated by the amplifier 260 is demodulated by the demodulator 262 in a conventional manner to provide the output signal on the output signal line 256 having a dc voltage level corresponding to the pressure differential across the diaphragm 130 . the ac pressure measuring circuit is calibrated to equate the variations in the ac voltage to the absolute pressure ( px ) applied to the diaphragm . in one embodiment , the demodulator comprises a synchronous demodulator known to the art . fig5 illustrates an improved pressure monitoring system 400 that includes circuitry that operates to compensate for the effects of differing ambient atmospheric pressures on the measured output signal from the cdg 100 . the improved measurement system of fig5 includes elements that are described above with respect to the system illustrated in fig4 . accordingly , like elements are identified with reference numbers corresponding to the reference numbers in fig4 . the elements of the improved pressure monitoring system in fig5 up to and including the ac pressure measuring circuit 250 are similar to the corresponding components in the previously described pressure monitoring system 200 of fig4 and are not described again in detail . in addition to the elements described above in fig4 , the improved pressure monitoring system of fig5 includes an analog - to - digital ( nd ) converter 410 . an input 412 of the a / d converter receives an analog value that represents the measured absolute pressure from the ac pressure measuring circuit . the a / d converter generates a digital value on an output 414 . the digital value also represents the measured absolute pressure , which may differ from the actual absolute pressure ( px ) because of the effects of the ambient atmospheric pressure on the accuracy of the cdg 100 . the digital value on the output 414 of the a / d converter 410 is provided to a first input 422 of a digital processing system 420 . the digital processing system has a second input 424 , and generates a calibrated absolute pressure signal on an output 426 . in one embodiment , the digital processing system 420 comprises a microcontroller . in other embodiments , the digital processing system comprises an application specific integrated circuit ( asic ) configured to perform the function described below . in the illustrated embodiment , the digital processing system may also control the operation of the a / d converter 410 to determine when the a / d converter samples the analog signal and generates the digital value . it should be understood that the a / d converter may be incorporated into the digital processing system . in such embodiments , the analog output from the ac pressure measuring system 250 is provided to an analog input port of the digital processing system . the second input 424 of the digital processing system 420 is connected to receive an output signal from an independent atmospheric pressure sensor 430 via a set of signal lines 432 . as illustrated in fig6 , the independent atmospheric pressure sensor is mounted in a common enclosure 440 that further encloses the cdg 100 such the independent atmospheric pressure sensor is subjected to the ambient atmospheric pressure that surrounds the body of the cdg . accordingly , the output of the independent atmospheric pressure sensor is a signal that represents the ambient atmospheric pressure . the independent atmospheric pressure sensor is โ independent โ because it is not affected by the absolute pressure ( px ) applied to the input of the cdg . it should be understood that the common enclosure may be a system enclosure into which the cdg is installed at a user site or the enclosure may be an enclosure into which the cdg is installed when the cdg is manufactured . in fig6 , the independent atmospheric pressure sensor is shown as being attached to the body of the cdg ; however , the independent atmospheric pressure sensor may be installed elsewhere in the common enclosure as long as the atmospheric pressure sensor is subjected to the same pressure as the cdg . the output of the independent atmospheric pressure sensor 430 may be an analog signal that represents the ambient atmospheric pressure or a digital signal that represents the ambient atmospheric pressure . in the former case , the digital processing system 420 includes an analog interface and performs integral analog - to - digital ( a / d ) conversion to convert the analog signal to a digital value . in the illustrated embodiment shown in fig5 , the independent atmospheric pressure sensor produces a digital value that represents the ambient atmospheric pressure . atmospheric pressure sensors are available from many sources . one such atmospheric sensor is a mpl115a1 miniature spi digital barometer from freescale semiconductor , inc ., that provides the digital value on a serial peripheral interface ( spi ) port , which is described in appendix a , filed herewith . the atmospheric sensor may also be a mpl115a2 miniature i 2 c digital barometer from freescale semiconductor , inc ., that provides the digital value on an inter - integrated circuit ( i 2 c ) port , which is described in appendix b , filed herewith . the contents of appendix a and appendix b are incorporated by reference herein . the spi port and the i 2 c port are both standard serial interface ports , and the sensor is selected , for example , in accordance with the type of port available on the digital processing system . fig5 illustrates an embodiment that includes the mpl115a2 i 2 c digital barometer integrated circuit . for this circuit , the serial interface includes three signal lines 432 comprising a serial clock ( scl ) line , a serial data ( sda ) line and a reset ( rst ) line . power , ground and other interconnection lines to and from the integrated circuit are not shown in fig5 and 6 . the operation of the i 2 c interface is well known . one device ( e . g ., the digital processing system ) operates as a master device to control data transfers between the devices . a second device ( e . g ., the atmospheric sensor ) operates as a slave device and sends data to the master device in response to commands from the master device . other pressure sensors 430 from other sources and with other interface ports may also be used . for example , a pressure sensor that continuously provides an analog or digital value to the second input of the digital processing system may also be used such that the control signals from the digital processing system to the pressure sensor may not be needed . the digital processing system 420 processes the raw digital data from the independent atmospheric pressure sensor 430 to generate an absolute value for the ambient atmospheric pressure surrounding the cdg 100 . in particular , as described in more detail in the technical data sheets for the mpl115a1 and the mpl115a2 available from freescale semiconductor , inc ., and included herewith as appendix a and appendix b , respectively , the digital processing system first accesses the atmospheric pressure sensor to input a plurality of constants that are stored in the atmospheric pressure sensor when the pressure sensor is manufactured and initially calibrated . the constants are unique for each particular sensor . the digital processing system then accesses the atmospheric pressure sensor to access a first set of data that represents the pressure sensed by the atmospheric pressure sensor and to access a second set of data that represents the temperature of the atmospheric pressure sensor . the digital processing system then performs a compensation algorithm ( described below ) specified in the technical data sheets to determine the actual ( compensated ) atmospheric pressure . it should be understood that other pressure sensors from other manufacturers may provide a digital output signal or an analog output signal that represents the actual absolute pressure . when such sensors are used , the digital processing system does not have to perform the compensation algorithm specified for the pressure sensors from freescale semiconductor , inc . the digital processing system 420 is responsive to the digital signal from the atmospheric pressure sensor 430 to generate a pressure correction factor to apply to the digital output from the a / d converter 410 . the pressure correction factor represents the effect of the ambient atmospheric pressure on the absolute pressure readings caused by the absolute input pressure ( px ). in one embodiment of the digital processing system , the effects of the ambient atmospheric pressure are stored in a lookup table 450 as pressure calibration factors . the calibration factors are indexed within the lookup table by the values of the ambient atmospheric pressure . in this embodiment , the digital processing system uses the digital value from the atmospheric pressure sensor to access the lookup table to select the calibration factor corresponding to the atmospheric pressure . the digital processing system applies the calibration factor as a correction to the measured pressure represented by the output of the a / d converter . in another embodiment , the digital processing system applies the digital value from the atmospheric pressure sensor as an input to a calibration equation that calculates the effect of the measured ambient atmospheric pressure on the measured absolute pressure ( px ). the output of the equation is a calibration factor that the digital processing system applies as a correction to the measured absolute pressure to offset the effect of the ambient atmospheric pressure . the corrected absolute pressure is provided to the user as an output from the digital processing circuit . the values for the lookup table for the first embodiment or the coefficients for the calibration equation in the second embodiment are determined during a calibration procedure that is performed on the cdg 100 by applying varying ambient atmospheric pressures to the body 110 of the cdg while maintaining the absolute input pressure ( px ) applied to the input of the cdg ( first cylindrical tube 120 in fig6 ) at a known value . as the ambient atmospheric pressure is varied , the effects of the changes in atmospheric pressure on the measured values of the absolute pressure are monitored . in particular , the difference between the known absolute pressure and the measured absolute pressure are determined for each applied value of atmospheric pressure . in the first embodiment , the differences are stored as entries in the lookup table 450 using the values of the atmospheric pressure as the indices for the stored values . in the second embodiment , the effects on the measured values determined during the calibration process are used to generate a calibration equation . the calibration equation is generated by applying curve - fitting or other known techniques to the data points to produce an equation that defines the pressure differences ( calibration factors ) as a function of the atmospheric pressure values . the operation of the improved pressure monitoring system 400 of fig5 is illustrated by a flowchart 500 in fig7 , which is implemented in the digital processing system 420 of fig5 . the steps of the flow chart may be executed periodically or continuously in accordance with the requirements of the system . as discussed above , the digital processing system may be a microcontroller ( or microprocessor ), in which case , some or all of the steps of the flow chart are implemented as software instructions . the digital processing system may also be an application specific integrated circuit ( asic ), in which case , some or all of the steps are implemented by logic circuits . it should be understood that the steps may also be implemented by a combination of hardware circuits and software instructions . the flow chart 500 in fig7 begins with a step 510 in which the analog output of the ac pressure measuring circuit 250 is converted to a digital input value by the a / d converter 410 . in a step 512 , the digital value from the a / d converter is received by the digital processing system 420 and is stored as a measured cdg pressure value . as discussed above , in certain embodiments where the a / d converter is part of the digital processing system , the digital processing system receives the analog value directly from the ac pressure measuring circuit and converts the analog value to a digital value within the digital processing system . the digital processing system 420 also generates appropriate command signals to the atmospheric pressure sensor 430 via the i 2 c reset ( rst ), clock ( scl ) and data ( sda ) lines 432 to cause the atmospheric pressure sensor to send data to the input 424 of the digital processing system . for the embodiment wherein the atmospheric pressure sensor is implemented by the mpl115a2 miniature i 2 c digital barometer from freescale semiconductor , inc ., or the mpl115a1 spi miniature digital barometer from freescale semiconductor , inc ., the digital processing system accesses the atmospheric pressure sensor at least one time to receive and store the coefficients that are used to convert the raw digital data from the atmospheric pressure sensor to compensated ( actual ) pressure . the first step for accessing the data from the atmospheric pressure sensor is thus shown as a decision step 520 in which the digital processing system determines whether the coefficients have already been stored . if the coefficients are not already stored , the digital processing system performs a step 522 in which it executes commands to cause the atmospheric pressure sensor to transfer the coefficient data and then performs a step 524 in which the digital processing system stores the coefficient data . the digital processing system then proceeds to a step 530 . if the coefficients are already stored , the digital processing system proceeds to the step 530 directly from the decision step 520 . in the step 530 , the digital processing system 420 generates the appropriate command signals on the i 2 c lines 432 to cause the atmospheric pressure sensor 430 to generate data representing the measured ambient temperature and pressure surrounding the cdg 100 . in a step 532 , the digital processing system stores the temperature and pressure data as uncompensated data . in a step 534 , the digital processing system converts the uncompensated temperature and pressure data to compensated pressure data , which is stored as a compensated atmospheric pressure value . for example , the technical data sheet from freescale semiconductor , inc ., for the illustrated atmospheric pressure sensor defines the following compensation equation : p comp = a 0 +( b 1 +( c 12 ร t adc ))ร p adc )+( b 2 ร t adc ) a 0 is a pressure offset coefficient ; b 1 is pressure sensitivity coefficient ; b 2 is a temperature coefficient of offset ; c 12 is a temperature coefficient of sensitivity ; p adc is the pressure value from the pressure sensor ; and t adc is the temperature value from the pressure sensor . other pressure sensors may be used that provide an output that is already compensated for pressure and temperature . when such pressure sensors are used , the step 534 is not required . in a step 540 , the digital processing system 420 generates a pressure differential value ( calibration factor ) that represents the effect of the atmospheric pressure on the pressure measured by the cdg 100 . the pressure differential value may be obtained from a lookup table that is indexed by the compensated atmospheric pressure value stored in the step 534 . for example , during a calibration process , the lookup table may be populated by pressure differential values that are determined by applying a fixed absolute input pressure ( px ) to the input of the cdg and by varying the ambient atmospheric pressure while monitoring the digital values representing the output of the ac pressure measuring circuit 250 . the pressure differential values correspond to the differences between the monitored digital values and the measured digital values at each value of the variable ambient atmospheric pressure . if the pressure differential value differs significantly with changes in temperature , the measured temperature value from the ambient atmospheric pressure sensor may also be provided as a second index to the lookup table so that the pressure differential value is a selected by a combination of the measured ambient atmospheric pressure and the measured temperature . as an alternative to a lookup table , the pressure differential value may also be determined by a calculation wherein the compensated ambient atmospheric pressure value is an input variable to an equation that is generated to represent the relationship between the value of the ambient atmospheric pressure and the pressure differential values . the generation of a parametric equation to represent the relationship between the compensated ambient atmospheric pressure value and the pressure differential values ( calibration factors ). the generation of such equations using curve fitting and other techniques is well known in the art . as with the lookup table embodiment , the equation can be generated with the compensated ambient atmospheric pressure as the only input variable and can also be generated with the measured temperature from the pressure sensor as a second input variable . in a step 542 , the digital processing system 420 applies the pressure differential value from the lookup table or from the calculation to the measured cdg absolute pressure value stored in the step 512 to increase or decrease the measured cdg absolute pressure value to generate a calibrated cdg absolute pressure value . the calibrated cdg absolute pressure value corresponds to the actual absolute pressure ( px ) applied to the cdg 100 via the first cylindrical tube 120 in fig6 . the digital processing system outputs the calibrated actual pressure value to the user ( e . g ., the surrounding system for which the pressure is being measured ) via the output 426 . after calculating and outputting the actual pressure value , the digital processing system 420 returns to the step 510 to again input the analog input signal and to repeat the foregoing steps . the steps may be repeated continuously or the steps may be repeated on a periodic basis by having the digital processing system wait for a predetermined duration before inputting the analog input signal . the waiting is represented by an optional delay step 550 ; however , it should be understood that the digital processing system may be controlled by a timer set at a particular repetition rate ( e . g ., once per second , once per millisecond , or the like ) that awakens the digital processing system or that generates an interrupt to trigger the digital processing system to exit from a wait state . the control of the timing of periodic measurement processes is well known in the art and can be accomplished in many ways . as various changes could be made in the above constructions without departing from the scope of the invention , it is intended that all the matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense .
| 6 |
with reference to fig1 , an embodiment of a laryngoscope handle 100 for a laryngoscope 110 will be described . in the embodiment shown , an illumination device in the form of a fiber optic laryngoscope blade 120 is connected to the laryngoscope handle 100 . the laryngoscope blade 120 ( e . g ., curved macintosh blade , straight miller / robertshaw blade , or other type of blade ) carries fiber optics ( e . g ., fiber optic light tube ) 130 . the fiber optic light tube 130 is optically coupled to a connection section 140 , where the laryngoscope blade 120 connects to the laryngoscope handle 100 . in alternative embodiments , other types of illumination devices other than a laryngoscope blade 120 are used and other illumination sources other than a laryngoscope handle 100 are used . in this embodiment , the laryngoscope handle 100 has a curved , ergonomic laryngoscope handle body with a series of finger grip indents 150 on an inner surface 160 . the laryngoscope handle 100 has a connection section 170 at an upper end 180 of an upper portion 190 with connection mechanism 200 for mechanically and optically coupling the connection section 140 of the laryngoscope blade 120 and the connection section 170 of the laryngoscope handle 100 . the connection mechanism 200 may include a switch therein ( e . g ., an electrically conductive ball contact in connection portion ( s ) 140 and / or 170 that contact each other to close circuit ) that is automatically operated when the connection sections 140 , 170 are connected for actuating an illumination source system 190 discussed below . for example , the illumination source system 190 is automatically placed in communication with one or more power sources 250 when the laryngoscope blade 120 is assembled or clicked together with the upper part of the laryngoscope handle 100 , and are automatically turned off when the laryngoscope blade 120 is released or disassembled from the upper part of the laryngoscope handle 100 for storage when not in use , for example when the laryngoscope blade 120 is unlocked / unlatched from the upper part of the laryngoscope handle 100 . alternatively or additionally , the laryngoscope handle 100 may include a manual switch for turning the illumination source system 190 on , off , and / or otherwise controlling the illumination source system 190 ( e . g ., switching to at least one of an โ off โ condition , an โ on โ condition in which both uv and white light is emitted , a uv light only condition , and a white light only condition ). adjacent to the connection section is an illumination source system 190 . the illumination source system 190 includes one or more white light illumination sources 200 , preferably one or more white light led ( s ). in alternative embodiments , the one or more white light illumination sources 200 include , but are not limited to , a white halogen light and / or a white incandescent light . the illumination source system 190 also includes one or more ultra violet ( uv ) light illumination sources 210 , preferably one or more uv led ( s ). the one or more uv light illumination sources 210 emit long wave uva radiation and little visible light . the one or more uv light illumination sources 210 emit electromagnetic radiation that is in the soft , near ultraviolet range . the one or more uv light illumination sources 210 prompt the visible effects of fluorescence and phosphorescence with respect to the patient &# 39 ; s vocal cords and the glottis , which is the space between the vocal cords , during laryngoscopy . in one embodiment , the one or more uv light illumination sources 210 emit electromagnetic radiation including a wavelength in the range of 315 to 400 nm , without emitting substantial electromagnetic radiation including a wavelength outside of the range of 300 to 450 nm . in another embodiment , the one or more uv light illumination sources 210 emit electromagnetic radiation including a wavelength of 385 - 395 nm . the illumination source system 190 may include a chamber 220 with mirrored wall ( s ) 230 . the chamber 220 may be cone - shaped or have another configuration to enhance the reflection and emission of light from the illumination source system 190 . the illumination sources 200 , 210 may be connected to a printed circuit board ( pcb ) 240 , which is electrically coupled to and powered by one or more power sources 250 ( e . g ., one or more rechargeable batteries , one or more disposable batteries , one or more dry cell batteries such as one or more lithium ion batteries ). an exemplary method of performing a medical procedure , and , in particular , an endotracheal intubation using the laryngoscope handle 100 and laryngoscope blade 120 of the laryngoscope is described below . the illumination source system 190 of the laryngoscope handle 100 is actuated ( e . g ., when the laryngoscope 110 is clicked together / assembled ). this causes the one or more white light illumination sources 200 and the one or more uv light illumination sources 210 in the laryngoscope handle 100 to emit , respectively , white and uv light , which are mixed in the chamber 220 of the handle 100 , resulting in a mixed , combination of white and uv light , which is transmitted to the fiber optic light tube 130 . at a distal end of the fiber optic light tube 130 , the combination of white and uv light is emitted distally from a distal end portion of the laryngoscope blade 120 . the laryngoscope blade 120 is inserted into a patient &# 39 ; s mouth and behind the patient &# 39 ; s tongue and mandible . by gripping the handle 100 with one &# 39 ; s hand , the tongue and mandible are lifted for viewing the vocal cords adjacent the larynx and to aid in the insertion of an endotracheal tube past the vocal cords . the black light of the combination black and uv light emitted from the fiber optic light tube 130 prompts the visible effects of fluorescence and phosphorescence with respect to the patient &# 39 ; s vocal cords and the glottis , making the patient &# 39 ; s vocal cords at the glottis visible either directly by the eyes of the medical provider or via a scope of the endotracheal tube ( or via an electronic display ). the black light causes vocal cords or vocal folds to naturally fluoresce , clearly identifying pathway to the trachea . the white light in combination with uv light provides general illumination ( e . g ., of the interior of the mouth and back of the patient &# 39 ; s throat ). this brightness of the white light is bright enough to provide general illumination ( e . g ., of the interior of the mouth and back of the patient &# 39 ; s throat ) while not being so bright as to overtake the effects of the uv light . the mixed uv and white light combination lighting produces โ near - 3d optimization of viewing area , causing airway structures to stand out via precision - shadowing effect . the uv and white light wavelength mix dramatically improves discrimination of tissues , field of view , reduces glare and creates better depth perception in the airway . the endotracheal tube is inserted into the patient &# 39 ; s mouth , between the patient &# 39 ; s visible vocal cords into the larynx , and then into the trachea of the patient in a usual manner . a stylet of the endotracheal tube may be used to shape the scope / endotracheal tube to the individual anatomy / pathology of the patient . in an embodiment of the laryngoscope handle 100 including a manual switch / controller , the respective light sources 200 , 210 may be individually / selectively actuated or deactivated ( e . g ., to cause only uv light to be emitted , only white light to be emitted , no light to be emitted , and / or a mixed , combined uv and white light to be emitted ) so that optimal viewing of the vocal cords occurs . the medical provider may prefer to use the uv light condition and / or the white light condition , depending on external lighting conditions , the individual anatomy / pathology of the patient , the patient &# 39 ; s condition , and other factors . in an alternative exemplary method , which is described in u . s . patent application u . s . patent application no . 13 / 328 , 499 , which is incorporated by reference herein , the laryngoscope 110 is used to assist in removal of an obstruction or foreign object from a patient &# 39 ; s trachea . the above figures may depict exemplary configurations for the invention , which is done to aid in understanding the features and functionality that can be included in the invention . the invention is not restricted to the illustrated architectures or configurations , but can be implemented using a variety of alternative architectures and configurations . additionally , although the invention is described above in terms of various exemplary embodiments and implementations , it should be understood that the various features and functionality described in one or more of the individual embodiments with which they are described , but instead can be applied , alone or in some combination , to one or more of the other embodiments of the invention , whether or not such embodiments are described and whether or not such features are presented as being a part of a described embodiment . thus the breadth and scope of the present invention , especially in the following claims , should not be limited by any of the above - described exemplary embodiments . terms and phrases used in this document , and variations thereof , unless otherwise expressly stated , should be construed as open ended as opposed to limiting . as examples of the foregoing : the term โ including โ should be read as meaning โ including , without limitation โ or the like ; the term โ example โ is used to provide exemplary instances of the item in discussion , not an exhaustive or limiting list thereof ; and adjectives such as โ conventional ,โ โ traditional ,โ โ standard ,โ โ known โ and terms of similar meaning should not be construed as limiting the item described to a given time period or to an item available as of a given time , but instead should be read to encompass conventional , traditional , normal , or standard technologies that may be available or known now or at any time in the future . likewise , a group of items linked with the conjunction โ and โ should not be read as requiring that each and every one of those items e present in the grouping , but rather should be read as โ and / or โ unless expressly stated otherwise . similarly , a group of items linked with the conjunction โ or โ should not be read as requiring mutual exclusivity among that group , but rather should also be read as โ and / or โ unless expressly stated otherwise . furthermore , although items , elements or components of the disclosure may be described or claimed in the singular , the plural is contemplated to be within the scope thereof unless limitation to the singular is explicitly stated . the presence of broadening words and phrases such as โ one or more ,โ โ at least ,โ โ but not limited to โ or other like phrases in some instances shall not be read to mean that the narrower case is intended or required in instances where such broadening phrases may be absent .
| 0 |
compounds of the invention , including salts thereof , can be prepared using known organic synthesis techniques and can be synthesized according to any of numerous possible synthetic routes . the reactions for preparing compounds of the invention can be carried out in suitable solvents , which can be readily selected by one of skill in the art of organic synthesis . suitable solvents can be substantially non - reactive with the starting materials ( reactants ), the intermediates , or products at the temperatures at which the reactions are carried out , e . g ., temperatures that can range from the solvent &# 39 ; s freezing temperature to the solvent &# 39 ; s boiling temperature . a given reaction can be carried out in one solvent or a mixture of more than one solvent . depending on the particular reaction step , suitable solvents for a particular reaction step can be selected by the skilled artisan . preparation of compounds of the invention can involve the protection and deprotection of various chemical groups . the need for protection and deprotection , and the selection of appropriate protecting groups , can be readily determined by one skilled in the art . the chemistry of protecting groups can be found , for example , in t . w . greene and p . g . m . wuts , protective groups in organic synthesis , 3 rd ed ., wiley & amp ; sons , inc ., new york ( 1999 ), which is incorporated herein by reference in its entirety . reactions can be monitored according to any suitable method known in the art . for example , product formation can be monitored by spectroscopic means , such as nuclear magnetic resonance spectroscopy ( e . g ., 1 h or 13 c ), infrared spectroscopy , spectrophotometry ( e . g ., uv - visible ), mass spectrometry , or by chromatographic methods such as high - performance liquid chromatography ( hplc ) or thin layer chromatography ( tlc ). compounds of formula i and intermediates thereof may be prepared according to the following reaction schemes and accompanying discussion . unless otherwise indicated , r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , r 10 , r 10b , r 11 , r 11a , t 1 , t 2 , t 3 , t 4 , q 1 , and x 1 , and structural formula i in the reaction schemes and discussion that follow are as defined above . in general , the compounds of this invention may be made by processes which include processes analogous to those known in the chemical arts , particularly in light of the description provided herein . certain processes for the manufacture of the compounds of this invention and intermediates thereof are provided as further features of the invention and are illustrated by the following reaction schemes . other processes are described in the experimental section . the schemes and examples provided herein ( including the corresponding description ) are for illustration only , and not intended to limit the scope of the present invention . scheme 1 refers to preparation of compounds of formula 1 - 5 ( i . e ., compounds of formula i wherein l 1 is o ). referring to scheme 1 , compounds of formula 1 - 1 [ where lg 1 is a suitable leaving group such as halo ( e . g ., f , cl or br )] and 1 - 2 [ wherein z 1 can be , e . g ., halogen ( e . g ., br or i ) or trifluoromethanesulfonate ( triflate )] are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 1 - 3 can be prepared by coupling a compound of formula 1 - 1 with a compound of formula 1 - 2 under suitable conditions . the coupling can be accomplished , for example , by heating a mixture of a compound of formula 1 - 1 with a compound of formula 1 - 2 in the presence of a base , such as cs 2 co 3 , in an appropriate solvent , such as dimethyl sulfoxide ( dmso ). alternatively , a metal - catalyzed ( such as using a palladium or copper catalyst ) coupling may be employed to accomplish the aforesaid coupling . in this variant of the coupling , a mixture of a compound of formula 1 - 1 and a compound of formula 1 - 2 can be heated in the presence of a base ( such as cs 2 co 3 ), a metal catalyst [ such as a palladium catalyst , e . g ., pd ( oac ) 2 ], and a ligand [ such as 1 , 1 โฒ- binaphthalene - 2 , 2 โฒ- diylbis ( diphenylphosphane ) ( binap )] in an appropriate solvent , such as 1 , 4 - dioxane . a compound of formula 1 - 3 can subsequently be reacted with a compound of formula q 1 - z 2 [ wherein z 2 can be br ; b ( oh ) 2 ; b ( or ) 2 wherein each r is independently h or c 1 - 6 alkyl , or wherein the two ( or ) groups , together with the b atom to which they are attached , form a 5 - to 10 - membered heterocycloalkyl optionally substituted with one or more c 1 - 6 alkyl ; a trialkyltin moiety ; or the like ] by a metal - catalyzed ( such as using a palladium catalyst ) coupling reaction to obtain a compound of formula i . compounds of formula q 1 - z 2 are commercially available or can be made by methods described herein or by methods analogous to those described in the chemical art . alternatively , a compound of formula 1 - 3 can be converted to a compound of formula 1 - 4 ( wherein z 2 is defined as above ). for example , a compound of formula 1 - 3 ( wherein z 1 is halogen such as br or i ) can be converted to a compound of formula 1 - 4 [ wherein z 2 is b ( oh ) 2 ; b ( or ) 2 wherein each r is independently h or c 1 - 6 alkyl , or wherein the two ( or ) groups , together with the b atom to which they are attached , form a 5 - to 10 - membered heterocycloalkyl or heteroaryl optionally substituted with one or more c 1 - 6 alkyl ] by methods described herein or other methods well known to those skilled in the art . in this example , this reaction can be accomplished , for example , by reacting a compound of formula 1 - 3 ( wherein z 1 is halogen such as br ) with 4 , 4 , 4 โฒ, 4 โฒ, 5 , 5 , 5 โฒ, 5 โฒ- octamethyl - 2 , 2 โฒ- bi - 1 , 3 , 2 - dioxaborolane , a suitable base ( such as potassium acetate ), and a palladium catalyst { such as [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii )} in a suitable solvent such as 1 , 4 - dioxane . in another example , a compound of formula 1 - 3 ( wherein z 1 is halogen such as br ) can be converted to a compound of formula 1 - 4 ( wherein z 2 is a trialkyltin moiety ) by alternate methods described herein or other methods well known to those skilled in the art . in this example , this reaction can be accomplished , for example , by reacting a compound of formula 1 - 3 ( wherein z 1 is halogen such as br ) with a hexaalkyldistannane ( such as hexamethyldistannane ) in the presence of a palladium catalyst [ such as tetrakis ( triphenylphosphine ) palladium ( 0 )] in a suitable solvent such as 1 , 4 - dioxane . a compound of formula 1 - 4 can then be reacted with a compound of formula q 1 - z 1 ( wherein z 1 is defined as above ) by a metal - catalyzed ( such as using a palladium catalyst ) coupling reaction to obtain a compound of formula i . compounds of formula q 1 - z 1 are commercially available or can be made by methods described herein or by methods analogous to those described in the chemical art . the type of reaction employed depends on the selection of z 1 and z 2 . for example , when z 1 is halogen or triflate and the q 1 - z 2 reagent is a boronic acid or boronic ester , a suzuki reaction may be used [ a . suzuki , j . organomet . chem . 1999 , 576 , 147 - 168 ; n . miyaura and a . suzuki , chem . rev . 1995 , 95 , 2457 - 2483 ; a . f . littke et al ., j . am . chem . soc . 2000 , 122 , 4020 - 4028 ]. in some specific embodiments , an aromatic iodide , bromide , or triflate of formula 1 - 3 is combined with an aryl or heteroaryl boronic acid or boronic ester of formula q 1 - z 2 and a suitable base , such as potassium phosphate , in a suitable organic solvent such as tetrahydrofuran ( thf ). a palladium catalyst is added , such as s - phos precatalyst { also known as chloro ( 2 - dicyclohexylphosphino - 2 โฒ, 6 โฒ- dimethoxy - 1 , 1 โฒ- biphenyl )[ 2 -( 2 - aminoethylphenyl )] palladium ( ii )- tert - butyl methyl ether adduct }, and the reaction mixture is heated . alternatively , when z 1 is halogen or triflate and z 2 is trialkyltin , a stille coupling may be employed [ v . farina et al ., organic reactions 1997 , 50 , 1 - 652 ]. more specifically , a compound of formula 1 - 3 ( wherein z 1 is br , i , or triflate ) may be combined with a compound of formula q 1 - z 2 ( wherein the q 1 - z 2 compound is a q 1 - stannane compound ) in the presence of a palladium catalyst , such as dichlorobis ( triphenylphosphine ) palladium ( ii ), in a suitable organic solvent such as toluene , and the reaction may be heated . where z 1 is br , i , or triflate and z 2 is br or i , a negishi coupling may be used [ e . erdik , tetrahedron 1992 , 48 , 9577 - 9648 ]. more specifically , a compound of formula 1 - 3 ( wherein z 1 is br , i , or triflate ) may be transmetallated by treatment with 1 to 1 . 1 equivalents of an alkyllithium reagent followed by a solution of 1 . 2 to 1 . 4 equivalents of zinc chloride in an appropriate solvent such as thf at a temperature ranging from โ 80 ยฐ c . to โ 65 ยฐ c . after warming to a temperature between 10 ยฐ c . and 30 ยฐ c ., the reaction mixture may be treated with a compound of formula q 1 - z 2 ( wherein z 2 is br or i ), and heated at 50 ยฐ c . to 70 ยฐ c . with addition of a catalyst such as tetrakis ( triphenylphosphine ) palladium ( 0 ). the reaction may be carried out for times ranging from 1 to 24 hours to yield the compound of formula 1 - 5 . similar to the chemical transformations described in scheme 1 , compounds of formula i can be prepared starting from compounds of formula 1 โฒ- 3 according to scheme 1 โฒ scheme 2 also refers to preparation of compounds of formula 1 - 5 . referring to scheme 2 , compounds of formula 1 - 5 may be prepared utilizing analogous chemical transformations to those described in scheme 1 , but with a different ordering of steps . compounds of formula 2 - 1 [ wherein pg 1 is a suitable protecting group such as methyl , benzyl , tetrahydropyranyl ( thp ), or tert - butyldimethyl ( tbs )] are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 2 - 1 can be converted to a compound of formula 2 - 2 either directly or after conversion to a compound of formula 2 - 3 using methods analogous to those described in scheme 1 . a compound of formula 2 - 2 may then be deprotected , using appropriate conditions depending on the selection of the pg 1 group , to obtain a compound of formula 2 - 4 , which in turn can be coupled with a compound of formula 1 - 1 in scheme 1 to afford a compound of formula 1 - 5 . the coupling conditions employed may be analogous to those described for the preparation of a compound of formula 1 - 3 in scheme 1 . scheme 3 refers to a preparation of a compound of formula 3 - 5 wherein a 1 is a moiety of formula a 1a or a suitable protecting group pg 2 . ( e . g ., methyl , benzyl , thp , or tbs ). referring to scheme 3 , compounds of formula 3 - 1 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 3 - 2 can be prepared by reacting an arylketone of formula 3 - 1 with an alkyl nitrite ( e . g ., isoamyl nitrite ) in the presence of an acid ( such as hydrochloric acid ). the resulting oxime of formula 3 - 2 can be converted to the diketone of formula 3 - 3 upon treatment with formaldehyde ( or its equivalent such as metaformaldehyde or polyformaldehyde ) in the presence of an acid ( such as an aqueous hydrochloric acid solution ). diketones of formula 3 - 3 can be reacted with glycinamide or a salt thereof ( such as an acetic acid salt ) in the presence of a base such as sodium hydroxide to obtain pyrazinones of formula 3 - 4 . alkylation of the pyrazinone nitrogen to obtain a compound of formula 3 - 5 can be achieved by treatment of a compound of formula 3 - 4 with a base [ such as lithium diisopropylamide ( lda ), lithium bis ( trimethylsilyl ) amide ( lhmds ), and the like ] and a compound of the formula r 11a โ z 3 [ wherein z 3 is an acceptable leaving group such as cl , br , i , methanesulfonate ( mesylate ), and the like and wherein r 11a is for example c 1 - 3 alkyl ( e . g ., methyl )]. suitable reaction solvents typically can be selected from polar aprotic solvents such as n , n - dimethylformamide ( dmf ), 1 , 4 - dioxane , or thf . alternatively , a compound of formula 3 - 5 may be prepared as in scheme 4 wherein l 1 is o , nh , n ( c 1 - 4 alkyl ) and n ( c 3 - 6 cycloalkyl ). referring to scheme 4 , compounds of formula 4 - 1 and 4 - 2 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 4 - 3 can be prepared by coupling a compound of formula 4 - 1 with a compound of formula 4 - 2 . the aforesaid coupling may be accomplished by reacting a compound of formula 4 - 1 with a compound of formula 4 - 2 in the presence of a suitable base ( such as potassium carbonate ), a suitable catalyst [ such as tetrakis ( triphenylphosphine ) palladium ( 0 )], and a suitable solvent ( such as ethanol ). a compound of formula 4 - 3 can be reacted with maleic anhydride and hydrogen peroxide in a solvent ( such as dichloromethane ) to provide a compound of formula 4 - 4 , which may contain a mixture of n - oxide regioisomers . a compound of formula 4 - 5 can be prepared from a compound of formula 4 - 4 by heating with acetic anhydride ; the initial product can be saponified using a base ( such as naoh ) in a suitable polar solvent ( such as water or methanol ). a compound of formula 3 - 5 can be prepared from a compound of formula 4 - 5 by reaction with a suitable base ( such as lda , lhmds and the like ), lithium bromide , and a compound of the formula r 11a โ z 3 ( wherein z 3 is an acceptable leaving group such as cl , br , i , mesylate , and the like ). suitable reaction solvents typically can be selected from polar aprotic solvents ( such as dmf , 1 , 4 - dioxane , or thf ). scheme 5 refers to a preparation of a compound of formula 5 - 5 wherein l 1 is o , nh , n ( c 1 - 4 alkyl ) and n ( c 3 - 6 cycloalkyl ) and a 1 is a moiety of formula a 1a or a pg 2 ( such as a benzyl group ). referring to scheme 5 , compounds of formula 5 - 1 and 5 - 2 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 5 - 3 can be prepared by coupling a compound of formula 5 - 1 with an enol trifluoromethanesulfonate of formula 5 - 2 . the aforesaid coupling may be accomplished by reacting a compound of formula 5 - 1 with a trifluoromethanesulfonate of formula 5 - 2 in the presence of a suitable base ( such as potassium carbonate or sodium carbonate ), a suitable catalyst [ such as palladium ( ii ) acetate ], optionally a suitable ligand ( such as tricyclohexylphosphine ), and optionally a suitable phase - transfer catalyst such as tetrabutylammonium chloride . suitable reaction solvents typically can be selected from polar aprotic solvents such as 1 , 4 - dioxane or thf . a compound of formula 5 - 3 can be reacted with 1 to 5 equivalents of a suitable base [ such as 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu )] under an oxygen atmosphere to obtain a compound of formula 5 - 4 . suitable reaction solvents typically can be selected from polar aprotic solvents such as dmf , 1 , 4 - dioxane , or thf . a compound of formula 5 - 5 can be obtained by reacting a compound of formula 5 - 4 with hydrazine in a suitable solvent such as 1 - butanol . scheme 6 refers to a preparation of a compound of formula 6 - 5 . referring to scheme 6 , a compound of formula 6 - 1 can be prepared as described in scheme 5 , wherein pg 2 is a suitable protecting group ( such as benzyl ). a compound of formula 6 - 1 can be converted to a suitably protected compound of formula 6 - 2 using methods described herein or other methods well known to those skilled in the art , wherein pg 3 is a suitable protecting group ( such as thp ) that can be removed under orthogonal reaction conditions to pg 2 . a compound of formula 6 - 3 can be prepared by selective removal of pg 2 under suitable deprotection conditions depending on the selection of pg 2 . for example , when pg 2 is a benzyl group , it can be removed by treatment with palladium ( 10 % on carbon ) under hydrogenation condition in a suitable solvent , such as methanol and ethyl acetate . using the aforementioned reaction conditions described in scheme 1 , a compound of formula 6 - 3 can be coupled with a reagent of formula 1 - 1 to yield a compound of formula 6 - 4 . a compound of formula 6 - 5 can be obtained by removing pg 3 under suitable deprotection conditions depending on the selection of pg 3 . for example , when pg 3 is thp , it can be removed under acidic conditions , such as hydrogen chloride in a suitable solvent , such as dichloromethane . scheme 7 refers to a preparation of a compound of formula 7 - 5 [ wherein r 10 is , for example , c 1 - 3 alkyl ( e . g ., methyl ); r 10b is , for example , h or c 1 - 3 alkyl ( e . g ., methyl ); and pg 4 is a suitable protecting group [ e . g ., 2 -( trimethylsilyl ) ethoxymethyl ( sem ), tert - butoxycarbonyl ( boc ), or benzyloxymethyl acetal ( bom )]. referring to scheme 7 , compounds of formula 2 - 3 and 7 - 1 are commercially available or can be prepared by methods described herein or other methods well known to those skilled in the art . a compound of formula 7 - 2 can be prepared by coupling a compound of formula 2 - 3 with a compound of formula 7 - 1 , in the presence of a suitable base ( such as potassium carbonate ) and a suitable catalyst { such as [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii )}. a compound of formula 7 - 3 can be prepared by selective removal of pg 2 under suitable de - protection conditions depending on the selection of pg 2 . for example , when pg 2 is a benzyl group , it can be removed by treatment with palladium ( 10 % on carbon ) under hydrogenation condition in a suitable solvent , such as methanol and ethyl acetate . using the aforementioned reaction conditions described in scheme 1 , a compound of formula 7 - 3 can be coupled with a reagent of formula 1 - 1 to yield a compound of formula 7 - 4 . alternatively , a compound of formula 7 - 4 can be prepared from intermediate 1 - 4 , following the coupling conditions described in scheme 1 . a compound of formula 7 - 5 can then be obtained from a compound of formula 7 - 4 by removing pg 4 under suitable deprotection conditions that are known to those skilled in the art . scheme 8 refers to a preparation of a compound of formula 8 - 1 [ wherein r 10 is , for example , c 1 - 3 alkyl ( e . g ., methyl ); r 10b is , for example , h or c 1 - 3 alkyl ( e . g ., methyl )]. referring to scheme 8 , compounds of formula 8 - 1 can be prepared by treating a compound of formula 7 - 5 with a suitable thianation reagent , such as lawesson &# 39 ; s reagent [ 2 , 4 - bis ( 4 - methoxyphenyl )- 1 , 3 , 2 , 4 - dithiadiphosphetane - 2 , 4 - dithione ] or phosphorus pentasulfide , in a suitable solvent such as toluene . scheme 9 refers to preparation of compounds of formula 9 - 5 and 9 - 6 . referring to scheme 9 , compounds of formula 9 - 1 are commercially available or can be made by methods described herein or other methods well known to those skilled in the art . a compound of formula 9 - 1 can be converted to a compound of formula 9 - 2 either directly or after conversion to a compound of formula 9 - 3 using methods analogous to those described in scheme 1 . the nitro group of a compound of formula 9 - 2 can then be converted to an amine via hydrogenation in the presence of a suitable catalyst , such as palladium ( 10 % on carbon ), to yield a compound of formula 9 - 4 . a compound of formula 9 - 4 can then be coupled with a compound of formula 1 - 1 in scheme 1 to afford a compound of formula 9 - 5 . the coupling conditions employed may be analogous to those described for the preparation of a compound of formula 1 - 3 in scheme 1 . a compound of formula 9 - 6 can be prepared via n - alkylation of a compound of formula 9 - 5 using a reagent of y โ z 3 , wherein y is c 1 - 4 alkyl , or c 3 - 6 cycloalkyl , and z 3 is an acceptable leaving group such as cl , br , i , mesylate , and the like . scheme 10 refers to preparation of compounds of formula 10 - 4 . referring to scheme 10 , a compound of formula 10 - 1 can be prepared via triflation of a compound of formula 2 - 4 ( scheme 2 ) using a suitable reagent such as trifluoromethanesulfonic anhydride in the presence of a suitable base such as triethylamine . a compound of formula 10 - 1 can be converted to a compound of formula 10 - 2 by coupling with potassium thioacetate , in the presence of a suitable metal catalyst , such as tris ( dibenzylideneacetone ) dipalladium ( 0 ), and a suitable ligand , such as ( r )-(โ)- 1 -[( sp )- 2 -( dicyclohexylphosphino ) ferrocenyl ] ethyldi - tert - butylphosphine , in a suitable solvent , such as toluene . a compound of formula 10 - 2 can then be hydrolyzed to obtain a compound of formula 10 - 3 , which in turn can be coupled with a compound of formula 1 - 1 in scheme 1 to afford a compound of formula 10 - 4 . the coupling conditions employed may be analogous to those described for the preparation of a compound of formula 1 - 3 in scheme 1 . a compound of formula 10 - 4 may then be deprotected , using appropriate conditions depending on the selection of the pg 1 group , to obtain a compound of formula i . additional starting materials and intermediates useful for making the compounds of the present invention can be obtained from chemical vendors such as sigma - aldrich or can be made according to methods described in the chemical art . those skilled in the art can recognize that in all of the schemes described herein , if there are functional ( reactive ) groups present on a part of the compound structure such as a substituent group , for example r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , r 10 , r 10b , r 11 , r 11a , t 1 , t 2 , t 3 , t 4 , q 1 , and x 1 etc ., further modification can be made if appropriate and / or desired , using methods well known to those skilled in the art . for example , a โ cn group can be hydrolyzed to afford an amide group ; a carboxylic acid can be converted to an amide ; a carboxylic acid can be converted to an ester , which in turn can be reduced to an alcohol , which in turn can be further modified . for another example , an oh group can be converted into a better leaving group such as a methanesulfonate , which in turn is suitable for nucleophilic substitution , such as by a cyanide ion ( cn โ ). for another example , an โ s โ can be oxidized to โ s (โ o )โ and / or โ s (โ o ) 2 โ. for yet another example , an unsaturated bond such as c โ c or c โก c can be reduced to a saturated bond by hydrogenation . in some embodiments , a primary amine or a secondary amine moiety ( present on a substituent group such as r 3 , r 4 , r 9 , r 10 , etc .) can be converted to an amide , sulfonamide , urea , or thiourea moiety by reacting it with an appropriate reagent such as an acid chloride , a sulfonyl chloride , an isocyanate , or a thioisocyanate compound . one skilled in the art will recognize further such modifications . thus , a compound of formula i having a substituent that contains a functional group can be converted to another compound of formula i having a different substituent group . similarly , those skilled in the art can also recognize that in all of the schemes described herein , if there are functional ( reactive ) groups present on a substituent group such as r 3 , r 4 , r 9 , r 10 , etc ., these functional groups can be protected / deprotected in the course of the synthetic scheme described here , if appropriate and / or desired . for example , an oh group can be protected by a benzyl , methyl , or acetyl group , which can be deprotected and converted back to the oh group in a later stage of the synthetic process . for another example , an nh 2 group can be protected by a benzyloxycarbonyl ( cbz ) or boc group ; conversion back to the nh 2 group can be carried out at a later stage of the synthetic process via deprotection . as used herein , the term โ reacting โ ( or โ reaction โ or โ reacted โ) refers to the bringing together of designated chemical reactants such that a chemical transformation takes place generating a compound different from any initially introduced into the system . reactions can take place in the presence or absence of solvent . compounds of formula i may exist as stereoisomers , such as atropisomers , racemates , enantiomers , or diastereomers . conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate using , for example , chiral high pressure liquid chromatography ( hplc ). alternatively , the racemate ( or a racemic precursor ) may be reacted with a suitable optically active compound , for example , an alcohol , or , in the case where the compound contains an acidic or basic moiety , an acid or base such as tartaric acid or 1 - phenylethylamine . the resulting diastereomeric mixture may be separated by chromatography and / or fractional crystallization and one or both of the diastereoisomers converted to the corresponding pure enantiomer ( s ) by means well known to one skilled in the art . chiral compounds of formula i ( and chiral precursors thereof ) may be obtained in enantiomerically enriched form using chromatography , typically hplc , on an asymmetric resin with a mobile phase consisting of a hydrocarbon , typically heptane or hexane , containing from 0 % to 50 % 2 - propanol , typically from 2 % to 20 %, and from 0 % to 5 % of an alkylamine , typically 0 . 1 % diethylamine . concentration of the eluate affords the enriched mixture . stereoisomeric conglomerates may be separated by conventional techniques known to those skilled in the art . see , e . g ., stereochemistry of organic compounds by e . l . eliel and s . h . wilen ( wiley , new york , 1994 ), the disclosure of which is incorporated herein by reference in its entirety . suitable stereoselective techniques are well - known to those of ordinary skill in the art . where a compound of formula i contains an alkenyl or alkenylene ( alkylidene ) group , geometric cis / trans ( or z / e ) isomers are possible . cis / trans isomers may be separated by conventional techniques well known to those skilled in the art , for example , chromatography and fractional crystallization . salts of the present invention can be prepared according to methods known to those of skill in the art . the compounds of formula i that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids . although such salts must be pharmaceutically acceptable for administration to animals , it is often desirable in practice to initially isolate the compound of the present invention from the reaction mixture as a pharmaceutically unacceptable salt and then simply convert the latter back to the free base compound by treatment with an alkaline reagent and subsequently convert the latter free base to a pharmaceutically acceptable acid addition salt . the acid addition salts of the basic compounds of this invention can be prepared by treating the basic compound with a substantially equivalent amount of the selected mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent , such as methanol or ethanol . upon evaporation of the solvent , the desired solid salt is obtained . the desired acid salt can also be precipitated from a solution of the free base in an organic solvent by adding an appropriate mineral or organic acid to the solution . if the inventive compound is a base , the desired pharmaceutically acceptable salt may be prepared by any suitable method available in the art , for example , treatment of the free base with an inorganic acid , such as hydrochloric acid , hydrobromic acid , sulfuric acid , nitric acid , phosphoric acid and the like , or with an organic acid , such as acetic acid , maleic acid , succinic acid , mandelic acid , fumaric acid , malonic acid , pyruvic acid , oxalic acid , glycolic acid , salicylic acid , isonicotinic acid , lactic acid , pantothenic acid , bitartric acid , ascorbic acid , 2 , 5 - dihydroxybenzoic acid , gluconic acid , saccharic acid , formic acid , methanesulfonic acid , ethanesulfonic acid , benzenesulfonic acid , p - toluenesulfonic acid , and pamoic [ i . e ., 4 , 4 โฒ- methanediylbis ( 3 - hydroxynaphthalene - 2 - carboxylic acid )] acid , a pyranosidyl acid , such as glucuronic acid or galacturonic acid , an alpha - hydroxy acid , such as citric acid or tartaric acid , an amino acid , such as aspartic acid or glutamic acid , an aromatic acid , such as benzoic acid or cinnamic acid , a sulfonic acid , such as ethanesulfonic acid , or the like . those compounds of formula i that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations . examples of such salts include the alkali metal or alkaline earth metal salts , and particularly the sodium and potassium salts . these salts are all prepared by conventional techniques . the chemical bases which are used as reagents to prepare the pharmaceutically acceptable base salts of this invention are those which form non - toxic base salts with the acidic compounds of formula i . these salts may be prepared by any suitable method , for example , treatment of the free acid with an inorganic or organic base , such as an amine ( primary , secondary or tertiary ), an alkali metal hydroxide or alkaline earth metal hydroxide , or the like . these salts can also be prepared by treating the corresponding acidic compounds with an aqueous solution containing the desired pharmacologically acceptable cations , and then evaporating the resulting solution to dryness , for example under reduced pressure . alternatively , they may also be prepared by mixing lower alkanolic solutions of the acidic compounds and the desired alkali metal alkoxide together , and then evaporating the resulting solution to dryness in the same manner as before . in either case , stoichiometric quantities of reagents are , for example , employed in order to ensure completeness of reaction and maximum yields of the desired final product . pharmaceutically acceptable salts of compounds of formula i ( including compounds of formula ia or ib ) may be prepared by one or more of three methods : ( i ) by reacting the compound of formula i with the desired acid or base ; ( ii ) by removing an acid - or base - labile protecting group from a suitable precursor of the compound of formula i or by ring - opening a suitable cyclic precursor , for example , a lactone or lactam , using the desired acid or base ; or ( iii ) by converting one salt of the compound of formula i to another by reaction with an appropriate acid or base or by means of a suitable ion exchange column . all three reactions are typically carried out in solution . the resulting salt may precipitate out and be collected by filtration or may be recovered by evaporation of the solvent . the degree of ionization in the resulting salt may vary from completely ionized to almost non - ionized . polymorphs can be prepared according to techniques well - known to those skilled in the art , for example , by crystallization . when any racemate crystallizes , crystals of two different types are possible . the first type is the racemic compound ( true racemate ) referred to above wherein one homogeneous form of crystal is produced containing both enantiomers in equimolar amounts . the second type is the racemic mixture or conglomerate wherein two forms of crystal are produced in equimolar amounts each comprising a single enantiomer . while both of the crystal forms present in a racemic mixture may have almost identical physical properties , they may have different physical properties compared to the true racemate . racemic mixtures may be separated by conventional techniques known to those skilled in the art โ see , for example , stereochemistry of organic compounds by e . l . eliel and s . h . wilen ( wiley , new york , 1994 ). the invention also includes isotopically labeled compounds of formula i wherein one or more atoms is replaced by an atom having the same atomic number , but an atomic mass or mass number different from the atomic mass or mass number usually found in nature . isotopically labeled compounds of formula i ( or pharmaceutically acceptable salts thereof or n - oxides thereof ) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein , using an appropriate isotopically labeled reagent in place of the non - labeled reagent otherwise employed . prodrugs in accordance with the invention can , for example , be produced by replacing appropriate functionalities present in the compounds of formula i with certain moieties known to those skilled in the art as โ pro - moieties โ as described , for example , in design of prodrugs by h . bundgaard ( elsevier , 1985 ). the compounds of formula i should be assessed for their biopharmaceutical properties , such as solubility and solution stability ( across ph ), permeability , etc ., in order to select the most appropriate dosage form and route of administration for treatment of the proposed indication . compounds of the invention intended for pharmaceutical use may be administered as crystalline or amorphous products . they may be obtained , for example , as solid plugs , powders , or films by methods such as precipitation , crystallization , freeze drying , spray drying , or evaporative drying . microwave or radio frequency drying may be used for this purpose . they may be administered alone or in combination with one or more other compounds of the invention or in combination with one or more other drugs ( or as any combination thereof ). generally , they will be administered as a formulation in association with one or more pharmaceutically acceptable excipients . the term โ excipient โ is used herein to describe any ingredient other than the compound ( s ) of the invention . the choice of excipient will to a large extent depend on factors such as the particular mode of administration , the effect of the excipient on solubility and stability , and the nature of the dosage form . pharmaceutical compositions suitable for the delivery of compounds of the present invention ( or pharmaceutically acceptable salts thereof ) and methods for their preparation will be readily apparent to those skilled in the art . such compositions and methods for their preparation may be found , for example , in remington &# 39 ; s pharmaceutical sciences , 19th edition ( mack publishing company , 1995 ). the compounds of the invention ( including pharmaceutically acceptable salts thereof and n - oxides thereof ) may be administered orally . oral administration may involve swallowing , so that the compound enters the gastrointestinal tract , and / or buccal , lingual , or sublingual administration by which the compound enters the blood stream directly from the mouth . formulations suitable for oral administration include solid , semi - solid and liquid systems such as tablets ; soft or hard capsules containing multi - or nano - particulates , liquids , or powders ; lozenges ( including liquid - filled ); chews ; gels ; fast dispersing dosage forms ; films ; ovules ; sprays ; and buccal / mucoadhesive patches . liquid formulations include suspensions , solutions , syrups and elixirs . such formulations may be employed as fillers in soft or hard capsules ( made , for example , from gelatin or hydroxypropyl methyl cellulose ) and typically comprise a carrier , for example , water , ethanol , polyethylene glycol , propylene glycol , methyl cellulose , or a suitable oil , and one or more emulsifying agents and / or suspending agents . liquid formulations may also be prepared by the reconstitution of a solid , for example , from a sachet . the compounds of the invention may also be used in fast - dissolving , fast - disintegrating dosage forms such as those described by liang and chen , expert opinion in therapeutic patents 2001 , 11 , 981 - 986 . for tablet dosage forms , depending on dose , the drug may make up from 1 weight % to 80 weight % of the dosage form , more typically from 5 weight % to 60 weight % of the dosage form . in addition to the drug , tablets generally contain a disintegrant . examples of disintegrants include sodium starch glycolate , sodium carboxymethyl cellulose , calcium carboxymethyl cellulose , croscarmellose sodium , crospovidone , polyvinylpyrrolidone , methyl cellulose , microcrystalline cellulose , lower alkyl - substituted hydroxypropyl cellulose , starch , pregelatinized starch and sodium alginate . generally , the disintegrant will comprise from 1 weight % to 25 weight %, for example , from 5 weight % to 20 weight % of the dosage form . binders are generally used to impart cohesive qualities to a tablet formulation . suitable binders include microcrystalline cellulose , gelatin , sugars , polyethylene glycol , natural and synthetic gums , polyvinylpyrrolidone , pregelatinized starch , hydroxypropyl cellulose and hydroxypropyl methylcellulose . tablets may also contain diluents , such as lactose ( monohydrate , spray - dried monohydrate , anhydrous and the like ), mannitol , xylitol , dextrose , sucrose , sorbitol , microcrystalline cellulose , starch and dibasic calcium phosphate dihydrate . tablets may also optionally comprise surface active agents , such as sodium lauryl sulfate and polysorbate 80 , and glidants such as silicon dioxide and talc . when present , surface active agents may comprise from 0 . 2 weight % to 5 weight % of the tablet , and glidants may comprise from 0 . 2 weight % to 1 weight % of the tablet . tablets also generally contain lubricants such as magnesium stearate , calcium stearate , zinc stearate , sodium stearyl fumarate , and mixtures of magnesium stearate with sodium lauryl sulfate . lubricants generally comprise from 0 . 25 weight % to 10 weight %, for example , from 0 . 5 weight % to 3 weight % of the tablet . other possible ingredients include anti - oxidants , colorants , flavoring agents , preservatives and taste - masking agents . exemplary tablets contain up to about 80 % drug , from about 10 weight % to about 90 weight % binder , from about 0 weight % to about 85 weight % diluent , from about 2 weight % to about 10 weight % disintegrant , and from about 0 . 25 weight % to about 10 weight % lubricant . tablet blends may be compressed directly or by roller to form tablets . tablet blends or portions of blends may alternatively be wet -, dry -, or melt - granulated , melt - congealed , or extruded before tabletting . the final formulation may comprise one or more layers and may be coated or uncoated ; it may even be encapsulated . the formulation of tablets is discussed in pharmaceutical dosage forms : tablets , vol . 1 , by h . lieberman and l . lachman ( marcel dekker , new york , 1980 ). consumable oral films for human or veterinary use are typically pliable water - soluble or water - swellable thin film dosage forms which may be rapidly dissolving or mucoadhesive and typically comprise a compound of formula i , a film - forming polymer , a binder , a solvent , a humectant , a plasticizer , a stabilizer or emulsifier , a viscosity - modifying agent and a solvent . some components of the formulation may perform more than one function . the compound of formula i ( or pharmaceutically acceptable salts thereof or n - oxides thereof ) may be water - soluble or insoluble . a water - soluble compound typically comprises from 1 weight % to 80 weight %, more typically from 20 weight % to 50 weight %, of the solutes . less soluble compounds may comprise a smaller proportion of the composition , typically up to 30 weight % of the solutes . alternatively , the compound of formula i may be in the form of multiparticulate beads . the film - forming polymer may be selected from natural polysaccharides , proteins , or synthetic hydrocolloids and is typically present in the range 0 . 01 to 99 weight %, more typically in the range 30 to 80 weight %. other possible ingredients include anti - oxidants , colorants , flavorings and flavor enhancers , preservatives , salivary stimulating agents , cooling agents , co - solvents ( including oils ), emollients , bulking agents , anti - foaming agents , surfactants and taste - masking agents . films in accordance with the invention are typically prepared by evaporative drying of thin aqueous films coated onto a peelable backing support or paper . this may be done in a drying oven or tunnel , typically a combined coater dryer , or by freeze - drying or vacuuming . solid formulations for oral administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . suitable modified release formulations for the purposes of the invention are described in u . s . pat . no . 6 , 106 , 864 . details of other suitable release technologies such as high energy dispersions and osmotic and coated particles are to be found in verma et al ., pharmaceutical technology on - line , 25 ( 2 ), 1 - 14 ( 2001 ). the use of chewing gum to achieve controlled release is described in wo 00 / 35298 . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may also be administered directly into the blood stream , into muscle , or into an internal organ . suitable means for parenteral administration include intravenous , intraarterial , intraperitoneal , intrathecal , intraventricular , intraurethral , intrasternal , intracranial , intramuscular , intrasynovial and subcutaneous . suitable devices for parenteral administration include needle ( including microneedle ) injectors , needle - free injectors and infusion techniques . parenteral formulations are typically aqueous solutions which may contain excipients such as salts , carbohydrates and buffering agents ( for example to a ph of from 3 to 9 ), but , for some applications , they may be more suitably formulated as a sterile non - aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile , pyrogen - free water . the preparation of parenteral formulations under sterile conditions , for example , by lyophilization , may readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art . the solubility of compounds of formula i ( including pharmaceutically acceptable salts thereof ) used in the preparation of parenteral solutions may be increased by the use of appropriate formulation techniques , such as the incorporation of solubility - enhancing agents . formulations for parenteral administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . thus compounds of the invention may be formulated as a suspension or as a solid , semi - solid , or thixotropic liquid for administration as an implanted depot providing modified release of the active compound . examples of such formulations include drug - coated stents and semi - solids and suspensions comprising drug - loaded poly ( dl - lactic - coglycolic acid ) ( plga ) microspheres . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may also be administered topically , ( intra ) dermally , or transdermally to the skin or mucosa . typical formulations for this purpose include gels , hydrogels , lotions , solutions , creams , ointments , dusting powders , dressings , foams , films , skin patches , wafers , implants , sponges , fibers , bandages and microemulsions . liposomes may also be used . typical carriers include alcohol , water , mineral oil , liquid petrolatum , white petrolatum , glycerin , polyethylene glycol and propylene glycol . penetration enhancers may be incorporated . see e . g ., finnin and morgan , j . pharm . sci . 1999 , 88 , 955 - 958 . other means of topical administration include delivery by electroporation , iontophoresis , phonophoresis , sonophoresis and microneedle or needle - free ( e . g ., powderject โข, bioject โข, etc .) injection . formulations for topical administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) can also be administered intranasally or by inhalation , typically in the form of a dry powder ( either alone ; as a mixture , for example , in a dry blend with lactose ; or as a mixed component particle , for example , mixed with phospholipids , such as phosphatidylcholine ) from a dry powder inhaler , as an aerosol spray from a pressurized container , pump , spray , atomizer ( for example an atomizer using electrohydrodynamics to produce a fine mist ), or nebulizer , with or without the use of a suitable propellant , such as 1 , 1 , 1 , 2 - tetrafluoroethane or 1 , 1 , 1 , 2 , 3 , 3 , 3 - heptafluoropropane , or as nasal drops . for intranasal use , the powder may comprise a bioadhesive agent , for example , chitosan or cyclodextrin . the pressurized container , pump , spray , atomizer , or nebulizer contains a solution or suspension of the compound ( s ) of the invention comprising , for example , ethanol , aqueous ethanol , or a suitable alternative agent for dispersing , solubilizing , or extending release of the active , a propellant ( s ) as solvent and an optional surfactant , such as sorbitan trioleate , oleic acid , or an oligolactic acid . prior to use in a dry powder or suspension formulation , the drug product is micronized to a size suitable for delivery by inhalation ( typically less than 5 microns ). this may be achieved by any appropriate comminuting method , such as spiral jet milling , fluid bed jet milling , supercritical fluid processing to form nanoparticles , high pressure homogenization , or spray drying . capsules ( made , for example , from gelatin or hydroxypropyl methyl cellulose ), blisters and cartridges for use in an inhaler or insufflator may be formulated to contain a powder mix of the compound of the invention , a suitable powder base such as lactose or starch and a performance modifier such as l - leucine , mannitol , or magnesium stearate . the lactose may be anhydrous or in the form of the monohydrate . other suitable excipients include dextran , glucose , maltose , sorbitol , xylitol , fructose , sucrose and trehalose . a suitable solution formulation for use in an atomizer using electrohydrodynamics to produce a fine mist may contain from 1 ฮผg to 20 mg of the compound of the invention per actuation and the actuation volume may vary from 1 ฮผl to 100 ฮผl . a typical formulation may comprise a compound of formula i or a pharmaceutically acceptable salt thereof , propylene glycol , sterile water , ethanol and sodium chloride . alternative solvents which may be used instead of propylene glycol include glycerol and polyethylene glycol . suitable flavors , such as menthol and levomenthol , or sweeteners , such as saccharin or saccharin sodium , may be added to those formulations of the invention intended for inhaled / intranasal administration . formulations for inhaled / intranasal administration may be formulated to be immediate and / or modified release using , for example , pgla . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . in the case of dry powder inhalers and aerosols , the dosage unit is determined by means of a valve which delivers a metered amount . units in accordance with the invention are typically arranged to administer a metered dose or โ puff โ containing from 0 . 01 to 100 mg of the compound of formula i . the overall daily dose will typically be in the range 1 ฮผg to 200 mg , which may be administered in a single dose or , more usually , as divided doses throughout the day . the compounds of the invention may be administered rectally or vaginally , for example , in the form of a suppository , pessary , or enema . cocoa butter is a traditional suppository base , but various alternatives may be used as appropriate . formulations for rectal / vaginal administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted and programmed release . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may also be administered directly to the eye or ear , typically in the form of drops of a micronized suspension or solution in isotonic , ph - adjusted , sterile saline . other formulations suitable for ocular and aural administration include ointments , gels , biodegradable ( e . g ., absorbable gel sponges , collagen ) and non - biodegradable ( e . g ., silicone ) implants , wafers , lenses and particulate or vesicular systems , such as niosomes or liposomes . a polymer such as crossed - linked polyacrylic acid , polyvinylalcohol , hyaluronic acid , a cellulosic polymer , for example , hydroxypropyl methyl cellulose , hydroxyethyl cellulose , or methyl cellulose , or a heteropolysaccharide polymer , for example , gelan gum , may be incorporated together with a preservative , such as benzalkonium chloride . such formulations may also be delivered by iontophoresis . formulations for ocular / aural administration may be formulated to be immediate and / or modified release . modified release formulations include delayed -, sustained -, pulsed -, controlled -, targeted , or programmed release . the compounds of the invention ( including pharmaceutically acceptable salts thereof ) may be combined with soluble macromolecular entities , such as cyclodextrin and suitable derivatives thereof or polyethylene glycol - containing polymers , in order to improve their solubility , dissolution rate , taste - masking , bioavailability and / or stability for use in any of the aforementioned modes of administration . drug - cyclodextrin complexes , for example , are found to be generally useful for most dosage forms and administration routes . both inclusion and non - inclusion complexes may be used . as an alternative to direct complexation with the drug , the cyclodextrin may be used as an auxiliary additive , i . e ., as a carrier , diluent , or solubilizer . most commonly used for these purposes are alpha -, beta - and gamma - cyclodextrins , examples of which may be found in international patent applications nos . wo 91 / 11172 , wo 94 / 02518 and wo 98 / 55148 . since the present invention has an aspect that relates to the treatment of the disease / conditions described herein with a combination of active ingredients which may be administered separately , the invention also relates to combining separate pharmaceutical compositions in kit form . the kit comprises two separate pharmaceutical compositions : a compound of formula i a prodrug thereof or a salt of such compound or prodrug and a second compound as described above . the kit comprises means for containing the separate compositions such as a container , a divided bottle or a divided foil packet . typically the kit comprises directions for the administration of the separate components . the kit form is particularly advantageous when the separate components are for example administered in different dosage forms ( e . g ., oral and parenteral ), are administered at different dosage intervals , or when titration of the individual components of the combination is desired by the prescribing physician . an example of such a kit is a so - called blister pack . blister packs are well known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms ( tablets , capsules , and the like ). blister packs generally consist of a sheet of relatively stiff material covered with a foil of a transparent plastic material . during the packaging process recesses are formed in the plastic foil . the recesses have the size and shape of the tablets or capsules to be packed . next , the tablets or capsules are placed in the recesses and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed . as a result , the tablets or capsules are sealed in the recesses between the plastic foil and the sheet . in some embodiments , the strength of the sheet is such that the tablets or capsules can be removed from the blister pack by manually applying pressure on the recesses whereby an opening is formed in the sheet at the place of the recess . the tablet or capsule can then be removed via said opening . it may be desirable to provide a memory aid on the kit , e . g ., in the form of numbers next to the tablets or capsules whereby the numbers correspond with the days of the regimen which the tablets or capsules so specified should be ingested . another example of such a memory aid is a calendar printed on the card , e . g ., as follows โ first week , monday , tuesday , etc . . . . second week , monday , tuesday , . . . โ etc . other variations of memory aids will be readily apparent . a โ daily dose โ can be a single tablet or capsule or several pills or capsules to be taken on a given day . also , a daily dose of formula i compound can consist of one tablet or capsule while a daily dose of the second compound can consist of several tablets or capsules and vice versa . the memory aid should reflect this . in another specific embodiment of the invention , a dispenser designed to dispense the daily doses one at a time in the order of their intended use is provided . for example , the dispenser is equipped with a memory aid , so as to further facilitate compliance with the regimen . an example of such a memory aid is a mechanical counter which indicates the number of daily doses that has been dispensed . another example of such a memory aid is a battery - powered micro - chip memory coupled with a liquid crystal readout , or audible reminder signal which , for example , reads out the date that the last daily dose has been taken and / or reminds one when the next dose is to be taken . the invention will be described in greater detail by way of specific examples . the following examples are offered for illustrative purposes , and are not intended to limit the invention in any manner . those of skill in the art will readily recognize a variety of non - critical parameters that can be changed or modified to yield essentially the same results . additional compounds within the scope of this invention may be prepared using the methods illustrated in these examples , either alone or in combination with techniques generally known in the art . in the following examples and preparations , โ dmso โ means dimethyl sulfoxide , โ n โ where referring to concentration means normal , โ m โ means molar , โ ml โ means milliliter , โ mmol โ means millimoles , โ ฮผmol โ means micromoles , โ eq .โ means equivalent , โยฐ c .โ means degrees celsius , โ mhz โ means megahertz , โ hplc โ means high - performance liquid chromatography . experiments were generally carried out under inert atmosphere ( nitrogen or argon ), particularly in cases where oxygen - or moisture - sensitive reagents or intermediates were employed . commercial solvents and reagents were generally used without further purification . anhydrous solvents were employed where appropriate , generally acroseal ยฎ products from acros organics or drisolv ยฎ products from emd chemicals . in other cases , commercial solvents were passed through columns packed with 4 รฅ molecular sieves , until the following qc standards for water were attained : a ) & lt ; 100 ppm for dichloromethane , toluene , n , n - dimethylformamide and tetrahydrofuran ; b ) & lt ; 180 ppm for methanol , ethanol , 1 , 4 - dioxane and diisopropylamine . for very sensitive reactions , solvents were further treated with metallic sodium , calcium hydride or molecular sieves , and distilled just prior to use . products were generally dried under vacuum before being carried on to further reactions or submitted for biological testing . mass spectrometry data is reported from either liquid chromatography - mass spectrometry ( lcms ), atmospheric pressure chemical ionization ( apci ) or gas chromatography - mass spectrometry ( gcms ) instrumentation . chemical shifts for nuclear magnetic resonance ( nmr ) data are expressed in parts per million ( ppm , ฮด ) referenced to residual peaks from the deuterated solvents employed . in some examples , chiral separations were carried out to separate atropisomers ( or atropenantiomers ) of certain compounds of the invention . in some examples , the optical rotation of an atropisomer was measured using a polarimeter . according to its observed rotation data ( or its specific rotation data ), an atropisomer ( or atropenantiomer ) with a clockwise rotation was designated as the (+)- atropisomer [ or the (+) atropenantiomer ] and an atropisomer ( or atropenantiomer ) with a counter - clockwise rotation was designated as the (โ)- atropisomer [ or the (โ) atropenantiomer ]. reactions proceeding through detectable intermediates were generally followed by lcms , and allowed to proceed to full conversion prior to addition of subsequent reagents . for syntheses referencing procedures in other examples or methods , reaction conditions ( reaction time and temperature ) may vary . in general , reactions were followed by thin - layer chromatography or mass spectrometry , and subjected to work - up when appropriate . purifications may vary between experiments : in general , solvents and the solvent ratios used for eluents / gradients were chosen to provide appropriate r f s or retention times . a solution of sodium methoxide in methanol ( 4 . 4 m , 27 ml , 119 mmol ) was added to a solution of ethyl 2 - cyanopropanoate ( 95 %, 13 . 2 ml , 99 . 6 mmol ) and 1 - methylurea ( 98 %, 8 . 26 g , 109 mmol ) in methanol ( 75 ml ), and the reaction mixture was heated at reflux for 18 hours , then cooled to room temperature . after removal of solvent in vacuo , the residue was repeatedly evaporated under reduced pressure with acetonitrile ( 3 ร 50 ml ), then partitioned between acetonitrile ( 100 ml ) and water ( 100 ml ). aqueous 6 m hydrochloric acid was slowly added until the ph had reached approximately 2 ; the resulting mixture was stirred for 1 hour . the precipitate was collected via filtration and washed with tert - butyl methyl ether , affording the product as a white solid . yield : 15 . 2 g , 79 . 3 mmol , 80 %. lcms m / z 156 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 10 . 38 ( br s , 1h ), 6 . 39 ( s , 2h ), 3 . 22 ( s , 3h ), 1 . 67 ( s , 3h ). a 1 : 1 mixture of acetonitrile and water ( 120 ml ) was added to a mixture of c1 ( 9 . 50 g , 49 . 6 mmol ), sodium nitrite ( 5 . 24 g , 76 mmol ), and copper ( ii ) bromide ( 22 . 4 g , 100 mmol ) { caution : bubbling and slight exotherm }, and the reaction mixture was allowed to stir at room temperature for 66 hours . addition of aqueous sulfuric acid ( 1 n , 200 ml ) and ethyl acetate ( 100 ml ) provided a precipitate , which was collected via filtration and washed with water and ethyl acetate to afford the product as a light yellow solid ( 7 . 70 g ). the organic layer of the filtrate was concentrated to a smaller volume , during which additional precipitate formed ; this was isolated via filtration and washed with 1 : 1 ethyl acetate / heptane to provide additional product ( 0 . 4 g ). total yield : 8 . 1 g , 37 mmol , 75 %. gcms m / z 218 , 220 [ m + ]. 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 11 . 58 ( br s , 1h ), 3 . 45 ( s , 3h ), 1 . 93 ( s , 3h ). to a mixture of c2 ( 21 . 9 g , 99 . 8 mmol ) and 2 -( trimethylsilyl ) ethoxymethyl chloride ( 20 g , 120 mmol ) in acetonitrile ( 400 ml ) was added 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 18 . 3 g , 120 mmol ), and the reaction mixture was stirred at 60 ยฐ c . for 18 hours . additional 2 -( trimethylsilyl ) ethoxymethyl chloride ( 5 g , 30 mmol ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 4 . 6 g , 30 mmol ) were added , and stirring was continued at 60 ยฐ c . for 18 hours . after the mixture had been concentrated in vacuo , the residue was diluted with water ( 500 ml ) and extracted with ethyl acetate ( 3 ร 300 ml ). the combined organic layers were concentrated ; purification using chromatography on silica gel ( gradient : 20 % to 50 % ethyl acetate in petroleum ether ) afforded the product as a colorless oil . yield : 22 . 5 g , 64 . 4 mmol , 64 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 5 . 41 ( s , 2h ), 3 . 61 - 3 . 72 ( m , 5h ), 2 . 13 ( s , 3h ), 0 . 93 - 1 . 02 ( m , 2h ), 0 . 00 ( s , 9h ). to a mixture of c3 ( 10 g , 29 mmol ), [ 4 -( benzyloxy )- 2 - methylphenyl ] boronic acid ( 10 . 4 g , 43 . 0 mmol ) and cesium carbonate ( 28 g , 86 mmol ) in 1 , 4 - dioxane ( 400 ml ) was added [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ) ( 2 . 2 g , 3 . 0 mmol ). the reaction mixture was heated at reflux for 4 hours , then filtered . the filtrate was concentrated , and the residue was purified by silica gel chromatography ( gradient : 10 % to 20 % ethyl acetate in petroleum ether ) to provide the product as a light yellow solid . yield : 10 g , 21 mmol , 72 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 34 - 7 . 49 ( m , 5h ), 7 . 00 ( d , half of ab quartet , j = 8 . 3 hz , 1h ), 6 . 91 - 6 . 97 ( m , 2h ), 5 . 50 ( ab quartet , j ab = 9 . 2 hz , ฮดv ab = 4 . 1 hz , 2h ), 5 . 10 ( s , 2h ), 3 . 73 - 3 . 79 ( m , 2h ), 3 . 03 ( s , 3h ), 2 . 15 ( s , 3h ), 1 . 65 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). a mixture of c4 ( 10 g , 21 mmol ) and palladium hydroxide ( 2 g , dry ) in methanol ( 300 ml ) was stirred at room temperature for 24 hours under 40 psi of hydrogen . after filtration of the reaction mixture , the filtrate was concentrated to provide the product as a light yellow solid . yield : 8 . 0 g , 21 mmol , 100 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 6 . 92 ( d , half of ab quartet , j = 8 . 2 hz , 1h ), 6 . 81 - 6 . 87 ( m , 2h ), 5 . 52 ( ab quartet , j ab = 9 . 5 hz , ฮดv ab = 2 . 7 hz , 2h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 03 ( s , 3h ), 2 . 11 ( s , 3h ), 1 . 65 ( s , 3h ), 0 . 99 - 1 . 05 ( m , 2h ), 0 . 01 ( s , 9h ). to a mixture of 2 - chloro - 3 - iodopyridine ( 2 . 39 g , 9 . 98 mmol ), cyclopropylboronic acid ( 860 mg , 10 mmol ) and potassium carbonate ( 4 . 14 g , 30 . 0 mmol ) in 1 , 4 - dioxane ( 50 ml ) was added tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 1 . 16 g , 1 . 00 mmol ). the reaction mixture was stirred at 120 ยฐ c . for 4 hours , then diluted with ethyl acetate ( 50 ml ) and filtered . the filtrate was concentrated and the residue was purified by silica gel chromatography ( gradient : 10 % to 30 % ethyl acetate in petroleum ether ) to afford the product as a colorless oil . yield : 1 g , 6 mmol , 60 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 20 ( dd , j = 4 . 7 , 1 . 8 hz , 1h ), 7 . 24 - 7 . 28 ( m , 1h ), 7 . 14 ( br dd , j = 7 . 6 , 4 . 8 hz , 1h ), 2 . 12 - 2 . 21 ( m , 1h ), 1 . 04 - 1 . 11 ( m , 2h ), 0 . 67 - 0 . 72 ( m , 2h ). palladium ( ii ) acetate ( 61 mg , 0 . 27 mmol ) and di - tert - butyl [ 3 , 4 , 5 , 6 - tetramethyl - 2 โฒ, 4 โฒ, 6 - tri ( propan - 2 - yl ) biphenyl - 2 - yl ] phosphane ( 130 mg , 0 . 27 mmol ) were added to a mixture of c6 ( 615 mg , 4 . 00 mmol ), c5 ( 1 . 0 g , 2 . 6 mmol ) and cesium carbonate ( 2 . 6 g , 8 . 0 mmol ) in 1 , 4 - dioxane ( 25 ml ). the reaction mixture was stirred at 120 ยฐ c . under microwave irradiation for 5 hours , then diluted with ethyl acetate ( 50 ml ) and filtered . after removal of solvents in vacuo , the residue was purified via silica gel chromatography ( gradient : 0 % to 25 % ethyl acetate in petroleum ether ) to provide the product as a yellow gum . yield : 900 mg , 1 . 8 mmol , 69 %. lcms m / z 494 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 02 ( dd , j = 4 . 8 , 1 . 8 hz , 1h ), 7 . 30 ( dd , j = 7 . 4 , 1 . 8 hz , 1h ), 7 . 11 - 7 . 14 ( m , 1h ), 7 . 08 - 7 . 10 ( m , 2h ), 7 . 01 ( dd , j = 7 . 5 , 4 . 8 hz , 1h ), 5 . 51 ( ab quartet , j ab = 9 . 3 hz , ฮดv ab = 3 . 8 hz , 2h ), 3 . 74 - 3 . 80 ( m , 2h ), 3 . 08 ( s , 3h ), 2 . 18 ( s , 3h ), 2 . 16 - 2 . 24 ( m , 1h ), 1 . 70 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 4h ), 0 . 74 - 0 . 79 ( m , 2h ), 0 . 03 ( s , 9h ). trifluoroacetic acid ( 1 . 5 ml ) was added to a solution of c7 ( 875 mg , 1 . 77 mmol ) in dichloromethane ( 8 ml ). the reaction mixture was stirred at room temperature for 2 hours and concentrated in vacuo ; the residue was dissolved in methanol ( 10 ml ), treated with potassium carbonate ( 1 . 22 g , 8 . 83 mmol ) and stirred at room temperature for 18 hours . after removal of solids via filtration , the filtrate was concentrated under reduced pressure and partitioned between ethyl acetate and water . the aqueous layer was extracted three times with ethyl acetate , and the combined organic layers were washed sequentially with water and with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 100 % ethyl acetate in heptane ) afforded a mixture of 1 and 2 , which was separated via reversed phase chiral chromatography ( column : chiral technologies , chiralpak ia ; gradient : heptane in ethanol ). the first - eluting atropenantiomer , obtained as a solid that exhibited a positive (+) rotation , was designated as example 1 . yield : 210 mg , 0 . 578 mmol , 33 %. the second - eluting atropenantiomer , also obtained as a solid but with a negative (โ) rotation , was designated as example 2 . yield : 190 mg , 0 . 523 mmol , 30 %. 1 : lcms m / z 364 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 7 . 94 ( br d , j = 5 hz , 1h ), 7 . 48 ( br d , j = 7 . 6 hz , 1h ), 7 . 22 ( d , j = 8 . 2 hz , 1h ), 7 . 03 - 7 . 14 ( m , 3h ), 3 . 04 ( s , 3h ), 2 . 20 ( s , 3h ), 2 . 15 - 2 . 23 ( m , 1h ), 1 . 63 ( s , 3h ), 0 . 99 - 1 . 06 ( m , 2h ), 0 . 75 - 0 . 82 ( m , 2h ). 2 : lcms m / z 364 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 7 . 94 ( dd , j = 4 . 8 , 1 . 7 hz , 1h ), 7 . 48 ( dd , j = 7 . 5 , 1 . 8 hz , 1h ), 7 . 22 ( d , j = 8 . 3 hz , 1h ), 7 . 09 - 7 . 14 ( m , 2h ), 7 . 06 ( dd , j = 8 . 4 , 2 . 3 hz , 1h ), 3 . 04 ( s , 3h ), 2 . 20 ( s , 3h ), 2 . 15 - 2 . 23 ( m , 1h ), 1 . 63 ( s , 3h ), 0 . 99 - 1 . 06 ( m , 2h ), 0 . 75 - 0 . 82 ( m , 2h ). cesium carbonate ( 476 mg , 1 . 46 mmol ) was added to a mixture of 3 - chloro - 2 , 5 - difluoropyridine ( 97 %, 150 mg , 0 . 97 mmol ) and c5 ( 366 mg , 0 . 972 mmol ) in dimethyl sulfoxide ( 5 ml ), and the reaction mixture was stirred at 80 ยฐ c . for 6 hours . water was added , and the mixture was extracted three times with ethyl acetate ; the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 10 % to 40 % ethyl acetate in heptane ) provided the product as a sticky solid . yield : 414 mg , 0 . 818 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 96 ( d , j = 2 . 7 hz , 1h ), 7 . 64 ( dd , j = 7 . 1 , 2 . 7 hz , 1h ), 7 . 09 - 7 . 15 ( m , 3h ), 5 . 51 ( ab quartet , j ab = 9 . 3 hz , ฮดv ab = 3 . 4 hz , 2h ), 3 . 74 - 3 . 80 ( m , 2h ), 3 . 07 ( s , 3h ), 2 . 19 ( s , 3h ), 1 . 69 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). trifluoroacetic acid ( 812 ฮผl , 10 . 9 mmol ) was added to a solution of c8 ( 187 mg , 0 . 370 mmol ) in dichloromethane ( 3 . 0 ml ), and the reaction mixture was stirred at room temperature for 1 hour . solvents were removed in vacuo , and the residue was taken up in tetrahydrofuran ( 4 . 5 ml ) and treated with concentrated aqueous ammonium hydroxide ( 9 ml ). after 4 hours , the reaction mixture was concentrated under reduced pressure , combined with the crude product from an identical reaction carried out on c8 ( 200 mg , 0 . 395 mmol ), and purified via chromatography on silica gel ( gradient : 20 % to 40 % ethyl acetate in heptane ), to provide the racemic product as a white solid . yield : 219 mg , 0 . 583 mmol , 76 %. this was separated into its atropenantiomers via chiral chromatography ( column : phenomenex lux cellulose - 1 ; gradient : 50 % to 100 % ethanol in heptane ). the first - eluting atropenantiomer , which was obtained as a white solid , exhibited a negative (โ) rotation and was designated as example 3 . yield : 25 mg , 66 ฮผmol , 9 %. the second - eluting atropenantiomer was also a white solid , but exhibited a positive (+) rotation ; this was designated as example 4 . yield : 62 mg , 160 ฮผmol , 21 %. 3 : lcms m / z 376 . 1 , 378 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 35 ( br s , 1h ), 7 . 97 ( d , j = 2 . 7 hz , 1h ), 7 . 64 ( dd , j = 7 . 1 , 2 . 8 hz , 1h ), 7 . 11 - 7 . 16 ( m , 3h ), 3 . 04 ( s , 3h ), 2 . 20 ( s , 3h ), 1 . 67 ( s , 3h ). 4 : lcms m / z 376 . 2 , 378 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 46 ( br s , 1h ), 7 . 97 ( d , j = 2 . 7 hz , 1h ), 7 . 64 ( dd , j = 7 . 1 , 2 . 7 hz , 1h ), 7 . 12 - 7 . 16 ( m , 3h ), 3 . 04 ( s , 3h ), 2 . 20 ( br s , 3h ), 1 . 67 ( s , 3h ). sodium hydride ( 1 . 84 g , 76 . 7 mmol ) was added in portions to a solution of 1 - ethylurea ( 5 . 7 g , 65 mmol ) and ethyl 2 - cyanopropanoate ( 7 . 5 g , 59 mmol ) in methanol ( 60 ml ) that had been cooled to 0 to 5 ยฐ c . the reaction mixture was stirred for 18 hours and then was concentrated in vacuo . acetonitrile ( 200 ml ) was added , and the mixture was again concentrated to dryness . the residue was diluted with a mixture of acetonitrile ( 100 ml ) and water ( 30 ml ); 12 m aqueous hydrochloric acid was added drop - wise until the ph was approximately 1 - 2 . after the mixture had been stirred for 1 hour , the precipitate was collected via filtration and washed with tert - butyl methyl ether , affording the product as a white solid . yield : 8 . 15 g , 48 . 2 mmol , 82 %. 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 3 . 84 ( q , j = 6 . 9 hz , 2h ), 1 . 66 ( s , 3h ), 1 . 07 ( t , j = 7 . 0 hz , 3h ). to a solution of c9 ( 6 . 2 g , 36 . 6 mmol ) in a 1 : 1 mixture of acetonitrile and water ( 70 ml ) were added sodium nitrite ( 3 . 8 g , 55 mmol ) and copper ( ii ) bromide ( 16 . 4 g , 73 . 4 mmol ), and the reaction mixture was stirred for 18 hours at room temperature . a mixture of 1 n aqueous sulfuric acid ( 100 ml ) and ethyl acetate ( 50 ml ) was added , and stirring was continued for 1 hour , at which time the organic layer was separated , and the aqueous layer was extracted with dichloromethane ( 2 ร 100 ml ). the combined organic layers were concentrated in vacuo ; silica gel chromatography ( gradient : 0 % to 50 % ethyl acetate in petroleum ether ) provided the product as a green solid . yield : 5 . 0 g , 21 mmol , 57 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 87 ( br s , 1h ), 4 . 21 ( q , j = 7 . 0 hz , 2h ), 2 . 11 ( s , 3h ), 1 . 32 ( t , j = 7 . 0 hz , 3h ). compound c10 was converted to the product using the method described for synthesis of c3 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 1 . 28 g , 3 . 52 mmol , 17 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 5 . 41 ( s , 2h ), 4 . 24 ( q , j = 7 . 1 hz , 2h ), 3 . 65 - 3 . 72 ( m , 2h ), 2 . 13 ( s , 3h ), 1 . 31 ( t , j = 7 . 1 hz , 3h ), 0 . 94 - 1 . 01 ( m , 2h ), 0 . 00 ( s , 9h ). compound c11 was converted to the product using the method described for synthesis of c4 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 1 . 09 g , 2 . 27 mmol , 78 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 34 - 7 . 49 ( m , 5h ), 7 . 05 ( d , j = 8 . 2 hz , 1h ), 6 . 91 - 6 . 97 ( m , 2h ), 5 . 50 ( s , 2h ), 5 . 10 ( s , 2h ), 3 . 79 - 3 . 89 ( m , 1h ), 3 . 74 - 3 . 80 ( m , 2h ), 3 . 23 - 3 . 34 ( m , 1h ), 2 . 15 ( s , 3h ), 1 . 62 ( s , 3h ), 1 . 00 - 1 . 07 ( m , 5h ), 0 . 03 ( s , 9h ). the product , obtained as a gray solid , was synthesized from c12 using the method described for synthesis of c5 in examples 1 and 2 . yield : 800 mg , 2 . 05 mmol , 90 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 6 . 99 ( d , j = 8 . 2 hz , 1h ), 6 . 79 - 6 . 85 ( m , 2h ), 5 . 51 ( s , 2h ), 3 . 79 - 3 . 89 ( m , 1h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 24 - 3 . 34 ( m , 1h ), 2 . 12 ( s , 3h ), 1 . 62 ( s , 3h ), 0 . 99 - 1 . 06 ( m , 5h ), 0 . 02 ( s , 9h ). cesium carbonate ( 127 mg , 0 . 390 mmol ) and c13 ( 50 mg , 0 . 13 mmol ) were added to a solution of 2 , 3 - dichloropyridine ( 38 mg , 0 . 26 mmol ) in dimethyl sulfoxide ( 3 ml ), and the reaction mixture was heated at 80 ยฐ c . for 18 hours . after removal of solids via filtration , the filtrate was partitioned between ethyl acetate ( 20 ml ) and water ( 20 ml ), and the aqueous layer was extracted with ethyl acetate ( 2 ร 20 ml ). the combined organic layers were concentrated in vacuo and the residue was purified by preparative thin - layer chromatography on silica gel ( eluent : 3 : 1 petroleum ether / ethyl acetate ) to afford the product as a yellow gum . yield : 31 mg , 62 ฮผmol , 48 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 08 ( dd , j = 4 . 7 , 1 . 4 hz , 1h ), 7 . 81 ( dd , j = 7 . 7 , 1 . 4 hz , 1h ), 7 . 11 - 7 . 19 ( m , 3h ), 7 . 05 ( dd , j = 7 . 6 , 4 . 9 hz , 1h ), 5 . 50 ( s , 2h ), 3 . 81 - 3 . 93 ( m , 1h ), 3 . 72 - 3 . 80 ( m , 2h ), 3 . 25 - 3 . 37 ( m , 1h ), 2 . 19 ( s , 3h ), 1 . 65 ( s , 3h ), 0 . 98 - 1 . 10 ( m , 5h ), 0 . 02 ( s , 9h ). compound c14 ( 31 mg , 62 ฮผmol ) was treated with trifluoroacetic acid ( 3 ml ), and the reaction mixture was stirred at room temperature for 1 hour . removal of solvent in vacuo provided the product ( 24 . 8 mg ), which was used for the next step without further purification . to a solution of c15 ( from the previous step , 24 . 8 mg , โฆ 62 ฮผmol ) in methanol ( 5 ml ) was added potassium carbonate ( 83 mg , 0 . 60 mmol ), and the reaction mixture was stirred at room temperature for 1 hour . after removal of solids via filtration , the filtrate was concentrated and the residue was purified by preparative thin - layer chromatography on silica gel ( eluent : 20 : 1 dichloromethane / methanol ) to afford the product as a white solid . yield : 7 . 7 mg , 21 ฮผmol , 34 % over two steps . lcms m / z 372 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 07 ( dd , j = 4 . 8 , 1 . 5 hz , 1h ), 7 . 98 ( dd , j = 7 . 8 , 1 . 6 hz , 1h ), 7 . 32 ( d , j = 8 . 2 hz , 1h ), 7 . 12 - 7 . 21 ( m , 3h ), 3 . 78 - 3 . 89 ( m , 1h ), 3 . 27 - 3 . 38 ( m , 1h , assumed ; partially obscured by solvent peak ), 2 . 21 ( s , 3h ), 1 . 60 ( s , 3h ), 1 . 07 ( t , j = 7 . 1 hz , 3h ). ethyl 2 - cyanobutanoate was reacted with 1 - methylurea according to the method described for synthesis of c9 in example 5 . the product was obtained as a white solid . yield : 5 . 95 g , 35 . 2 mmol , 66 %. 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 10 . 36 ( s , 1h ), 6 . 41 ( s , 2h ), 3 . 22 ( s , 3h ), 2 . 22 ( q , j = 7 . 3 hz , 2h ), 0 . 87 ( t , j = 7 . 3 hz , 3h ). to a solution of c16 ( 5 . 95 g , 35 . 2 mmol ) in a 1 : 1 mixture of acetonitrile and water ( 80 ml ) were added sodium nitrite ( 3 . 6 g , 52 mmol ) and copper ( ii ) bromide ( 15 . 7 g , 70 . 3 mmol ), and the reaction mixture was stirred for 18 hours at room temperature . a mixture of 1 n aqueous sulfuric acid ( 100 ml ) and ethyl acetate ( 50 ml ) was added , and stirring was continued for 1 hour . the resulting solid was collected via filtration and the filter cake was washed with aqueous ethyl acetate , providing the product as a white solid ( 4 g ). the organic layer of the filtrate was separated and the aqueous layer was extracted with dichloromethane ( 2 ร 100 ml ); the combined organic layers were concentrated in vacuo to afford additional product as a green solid ( 3 g ). yield : 7 g , 30 mmol , 85 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 92 ( br s , 1h ), 3 . 62 ( s , 3h ), 2 . 58 ( q , j = 7 . 4 hz , 2h ), 1 . 09 ( t , j = 7 . 4 hz , 3h ). compound c17 was converted to the product using the method described for synthesis of c3 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 3 . 1 g , 8 . 5 mmol , 28 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 5 . 41 ( s , 2h ), 3 . 66 ( s , 3h ), 3 . 64 - 3 . 72 ( m , 2h ), 2 . 61 ( q , j = 7 . 4 hz , 2h ), 1 . 09 ( t , j = 7 . 4 hz , 3h ), 0 . 95 - 1 . 01 ( m , 2h ), 0 . 00 ( s , 9h ). compound c18 was converted to the product using the method employed for synthesis of c4 in examples 1 and 2 . the product was obtained as a yellow gum . yield : 1 . 26 g , 2 . 62 mmol , 59 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 34 - 7 . 49 ( m , 5h ), 7 . 03 ( d , j = 8 . 0 hz , 1h ), 6 . 91 - 6 . 97 ( m , 2h ), 5 . 47 - 5 . 54 ( m , 2h ), 5 . 10 ( s , 2h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 00 ( s , 3h ), 2 . 18 - 2 . 29 ( m , 1h ), 2 . 16 ( s , 3h ), 1 . 86 - 1 . 97 ( m , 1h ), 0 . 99 - 1 . 07 ( m , 2h ), 0 . 91 ( t , j = 7 . 3 hz , 3h ), 0 . 03 ( s , 9h ). the product , obtained as a gray solid , was synthesized from c19 using the method described for synthesis of c5 in examples 1 and 2 . yield : 850 mg , 2 . 18 mmol , 83 %. lcms m / z 413 . 2 [ m + na + ]. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 6 . 97 ( d , j = 7 . 9 hz , 1h ), 6 . 79 - 6 . 86 ( m , 2h ), 5 . 48 - 5 . 54 ( m , 2h ), 3 . 73 - 3 . 80 ( m , 2h ), 3 . 01 ( s , 3h ), 2 . 18 - 2 . 30 ( m , 1h ), 2 . 13 ( s , 3h ), 1 . 86 - 1 . 97 ( m , 1h ), 0 . 99 - 1 . 06 ( m , 2h ), 0 . 90 ( t , j = 7 . 3 hz , 3h ), 0 . 02 ( s , 9h ). a mixture of c20 ( 80 mg , 0 . 20 mmol ), 2 , 3 - dichloropyridine ( 45 mg , 0 . 30 mmol ) and cesium carbonate ( 199 mg , 0 . 611 mmol ) in dimethyl sulfoxide ( 8 ml ) was heated at 120 ยฐ c . for 18 hours . after addition of water and ethyl acetate , the mixture was extracted with ethyl acetate . the combined organic layers were dried , filtered , and concentrated under reduced pressure . preparative thin - layer chromatography on silica gel ( eluent : 1 : 1 petroleum ether / ethyl acetate ) afforded the product as a colorless oil . yield : 82 mg , 0 . 16 mmol , 80 %. a solution of c21 ( 82 mg , 0 . 16 mmol ) in trifluoroacetic acid ( 3 ml ) was heated at 80 ยฐ c . for 1 hour . after removal of solvent in vacuo , the residue was dissolved in methanol ( 5 ml ), treated with potassium carbonate ( 68 mg , 0 . 49 mmol ), and stirred at room temperature for 1 hour . the reaction mixture was filtered , and the filtrate was concentrated ; purification via preparative thin - layer chromatography ( eluent : ethyl acetate ) provided the product as a white solid . yield : 28 mg , 75 ฮผmol , 47 %. lcms m / z 372 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 07 ( br d , j = 4 hz , 1h ), 7 . 97 ( d , j = 7 . 5 hz , 1h ), 7 . 29 ( d , j = 8 . 3 hz , 1h ), 7 . 11 - 7 . 21 ( m , 3h ), 3 . 01 ( s , 3h ), 2 . 22 ( s , 3h ), 2 . 17 - 2 . 27 ( m , 1h ), 1 . 87 - 1 . 98 ( m , 1h ), 0 . 93 ( t , j = 7 . 3 hz , 3h ). compound c2 ( 800 mg , 3 . 65 mmol ), di - tert - butyl dicarbonate ( 99 %, 966 mg , 4 . 38 mmol ), triethylamine ( 0 . 62 ml , 4 . 4 mmol ) and 4 -( dimethylamino ) pyridine ( 45 mg , 0 . 36 mmol ) were combined in tetrahydrofuran ( 15 ml ) and heated to 70 ยฐ c . for 1 hour , then allowed to stir at room temperature for 18 hours . the reaction mixture was concentrated in vacuo , and the residue was purified via chromatography on silica gel ( gradient : 10 % to 25 % ethyl acetate in heptane ) to provide the product as a white solid . yield : 1 . 10 g , 3 . 45 mmol , 94 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 3 . 64 ( s , 3h ), 2 . 12 ( s , 3h ), 1 . 61 ( s , 9h ). a mixture of c22 ( 1 . 00 g , 3 . 13 mmol ), [ 4 -( benzyloxy )- 2 - methylphenyl ] boronic acid ( 98 %, 1 . 16 g , 4 . 68 mmol ), chloro ( 2 - dicyclohexylphosphino - 2 โฒ, 6 โฒ- dimethoxy - 1 , 1 โฒ- biphenyl )[ 2 -( 2 - aminoethylphenyl )] palladium ( ii )- tert - butyl methyl ether adduct ( s - phos precatalyst ) ( 119 mg , 0 . 156 mmol ), and cesium carbonate ( 3 . 06 g , 9 . 39 mmol ) in 2 - methyltetrahydrofuran ( 10 ml ) and water ( 3 ml ) was heated at 50 ยฐ c . for 66 hours . the reaction mixture was diluted with water and ethyl acetate , and then filtered to remove suspended solids . the filtrate was extracted several times with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . the resulting solid was suspended in a 1 : 3 mixture of ethyl acetate and heptane , stirred for several minutes , and filtered , providing the product as a white solid . yield : 970 mg , 2 . 22 mmol , 71 %. lcms m / z 337 . 2 [( m - boc )+ h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 34 - 7 . 48 ( m , 5h ), 6 . 91 - 7 . 01 ( m , 3h ), 5 . 10 ( s , 2h ), 3 . 01 ( s , 3h ), 2 . 16 ( br s , 3h ), 1 . 66 ( s , 9h ), 1 . 64 ( s , 3h ). compound c23 ( 250 mg , 0 . 573 mmol ) was mixed with a 30 % solution of hydrogen bromide in acetic acid ( 1 ml , 5 mmol ) and allowed to stir for 18 hours at room temperature . after removal of acetic acid under reduced pressure , the residue was dissolved in a minimal quantity of ethanol and diluted with 4 m aqueous hydrochloric acid to provide a slightly cloudy mixture ; this was evaporated to dryness , and the resulting solid was suspended in 4 n aqueous hydrochloric acid , stirred for several minutes , and filtered , affording the product as a yellow solid . yield : 125 mg , 0 . 508 mmol , 89 %. lcms m / z 247 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 11 . 36 ( br s , 1h ), 9 . 71 ( v br s , 1h ), 6 . 99 ( d , j = 8 . 2 hz , 1h ), 6 . 76 ( d , j = 2 . 3 hz , 1h ), 6 . 72 ( d , j = 8 . 1 , 2 . 3 hz , 1h ), 2 . 82 ( s , 3h ), 2 . 03 ( s , 3h ), 1 . 44 ( s , 3h ). 2 - chloro - 3 -( trifluoromethyl ) pyridine ( 98 %, 269 mg , 1 . 45 mmol ), c24 ( 325 mg , 1 . 32 mmol ) and cesium carbonate ( 521 mg , 1 . 60 mmol ) were combined in n , n - dimethylformamide ( 6 ml ) and the resulting suspension was heated at 100 ยฐ c . for 18 hours . after it had cooled to room temperature , the reaction mixture was diluted with aqueous 1 m hydrochloric acid and extracted several times with ethyl acetate . the combined organic layers were washed twice with water and once with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . the resulting solid was suspended in a 1 : 1 mixture of ethyl acetate and heptane , stirred for several minutes and collected by filtration , providing the product as a white solid . yield : 440 mg , 1 . 12 mmol , 85 %. lcms m / z 392 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 31 - 8 . 36 ( m , 2h ), 8 . 05 ( br d , j = 7 . 5 hz , 1h ), 7 . 13 - 7 . 22 ( m , 4h ), 3 . 06 ( s , 3h ), 2 . 21 ( s , 3h ), 1 . 69 ( s , 3h ). racemate c25 ( 1 . 30 g , 3 . 32 mmol ) was separated into its atropenantiomers via chiral chromatography ( column : phenomenex lux cellulose - 2 ; gradient : heptane / ethanol ). the first - eluting atropenantiomer , obtained as a tan solid that exhibited a negative (โ) rotation , was designated as example 7 . yield : 536 mg , 1 . 37 mmol , 41 %. the second - eluting atropenantiomer , also obtained as a tan solid but with a positive (+) rotation , was designated as example 8 . yield : 553 mg , 1 . 41 mmol , 42 %. 7 : lcms m / z 392 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 34 ( ddq , j = 4 . 9 , 1 . 9 , 0 . 6 hz , 1h ), 8 . 30 ( br s , 1h ), 8 . 05 ( ddq , j = 7 . 6 , 1 . 9 , 0 . 7 hz , 1h ), 7 . 13 - 7 . 21 ( m , 4h ), 3 . 06 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 69 ( s , 3h ). 8 : lcms m / z 392 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 34 ( br d , j = 4 . 9 hz , 1h ), 8 . 30 ( br s , 1h ), 8 . 05 ( br d , j = 7 . 5 hz , 1h ), 7 . 13 - 7 . 22 ( m , 4h ), 3 . 06 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 69 ( s , 3h ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 98 %, 5 . 57 ml , 36 . 5 mmol ) was added to a suspension of c2 ( 4 . 00 g , 18 . 3 mmol ) and 4 -( chloromethyl )- 1 , 2 - dimethoxybenzene ( 5 . 16 g , 27 . 6 mmol ) in acetonitrile ( 80 ml ), and the reaction mixture was heated at 60 ยฐ c . for 18 hours . after removal of solvent in vacuo , the residue was purified via silica gel chromatography ( gradient : 25 % to 50 % ethyl acetate in heptane ) to afford the product as a white solid . yield : 5 . 70 g , 15 . 4 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 08 - 7 . 12 ( m , 2h ), 6 . 80 ( d , j = 8 . 0 hz , 1h ), 5 . 07 ( s , 2h ), 3 . 88 ( s , 3h ), 3 . 85 ( s , 3h ), 3 . 65 ( s , 3h ), 2 . 14 ( s , 3h ). an aqueous solution of potassium carbonate ( 3 . 0 m , 14 ml , 42 mmol ) was added to a mixture of c26 ( 5 . 00 g , 13 . 5 mmol ), ( 4 - hydroxy - 2 - methylphenyl ) boronic acid ( 4 . 12 g , 27 . 1 mmol ), [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ), dichloromethane complex ( 98 %, 1 . 13 g , 1 . 36 mmol ) and 1 , 4 - dioxane ( 120 ml ). after the reaction mixture had been heated at 100 ยฐ c . for 18 hours , it was cooled to room temperature , diluted with ethyl acetate and water , and filtered through diatomaceous earth . the organic layer from the filtrate was washed sequentially with saturated aqueous sodium bicarbonate solution and with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . purification using silica gel chromatography ( gradient : 25 % to 75 % ethyl acetate in heptane ) afforded the product as a white foam . yield : 2 . 71 g , 6 . 84 mmol , 51 %. lcms m / z 397 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 22 ( d , j = 2 . 0 hz , 1h ), 7 . 19 ( dd , j = 8 . 1 , 2 . 0 hz , 1h ), 6 . 93 ( d , j = 8 . 2 hz , 1h ), 6 . 83 ( d , j = 8 . 3 hz , 1h ), 6 . 80 - 6 . 82 ( m , 1h ), 6 . 76 - 6 . 80 ( m , 1h ), 5 . 16 ( ab quartet , j ab = 13 . 3 hz , ฮดv ab = 19 . 2 hz , 2h ), 3 . 91 ( s , 3h ), 3 . 87 ( s , 3h ), 3 . 02 ( s , 3h ), 2 . 11 ( br s , 3h ), 1 . 66 ( s , 3h ). a mixture of 2 , 3 - dichloro - 5 - methylpyridine ( 735 mg , 4 . 54 mmol ), c27 ( 1 . 5 g , 3 . 8 mmol ) and cesium carbonate ( 2 . 46 g , 7 . 55 mmol ) in dimethyl sulfoxide ( 36 ml ) was stirred at 100 ยฐ c . for 40 hours , and at 120 ยฐ c . for a further 48 hours . the reaction mixture was diluted with water ( 300 ml ) and extracted with ethyl acetate ( 3 ร 200 ml ); the combined organic layers were dried , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 10 % to 60 % ethyl acetate in petroleum ether ) provided the product as a yellow solid . yield : 1 . 7 g , 3 . 2 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 89 - 7 . 92 ( m , 1h ), 7 . 64 - 7 . 66 ( m , 1h ), 7 . 23 ( br d , j = 1 . 9 hz , 1h ), 7 . 20 ( br dd , j = 8 . 2 , 1 . 9 hz , 1h ), 7 . 10 - 7 . 12 ( br s , 1h ), 7 . 06 - 7 . 09 ( m , 2h ), 6 . 83 ( d , j = 8 . 2 hz , 1h ), 5 . 16 ( ab quartet , j ab = 13 . 4 hz , ฮดv ab = 20 . 4 hz , 2h ), 3 . 91 ( s , 3h ), 3 . 87 ( s , 3h ), 3 . 06 ( s , 3h ), 2 . 32 ( s , 3h ), 2 . 16 ( s , 3h ), 1 . 68 ( s , 3h ). this experiment was carried out in three batches . a mixture of c28 ( 600 mg , 1 . 15 mmol ) and methoxybenzene ( 622 mg , 5 . 75 mmol ) in trifluoroacetic acid ( 20 ml ) was stirred at 120 ยฐ c . for 48 hours , then at 125 ยฐ c . for another 48 hours . the three batches were combined , concentrated under reduced pressure , and purified via chromatography on silica gel ( gradient : 10 % to 70 % ethyl acetate in petroleum ether ). the product was obtained as a light brown solid . yield : 690 mg , 1 . 86 mmol , 54 %. lcms m / z 371 . 8 , 373 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 7 . 90 - 7 . 92 ( m , 1h ), 7 . 82 - 7 . 84 ( m , 1h ), 7 . 23 ( d , j = 8 . 4 hz , 1h ), 7 . 14 ( br d , j = 2 . 2 hz , 1h ), 7 . 08 ( br dd , j = 8 . 2 , 2 . 2 hz , 1h ), 3 . 03 ( s , 3h ), 2 . 33 ( br s , 3h ), 2 . 20 ( br s , 3h ), 1 . 62 ( s , 3h ). compound c29 ( 690 mg , 1 . 86 mmol ) was separated into its atropenantiomers via supercritical fluid chromatography ( column : chiral technologies , chiralcel oj - h , 5 ฮผm ; eluent : 7 : 3 carbon dioxide / methanol ). the first - eluting atropenantiomer , obtained as a solid that exhibited a positive (+) rotation , was designated as example 9 . yield : 240 mg , 0 . 645 mmol , 35 %. the second - eluting atropenantiomer , also obtained as a solid but with a negative (โ) rotation , was designated as example 10 . yield : 250 mg , 0 . 672 mmol , 36 %. 9 : lcms m / z 372 . 1 , 374 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 36 ( br s , 1h ), 7 . 91 - 7 . 93 ( m , 1h ), 7 . 65 - 7 . 66 ( m , 1h ), 7 . 13 - 7 . 14 ( m , 1h ), 7 . 10 - 7 . 11 ( m , 2h ), 3 . 04 ( s , 3h ), 2 . 32 - 2 . 34 ( m , 3h ), 2 . 18 - 2 . 19 ( m , 3h ), 1 . 67 ( s , 3h ). 10 : lcms m / z 372 . 1 , 374 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 35 ( br s , 1h ), 7 . 91 - 7 . 93 ( m , 1h ), 7 . 65 - 7 . 66 ( m , 1h ), 7 . 13 - 7 . 14 ( m , 1h ), 7 . 10 - 7 . 11 ( m , 2h ), 3 . 04 ( s , 3h ), 2 . 33 ( dd , j = 0 . 7 , 0 . 7 hz , 3h ), 2 . 19 ( d , j = 0 . 6 hz , 3h ), 1 . 67 ( s , 3h ). a solution of c22 ( 23 . 3 g , 73 . 0 mmol ), [ 4 -( benzyloxy ) phenyl ] boronic acid ( 25 g , 110 mmol ), [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ) ( 2 . 68 g , 3 . 66 mmol ), and cesium carbonate ( 95 . 2 g , 292 mmol ) in 2 - methyltetrahydrofuran ( 360 ml ) and water ( 120 ml ) was purged with nitrogen and heated to 50 ยฐ c . for 5 hours . after cooling to room temperature , the reaction mixture was stirred at room temperature for 18 hours , then diluted with water and ethyl acetate . the mixture was filtered , and the filtrate was extracted several times with ethyl acetate . the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . the resulting solid was combined with the solid collected from the initial filtration , and extracted several times with hot ethyl acetate ; the combined ethyl acetate extracts were concentrated under reduced pressure . the residue was suspended in a 1 : 3 mixture of ethyl acetate and heptane , stirred for several minutes , and filtered , affording the product as a gray solid , which was used without additional purification . yield : 21 . 8 g , 51 . 6 mmol , 71 %. lcms m / z 323 . 1 [( m - boc )+ h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : ฮด 7 . 46 - 7 . 51 ( m , 2h ), 7 . 42 ( br dd , j = 7 . 5 , 7 . 4 hz , 2h ), 7 . 32 - 7 . 38 ( m , 3h ), 7 . 18 ( br d , j = 8 . 8 hz , 2h ), 5 . 16 ( s , 2h ), 2 . 92 ( s , 3h ), 1 . 54 ( s , 9h ). compound c30 ( 21 . 8 g , 51 . 6 mmol ) was mixed with a 30 % solution of hydrogen bromide in acetic acid ( 100 ml , 520 mmol ) and stirred at room temperature for 4 hours . acetic acid was removed under reduced pressure , and the resulting oil was dissolved in a minimal quantity of ethanol and diluted with water , providing a slightly cloudy mixture . after this was evaporated to dryness , the resulting solid was suspended in water and stirred for several minutes . filtration afforded the product as a tan solid , which was used without additional purification . yield : 11 . 4 g , 49 . 1 mmol , 95 %. lcms m / z 233 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 11 . 34 ( br s , 1h ), 9 . 85 ( br s , 1h ), 7 . 14 ( br d , j = 8 . 6 hz , 2h ), 6 . 89 ( br d , j = 8 . 6 hz , 2h ), 2 . 88 ( s , 3h ), 1 . 50 ( s , 3h ). cesium carbonate ( 32 . 6 g , 100 mmol ) was added to a mixture of c31 ( 11 . 4 g , 49 . 1 mmol ) and 2 , 3 - dichloro - 4 - methylpyridine ( 11 . 9 g , 73 . 4 mmol ) in 1 - methylpyrrolidin - 2 - one ( 100 ml ), and the reaction mixture was heated at 140 ยฐ c . for 24 hours . additional 2 , 3 - dichloro - 4 - methylpyridine ( 4 . 0 g , 25 mmol ) was added , and heating was continued for 24 hours . the reaction mixture was cooled to approximately 50 ยฐ c . and poured into ice water ( 500 ml ); the resulting suspension was stirred for 5 minutes and then filtered . the collected solid was dissolved in hot ethanol ( 600 ml ), treated with charcoal and magnesium sulfate , and stirred under heating for 10 minutes . the hot mixture was filtered through diatomaceous earth , and the hot filtrate was diluted with heptane ( 400 ml ) while stirring , then cooled to 0 ยฐ c . after stirring for 45 minutes at 0 ยฐ c ., the mixture was filtered to afford the crude product as an off - white solid ( 11 . 75 g ). the filtrate was concentrated under reduced pressure , suspended in diethyl ether , and filtered to provide a solid , which was extracted several times with hot ethyl acetate ; the combined ethyl acetate extracts were concentrated in vacuo , yielding additional crude product ( 2 g ). the two lots of crude product were combined and recrystallized from ethyl acetate / heptane to afford the final product as a white solid . yield : 11 . 1 g , 31 . 0 mmol , 63 %. lcms m / z 358 . 2 , 360 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 11 . 42 ( br s , 1h ), 8 . 00 ( d , j = 5 . 0 hz , 1h ), 7 . 42 ( br d , j = 8 . 8 hz , 2h ), 7 . 30 ( br d , j = 8 . 7 hz , 2h ), 7 . 21 ( br d , j = 5 . 0 hz , 1h ), 2 . 91 ( s , 3h ), 2 . 44 ( s , 3h ), 1 . 53 ( s , 3h ). to a mixture of 2 - chloro - 3 -( difluoromethyl ) pyridine ( 15 g , 92 mmol ) and cesium carbonate ( 90 g , 280 mmol ) in dimethyl sulfoxide ( 300 ml ) was added 4 - bromo - 3 - methylphenol ( 19 . 8 g , 106 mmol ). the reaction mixture was stirred at 100 ยฐ c . for 18 hours , then diluted with water ( 1 l ) and extracted with ethyl acetate ( 5 ร 200 ml ). the combined organic layers were dried , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : 40 : 1 petroleum ether / ethyl acetate ) afforded the product as a white solid . yield : 27 g , 86 mmol , 93 %. 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 19 ( br d , j = 4 hz , 1h ), 8 . 07 ( d , j = 7 . 2 hz , 1h ), 7 . 56 ( d , j = 8 . 5 hz , 1h ), 7 . 19 - 7 . 25 ( m , 1h ), 7 . 10 ( br d , j = 2 . 5 hz , 1h ), 7 . 08 ( t , j hf = 54 . 8 hz , 1h ), 6 . 90 ( dd , j = 8 . 6 , 2 . 6 hz , 1h ), 2 . 39 ( s , 3h ). to a mixture of c32 ( 27 g , 86 mmol ), 4 , 4 , 4 โฒ, 4 โฒ, 5 , 5 , 5 โฒ, 5 โฒ- octamethyl - 2 , 2 โฒ- bi - 1 , 3 , 2 - dioxaborolane ( 32 . 8 g , 129 mmol ) and potassium acetate ( 25 . 8 g , 263 mmol ) in 1 , 4 - dioxane ( 500 ml ) was added [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ) ( 6 . 3 g , 8 . 6 mmol ). the mixture was stirred at 100 ยฐ c . for 18 hours , then filtered . after concentration of the filtrate under reduced pressure , the residue was purified via silica gel chromatography ( eluent : petroleum ether ) to provide the product as a yellow oil . yield : 16 g , 44 mmol , 51 %. lcms m / z 362 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 18 - 8 . 22 ( m , 1h ), 8 . 07 ( br d , j = 7 hz , 1h ), 7 . 75 ( d , j = 8 . 0 hz , 1h ), 7 . 22 ( dd , j = 7 . 6 , 5 . 0 hz , 1h ), 7 . 07 ( t , j hf = 55 . 0 hz , 1h ), 6 . 93 ( br d , j = 2 hz , 1h ), 6 . 90 ( br dd , j = 8 , 2 hz , 1h ), 2 . 52 ( s , 3h ), 1 . 35 ( s , 12h ). compound c10 was converted to the product according to the method used for synthesis of c26 in examples 9 and 10 . the product was obtained as a light yellow oil . yield : 720 mg , 1 . 88 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 07 - 7 . 14 ( m , 2h ), 6 . 80 ( d , j = 8 . 2 hz , 1h ), 5 . 06 ( s , 2h ), 4 . 23 ( q , j = 7 . 0 hz , 2h ), 3 . 88 ( s , 3h ), 3 . 85 ( s , 3h ), 2 . 13 ( s , 3h ), 1 . 30 ( t , j = 7 . 0 hz , 3h ). to a mixture of c34 ( 57 . 5 mg , 0 . 150 mmol ), c33 ( 108 mg , 0 . 299 mmol ), and tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 17 mg , 15 ฮผmol ) in a mixture of 1 , 4 - dioxane ( 3 ml ) and water ( 20 drops ) was added barium hydroxide ( 77 mg , 0 . 45 mmol ). the reaction mixture was stirred at 60 ยฐ c . for 20 hours , then diluted with saturated aqueous ammonium chloride solution ( 20 ml ) and extracted with ethyl acetate ( 3 ร 20 ml ). the combined organic layers were dried , filtered , and concentrated in vacuo . preparative high - performance liquid chromatography afforded the product as a white solid . yield : 30 mg , 56 ฮผmol , 37 %. lcms m / z 538 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 28 ( br d , j = 4 hz , 1h ), 8 . 04 ( d , j = 7 . 2 hz , 1h ), 7 . 10 - 7 . 25 ( m , 6h ), 7 . 02 ( t , j hf = 55 . 1 hz , 1h ), 6 . 83 ( d , j = 8 . 2 hz , 1h ), 5 . 17 ( s , 2h ), 3 . 90 ( s , 3h ), 3 . 87 ( s , 3h ), 3 . 81 - 3 . 9 ( m , 1h ), 3 . 27 - 3 . 38 ( m , 1h ), 2 . 18 ( s , 3h ), 1 . 66 ( s , 3h ), 1 . 07 ( t , j = 7 . 0 hz , 3h ). compound c35 was deprotected using the method described for synthesis of c29 in examples 9 and 10 . in this case , purification was carried out via reversed phase high - performance liquid chromatography ( column : waters sunfire c18 , 5 ฮผm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 30 % to 50 % b ). lcms m / z 388 . 1 [ m + h ] + . 1 h nmr ( 600 mhz , dmso - d 6 ) ฮด 8 . 34 ( br d , j = 4 . 5 hz , 1h ), 8 . 13 ( br d , j = 7 . 2 hz , 1h ), 7 . 35 ( d , j = 8 . 3 hz , 1h ), 7 . 32 ( dd , j = 7 . 4 , 5 . 0 hz , 1h ), 7 . 28 ( t , j hf = 54 . 4 hz , 1h ), 7 . 24 ( br d , j = 2 . 1 hz , 1h ), 7 . 18 ( br dd , j = 8 . 2 , 2 . 3 hz , 1h ), 3 . 63 - 3 . 71 ( m , 1h ), 3 . 08 - 3 . 15 ( m , 1h ), 2 . 15 ( s , 3h ), 1 . 45 ( s , 3h ), 0 . 95 ( t , j = 7 . 0 hz , 3h ). this reaction was carried out 3 times . a mixture of potassium carbonate ( 282 g , 2 . 04 mol ) and n , n - dimethylformamide ( 750 ml ) was heated to 100 ยฐ c . and slowly treated , in a drop - wise manner over 1 hour , with a solution of 2 - chloropyridin - 3 - ol ( 66 . 7 g , 515 mmol ) and sodium chloro ( difluoro ) acetate ( 200 g , 1 . 31 mol ) in n , n - dimethylformamide ( 750 ml ). after completion of the addition , the reaction mixture was stirred at 100 ยฐ c . for 1 hour , then cooled to 25 ยฐ c . and partitioned between water ( 10 l ) and tert - butyl methyl ether ( 5 l ). the aqueous layer was extracted with ethyl acetate ( 4 ร 2 . 5 l ), and the combined organic layers were washed with saturated aqueous sodium chloride solution ( 6 ร 2 . 5 l ), dried over sodium sulfate , filtered , and concentrated in vacuo . the combined crude products from the three reactions were purified via distillation at reduced pressure ( 30 - 40 ยฐ c ., 1 - 5 mm hg ) to provide the product as a colorless oil . yield : 192 g , 1 . 07 mol , 69 %. lcms m / z 180 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 26 - 8 . 30 ( m , 1h ), 7 . 60 ( br d , j = 8 . 2 hz , 1h ), 7 . 28 ( br dd , j = 8 . 0 , 4 . 8 hz , 1h ), 6 . 60 ( t , j hf = 72 . 5 hz , 1h ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 6 . 00 ml , 40 . 2 mmol ) was added to a suspension of c2 ( 8 . 00 g , 36 . 5 mmol ) and benzyl chloromethyl ether ( 95 %, 5 . 86 ml , 40 . 2 mmol ) in acetonitrile ( 100 ml ). after 90 hours at room temperature , the reaction mixture was concentrated in vacuo , diluted with water , and extracted several times with ethyl acetate . the combined organic layers were washed sequentially with water and with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 10 % to 25 % ethyl acetate in heptane ) afforded the product as a white solid . yield : 10 . 1 g , 29 . 8 mmol , 82 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 24 - 7 . 39 ( m , 5h ), 5 . 52 ( s , 2h ), 4 . 71 ( s , 2h ), 3 . 63 ( s , 3h ), 2 . 11 ( s , 3h ). to a mixture of c37 ( 10 . 5 g , 31 . 0 mmol ), [ 4 -( methoxymethoxy )- 2 - methylphenyl ] boronic acid ( 7 . 58 g , 38 . 7 mmol ) and potassium carbonate ( 13 g , 94 mmol ) in 1 , 4 - dioxane ( 170 ml ) was added [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ), dichloromethane complex ( 1 . 3 g , 1 . 6 mmol ). the reaction mixture was stirred at 80 ยฐ c . for 18 hours and filtered ; the filtrate was concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) provided the product as a yellow oil . yield : 10 . 5 g , 25 . 6 mmol , 83 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 25 - 7 . 46 ( m , 5h ), 6 . 93 - 7 . 02 ( m , 3h ), 5 . 60 ( ab quartet , j ab = 9 . 4 hz , ฮดv ab = 9 . 7 hz , 2h ), 5 . 22 ( s , 2h ), 4 . 79 ( s , 2h ), 3 . 52 ( s , 3h ), 3 . 00 ( s , 3h ), 2 . 12 ( br s , 3h ), 1 . 63 ( s , 3h ). to a solution of c38 ( 9 . 0 g , 22 mmol ) in tetrahydrofuran ( 70 ml ) was added aqueous hydrochloric acid ( 8 m , 70 ml ), and the reaction mixture was stirred at room temperature for 1 hour . after extraction with ethyl acetate ( 5 ร 100 ml ), the combined organic layers were concentrated in vacuo ; silica gel chromatography ( gradient : 0 % to 50 % ethyl acetate in petroleum ether ) afforded the product as a white solid . yield : 6 . 3 g , 17 mmol , 77 %. lcms m / z 389 . 0 [ m + na + ]. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 43 ( br d , j = 7 hz , 2h ), 7 . 25 - 7 . 37 ( m , 3h ), 6 . 91 ( d , j = 7 . 9 hz , 1h ), 6 . 78 - 6 . 84 ( m , 2h ), 5 . 61 ( ab quartet , j ab = 9 . 4 hz , ฮดv ab = 9 . 2 hz , 2h ), 5 . 47 ( s , 1h ), 4 . 79 ( s , 2h ), 3 . 01 ( s , 3h ), 2 . 09 ( s , 3h ), 1 . 64 ( s , 3h ). a suspension of c39 ( 10 g , 27 mmol ), c36 ( 5 . 88 g , 32 . 7 mmol ), and cesium carbonate ( 99 %, 13 . 5 g , 41 . 0 mmol ) in dimethyl sulfoxide ( 200 ml ) was heated to 80 ยฐ c . for 18 hours . compound c36 ( 2 . 9 g , 16 mmol ) was added , and the reaction mixture was heated at 90 ยฐ c . for 3 hours , then at 80 ยฐ c . for 66 hours . after cooling to room temperature , the reaction mixture was diluted with water and extracted three times with ethyl acetate . the combined organic layers were washed with water ( 5 ร 300 ml ), washed with saturated aqueous sodium chloride solution ( 200 ml ), dried over magnesium sulfate , filtered , and concentrated in vacuo . purification via silica gel chromatography ( gradient : 25 % to 50 % ethyl acetate in heptane ) provided the product as a viscous , light yellow oil . yield : 10 . 8 g , 21 . 2 mmol , 78 %. lcms m / z 510 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 05 ( dd , j = 4 . 9 , 1 . 7 hz , 1h ), 7 . 61 - 7 . 65 ( m , 1h ), 7 . 40 - 7 . 44 ( m , 2h ), 7 . 30 - 7 . 36 ( m , 2h ), 7 . 24 - 7 . 29 ( m , 1h ), 7 . 11 - 7 . 16 ( m , 2h ), 7 . 10 ( dd , j = 7 . 9 , 4 . 9 hz , 1h ), 7 . 08 ( br d , j = 8 hz , 1h ), 6 . 70 ( t , j hf = 73 . 5 hz , 1h ), 5 . 61 ( ab quartet , j ab = 9 . 5 hz , ฮดv ab = 9 . 2 hz , 2h ), 4 . 79 ( br s , 2h ), 3 . 04 ( s , 3h ), 2 . 16 ( br s , 3h ), 1 . 66 ( s , 3h ). a mixture of c40 ( 10 . 8 g , 21 . 2 mmol ) and trifluoroacetic acid ( 110 ml ) was heated at 80 ยฐ c . for 1 hour . the reaction mixture was concentrated in vacuo , treated with dichloromethane and concentrated again , then treated with tetrahydrofuran , concentrated under reduced pressure , and dried under high vacuum . the residue was diluted with tetrahydrofuran ( 50 ml ), cooled in an ice bath , and treated with concentrated ammonium hydroxide ( 50 ml ). the flask was removed from the ice bath and the reaction mixture was stirred at room temperature for 45 minutes ; after removal of solvents in vacuo , purification via silica gel chromatography ( gradient : 25 % to 100 % ethyl acetate in heptane ) provided a racemic mixture of 13 and its atropenantiomer . this was combined with material obtained from a similar reaction carried out on c40 ( 15 . 3 g , 30 . 0 mmol ), and separated via supercritical fluid chromatography ( column : phenomenex lux cellulose - 2 , 5 ฮผm ; eluent : 3 : 2 carbon dioxide / methanol ). the first - eluting atropenantiomer , which exhibited a negative (โ) rotation , was assigned as atropenantiomer 13 . yield : 4 . 8 g , 12 mmol , 23 %. this material was dissolved in hot ethyl acetate ( 200 ml ) and slowly treated with heptane ( 100 ml ) while maintaining the mixture at reflux . after slowly cooling to room temperature , the mixture was stirred at room temperature for 18 hours , then cooled to 0 ยฐ c . and stirred for 30 minutes . filtration afforded the product as a powdery white solid . yield : 4 . 17 g , 10 . 7 mmol , 89 % from the recrystallization . lcms m / z 390 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 11 . 45 ( br s , 1h ), 8 . 06 ( dd , j = 4 . 8 , 1 . 5 hz , 1h ), 7 . 81 ( br d , j = 7 . 9 hz , 1h ), 7 . 32 ( t , j hf = 73 . 4 hz , 1h ), 7 . 12 - 7 . 31 ( m , 4h ), 2 . 87 ( s , 3h ), 2 . 14 ( s , 3h ), 1 . 48 ( s , 3h ). compound c39 was reacted with 2 - chloro - 3 -( difluoromethyl ) pyridine using the method described for synthesis of c40 in example 13 . the product was obtained as a white solid . yield : 17 . 3 g , 35 . 1 mmol , 86 %. lcms m / z 494 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 27 - 8 . 31 ( m , 1h ), 8 . 02 - 8 . 07 ( m , 1h ), 7 . 41 - 7 . 46 ( m , 2h ), 7 . 32 - 7 . 37 ( m , 2h ), 7 . 26 - 7 . 31 ( m , 1h ), 7 . 08 - 7 . 21 ( m , 4h ), 7 . 03 ( t , j hf = 55 . 1 hz , 1h ), 5 . 62 ( ab quartet , j ab = 9 . 5 hz , ฮดv ab = 9 . 5 hz , 2h ), 4 . 80 ( br s , 2h ), 3 . 05 ( s , 3h ), 2 . 17 ( br s , 3h ), 1 . 68 ( s , 3h ). compound c41 was converted to a racemic mixture of the products using the method described for synthesis 13 in example 13 . this racemate was obtained as an off - white solid . yield : 12 . 1 g , 32 . 4 mmol , 92 %. it was separated into its component atropenantiomers via supercritical fluid chromatography ( column : phenomenex lux cellulose - 2 , 5 ฮผm ; eluent : 55 : 45 carbon dioxide / methanol ). the first - eluting atropenantiomer exhibited a negative (โ) rotation , and was designated as example 14 ( 5 . 15 g ). this material was dissolved in hot ethyl acetate , concentrated to a volume of 50 ml , and allowed to crystallize at room temperature ; 14 was isolated as a white solid , 3 . 35 g . the filtrate was concentrated and similarly recrystallized to afford a white solid ( 450 mg ). combined yield of 14 : 3 . 8 g , 10 mmol , 28 %. the second - eluting atropenantiomer , obtained as an off - white solid exhibiting a positive (+) rotation , was designated as example 15 . yield : 4 . 9 g , 13 . 1 mmol , 37 %. 14 : lcms m / z 374 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 47 ( br s , 1h ), 8 . 27 - 8 . 31 ( m , 1h ), 8 . 02 - 8 . 07 ( m , 1h ), 7 . 12 - 7 . 21 ( m , 4h ), 7 . 03 ( t , j hf = 55 . 0 hz , 1h ), 3 . 06 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 68 ( s , 3h ). 15 : lcms m / z 374 . 0 [ m + h ] + . 1 h nmr ( 600 mhz , cdcl 3 ) ฮด 8 . 98 ( br s , 1h ), 8 . 29 ( br d , j = 4 . 7 hz , 1h ), 8 . 04 ( br d , j = 7 . 5 hz , 1h ), 7 . 13 - 7 . 21 ( m , 4h ), 7 . 03 ( t , j hf = 55 . 1 hz , 1h ), 3 . 06 ( s , 3h ), 2 . 21 ( s , 3h ), 1 . 68 ( s , 3h ). methylation of ethyl 3 - oxopentanoate according to the method of d . kalaitzakis et al ., tetrahedron : asymmetry 2007 , 18 , 2418 - 2426 , afforded ethyl 2 - methyl - 3 - oxopentanoate ; subsequent treatment with 1 equivalent of bromine in chloroform provided ethyl 4 - bromo - 2 - methyl - 3 - oxopentanoate . this crude material ( 139 g , 586 mmol ) was slowly added to a 0 ยฐ c . solution of potassium hydroxide ( 98 . 7 g , 1 . 76 mol ) in water ( 700 ml ). the internal reaction temperature rose to 30 ยฐ c . during the addition . the reaction mixture was then subjected to vigorous stirring for 4 hours in an ice bath , at which point it was acidified via slow addition of concentrated hydrochloric acid . after extraction with ethyl acetate , the aqueous layer was saturated with solid sodium chloride and extracted three additional times with ethyl acetate . the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated under reduced pressure to afford a mixture of oil and solid ( 81 . 3 g ). this material was suspended in chloroform ( 200 ml ); the solids were removed via filtration and washed with chloroform ( 2 ร 50 ml ). the combined filtrates were concentrated in vacuo and treated with a 3 : 1 mixture of heptane and diethyl ether ( 300 ml ). the mixture was vigorously swirled until some of the oil began to solidify . it was then concentrated under reduced pressure to afford an oily solid ( 60 . 2 g ). after addition of a 3 : 1 mixture of heptane and diethyl ether ( 300 ml ) and vigorous stirring for 10 minutes , filtration afforded the product as an off - white solid . yield : 28 . 0 g , 219 mmol , 37 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 4 . 84 ( br q , j = 6 . 8 hz , 1h ), 1 . 74 ( br s , 3h ), 1 . 50 ( d , j = 6 . 8 hz , 3h ). trifluoromethanesulfonic anhydride ( 23 . 7 ml , 140 mmol ) was added portion - wise to a solution of c42 ( 15 . 0 g , 117 mmol ) and n , n - diisopropylethylamine ( 99 %, 24 . 8 ml , 140 mmol ) in dichloromethane ( 500 ml ) at โ 20 ยฐ c ., at a rate sufficient to maintain the internal reaction temperature below โ 10 ยฐ c . the reaction mixture was allowed to warm gradually from โ 20 ยฐ c . to 0 ยฐ c . over 5 hours . it was then passed through a plug of silica gel , dried over magnesium sulfate , and concentrated in vacuo . the residue was suspended in diethyl ether and filtered ; the filtrate was concentrated under reduced pressure . purification using silica gel chromatography ( gradient : 0 % to 17 % ethyl acetate in heptane ) afforded the product as a pale yellow oil . yield : 21 . 06 g , 80 . 94 mmol , 69 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 5 . 09 - 5 . 16 ( m , 1h ), 1 . 94 - 1 . 96 ( m , 3h ), 1 . 56 ( d , j = 6 . 6 hz , 3h ). benzyl 4 - bromo - 3 - methylphenyl ether was converted to the product using the method described for synthesis of c33 in example 12 . the product was isolated as a yellow gel . yield : 15 g , 46 mmol , 67 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 73 ( d , j = 8 . 0 hz , 1h ), 7 . 30 - 7 . 46 ( m , 5h ), 6 . 76 - 6 . 82 ( m , 2h ), 5 . 08 ( s , 2h ), 2 . 53 ( s , 3h ), 1 . 34 ( s , 12h ). compound c43 ( 5 . 0 g , 19 mmol ), c44 ( 7 . 48 g , 23 . 1 mmol ), tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 2 . 22 g , 1 . 92 mmol ), and sodium carbonate ( 4 . 07 g , 38 . 4 mmol ) were combined in 1 , 4 - dioxane ( 100 ml ) and water ( 5 ml ), and heated at reflux for 2 hours . the reaction mixture was filtered and the filtrate was concentrated in vacuo . purification using silica gel chromatography ( eluents : 10 : 1 , then 5 : 1 petroleum ether / ethyl acetate ) provided the product as a white solid . yield : 5 . 8 g , 19 mmol , 100 %. nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 33 - 7 . 49 ( m , 5h ), 6 . 98 ( d , j = 8 . 5 hz , 1h ), 6 . 94 ( br d , j = 2 . 5 hz , 1h ), 6 . 88 ( br dd , j = 8 . 3 , 2 . 5 hz , 1h ), 5 . 20 ( qq , j = 6 . 7 , 1 . 8 hz , 1h ), 5 . 09 ( s , 2h ), 2 . 21 ( s , 3h ), 1 . 78 ( d , j = 1 . 8 hz , 3h ), 1 . 31 ( d , j = 6 . 8 hz , 3h ). a solution of c45 ( 5 . 4 g , 18 mmol ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 13 . 3 g , 87 . 4 mmol ) in acetonitrile ( 100 ml ) was cooled to โ 60 ยฐ c . oxygen was bubbled into the reaction mixture for 20 minutes at โ 60 ยฐ c . ; the solution was then stirred at 50 ยฐ c . for 18 hours . the reaction mixture was concentrated in vacuo and purified via silica gel chromatography ( eluent : 5 : 1 petroleum ether / ethyl acetate ) to provide the product as a colorless oil . yield : 3 . 5 g , 11 mmol , 61 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : ฮด 7 . 33 - 7 . 49 ( m , 5h ), 6 . 92 - 6 . 96 ( m , 1h ), 6 . 88 ( dd , j = 8 . 5 , 2 . 5 hz , 1h ), 5 . 09 ( s , 2h ), 2 . 20 ( s , 3h ), 1 . 73 ( s , 3h ). a mixture of c46 ( 3 . 5 g , 11 mmol ) and hydrazine hydrate ( 85 % in water , 1 . 9 g , 32 mmol ) in n - butanol ( 60 ml ) was heated at reflux for 18 hours . after removal of volatiles under reduced pressure , the residue was stirred with ethyl acetate ( 20 ml ) for 30 minutes , whereupon filtration provided the product as a white solid . yield : 2 . 0 g , 6 . 2 mmol , 56 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 10 . 93 ( br s , 1h ), 7 . 33 - 7 . 51 ( m , 5h ), 6 . 96 ( s , 1h ), 6 . 88 - 6 . 94 ( m , 2h ), 5 . 10 ( s , 2h ), 2 . 04 ( s , 3h ), 1 . 95 ( s , 3h ), 1 . 91 ( s , 3h ). a mixture of c47 ( 17 . 8 g , 55 . 6 mmol ), 3 , 4 - dihydro - 2h - pyran ( 233 g , 2 . 77 mol ) and p - toluenesulfonic acid monohydrate ( 2 . 1 g , 11 mmol ) in tetrahydrofuran ( 800 ml ) was heated at reflux for 18 hours . triethylamine ( 10 ml , 72 mmol ) was added , and the mixture was concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 25 % ethyl acetate in petroleum ether ) afforded the product as a solid , presumed to be a mixture of diastereomeric atropisomers from its 1 h nmr spectrum . yield : 20 g , 49 mmol , 88 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : ฮด 7 . 32 - 7 . 50 ( m , 5h ), 6 . 82 - 6 . 96 ( m , 3h ), 6 . 15 ( br d , j = 10 . 3 hz , 1h ), 5 . 08 ( s , 2h ), 4 . 14 - 4 . 23 ( m , 1h ), 3 . 76 - 3 . 85 ( m , 1h ), 2 . 28 - 2 . 41 ( m , 1h ), 2 . 01 and 2 . 04 ( 2 s , total 3h ), 1 . 97 and 1 . 98 ( 2 s , total 3h ), 1 . 89 and 1 . 89 ( 2 s , total 3h ). palladium ( 10 % on carbon , 1 . 16 g , 1 . 09 mmol ) was added to a solution of c48 ( 1 . 47 g , 3 . 63 mmol ) in methanol ( 30 ml ) and ethyl acetate ( 10 ml ), and the mixture was hydrogenated ( 50 psi ) on a parr shaker for 18 hours at room temperature . the reaction mixture was filtered through diatomaceous earth , and the filter pad was rinsed with ethyl acetate ; the combined filtrates were concentrated in vacuo and triturated with heptane , affording the product as a white solid , judged to be a mixture of diastereomeric atropisomers from its 1 h nmr spectrum . yield : 1 . 01 g , 3 . 21 mmol , 88 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : ฮด 6 . 74 - 6 . 85 ( m , 3h ), 6 . 12 - 6 . 17 ( m , 1h ), 4 . 15 - 4 . 23 ( m , 1h ), 3 . 76 - 3 . 84 ( m , 1h ), 2 . 28 - 2 . 41 ( m , 1h ), 1 . 99 and 2 . 01 ( 2 s , total 3h ), 1 . 97 and 1 . 98 ( 2 s , total 3h ), 1 . 89 and 1 . 89 ( 2 s , total 3h ). compound c49 was reacted with 2 - chloro - 3 -( difluoromethyl ) pyridine using the method described for synthesis of c8 in examples 3 and 4 . the product was obtained as a white solid , presumed to be a mixture of diastereomeric atropisomers from its 1 h nmr spectrum . yield : 17 . 5 g , 39 . 6 mmol , 82 %. lcms m / z 358 . 2 [( m - tetrahydropyran )+ 1 ]. 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 8 . 31 - 8 . 35 ( m , 1h ), 8 . 11 - 8 . 15 ( m , 1h ), 7 . 29 ( t , j hf = 54 . 5 hz , 1h ), 7 . 28 - 7 . 33 ( m , 1h ), 7 . 20 - 7 . 22 ( m , 1h ), 7 . 11 - 7 . 19 ( m , 2h ), 5 . 92 - 5 . 98 ( m , 1h ), 3 . 94 - 4 . 01 ( m , 1h ), 3 . 57 - 3 . 65 ( m , 1h ), 2 . 13 - 2 . 26 ( m , 1h ), 2 . 02 and 2 . 03 ( 2 br s , total 3h ), 1 . 93 - 2 . 0 ( m , 1h ), 1 . 92 ( s , 3h ), 1 . 78 ( s , 3h ), 1 . 61 - 1 . 74 ( m , 2h ), 1 . 48 - 1 . 58 ( m , 2h ). hydrogen chloride in 1 , 4 - dioxane ( 4 m , 198 ml , 792 mmol ) was added to a solution of c50 ( 17 . 5 g , 39 . 6 mmol ) in dichloromethane ( 200 ml ) and 1 , 4 - dioxane ( 200 ml ), and the reaction mixture was stirred at room temperature for 18 hours . after solvents had been removed in vacuo , the residue was suspended in diethyl ether ( 200 ml ) and slowly treated with a half - saturated aqueous solution of sodium bicarbonate . the suspension was vigorously stirred for 15 minutes , then filtered ; the collected solid was washed twice with water and twice with diethyl ether . the solid was then suspended in ethanol ( 200 ml ), concentrated to dryness , resuspended in ethanol ( 200 ml ) and concentrated once more . the residue was similarly treated with diethyl ether and with heptane to afford the racemic product as a white solid . yield : 12 . 0 g , 33 . 6 mmol , 85 %. lcms m / z 358 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) ฮด 12 . 82 ( br s , 1h ), 8 . 32 - 8 . 36 ( m , 1h ), 8 . 10 - 8 . 15 ( m , 1h ), 7 . 29 ( t , j hf = 54 . 2 hz , 1h ), 7 . 28 - 7 . 33 ( m , 1h ), 7 . 19 - 7 . 22 ( m , 1h ), 7 . 10 - 7 . 17 ( m , 2h ), 2 . 02 ( s , 3h ), 1 . 87 ( s , 3h ), 1 . 74 ( s , 3h ). separation of the racemate into its component atropenantiomers was carried out via supercritical fluid chromatography ( column : chiral technologies , chiralpak as - h , 5 ฮผm ; eluent : 85 : 15 carbon dioxide / methanol ). the first - eluting atropenantiomer , obtained as a white solid that exhibited a positive (+) rotation , was designated as example 16 . yield : 5 . 22 g , 14 . 6 mmol , 37 %. the second - eluting atropenantiomer , also obtained as a white solid but with a negative (โ) rotation , was designated as example 17 . yield : 5 . 31 g , 14 . 8 mmol , 37 %. 16 : lcms m / z 358 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 23 - 8 . 27 ( m , 1h ), 8 . 08 - 8 . 12 ( m , 1h ), 7 . 26 ( dd , j = 7 . 5 , 4 . 9 hz , 1h ), 7 . 18 - 7 . 20 ( m , 1h ), 7 . 12 - 7 . 14 ( m , 2h ), 7 . 12 ( t , j hf = 55 hz , 1h ), 2 . 09 ( br d , j = 0 . 4 hz , 3h ), 2 . 00 ( s , 3h ), 1 . 90 ( s , 3h ). 17 : lcms m / z 358 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 23 - 8 . 27 ( m , 1h ), 8 . 08 - 8 . 12 ( m , 1h ), 7 . 26 ( dd , j = 7 . 6 , 5 . 0 hz , 1h ), 7 . 18 - 7 . 20 ( m , 1h ), 7 . 12 - 7 . 14 ( m , 2h ), 7 . 12 ( t , j hf = 55 hz , 1h ), 2 . 09 ( br d , j = 0 . 5 hz , 3h ), 2 . 00 ( s , 3h ), 1 . 90 ( s , 3h ). trifluoromethanesulfonic anhydride ( 1 . 3 g , 4 . 6 mmol ) was slowly added to a 0 ยฐ c . solution of c5 ( 600 mg , 1 . 6 mmol ) in pyridine ( 15 ml ), and the reaction mixture was stirred at room temperature for 3 hours . after solvent had been removed under reduced pressure , the residue was purified by silica gel chromatography ( gradient : 5 % to 17 % ethyl acetate in petroleum ether ) to afford the product as a yellow oil . yield : 790 mg , 1 . 55 mmol , 97 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 27 - 7 . 33 ( m , 2h ), 7 . 21 - 7 . 25 ( m , 1h ), 5 . 50 ( ab quartet , j ab = 9 . 2 hz , ฮดv ab = 4 . 1 hz , 2h ), 3 . 73 - 3 . 79 ( m , 2h ), 3 . 02 ( s , 3h ), 2 . 26 ( br s , 3h ), 1 . 63 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). tris ( dibenzylideneacetone ) dipalladium ( 0 ) ( 27 mg , 29 ฮผmol ) and ( r )-(+ 1 -[( s p )- 2 -( dicyclohexylphosphino ) ferrocenyl ] ethyldi - tert - butylphosphine ( josiphos ligand , 33 mg , 60 ฮผmol ) were added to a solution of c51 ( 305 mg , 0 . 600 mmol ) in degassed toluene ( 7 ml ), and the mixture was stirred for 5 minutes at room temperature . potassium thioacetate ( 274 mg , 2 . 40 mmol ) was added and the reaction mixture was heated at 120 ยฐ c . for 24 hours . it was then filtered through a pad of diatomaceous earth , and the pad was washed with ethyl acetate ; the combined filtrates were concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) provided the product as a brown gum . yield : 172 mg , 0 . 396 mmol , 66 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 38 - 7 . 44 ( m , 2h ), 7 . 15 ( d , j = 7 . 8 hz , 1h ), 5 . 48 - 5 . 53 ( m , 2h ), 3 . 73 - 3 . 79 ( m , 2h ), 3 . 03 ( s , 3h ), 2 . 47 ( s , 3h ), 2 . 20 ( s , 3h ), 1 . 65 ( s , 3h ), 1 . 00 - 1 . 06 ( m , 2h ), 0 . 03 ( s , 9h ). a solution of c52 ( 300 mg , 0 . 69 mmol ) and potassium hydroxide ( 168 mg , 2 . 99 mmol ) in a mixture of methanol ( 10 ml ) and water ( 3 drops ) was stirred at room temperature for 3 hours . after neutralization with 1 m aqueous hydrochloric acid , the mixture was concentrated in vacuo . preparative thin layer chromatography on silica gel ( eluent : 3 : 1 petroleum ether / ethyl acetate ) afforded the product as a yellow syrup . yield : 170 mg , 0 . 433 mmol , 63 % yield . compound c53 was reacted with 3 - chloro - 2 - fluoropyridine using the method described for synthesis of c8 in examples 3 and 4 . the product was obtained as a white solid . yield : 20 mg , 40 ฮผmol , 40 %. a solution of c54 ( 20 mg , 40 ฮผmol ) in trifluoroacetic acid ( 5 ml ) was stirred at room temperature for 18 hours . the reaction mixture was concentrated in vacuo and the residue was dissolved in methanol ( 5 ml ). potassium carbonate ( 69 mg , 0 . 50 mmol ) was added , and the reaction mixture was stirred at room temperature for 3 hours and filtered ; the filtrate was concentrated in vacuo and purified via preparative thin layer chromatography on silica gel ( eluent : 1 : 2 petroleum ether / ethyl acetate ) to provide the product as a white solid . yield : 7 . 5 mg , 20 ฮผmol , 50 %. lcms m / z 374 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 25 ( dd , j = 4 . 7 , 1 . 6 hz , 1h ), 8 . 19 ( br s , 1h ), 7 . 64 ( dd , j = 7 . 9 , 1 . 6 hz , 1h ), 7 . 55 - 7 . 57 ( m , 1h ), 7 . 51 - 7 . 55 ( m , 1h ), 7 . 15 ( d , j = 7 . 8 hz , 1h ), 7 . 06 ( dd , j = 7 . 9 , 4 . 6 hz , 1h ), 3 . 05 ( s , 3h ), 2 . 21 ( br s , 3h ), 1 . 68 ( s , 3h ). to a solution of tert - butyl 4 - bromo - 7 - methoxy - 1h - indole - 1 - carboxylate ( which may be prepared via tert - butoxycarbonyl protection of 4 - bromo - 7 - methoxy - 1h - indole ) ( 1 . 0 g , 3 . 1 mmol ) in 1 , 4 - dioxane ( 20 ml ) were added 4 , 4 , 4 โฒ, 4 โฒ, 5 , 5 , 5 โฒ, 5 โฒ- octamethyl - 2 , 2 โฒ- bi - 1 , 3 , 2 - dioxaborolane ( 1 . 46 g , 5 . 75 mmol ), potassium acetate ( 902 mg , 9 . 19 mmol ) and [ 1 , 1 โฒ- bis ( diphenylphosphino ) ferrocene ] dichloropalladium ( ii ), dichloromethane complex ( 498 mg , 0 . 610 mmol ). the reaction mixture was stirred for 5 hours at 120 ยฐ c ., then cooled and filtered ; the filtrate was concentrated under reduced pressure and purified via silica gel chromatography ( gradient : 0 % to 6 % ethyl acetate in petroleum ether ) to afford the product as a yellow solid . yield : 520 mg , 1 . 4 mmol , 45 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 69 ( d , j = 8 . 0 hz , 1h ), 7 . 55 ( d , j = 3 . 5 hz , 1h ), 7 . 10 ( d , j = 3 . 6 hz , 1h ), 6 . 81 ( d , j = 8 . 0 hz , 1h ), 3 . 96 ( s , 3h ), 1 . 62 ( s , 9h ), 1 . 37 ( s , 12h ). to a solution of c55 ( 600 mg , 1 . 6 mmol ) in 1 , 4 - dioxane ( 20 ml ) were added c37 ( 600 mg , 1 . 8 mmol ), tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 186 mg , 0 . 161 mmol ) and barium hydroxide ( 830 mg , 4 . 8 mmol ). the reaction mixture was stirred for 18 hours at 60 ยฐ c ., then cooled and filtered ; the filtrate was concentrated in vacuo and subjected to silica gel chromatography ( gradient : 0 % to 35 % ethyl acetate in petroleum ether ), providing the product as a yellow gum . yield : 310 mg , 0 . 61 mmol , 38 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 60 ( d , j = 3 . 6 hz , 1h ), 7 . 45 ( br d , j = 7 hz , 2h ), 7 . 27 - 7 . 39 ( m , 3h , assumed ; partially obscured by solvent peak ), 6 . 94 ( ab quartet , j ab = 8 . 2 hz , ฮดv ab = 35 . 2 hz , 2h ), 6 . 24 ( d , j = 3 . 6 hz , 1h ), 5 . 63 ( ab quartet , j ab = 9 . 4 hz , ฮดv ab = 6 . 7 hz , 2h ), 4 . 81 ( s , 2h ), 4 . 01 ( s , 3h ), 3 . 00 ( s , 3h ), 1 . 66 ( s , 9h ), 1 . 64 ( s , 3h ). boron tribromide ( 1 . 5 g , 6 . 0 mmol ) was added drop - wise to a โ 78 ยฐ c . solution of c56 ( 310 mg , 0 . 61 mmol ) in dichloromethane ( 10 ml ), and the reaction mixture was stirred for 18 hours at room temperature . after addition of methanol ( 10 ml ) and sodium bicarbonate ( 1 g ), the mixture was filtered and the filtrate was concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 4 % methanol in dichloromethane ) afforded the product as a yellow gum . yield : 40 mg , 0 . 15 mmol , 24 %. 1 h nmr ( 400 mhz , cd 3 od ) ฮด 7 . 29 ( d , j = 3 . 0 hz , 1h ), 6 . 70 ( ab quartet , j ab = 7 . 7 hz , ฮดv ab = 41 . 9 hz , 2h ), 6 . 18 ( d , j = 3 . 1 hz , 1h ), 3 . 00 ( s , 3h ), 1 . 61 ( s , 3h ). 2 - chloro - 3 -( trifluoromethyl ) pyridine ( 133 mg , 0 . 733 mmol ) and cesium fluoride ( 12 mg , 79 ฮผmol ) were added to a solution of c57 ( 20 mg , 74 ฮผmol ) in n , n - dimethylformamide ( 5 ml ). the reaction mixture was stirred for 18 hours at 100 ยฐ c ., then cooled and filtered . the filtrate was concentrated under reduced pressure , and the residue was purified by preparative thin layer chromatography on silica gel ( eluent : 10 : 1 dichloromethane / methanol ) to provide the product as a white solid . yield : 9 . 2 mg , 22 ฮผmol , 30 %. lcms m / z 417 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 20 - 8 . 27 ( m , 2h ), 7 . 34 ( d , j = 3 . 1 hz , 1h ), 7 . 28 ( br dd , j = 7 , 5 hz , 1h ), 7 . 01 ( ab quartet , j ab = 7 . 9 hz , ฮดv ab = 4 . 4 hz , 2h ), 6 . 35 ( d , j = 3 . 1 hz , 1h ), 3 . 05 ( s , 3h ), 1 . 65 ( s , 3h ). preparations p1 and p2 describe preparations of some starting materials or intermediates used for preparation of certain exemplar compounds of the invention . this experiment was carried out four times . tributyl ( methoxy ) stannane ( 400 g , 1 . 24 mol ), 1 - bromo - 4 - methoxy - 2 - methylbenzene ( 250 g , 1 . 24 mol ), prop - 1 - en - 2 - yl acetate ( 187 g , 1 . 87 mol ), palladium ( ii ) acetate ( 7 . 5 g , 33 mmol ) and tri - o - tolylphosphine ( 10 g , 33 mmol ) were stirred together in toluene ( 2 l ) at 100 ยฐ c . for 18 hours . after it had cooled to room temperature , the reaction mixture was treated with aqueous potassium fluoride solution ( 4 m , 400 ml ) and stirred for 2 hours at 40 ยฐ c . the resulting mixture was diluted with toluene ( 500 ml ) and filtered through diatomaceous earth ; the filter pad was thoroughly washed with ethyl acetate ( 2 ร 1 . 5 l ). the organic phase from the combined filtrates was dried over sodium sulfate , filtered , and concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 5 % ethyl acetate in petroleum ether ) provided the product as a yellow oil . combined yield : 602 g , 3 . 38 mol , 68 %. lcms m / z 179 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 05 ( d , j = 8 . 3 hz , 1h ), 6 . 70 - 6 . 77 ( m , 2h ), 3 . 79 ( s , 3h ), 3 . 65 ( s , 2h ), 2 . 22 ( s , 3h ), 2 . 14 ( s , 3h ). compound c58 ( 6 . 00 g , 33 . 7 mmol ) and selenium dioxide ( 7 . 47 g , 67 . 3 mmol ) were suspended in 1 , 4 - dioxane ( 50 ml ) and heated at 100 ยฐ c . for 18 hours . the reaction mixture was cooled to room temperature and filtered through diatomaceous earth ; the filtrate was concentrated in vacuo . silica gel chromatography ( eluent : 10 % ethyl acetate in heptane ) afforded the product as a bright yellow oil . yield : 2 . 55 g , 13 . 3 mmol , 39 %. lcms m / z 193 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 7 . 66 ( d , j = 8 . 6 hz , 1h ), 6 . 81 ( br d , half of ab quartet , j = 2 . 5 hz , 1h ), 6 . 78 ( br dd , half of abx pattern , j = 8 . 7 , 2 . 6 hz , 1h ), 3 . 87 ( s , 3h ), 2 . 60 ( br s , 3h ), 2 . 51 ( s , 3h ). compound c59 ( 4 . 0 g , 21 mmol ) and glycinamide acetate ( 2 . 79 g , 20 . 8 mmol ) were dissolved in methanol ( 40 ml ) and cooled to โ 10 ยฐ c . aqueous sodium hydroxide solution ( 12 n , 3 . 5 ml , 42 mmol ) was added , and the resulting mixture was slowly warmed to room temperature . after stirring for 3 days , the reaction mixture was concentrated in vacuo . the residue was diluted with water , and 1 m aqueous hydrochloric acid was added until the ph was approximately 7 . the aqueous phase was extracted with ethyl acetate , and the combined organic extracts were washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated under reduced pressure . the resulting residue was slurried with 3 : 1 ethyl acetate / heptane , stirred for 5 minutes , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : ethyl acetate ) provided the product as a tan solid that contained 15 % of an undesired regioisomer ; this material was used without further purification . yield : 2 . 0 g . lcms m / z 231 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 09 ( s , 1h ), 7 . 14 ( d , j = 8 . 2 hz , 1h ), 6 . 82 - 6 . 87 ( m , 2h ), 3 . 86 ( s , 3h ), 2 . 20 ( s , 3h ), 2 . 11 ( s , 3h ). compound c60 ( from the previous step , 1 . 9 g ) was dissolved in n , n - dimethylformamide ( 40 ml ). lithium bromide ( 0 . 86 g , 9 . 9 mmol ) and sodium bis ( trimethylsilyl ) amide ( 95 %, 1 . 91 g , 9 . 89 mmol ) were added , and the resulting solution was stirred for 30 minutes . methyl iodide ( 0 . 635 ml , 10 . 2 mmol ) was added and stirring was continued at room temperature for 18 hours . the reaction mixture was then diluted with water and brought to a ph of approximately 7 by slow portion - wise addition of 1 m aqueous hydrochloric acid . the aqueous layer was extracted with ethyl acetate and the combined organic layers were washed several times with water , dried over magnesium sulfate , filtered , and concentrated . silica gel chromatography ( gradient : 75 % to 100 % ethyl acetate in heptane ) afforded the product as a viscous orange oil . yield : 1 . 67 g , 6 . 84 mmol , 33 % over two steps . lcms m / z 245 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 17 ( s , 1h ), 7 . 03 ( br d , j = 8 hz , 1h ), 6 . 85 - 6 . 90 ( m , 2h ), 3 . 86 ( s , 3h ), 3 . 18 ( s , 3h ), 2 . 08 ( br s , 3h ), 2 . 00 ( s , 3h ). to a โ 78 ยฐ c . solution of c61 ( 1 . 8 g , 7 . 4 mmol ) in dichloromethane ( 40 ml ) was added a solution of boron tribromide in dichloromethane ( 1 m , 22 ml , 22 mmol ). the cooling bath was removed after 30 minutes , and the reaction mixture was allowed to warm to room temperature and stir for 18 hours . the reaction was cooled to โ 78 ยฐ c ., and methanol ( 10 ml ) was slowly added ; the resulting mixture was gradually warmed to room temperature . after the solvent had been removed in vacuo , methanol ( 20 ml ) was added , and the mixture was again concentrated under reduced pressure . the residue was diluted with ethyl acetate ( 300 ml ) and water ( 200 ml ), the aqueous layer was brought to ph 7 via portion - wise addition of saturated aqueous sodium carbonate solution , and the mixture was extracted with ethyl acetate ( 3 ร 200 ml ). the combined organic layers were washed with water and with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo to afford the product as a light tan solid . yield : 1 . 4 g , 6 . 0 mmol , 81 %. lcms m / z 231 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 21 ( s , 1h ), 6 . 98 ( d , j = 8 . 2 hz , 1h ), 6 . 87 - 6 . 89 ( m , 1h ), 6 . 85 ( br dd , j = 8 . 2 , 2 . 5 hz , 1h ), 3 . 22 ( s , 3h ), 2 . 06 ( br s , 3h ), 2 . 03 ( s , 3h ). 3 - methylphenol ( 9 . 0 g , 83 mmol ) was combined with trifluoromethanesulfonic acid ( 90 ml ), cooled to โ 10 ยฐ c ., and treated in a drop - wise manner with propanoyl chloride ( 7 . 7 g , 83 mmol ). the reaction mixture was stirred at โ 10 ยฐ c . for 3 hours and then at room temperature for 18 hours , whereupon it was poured into ice water ( 600 ml ). the resulting solid was collected via filtration and purified by silica gel chromatography ( gradient : 5 % to 70 % ethyl acetate in petroleum ether ) to afford the product as an off - white solid . yield : 6 . 7 g , 41 mmol , 49 %. 1 h nmr ( 400 mhz , cd 3 od ) ฮด 7 . 75 ( d , j = 8 . 5 hz , 1h ), 6 . 64 - 6 . 69 ( m , 2h ), 2 . 92 ( q , j = 7 . 3 hz , 2h ), 2 . 45 ( s , 3h ), 1 . 13 ( t , j = 7 . 3 hz , 3h ). this experiment was carried out in four batches . a mixture of c62 ( 1 . 0 g , 6 . 1 mmol ) and n , n - dimethylformamide dimethyl acetal ( 15 ml ) was stirred at 130 ยฐ c . for 30 hours . the four reaction mixtures were combined and concentrated to dryness , providing the product as a dark oil . this was used for the next step without further purification . yield : 5 . 0 g , 21 mmol , 86 %. this experiment was carried out in two batches . a mixture of c63 ( from the previous step , 2 . 5 g , 11 mmol ), 1 - methylurea ( 1 . 35 g , 18 . 2 mmol ) and p - toluenesulfonic acid ( 3 . 13 g , 18 . 2 mmol ) in 1 , 4 - dioxane ( 100 ml ) was heated at reflux for 40 hours , then concentrated under reduced pressure . the residue was mixed with toluene ( 100 ml ), treated with p - toluenesulfonic acid ( 3 . 13 g , 18 . 2 mmol ) and heated at reflux for another 20 hours . the two crude products were combined and concentrated in vacuo . purification via silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) afforded the product as a brown solid . yield : 2 . 5 g , 10 mmol , 45 %. 1 h nmr ( 400 mhz , cdcl 3 ) ฮด 8 . 52 ( s , 1h ), 6 . 98 ( br d , half of ab quartet , j = 9 hz , 1h ), 6 . 86 - 6 . 92 ( m , 2h ), 3 . 87 ( s , 3h ), 3 . 24 ( s , 3h ), 2 . 08 ( s , 3h ), 1 . 78 ( s , 3h ). to a โ 70 ยฐ c . solution of c64 ( 2 . 5 g , 10 mmol ) in dichloromethane ( 100 ml ) was added boron tribromide ( 17 . 9 g , 71 . 4 mmol ) drop - wise . the reaction mixture was stirred at โ 60 ยฐ c . to โ 70 ยฐ c . for 1 hour and then at room temperature for 18 hours , whereupon it was cooled to โ 60 ยฐ c . and quenched with methanol . water ( 100 ml ) was added , and the mixture was adjusted to a ph of 6 via slow addition of solid sodium bicarbonate . the mixture was extracted with dichloromethane ( 100 ml ) and with ethyl acetate ( 5 ร 100 ml ); the combined organic layers were dried , filtered , and concentrated in vacuo . the residue was washed with a mixture of petroleum ether and ethyl acetate ( 4 : 1 , 40 ml ) and the solid was collected by filtration to afford the product as a yellow solid . yield : 2 . 2 g , 9 . 5 mmol , 95 %. lcms m / z 231 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) ฮด 8 . 65 ( s , 1h ), 7 . 05 ( d , j = 8 . 3 hz , 1h ), 6 . 88 - 6 . 91 ( br s , 1h ), 6 . 87 ( br dd , j = 8 . 3 , 2 . 2 hz , 1h ), 3 . 38 ( s , 3h ), 2 . 11 ( s , 3h ), 1 . 89 ( s , 3h ). method a describes a specific method for preparations of certain exemplar compounds of the invention . a solution of c5 in n , n - dimethylformamide ( 0 . 33 m , 300 ฮผl , 100 ฮผmol ) was combined in a reaction vial with the appropriately substituted 2 - chloropyridine or 2 - fluoropyridine ( 100 ฮผmol ). potassium carbonate ( 300 ฮผmol ), copper ( i ) iodide ( 10 ฮผmol ) and tetrabutylammonium bromide ( 20 ฮผmol ) were added under nitrogen , and the vial was capped and shaken at 130 ยฐ c . for 16 hours . solvent was removed using a speedvac ยฎ concentrator , and the residue was partitioned between ethyl acetate ( 1 ml ) and water ( 1 ml ); the aqueous layer was extracted with ethyl acetate ( 2 ร 1 ml ), and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated to provide the crude product , which was used directly in the following step . the 1 , 5 - dimethyl - 6 -[ 2 - methyl - 4 -( substituted pyridin - 2 - yloxy ) phenyl ]- 3 -{[ 2 -( trimethylsilyl ) ethoxy ] methyl } pyrimidine - 2 , 4 ( 1h , 3h )- dione ( c65 ) from the previous step was dissolved in a mixture of dichloromethane and trifluoroacetic acid ( 4 : 1 , 1 ml ), and the reaction vial was capped and shaken at 30 ยฐ c . for 16 hours . after removal of solvents , the product was purified by high - performance liquid chromatography using one of the following systems : a ) dikma diamonsil ( 2 ) c18 , 5 ฮผm ; mobile phase a : water containing 0 . 225 % formic acid ; mobile phase b : acetonitrile containing 0 . 225 % formic acid ; gradient : 35 % to 70 % b ; b ) phenomenex gemini c18 , 8 ฮผm ; mobile phase a : aqueous ammonium hydroxide , ph 10 ; mobile phase b : acetonitrile ; gradient : 35 % to 75 % b . table 1 below lists some additional exemplar compounds of invention ( examples 20 - 81 ) that were made using methods , intermediates , and preparations described herein . 7 . the requisite 2 - chloropyridine was prepared via reaction of 2 - chloro - 3 - iodopyridine with a salt of the appropriate azetidine , using palladium ( ii ) acetate , 1 , 1 โฒ- binaphthalene - 2 , 2 โฒ- diylbis ( diphenylphosphane ) ( binap ) and cesium carbonate in toluene at elevated temperature . 8 . reaction of 2 - chloropyridin - 3 - ol with bromocyclopropane , in the presence of cesium carbonate in n , n - dimethylacetamide at 150 ยฐ c ., afforded 2 - chloro - 3 -( cyclopropyloxy ) pyridine . 9 . reaction of 2 - chloro - 5 - fluoropyridin - 4 - ol with iodomethane and silver carbonate provided 2 - chloro - 5 - fluoro - 4 - methoxypyridine . 10 . the reaction between phenol c5 and the chloropyridine was effected via reaction with copper ( i ) iodide and cesium carbonate in pyridine at 120 ยฐ c . 13 . olefin reduction was effected via hydrogenation using palladium on carbon and n , n - diisopropylethylamine in methanol . 14 . in this case , reaction with the chloropyridine was carried out using 4 , 5 - bis ( diphenylphosphino )- 9 , 9 - dimethylxanthene ( xantphos ) in place of di - tert - butyl [ 3 , 4 , 5 , 6 - tetramethyl - 2 โฒ, 4 โฒ, 6 โฒ- tri ( propan - 2 - yl ) biphenyl - 2 - yl ] phosphane . 15 . 1 -( 2 - chloropyridin - 3 - yl ) ethanone was converted to 2 - chloro - 3 -( 1 , 1 - difluoroethoxyl ) pyridine using the method of d . b . horne et al ., tetrahedron lett . 2009 , 50 , 5452 - 5455 . upon deprotection , the difluoroethoxy group was also cleaved . 16 . in this case , cesium fluoride was used in place of cesium carbonate in the reaction of the chloropyridine with phenol c49 . 17 . compound c3 was reacted with ( 4 - hydroxyphenyl ) boronic acid , under the conditions described for preparation of c4 in examples 1 and 2 , to afford 6 -( 4 - hydroxyphenyl )- 1 , 5 - dimethyl - 3 -{[ 2 -( trimethylsilyl ) ethoxy ] methyl } pyrimidine - 2 , 4 ( 1h , 3h )- dione . 18 . in this case , the deprotection was carried out in trifluoroacetic acid at 100 ยฐ c . 19 . the racemic product was separated into its atropenantiomers via high - performance liquid chromatography ( column : chiral technologies , chiralpak ad - h , 5 ฮผm ; gradient : ethanol in heptane ). this example was the first - eluting atropenantiomer , and exhibited a positive (+) rotation . 20 . compound c49 was reacted with 2 - chloro - 3 - iodopyridine to afford 5 -{ 4 -[( 3 - iodopyridin - 2 - yl ) oxy ]- 2 - methylphenyl }- 4 , 6 - dimethyl - 2 -( tetrahydro - 2h - pyran - 2 - yl ) pyridazin - 3 ( 2h )- one ; subsequent suzuki reaction with cyclopropylboronic acid provided 5 -{ 4 -[( 3 - cyclopropylpyridin - 2 - yl ) oxy ]- 2 - methylphenyl }- 4 , 6 - dimethyl - 2 -( tetrahydro - 2h - pyran - 2 - yl ) pyridazin - 3 ( 2h )- one . deprotection in this case was carried out with trifluoroacetic acid rather than hydrochloric acid . 21 . the requisite 2 - chloro - 3 -( oxetan - 3 - yl ) pyridine was prepared from ( 2 - chloropyridin - 3 - yl ) boronic acid using the method reported by m . a . j . duncton et al ., org . lett . 2008 , 10 , 3259 - 3262 . 22 . 2 - chloro - 3 -( difluoromethoxy )- 4 - methylpyridine was prepared from 2 - chloro - 4 - methylpyridin - 3 - ol using conditions reported by l . f . frey et al ., tetrahedron 2003 , 59 , 6363 - 6373 . 23 . the racemic product was separated into its component atropenantiomers using chiral separation . conditions for analytical hplc . column : chiralpak ad - h , 20 ร 250 mm ; mobile phase a : heptane ; mobile phase b : ethanol ; gradient : 5 . 0 % to 95 % b , linear over 12 minutes ; flow rate : 28 ml / minute . the first - eluting atropenantiomer , which exhibited a positive (+) rotation , was designated as example 55 ; the second - eluting one , which gave a negative (โ) rotation , was designated as example 54 . 24 . the requisite 2 -[ 1 -( 3 , 4 - dimethoxybenzyl )- 3 , 5 - dimethyl - 2 , 6 - dioxo - 1 , 2 , 3 , 6 - tetrahydropyrimidin - 4 - yl ]- 5 - hydroxybenzonitrile was prepared via reaction of c26 with 5 - hydroxy - 2 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) benzonitrile , mediated by chloro ( 2 - dicyclohexylphosphino - 2 โฒ, 6 โฒ- dimethoxy - 1 , 1 โฒ- biphenyl )[ 2 -( 2 โฒ- amino - 1 , 1 โฒ- biphenyl )] palladium ( ii ) and potassium phosphate . 25 . conditions for analytical hplc . column : waters atlantis dc18 , 4 . 6 ร 50 mm , 5 ฮผm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 5 . 0 % to 95 % b , linear over 4 . 0 minutes ; flow rate : 2 ml / minute . 26 . reaction of c49 with methyl 2 - chloropyridine - 3 - carboxylate afforded methyl 2 -{ 4 -[ 3 , 5 - dimethyl - 6 - oxo - 1 -( tetrahydro - 2h - pyran - 2 - yl )- 1 , 6 - dihydropyridazin - 4 - yl ]- 3 - methylphenoxy } pyridine - 3 - carboxylate ; the ester group was converted to an amide via subjection to ammonium hydroxide in methanol at elevated temperature , to provide 2 -{ 4 -[ 3 , 5 - dimethyl - 6 - oxo - 1 -( tetrahydro - 2h - pyran - 2 - yl )- 1 , 6 - dihydropyridazin - 4 - yl ]- 3 - methylphenoxy } pyridine - 3 - carboxamide . 27 . methyl 2 -{ 4 -[ 3 , 5 - dimethyl - 6 - oxo - 1 -( tetrahydro - 2h - pyran - 2 - yl )- 1 , 6 - dihydropyridazin - 4 - yl ]- 3 - methylphenoxy } pyridine - 3 - carboxylate ( see footnote 26 ) was deprotected to afford this example . 28 . 2 , 4 - dichloro - 3 - methylpyridine was converted to 2 - chloro - 4 - methoxy - 3 - methylpyridine via reaction with sodium hydride / methanol . 29 . in this case , the deprotection was carried out with trifluoroacetic acid in dichloromethane at room temperature . 30 . the requisite 2 - chloro - 4 - methyl - 3 -( trifluoromethyl ) pyridine was prepared via reaction of 2 - chloro - 3 - iodo - 4 - methylpyridine with methyl difluoro ( fluorosulfonyl ) acetate and copper ( i ) iodide in n , n - dimethylformamide at 90 ยฐ c . 32 . reaction of 2 , 4 - dichloro - 3 - iodopyridine with sodium methoxide in methanol provided 2 - chloro - 3 - iodo - 4 - methoxypyridine ; this material was converted to 2 - chloro - 4 - methoxy - 3 -( trifluoromethyl ) pyridine as described in footnote 30 . 33 . the final deprotection was carried using hydrogen chloride in methanol , at room temperature . 34 . deprotection was carried out using the method described in examples 16 and 17 . 35 . separation of atropenantiomers was carried out via supercritical fluid chromatography ( column : chiral technologies , chiralpak as - h , 5 ฮผm ; eluent : 85 : 15 carbon dioxide / methanol ). the first - eluting atropenantiomer exhibited a positive (+) rotation , and was designated as example 66 . the second - eluting atropenantiomer displayed a negative (โ) rotation , and was designated as example 65 . 36 . in this case , mass spectrometry data was obtained on the racemate , prior to separation of the atropenantiomers . 37 . compound c37 was reacted with ( 4 - hydroxyphenyl ) boronic acid , using the method described for preparation of c4 in examples 1 and 2 , to afford 3 -[( benzyloxy ) methyl ]- 6 -( 4 - hydroxyphenyl )- 1 , 5 - dimethylpyrimidine - 2 , 4 ( 1h , 3h )- dione . 38 . conditions for reaction of the phenol with the chloropyridine were similar to those used for synthesis of c7 in examples 1 and 2 . 39 . after the coupling reaction , the reaction mixture was partitioned between water and ethyl acetate . the organic layer was dried with sodium sulfate and concentrated in vacuo ; this material was deprotected with hydrogen chloride in 1 , 4 - dioxane . 40 . purification was effected via reversed phase high - performance liquid chromatography . column : waters sunfire c18 , 5 ฮผm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 30 % to 50 % b . 41 . purification was carried out via reversed phase high - performance liquid chromatography using an appropriate gradient in one of the following systems : a ) column : agela durashell c18 , 5 ฮผm ; mobile phase a : ammonium hydroxide in water , ph 10 ; mobile phase b : acetonitrile ; b ) column : phenomenex gemini , 10 ฮผm ; mobile phase a : ammonium hydroxide in water , ph 10 ; mobile phase b : acetonitrile ; c ) column : phenomenex gemini , 8 ฮผm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; d ) column : yms c18 , 5 ฮผm ; mobile phase a : ammonium hydroxide in water , ph 10 ; mobile phase b : acetonitrile . 42 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 ร 50 mm , 5 ฮผm . mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile . gradient : 0 to 0 . 5 minutes , 10 % b ; 0 . 5 to 4 . 0 minutes , linear from 10 % to 100 % b . flow rate : 0 . 8 ml / minute . 43 . compound c33 was reacted with 6 - bromo - 3 -( 3 , 4 - dimethoxybenzyl )- 1 - cyclopropyl - 5 - methylpyrimidine - 2 , 4 ( 1h , 3h )- dione , using the method described for example 12 , to yield example 81 . the intermediate , 6 - bromo - 3 -( 3 , 4 - dimethoxybenzyl )- 1 - cyclopropyl - 5 - methylpyrimidine - 2 , 4 ( 1h , 3h )- dione , was prepared from commercially available 1 - cyclopropyl urea following the methods described for the preparation of c10 and c34 . the affinity of the compounds described herein was determined by competition binding assays similar to those described in ryman - rasmussen et al ., โ differential activation of adenylate cyclase and receptor internalization by novel dopamine d1 receptor agonists โ, molecular pharmacology 68 ( 4 ): 1039 - 1048 ( 2005 ). this radioligand binding assay used [ 3 h ]- sch23390 , a radiolabeled d1 ligand , to evaluate the ability of a test compound to compete with the radioligand when binding to a d1 receptor . d1 binding assays were performed using over - expressing ltk human cell lines . to determine basic assay parameters , ligand concentrations were determined from saturation binding studies where the k d for [ 3 h ]- sch23390 was found to be 1 . 3 nm . from tissue concentration curve studies , the optimal amount of tissue was determined to be 1 . 75 mg / ml per 96 well plate using 0 . 5 nm of [ 3 h ]- sch23390 . these ligand and tissue concentrations were used in time course studies to determine linearity and equilibrium conditions for binding . binding was at equilibrium with the specified amount of tissue in 30 minutes at 37 ยฐ c . from these parameters , k i values were determined by homogenizing the specified amount of tissue for each species in 50 mm tris ( ph 7 . 4 at 4 ยฐ c .) containing 2 . 0 mm mgcl 2 using a polytron and spun in a centrifuge at 40 , 000 ร g for 10 minutes . the pellet was resuspended in assay buffer [ 50 mm tris ( ph 7 . 4 @ rt ) containing 4 mm mgso 4 and 0 . 5 mm edta ]. incubations were initiated by the addition of 200 ฮผl of tissue to 96 - well plates containing test drugs ( 2 . 5 ฮผl ) and 0 . 5 nm [ 3 h ]- sch23390 ( 50 ฮผl ) in a final volume of 250 ฮผl . non - specific binding was determined by radioligand binding in the presence of a saturating concentration of (+)- butaclamol ( 10 ฮผm ), a d1 antagonist . after a 30 minute incubation period at 37 ยฐ c ., assay samples were rapidly filtered through unifilter - 96 gf / b pei - coated filter plates and rinsed with 50 mm tris buffer ( ph 7 . 4 at 4 ยฐ c .). membrane bound [ 3 h ]- sch23390 levels were determined by liquid scintillation counting of the filterplates in ecolume . the ic 50 value ( concentration at which 50 % inhibition of specific binding occurs ) was calculated by linear regression of the concentration - response data in microsoft excel . k , values were calculated according to the cheng - prusoff equation : where [ l ]= concentration of free radioligand and k d = dissociation constant of radioligand for d1 receptor ( 1 . 3 nm for [ 3 h ]- sch23390 ). the d1 camp ( cyclic adenosine monophosphate ) htrf ( homogeneous time - resolved fluorescence ) assay used and described herein is a competitive immunoassay between native camp produced by cells and camp labeled with xl - 665 . this assay was used to determine the ability of a test compound to agonize ( including partially agonize ) d1 . a mab anti - camp labeled cryptate visualizes the tracer . the maximum signal is achieved if the samples do not contain free camp due to the proximity of donor ( eu - cryptate ) and acceptor ( xl665 ) entities . the signal , therefore , is inversely proportional to the concentration of camp in the sample . a time - resolved and ratiometric measurement ( em 665 nm / em 620 nm ) minimizes the interference with medium . camp htrf assays are commercially available , for example , from cisbio bioassays , iba group . the camp dynamic kit was obtained from cisbio international ( cisbio 62am4pej ). multidrop combi ( thermo scientific ) was used for assay additions . an envision ( perkinelmer ) reader was used to read htrf . a hek293t / hd1 # 1 stable cell line was constructed internally ( pfizer ann arbor ). the cells were grown as adherent cells in nunct 500 flasks in high glucose dmem ( invitrogen 11995 - 065 ), 10 % fetal bovine serum dialyzed ( invitrogen 26400 - 044 ), 1 ร mem neaa ( invitrogen 1140 , 25 mm hepes ( invitrogen 15630 ), lx pen / strep ( invitrogen 15070 - 063 ) and 500 ฮผg / ml genenticin ( invitrogen 10131 - 035 ) at 37 ยฐ c . and 5 % co 2 . at 72 or 96 hours post - growth , cells were rinsed with dpbs , and 0 . 25 % trypsin - edta was added to dislodge the cells . media was then added and cells were centrifuged and media removed . the cell pellets were re - suspended in cell culture freezing medium ( invitrogen 12648 - 056 ) at a density of 4e7 cells / ml . one ml aliquots of the cells were made in cryo - vials and frozen at โ 80 ยฐ c . for future use in the d1 htrf assay . frozen cells were quickly thawed , re - suspended in 50 ml warm media and allowed to sit for 5 min prior to centrifugation ( 1000 rpm ) at room temperature . media was removed and cell pellet was re - suspended in pbs / 0 . 5 ฮผm ibmx generating 2e5 cells / ml . using a multidrop combi , 5 ฮผl cells / well was added to the assay plate ( greiner 784085 ), which already contained 5 ฮผl of a test compound . compound controls [ 5 ฮผm dopamine ( final ) and 0 . 5 % dmso ( final )] were also included on every plate for data analysis . cells and compounds were incubated at room temperature for 30 min . working solutions of camp - d2 and anti - camp - cryptate were prepared according to cisbio instructions . using multidrop , 5 ฮผl camp - d2 working solution was added to the assay plate containing the test compound and cells . using multidrop , 5 ฮผl anti - camp - cryptate working solutions was added to assay plate containing test compound , cells and camp - d2 . the assay plate was incubated for 1 hour at room temperature . the assay plate was read on an envision plate reader using cisbio recommended settings . a camp standard curve was generated using camp stock solution provided in the cisbio kit . data analysis was done using computer software . percent effects were calculated from the compound controls . ratio ec 50 was determined using the raw ratio data from the envision reader . the camp standard curve was used in an analysis program to determine camp concentrations from raw ratio data . camp ec 50 was determined using the calculated camp data . various modifications of the invention , in addition to those described herein , will be apparent to those skilled in the art from the foregoing description . such modifications are also intended to fall within the scope of the appendant claims . each reference ( including all patents , patent applications , journal articles , books , and any other publications ) cited in the present application is hereby incorporated by reference in its entirety .
| 2 |
as indicated in fig1 , a typical swimming pool comprises a pool 10 , which has a drain 11 and sump 12 at the bottom of the pool , and a skimmer 14 , which carries away overflow and collects floating debris , a strainer 15 at the inlet to a pump 16 , a filter 17 , a water main 18 , a source of fresh water , a system outlet 19 and a pool inlet 20 . pipes 21 - 30 and valves 31 - 36 connect all of the aforesaid elements . in normal operation water is taken from the pool through the skimmer 14 , the pipe 21 , the valve 31 , pipes 22 and 23 , strainer 15 , pump 16 , pipe 24 , valve 32 , pipe 25 , filter 17 , pipe 26 , valve 33 and pipe 27 , back to the pool inlet 20 . valve 34 allows water to be recirculated in whole or in part from the bottom drain 11 and valve 35 allows water to be gravity dumped through pipe 29 to the system outlet 19 . valve 36 connects the main 18 to replenish through pipes 28 and 23 . the valves 32 and 33 may be turned to backwash the filter 17 via pipe 30 . the skimmer 14 is arranged to collect leaves and other floating debris . to prevent the plugging of pipes 21 , 22 , 23 , and pump 16 , the skimmer 14 has perforated basket 41 of larger diameter and strainer 15 has a strainer basket 42 . while the flow velocity of the baskets is much less than in the pipes , it is still perceptible and non - uniform so that when a container of chemical of the kind described hereafter is dropped into the perforated basket in the skimmer , or in the strainer basket , it bobs or flutters with the flow through the baskets . the feeder may be inserted at these places or a special chamber . fig2 is representative of a practical embodiment for a dispensing container for chemicals , hereinafter termed a โ feeder โ ( the etani patents ). the feeder comprises two plastic hemispheres 101 , 102 which are joined together in the manner of some table tennis balls with cement . the hemisphere 101 has a filling hole 105 , which is closed by a plug 110 . for dispensing the chemical , there are a number of small holes 112 in the hemisphere 101 . plug 110 has a porous buoyant portion 114 . fig3 represents a construction in which two hemispheres 121 and 122 are joined at a flange . the thermo - plastic hemispheres with flanges can be made easily by the vacuum - forming process . this is the preferred construction when polyvinyl chloride ( pvc ) is used , or when the filling chemical is compressed into a solid ball โ brickette โ. the flange closure is readily achieved by ultrasonic welding , and the flange assists the rotation of the feeder in the eddies of flow . it also facilitates the handling and packaging of the feeders . the body of chemical , or an added weight 127 tends to stabilize the upward orientation of the feeder holes in conditions of low flow . fig4 represents an alternate closure of the feeder of fig3 . in this construction the feeder is filled by the supplier with a desired quantity of chemical 140 , leaving an empty space 141 , and sealed with a patch 144 . the empty space may be filled with inert gas for chemicals which may be degraded in the presence of air or moisture . with this construction , the user must make the proper number of dispensing holes by piercing the feeder with a needle or the like . fig5 is a cut - away drawing of the capsule configuration preferred for most swimming pool and spa uses . the sphere is blow molded of high density polyethylene . twenty - two grams of the polymer are needed for a sphere 2ยพ inches in diameter . the shell 150 varies somewhat in thickness between about one sixteenth and one eighth of an inch . the mold is made in two parts . when molding is complete the sphere is left with a small hole at 151 and a pair of stub wings 152 and 153 which serve the function of the flange in the configuration of fig3 . in preparation for filling , the blow hole 151 is closed , and the filling hole 154 , formed in the mold , is clealy cut through , both operations using an ultrasonic tool . it is desired that this capsule float with each dispensing hole 157 near the liquid levels inside 158 , and outside 159 , the capsule when it is resting in still water . to achieve this result , an air space 160 is left after filling with the emulsion , and zero - gauge buck shot 161 is swaged into the filler plug 162 . depending on the product , the dispensing units may be formed of a translucent plastic , and in some instances a colored opaque plastic . it therefore becomes difficult for the pool or spa owner to determine of there is any efficacy left in the dispensing unit in that most of the chemical water treatment solutions are also clear or translucent . in operation , the chemical water treatment solution is gradually dispensed through the apertures in the dispensing unit to the pool and the dispensed chemical water treatment solution is replaced by normal pool water . therefore the weight of the dispensing unit does not provide an indicia or indicate to the pool owner whether or not the chemical water treatment solution has been fully dispensed and that the dispensing unit is depleted . placement of a water soluble colorant or dye into the chemical water treatment solution at the time of filling the dispensing unit provides the pool owner with a visual indicia as to the amount of chemical water treatment solution remaining . this can be evident to the pool or spa owner by merely examining the dispensing unit if the dispensing unit is translucent to determine if the pool or spa owner detects any color within the dispensing unit which in turn would indicate that there is chemical water treatment solution remaining in the dispensing unit . in those cases where the dispensing unit is opaque , the pool or spa owner can remove the dispensing unit from the pool or spa and shake the dispensing unit to dispense a small quantity of the contents of same . if the dispensed contents have a color , it is indicative that there is still chemical water treatment solution remaining in the dispenser . when the pool or spa owner visually observes a clear liquid within a translucent container , or a clear liquid dispensed after shaking the dispensing unit , the pool or spa owner is reasonably assured that the chemical water treatment solution has been completely dispensed and that a new dispensing unit should be prepared and positioned in the pool skimmer . the dye utilized in order to color code the water treatment chemicals may be a water soluble organic or inorganic colorant or dye such as a food grade , non - toxic , biodegradable and water soluable and may include a common food coloring . the color of the dye is one of choice , however the color may be chosen to indicate the particular chemical solution and its water quality efficacy . in the case of swimming pools and spas , the water soluble organic or inorganic colorant or dye may be food grade , non - toxic , biodegradable and water soluble such as food coloring . in this manner , as it is disbursed from its concentration in the dispensing unit , the dye is diluted due to the volume of the pool or spa such that there is no aesthetic displeasing effect . in the dispensing unit of the type described herein , it has been found that an appropriate range of organic or inorganic colorant or dye is in the range of 0 . 07 percent to 10 . 0 percent with a preferred range of 0 . 07 percent to 0 . 10 percent by volume . as an example , quantities of common water quality treatment solutions are prepared in 55 gallon batches ( 7 , 040 ounces ) for filling dispensing units of the type described . it has been found that the quantity of dye required for introduction into the batch process in order to achieve a color coded water treatment solution for filling the dispensing unit can range from 5 ounces to 7 ounces per batch ( 55 gallons ; 7 , 040 ounces ). this quantity of dye in this type of batch process results in a color coded water treatment solution within a dispensing unit of the type described which is visible to the eye if the dispensing unit is constructed of a translucent plastic , and that it is further visible to the eye if the dispensing unit is constructed of an opaque plastic such that the pool or spa owner must remove the dispensing unit and shake the dispensing unit in order to dispense several drops of contents onto his hand . the presence of an effective amount of the select water treatment solution within the dispensing unit would be visible to the eye of the pool or spa user when the dispensing unit was so shaken . the purpose of the water soluble organic or inorganic colorant or dye is to provide a visual color coding indicia available to the user for efficacy of chemical introduction to the pool or spa . a greater amount of water soluble colorant or dye reduces the amount of effective chemical treatment . an increased amount of water soluble organic or inorganic colorant or dye provides increased visual indicia but limits the efficacy and duration of time release of the effective chemical . therefore a range of 0 . 07 percent to 10 . 0 percent by volume of dye provides an effective volume amount of effective chemical over time and a preferred range of 0 . 07 percent to 1 . 0 percent of dye allows for a suggested maximization of effective chemical . therefore , while the present invention has been disclosed with respect to the preferred embodiments thereof , it will be recognized by those of ordinary skill in the art that various changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore manifestly intended that the invention be limited only by the claims and the equivalence thereof .
| 1 |
the present invention discloses a packaging structure of a light - sensing device with a spacer wall , wherein a spacer is used to protect the light - sensing region from external pollutants and used to protect the regions where the electric contacts are to be formed from the overflow glue . refer to fig2 a diagram schematically showing one embodiment of the present invention . the packaging structure of a light - sensing device with a spacer wall according to one embodiment of the present invention comprises : a light transparent substrate 10 , which may filter out a light of a specific wavelength ; metallic traces 12 , installed on the light transparent substrate 10 ; multiple metallic balls 14 , disposed on the metallic traces 12 ; a light - sensing element 16 , further comprising a light - sensing region 18 and multiple metallic pads 20 , wherein the metallic pads 20 have multiple metallic contacts 22 for the electric connection between the metallic pads 20 and the metallic traces 12 ; and a spacer wall 24 , disposed between the metallic pads 20 and the light - sensing region 18 , and used to protect the light - sensing region 18 from external pollutants , wherein the spacer wall 24 may be formed via a screen - printing method and can be made of an insulation polymer with slight elasticity , such as a polyimide . in this embodiment , the height of the spacer wall 24 is controlled to be slightly larger than the spacing between the light transparent substrate 10 and the light - sensing element 16 and used to protect the light - sensing region 18 from external pollutants . in this embodiment , the objective of retarding external pollutants can be achieved without any additional glue layer . therefore , the problem of the overflow glue , which occurs in the conventional technology , can be avoided herein . refer to fig3 a diagram schematically showing another embodiment of the present invention . the packaging structure of a light - sensing device with a spacer wall according to another embodiment of the present invention comprises : a light transparent substrate 10 ; metallic traces 12 , installed on the light transparent substrate 10 ; multiple metallic balls 14 , disposed on the metallic traces 12 ; a light - sensing element 16 , further comprising a light - sensing region 18 and multiple metallic pads 20 , wherein the metallic pads 20 have multiple metallic contacts 22 for the electric connection between the metallic pads 20 and the metallic traces 12 ; two spacer walls 26 , 28 , wherein the spacer wall 26 is formed on the light transparent substrate 10 and disposed corresponding to the position between the metallic pads 20 and the light - sensing region 18 ; the spacer wall 28 is formed on the light transparent substrate 10 and disposed between the metallic ball 14 and the metallic pad 20 ; and a glue layer 30 , used to seal the gap between the light - sensing element 16 and the light transparent substrate 10 . as shown in fig3 , the glue layer 30 is confined to between the spacer wall 26 and the spacer wall 28 . even if the heights of the spacer walls 26 , 28 do not exceed the spacing between the light - sensing element 16 and the light transparent substrate 10 , the glue overflow , which occurs in the conventional technology , will not occur in this embodiment because of the surface tension of the glue . thus , the problem that the glue overflows onto the metallic balls 14 and the light - sensing region 18 can be effectively avoided herein . refer to fig4 a diagram schematically showing further embodiment of the present invention . in this embodiment , the spacer wall 26 in the abovementioned embodiment , which is originally formed on the light transparent substrate 10 and disposed corresponding to the position between the metallic pads 20 and the light - sensing region 18 , is otherwise formed on the lower surface of the light - element 16 and disposed between the metallic pads 20 and the light - sensing region 18 , as shown by the spacer wall 32 in fig4 . as shown in the abovementioned embodiments , the spacer walls 26 , 32 of the present invention are disposed between the metallic pads 20 and the light - sensing region 18 . thus , it is reasonable to design the forms of the spacer walls 26 , 32 according to the distribution contour of the metallic pads 20 , as those shown in from fig5 ( a ) to fig5 ( c ). in from fig5 ( a ) to fig5 ( c ), three common distribution contours of the metallic pads 20 โ a loop , two parallel lines , and a u - shape โ and the forms of the spacer walls 26 , 32 corresponding to those three distribution contours , which are also are a loop , two parallel lines , and a u - shape , are exemplified with the spacer wall 32 , which is formed on the light - sensing element 16 . however , according to the objective of effectively retarding external pollutants , the spacer wall of a loop shape , which encloses the light - sensing region completely , can also be applied to the cases wherein the distribution contours of the metallic pads are of a u - shape or two parallel lines . in summary , the present invention is a packaging structure of a light - sensing device with a spacer wall , which utilizes a spacer wall to protect the light - sensing region and the metallic balls from the pollution of the external pollutants or against the influence of the overflow glue in order to guarantee the yield and performance of the product . confronting the trend of fabricating slim and lightweight electronic elements , the present invention can also overcome the problem of overflow - glue pollution , which the miniaturization of electronic elements must face but the conventional technology cannot solve . those described above are only the preferred embodiments of the present invention and not intended to limit the scope of the present invention . any equivalent modification and variation according to the characteristics , the structures or the spirit of the present invention disclosed herein is to be included within the scope of the present invention .
| 7 |
in fig1 , an electromagnetic valve 10 of the prior art is shown . as its central component , the valve 10 has a substantially hollow - cylindrical tappet guide 12 , or valve insert , on the outside of which a collar 14 is embodied approximately in the middle of its length and a through opening 16 is embodied in the longitudinal direction in the interior . in the through opening 16 , a substantially circular - cylindrical tappet 18 is supported displaceably in the longitudinal direction of the tappet guide 12 . on the lower end of the tappet 18 , in terms of fig1 , a sealing body 20 is provided , which has a spherical - segment - shaped surface 22 that bulges downward . diametrically opposite the sealing body 20 , there is a sealing seat 24 or sealing body which is designed essentially hollow - cylindrically and which has a frustoconical surface 26 opposite the spherical - segment - shaped surface 22 . a spiral spring 28 , which acts as a compression spring and is braced on the sealing seat 24 , is thrust onto the lower part of the tappet 18 , which โ as can be seen from fig1 โ is designed with a smaller diameter . on the face end , facing away from this spiral spring 28 , of the substantially hollow - cylindrical sealing seat 24 , there is a virtually disk - shaped insert body 30 , with a check ball valve 32 embodied eccentrically in it . a slightly cup - shaped axial filter 34 is located on the lower face end , in terms of fig1 , of this insert body 30 . a through bore 36 is embodied in the insert body 30 , and a through bore 38 adjoining this through bore 36 is embodied in the longitudinal direction in the sealing seat 24 . through these through bores 36 and 38 , a fluid operating medium or fluid delivered through the axial filter 34 can reach the conical - segment - shaped surface 26 of the sealing seat 24 . in the operating state shown , the sealing body 20 does not rest on the sealing seat 24 . the operating medium is therefore capable of getting into the chamber in and around the spiral spring 28 , and from there it can flow out through one or more longitudinal grooves 40 embodied in the tappet guide 12 , a plurality of radial grooves 42 embodied in the insert body 30 , and a radial filter 44 located on the jacket face of the tappet guide 12 . so that this flow of operating medium through the sealing seat 24 can also be interrupted by the valve 10 , the tappet 18 , on its upward end portion in terms of fig1 , has an electromagnetic armature 46 . this armature can be moved with the aid of an electromagnet , not shown , so that the tappet 18 is displaced in the tappet guide 12 and the spherical - segment - shaped surface 22 is guided toward the conical - segment - shaped surface 26 . in order to enable this motion of the tappet 18 , an air gap 48 is embodied between the upper end face , in terms of fig1 , of the substantially hollow - cylindrical tappet guide 12 and the lower end face of the armature 46 . a substantially cup - shaped cap 50 is also fitted over the armature 46 and is fixed on the outer jacket face of the tappet guide 12 with the aid of a circumferential welded seam 52 . in fig2 , an exemplary embodiment of an electromagnetic valve 10 of the invention is shown . in contrast to the valve 10 shown in fig1 , the valve of fig2 has a one - piece sealing seat - tappet guide component 54 , which takes on both the function of a tappet guide and the function of a sealing seat . as a further innovation compared to the valve 10 shown in fig1 , the valve 10 of fig2 , in the upper end region in terms of fig2 , has an adjusting ring 56 of l - shaped cross section , which is fixed on the tappet guide 12 with the aid of a press fit or radial compression 58 . the adjusting ring 56 has no guidance function for the tappet 18 and instead serves to adjust the air gap 48 , which now , in the valve 10 of fig2 , is formed between the upper end face of the adjusting ring 56 and the lower end face of the armature 46 . in the valve 10 of fig2 , a cap 50 is fitted over the adjusting ring 56 and the upper region , in terms of fig2 , of the tappet guide 12 ; it is firmly slipped onto the tappet guide 12 with the aid of a press fit or radial compression 60 and is then fixed on the outer circumference of the tappet guide 12 with a laser - welded seam 62 . besides these innovations , in the sealing seat - tappet guide component 54 of the valve 10 of fig2 , two or more diametrically opposed radial bores 64 are embodied above the conical - segment - shaped surface 26 of the sealing seat portion of the sealing seat - tappet guide component 54 . an operating medium flowing through the sealing seat portion of the sealing seat - tappet guide component 54 can flow through these radial bores 64 , deflected only twice at an angle of 90 ยฐ each , to the radial filter 44 located on the outer jacket face of the tappet guide 12 . in fig3 , this primary direction of the flow of the operating medium through the radial bores 64 is illustrated by an arrow 66 . in fig3 , the primary line 68 of the magnetic flux in or on the valve 10 of fig2 is also shown . as can be seen , the magnetic flux passes from the tappet guide 12 radially toward a leg of the adjusting ring 56 of l - shaped cross section and from it axially into the armature 46 . the cap 50 comprises material that conducts magnetic flux , and it closes the magnetic circuit between the sealing seat - tappet guide component 54 and the armature 46 . an electric coil that generates the magnetic field or flux is not shown . it can be assumed that this coil is slipped onto the magnet valve and surrounds both the armature 46 and the tappet guide 12 as far as the collar 14 . in the valve 10 shown in fig2 and 3 , the insert body 30 is designed precisely the same as that in fig1 , although the radial grooves 42 in the insert body 30 are no longer necessary and can therefore be omitted . in fig4 , a second exemplary embodiment of an electromagnetic valve 10 of the invention is shown , which in terms of the sealing seat - tappet guide component 54 and the one - piece design thus attained of the sealing seat and tappet guide is designed like the sealing seat - tappet guide component 54 shown in fig2 and 3 . however , in the region of the adjusting ring 56 , the valve 10 of fig4 is modified . here the adjusting ring 56 is embodied as comparatively long in the longitudinal direction , and between the lower end region , in terms of fig4 , of the this long adjusting ring 56 and the upper end region of the sealing seat - tappet guide component 54 , a radial compression 70 and an extensive laser - welded seam 72 are embodied . onto the remaining jacket face of the long adjusting ring 56 , the cap 50 is slipped onto the adjusting ring 56 at a radial compression 74 and then likewise fixed with a laser - welded seam 76 ; the two laser - welded seams 72 and 76 may be made in a single operation . alternatively , the laser - welded seams 72 and 76 may be made in succession and possibly even at different work stations . the foregoing relates to preferred exemplary embodiments of the invention , it being understood that other variants and embodiments thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims .
| 5 |
[ 0013 ] fig1 is a simplified perspective or isometric view of an array 10 of individual missile launcher cells 10 a , 10 b , 10 c , and 10 d , with portions of the structure cut away to reveal interior details . in fig1 the individual cells 10 a , lob , 10 c , and 10 d are identical to each other . each cell includes a lattice - type support structure designated 12 , thus missile launcher 10 a includes a lattice - type support structure designated 12 a , missile launcher cell lob includes a lattice - type support structure 12 b , missile launcher cell 10 c includes a lattice - type support structure 12 c , and launcher cell 10 d includes a lattice - type support structure 12 d . each support structure 12 includes four โ leg โ portions . taking missile launcher cell 10 d of fig1 as being representative , three such legs can be seen , namely legs 14 d 1 , 14 d 2 , and 14 d 3 , and the fourth leg is not illustrated . the illustrated legs of support structure 12 a of missile launcher 10 a are 14 a 1 and 14 a 2 , the illustrated legs of support structure 12 b of missile launcher 10 b are 14 b 1 and 14 b 2 , and the illustrated legs of support structure 12 c of missile launcher 10 c are 14 c 1 and 14 c 2 . the legs of each support structure extend parallel with the missile launcher longitudinal axis ; in particular , the various legs extend parallel to their corresponding launcher cell longitudinal axes 8 a , 8 b , 8 c , and 8 d . a plurality of interconnecting support braces extend between the โ legs โ of the support structure of each missile launcher cell . as illustrated in fig1 representative support braces 20 a 1 , 20 a 2 , and 20 a 3 extend between leg elements 14 a 1 and 14 a 2 . the combination of these leg elements and support braces defines an elongated cavity ( not is 15 clearly visible in fig1 ), having a rectangular or square cross - section , which extends vertically through each support structure 12 a , 12 b , 12 c , and 12 d . the cross - sectional dimensions of each such cavity are dimensioned to accommodate a canisterized missile , and to hold such canisterized missile in a vertical or about - vertical posture . in a particular embodiment in which the canisterized missile is a mark 25 canisterized missile , the cross - section is rectangular . a protective door or hatch assembly or structure is located at the upper or missile launch end of each missile launcher cell . more particularly , fig1 illustrates a hatch assembly 16 a associated with missile launcher cell 10 a , a hatch assembly 16 b associated with missile launcher cell lob , a hatch assembly 16 c associated with missile launcher cell 10 c , and a hatch assembly 16 d associated with missile launcher cell 10 d . each hatch assembly includes a generally flat deck portion or deck extension , and a hatch covering one or more apertures by which one or more missiles may exit , and or through which exhaust gases may vent . in fig1 hatch assembly 16 a of missile launcher cell 10 a has a deck portion of deck extension 16 ad and a hinged hatch 16 ah , hatch assembly 16 d of missile launcher cell 10 d has a deck 16 dd and a hinged hatch 16 dh , with the hatches illustrated as being in the closed position . hatch assembly 16 c of missile launcher 16 c has a deck 16 cd and an open hatch 16 ch . the hatch 16 bh of hatch assembly 16 b is illustrated in phantom to reveal a square missile - end โ aperture โ 18 bm in which a canisterized missile ( not illustrated in fig1 ) may be accommodated , and additional chimney or exhaust uptake apertures 18 bc 1 and 18 bc 2 . each missile launcher cell 10 a , 10 b , 10 c , and 10 d of array 10 of fig1 also includes an a pair of missile exhaust gas uptake ducts or chimneys . in fig1 portions of the two chimneys associated with missile launcher cell 10 a are designated 30 a 1 and 30 a 2 , and portions of the corresponding chimneys of missile launcher cell lob are designated 30 b 1 and 30 b 2 , respectively . the chimneys associated with missile launcher cell 10 c are designated 30 c 1 and 30 d 2 , and those associated with missile launcher cell 10 d are designated 30 d 1 and 30 d 2 in fig1 . the chimneys associated with each launcher cell extend from near the bottom , breech or missile exhaust end of each launcher cell to near the top , muzzle , or missile launch end of the launcher cell , and are generally parallel with the axis of the corresponding support structure . thus , chimneys 30 a 1 and 30 a 2 extend parallel with the longitudinal axis 8 a of missile launcher support structure 12 a , chimneys 30 b 1 and 30 b 2 extend parallel with the longitudinal axis 8 b of missile launcher support structure 12 b , chimneys 30 c 1 and 30 c 2 extend parallel with the longitudinal axis 8 c of missile launcher support structure 12 c , chimneys 30 d 1 and 30 d 2 extend parallel with the longitudinal axis 8 d of missile launcher support structure 12 d . at their upper ends , the various chimneys or missile exhaust gas uptake ducts open into a region which lies under the doors or hatches of the corresponding missile launcher cell when that door or hatch is in its closed position . in fig1 the open ends of the two chimneys 30 b 1 and 30 b 2 are designated 18 bc 1 and 18 bc 2 , respectively . the chimneys are preferably fastened to the corresponding deck plate , as by welding if the chimney is metallic , or by other suitable fastening method for other materials , as for example the chimneys 30 b 1 and 30 b 2 should be secured to deck plate 16 bd . the corresponding hatch 16 bh , when in its closed state , covers both the two chimney openings 18 bc 1 and 18 bc 2 and also the upper end of the elongated , vertically oriented cavity associated with or defined by the support structure 12 b . in addition to the chimneys , each missile launcher cell 10 a , 10 b , 10 c , and 10 d of array 10 is associated with an exhaust gas plenum or manifold . thus , a plenum 40 a is associated with missile launcher cell 10 a , a plenum 40 b is associated with missile launcher cell lob , a plenum 40 c is associated with missile launcher cell 10 c , and a plenum 40 d is associated with missile launcher cell 10 d . each exhaust gas plenum includes an attachment arrangement for attaching the plenum to the support structure . in a particular embodiment of the invention , the attachment arrangement also supports a โ dogdown โ arrangement which provides secure attachment of the plenum to the lower end of the canister of the canisterized missile used therewith . in fig1 the attachment arrangement for the exhaust gas plenum of each missile launcher includes four bosses or structures of a set 42 of bosses . thus , exhaust gas plenum 40 a of fig1 includes on its upper surface four attachment bosses , each of which is designated 42 a , spaced around a rectangular or square exhaust gas inlet port 44 a . similarly , exhaust gas plenum 40 b includes on its upper surface four attachment bosses , each of which is designated 42 b , spaced around a square exhaust gas inlet port 44 b , exhaust gas plenum 40 c includes on its upper surface four attachment bosses , each of which is designated 42 c , spaced around a square exhaust gas inlet port 44 c , and exhaust gas plenum 40 d includes on its upper surface four attachment bosses , each of which is designated 42 d , spaced around a square exhaust gas inlet port 44 d . each of the bosses of set 42 is attached to the lower end of a leg of the associated support structure . as an example , the lower ends of the three vertically disposed legs 14 d 1 , 14 d 2 , and 14 d 3 of support structure 12 d of missile launcher 10 d which are visible in fig1 are attached to those three bosses 42 d of plenum 40 d which are nearest the viewer . this effectively fastens the plenum 40 d to its associated support structure 12 d , with axis 8 d of the elongated vertically - oriented cavity ( not designated in fig1 ) associated with the support structure 12 d overlying the missile exhaust gas entry port 44 d of the plenum 40 d . the chimneys or missile exhaust gas uptake ducts of each missile launcher cell are connected at their lower , missile exhaust , or breech ends to corresponding apertures of the associated plenum , so that missile exhaust gases entering the plenum can be vented through the chimneys to a location near the upper , missile launch , or muzzle ends of the structure . more particularly , the lower ends of chimneys 30 a 1 and 30 a 2 of missile launcher 10 a are connected to corresponding apertures 46 a 1 and 46 a 2 of plenum 40 a , the lower ends of chimneys 30 b 1 and 30 b 2 of missile launcher lob are connected to corresponding apertures 46 b 1 and 46 b 2 of plenum 40 b , the lower ends of chimneys 30 c 1 and 30 c 2 of missile launcher 10 c are connected to corresponding apertures 46 c 1 and 46 c 2 of plenum 40 c , and the lower ends of chimneys 30 d 1 and 30 d 2 of missile launcher 10 d are connected to corresponding apertures 46 d 1 and 46 d 2 of plenum 40 d . the chimneys are thus supported at their lower ends by attachment to their respective plenums , and may be attached at their upper ends to their respective deck plates . in addition , further attachments may be made along their lengths to their respective support structures . [ 0020 ] fig2 is a simplified perspective or isometric view of missile launcher cell 10 d of fig1 standing alone . elements of fig2 corresponding to those of fig1 are designated by the same reference numerals . in fig2 a portion of the drive mechanism which controls the operation of hatch 16 dh is designated as 216 . fig3 a is a simplified perspective or isometric view of the upper , missile launch , or muzzle end 300 of the missile launcher cell 10 d of fig2 . in fig3 a , elements corresponding to those of fig2 are designated by the same reference numerals . in fig3 a , various sets of apertures or holes defined in the edge of the deck portion 16 dd are designated 316 da 1 , 316 da 2 , 316 da 3 , and 316 da 4 . these sets of apertures are provided for allowing the use of bolts to fasten each deck portion to an adjacent deck portion of another missile launcher cell , in order to form an array such as that illustrated and described in conjunction with fig1 or to fasten the deck portion of the cell to an adjacent deck structure of the ship or other support structure on which it is mounted , a cut - away portion of which is illustrated in phantom as 390 in fig3 a . [ 0021 ] fig3 b is a simplified perspective or isometric view of a lower , missile exhaust end , or breech end 380 of the missile launcher structure of fig2 illustrating some details of the structure . elements of fig3 b corresponding to those of fig2 are designated by like reference numerals . in fig3 b , the structure of plenum 40 d is seen to include legs or supports 339 a , 339 b , and 339 c , each of which defines a plurality of plenum - to - ship mounting or attachment holes or apertures 340 d 1 , 340 d 2 , and 340 d 3 , respectively . in addition , details of the dogdown mechanism 360 include connecting drive bars 350 a and 350 b . in fig4 a , 4 b , and 4 c , elements corresponding to those of fig1 , 3 a , and 3 b are designated by the same reference numerals . in fig4 c , the aperture 418 d represents the end of the elongated cavity defined by the support structure 12 d , and it is centered on axis 8 d , which appears as a dot in the view of fig4 c . fig4 b illustrates axis 8 d as centered in the view , while fig4 a shows axis 8 d as off - center relative to the entire structure . axis 8 d appears as off center in fig4 a because it is centered on the support structure 12 d , which is offset relative to the entire missile launcher cell 10 d because of the presence of the chimneys 30 d 1 and 30 d 2 . [ 0023 ] fig5 represents a cross - sectional view of missile launcher cell 10 d of fig1 shown alone , and partially cut away to show the missile 512 and a missile canister 510 , defining a missile launch end 510 ml and a missile exhaust end 510 me , with the missile 512 contained within the canister 510 . in fig5 the hatch 16 dh is open . other embodiments of the invention will be apparent to those skilled in the art . for example , while the support structure 12 x of a cell 10 x of the figures are illustrated as being of a particular form of lattice , other types may be used , or solid ( non - lattice ) portions may be used . while the missile launcher array of fig1 shows a linear array of missile launcher cells , the array can be rectangular , so that it includes a plurality of rows and columns , and it may intermix rectangular or square with linear arrays of missile launcher cells . while the plenum associated with each missile launch cell has been shown as being roughly cubical , it may be drum - shaped ( that is , a portion of a right circular cylinder ) or semispherical ( some portion of a sphere , including a hemisphere ). while the missile canister has been described as containing a single missile , the missile canister can be of the type containing a plurality of missiles . thus , a missile launcher cell ( any one of 12 a , 12 b , 12 c , or 12 d of array 10 , with 12 d taken as typical ) according to an aspect of the invention is for accepting a canisterized missile ( 510 , 512 ) which defines a missile launch end ( 510 ml ) and a missile exhaust end ( 510 me ), for , in use prior to missile launch , holding the missile canister ( 510 , 512 ) in a generally vertical launch position below a deck ( 390 ). the missile launcher cell ( 16 d ) comprises at least one elongated exhaust gas chimney ( 30 d 1 , 30 d 2 ). it also comprises a support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) defining a generally axial cavity ( 418 d ), also defining a missile launch end and a missile exhaust end . the cavity ( 418 d ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) has length and cross - sectional dimensions sufficient to accommodate the missile canister the one or more exhaust chimney ( 30 d 1 , 30 d 2 ) s lie along the exterior of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) and extend , parallel with the axis ( 8 d ) of the cavity ( 418 d ), from near the missile launch end ( 300 ) to near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). the missile launcher cell ( 16 d ) also includes a missile exhaust plenum ( 40 d ) attached to the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). the missile exhaust plenum ( 40 d ) is to the one or more exhaust chimney ( 30 d 1 , 30 d 2 ) s near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). the missile exhaust plenum ( 40 d ) further includes an attachment arrangement ( 360 ) for attachment to the missile exhaust end ( 510 me ) of the missile canister ( 510 , 512 ), for routing missile exhaust gas from the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) to the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ), for causing missile exhaust gas to vent from the one or more chimneys ( 30 d 1 , 30 d 2 ) near the missile launch end ( 300 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) of the missile launcher cell ( 16 d ). a door or hatch structure ( 16 dh ) is attached to the missile launch end ( 300 ) of the missile launch cell support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), for , in the closed state , protecting at least the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), the one or more chimney 30 d 1 , 30 d 2 ) s and any missile canister ( 510 , 512 ) accommodated within the cavity ( 418 d ). in a particular embodiment of the invention , the cavity ( 418 ) has a rectangular , or more particularly square , cross - section , and is dimensioned to accommodate a mk 25 canisterized missile ( 510 , 512 ). the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) may be a latticework . the number of chimneys ( 30 d 1 , 30 d 2 ) in a particular embodiment is two , with the two chimneys ( 30 d 1 , 30 d 2 ) running parallel with each other and with the cavity axis ( 8 d ). in a particularly advantageous embodiment of the invention , an array ( 10 ) of missile launcher cells ( 16 a , 16 b , 16 c , and 16 d ) has each of the missile launcher cells ( 16 d ) of the array dimensioned for accepting a canisterized missile ( 510 , 512 ), where each missile canister ( 510 , 512 ) defines a missile launch end ( 510 ml ) and a missile exhaust end ( 510 me ). in use prior to missile launch , the array ( 10 ) of missile launcher cells ( 16 d ) holds the missile canisters ( 510 , 512 ) in a generally vertical launch position below a deck . each of the missile launcher cells ( 16 d ) includes at least one elongated exhaust gas chimney ( 30 d 1 , 30 d 2 ), and a support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) defining a generally axial cavity ( 418 d ), and defining a missile launch end ( 300 ) and a missile exhaust end ( 380 ). the cavity ( 418 d ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) of each cell has length and cross - sectional dimensions sufficient to accommodate a missile canister ( 510 , 512 ). the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ) are attached , andor lie adjacent to , the exterior of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) and extend , parallel with the axis ( 8 d ) of the cavity , from near the missile launch end ( 300 ) to near the missile exhaust end ( 380 ) of the structure . a missile exhaust plenum ( 40 d ) is attached to the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) of each cell . the missile exhaust plenum ( 40 d ) of each cell ( 16 ) is coupled to the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ) near the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), and also includes an attachment arrangement or means for attachment ( 360 ) to the missile exhaust end ( 510 me ) of the missile canister ( 510 , 512 ), for thereby routing missile exhaust gas from the missile exhaust end ( 380 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) to the one or more chimneys ( 30 d 1 , 30 d 2 ), for causing missile exhaust gas to vent from the at least one chimney ( 30 d 1 , 30 d 2 ) near the missile launch end ( 300 ) of the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ). a door or hatch structure ( 16 dh ) is attached to the missile launch end ( 300 ) of the missile launch support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ), for , when closed , protecting at least the support structure ( 14 d 1 , 14 d 2 , 20 d 1 , 20 d 2 ) and the one or more exhaust chimneys ( 30 d 1 , 30 d 2 ) of the missile launcher cell ( 16 d ), and any missile canister ( 510 , 512 ) accommodated within the cavity ( 418 d ) of the cell , and for , when open , providing for egress of the missile ( 512 ) from its canister ( 510 ) and exhaust gas from the one or more chimneys ( 30 d 1 , 30 d 2 ). this arrangement allows the array of missile launchers to be maintained in a condition in which all of the launcher cells are fitted with canisterized missiles , without keeping at least one missile launch cell clear or unloaded so as to provide a chimney or path for the escape of exhaust gas from a missile fired in a missile launch cell of the array . thus , an aspect of the invention lies in an array of launchers ( 10 ) in which a canisterized missile is located within each of ( all of ) the cavities of the array .
| 5 |
referring to fig1 a tunnel furnace is divided into a number of sections leading from a loading / unloading station 1 at the inlet end of the furnace . the first five sections of the furnace constitute together a heating part 2 of the furnace which leads to a pre - bending section 3 , followed by a bending section 5 which is maintained at the bending temperature . the next section of the furnace is a transfer section 6 which has open sides to permit an operator to view the bending section 5 . the final two sections together form a cooling section 7 which leads to a transfer station 8 at the outlet end of the furnace . as is customary each mould is mounted in a steel - walled insulated box 9 which is mounted on its carriage 10 which runs on rails 11 which extend right through the furnace from the loading / unloading station 1 to the transfer station 8 . at the transfer station 8 each carriage in sequence is lifted by a lift table to an upper return run of rails 12 along which the carriages run as they are pushed back to a lift indicated at 13 , which lowers each carriage in turn to the level of the rails at the station 1 ready for unloading and reloading . the carriages indexed through the furnace in sequence with a fixed residence time , e . g . 90 seconds , in each section of the furnace . fig2 and 3 illustrate the mounting of a sag bending mould in each box 9 . in this embodiment each box 9 is an enclosed structure having a floor 14 , side walls 15 and front and rear walls 16 . the floor 14 and the side rear walls 15 and 16 are of double - walled stainless steel with insulation . the sag bending mould is mounted on the floor 14 and includes lateral mould members 17 and end wing pieces 18 which are shown diagrammatically and are of conventional design . the lateral mould members 17 are narrow strip members having an upper edge of curved configuration to which the glass conforms as it sags in the bending section 5 of the furnace . the wing pieces are usually conterpoised so that they can readily swing upwardly under the effect of gravity as the glass sags . a pair of glass sheets which are to be sag - bent together and are for eventual lamination together to form a vehicle windscreen , are indicated at 19 . fig2 and 3 show how the glass 19 has only points of contact with the predominant points of the mould when the glass is loaded on to the mould at the station 1 . initially the glass will be at room temperature as it is loaded and the mould members in the box will also be at about room temperature , or possibly rather higher depending on the cooling effected during the return run of the carriage . each mould in its box 9 is advanced in turn into the five heating sections which together form the heating part 2 of the furnace . the construction of each of these five heating sections of the furnace is identical and is as illustrated in fig2 and 3 . the roof of each heating section of the furnace carries a pluraltiy of radiant heaters 20 and heat is radiated downwardly through the open top of the box 9 towards the upper surface of the glass 19 which is now stationary in the heating section . the mould members are partially screened from the radiant heat by the glass itself . in the embodiment illustrated each of the heating sections has a hot air supply including means for directing hot air beneath and around each mould supporting the glass . at either side of the furnace roof in each of the heating sections there are hot air supply ducts 21 leading to slots 22 at either side of the roof . each of the ducts 21 leads from a heater 23 which is supplied with air by a fan 24 which extracts air through a central extract aperture 25 in the furnace roof 26 between the slots 22 . if the air extracted through the central aperture 25 is hot enough it may not be necessary to provide the heaters 23 . the slots 22 supply hot air downwardly into each box just within the side walls 15 of the box , and inclined deflector plates 27 are fitted into the lower corners of each box where the side walls 15 of the box meet the floor 14 . these deflector plates 27 have the effect of deflecting the hot air flows sideways beneath the mould as indicated by the arrows 28 . the hot air flows underneath the mould and around the mould members 17 , 18 and outwardly around the mould members towards the front and rear walls 16 of the box , and then up to the roof 26 of the furnace for extraction through the central extract aperture 25 as indicated by arrows 29 . the hot air heats the lower surface of the supported glass to assist thermal equalisation through the glass thickness , especially when two glass sheets are being bent together , and has the effect of minimizing the temperature difference between the mould members and the glass . in one example of operation , by employing in the first heating section of the furnace flows of hot air at 300 ยฐ c . with a rate of flow of 0 . 47m 3 / s , it was found that the temperature difference between the mould members and the glass , which otherwise might have been of the order of 100 ยฐ c ., was reduced to about 45 ยฐ c . to 50 ยฐ c ., and surface flaws on the lower surface of the glass were eliminated . it is desirable to maintain this reduced temperature difference which has been introduced in the first of the heating sections . to effect this hot air flows 28 around the mould may be provided in at least the first three heating sections . usually the hot air flows 28 are provided in the second to fifth heating sections of the heating part 2 of the furnace in the same way as in the first heating section . the carriage then moves to the bending section 3 where the furnace temperature is of the order of 700 ยฐ c . from the pre - bending section 3 the carriage moves to the bending section 5 where the glass is at a sag bending temperature of about 590 ยฐ c . to 610 ยฐ c . with the mould members at a temperature of about 530 ยฐ c . to 540 ยฐ c . the minimal temperature difference between the mould and the glass which is established in the first heating section 2 of the furnace , had been maintained throughout the concomitant heating of the mould members and the glass prior to bending . the indexing cycle time is such that immediately the glass has sag bent to the required configuration of the mould , it is removed from the bending section and cooled and gradually transported step - by - step back to the loading / unloading station 4 , by which time it has cooled to about room temperature , or somewhat above . in each of the heating sections 2 , the downward flow of air 28 , which are deflected beneath and around the mould , are heated to a temperature commensurate with the temperature of the glass in that furnace section , for example 400 ยฐ c . in the fourth heating section and 500 ยฐ c . in the fifth heating section . the deflector plates 27 are , in the illustrated embooiment , the faces of members of triangular section which are fitted into the corners of the box 9 . deflector plates which are at 45 ยฐ to the side walls 15 and floor 14 of the box have been found to be effective . other shapes may be employed , for example deflector members with conrave surfaces which modify the flows beneath and around the mould members . in another way of carrying out the invention , each box 9 may be of a simplified construction which is of l - shaped cross section having a floor and a front wall only . the boxes abut against each other , so that the front wall of each box in the furnace acts as the rear wall of the preceding box . the side edges of these simplified boxes are close to the side walls of the furnace sections , and at each of the sections of the heating part 2 of the furnace there are air supply slots in the side walls of the furnace , at the level of the moulds , which direct the hot air flows around each mould beneath the glass in similar manner to the flows 28 described with reference to fig2 and 3 . the convective heating which is employed in carrying out the invention has been found to eliminate the problem of the generation of tensile stresses in the glass due to thermal gradients between the generally hotter glass and the cooler spots caused by localised contact with the mould . damage caused by the hotter glass sagging on to the colder mould during the final stages of the bending is also avoided . overall heating efficiency is improved , which has permitted a reduction in the timing of the indexing cycle while still ensuring , when manufacturing pairs of glass sheets to be laminated , that the two sheets conform sufficiently closely to one another and the desired shape . for example it has been found that operation of the method and apparatus of the invention increases the rate of heating of the glass by a factor of between 2 and 3 . it has even been possible to reduce the residence time in each heating section from 90 seconds to 60 seconds by employing the hot air flows in at least the first three heating sections to maintain a tolerable temperature difference between the mould and the glass .
| 2 |
this invention involves the design of a dual - mode wireless power receiver . the dual - mode wireless power receiver can receive power from either an inductive charger operating in the range of hundreds of khz or a resonant charger operating at a frequency in the mhz range . the dual - mode wireless power receiver can have a low - frequency operating range of 110 - 205 khz and a high operation frequency of 6 . 78 mhz , but the invention can generally be used for any two frequency bands separated by a factor of at least 5 . fig1 is a schematic diagram illustrating an inductive wireless power receiver circuit 2 that implements a low - q , inductive charging receiver . an inductor l 3 represents the receiver coil ( rx coil ), which is magnetoelectrically coupled to a source coil . ac power induced in l 3 is rectified by a bridge rectifier 4 to generate a dc voltage vrect . the bridge rectifier 4 is an arrangement of four ( or more ) diodes in a bridge circuit configuration that provides the same polarity of output for either polarity of input . a bridge rectifier provides full - wave rectification from a two - wire ac input , resulting in lower cost and weight as compared to a rectifier with a 3 - wire input from a transformer with a center - tapped secondary winding . capacitor c 2 q and inductor l 3 form an electromagnetic resonator with a resonant frequency around the wireless power operating frequency . this frequency is typically in the range of hundreds of khz . the series resonant circuit that includes l 2 and c 2 q also includes the impedance of the bridge rectifier 4 . this includes the circuit that is drawing wireless power , so it can be relatively high . the quality factor of the electromagnetic resonator is given by where ฯi is the angular operating frequency of the inductive wireless power system and r 1 is the equivalent resistance of the diode bridge rectifier 4 . resistance r 1 can be relatively high , so the quality factor of this circuit is typically in the low single digits . a value of cs is chosen such that the resonant frequency of the electromagnetic resonator is equal to the operating frequency of the inductive wireless power system , using the equation fig2 is a schematic diagram illustrating a resonant power receiver circuit 8 used in accordance with the invention that implements a high - q resonant wireless power receiver . an inductor l 2 represents the receiver coil ( rx coil ). capacitors c 2 a and c 2 b form a resonant matching network between l 2 and the bridge rectifier 4 . this matching network is series - parallel because c 2 a is in series with the load and c 2 b is in parallel with it . the inductor l 2 and the capacitors c 2 a and c 2 b form an electromagnetic resonator . because some of the inductor current can circulate in a loop including only l 2 , c 2 a and c 2 b ( plus parasitic resistance ), the quality factor of this electromagnetic resonator can be relatively high , perhaps greater than 100 . to choose the values of c 2 a and c 2 b , one needs to ensure that their series combination is resonant with l 2 at the desired operating frequency on . it is preferred in some cases to operate the resonant receiver at a relatively high frequency to maximize the quality factor of the resonator . in other embodiments an operating frequency of 6 . 78 mhz is used . there would be significant utility for a dual - mode wireless power receiver that could receive power from either an inductive charger operating in the 100s of khz or a resonant charger operating at a frequency in the mhz range . the example discussed here has a low - frequency operating range of 110 - 205 khz and a high operation frequency of 6 . 78 mhz , but the method is generally useful for any two frequency bands separated by a factor of at least 5 . although the circuit topologies of the inductive receiver and the resonant receiver are similar , the required inductance and capacitance values are typically quite different , given the different operating frequencies . for a given application , there are some constraints on the usable rectified voltage range . for example , for mobile electronics that use lithium - ion batteries , it is desirable to produce a regulated 5v supply in order to charge the battery at 3 . 0 - 4 . 2 v . thus the rectified voltage should be chosen in the range of 5v - 15v such that a step - down regulator such as a buck regulator or linear dropout regulator can be selected to produce the regulated 5v supply efficiently . for a dual - mode receiver , this voltage range should be observed in both modes . however , for the same value of receiver - coil inductance , a much higher voltage is generated at 6 . 78 mhz than at 100 khz , given the fact that induced voltage is expressed by where vind is the induced voltage , m is the mutual inductance , ii is the source - coil current and ฯ is the operating angular frequency . the mutual inductance m is proportional to the square root of the product of the source coil and receiver coil inductances . thus , it would be advantageous for the dual - mode receiver if the effective inductance of the electromagnetic resonator were higher at low frequencies than at high frequencies . fig3 shows the circuit topology 14 of the dual - mode receiver . it has the property that the effective inductance of the electromagnetic resonator is much higher at low frequencies than at high frequencies . this occurs because the capacitor c 2 a has an impedance much lower than the inductor l 3 at high frequencies , thus it shunts l 3 . at low frequencies , the two inductors appear in series so as to give the required high inductance value . it is possible to make some rough approximations to better understand the operation of the dual - mode receiver . let us assume that the inductance of l 3 is 10 ร the inductance of l 2 . furthermore , let us assume that the capacitance of c 2 q is roughly 100 ร the capacitance of c 2 a or c 2 b . finally , let us assume that the capacitors are chosen such that the impedance of c 2 q is negligibly small at 6 . 78 mhz , and that the impedances of c 2 a and c 2 b are negligibly large at 100 khz . one can judge whether the capacitances are negligible by comparing them to the impedance of the inductors . at low frequency ( e . g ., 100 khz ), the c 2 a and c 2 b capacitors can be approximated as open circuits . thus the receiver circuit can be reduced to a pure series lc circuit in which l 2 , l 3 and c 2 q are the series elements . the effective inductance is 11 ร l 2 . one can choose c 2 q to combine with this inductance to create a series resonance at 100 khz , as required by the qi specification . at high frequency ( e . g ., 6 . 78 mhz ), the c 2 q capacitor can be modeled as a short circuit . the parallel combination of c 2 a and l 3 is dominated by c 2 a . thus the receiver circuit can be reduced to a series - parallel resonant circuit where l 2 , c 2 a and c 2 b are the active elements , similar to fig2 . this circuit can be tuned to resonance at 6 . 78 mhz . the effective inductance of this circuit at high frequency is approximately equal to l 2 , although a small contribution from l 3 can also be observed . a wireless power receiver using this coil arrangement and matching network can receive power either from an inductive charger at low frequency ( e . g ., 100 khz - 200 khz ) or at high frequency ( e . g ., 6 . 78 mhz ). the same rectification and regulation produced by the bridge rectifier 4 can be used , thus making maximum use of the active circuitry . the frequency of the ac power can be detected and used to determine which communications protocol to be used , if any . in some inductive wireless power standards , load modulation may be used for in - band communications . the load modulation may be implemented through the use of switched capacitors cc , as shown in fig4 . these capacitors cc apply some detuning when switched in , presenting a variation in the impedance seen by the source amplifier , which can be decoded to recover some information . the value of the capacitors cc is typically on the order of the c 2 q capacitor . in the high - frequency resonant mode , these capacitors can be used as voltage clamps . switching in the cc capacitors couples the input terminals of the rectifier to ground with a low ac impedance . this can be used as a protection mechanism , to limit the ac voltage applied to the terminals of an ic that has a maximum voltage tolerance . fig5 shows a coil arrangement 18 that can form two separate inductors in the same plane of a printed circuit board , making it possible to save circuit area . in the example of fig5 , the two inductors are arranged in a planar , concentric fashion with the l 3 inductor on the inside and the l 2 inductor on the outside . the orientation can also be reversed such that the l 3 inductor is on the outside and the l 2 inductor is on the inside . realizing the inductive coil elements in a planar arrangement is advantageous because the thickness of the coil assembly can be minimized . realizing the inductive coil elements in a concentric fashion is advantageous because it makes maximal use of a limited space . both area and thickness may be highly constrained in a portable electronic device . the two coils have mutual inductance to each other , but this effect can be accounted for in the tuning network . other embodiments can use different arrangements to satisfy the requirements of inductors l 2 and l 3 . the connection points 1 - 3 illustrate the interconnection points for the overall concentric arrangement 18 . in addition to a printed circuit board , any planar mass - production process may be used to implement the inductive coil arrangement . the diode bridge rectifier 4 can be replaced with a synchronous rectifier 22 in any of the receiver circuits to reduce ohmic losses as shown in fig6 . the synchronous rectifier 22 improves the efficiency of rectification by replacing diodes with actively controlled switches such as transistors , usually power mosfets or power bjts . historically , vibrator driven switches or motor - driven commutators have also been used for mechanical rectifiers and synchronous rectification , which also be used in accordance with the invention . essentially , the invention describes a receiver - side circuit that can operate either in a low - frequency inductive charging system such as qi or a higher - frequency resonant wireless power system . the invention allows for the use of complicated coil arrangements and one more passive component than a single - mode receiver . moreover , the dual - mode wireless power receiver can have a low - frequency operating range of 110 - 205 khz and a high operation frequency of 6 . 78 mhz , but the invention can generally be used for any two frequency bands separated by a factor of at least 5 . although the present invention has been shown and described with respect to several preferred embodiments thereof , various changes , omissions and additions to the form and detail thereof , may be made therein , without departing from the spirit and scope of the invention .
| 7 |
the following description is provided to enable any person skilled in the art to be able to use the invention and sets forth the best modes contemplated by the inventors for carry out their invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principals of the present invention have been defined herein , specifically to provide for an improved intrusion detection unit 10 . the intrusion detection unit 10 of the present invention may use any desired components , with the elements thereof made from any desired material . as best shown in fig1 - 4 , the unit 10 of the present invention includes a portable body or housing 12 having all necessary components held therein . the portable body or housing 12 includes a port 11 , sides , a base , a front 14 , a back 16 and a passive motion detector 18 connected to a power source 20 , such as a battery , via a circuit board 22 . as shown in fig3 the rear housing 16 includes a securing means 24 , such as a hook and loop fastening means or magnetic holding strip , to allow the unit 10 to be secured in a desired location . for example , the unit 10 can be supported on its base on a flat surface , or secured against a wall , a desk , a filing cabinet , or other flat surface , in an area or room that is to be monitored , such as one that has been checked by law enforcement or other security personnel . the unit 10 would then be turned on and a separate radio unit or cellular telephone plugged into the port 11 in the housing 12 ( see fig1 ), to detect the presence of an intruder after the law enforcement or other security personnel have left the area or room . the unit 10 or the cellular telephone and / or radio unit plugged into the device may include the necessary video or audio adapters and related software , well known to those skilled in the art , to take and transmit images and / or sounds of an intruder . any camera associated with the unit 10 , the separate telephone or the separate radio unit may be of the normal still or video type . this unit 10 , therefore , allows more law enforcement or other security personnel to be freed for searching , or other duties , and eliminates the need for them to remain in an area or room that is to be monitored , such as one that has already been inspected or searched , or that is to be continuously monitored . that is , the unit 10 of the present invention will detect the presence of a human intruder , trigger the transmitter of an external radio unit or cell phone plugged into the unit , broadcast a stored audio message in the unit , and then pickup and broadcast still or video images and / or ambient sound from the area or room where the unit is located . to save battery life in the unit and / or the external radio , the unit will include a means to automatically switch power on and off and to switch off power when not in use in or connected to a microcontroller 36 to turn the external radio or cell phone to standby , if no intruder is present . the passive infrared motion detector 18 preferably uses a dual element pyroelectric sensor , which measures changes in heat within its field of view . a fresnel lens 26 , having a wide angle of view , is preferably used to divide the field of view into multiple zones whereby an object , moving from one zone to another , suddenly appears or disappears from the sensor &# 39 ; s view . the moving object , therefore , causes a change in signal levels , which is sensed by the accompanying circuitry in the motion detector . as set forth above , the goal of the unit 10 of the present invention is to be easily portable and to provide area intrusion monitoring and remote detection at low cost for use by law enforcement and other security personnel . this is provided by the unit 10 of the present invention , in which a microcontroller and its &# 39 ; firmware operation and circuitry on the board 22 control the implementation of this intrusion detection radio appliance . as shown in fig5 - 7 , the detector 18 is preferably a dual - element pyroelectric passive infrared detector that , like all pyroelectric detectors , is sensitive only to changes in temperature . a change in temperature produces a small voltage , which is amplified by an internal jfet transistor . the detector &# 39 ; s dual elements are connected opposing one another . this helps reduce false triggering due to changes in ambient temperature . any such thermal changes will affect equally both elements and will cancel , producing no output . the detector 18 is positioned at the focal point of the fresnel lens 26 . the lens 26 is designed to have a wide field of view to cover as much of the surrounding area as possible . the lens 26 is also designed with multiple zones , which pass or block infrared energy from an object depending upon position . as a warm object , such as a person moves through the field of view , the zones of the lens 26 breaks repeatedly as the person moves across the field of view . this chopping affect creates a change in infrared temperature of the detector 18 , thereby producing an output signal . a two - stage bandpass filter 28 and amplifier 30 are used and shown in fig5 . the amplifier 30 is sensitive to frequencies between 1 and 25 hz only . this further helps reduce false alarms since normal human motion will fall within this range . the total gain of the amplifier chain is 76 db . this high gain is needed because the amount of infrared energy striking the detector 18 is very low and thus the signal from the detector is very low as well . a dual - threshold window comparator is formed by 32 and 34 , as shown in fig5 . the output of the amplifier 30 is compared with voltage levels set by r8 , r9 and r10 . if the signal rises above the lower threshold , triga ! will switch from a logic high to a logic low . if the signal drops below a lower threshold , trigb ! will similarly switch . the circuit is designed such that the system will trigger when infrared energy from an object passing from a light to a dark zone , or from dark to light , is sensed . as shown in fig6 an 8 bit microcontroller or microprocessor 36 with onboard program rom and ram is preferably used . the microcontroller 36 operates at a low frequency set by a crystal x 1 . this low frequency keeps power consumption low for prolonged battery life . also , as described above , the microcontroller 36 includes a means to prolong battery life in the external radio or cell phone , by turning the external radio or cell phone to standby , if no intruder is present . an led 38 is driven by one output port from microcontroller 36 . upon power up , this led 38 will flash for a predetermined time , such as several tens of seconds . during this time , the amplifier and detector circuit are allowed to stabilize , and triggers are inhibited . this allows an operator to turn the unit 10 on , plug in a separate radio unit or cell phone , if not already done , and leave the area without triggering the system . once the led 38 stops flashing , the system is armed and ready to sense movement and broadcast on the external radio or cell phone plugged into the unit 10 . the triga and trigb signals from the window comparator 32 , 34 , previously discussed , are inputs to the microcontroller 36 . either of these inputs becoming a logic low will start the transmit cycle . the cycle begins by microcontroller 36 turning on power to the output circuitry . this signal is called , or indicated as , + 5 vsw , and by keeping this off except when triggered , helps extend battery life . when the xmt ! signal is brought low , a load is applied to an external microphone input 39 to the external radio or cell phone , which simulates keying the push to talk switch . the external radio or cell phone will now transmit the stored audio and then ambient audio or video images . the alarm output from microcontroller 36 produces a modulated square wave that is coupled into a transmit output amplifier 40 by r 26 and c 23 ( see fig7 ). unless somehow shutoff , this causes a beeping tone which precedes the transmission of the stored audio message . as shown in fig6 the unit 10 includes an analog record / playback device 42 having a flash memory as a non - volatile storage medium . this device 42 may store up to 12 seconds of audio , such as recorded or synthesized tone or voice . when a trigger occurs and the external radio or cell phone has been placed into transmit mode , a play signal is brought low causing a playback of the recorded audio signal . device 42 is designed to directly drive a speaker 44 so the signal is coupled to an amplifier 46 by r 28 and c 26 . the output of amplifier 46 is then fed to output amplifier 40 . once the transmission of the previously recorded audio is completed by the device 42 , the signal from a microphone 39 is amplified by a further amplifier 50 . the output from this amplifier 50 is also coupled into output amplifier 40 so that ambient sounds may be monitored and transmitted for several seconds , or the plugged in cellular telephone and any video camera may transmit images to alert law enforcement or other security personnel of an intruder . to record on the device 42 , a record button is pressed and held . the microcontroller 36 then powers up the microphone circuitry and sends a record command to the record / playback device 42 . while recording , the led 38 turns on . recording stops when the user releases the button or when a maximum time of approximately 12 seconds has elapsed . power to the unit 10 is turned on and off with a momentary pushbutton 51 ( see fig7 ). a cmos flip - flop 52 is powered whenever a 9 - volt battery 54 is connected thereto . the current draw by flip - flop 52 is low enough that the shelf life of the battery 54 is not significantly affected . each time the power button 51 is pressed , flip flop 52 toggles between the set and reset conditions . in the reset condition , 56 is turned on , thus sending power from the battery 54 to voltage regulator 58 , and hence powering up the rest of the circuitry . in the set condition , 56 , and all other circuitry , are off . it , therefore , can be seen that the present invention provides a novel and improved , low cost intrusion detection device into which a separate radio or cellular telephone unit is plugged to allow law enforcement or other security personnel to leave the intrusion detection unit in a given area for monitoring the area , without the need for further personnel . those skilled in the art will appreciate that various adaptations and modifications of the just - described , preferred embodiments can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein .
| 6 |
air is admitted into an inlet 10 of a pump 12 for discharge as pressurized air ( 20 psi ) through an outlet 14 . the pressurized air is fed into an oxygenator having a filter 16 for only permitting oxygen therethrough . alternatively , nitrogen filters 22 can be used to expel the nitrogen in the air . exhaust valves 18 are periodically operated , e . g ., to expel the nitrogen . the oxygen - rich air is pumped by pump 20 into an inlet of a tubular inner chamber 24 whose wall is constituted of a material transmissive to ultraviolet ( uv ) light , e . g ., glass . as outer chamber 26 surrounds the inner chamber and has a cylindrical side wall 28 and axial end walls 30 , 32 . the walls bound an interior in which a drop of mercury 34 is received . the walls 28 , 30 , 32 are made of a material reflective to uv light , e . g ., glass whose exterior surfaces are coated with a reflective , mirrored layer . a plurality of electrodes 36 extends through the end walls and , when connected to a high voltage ( e . g ., 10 , 000 vdc ), the electrodes form a mercury arc inside the outer chamber 26 and form uv light as a byproduct . the uv light enters the inner chamber and converts the oxygen therein into ozone . the ozone is passed through a valve 38 into a fuel cell 40 for oxidation therein . it will be understood that each of the elements described above , or two or more together , also may find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in an improved fuel cell for the passenger car , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention and , therefore , such adaptations should and are intended to be comprehended within the meaning and range of equivalence of the following claims . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims .
| 7 |
proceeding to a detailed description of the present invention , the flexible expansion means , generally 10 , is shown in fig1 in conjunction with a standard i . v . set , generally 11 , which will include two spaced apart injection sites 24 and 30 which are connected to the flexible expansion means , generally 10 , by means of lengths of tubing 26 and 29 . flexible expansion means 10 is composed of an outwardly pleated , flexible tubing having expandable wall sections 15 and a central passageway 17 having a width greater than the diameter of tubing 26 and 29 . the i . v . administration set 11 will include the usual i . v . solution container 12 which will be supported by the usual support means through bail 14 . a vented piercing pin , generally 16 , will have the usual drip chamber 19 and air vent 18 . a length of tubing 20 will interconnect drip chamber 19 with y - injection site 24 and the flow of liquid through tubing 20 is controlled by a flow control clamp 22 . at the opposite end of the set is a length of tubing 34 connected with y - injection site 30 and the flow of liquid therethrough controlled by slide clamp 36 . a needle adapter 39 provides attachment for hypodermic needle 40 . two hypodermic syringes 42 and 43 having hypodermic needles 46 and 45 , respectively , are placed in pierceable engagement with reseal caps 25 and 32 of y - injection sites 24 and 30 , respectively . fig2 illustrates the flexible expansion means 10 when it will be filled with a retrograde volume of fluid 44 supplied by syringe 43 . it will be noted that the fluid 44 fills the space between the pleated wall sections 15 . this will be explained later in the operation . fig3 illustrates an alternative embodiment , generally 50 , of a flexible expansion means wherein the flexible expansion means is in the form of a length of corrugated tubing having pleated side walls 53 . as is similar to flexible expansion means 10 , it is utilized in the same i . v . administration set as illustrated in fig1 with a length of tubing 55 interconnected to drip chamber 19 and solution container 12 as well as to first injection site 54 . tubing 59 is also interconnected with injection site 54 having a reseal cap 56 for engagement with hypodermic syringe 73 by means of needle 57 . a length of tubing 60 also connects corrugated tubing 50 with a second injection site 62 which communicates with hypodermic syringe 71 by means of needle 64 passing through reseal cap 63 . another length of tubing 66 extends from reseal site 62 with the flow therethrough controlled by slide clamp 68 . needle adapter 69 secures hypodermic needle 70 thereto . fig4 is an enlarged view showing the corrugated tubing 50 with side walls 53 in the expanded state and the retrograde fluid 44 contained therein . this will be later referred to in the operation immediately to follow . a better understanding of the advantages of the flexible expansion means 10 and 50 will be had by reference to their operation . the i . v . administration set 11 will be packaged in the usual manner as illustrated in fig1 except that the hypodermic syringes 42 and 43 will not be in contact with the injection sites 24 and 30 . neither is the hypodermic needle 40 nor i . v . solution container 12 usually attached . when it is desired to administer the fluid in container 12 , the hypodermic needle 40 will be attached to needle adapter 39 and the vented piercing pin and drip chamber 16 pierced through the usual rubber stopper in container 12 . fluid flow will be controlled through the set by means of flow control clamp 22 and by opening slide clamp 36 . when it is desired to administer the retrograde additive liquid in syringe 43 , such as vitamins , the slide clamp 36 will be placed in a closed position and hypodermic syringe 42 will be positioned in contact with y - injection site 24 with hypodermic needle 46 pierced through reseal cap 25 and plunger 48 in an inward position . when it is desired to introduce the additive material , syringe 43 will have hypodermic needle 45 pierced through cap 32 and the contents of the syringe delivered into the y - reseal injection site 30 by moving plunger 49 into the syringe barrel . as clamp 36 is in a closed position , the contents of the syringe will fill into tubing 34 and 29 whereupon it will expand into the expansion means 10 . as this is occurring , the liquid in the expansion means 10 will in many instances fill it completely until it appears in the condition shown in fig2 . the excess liquid will then flow into tubing 26 and syringe 42 with an automatic moving outwardly of plunger 48 . it will be recognized also that tubing clamp 22 will be in a position to close tubing 20 which will have previously been filled with liquid from container 12 . to deliver the retrograde volume of liquid 44 , all that is required is that the syringes be removed from the injection sites and slide clamp 36 be opened . the retrograde volume will flow out to hypodermic needle 40 until the expansion means will assume the previous condition as indicated in fig1 . the operation of the expansion member 50 shown in fig3 and 4 will be as previously described for unit 10 . pleated tubing 53 will be in a collapsed condition before the retrograde fluid is introduced which is illustrated in fig3 . with the retrograde fluid 44 introduced it will assume a position as shown in fig4 . accordingly , the only difference between utilizing the corrugated tubing 50 over the pleated chamber 10 is that it will be effected over a longer vertical dimension . the pleated or corrugated tubing representing the flexible expansion means 10 and 50 is composed of a resinous , plastic material such as polyvinyl chloride and can be formed in the usual manner into the pleated or corrugated condition . it is assembled in an i . v . set such as between two lengths of tubing 26 and 29 by solvent bonding as the same plastic material can be used for the tubing as well as for the expansion means 10 or 50 . alternatively , different thermoplastic materials can be used such as polyolefins and still be sealed or bonded together such as by means of epoxies . it will be appreciated that in place of a vented piercing pin 16 a nonvented one could be employed when a self collapsing container is employed such as a flexible container . further , when the flexible expansion means 10 or 50 is employed with a positive pressure system , such as an i . v . pump , it is important that the expandable wall sections 15 and 53 remain in one of two stable conditions , extended or collapsed . if they are allowed to collapse by their own resilience , they will influence the delivery rate and may bolus the patient . the preferred manner is to have them extended until the medication has been pushed toward the patient . they could then be collapsed by compressing them to their original shape . they would then be ready for use for the next retrograde medication procedure . it is apparent that some means of holding the expansion sections extended or collapsed against the pump pressures ( up to 40 psi ) must be employed if they are to be utilized in conjunction with an i . v . pump . this would be accomplished in using materials and fabrication methods to adjust the force required to expand or contract the pleated walls . the expansion or contracting sections should be of such rigidity that the sections , when filled with medication , will remain extended . controlled expansion is also required for if they expand unintentionally , the unit can draw blood into the catheter or needle . upper injection sites 24 and 54 are disclosed in conjunction with flexible expansion means 10 and 50 . while resulting in a less practical unit , these could be eliminated if the additive volume is less than the volume of the expanded section and the clamps above and below are closed when filling . overfilling will pressurize the capacity between the clamps : if the upper clamp is opened first , excess will go up to the drip chamber ; if the lower clamp is opened , the excess will be delivered to the patient ( bolus ). in utilizing the two syringe systems , one should be aware not to remove the same amount as added . it will thus be seen that through the present invention there is now provided a flexible expansion member for an i . v . administration set which will allow for varying the retrograde volume of an additive i . v . fluid . the flexible expansion member permits a large volume of liquid to be placed in an i . v . administration set between the respective injection sites obviating the need for a long length of flexible tubing . as will be readily appreciated , the i . v . solution container is usually set at a predetermined distance above the patient and the use of a long length of flexible tubing can be a problem because of potential kinking or constriction . it will be further seen that the flexible expansion means is simple in its construction and can be readily fabricated from standard thermoplastic materials and molding techniques . the foregoing invention can now be practiced by those skilled in the art . such skilled persons will know that the invention is not necessarily restricted to the particular embodiments presented herein . the scope of the invention is to be defined by the terms of the following claims as given meaning by the preceding description .
| 0 |
this invention relates to rapamycin dimers of general formula ( 1 ), which possess immunosuppressive and / or antifungal and / or antitumor and / or anti - inflammatory activity in vivo and / or inhibit thymocyte proliferation in vitro and are therefore useful in the treatment of transplantation rejection , autoimmune diseases ( i . e . lupus , rheumatoid arthritis , diabetes mellitus , multiple sclerosis ), fungal infections ( i . e . candida albicans ), cancer , and diseases of inflammation . ## str3 ## wherein a is --( ch 2 ) n --, --( ch 2 ) n --( ch โ ch )--( ch 2 ) m --, --( ch 2 ) n --(-- c . tbd . c --)--( ch 2 ) m -- , ## str4 ## substituted alkyl , substituted alkenyl , substituted alkynyl , and substituted aromatic ; n = 1 - 10 , m = 1 - 10 and n = m or n โ m the rapamycin dimers ( 1 ) of this invention can be prepared by standard literature procedure as outlined below ## str5 ## wherein r is rapamycin and a is as defined above . the ester formation between alcohol and acyl halide has been described [ jerry march , advanced organic chemistry , 3rd edition , published in 1985 , page 346 ]. the specific reaction condition employed in this invention was developed by s . rakhit of ayerst laboratories and reported in u . s . pat . no . 4 , 316 , 885 ( feb . 23 , 1982 ). immunosuppresive activity of the compounds of the present invention was evaluated in an in vitro standard pharmacological test procedure to measure lymphocyte proliferation ( laf ). the comitogen - induced thymocyte proliferation procedure ( laf ) was used as an in vitro measure of the immunosuppressive effects of representative compounds . briefly , cells from the thymus of normal balb / c mice were cultured for 72 hours with pha and il - 1 and pulsed with tritiated thymidine during the last six hours . cells are cultured with and without various concentrations of rapamycin , cyclosporin a , or test compound . cells are harvested and incorporated ; radioactivity is determined . inhibition of lymphoproliferation is assessed in percent change in counts per minute from non - drug treated controls . the results are expressed by the following ratio : ## equ1 ## the following table summarizes the results of representative compounds of this invention in this standard test procedure . table 1______________________________________biological activity - laf assay r /* a at 100 nm at 10 nm at ic . sub . 50______________________________________example 1 1 . 0 0 . 95 -- example 2 0 . 96 0 . 28 -- example 3 1 . 0 0 . 59 -- example 4 1 . 0 1 . 10 1 . 32______________________________________ * relative potency of analogs / rapamycin at dosages 100 nm and at 10 nm . the results of this standard pharmacological test procedure for a representative compound of this invention demonstrates that the compounds of this invention are useful as immunosuppressive agents . the compounds may be administered neat or with a pharmaceutical carrier to a mammal in need thereof . the pharmaceutical carrier may be solid or liquid . a solid carrier can include one or more substances which may also act as flavoring agents , lubricants , solubilizers , suspending agents , fillers , glidants , compression aids , binders or tablet - disintegrating agents ; it can also be an encapsulating material . in powders , the carrier is a finely divided solid which is in admixture with the finely divided active ingredient . in tablets , the active ingredient is mixed with a carrier having the necessary compression properties in suitable proportions and compacted in the shape and size desired . the powders and tablets preferably contain up to 99 % of the active ingredient . suitable solid carriers include , for example , calcium phosphate , magnesium stearate , talc , sugars , lactose , dextrin , starch , gelatin , cellulose , methyl cellulose , sodium carboxymethyl cellulose , polyvinylpyrrolidine , low melting waxes and ion exchange resins . liquid carriers are used in preparing solutions , suspensions , emulsions , syrups , elixirs and pressurized compositions . the active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid carrier such as water , an organic solvent , a mixture of both or pharmaceutically acceptable oils or fats . the liquid carrier can contain other suitable pharmaceutical additives such as solubilizers , emulsifiers , buffers , preservatives , sweeteners , flavoring agents , suspending agents , thickening agents , colors , viscosity regulators , stabilizers or osmo - regulators . suitable examples of liquid carriers for oral and parenteral administration include water ( partially containing additives as above , e . g . cellulose derivatives , preferably sodium carboxymethyl cellulose solution ), alcohols ( including monohydric alcohols and polyhydric alcohols , e . g . glycols ) and their derivatives , and oils ( e . g . fractionated coconut oil and arachis oil ). for parenteral administration , the carrier can also be an oily ester such as ethyl oleate and isopropyl myristate . sterile liquid carriers are useful in sterile liquid form compositions for parenteral administration . the liquid carrier for pressurized compositions can be halogenated hydrocarbon or other pharmaceutically acceptable propellent . liquid pharmaceutical compositions which are sterile solutions or suspensions can be utilized by , for example , intramuscular , intraperitoneal or subcutaneous injection . sterile solutions can also be administered intravenously . the compound can also be administered orally either in liquid or solid composition form . preferably , the pharmaceutical composition is in unit dosage form , e . g . as tablets or capsules . in such form , the composition is sub - divided in unit dose containing appropriate quantities of the active ingredient ; the unit dosage forms can be packaged compositions , for example , packeted powders , vials , ampoules , prefilled syringes or sachets containing liquids . the unit dosage form can be , for example , a capsule or tablet itself , or it can be the appropriate number of any such compositions in package form . the dosage to be used in the treatment must be subjectively determined by the attending physician . the following examples illustrate the preparation of representative compounds of this invention . a solution of 0 . 13 g adipoyl chloride in 1 ml dry toluene was added dropwise at room temperature to a solution of 1 . 10 g rapamycin in 20 ml dry toluene and 2 ml dry pyridine ; the resulting solution was heated at 50 ยฐ c . under nitrogen with stirring for 65 hours . the product was extracted into ethyl acetate after addition of 20 ml 2n hcl and 20 ml brine . the ethyl acetate solution was dried over mgso 4 and the solvent removed under reduced pressure . chromatography through silica gel using 10 % ethyl acetate in dichloromethane yielded 50 mg product as a yellow solid , mp 111 ยฐ- 142 ยฐ c . ir ( kbr ): 3430 , 2925 , 1718 , 1645 , 1352 , 1170 , 785 , and 632 cm - 1 . nmr ( cdcl 3 , 400 mhz ): ฮด 3 . 36 ( s , 6h , och 3 ), 3 . 33 ( s , 6h , och 3 ), 3 . 14 ( s , 6h , och 3 ), 1 . 75 ( s , 6h , ch 3 ), 1 . 65 ( s , 6h , ch 3 ). ms ( neg fab ): 1937 , 590 . a solution of 0 . 25 g pimeloyl chloride in 1 ml toluene was added to a solution of 1 . 12 g rapamycin in 35 ml toluene and 2 ml pyridine ; the resulting solution was heated at 50 ยฐ c . for 44 hours under nitrogen with stirring . upon cooling , 10 ml 2n hcl and 20 ml brine were added and the product was extracted into ethyl acetate ( 30 ml ), which was washed with brine dried over mgso 4 and evaporated . the residue was chromatographed through silica gel using a gradient of 5 % to 30 % ethyl acetate in dichloromethane , yielding 75 mg purified product as a pale yellow solid , mp 120 ยฐ- 150 ยฐ c . ir ( kbr ): 3440 , 2930 , 1732 , 1648 and 1455 cm - 1 . nmr ( cdcl 3 , 400 mhz ): ฮด 3 . 37 ( s , 6h , och 3 ), 3 . 34 ( s , 6h , och 3 ), 3 . 14 ( s , 6h , och 3 ). ms ( neg fab ): 1951 , 590 . a stirred solution of 1 . 24 g rapamycin and 0 . 30 g suberoyl chloride in 100 ml toluene and 2 ml pyridine was heated at 50 ยฐ c . for 66 hours under nitrogen , then cooled , diluted with 100 ml ethyl acetate and treated with 20 ml 2n hcl and 50 ml brine . the organic portion was washed with brine , dried over mgso 4 , stripped of solvent , and chromatographed through silica gel using a gradient of 0 . 5 % to 20 % methanol in dichloromethane , yielding 140 mg product as a pale yellow solid , mp 117 ยฐ- 134 ยฐ c . ir ( kbr ): 3430 , 2920 , 1728 , 1640 , 1442 and 980 cm - 1 . nmr ( cdcl 3 , 400 mhz ): ฮด 3 . 37 ( s , 6h , ome ), 3 . 33 ( s , 6h , ome ), 3 . 14 ( s , 6h , ome ). ms ( neg fab ): 1965 , 590 . a solution of 1 . 27 rapamycin and 50 mg azelaoyl chloride in 125 ml toluene and 2 ml pyridine was stirred at 50 ยฐ c . under nitrogen for 65 hours , then cooled and treated with 20 ml 2n hcl . the organic portion was washed with brine , dried over mgso 4 , stripped of solvent , and chromatographed through silica gel using a gradient of 0 . 5 % to 10 % methanol in dichloromethane , yielding 110 mg product as a pale yellow solid , mp 107 ยฐ- 125 ยฐ c . ir ( kbr ): 3450 , 2935 , 1730 , 1650 , 1455 , 1100 and 990 cm - 1 . nmr ( cdcl 3 , 400 mhz ): ฮด 3 . 375 ( s , 6h , ome ), 3 . 33 ( s , 6h , ome ), 3 . 14 ( s , 6h , ome ). ms ( neg fab ): 1979 , 590 . a solution of 100 mg 1 , 4 - phenylenediacrylic acid in 5 ml thionyl chloride was heated at reflux under nitrogen for two hours . the thionyl chloride was removed under reduced pressure ; the residue was dissolved in 5 ml toluene , added to a stirred solution of 0 . 90 g rapamycin in 25 ml toluene and 2 ml pyridine , and heated at 50 ยฐ c . for 72 hours . the cooled reaction mixture was treated with 20 ml 2n hcl and diluted with 20 ml ethyl acetate and 50 ml brine . the product was extracted into ethyl acetate and chromatographed through silica gel using a gradient of 0 to 3 percent methanol in dichloromethane , yielding 60 mg product as a pale yellow solid , mp 121 ยฐ- 131 ยฐ c . ir ( kbr ): 3420 , 2930 , 1715 , 1640 , 1445 , 1100 and 980 cm - 1 . nmr ( cdcl 3 , 400 mhz ): ฮด 7 . 64 ( d , 2h , j = 12 . 0 hz ), 7 . 52 ( s , 4h , aromatic ), 6 . 47 ( d , 2h , j = 12 . 0 hz ), 3 . 38 ( s , 6h , ome ), 3 . 32 ( s , 6h , ome ), 3 . 12 ( s , 6h , ome ). ms ( neg fab ): 2009 ( m - ), 1112 , 590 .
| 2 |
fig1 shows the construction of an image forming system comprising a preferred embodiment of the present invention . this image forming system comprises a scanner 100 and printers 200 connected by means of their respective video interface , p1284 interface and network interface , such that they are capable of bi - directional communication . the original document images are read by a color ccd in the scanner 100 and output as 8 - bit r , g , and b image data . after undergoing various processes in an image processor 135 in the scanner 100 , such as rgb to ymck color conversion , the image data is sent to one of the printers 200 . although only one printer is illustrated in fig1 there may be several printers connected to the scanner 100 . the scanner 100 has a reading unit 110 equipped with a color ccd , a panel 120 by which instructions are input by the user , and a control board 130 . the control board 130 has a reading control unit 131 that controls the reading unit 110 , a memory 132 that temporarily stores the read image data , a backup ram 133 that stores the image processing parameters , a memory control unit 134 that controls the memory 132 and the backup ram 133 , an image processing unit 135 that performs image processing such as logarithmic conversion ( conversion from brightness data to density data ), ucr / bp processing ( undertone elimination and black ink generation ), color conversion ( conversion to ymck printing color data ), space filter processing such as smoothing ( moire suppression ) and mtf correction ( sharpening of character and line images ), and gamma correction ( linearization of the recording density ) appropriate for the output characteristics of the printer 200 , a panel control unit 136 that controls the panel 120 , a printer interface control unit 137 that controls the printer interface that allows communication with the printer 200 , and a cpu 138 that performs overall control of the components described above . the reading unit 110 and the control board 130 are connected through scsi ports , and the panel 120 and the control board 130 are connected by means of a dedicated interface . the interfaces for each printer comprise all of the interfaces capable of bi - directional communication , such as a p1284 interface , a network interface , and a video interface . the image data that has undergone image processing is transmitted to the printer 200 via the video interface . each printer 200 has a video interface 210 and a nonvideo interface 220 , each of which is capable of communication with the scanner 100 , an engine unit 230 that prints image data received via the video interface 210 , and a cpu 240 that performs overall control of the components mentioned above . the engine unit 230 forms images corresponding to each of the colors of yellow ( y ), magenta ( m ), cyan ( c ) and black ( k ), which together form a color image . in the image forming system of the present invention comprising a scanner and printers connected , as described above , image quality data for the images output from the printers 200 is transmitted to the scanner 100 , and variations in the image quality of the output images due to differences among the printers 200 are reduced by automatically adjusting the image processing parameters to have the scanner 100 correct the output images based on the data sent from the printer 200 . fig2 is a flow chart showing the sequence of the automatic adjustment process . automatic adjustment is begun by the user executing an instruction to begin from the panel 120 ( alternatively , automatic adjustment may be performed at regular intervals ). here , possible automatic adjustment modes provided include density gamma adjustment mode ( mode number m = 0 ) to automatically adjust for variations in the reproduced density gradation due to differences among the printers , and color adjustment mode ( mode number m = 1 ) to automatically adjust for variations in color reproduction . the mode number m may be set by an operator using the panel 20 . the mode number m change is implemented by the cpu 138 . the mode number m may be set by an operator using the panel 120 . the mode number m change is then implemented by the cpu 138 . when an instruction to begin automatic adjustment is issued , the cpu 138 of the scanner 100 determines from the result of communication with the printer 200 whether or not printer initialization has been completed ( step s 1 ). if the answer is no , the cpu 138 waits until initialization of printer 200 is completed , and if the answer is yes , it proceeds to the next step , step s 2 . in step s 2 , it is determined whether the active automatic adjustment mode is density gamma adjustment mode or color adjustment mode . if the active mode is density gamma adjustment mode ( yes in step s 2 ), the density gamma adjustment mode patterns shown in fig4 are created and stored in the pattern data buffer in the memory 132 ( step s 3 ) ( see fig3 ). the density gamma adjustment patterns comprise pattern data comprising combinations of c , m , y and k values each ranging from the smallest ( 1 ) to the largest ( 255 ). if the active mode is the color adjustment mode ( no in step s 2 ), the color adjustment patterns shown in fig5 are created and stored in the pattern data buffer in the memory 132 ( step s 4 ). the color adjustment patterns consist of pattern data comprising n different combinations of random c , m and y values . when the storage of pattern data in either step s 3 or step s 4 is completed , the command to begin automatic adjustment is sent to the printer 200 ( step s 5 ), and one item of pattern data is selected in step s 6 in accordance with the sequence of pattern data items ( pattern 1 to pattern n ) set in step s 3 or step s 4 . in step s 7 , the cpu 138 waits for receipt of the density data created by the printer 200 in accordance with the pattern data sent in step s 6 and sent to the printer 200 . on the other hand , if the printer 200 is an electrophotographic printer , a toner image is formed on the photoreceptor based on the received pattern data , the toner image is read by a density detection sensor not shown in the drawings , and density data is thereby obtained . this density data is then sent to the scanner 100 . however , if the printer 200 is an inkjet printer or a thermal transfer printer , the pattern may be created on paper and the density data for this pattern obtained . when the scanner 100 receives the density data from the printer 200 ( yes in step s 7 ), the density data is stored in the memory 132 ( step s 8 ), and the pattern data number n is incrementally increased ( step s 9 ). in step s 10 , it is determined whether the density data for the final pattern data item n has been stored . if the answer in step s 10 is no , the cpu 138 returns to step s 6 and the density data for the next pattern data is obtained . if the answer is yes , this means that the density data for all of the pattern data has been obtained , and the command to complete automatic adjustment is sent to the printer 200 ( step s 11 ). after the density data for all of the pattern data is obtained in this way , in step s 12 , it is determined whether the active automatic adjustment mode is density gamma adjustment mode or color adjustment mode . if it is density gamma adjustment mode ( yes in step s 12 ), density reproduction data is created from the density data ( step s 13 ), and a new gamma correction lookup table that comprises the image processing parameter is calculated ( step s 14 ) so that the printer input values and the read density have a linear relationship , as shown in fig7 ( c ). if the active automatic adjustment mode is color adjustment mode ( no in step s 12 ), color adjustment data is created ( step s 15 ) and a color adjustment parameter that comprises the image processing parameter is calculated from the color adjustment data ( step s 16 ). the processes of steps s 13 through s 16 are explained in further detail below . the image processing parameters calculated in steps s 14 and s 16 are stored in the backup ram 133 ( step s 17 ). fig6 is a block diagram showing the construction of the image processing unit 135 where the active automatic adjustment mode is the density gamma adjustment mode ( m = 0 ) as shown in the flow chart referred to above . the image processing sequence where the density gamma adjustment mode is active will be explained below with reference to fig6 . the 8 - bit r , g , and b image data read and output by the reading unit 110 is stored in the memory 132 in the control board 130 . the r , g , and b image data is then read out from the memory 132 synchronously with each of the ymck color images printed by the printer 200 , and after logarithmic conversion ( conversion from brightness data to density data ), ucr / bp processing ( undertone elimination and black ink generation ), and color conversion ( conversion to ymck printing color data ) are performed , space filter processing such as smoothing ( moire suppression ) and mtf correction ( sharpening of character and line images ), and gamma correction ( linearization of the recorded density ) appropriate for the output characteristics of the printer 200 are performed by the image processing unit 135 . on the other hand , the r , g , and b data read out from the memory 132 is input to an area differentiation unit 139 and area differentiation to distinguish between character areas and photo areas , for example , is performed . based on the results of this differentiation , the relative amounts of smoothing and mtf correction are alternated for each area , thereby improving image sharpness . the image data processed in this way is input into the printer 200 via the prescribed printer interface , and printing is performed . if the density gamma adjustment mode is active , as described above , the scanner 100 outputs the density gamma adjustment data shown in fig4 to the printer 200 ( steps s 5 through s 11 ), creates density reproduction data from the density data received from the printer 200 ( step s 13 ), and changes the gamma correction lookup table ( lut ) so that this density reproduction data will exhibit a linear relationship between the printer input values and the read density ( s 14 ). fig7 ( a ), 7 ( b ), and 7 ( c ) are graphs showing an example of the density reproduction data obtained from the printer and the linearization performed during automatic adjustment . as shown in fig7 ( a ), the image density reproduced ( read density ) generally does not have a linear relationship to the original document density to be reproduced ( printer input values ). this nonlinearity varies among printers , and variations in density and color are particularly marked in low - density areas . if gamma correction that is adjusted so as to satisfy linearity of only the average values in the drawing is performed with regard to the printer characteristics shown in fig7 ( a ), the result shown in fig7 ( b ) is obtained , and variations due to differences among printers remain . in the present invention , the settings of the scanner 100 are corrected so that the output from each printer 200 will exhibit a linear relationship between the printer input values and the read density . by performing this automatic adjustment for each printer 200 as described above , as shown in fig7 ( c ), image reproduction is attained that comes very close to satisfying this linearity criterion at all times regardless of the differences among the printers 200 , and variations in the output image quality that occur due to differences among conventional printers , printer changes over time and replacement of consumable parts are reduced . fig8 is a block diagram showing the construction of the image processing unit 135 where the active automatic adjustment mode is the color adjustment mode ( m = 1 ) as shown in the above flow chart . the image processing sequence where the color adjustment mode is active will be explained below with reference to fig8 . this image processing sequence is basically identical to that shown in fig6 . in other words , the 8 - bit r , g , and b image data read and output by the reading unit 110 is stored in the memory 132 in the control board 130 . the r , g , and b image data is then read out from the memory 132 synchronously with the ymck color images printed by the printer 200 , and after logarithmic conversion , ucr / bp processing and color conversion masking matrix conversion are performed , space filter processing such as smoothing and mtf correction and gamma correction appropriate for the output characteristics of the printer 200 are performed by the image processing unit 135 . on the other hand , the r , g , and b data taken out from the memory 132 is input to the area differentiation unit 139 and area differentiation to distinguish among character areas and photo areas , for example , is performed . based on the results of this differentiation , the relative amounts of smoothing and mtf correction are alternated for each area , thereby improving image sharpness . the image data processed in this way is input into the printer 200 via a prescribed printer interface , and printing is performed . if the color adjustment mode is active , as described above , the scanner 100 outputs the color adjustment patterns to the printer 200 ( steps s 5 through s 11 ), creates color adjustment data from the density data received from the printer 200 ( step s 15 ), and changes the color adjustment parameter using this color adjustment data ( step s 16 ). specifically , the color adjustment chart ( a chart in which each of ymck colors has a linear relationship to the density ) is read by the reading unit 110 , r , g and b average values are calculated for each patch , and data ( color adjustment pattern ) is created by performing logarithmic conversion and ucr / bp processing to all of the data ( step s 4 ). the data obtained from the logarithmic conversion and ucr / bp processing is termed data 1 ( dr , dg , db ). this data 1 is then output to the printer 200 in accordance with the sequence outlined in the flow chart of fig2 ( steps s 5 through s 11 ), and color adjustment density data is thereby obtained ( step s 15 ). this data is termed data 2 . the color conversion masking matrix is then sought using the smallest square method so that the error between data 1 and data 2 will be the smallest ( step s 16 ). in other words , a is sought that makes the error between ax and y the smallest when ax = y , data 1 is x and data 2 is y in the equation 1 below ( color conversion masking matrix conversion equation ). namely , the equation 2 below is obtained using smallest square method curve - fitting . ๎ข equation ๎ข ๎ข 1 ๎ข : ๎ข ( ๎ข m11 m12 m13 m14 m15 m16 m17 m18 m19 m21 m22 m23 m24 m25 m26 m27 m28 m29 m31 m32 m33 m34 m35 m36 m37 m38 m39 ๎ข ) ๎ข ( ๎ข dr dg dg dr ร dg 256 dg ร db 256 dr ร db 256 dr 2 256 dg 2 256 db 2 256 ๎ข ) = ( ๎ข c m y ๎ข ) ๎ข equation ๎ข ๎ข 2 ๎ข : ๎ข โ i = 0 n ๎ข ๎ข { ๎ข ci - ( m11 ร x1 i + m12 ร x2 i + m13 ร x3 i + m14 ร x4 i + m15 ร x5 i + m16 ร x6 i + m17 ร x7 , + m18 ร x8 i + m19 ร x9 i ) ๎ข } 2 m 11 through m 19 that will make the result of this equation 2 the smallest are then sought . m 21 through m 29 and m 31 through m 39 are sought in the same manner and deemed the color conversion masking coefficients . fig9 is a flow chart showing the sequence of the copying operation after automatic adjustment . when the user issues a copy instruction via the panel 120 , the cpu 138 of the scanner 100 reads the image processing parameter stored in the step s 17 described above from the backup ram 133 ( step s 21 ) and sets the read parameter in the image processing unit 135 ( step s 22 ). it then begins scanning by means of the reading unit 110 to read the original document , and processes the image data obtained by means of the image processing unit 135 in which the new parameter is set ( see fig6 and 8 ) ( step s 23 ). the processed image data is input to the printer 200 via the prescribed printer interface , whereby printing is begun ( step s 24 ). therefore , using this embodiment , the scanner 100 calculates and stores the scanner image processing parameter for density gamma adjustment or color adjustment and performs image processing using the current scanner image processing parameter when copying is begun . consequently , the variations in the reproduced gradation and color reproduction that occur due to the differences among printers 200 may be automatically adjusted for on the side of the scanner 100 such that more precise correction is possible and variations in output image quality are further reduced . in addition , not only the variations in output image quality due to the differences among printers 200 , but also the variations in output image quality that occur due to changes in the printers 200 over time or to the replacement of consumable parts may be adjusted for in the same manner . the variations in output image quality are further reduced from this perspective as well . further , even where different combinations are used for the scanner 100 and printers 200 , the automatic adjustment described above is applicable to reduce the variations in output image quality . moreover , where image processing is performed using a personal computer and the image data is output to printers 200 , adjustment for the differences among the printers 200 may be performed . the automatic adjustment by the scanner 100 is performed by the cpu 138 executing a prescribed program that describes the processing sequence described above . this prescribed program is provided in the form of a computer - readable recording medium ( floppy disk or cd - rom , for example ). this prescribed program may be provided on its own as application software that executes the processing explained above or may be incorporated in the scanner software as one of the scanner functions . this applies where the output from the scanner undergoes image processing by means of a personal computer and is then output to the printers . as explained above , using the present invention , adjustment of image processing parameters is performed in the image processor , and therefore , variations in the reproduced gradation and color reproduction due to the different characteristics of the image forming apparatuses may be automatically adjusted for on the side of the image processor , whereby more precise correction may be performed and the variations in output image quality are further reduced . the variations in output image quality due to changes in the image forming apparatuses over time in the market or to replacement of consumable parts may also be automatically adjusted for . while particular embodiments of the present invention have been illustrated and described herein , the scope of this patent is not limited to the particular illustrated embodiments . the scope of the patent shall be defined by the following claims and equivalents thereto .
| 6 |
the permeation rate used herein means the amount of a permeate per unit membrane area per unit time and expressed by the unit of kg / m 2 . hr . on the other hand , the separation factor ( ฮฑ ) is the ratio of the proportion of water to an organic compound in the feed mixture , to that in the permeate in vapor form . that is , ฮฑ =( x / y ) p /( x / y ) f , wherein x and y are compositions of water and an organic compound in a two - component system , respectively : and p and f represent the permeate and the feed mixture , respectively . in order to further illustrate the present invention in detail , a mechanism of separation of liquid by pervaporation is set forth hereinafter . that is , the mechanism of separation of liquid by pervaporation is said to be dissolution and diffusion of liquid in a membrane . generally , a separation factor ฮฑ ab which is a value obtained by dividing a weight ratio of a component to b component after permeation through a membrane by that before permeation can be expressed by the product of a ratio of solubilities of a and b components to the membrane and a ratio of diffusion rates of a and b components in the membrane . therefore , in order to increase the separation factor ฮฑ ab , it is necessary to increase either or both of the solubility ratio and the ratio of diffusion rates of a and b components . the solubility is mainly determined by interaction between permeate molecules and a membrane ( chemical miscibility ). as a measure of chemical miscibility between a material constituting a membrane and a material to be separated , a solubility parameter is taken . upon choosing a material constituting a membrane , it is preferred to choose a material having high chemical miscibility or similar polarity to a material to be separated . and , it is said that , in the case that a material to be separated ( permeate molecules ) is hydrophilic , a material constituting a membrane having a high solubility parameter and high polarity is suitable and , in the case that a material is not hydrophilic , a material constituting a membrane having reverse properties is suitable . the diffusion rate is determined by shape , size and an agglomeration state of permeate molecules , and a free volume of a membrane . in order to increase a separation factor ฮฑ ab , shape of permeate molecules in a feed mixture should be largely different . in general , a smaller molecule has a larger diffusion rate . however , when a given material to be separated is fixed , it is difficult to increase a diffusion rate ฮฑ ab by difference in shape of permeate molecules . on the other hand , a free volume of a membrane is defined by molecular spacings in the sense of a molecular measure , although it is not macroscopic holes . when a low molecular weight material which makes molecular motion of a high molecular weight material vigorous is contained , a free volume of a membrane becomes larger , which facilitates permeation . in a membrane having a larger free volume , difference between diffusion rates due to difference in size of permeate molecules becomes smaller , whereas , in a membrane having a smaller free volume , difference between diffusion rates due to difference in size of permeate molecules becomes larger . in order to increase a separation factor by utilizing size of permeate molecules , a free volume of a membrane should be small . in order to make a free volume of a membrane smaller , there is employed such a method as introduction of a crosslinking structure or crystalline structure to form three dimensional network . according to the present inventor &# 39 ; s study on various membranes for separation of an aqueous solution containing a water soluble organic compound , particularly , ethanol by pervaporation , it has been found that a separation membrane which is obtained by adding polystyrene sulfonic acid to polyvinyl alcohol having a large solubility parameter , i . e ., strong hydrophilic nature , and subjecting the mixture to heat treatment to effect intermolecular crosslinking reaction between the hydroxy group of polyvinyl alcohol and the sulfonic acid group of polystyrene sulfonic acid can selectively separate the alcohol from the water - alcohol mixture , and the membrane has sufficient durability as well as high permeation rate and separation factor throughout a wide concentration range of the alcohol . the sulfonic acid group of the above reaction mixture may be introduced as a sulfonate group . as the polyvinyl alcohol copolymer used in the present invention , there can be used copolymers of polyvinyl alcohol and other polymers such as polyethylene , polyvinyl acetate , polymethyl acrylate , polystyrene , polyacrylonitrile , polyacrylic acid and the like . however , in the present invention , preferably , polyvinyl alcohol is used . as the polystyrene sulfonic acid copolymer , there can be used copolymers of polystyrene sulfonic acid and other polymers such as polyacrylonitrile , polyvinyl chloride , polymethyl acrylate , polyacrylic acid and the like . however , in the present invention , preferably , polystyrene sulfonic acid is used . the separation membrane of the present invention can be prepared by , for example , dissolving polyvinyl alcohol or the polyvinyl alcohol copolymer , and polystyrene sulfonic acid or the polystyrene sulfonic acid copolymer in water or an aqueous solution containing a water soluble organic compound such as an alcohol or the like and casting the solution on a porous supporting material , for example , an ultrafiltration membrane . drying and heat treatment are carried out , simultaneously to effect intermolecular crosslinking to form a coat layer on the porous supporting material a crosslinked reaction mixture of the polyvinyl alcohol or polyvinyl alcohol copolymer and the polystyrene sulfonic acid or polystyrene sulfonic acid copolymer . the heat treatment is carried out at a temperature in the range of 80 ยฐ to 200 ยฐ c ., preferably , 100 ยฐ to 150 ยฐ c . the mixing ratio of polyvinyl alcohol and polystyrene sulfonic acid is in the range of , preferably , 1 to 10 parts by weight , more preferably , 1 . 5 to 5 parts by weight of polyvinyl alcohol per 1 part by weight of polystyrene sulfonic acid . the porous supporting material that having micropores of several tens to several thousands รฅ on its surface . examples thereof include porous supporting material made of known materials such as polysulfone , polyether sulfone , polyacrylonitrile , cellulose esters , polycarbonate , polyvinylidene fluoride and the like . the porous supporting material may be in any shape , for example , it may be flat membrane , tubular membrane , hollow fiber membrane and the like . preferably , the coat layer composed of the thin film of the crosslinkable film is as thin as possible so far as it is pinhole free . the thickness of the coat layer is 0 . 05 to 5 ฮผm , preferably , 0 . 1 to 1 ฮผm . in order to thin the thickness of the coat layer , it is necessary to decrease the solids content of the solution applied on the porous supporting material , or the thickness of the coated film . the solids content is , preferably , 1 to 15 % by weight , more preferably , 5 to 10 % by weight . in order to thin the thickness of the film , it is necessary to choose a suitable coating method . in order to form a uniform pinhole free film , the solution is preferably applied on the porous supporting material with a bar coating machine , a spin coating machine and the like . in the membrane thus produced , oh group of polyvinyl alcohol and so 3 h group of polystyrene sulfonic acid are reacted to form intermolecular crosslinking . formation of crosslinking can be confirmed by solubility of the membrane in a mixture to be separated or the infrared absorption spectrum of the membrane . when crosslinking is not formed , the membrane is dissolved during separation operation . a partially remaining sulfonic acid group is neutralized with a base to convert into a sulfonate . examples of the counter cation of the sulfonate include alkali metals , alkaline earth metals , transition metals and ammonium ions of the formula r 4 n + wherein r is hydrogen or alkyl . preferably , it is an alkali metal , particularly , sodium . the membrane thus formed is mainly used for separation of a mixture of water and one or more organic compounds , for example , an aqueous solution containing one or more organic compounds selected from the group consisting of alcohols such as methanol , ethanol , 1 - propanol , 2 - propanol , n - butanol and the like ; ketones such as acetone , methyl ethyl ketone and the like ; ethers such as tetrahydrofuran , dioxane and the like organic acids such as formic acid , acetic acid and the like aldehydes such as formaldehyde , acetaldehyde , propionaldehyde and the like ; and amines such as pyridine , picoline and the like . further , the membrane can be used for separation of a gaseous mixture of water and these organic compounds . according to the present invention , separation can be carried out by the steps of ( a ) contacting one side of the separation membrane of the present invention with a liquid feed mixture containing water and at least one organic compound ; and ( b ) withdrawing from the other side of said membrane a permeate in a vapor state . these operations per se can be carried out according to a known method . by using the membrane of the present invention , separation of an organic liquid mixture throughout a wide concentration range can be efficiently carried out at a large permeation rate with maintaining a separation factor higher than that of a known separation method using a conventional membrane . thereby , a compact and rational separation system can be realized and it is possible to improve the ability of treatment and decrease in cost . thus , according to the present invention , a membrane separation method is practically applicable for reducing operation steps and saving energy in separation and purification processes in chemical industries . the following comparative examples and examples further illustrate the present invention in detail but are not to be construed to limit the scope thereof . the following pervaporation experiments were carried out by maintaining one side of a membrane to which a mixture of water and a water soluble organic compound was fed at atmosphere pressure and the other permeate side at reduced pressure not more than 0 . 3 mmhg . the active surface of the membrane was directed to the feed side and the feed mixture was added on the surface and stirred at a constant temperature . at this time , effective membrane area was 15 . 2 cm 2 . water and the organic compound permeated through the membrane were collected by condensation with liquid nitrogen . n - propanol was added to the permeate as an internal standard and a permeation rate and a separation factor were determined by tcd gas chromatography . by the way , the separation factor of water to ethanol ฮฑ etoh h . sbsp . 2 o is defined as follows : ## equ1 ## wherein x etoh and x h . sbsb . 2 o are ethanol and water contents (% by weight ) in the feed mixture , respectively ; and y etoh and y h . sbsb . 2 o are ethanol and water contents (% by weight ) in the permeate . polyvinyl alcohol having a polymerization degree of 2 , 000 ( 7 g ) was dissolved in water ( 93 g ) at 80 ยฐ c . after cooling to room temperature , the solution was applied on an ultrafiltration membrane composed of polyacrylonitrile with a spin coating machine . the coated ultrafiltration membrane was dried at 40 ยฐ c . for 1 hour and then subjected to heat treatment at 120 ยฐ c . for 2 hours . the pervaporation ability in aqueous 95 % ( w / w ) ethanol solution of the membrane thus obtained was such that the permeation rate was 0 . 02 kg / m 2 . hr and the separation factor ( ฮฑ etoh h . sbsp . 2 o ) was 160 . polystyrene having a polymerization degree of 1 , 000 to 1 , 400 ( 10 g ) was dissolved in carbon tetrachloride ( 200 ml ) at 60 ยฐ c . for 1 hour . then , the solution was placed in a four necked flask and conc . sulfuric acid ( 30 ml ) was added to the flask under nitrogen atmosphere . the mixture was reacted at 60 ยฐ c . for 4 hours . the reaction mixture was added to dehydrated ether to form a white precipitate . to the precipitate was added carbon tetrachloride to dissolve the precipitate . the solution was further added to dehydrated ether to form a precipitate . this procedure was repeated four times to purify the reaction product . the reaction product was confirmed as polystyrene sulfonic acid by its infrared absorption spectrum . to the polystyrene sulfonic acid thus obtained ( 1 . 2 g ) were added polyvinyl alcohol having a polymerization degree of 2 , 000 ( 1 . 8 g ), ethanol ( 1 . 4 g ) and water ( 24 g ) and the mixture was dissolved at 80 ยฐ c . the solution was applied on an ultrafiltration membrane composed of polyacrylonitrile with a spin coating machine ( 800 r . p . m .). the coated membrane was dried at 40 ยฐ c . for 1 hour and then subjected to heat treatment at 120 ยฐ c . for 2 hours to effect crosslinking . the pervaporation ability in aqueous 95 % ( w / w ) ethanol solution of the membrane thus obtained was such that the permeation rate was 3 . 8 ร 10 - 2 kg / m 2 . hr and the separation factor ( ฮฑ etoh h . sbsp . 2 o ) was 97 . polystyrene having a polymerization degree of 1 , 000 to 1 , 400 ( 10 g ) was dissolved in carbon tetrachloride ( 200 ml ) at 60 ยฐ c . for 1 hour . then , the solution was placed in a four necked flask and conc . sulfuric acid ( 30 ml ) was added to the flask under nitrogen atmosphere . the mixture was reacted at 60 ยฐ c . for 4 hours . the reaction mixture was added to dehydrated ether and to form a white precipitate . to the precipitate was added carbon tetrachloride to dissolve the precipitate . the solution was further added to dehydrated ether to form a precipitate . this procedure was repeated four times to purify the reaction product . the reaction product was confirmed as polystyrene sulfonic acid by its infrared absorption spectrum . to the polystyrene sulfonic acid thus obtained ( 1 . 2 g ) were added polyvinyl alcohol having a polymerization degree of 2 , 000 ( 1 . 8 g ), ethanol ( 14 g ) and water ( 24 g ) and the mixture was dissolved at 80 ยฐ c . the solution was applied on an ultrafiltration membrane composed of polyacrylonitrile by a spin coating machine ( 800 r . p . m .). the coated membrane was dried at 40 ยฐ c . for 1 hour and then subjected to heat treatment at 120 ยฐ c . for 2 hours to effect crosslinking . the membrane was soaked in an aqueous ethanol solution for 1 hour , aqueous 0 . 1 n naoh solution for 1 hour , 0 . 1 n nacl solution for 1 hour and then the ethanol solution for 1 hour and was dried at room temperature . the pervaporation ability of the membrane obtained is shown in table 1 . table 1______________________________________ separation ethanol permeation factorrun conc . temp . rate h . sub . 2 ono . ( wt %) (ยฐ c .) ( kg / m . sup . 2 ยท hr ) ( ฮฑ . sub . etoh ) ______________________________________1 90 60 0 . 34 15002 95 60 0 . 14 14303 99 60 0 . 03 9904 95 75 0 . 23 950______________________________________ sodium poly - p - styrene sulfonate ( 10 g ) was dissolved in water ( 100 ml ). to the solution was added h + type cation exchange resin ( amberlite ir - 120b ) ( 25 ml ) and the mixture was stirred for 1 hour . by this procedure , the sodium poly - p - styrene sulfonate was converted into poly - p - styrene sulfonic acid . the ion exchange resin was filtered off and to the filtrate ( 50 ml ) were added polyvinyl alcohol ( 4 . 2 g ) and water ( 50 g ). the solution was applied on a polyacrylonitrile ultrafiltration membrane by a bar coating machine . the coated ultrafiltration membrane was dried at 40 ยฐ c . for 1 hour and subjected to heat treatment at 120 ยฐ c . for 2 hours to effect intermolecular crosslinking . the pervaporation ability of this membrane is shown in table 2 . table 2______________________________________ separation ethanol permeation factorrun conc . temp . rate h . sub . 2 ono . ( wt %) (ยฐ c .) ( kg / m . sup . 2 ยท hr ) ( ฮฑ . sub . etoh ) ______________________________________5 50 60 40 266 75 60 0 . 25 497 95 60 0 . 03 5008 95 40 0 . 23 12909 99 40 0 . 01 710______________________________________ the membrane obtained in comparative example 1 was soaked in an aqueous ethanol solution for 1 hour , 0 . 1 n koh solution or 0 . 1 n csoh solution for 3 hours and then the ethanol solution for 1 hour and was dried at room temperature . the pervaporation ability of this membrane is shown in table 3 . table 3______________________________________ separation ethanol permeation factorrun conc . temp . rate h . sub . 2 ono . base ( wt %) (ยฐ c .) ( kg / m . sup . 2 ยท hr ) ( ฮฑ . sub . etoh ) ______________________________________10 koh 95 60 0 . 16 84011 csoh 95 60 0 . 13 630______________________________________ according to the same manner as described in example 1 , a separation membrane was prepared except that the mixing ratio ( weight ratio ) of polyvinyl alcohol and polystyrene sulfonic acid , and the total weight % ( solids content ) of polystyrene sulfonic acid and polyvinyl alcohol were varied . the pervaporation ability of the membrane prepared is shown in table 4 . the pervaporation ability was determined by feeding aqueous 95 % ( w / w ) ethanol solution at 60 ยฐ c . table 4______________________________________ separation solids mixing * permeation factorrun content ratio rate h . sub . 2 ono . ( wt %) ( wt ratio ) ( kg / m . sup . 2 ยท hr ) ( ฮฑ . sub . etoh ) ______________________________________12 7 . 5 2 . 0 / 1 . 0 0 . 10 97013 7 . 5 1 . 5 / 1 . 0 0 . 13 107014 7 . 5 1 . 0 / 1 . 0 0 . 13 36015 5 . 0 1 . 5 / 1 . 0 0 . 10 19016 3 . 7 1 . 5 / 1 . 0 0 . 11 140______________________________________ * polyvinyl alcohol / polystyrene sulfonic acid to polystyrene sulfonic acid ( 1 . 2 g ) were added polyvinyl alcohol having a polymerization degree of ( 1 . 8 g ), ethanol ( 14 g ) and water ( 24 g ) and the mixture was dissolved at 80 ยฐ c . the solution was applied on a glass plate and dried at 40 ยฐ c . for 1 hour to prepare a membrane . the infrared absorption spectrum of this membrane is shown in fig1 . further , the membrane was subjected to heat treatment at 120 ยฐ c . for 2 hours . the infrared absorption spectrum of this membrane is shown in fig2 . as shown by these drawings , absorption bands at 1180 cm - 1 and 1450 cm - 1 are newly appeared by heat treatment at 120 ยฐ c . for 2 hours . these absorption bands are corresponding to r -- o -- so 2 -- r formed by the crosslinking reaction of the polyvinyl alcohol and polystyrene sulfonic acid , and become more intense by heating for a longer time .
| 8 |
the present invention is a system and method for remotely processing misrecognized speech generated when converting speech audio to text in an embedded speech recognition system . as used herein , an embedded speech recognition system refers to a speech recognition system that is bound in a functionally fixed manner within specific hardware ; hardware which is not designed to be re - purposed by a user , meaning that a user should not โ delete โ speech recognition software from the hardware device in order to use the device for a purpose unrelated to speech recognition . that is , an embedded speech recognition system utilizes specialized hardware for performing speech recognition tasks . the embedded speech recognition system can be an integrated part of a stand - alone computing device , such as a mobile dictation device . it should be noted that embodiments exist where the embedded speech recognition system can receive external input and where firmware updates can be applied to the embedded speech recognition system . such actions are not to be construed as โ re - purposing โ the embedded speech recognition system , for purposes of the invention detailed herein . fig1 is a schematic illustration illustrating the interaction between an embedded speech recognition system 110 and a remote training system 120 , both configured in accordance with the inventive arrangements . as shown in fig1 , the method can include detecting a speech misrecognition in the embedded speech recognition system 110 . misrecognized speech can refer to speech recognized text which does not match the actual audio input provided by the speaker . an example of misrecognized speech can include the speech recognized text , โ time โ resulting from the speaker provided audio input , โ climate โ. upon detecting a speech misrecognition , both the speech audio associated with the misrecognized and the active acoustic model 130 can be transmitted to the remote training system 120 . subsequently , the remote training system 120 can use the speech audio in a process for modifying the acoustic model . once modified , the improved acoustic model 140 can be transmitted back to the embedded speech recognition system 110 . as shown in fig1 , the embedded speech recognition system 110 and the remote training system 120 can communicate through communications link 150 . communications link can be any suitable communications system , including both wireless or wireline technologies . examples of wireless technologies can include line - of - sight technologies such as infrared , radio frequency communications , including cellular , as well as short - range radio frequency communications technologies , such as bluetooth โข technology from the bluetooth special interest group . examples of wireline technologies can include direct cable technologies such as usb , and serial communications , as well as communications network technologies such as ethernet . fig2 shows an embedded speech recognition system 110 suitable for use with the present invention . the embedded speech recognition system 110 preferably is comprised of an embedded computing device including a central processing unit ( cpu ) 202 , one or more memory devices and associated circuitry 204 a , 204 b . the embedded speech recognition system 110 also can include an audio input device such as a microphone 208 and an audio output device such as a speaker 210 , both operatively connected to the computing device through suitable audio interface circuitry 206 . the cpu 202 can be comprised of any suitable microprocessor or other electronic processing unit , as is well known to those skilled in the art . memory devices can include both non - volatile memory 204 a and volatile memory 204 b . examples of non - volatile memory can include read - only memory and flash memory . examples of non - volatile memory can include random access memory ( ram ). the audio interface circuitry 206 can be a conventional audio subsystem for converting both analog audio input signals to digital audio data , and also digital audio data to analog audio output signals . in one aspect of the present invention , a display 225 and corresponding display controller 220 can be provided . the display 225 can be any suitable visual interface , for instance an lcd panel , led array , crt , etc . in addition , the display controller 220 can perform conventional display encoding and decoding functions for rendering a visual display based upon digital data provided in the embedded speech recognition system 110 . still , the invention is not limited in regard to the use of the display 225 to present visual feedback to a speaker . rather , in an alternative aspect , an audio user interface ( aui ) can be used to provide audible feedback to the speaker in place of the visual feedback provided by the display 225 and corresponding display controller 220 . moreover , in yet another alternative aspect , feedback can be provided to the speaker through both an aui and the display 225 . fig3 illustrates an exemplary high level architecture for the embedded speech recognition system 110 of fig1 . as shown in fig3 , an embedded speech recognition system 110 for use with the invention typically can include an operating system 302 , a speech recognition engine 310 , a speech enabled application 320 , and acoustic models / language models 330 for use by the speech recognition engine 310 . notably , acoustic models 330 can include phonemes which can be used by the speech recognition engine 310 to derive a list of potential word candidates from an audio speech signal . significantly , in fig3 , the speech recognition engine 310 , speech enabled application 320 and acoustic / language models 330 are shown as separate application programs . it should be noted however that the invention is not limited in this regard , and these various application programs could be implemented as a single , more complex applications program . for example the speech recognition engine 310 could be combined with the speech enabled application 320 . referring now to both fig2 and 3 , during a speech recognition session , speech audio signals representative of sound received in microphone 208 are processed by cpu 202 within the embedded speech recognition system 110 using audio circuitry 206 so as to be made available to the operating system 302 in digitized form . the speech audio signals received by the embedded speech recognition system 110 are conventionally provided to the speech recognition engine 310 via the computer operating system 302 in order to perform speech - to - text conversions on the speech audio signals which can produce speech recognized text . in sum , as in conventional speech recognition systems , the audio signals are processed by the speech recognition engine 310 using acoustic models 330 to identify words spoken by a user into microphone 208 . once speech audio signals representative of speech have been converted to speech recognized text by the speech recognition engine 310 , the speech recognized text can be provided to the speech enabled application 320 for further processing . examples of speech enabled applications can include a speech - driven command and control application , or a speech dictation system , although the invention is not limited to a particular type of speech enabled application . the speech enabled application , in turn , can present the speech recognized text to the user through a user interface . for example , the user interface can be a visual display screen , an lcd panel , a simple array of leds , or an aui which can provide audio feedback through speaker 210 . in any case , responsive to the presentation of the speech recognized text , a user can determine whether the speech recognition engine 310 has properly speech - to - text converted the user &# 39 ; s speech . in the case where the speech recognition engine 310 has improperly converted the user &# 39 ; s speech into speech recognized text , a speech misrecognition is said to have occurred . importantly , where the user identifies a speech misrecognition , the user can notify the speech recognition engine 310 . specifically , in one aspect of the invention , the user can activate an error button which can indicate to the speech recognition engine that a misrecognition has occurred . however , the invention is not limited in regard to the particular method of notifying the speech recognition engine 310 of a speech misrecognition . rather , other notification methods , such as providing a speech command can suffice . responsive to receiving a misrecognition error notification , the speech recognition engine 310 can transmit the original speech audio signal which had been misrecognized , and the active acoustic model to the remote training system 120 . additionally , the active language model also can be transmitted to the remote training system 120 . subsequently , the remote training system can process the speech audio signal and the active acoustic model to modify the acoustic model in a speech training session . fig4 illustrates an exemplary high level architecture for the speech training system 120 of fig1 . as shown in fig4 , a speech training system 120 for use with the invention typically can include an operating system 402 , a speech recognition engine 410 , a speech training application 420 , and acoustic models / language models 430 for use by the speech recognition engine 410 and for modification by the speech training application 420 . as in the case of fig3 , in fig4 the speech recognition engine 410 , speech training application 420 and acoustic / language models 430 are shown as separate application programs . it should be noted however that the invention is not limited in this regard , and these various application programs could be implemented as a single , more complex applications program . in operation , during a remote speech training session , a list of contextually valid phrases in the speech recognition system can be presented to the user . contextually valid phrases can include those phrases in a finite state grammar system which would have been valid phrases at the time of the misrecognition . for example , in a speech - enabled word processing system , while editing a document , a valid phrase could include , โ close document โ. by comparison , in the same word processing system , prior to opening a document for editing , an invalid phrase could include โ save document โ. hence , if a misrecognition error had been detected prior to opening a document for editing , the phrase โ save document โ would not be included in a list of contextually valid phrases , while the phrase โ open document โ would be included in a list of contextually valid phrases . once the list of contextually valid phrases has been presented to the user , the user can select one of the phrases as the phrase actually spoken by the user . subsequently , a list words can be presented which form the selected phrase . again , the speaker can select one or more words in the list which represent those words originally spoken by the speaker , but misrecognized by the embedded speech recognition system 110 . these words can be processed along with the stored speech audio input and the active language model 430 by the speech training application 420 . more particularly , the speech training application 420 can incorporate corrections into acoustic models 430 based on the specified correct words . by modifying the acoustic models 430 during a speech training session , the accuracy of the speech recognition engine 310 of the embedded speech recognition system 110 can increase as fewer misrecognition errors can be encountered during a speech recognition session . fig5 a is a flow chart illustrating a method for processing a misrecognition error in an embedded speech recognition system during a speech recognition session . the method can begin in step 502 in which an embedded speech recognition system can await speech input . in step 504 , if speech input is not received , the system can continue to await speech input . otherwise , in step 506 the received speech input can be speech - to - text converted in a speech recognition engine , thereby producing speech recognized text . in step 508 , the speech recognized text can be presented through a user interface such as a visual or aui . subsequently , in step 510 if an error notification is not received , such notification indicating that a misrecognition has been identified , it can be assumed that the speech recognition engine correctly recognized the speech input . as such , the method can return to step 502 in which the system can await further speech input . in contrast , if an error notification is received , indicating that a misrecognition has been identified , in step 512 the speech audio input , active acoustic model , and the active language model can be transmitted to the remote speech training system . fig5 b is a flow chart illustrating a method for performing speech training in a remote speech training system based on a speech misrecognition detected in an embedded speech recognition system . in step 514 , each of the speech audio , active acoustic model and active grammar which had been received from the embedded speech recognition system can be recalled for use by the speech training system . subsequently , in step 516 a list of contextually valid phrases can be compiled indicating those phrases which would be considered valid speech input at the time of the misrecognition . additionally , in step 518 the list can be presented through a user interface . in step 520 , a phrase can be selected from among the phrases in the list . then , in step 522 , the words forming the selected phrase can be presented in a list of words through the user interface . in step 524 , one or more of the words can be selected , thereby indicating those words which had been misrecognized by the speech recognition engine . thereafter , in step 526 the selected words can be passed to a speech training process . also , in step 526 the original speech audio input and active grammar can be provided to the speech training process . in consequence , in step 528 , the speech training process can modify the acoustic model in order to improve future recognition accuracy . finally , in step 530 , the modified acoustic model can be transmitted back to the embedded speech recognition system . notably , the present invention can be realized in hardware , software , or a combination of hardware and software . the method of the present invention can be realized in a centralized fashion in one computer system , or in a distributed fashion where different elements are spread across several interconnected computer systems . any kind of computer system or other apparatus adapted for carrying out the methods described herein is suitable . a typical combination of hardware and software could be a general purpose computer system with a computer program that , when being loaded and executed , controls the computer system such that it carries out the methods described herein . the present invention can also be embedded in a computer program product , which comprises all the features enabling the implementation of the methods described herein , and which when loaded in a computer system is able to carry out these methods . computer program means or computer program in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : a ) conversion to another language , code or notation ; b ) reproduction in a different material form . while the foregoing specification illustrates and describes the preferred embodiments of this invention , it is to be understood that the invention is not limited to the precise construction herein disclosed . the invention can be embodied in other specific forms without departing from the spirit or essential attributes . accordingly , reference should be made to the following claims , rather than to the foregoing specification , as indicating the scope of the invention .
| 6 |
fig1 schematically depicts a lithographic projection apparatus 1 according to an embodiment of the invention . the apparatus 1 includes a base plate bp . the apparatus may also include a radiation source la ( e . g . uv or euv radiation , such as , for example , generated by an excimer laser operating at a wavelength of 248 nm , 193 nm or 157 nm , or by a laser - fired plasma source operating at 13 . 6 nm ). a first object ( mask ) table mt is provided with a mask holder configured to hold a mask ma ( e . g . a reticle ), and is connected to a first positioning device pm that accurately positions the mask with respect to a projection system or lens pl . a second object ( substrate ) table wt is provided with a substrate holder configured to hold a substrate w ( e . g . a resist - coated silicon wafer ), and is connected to a second positioning device pw that accurately positions the substrate with respect to the projection system pl . the projection system or lens pl ( e . g . a mirror group ) is configured to image an irradiated portion of the mask ma onto a target portion c ( e . g . comprising one or more dies ) of the substrate w . as here depicted , the apparatus is of a reflective type ( i . e . has a reflective mask ). however , in general , it may also be of a transmissive type , for example with a transmissive mask . alternatively , the apparatus may employ another kind of patterning device , such as a programmable mirror array of a type as referred to above . the source la ( e . g . a discharge or laser - produced plasma source ) produces radiation . this radiation is fed into an illumination system ( illuminator ) il , either directly or after having traversed a conditioning device , such as a beam expander , for example . the illuminator il may comprise an adjusting device configured to set the outer and / or inner radial extent ( commonly referred to as ฯ - outer and ฯ - inner , respectively ) of the intensity distribution in the beam of radiation pb . in addition , it will generally comprise various other components , such as an integrator and a condenser . in this way , the beam of radiation pb impinging on the mask ma has a desired uniformity and intensity distribution in its cross - section . it should be noted with regard to fig1 that the source la may be within the housing of the lithographic projection apparatus , as is often the case when the source la is a mercury lamp , for example , but that it may also be remote from the lithographic projection apparatus , the radiation which it produces being led into the apparatus ( e . g . with the aid of suitable directing mirrors ). this latter scenario is often the case when the source la is an excimer laser . the present invention encompasses both of these scenarios . the beam pb subsequently intercepts the mask ma , which is held on a mask table mt . having traversed the mask ma , the beam pb passes through the lens pl , which focuses the beam pb onto a target portion c of the substrate w . with the aid of the second positioning device pw and interferometer ( s ) if , the substrate table wt can be moved accurately , e . g . so as to position different target portions c in the path of the beam pb . similarly , the first positioning device pm can be used to accurately position the mask ma with respect to the path of the beam pb , e . g . after mechanical retrieval of the mask ma from a mask library , or during a scan . in general , movement of the object tables mt , wt will be realized with the aid of a long - stroke module ( coarse positioning ) and a short - stroke module ( fine positioning ), which are not explicitly depicted in fig1 . however , in the case of a wafer stepper ( as opposed to a step and scan apparatus ) the mask table mt may just be connected to a short stroke actuator , or may be fixed . the mask ma and the substrate w may be aligned using mask alignment marks m 1 , m 2 and substrate alignment marks p 1 , p 2 . 1 . the depicted apparatus can be used in two different modes : in step mode , the mask table mt is kept essentially stationary , and an entire mask image is projected at once , i . e . a single โ flash ,โ onto a target portion c . the substrate table wt is then shifted in the x and / or y directions so that a different target portion c can be irradiated by the beam pb ; 2 . in scan mode , essentially the same scenario applies , except that a given target portion c is not exposed in a single โ flash .โ instead , the mask table mt is movable in a given direction ( the so - called โ scan direction โ, e . g ., the y direction ) with a speed v , so that the beam of radiation pb is caused to scan over a mask image . concurrently , the substrate table wt is simultaneously moved in the same or opposite direction at a speed v = mv , in which m is the magnification of the lens pl ( typically , m = ยผ or โ
). in this manner , a relatively large target portion c can be exposed , without having to compromise on resolution . fig2 shows the projection apparatus 1 comprising an illumination system with a source - collector module or radiation unit 3 , illumination optics unit 4 , and projection optics system 5 . a radiation system 2 includes the source - collector module or radiation unit 3 and the illumination optics unit 4 . the radiation unit 3 may be provided with an euv radiation source 6 which may be formed by a discharge plasma . the euv radiation source 6 may employ a gas or vapor , such as xe gas or li vapor in which a very hot plasma may be created to emit radiation in the euv range of the electromagnetic spectrum . the very hot plasma is created by causing a partially ionized plasma of an electrical discharge to collapse onto the optical axis o . partial pressures of 0 . 1 mbar of xe , li vapor or any other suitable gas or vapor may be required for efficient generation of the radiation . the radiation emitted by radiation source 6 is passed from the source chamber 7 into collector chamber 8 via a gas barrier or โ foil trap โ 9 . the gas barrier 9 includes a channel structure such as , for example , described in detail in u . s . patent application publication 2002 / 0154279 a1 and u . s . pat . no . 6 , 359 , 969 . the collector chamber 8 includes a radiation collector 10 , which according to the present invention , is formed by a grazing incidence collector . radiation passed by collector 10 is reflected off a grating spectral filter 11 or mirror to be focused in a virtual source point 12 at an aperture in the collector chamber 8 . from chamber 8 , the beam of radiation 16 is reflected in illumination optics unit 4 via normal incidence reflectors 13 , 14 onto a reticle or mask positioned on reticle or mask table 15 . a patterned beam 17 is formed which is imaged in projection optics system 5 via reflective elements 18 , 19 onto wafer stage or substrate table 20 . more elements than shown may generally be present in illumination optics unit 4 and projection system 5 . as can be seen in fig3 , the grazing incidence collector 10 comprises a number of nested reflector elements 21 , 22 , 23 . a grazing incidence collector of this type is , for instance , shown in german patent application de 101 38 284 . 7 , which is equivalent to u . s . patent application publication 2003 / 0095623 a1 . the embodiment of the rotating channel array or barrier 43 according to the present invention as shown in fig4 shows the euv source 6 from which euv radiation beams 6 โฒ emanate . the beams 6 โฒ impinge on the barrier 43 forming part of a vacuum wall separating the source chamber from the uv optics downstream of the optical axis . the barrier 43 is rotatable around the optical axis o , as indicated by the arrow . it is also possible for the barrier 43 to rotate around the optical axis o in a direction opposite to the direction of the arrow or alternately rotate in one direction or the other . the center 44 of the barrier 43 is located on the optical axis . the barrier 43 may be cylindrically symmetric along an optical axis 0 . the barrier may also be invariant when rotated over some specific angles only . the barrier 43 comprises a lamellar structure 41 . the mutual distance between the different lamellas can vary , as shown , for a segment 42 of the barrier 43 . thus , the distance between consecutive lamellas may vary . the lamellar structure 41 forms , viewed in 3d , small channels . the channels may be focussed on the radiation source 6 . it is also possible to construct a channel array 43 without a real focus . the channels are , however , parallel with the emitted euv beam . the principal idea behind the invention is that contaminating particles 45 in the euv radiation 6 โฒ will , due to rotation of the barrier 43 stick to the inside of the lamellar structure 41 through which the euv radiation 6 โฒ propagates . the barrier 43 is rotatable for instance by a drive 46 located on both sides of the barrier 43 , with rotational speeds of about 7 rotations per second . the lamellar structure 41 is focussed on the radiation source . euv rays of radiation emitted from the euv source may pass the lamellar structure 41 without obstruction . typical values for the dimensions of the lamellar structure 41 are : platelets : height 30 mm , thickness 0 . 1 mm and width 50 mm ( curved ). a typical value for the channel width is 1 mm . the distance from the barrier 43 to the source 6 is typically in the order of 60 mm . when the rotation of the foil trap is not synchronized with the pulse frequency of the source , stroboscopic effects can occur . to circumvent stroboscopic effects , the foil trap could be rotated exactly an integer number of channels in between two pulses of the source . for those components shown in fig5 having the same reference numeral as corresponding components shown in fig2 - 4 , reference is made to the description of those figures above , as these components are not described further hereinbelow . fig5 shows a barrier assembly 47 including barriers 43 and 43 โฒ driven by separate drives 46 and 46 โฒ, respectively . in the embodiment shown barriers 43 and 43 โฒ rotate in opposite directions , as indicated by arrows a 1 and a 2 , around the optical axis o . this barrier assembly is able to prevent fast moving contaminating particles ( thermal or with velocities several times higher than thermal ) emanating from the euv source ( or thermalized in the volume between the source and the foil traps ) to escape from the source chamber and reach the collector chamber . this may also be achieved by similar barrier assemblies , wherein one barrier 43 is rotating and the other barrier 43 โฒ is stationary , or wherein both barriers 43 , 43 โฒ rotate in the same direction , however with different velocities . while specific embodiments of the invention have been described above , it will be appreciated that the invention may be practiced otherwise then as described . the description is not intended to limit the invention .
| 6 |
the amplified transducer signal is fed to a comparator 1 serving as a threshold valve switch , the threshold level of which being adjustable by the potentiometer p and its hysteresis being defined by the resistor r h1 . the outlet signal b of the inverter 2 subsequently added to the comparator 1 , is fed to the control circuit of the integrator 4 which comprises a transmission gate 3 . in the case of a positive control voltage the control circuit shunts the capacitor c i of the integrator 4 holding the capacitor c i at zero level . if a negative control voltage is fed to the transmission gate 3 , the integrator outlet voltage c ascends linearly according to the slew rate defined by the time coefficient r i . c i , 4 , 3 . the peak value obtained at the respective period is stored at the peak value storage , built by the two operational amplifiers 5 and 6 whereby the discharge time of the storage - capacitor c 1 is defined by the resistor r 1 . a voltage divider consisting of the resistors r t1 and r t2 is subsequently added to the peak value storage . the midpoint tap e of the voltage divider and the outlet c of the integrator are connected to a comparator 7 . if the integrator output voltage c which is fed to the inverting inlet of comparator 7 becomes more positive than the voltage peak value e determined by the peak value gauge in the prior period and which already had decreased a little due to the time coefficient c 1 . r 1 , the comparator outlet f becomes negative . as soon as at the next positive edge of the comparator outlet b the comparator resets the integrator to zero level the voltage at the outlet c of the integrator , respectively at the inverting inlet of the comparator falls short of the divided voltage peak value e or the voltage at the non - inverting inlet of said comparator respectively , and its outlet voltage becomes positive again . for the compensation of the time shift between the first positive edge appearing at the outlet b of the threshold value switch and the first positive edge at the outlet f of the comparator caused by the non - infinite slew rate of the comparator 7 , the two outlets b and f are connected to a logic circuit 8 , comprising an inverter and a nor - gate . as , especially shown by fig2 the signal at the outlet f of the comparator 7 before the arrival of the first pulse of a group of pulses at the inlet a of the threshold value switch is negative . before the arrival of the first pulse of a group of pulses the outlet of the threshold value switch is negative ; however , a positive signal is fed to the inlet of the nor - gate , due to the inverter . therefore at the outlet of the nor - gate before the arrival of the first pulse a negative signal is available . at the time the first pulse arrives at the inlet a the outlet of the threshold value switch becomes positive and therefore the corresponding inlet of the nor - gate becomes negative , causing the outlet g of the gate to become and remain positive as long as the outlet of the comparator 7 is negative due to the finite slew rate of the comparator , although already a positive pulse is present at the outlet of the threshold value switch . in principle it is possible to build up the circuit according the invention with other elements than that shown in fig1 . for instance the threshold value switch may be built as a schmitt - trigger and the peak value storage may be built by a simple capacitor . further it is possible to eliminate the inverter 2 as well as the inverter of the logic circuit . it is only essential that the threshold value switch be connected to an integrator 4 which according to its control may be released , reset or blocked respectively , and if necessary , to a logic circuit 8 comprising a nor - or an and - gate whereby the integrator is connected directly and via a peak value storage and a voltage divider subsequently added to the peak value storage to a comparator which , if desired , may be connected to the logic circuit .
| 6 |
referring to the only figure , a photodetector 10 is connected to a gate bias source 12 and an admittance bridge 14 . the admittance bridge 14 is further connected to a reference oscillator 16 and a lock - in amplifier 18 . the lock - in amplifier 18 is further connected to a recording device 20 that outputs appropriate information such as the light intensity of a beam 22 of light being of an infrared wavelength , for example . although , a broad range of wavelengths for detection is desired and made possible by the present invention . further , although the present invention is shown as a single photodetector 10 , it is clearly within the scope of the invention to place multiple photodetectors 10 on a single ic with the related electronics to output , for example , digital signals as to the intensity of each photodetector 10 . such electronics could include not only the above items but phase - lock loops , counters , and processors . referring in particular to photodetector 10 , a wafer 42 is an n - type semiconductor single - crystal silicon wafer which has upon a top surface 44 and a bottom surface 46 , a highly doped donor ( n +) layer 32 and ( n +) layer 28 , respectively . an electrically insulating layer 26 is placed on bottom highly doped donor layer 28 . layer 26 has a drain contact 24 and a source contact 22 therethrough . emitter contact 24 is bonded to layer 28 and source contact 22 is bonded to a source 40 being a highly doped acceptor area . substrate 30 being n - type acts as a drain 48 of the photodetector 10 . a layer 50 is deposited upon the highly doped donor layer 32 . layer 50 is a layer which is electrically insulating as well as chemically inactive to the material of photoactive layer 34 . photoactive layer 34 is preferrably solid but an encapsulated liquid layer is possible . layer 50 may be aluminum oxide , zinc oxide , or tantalum oxide or other materials that satisfy the criteria noted above . photoactive layer 34 may be essentially a mixture of porphyrin - quinone . u . s . pat . no . 3 , 873 , 215 is incorporated by reference as to the teachings contained therein especially those directed at the light sensitive compounds . it has been found that certain light sensitive porphyrin - quinone solutions eject protons and uptake protons when illuminated . charge separation accompanies the movement of protons and is observed in light - sensitive solid solutions . the amount of uptake or ejection is proportional to the light intensity with a constant porphyrin concentration . the wavelength can be varied over a wide range which depends on the absorption characteristic of the porphyrin . when the light sensitive porphyrin - quinone solution is exposed to light , protons are ejected into the surrounding media . the photo - response of the photodetector 10 may also arise from a charge - transfer mechanism of layer 34 . many porphyrins can be used as a component of the photoactive layer 34 . chlorophyll a , chlorophyll b , pheophytin , bacteria - chlorophyll and zinc tetraphenylporphin have been found to be especially useful . hydroquinone and benzoquinone have been found useful as the quinone component . hydroquinone gives greater responses . with the use of benzoquinone , air can be present but air must be absent when using hydroquinone as the quinone component . the porphyrin concentration is usually in the range of about 10 - 2 to 10 - 5 moles while the quinone concentration is generally in the range of about 10 - 2 to 10 - 4 moles . the photoactive layer 34 need not be limited to porphyrins - quinone ( hydroquinone ) systems . a protective layer 52 may be deposited over photoactive layer 34 to prevent any environmental impact such as oxidation of the chemicals therein . layer 52 is only partially shown thereon . a gate electrode 36 is deposited either upon layer 34 or layer 52 as the case may be . lead 38 provides the connection to the gate bias source 12 . the only figure shows the structure of a three - terminal modified gate - controlled photodetector 10 . there are three possible ways to measure the differential admittance of photodetector 10 . one way to measure the admittance is through the gate electrode 36 and contacts 22 and 24 by an essentially standard mos measurement . the second method of measurement is through the gate electrode 36 and source contact 22 with substrate 30 floating or shorted to the source . the preferred method described is through the source contact 22 and drain contact 24 with the gate electrode 36 controlled by a bias voltage . the differential admittance is measured by means of capacitance bridge 14 and lock - in amplifier 18 with other devices as shown in the figure . when the gate voltage biases the area under insulating layer 50 into accumulation , the admittance is only the p - n junction capacitance between the source and substrate . when a sufficiently negative gate bias voltage is applied , a p - type inversion layer starts to build up . this inversion layer connects to the p + and the measured capacitance increases drastically due to the extension of the inversion region . light on the photoactive layer 34 contributes to the capacitance change . the inversion layer resistivity is dependent on the applied bias . if the operating frequency is high enough , the current cannot follow the voltage in the inversion layer . as a result , the loss term rises and the capacitance decreases . when the p - n junction is biased , the c - v g and g - v g characteristics of the device will change . sets of c - v g and g - v g curves obtained at 10 khz frequency with different junction bias illustrate such . when the p - n junction is reverse biased , the depletion region will be widened which requires stronger electric fields at the silicon surface to invert the depletion layer . in other words , a higher negative gate bias is necessary to turn on the inversion layer . this causes the curves to shift in the negative gate bias direction with increased p - n junction reverse bias . the maximum capacitance for strong inversion also decreases due to the widening of depletion layer . when the junction is forward biased , a reverse situation occurs . since forward bias causes current to flow through the junction , it can only be measured in a relatively small range of forward bias voltages . the bias has the same effect on the g - v g characteristics . when porphyrins are excited with light in the presence of quinones or hydroquinones , protons are either ejected into the media by hydroquinone or protons are taken up by the semiquinone that is formed in the porphyrin - quinone reaction . the amount of proton movement is a function of the intensity of light . this movement has been found to be a straight line relationship . the wavelength of light whose intensity is being measured is determined by the absorption properties of the porphyrin . various wavelengths can be determined by changing the porphyrin e . g ., zn porphyrins , cd porphyrins , zn tetraphenylporphine , pheophytin , etc . when the photoactive layer 34 is irradiated , proton movement ( ph change ) or charge separation induces a change in the amount of capacitance of the p - n junction . the change in capacitance is measured by the change in frequency necessary to maintain the original capacitance valve . this change in frequency reflects the intensity of light irradiating the photoactive layer 34 . the ph change or charge separation can also be measured as a change in the gate voltage at a fixed value of source - substrate ( drain ) capacitance . the photodetector 10 can be fabricated by the following procedure : a ( 100 ) oriented single - crystal silicon wafer 42 being 2 - ฯcm n - type phosphorus doped and about 12 mils thick is used with only one side polished . after a series of regular cleaning steps , the silicon wafer is coated with a layer of spin - on - dopant glass ( p atom concentration of 10 21 / cm 3 ) on both sides , after which it is given a drive - in treatment at 1100 ยฐ c . for 1 hour to produce n + doped layers 28 and 32 of about 1 ฮผm thick on both sides . the doped glass layer is removed and the wafer is thermally oxidized in a dry oxygen ambient at 1100 ยฐ c . for 3 hours . this yields 200 - nm layers 26 and 50 of sio 2 . a 150 ฮผm diameter aluminum dot is evaporated on top of the polished surface through a molybdemun mask . the distance between centers of the aluminum dots was 0 . 5 mm . the aluminum can be anywhere from 4 - 6 ฮผm in thickness . the wafer 42 is then subjected to a temperature gradient zone melting process . the temperature gradient zone melting process is a process in which a liquid zone in the form of a sheet , rod , or droplet migrates through a solid in a temperature gradient . the migration of the liquid zone is caused by three spatially sequential processes : dissolution of the solid on the hot forward side of the liquid zone ; diffusion transport of the dissolved silicon to the cold rear side of the liquid zone ; and deposition of the silicon - aluminum alloy on the cold rear surface . in the present case , the front side of the wafer 42 is put directly underneath the infrared light source with the rear side of the wafer radiatively cooled by means of a water - cooled heat sink so that a temperature gradient over 200 ยฐ c ./ cm is obtained across the wafer 42 . the 150 ฮผm aluminum dot can be stably migrated through the silicon wafer in about 5 minutes . once the silicon wafer 42 is heated up to around 1200 ยฐ c ., the already molten aluminum dot moves through the 0 . 20 ฮผm layer 50 and penetrates into the silicon bulk . after migrating through the silicon substrate 30 the a1 droplet penetrates the sio 2 layer 26 on the other surface . it is obvious that the gradient grown zone will be degenerate p + due to the aluminum alloy . as a result , the sharp p - n junction forms . conventional lithographic methods are applied to open a window on both sides with the aluminum dot at its center . the silicon - aluminum alloy zone can be etched in a similar way , although the etching rate is generally not the same . the parameters which control the etching rate include : concentration of koh , temperature , stirring , ultrasonic agitation , etc . if these factors are properly controlled , the opened windows can be etched down preferentially and become a trapezoid as shown in the figure . the front surface is etched down about 100 ฮผm . the bottom surface of the etched window is ( 100 ) oriented as is the silicon wafer itself and the four sides of the window are all in the ( 111 ) direction or its equivalents . a similar etching cycle is carried out to remove the aluminum on the rear side so that contact can be made to the aluminum enriched p + region . after the preferential etching is completed , the remaining sio 2 in layer 26 is removed in an hf solution . a thermal oxidation cycle is used to regrow layer 26 of sio 2 . a layer of sio 2 with a thickness of approximately 1500 angstroms is grown . a further procedure deposits layer 50 of aluminum oxide in place of sio 2 , for example . additional conventional procedures deposit photoactive layer 34 and protective layer 52 thereon as required . clearly , many modifications and variations of the present invention are possible in light of the above teachings and it is therefore understood , that within the inventive scope of the inventive concept , the invention may be practiced otherwise than specifically claimed .
| 8 |
as used herein , the term โ a โ or โ an โ, when used in conjunction with the term โ comprising โ in the claims and / or the specification , may refer to โ one ,โ but it is also consistent with the meaning of โ one or more ,โ โ at least one ,โ and โ one or more than one .โ some embodiments of the invention may consist of or consist essentially of one or more elements , method steps , and / or methods of the invention . it is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein . as used herein , the term โ or โ in the claims refers to โ and / or โ unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive , although the disclosure supports a definition that refers to only alternatives and โ and / or .โ the present invention relates to the design , synthesis , construction , composition , characterization and use of a novel therapeutic agent such as nucleic acids ( micrornas ) and methods useful in treating cancer . more specifically , the invention discloses that artificial microrna 29a , b , c is a potent tumor suppressor able to significantly suppress cell proliferation , increase apoptosis , suppress tumor growth and increase sensitivity of chemotherapeutic drugs when presented in the form of pri - mirna , pre - mirna , mature mirna or fragments of variants thereof that retain the biological activity of the mature mirna and dna encoding a pri - mirna , pre - mirna , mature mirna , fragments or variants thereof , or regulatory elements of the mirna . a preferred embodiment of the present invention discloses that that mir - 29a significantly decreases the proliferation of both p53 - deficient ovcar8 and p53 - wild type heya8 . this is common characteristic of tumor suppressor genes and micrornas . from this work , a person having ordinary skill in this art could readily conclude that mir - 29a along with its family members mir - 29b and mir - 29c are strong suppressors of ovarian and other cancers . another preferred embodiment of the present invention discloses that mir - 29a significantly increases the sensitivity to cisplatin ( which is commonly used to treat ovarian and other cancers ). mir - 29a treated heya8 cells proliferate at rates substantially lower than heya8 cells treated with a scrambled control or the parental heya8 cell line . from these data one may readily conclude that mir - 29a and its family members mir - 29b and mir - 29c would significantly increase the sensitivity of tumors to chemotherapy in ovarian and other cancers . another preferred embodiment of this invention teaches that patients that are able to respond to current doses of chemotherapy can be treated with much lower doses of chemotherapy when presented with mir - 29a , b , c . also , patients that do not respond to chemotherapy , or patients that respond but relapse , can be treated with regular doses of chemotherapy in presence of mir - 29a , b , c . in addition since mir - 29a is highly effective at suppressing the proliferation of p53 - wild type ovarian cancer cells it is likely to be effective in treating low grade tumors as well . one preferred embodiment of the invention discloses the use of a nucleic acid construct encoding an artificial mirna presented as a double - stranded rna or precursor hairpin or a primary mirna in the single straded rna form or encoded in a dna vector delivered in a suitable pharmaceutical carrier , to be used for inhibiting the expression of all oncogenes and regulators of oncogenes containing a mir - 29a , b , c complementary site ( lcs ). the pharmaceutical carrier includes , but is not limited to , a virus , a liposome , or a polymer , and any combination thereof . another preferred embodiment of the present invention discloses the composition , methods and use of a nucleic acid construct encoding an artificial mirna presented as a double - stranded rna or precursor a hairpin or a primary mirna in the single stranded rna form or encoded in a dna vector delivered in a suitable pharmaceutical carrier , to be used for inhibiting the expression of all oncogenes and regulators of oncogenes containing a mir - 29a , b , c complementary site ( lcs ), wherein the mir - 29a , b , c is delivered in multiple ways , to include but not limited to , as a mature mirna by itself , or as a gene is encoded by a nucleic acid , or as a precursor hairpin by itself or conjugated to nanoparticles of metal or liposomal origin , or conjugated to nanoparticles of metal or liposomal origin , or as a primary mirna by itself or conjugated to nanoparticles of metal or liposomal origin or delivered on a virus , or as a liposome , or as a polymer , or as a gene that is encoded by a nucleic acid and such nucleic acid is located on a vector , or as a gene is encoded by a nucleic acid , or as a precursor hairpin by itself or conjugated to nanoparticles of metal or liposomal origin . another preferred embodiment of the present invention discloses that such nucleic acid is located on a vector selected from the group consisting of a plasmid , cosmid , phagemid , virus , and other vehicles derived from viral or bacterial sources , or is located on a vector that may further comprises one or more in vivo expression elements selected from the group consisting of a promoter , enhancer , and combinations thereof . another preferred embodiment of the present invention relates to the use of mir - 29a , b , c where mirna is administered to , or expression is increased in the cells of , a patient for treatment or prevention of cancer , including but not limited to lung cancer , pancreatic cancer , skin cancer , hematological neoplasms , breast cancer , brain cancer , colon cancer , follicular lymphoma , bladder cancer , cervical cancer , endometrial cancer , esophageal cancer , gastric cancer , head and neck cancer , multiple myeloma , liver cancer , lymphomas , oral cancer , osteosarcomas , ovarian cancer , uterine leiomyosarcoma , uterine leiomyomas , endometriomas , endometriosis , uterine papillary serous carcinomas , prostate cancer , testicular cancer , and / or thyroid cancer . another preferred embodiment of the present invention relates to the use of mir - 29a , b , c where mirna is administered to , or expression is increased in the cells of , a patient for treatment or prevention of cancer and wherein the patient is undergoing one or more cancer therapies selected from the group consisting of surgery , chemotherapy , radiotherapy , thermotherapy , immunotherapy , hormone therapy and laser therapy . another embodiment of the present invention discloses a method for determining the sensitivity of a cancer to a mir - 29a , b , c mirna delivered on a suitable pharmaceutical carrier to bind to an mrna encoded by an oncogene containing one or several mir - 29a , b , c complementary site ( lcs ) in a cancerous or transformed cell or an organism with a cancerous or transformed cell ; and determining if the cancerous or transformed cell growth or viability is inhibited or if expression of the oncogene is inhibited . while the invention described here specifically relates to the design and construction of a novel therapeutic agents such as nucleic acids ( micrornas ) to treat cancer , one of ordinary skills in the art , with the benefit of this disclosure , it is possible to extend the proposed micrornas to be used in many kind of cancer treatment , and would recognize the extension of the approach to other treatment protocols . the following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion . one skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned , as well as those objects , ends and advantages inherent herein . changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art . the set of 487 tumors analyzed were from the original tcga set of 489 ( samples tcga - 041536 and tcga - 61 - 1911 did not have quality mirna data at the time of this study ). the mirna array normalization steps are as follows . the gmeansignal from raw array files (. level 1 .) were quantile normalized and log transformed , removing duplicate samples and control probes (. level 2 .). multiple median centering steps set the median of every batch to the median of all batches : in brief , within each batch , the median for each mirna was first subtracted , then calculated the across batch median and added it back to all samples within that batch ; the resulting data were collapsed to mirna levels (. level 3 .). the level 3 mirna data are available at the tcga data portal . for gene expression analysis , the previously described . unified . dataset was used . the definition and validation of a prognostic mirna signature was carried out essentially as described for the previously - defined prognostic mrna ( gene ) signature [ the_cancer_genome_atlas_research_network ( 2011 ) integrated genomic analyses of ovarian carcinoma . nature 474 : 609 - 615 ], using the previously - defined training and validation subsets with expression values normalized within each subset to standard deviations from the median . given the mirna signature from the training dataset , the prognostic t - score was defined for each validation profile as the two - sided t - statistic comparing , within each tumor profile , the average of the poor prognosis mirnas with the average of the good prognosis mirnas . the time course mts assay experiments were run three times ( separate days ), each with a different set of biological quadruplicates ( n = 12 per group ); within each experiment run , the viability measures within each time point were centered on the mean of the wt group for the first run . for cisplatin treatment , cells were transfected as described , and media was replaced after 24 hrs with media containing cisplatin ( sigma ) ( 0 - 7 . 5 ฮผg / ml ). viability was assayed 72 hrs post - transfection . experiments were run three times , each with a different biological replicate ( n = 3 per group ). for each run , viability measures within each concentration point were centered on the mean of values for the first run . total rna ( 60 ng ) was reverse transcribed in a 40 ฮผl reaction using the taqman ยฎ microrna reverse transcription kit ( abi ). custom primer sequences are shown in table 1 . qpcr was performed on a stepone real - time pcr system ( abi ) using power - sybr green pcr master mix ( abi ) in a 20 ฮผl reaction and human ribosomal rna 18s as an endogenous control ( which was itself not mir - 29a - regulated , data not shown ). the qpcr experiments were run four times ( separate days ), each with independent biological samples ( n = 4 per group ); within each experiment run , relative expression values were normalized to standard deviations from the mean . mirnas are influenced by both copy number alteration and genomic location . the tcga ovarian cancer datasets were examined , representing 487 tumors profiled for mirna expression , for patterns of correlation between the mirnas and other molecular features . to begin with , it was considered whether mirnas with expression levels frequently altered by changes in dna copy number may reveal a subset of mirnas under clonal selection in the tumors . such mirnas would be of interest as candidate oncomirs or tumor suppressive mirs . mirnas were therefore systematically analyzed for both loss and gain of dna copy number associated with a concordant change in mature mirna expression level . this analysis revealed several mirnas in focally amplified and deleted genomic regions . in particular , let - 7b was the most frequently deleted mirna having both recurrent hemizygous genomic loss ( 86 % of samples ) and homozygous deletion ( 7 . 2 %). four members of the mir - 30 family were among the most frequently amplified mirnas . interestingly , these members were encoded at two different focally amplified loci ( 8q24 and 1p34 ) and all four mirnas showed strong concordant change in mature mirna expression . moreover , mirnas were frequently coexpressed with neighboring mirnas . previously , when examining mirna expression profiles in a small dataset of 24 normal human tissues , baskerville and bartel found evidence that proximal pairs of mirnas are generally coexpressed ( suggesting that they are processed from polycistronic primary transcripts ), and that intronic mirnas are usually coexpressed with their host gene mrna ( suggesting that they both derive from a common transcript ) [ 15 ]. to examine this situation in ovarian cancer ( thereby reinforcing current notions of mirna biology as well as the integrity of the tcga data ), pairwise comparisons for each chromosome between the expression profiles of all mirnas oriented in the same direction were made , calculating for each pair a correlation coefficient . the results showed that most mirna genes within 50 - 100 kb of each other had highly correlated expression patterns . notably , at distances beyond 100 kb ( exceeding the length of most human genes ), the correlation between pairs dropped dramatically to zero . while dna copy number alterations undoubtedly influence gene and mirna expression in cancer , pairwise correlations in copy number levels between proximal mirnas showed a very different pattern from the pairwise expression correlations . high proximal correlations for copy number extended for & gt ; 1 mb in length , with no dramatic drop . approximately 177 of the 558 mature human mirnas profiled are located in the genome within the introns of host genes , and mirnas were found to be frequently coexpressed with these host genes in this data . for each of 188 mirna - host gene pairs ( each comprised of a mirna located within the boundaries of a known gene , same orientation , where some mature mirnas have multiple genomic locations ), the correlation between mirna and host gene expression was computed . mirna - host gene pairs tended to be strongly correlated with each other and , with 52 % of the mirna - host gene pairs with available data showing significant positive correlation 1 ( p & lt ; 0 . 01 ), in agreement with previous studies . as expected , mirna expression was also correlated with host gene copy number , though the correlations were not as strong as for gene expression . mirnas and their predicted gene targets tend to be anti - correlated within ovarian tumors a key to studying mirnas is identifying their gene targets . while mirna targeting predictions made in silico ( the vast majority being unvalidated ) may have sizable rates of false positives and negatives , considering correlations between gene and mirna expression across a large panel of tumors could provide further support for potential mirna : mrna targeting relationships . to this end , all possible mirna : mrna correlations across the 487 tcga ovarian tumors were computed , for the top expressed 191 mirnas and 8547 genes . the 191 ร 8547 mirna : mrna pairs were then sorted by low to high correlation , and found that among the most anti - correlated pairs , there was high enrichment for predicted mirna : mrna targeting interactions by miranda algorithm , where no such enrichment was observed for the positively correlated mirnas : mrnas . ( this trend was observed when considering all other mirnas and genes in addition to those most highly expressed . in addition to validating the public target prediction databases as being enriched for true positives , this finding indicated that thousands of mirna : mrna targeting interactions are active in ovarian cancer and influence tumor gene expression heterogeneity . the impact of copy number alteration on expression level can vary greatly between genes , conceivably introducing bias when evaluating association of mirna and gene expression levels . therefore , in addition to a direct pearson &# 39 ; s correlation between mirna and mrna , a simple linear regression model was applied to account for โ noise โ due to copy number alteration , evaluating the association between expression levels of a mirna and mrna , when copy number alteration status of the gene is held fixed . interestingly , the pearson &# 39 ; s model and the regression model of mirna : mrna correlations both gave very similar overall results in terms of predicted target enrichment , with the regression model &# 39 ; s negatively correlated pairs showing slightly greater target enrichment . while , in general , copy number alteration did not represent a major confounding factor , the regression model could identify individual mirna : mrna correlations which were missed by the pearson &# 39 ; s model , including mir - 29a : hars2 . as another way to globally represent mirna : mrna interactions in ovarian cancer , for all mirna : mrna pairs with the strongest negative correlation ( regression coefficient & lt ;โ 7 . 0 , based on the linear model ), the matrix of correlation coefficients were clustered , thereby grouping mirnas when they are negatively correlated with same genes and vice versa . the gene dendrogram was then cut to extract 6 gene clusters ( based on what appeared to be natural separations within the cluster tree ), each of which was found to be uniquely enriched for different gene classes , including a cluster with wnt and hedgehog pathway gene members , a cluster with cell adhesion genes , two clusters with immune response genes , and a cluster of cell cycle - related genes . for several individual mirnas , the genes anti - correlated in expression were significantly enriched for in silico predicted targets . fig1 shows that gene transcripts with mirna 7mer in the 3 โฒ- utr tend to be anti - correlated with expression of the corresponding mirna . top anticorrelated genes of mir - 29 in ovarian cancer included dnmt3a and dnmt3b , suggesting a role for mir - 29 in high - grade serous ovarian cancer . fig2 shows the correlation of gene expression with mir - 29a expression . mir - 29a was underexpressed in the dna methylation subtype โ mc2 โ. genes anti - correlated with mir - 29a were enriched for mir - 29a targets as predicted by sequence analysis ( either targetscan or miranda , fig2 ). however , many in silico predicted targets did not show the anticipated anti - correlation patterns , again suggesting that by factoring in expression data , one could reduce the false positive rate for target predictions . fig3 shows the top eight words ( of all 5 , 6 and 7mers ) enriched in 3 โฒ- utrs of mrnas anti - correlated with mir - 29a ( 5 โฒ- tagcaccatctgaaatcggtta - 3 โฒ, seq id no : 13 ) expression ( fdr & lt ; 1 โ 6 ). fig4 contains a qpcr analysis showing relative quantity of selected mir - 29a anti - correlated gene targets after mir29a overexpression in heya8 ovarian cancer cells . furthermore , as additional evidence for mir - 29 activity , a correlation - based sequence motif analysis found that the mir - 29 seed sequence complement was the top enriched motif in 3 โฒ- utrs of mrnas anti - correlated with mir - 29a expression ( fig3 ), further suggesting that mir - 29 directly regulates expression levels of many target mrnas in the tumors . this analysis also showed strong enrichment for non - canonical mir - 29a seed motifs ( i . e . motifs not following the typical pattern of nucleotides 2 - 7 ) with a bulge in position 3 of the mir - 29a sequence , suggesting that target prediction methods requiring perfect base pairing in the seed region of the mirna target duplex could miss a substantial fraction of functional mirna target interactions . by forcing mir - 29a expression in vitro in the ovarian cancer cell line heya8 , it was confirmed that a number of the genes anti - correlated with mir - 29a , i . e ., dnmt3a , dnmt3b , cdc6 , cbx1 , mybl2 , and timeless ( four of which were predicted direct targets ), were repressed by mir - 29a ( fig4 ), which demonstrated these gene targets as relevant in both the in vitro functional models as well as the human tumor specimens ; one gene tested , sae1 , showed anticorrelations but no functional repression . while mir - 29 expression was not associated with survival ( p & gt ; 0 . 05 , univariate cox ), forced mir - 29a expression impacted cell proliferation in ovcar - 8 and heya8 cell lines ( fig5 a - 5b ) and had an additional effect on chemotherapeutic agent cisplatin in inhibiting the growth of these lines ( fig6 a - 6b ). fig5 a - 5b demonstrate the effect of mir - 29a overexpression on proliferation of heya8 and ovcar - 8 cells . when compared with the parental strains in each case as well as these cell lines transiently transfected with a scrambled control mir - 29a is able to very significantly suppress cell proliferation in p53 - wild type heya8 and moderately suppress cell proliferation of the p53 - deficient ovcar8 . fig6 shows the effect of mir - 29a on proliferation under cisplatin treatment . as can be clearly seen by fig6 a , mir - 29a suppresses the proliferation of heya8 significantly more effectively than the scrambled control at the same dosage of cisplatin . the present invention is well adapted to attain the ends and advantages mentioned as well as those that are inherent therein . the particular embodiments disclosed above are illustrative only , as the present invention may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein . furthermore , no limitations are intended to the details of construction or design herein shown , other than as described in the claims below . it is therefore evident that the particular illustrative embodiments disclosed above may be altered or modified and all such variations are considered within the scope and spirit of the present invention . also , the terms in the claims have their plain , ordinary meaning unless otherwise explicitly and clearly defined by the patentee .
| 0 |
fig1 shows a cross - section of a coaxial valve . in the valve box 1 , a flow channel 10 with a fluid inlet opening 12 and a fluid outlet opening 14 is provided . the fluid inlet opening 12 and the fluid outlet opening 14 on opposite ends of the valve box 1 are constructed in such a way that the flow channel 10 from the fluid inlet opening 12 is level with the fluid outlet opening 14 . in the cross - sectional view , flow channel 10 , the fluid inlet opening 12 and the fluid outlet opening 14 are arranged in a circular fashion and coaxially to each other , whereby they share a common center line x . in the area of the fluid inlet opening 12 , the flow channel 10 is formed by a first cylindrical bore section 16 . the first cylindrical bore section 16 is provided with a first frontal lid section 11 of valve box 1 . the fluid outlet opening 14 is provided with a second frontal lid section 13 on the side opposing the first frontal lid section of the valve casing . a cylindrical mid section 15 is situated between the first frontal lid section 11 and the second frontal lid section 13 of the valve box 1 . both lid sections 11 , 13 are screwed together with the cylindrical mid section , as illustrated in fig1 . the second frontal lid section 13 shows a cylindrical casing connection 17 protruding forward in the direction of the center line x which has been provided with a fluid outlet opening 14 . on the inside of the cylindrical casing connection 17 , a basically cylindrical second bore section 18 of the flow channel 10 is built , whereby this bore section possesses a diameter which is greater than that of the first cylindrical bore section 16 . between the first cylindrical bore section 16 and the second basically cylindrical bore section 18 of the flow channel 10 , a cylindrical internal space 19 is located in the area of the mid section 15 of the valve box 1 , the diameter of which is considerably larger than the diameter in the second basically cylindrical bore section 18 . in the flow channel 10 there is a tubular valve casing 2 coaxial to flow channel 10 between the first cylindrical bore section 16 and the second basically cylindrical bore section 18 . the valve casing 2 is made circular in cross - section and free to travel along its axis , which is identical with the center line x . the valve casing 2 is constructed as a straight tube and surrounds an inner channel 20 , which is provided with a front - sided inlet port 22 next to inlet opening 12 and a front - sided outlet port 24 , which faces toward fluid outlet opening 14 . thus the inner channel 20 provides a central section of flow channel 10 between the first cylindrical bore section 16 and the second basically cylindrical bore section 18 . on the internal space 19 , a drive 3 is provided . the drive acts on the valve casing 2 to move toward the center line x and will be further described hereafter . the drive 3 surrounds a drive motor 30 , which is arranged inside the internal space 19 , is constructed as an electric motor , and surrounds valve casing 2 , and a ball planetary gear 4 which couples the drive of the motor 30 and the valve casing 2 . the motor 30 and the ball planetary gear 4 are also arranged coaxially around the valve casing 2 , so that the rotation axis of the motor 30 and the ball planetary gear 4 align with the center line x under normal circumstances when no deformation of the valve casing 2 , caused by mechanical tension , has taken place . the motor 30 is constructed as an internal rotor motor and has an external radial stator 32 as well as an internal radial rotor 34 . the stator 32 is prevented from turning by means of at least one radial outward protruding nib 31 on a radially inward turned rib 15 โฒ of the cylindrical mid section 15 , but can be axially displaced . this possibility for axial displacement facilitates a minimal relative movement in axial direction between the valve box 1 and the drive 3 , thus avoiding tensions within drive 3 and in the valve box 1 on account of varying thermal expansion of drive 3 and valve box 1 . for the same reason a nib 31 โฒ is allowed in addition between the radial outer edge of the nib 31 and the inner wall of the cylindrical mid section 15 which also facilitates a radial relative movement between the drive 3 and the valve box 1 . the stator 32 of the drive motor 30 is equipped with an electrical winding familiar to those skilled in the art . the rotor 34 inside the stator 32 is equipped with permanent magnets familiar to those skilled in the art around the outer surface . the rotor 34 is pivotable without friction by means of two radial ball bearings 33 , 35 inside stator 32 . this positioning of rotor 34 inside stator 32 by means of ball bearings 33 , 35 ensures that a constant radial distance is maintained between rotor 34 and stator 32 , even when extreme thermal influences have an effect on drive 3 . a cylindrical drive shaft 40 which is part of the ball planetary gear 4 has been provided inside the rotor 34 . the shaft is also prevented from turning and is axially tightly connected with rotor 34 . the drive shaft 40 is also arranged in coaxial order with the valve casing 2 , and the middle axis of the drive shaft 40 is identical with the center line x of the valve casing 2 . the drive shaft 40 is provided with at least one threaded inner circular groove 42 . the drive shaft 40 surrounds a central radial , outwardly tapering section 25 of the valve casing 2 . this middle section 25 of the valve casing 2 forms an inner drive element 44 , which is integrated with the valve casing 2 and which exhibits a threaded outer circular groove 46 on its exterior circumference which extends in axial direction across almost the entire length of the middle section 25 which is longer in axial direction than the section of the drive shaft 40 , which is connected with the inner circular groove 42 . between the radial outer circumference of the drive element 44 which has been constructed by the section 25 of the valve casing 2 and the inner circumference of the drive shaft there is only a very small space , so that the inner circular groove 42 and the outer circular groove 46 shown in the covering of the ball bearing channel 47 in fig1 form a basically circular cross - section , which contains numerous balls 48 . in this way , the inner drive element 44 , the balls 48 , and the drive casing 40 will form the ball planetary gear 4 . the drive 3 and the ball planetary gear 4 will create a ball rotary spindle drive 5 for the valve casing 2 , which is integrated into the ball rotary spindle drive . the valve casing 2 is constructed within the area of its flow inlet port 22 which has been inserted in the first frontal lid section 11 and has been sealed off with a slide ring gasket sealing washer 6 . in the same way the valve casing 2 is constructed in the area of its opposite flow outlet port 24 and has been sealed off with a second slide ring gasket sealing washer 7 axially , whereby the second slide ring gasket sealing washer 7 is inserted in the second frontal lid section 13 . the first slide ring gasket sealing washer 6 consists of a first ring - shaped insert element 60 , which surrounds the valve casing 2 and is equipped with a circular seal 62 with a sealing lip 64 fitted to the outer surface of the valve casing 2 and seals it . axially inward from the sealing lip 64 , turned away from the inlet port 22 , that is , in the first insert element 60 , there is a slide ring 66 , which surrounds the outside of the valve casing 2 and turns this with minimal friction . in an analogous fashion the second slide ring gasket sealing washer 7 shows a second insert element 70 , which is tied to the second frontal lid section 13 . the second insert element 70 is equipped with a ring - shaped seal 72 which has a radially inward turned sealing lip 74 and surrounds and seals the outer circumference . in the second insert element 70 , axially inward from the sealing lip 74 , turned away from the flow outlet port 24 , there is an slide ring 76 , which surrounds the valve casing 2 and turns it with absolutely minimal friction . the ball rotary spindle drive 5 , consisting of the drive motor 3 and the ball planetary gear 4 including the valve casing 2 , is situated inside the valve box 1 and can be turned a little in all directions around the ball central point m , so that this ball central point m is positioned on the center line x , as outlined below . this positioning is achieved by means of two ball bearings 52 , 56 coaxial to the center line x which have corresponding axial inner bearing ring 53 , 57 and which have been installed on opposite front sides of the rotor 34 . the corresponding bearing rings 54 , 58 of the axial ball bearings 52 , 56 are supported by the first frontal lid section 11 and / or the second frontal lid section 13 in a way that will be described later on . in addition , there is a support ring 55 in place coaxially to the center line x and similarly on the second frontal lid section , a support ring 59 is located coaxially to the center line x . the positioning of the ball rotary spindle drive 5 inside the valve box 1 , shown in detail a in fig1 , will now be described by means of fig2 . the description is given by reference to the upper axial ball bearing 56 in fig1 , while the support of the lower axial ball bearing 52 is achieved in the first frontal lid section 11 in the same way . the support ring 59 is affixed to the second insert element 70 , which is connected with the frontal lid section 13 in a manner familiar to those versed in the art . on its axially and radially inward side , the support ring 59 is equipped with a supporting spherical , concave inner surface 59 โฒ which has a corresponding ring - shaped , spherical , convex outer surface 58 โฒ which is found on the axial and radial outer area of the axial outer support ring 58 of the axial ball bearing 56 . in the same way , the axially outer bearing ring 54 of the axial ball bearing 52 is equipped with a ring - shaped , spherical , convex outer surface 54 , as is the support ring 55 , which is affixed to the first insert element 60 of the first frontal lid section 11 with a spherical , concave inner surface 55 โฒ, as shown in fig3 . the convex surfaces 54 โฒ and 58 โฒ are ring - shaped segments of spheres in a virtual sphere with a central point m on the center line x . even the concave surfaces 55 โฒ and 59 โฒ are ring - shaped spherical segments of a virtual sphere with the same central point m . in this manner the entire rotary spindle drive 5 can rotate a little around the center point m with relative movement between inner and outer surfaces 54 โณ and 55 โณ, as well as surfaces 58 โณ and 59 โณ. furthermore , fig3 shows that the valve casing 2 in the area of the first frontal cover section 11 is fitted with a pivot 26 projecting radially outwards , and a ball bearing 27 is connected to the pivot . both the pivot 26 and the ball bearing 27 then catch a longitudinal slot 11 โณ of the first frontal lid section 11 that runs parallel to the center line x , and the ball bearing 27 , including its outer ring 27 โณ, will roll off a side wall of the longitudinal slot 11 โณ. in an analogous manner , on the valve casing 2 on the opposite side there is a pivot 28 projecting radially outwards . as shown in fig1 , a ball bearing 29 is connected to the pivot and will be steered in the same manner through a longitudinal slot 11 โณ designated for this side of the first frontal lid section 11 . both these sideways guiding methods in the valve casing 2 will prevent the valve casing 2 from rotating relative to the valve box 1 , and will assure that the valve casing 2 โ with the exception of a minimal swiveling action around the ball central point m โ can only move in the direction of the center line x . using ball bearings 27 and 29 as guide rollers will minimize any friction in the respective axial guide ways . the second frontal lid section provides for a shutoff mechanism 8 inside the cylindrical casing connection 17 , i . e . in the second mainly cylindrical bore section 18 of the flow channel 10 . to open and close the valve , this shutoff mechanism will work in conjunction with the outlet port 24 of the valve casing 2 . the shutoff mechanism 8 includes a ring - shaped base section 80 positioned coaxially to the center line x in the area of the fluid outlet opening 14 in the second frontal lid section 13 . connected to the ring - shaped base section 80 is a cylindrical tubular pedestal section 81 which is also positioned coaxially to the center line x . it forms the first part 82 of the shutoff mechanism 8 and extends into the mainly cylindrical bore connection 18 in the direction of the axial flow . the cylindrical pedestal section 81 is provided in its perimeter wall with a majority of openings 89 , which produce a fluid connection between the mainly cylindrical bore section 18 of the flow channel 10 and the fluid outlet opening 14 . the axial front wall 83 of the cylindrical pedestal section 81 pointing inwards into the valve box 1 is designed as a concave wall and is provided with a concave front surface 83 โณ, which is designed dome - shaped and constitutes a spherical segment of a virtual sphere with the central point m . an adapted convex outer surface 84 โณ of a support element 84 for a valve unit 86 rests in the concave front surface 83 โณ. the support element 84 and the valve unit 86 together form a second part 85 of the shutoff mechanism 8 . also the support element 84 and the valve unit 86 are ordered co - axially to the central line x , whereby the convex outer surface 84 โณ of the support element 84 likewise forms a dome - shaped spherical segment of a virtual ball with the central point m . the valve unit 86 is ordered to the side of the support element 84 turned away from the convex outer surface 84 โณ and points to the outlet port 24 of the valve casing 2 . the valve unit 86 is designed conically , whereby in the area of its greatest perimeter it is provided with a circular step 86 โณ forming a valve seat , which in sealing works together with the valve seat formed from the perimeter edge of the outlet port 24 of the valve casing 2 near the closed valve . by means of a screw 87 centrally penetrating the concave front wall 83 , which is braced against the front wall via a support element 88 provided on the back side of the concave front wall 83 of the cylindrical pedestal section 81 , the valve unit 86 and the support element 84 , and the first part 82 are braced against the second part 85 of the shutoff mechanism 8 . the support element 88 is thereby provided with a concave front surface 88 โณ pointing to the front wall 83 , which forms a spherical sector of a virtual sphere with the central point m . the convex back surface 83 โณ of the front wall 83 , which is pointing towards the fluid outlet opening 14 , is also part of a spherical surface with the central point m . this shutoff mechanism 8 design , with its spherical surfaces showing the same central point m as the spherical surfaces of the ball rotary spindle drive 5 bearing inside the valve box , also allows the valve unit 86 to pivot a little around the center line m . therefore , no significant uneven load will occur on the circular step 86 โณ of the valve unit 86 which controls the valve location of the sealing element 8 . that means , even in cases where there is a slight pivoting of the ball rotary spindle drive 5 and the valve unit 86 , a dependable seal regarding the valve in the area of the valve unit 86 and the outlet port 24 is guaranteed . furthermore , this way any external constraining forces will be kept away from the ball rotary spindle drive 5 . any reference item numbers listed in any claims , descriptions , and drawings are solely provided to better understand the invention . they are in no way intended to limit the scope of protection . the foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed to include everything within the scope of the appended claims and equivalents thereof .
| 5 |
fig1 - 6 illustrate an amphibious aircraft 10 according to one embodiment of the invention . in this embodiment , the aircraft 10 features a power plant 12 mounted to an aft portion of fuselage 14 . the fuselage 14 includes a wing 16 . a float 18 is cantilevered from the wing 16 . a vertical fin 20 is coupled to the aft end of each float 18 . a horizontal stabilizer 22 is coupled to the vertical fins 20 , preferably but not necessarily near the top of the fins 20 , to complete a tail portion 24 . a nosewheel 26 is coupled to the front of the fuselage 14 . in some embodiments , the fuselage 14 is configured for appropriate hydrodynamic effects , both statically and dynamically during all phases of taxing , takeoff , and landing . the fuselage 14 may feature any desired shape , length , width , and height to accomplish the result of appropriate aerodynamic and hydrodynamic performance for a general aviation class amphibious aircraft with favorable stability , airspeed , range , and maneuverability characteristics . the fuselage 14 may be assembled in a stress skin monocoque , semimonocoque , or longitudinal member design , or a combination of any or all of these designs . a skin 27 is fastened to the design and carries primarily the shear load , tension , and bending stresses . the fuselage 14 may be formed of any suitable material including but not limited to aluminum , aluminum alloys , other metallic materials , composite materials , or other similar materials . the horizontal stabilizer 22 may be included as shown in fig1 - 4 . the horizontal stabilizer 22 generally affects pitch performance during taxiing , takeoff , and landing on the water . the wing 16 can formed of a stress skin monocoque , semimonocoque , or conventional longitudinal member design , or a combination of any or all of these designs . a monocoque construction can use corrugations extending along the length of the wing 16 for structural integrity . in cross section , the corrugations provide advantages of a warren truss arrangement , which provides stability and stiffness for the wing 16 . the wing 16 may be formed of any suitable material including but not limited to aluminum , aluminum alloys , other metallic materials , composite materials , or other similar materials . fig1 - 6 illustrate one embodiment of the float 18 , which includes a step 28 and a main wheel 30 . the float 18 may be formed of any suitable material including but not limited to stress skin monocoque , wood , foam , plastic , composites , fiberglass , or other desired materials . the floats 18 are oriented substantially parallel to chords of the wing 16 . as a result , the floats 18 present minimal surface area to the airflow , thus reducing drag and increasing cruise speed of the aircraft 10 . the step 28 divides the float 18 into a forward portion 32 and an aft portion 34 . in some embodiments , the forward portion 32 is shaped to incorporate a ski surface 36 into a bottom 38 of the float 18 . in these embodiments , the ski surface 36 results in a float 18 having a lower surface that is generally planar . the ski surface 36 provides the float 18 with improved planing capabilities , allowing earlier transition to the planing mode and thus increasing acceleration and decreasing the time spent on the surface during take - off . in some embodiments , the incorporation of the ski surface 36 significantly enhances take - off performance compared to that of a more conventionally arranged float shape . for example , the incorporation of the ski surface 36 may provide takeoff speeds of substantially 52 knots , more preferably between 52 and 56 knots , which is substantially higher than takeoff speeds for conventionally located steps , where conventional takeoff speeds range from 35 to 39 knots . the use of the ski surface 36 may also allow the aircraft 10 to takeoff from distances less than 1000 feet . due to its planar configuration , the ski surface 36 enables lower surface contact pressure , resulting in less friction or tendency of the float 18 to become entrenched in the landing surface , particularly when the landing surface is snow , wet grass , or marginal environments such as marshy areas or when landing in soil or pavement during an emergency . in some embodiments , as shown in fig2 , 3 , 5 , and 6 , the step 28 creates a sudden break or discontinuity in the longitudinal lines extending from the forward portion 32 at the approximate point around which the aircraft 10 rotates into a lift - off attitude . the step 28 allows water to flow freely behind the step , resulting in minimum surface friction to allow the aircraft 10 to break away from the water &# 39 ; s surface . in some embodiments , the step 28 is located slightly forward of a conventional step location , where the conventional location is rearward 6 ยฐ to 10 ยฐ off a vertical e . g . location 40 . the e . g . location 40 may have any appropriate location on the aircraft 10 based on the various components and loading parameters associated with the aircraft 10 . in one embodiment , as illustrated in fig3 , the step 28 is located on a vertical line passing through the e . g . location 40 . in there embodiments , the step 28 is located between a vertical line passing through the e . g . location 40 and the conventional location . in the embodiments where the step 28 is located forward of its conventional location , the aft portion 34 of the float 18 is in the water at taxiing speeds , whereupon the floats 18 are acting in a displacement mode , the aircraft has a nose up trim , and a pair of rudders 44 can be used to steer . the forward shift of the step 28 moves the float &# 39 ; s resultant pressure vector slightly forward of the more conventional location . as a result , the aircraft &# 39 ; s resultant force vector is similar to the configuration of a โ tail dragger โ land plane , where a tail dragger is a term used to describe a type of conventional landing gear for land planes where the main wheels are located on each side of the centerline ahead of the e . g ., with a steerable tailwheel located under the tail . this type of landing gear is known for its ability to land โ tail first ,โ however , unlike the tail dragger land plane , which may incur momentum - caused handling issues , the water environment for the aircraft 10 will actually aid the handling and stability characteristics by providing a stabling and damping influence on an aft portion 42 . hence , the aircraft 10 operates as a โ tail dragger โ when the aft portions 34 are wetted . this configuration causes the aircraft 10 to sit in nose - high trim when taxiing , but allows a nearly ideal take - off attitude with little or input from the pilot . during take - off , as the aircraft 10 transitions toward takeoff speed , the aircraft 10 begins to plane on the forward portion 32 of each float 18 , so that the aft portion 34 of each float 18 is no longer wetted . the forward portion 32 of each float 18 acts as a hydroplane so that the aircraft 10 can be flown off the water straight and level . the aerodynamic center of the wing 16 and the horizontal stabilizer 22 lift the aft portions 34 off the water , so that the center of buoyancy shifts forward from aft of the e . g . to a more forward location , which is forward of the step 28 . because the aircraft 10 operates as a tail dragger during takeoff on water , the aircraft 10 can maintain a relatively stable angle of attack throughout its acceleration run , with only minimal input from the pilot required . properly trimmed and configured , it is possible that the aircraft 10 will be able to accelerate and lift off the water with no pilot input , beyond moving the throttle to takeoff position . in some embodiments , the forward location of the step 28 significantly enhances take - off performance compared to a more conventionally located step . for example , the forward location of the step 28 may allow takeoff speeds of substantially 52 knots , preferably between 52 and 56 knots , which is substantially higher than conventional takeoff speeds of 35 to 39 knots . the forward location of the step 28 may also allow the aircraft 10 to takeoff from distances less than 1000 feet . when landing the aircraft 10 , the same tail dragger - like float 18 configuration allows the tail portion 24 to settle into the water earlier and with less pilot input , accomplishing on - water stability that is not possible with a more conventional float design . in short , the pilot does not have to fly the plane on the water down to taxi speed as is the case for conventional float designs , thus reducing the potential for noseovers . the tendency to settle the tail portion 24 quickly is considered to be more stable and thus safer because of the shifted balance position . it is possible that the aircraft 10 , with correct trim settings , will be able to land and transition to displacement mode with little or no pilot input . when performing a takeoff or landing on land , the aircraft 10 operates like a land plane with tricycle gear because the main wheels 30 are located in the conventional location ( i . e ., not located aft of the preferred 6 ยฐ to 10 ยฐ off the vertical e . g . location ). therefore , handling of aircraft 10 on a hard runway is no different than any other tricycle configured plane . the similarity of runway characteristics allows for easier pilot transition from a conventional land aircraft to the aircraft 10 . to maneuver the aircraft 10 in the water , some embodiments include the rudder 44 that is positioned on the aft portion 34 behind the step 28 , which is illustrated in fig2 , 3 , 5 , and 6 . when the aircraft 10 planes on the forward portion 32 of each float 18 , the rudder 44 is removed from the water . due to its placement behind the step 28 , the rudder 44 does not create any drag and therefore does not require retraction during flight . in some embodiments , the rudder 44 is located approximately three - quarters of the distance between the step 28 and the aft end 42 of the float 18 in a direction toward the aft end 42 . the rudder 44 may be formed of any appropriate material including but not limited to aluminum , carbon steel , stainless steel , other metallic materials , composite materials , or other similar materials . the tendency to quickly settle the tail portion 24 is considered to be more stable and thus safer because it allows the rudders 44 to function sooner than what might otherwise be possible with a conventional step location . in some embodiments , as shown in fig1 - 4 , the power plant 12 includes a reciprocating propeller / fan design . in some embodiments , the power plant 12 is an aft - mounted propeller power plant 12 . however , the power plant 12 may be mounted in any suitable location and may be of any desired manufacture or design , including reciprocating or jet . the fan or propeller ( in this document , both are included in the meaning of the term โ propeller โ) may be constant speed or variable speed , controllable pitch or otherwise . one particular form of power plant design that is appropriate is a fanjet or jet engine with high bypass ratio . the aft - mounting location provides some protection to the power plant 12 from excessive spray during water landings and takeoffs . in some embodiments , as shown in fig1 - 4 , the power plant 12 is a propeller power plant wherein the propeller is surrounded by a shroud 46 . the shroud 46 can substantially enhance efficiency and performance of the propeller , can make the propeller / power plant combination quieter , and can provide additional protection to prevent contact between the propeller power plant 12 and the water . the shroud 46 also protects the propeller power plant 12 from damage caused by objects that it would otherwise encounter . the shroud 46 may be formed of any suitable material including aluminum , carbon steel , stainless steel , other metallic materials , composite materials , or other similar materials . the shroud 46 can either be wiped by the propeller or provide sufficient space for the propeller to rotate freely . in cross section , the shroud 46 may be any appropriate shape that reduces drag and gives appropriate performance characteristics , including but not limited to an airfoil with the high - pressure side facing outward , an airfoil with the high - pressure side facing inward , or any other appropriate shape . at low airspeeds , the shrouded propeller power plant 12 increases the static and low speed thrust performance over an open propeller power plant of the same diameter . thus , the static and low speed thrust is increased without any change in power or power plant diameter . the improved performance of the shrouded propeller power plant 12 reduces the required take - off distance and increasing climb rates . this increased power plant effectiveness continues through cruising speeds in excess of 200 knots . the shroud 46 also reduces the amount of noise produced by the propeller power plant 12 . as a result , the shrouded propeller power plant 12 produces a quieter operation as compared to open propeller power plant configurations . the aircraft 10 is therefore able to operate within more noise sensitive areas such as those with higher population densities or forms of environmental noise restrictions . the foregoing is provided for purposes of illustrating , explaining , and describing embodiments of the present invention . further modifications and adaptations to these embodiments will be apparent to those skilled in the art and may be made without departing from the scope or spirit of the invention .
| 1 |
fig1 and 4 of the drawings illustrate a floating platform assembly 10 according to a preferred embodiment of the present invention made up of a plurality of individual platform modules 12 arranged in a rectangular array and secured together to form the platform . the modules are identical in structure , and one of the modules 12 is illustrated in more detail in fig2 and 3 . as best illustrated in fig2 and 3 , each module 12 comprises a hollow tube or cylinder 14 which is open at its lower end 16 and has a flat head or cap 18 of square shape at its upper end . the cylinder walls are of air - entrained concrete or similar water resistent and durable material , and the cylinder walls are preferably reinforced with post - or pre - tensioned vertical steel tendons and welded circular horizontal tie bars . the internal surfaces of the cylinder and cylinder head may be lined with a layer 22 of reinforced plastic or similar materials . the module has four air orifices 24 arranged at right angles to one another . in order to make up a rectangular platform 26 of the desired dimensions , as illustrated in fig1 and 4 , a plurality of modules are arranged in an array covering the desired platform area with the cylinder heads 18 secured together by welding or the like at their adjacent side edges , with the air orifices in each cylinder aligned with one air orifice in each of four directly or diagonally adjacent cylinders . as illustrated schematically in fig4 a connecting air passageway 28 extends between each pair of aligned orifices 24 . a valve 30 for controlling the size of the air orifice is preferably provided in each passageway 28 , as illustrated in fig5 . the passageway preferably extends across a space between the two cylinders in this case , for example in a diagonal interconnection , in order to provide easy access to the valve . a suitable electronic valve actuating controller 32 is provided for controlling each valve 30 based on the output of a sea state monitor 34 mounted on the outside of the platform . in some cases , where the range of sea conditions can be predetermined in order to set the appropriate orifice size , valve 30 may not be needed . the modules at the peripheral edges of the platform will have only three air orifices connected to the three adjacent modules , while the modules at the corners will have only two air orifices for connection to the two adjacent modules . alternatively , all modules will be made with four orifices and the outer orifices will be suitably plugged after construction of the platform . in the illustrated arrangement , each module comprises a cylinder with a square head . however , clearly other interfitting shapes may be used in alternative embodiments and the heads may have any shape of polygonal periphery . clearly , where the sides of the module head have more facets , there will be a greater number of adjacent modules and thus a greater number of connecting passageways . with this arrangement , a flat platform 26 is formed which can be supported on the water surface on a plurality of pockets of trapped air in each of the cylinders . water will enter the open lower end of each cylinder to a level dependent on air pressure in trapped air chamber 42 above the water level 44 . considering one cylinder or module as illustrated in fig2 the weight or load on the cylinder head will compress gas or trapped air in chamber 42 until the pressure is high enough to start displacing water from the chamber . when the air reaches a proper pressure for supporting the platform , it will have displaced a volume of water equal in weight to that of the platform . thus , the water level in the chamber will be dependent on load , and the water level will be higher for higher loads . in fig2 line 46 represents the water line when the module is not loaded and line 47 represents the water line in the module when loaded . lines 48 and 49 represent the surrounding sea level when the platform is under a full load and when it is unloaded , respectively . the dimensions of each module will be dependent on the overall platform dimensions as well as the load to be supported . a module designed for a superimposed load of 400 pounds per square foot , for example , may have a height of 40 feet ( 12 . 19 meters ), a diameter of 20 feet ( 6 . 10 meters ) with a head or end cap which is 20 foot square . the walls are preferably at least 4 inches ( 10 . 16 cm ) thick with the head being 12 inches ( 30 . 48 cm ) thick . the trapped air bubbles support the platform and also act as shock absorbers to mitigate changes in surface conditions and reduce pitch and heave of the platform . this is illustrated in more detail in fig4 which illustrates a typical wave curve 50 travelling beneath the platform . in fig4 line 52 represents the average water line or bubble draft line in the modules , while line 54 represents the average water line in the surrounding water . as illustrated in fig4 for a simplified wave taking the form of a sine curve , when the crest of the wave is located beneath a module there will be an increase in surge force at that point in the structure . this will cause water to rise in that module , compressing the air in the trapped air chamber . the compressed air will escape via passageways 28 to adjacent chambers under lower pressure , as indicated by the arrows in fig4 . bubble draft lines will therefore move up and down in the platform modules under wave action in a similar manner to pistons in the cylinders of an internal combustion engine . with orifices of a suitable size linking each chamber to the adjacent chambers , a lower pressure chamber will receive air from any of its neighbors which are under higher pressure . this will partially charge the lower pressure chamber in anticipation of the surge that has charged the higher pressure chamber next to it , tending to dampen the force of the surge when it reaches the lower pressure chamber . thus , the platform is pneumatically stabilized since vertical impact forces due to wave surges are muted by air compression and passage of trapped air between chambers . the size of the orifices is critical for optimum results . if an orifice is too large , the desired compression in the chambers for optimum lift would not be reached . if an orifice is too small , the balancing effect due to air flow between the chambers will be lost . additionally , the optimum orifice size will vary dependent on surrounding sea conditions , with the orifice size being larger if the sea is rougher . fig5 schematically illustrates a suitable control circuit for controlling valve 30 and thus the orifice size dependent on sea conditions . adjustment of valves 30 will be similar to adjustment of a racing car suspension system to meet variable track conditions . this platform assembly will be suitable for constructing a very large floating platform suitable for supporting an offshore airport facility , for example , or extended living accommodations , a de - salinization plant , trash re - cycling facility or other large area installation for which there is insufficient space on land . it is suitable for platform areas of 360 , 000 square feet or greater . although the platform has a rectangular periphery in the illustrated embodiment , clearly other platform shapes can be constructed by suitable arrangement of the modules to form the desired array shape . the platform will be assembled partially on land and partially at sea for maximum economy . clearly it would be impossible for practical purposes to assemble the entire platform on land . thus , the modules will be secured together in manageable small bundles while on land , in the largest suitable size for launching and transit , and then towed to the platform site , where the bundles will be secured and linked together . the modules are preferably towable in an upright orientation , so that their draft or height must be compatible with the depth of channels linking on - shore construction sites to the off - shore platform site . most major shipping channels are dredged to forty feet , so that the module example given above could be towed through such channels . the modular design of this platform assembly lends itself to on - shore construction of relatively large segments , thereby reducing off - shore construction costs which are typically more expensive than on - shore costs . the individual modules are themselves of relatively simple construction , further reducing the expense of the platform . although the platform is constructed of identical small modules in the preferred embodiment for ease of construction , it may alternatively be constructed by securing a plurality of cylinders to the undersurface of a flat platform . fig6 and 7 illustrate part of a modified platform assembly 70 . as in the previous embodiment , the platform is made up of modules 12 comprising hollow cylinders 14 and flat heads 18 , and like reference numerals have been used for like parts as appropriate . however , instead of simple valved passageways linking all adjacent modules , some or all of the connections between modules are replaced by ducts or passageways 72 forming diagonal connections between diagonally - adjacent modules , as illustrated in fig6 . a conventional self - rectifying reversible air flow turbine generator 74 is mounted in the center of each duct 72 , and valves 76 are located in the ducts on each side of turbine between the respective air chamber and the turbine . as in the previous embodiment , valves 76 are used to control the orifice size and also to shut down the connection if maintenance is needed for repair of the turbine . each turbine has a power generator 78 which is connected to all the other power generators to provide an electrical power output 80 to a suitable storage and power transmission facility , which may be provided on the platform . with this arrangement , the energy of each passing wave may be converted into compressed air flowing in the passageways 72 and readily converted into electrical energy by the generators 74 . this power would be relatively inexpensive to produce and would serve to offset the costs of constructing the platform . the floating platform assembly described above is of relatively simple construction with identical modules being used to make up a platform of any desired size or shape simply by securing sufficient numbers of modules together both on and off shore . since the modules are of relatively low draft , more construction can take place on shore and transportation is simplified . individual modules are relatively small even for a massive floating platform , allowing them to be constructed on - shore in large numbers and stored until needed . the constructed platform will be similar to a gigantic carpet supported on many pockets of air and thrown over the water surface . unlike most previously proposed floating structures with widely spaced supports , each module of this structure will be directly sharing in the support of the entire platform in a monolithic fashion . this concept reduces the force differentials between support elements to a point where it can be assumed to act structurally as a monolithic entity , thereby significantly reducing the costs of the module and module connecting systems . an additional advantage is the fact that impact loads due to wave action will be readily absorbed due to the compressible cushions of air extending across the entire platform area , and the interconnection between adjacent modules allowing even greater dampening of wave action . the platform assembly can also be readily constructed to include air flow turbine generators for converting wave forces to electrical energy , providing a source of revenue for offsetting the construction costs as well as a low cost source of energy which has less environmental hazards than traditional power plants . although a preferred embodiment of the invention has been described above by way of example only , it will be understood by those skilled in the field that modifications may be made to the disclosed embodiment without departing from the scope of the invention , which is defined by the appended claims .
| 1 |
fig1 a shows the initial situation of a method . positions that relate to a virtual position image are represented below by circles and positions that relate to a real position image are represented by rectangles . in the first step a first real position 1 is determined . the vehicle comprises a global satellite navigation system gnss for this , such as gps or glonass , for determining the actual position with which the first position 1 of the vehicle is determined . in addition , the vehicle comprises a digital map k , in which the position , course and width of a road s are stored . further , the map comprises two objects l 1 , l 2 or landmarks for which the position in the map is stored . there is a deviation between the first measured position 1 and the digital map k , according to which the vehicle would be off the road . said situation is pre - corrected in the second step . in the second step , as shown in fig1 b , a second position 2 of the vehicle is determined by fitting the first position 1 into the road from the digital map k . for this purpose , the shortest distance from the first position to a point on the road or a plausible lane of the road is preferably determined and the first position is fitted in at said point in order to determine the second position . this results in a first position error ฮดx_m . in the third step two processes take place , from which a real and a virtual position image are produced , as can be seen in fig1 c and 1 d . the starting point in the third step is identifying at least one of the objects l 1 , l 2 , in said example two objects , in the surroundings of the vehicle , the position of which can be referenced in the digital map and can also be detected by means of the vehicle . in fig1 c it is first shown how the virtual position image is produced . after the objects l 1 , l 2 have been identified , the relative distance ฮดx 2 l 1 and ฮดx 2 l 2 between the second position and the respective object is determined , wherein in the reference characters x 2 stands for the second position and l 1 and l 2 stand for the positions of the first and second objects . in fig1 d it is shown how the real position image is produced . real relative distances between the vehicle or the position thereof and the respective object or the respective position thereof are determined by means of sensors of the vehicle . for the sake of simplicity , in the figures the positions of the objects in the real position image are also characterized with l 1 and l 2 , even if for this purpose a further indication , such as for example real , could have been used for different identification . depending on which object it is , different sensors can be used here , such as for example an environment sensor system , a camera sensor system and / or a radar sensor system and / or a lidar sensor system and / or an ultrasonic sensor system and / or a temperature sensor system and / or a rain sensor system and / or a road condition sensor system and / or a chassis sensor system . if for example the object is partial paving , then acceleration , wheel revolution rate and steering angle sensors can be used in order to determine the distance to the object . accordingly , a relative real distance from other visually easily detectable objects can be determined by means of a camera sensor system . the absolute position is not determined , but the relative distance between the vehicle position and the respective object l 1 , l 2 is determined and a position of the objects l 1 , l 2 is projected therefrom , the absolute position of the objects l 1 , l 2 is not needed for the real position image . if said absolute position of the objects is known from a different source than the digital map , however , the same can be used to determine a further pre - correction of the vehicle position using the relative distance ฮดx 4 l 1 and ฮดx 4 l 2 , from which the position 4 as shown in fig1 d results . otherwise , the relative distance corresponds to the distance between the objects l 1 , l 2 and the first position 1 and would be called ฮดx 1 l 1 and ฮดx 1 l 2 . in fig1 d , the deviation ฮดl_i can further be seen , wherein the i stands collectively for the index 1 or 2 and represents the deviation of the distances from each other between the positions l 1 from the real and virtual position images . the deviation is determined from the difference of the distances , i . e . for the object l 1 the deviation is given by the deviation would also be determined in a corresponding way for the second object or for all referenced objects . a corrected position of the vehicle is now determined in the fourth step . for this purpose , the minimum deviation of the computed distance from the real distance is determined . it is particularly preferable for this to use the method of least squares , that is the position change is sought iteratively until it is particularly preferable for this to shift the digital map iteratively so that the deviation of the computed distance from the real distance is minimized . said step is shown as an example in fig1 e , wherein the shifted map is shown dashed . the digital map including the second position 2 and the position of the objects l 1 , l 2 is iteratively shifted until the absolute minimum deviation is achieved . in doing so , the displacement of the digital map comprises at least one translational and one rotational displacement . in the case of the example , as shown in fig1 e , there is a translational displacement by the distance ฮดx_t and a rotational displacement ฯ_t . an improved corrected position 5 results from said displacement , as shown in fig1 e . the second position error is characterized in fig1 e as ฮดx_s and comprises both the translational error and also the rotational error . finally , in a fifth step the method can be improved still further by carrying out a second correction , whereby the corrected position is corrected once again by fitting the corrected position into a plausible lane of the road . advantageously , the last corrected position is shifted to match the digital map for this , so that it is located in the correct lane , i . e . matching the direction of travel . the corrected position of the vehicle is then said last corrected position 6 . alternatively , however , said step can be omitted . the aforementioned position 5 is then the corrected position . the last step can also include a position error ฮดx_l consisting of a translational error and a rotational error . the total error of the position or the correction value of the position therefore consists of the three position errors ฮดx_m , ฮดx_s and ฮดx_l , i . e . the method can be improved and compared to the examples described above by further determining the first position by means of the plurality of vehicle sensors , in particular by means of a sensor fusion unit m2xpro for merging and plausibility checking the sensor data . such a sensor fusion unit m2xpro is shown in fig3 , and together with the gnss unit can form a system unit . in fig2 and 3 , an exemplary embodiment of a vehicle system is shown in two different levels of detail . in fig2 the vehicle system is shown at a system level . it shows the system 100 , wherein the system boundary is shown in fig2 by dashed lines . the system 100 is inter alia connected to a backend server 210 , for example a map server , by means of which current data for the digital map can be obtained . said backend server is connected to an internal server 110 of the vehicle that is a component of the system 100 . moreover , the system 100 is connected to at least one satellite 220 . the system 100 comprises inter alia a position and localization module 120 that is coupled to the internal server 110 , the satellites 220 and a plurality of sensors 130 . a detailed representation of the position and localization model 120 is shown in fig3 and is described in more detail below . the position and localization module 120 is connected to a plurality of applications disposed in an application layer 140 and provides said applications with the corrected position 5 or 6 . a detailed representation of the position and localization module 120 is shown in fig3 . it comprises a localization unit 121 that comprises a gnss unit and a sensor fusion unit and the first position 1 of the vehicle can be determined thereby . said localization unit 121 is coupled to at least one gnss satellite and a plurality of sensors 130 . moreover , the position and localization module 120 comprises a unit 122 for fitting the first position into a digital map . a further unit 123 is used for the detection and plausibility checking of objects . a third unit 124 is used for orientation of the digital map and fitting the corrected position into a plausible lane . the vehicle system 100 enables inter alia data relating to the object to be received by means of messages via vehicle - 2 - x , such as by means of the connection 125 shown between the v 2 x or c 2 x module and the sensors . further , the system enables a corrected position of an object or corrected data relating to the digital map to be transmitted to a map server . this is carried out by means of the internal server 110 , which comprises an upload and download unit 111 , 112 for this . in this way it is possible to obtain the digital map from a map server and to check the same by means of a time stamp of the digital map and to reject it if another digital map is more up to date . further advantageous alternate embodiments include a method for improved position determination , wherein a first position is determined by means of a global satellite navigation system and wherein the first position is fitted into a digital map , wherein a second position is determined relative to an object that is recorded in the digital map , characterized in that , the first position is corrected by means of the second position . alternately another method further including the correction of the first position by means of the second position is carried out during an iterative adjustment , in particular during a so - called least squares method . alternately another method further including the second position is determined by means of an environment sensor system . alternately another method further including the environment sensor system comprises a camera sensor system and / or a radar sensor system and / or a lidar sensor system and / or an ultrasonic sensor system and / or a temperature sensor system and / or a rain sensor system and / or a road condition sensor system . alternately another method further including a third position is determined by means of an inertial sensor system in the context of dead reckoning . alternately another method further including the inertial sensor system detects a three - dimensional rate of turn and a three - dimensional acceleration . alternately another method further including the first position is additionally or alternatively corrected by means of the third position . alternately another method further including a fourth position is determined by means of a steering angle sensor system and a wheel revolution rate sensor system . alternately another method further including the first position is additionally or alternatively corrected by means of the fourth position . alternately another method further including the global satellite navigation system is a gps system , a glonass - system or a galileo system . further advantageous alternate embodiments include a system for improved position determination , comprising a global satellite navigation system , an environment sensor system , a steering angle sensor system , a wheel revolution rate sensor system and an inertial sensor system , characterized in that the system is designed to carry out a method as described above . a use of the system in a vehicle , in particular in a motor vehicle . according to one embodiment it is therefore preferably provided that initially , as in the prior art , the gnss vehicle position is mapped in the digital map . however , the map particularly preferably contains additional fixed location objects , so - called โ landmarks โ. all data in the map are preferably referenced to a global reference coordinate system , for example the wgs ( world geodetic system 1984 ) data format . the gnss vehicle position is now preferably placed in the map coincident with the most plausible position and the relative distance from the referenced landmarks calculated in the closest proximity ( ฮดx 1 l i ) fixed objects are detected from the vehicle , preferably by means of calibrated environment sensors ( for example a camera , radar , lidar etc . ), and the relative distance thereof from the vehicle is measured ( ฮดx 2 l i ). said distances are relatively accurate . the position error of the map compared to reality is now ฮดl i = ฮดx 1 l i โ ฮดx 2 l i . in order to achieve the best positioning of the map in reality and to determine the true lane position from the maps , the map with the vehicle position is now preferably shifted and rotated until the smallest value for ฮดl i is achieved . this can particularly preferably be calculated with the so - called โ least square fit โ method min ( ฮดl i 2 ). finally , the vehicle position is now brought into coincidence with the origin of the environment sensor . the real measurement by means of the environment sensors generally enables cm - accurate positioning to fixed objects in the surroundings of the vehicle . lane - accurate assignment can be carried out by means of fitting into a georeferenced map with the same landmark information . the residual error ฮดl i - min =( ฮดx 1 l i )*โ( ฮดx 2 l i ) (* after fitting the map landmarks into the landmarks from the environment sensor system ) is then preferably updated in the map and the map material is thereby optimized . likewise , landmarks that are not yet noted in the map can preferably be entered into the map . advantageously , the maps are stored in a static server and transmitted to the auto by means of a suitable radio transmission . owing to the known gnss position of the vehicle , preferably only the data that are relevant to a certain region are transmitted and thus the amount of data is limited . a further advantage of server - based map management is the possibility of statistically analyzing the returned โ residual discrepancies โ by analyzing a plurality of responses . outliers indicate a fault in the transmitting vehicle . lane - accurate positioning in a map is in particular required during autonomous travel , because for example traffic rules are often correlated with lanes or accurate trajectory planning has to be calculated for the relevant lane . likewise , the relevance can be determined from information relating to the actual direction of travel received by means of car 2 x .
| 6 |
the following detailed description of the invention is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any theory presented in the preceding background of the invention or the following detailed description of the invention . a first subject matter of the invention relates to cosmetic agents , each including , based on the total weight of the agent , 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt ./%; at least one wax ; solid matter dispersed in particulate form ; optionally further ingredients ; wherein the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . the term โ free water โ shall be understood according to the invention such that the content of constitutional water , hydration water or similarly molecularly bound water that can be present in the components used , in particular in the solids dispersed in particulate form , does not constitute free water within the meaning of the present application . all information regarding the states of matter ( solid , liquid , gaseous ) in this application relate to normal conditions . โ normal conditions โ within the meaning of the present application refer to a temperature of 20 ยฐ c . and a pressure of 1013 . 25 mbar . melting point information likewise refers to a pressure of 1013 . 25 mbar . it is furthermore essential that the composition according to the invention includes at least one or more liquid oils in said total amount . an oil according to the invention shall be understood to mean a liquid substance that can be mixed in bidistilled water to less than 1 wt . % under normal conditions . in a preferred embodiment , the liquid oil is selected from at least one compound of the group consisting of liquid silicones , ester oils , trifatty acid esters of saturated and / or unsaturated , linear and / or branched c 6 to c 22 fatty acids including glycerol , vegetable oils , liquid paraffin oils , isoparaffin oils , liquid synthetic hydrocarbons , liquid di - n - alkyl ethers , dicarboxylic acid esters , and symmetrical , asymmetrical or cyclic esters of carbonic acid . it is preferred according to the invention if the agent according to the invention , based on the weight of the composition , includes liquid oil in a total amount of in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, in the composition according to the invention . the composition according to the invention preferably includes at least one silicone oil as the liquid oil . it is preferred according to the invention if the agent according to the invention , based on the weight of the composition , includes silicone oil in a total amount of 30 to 70 wt . %, in particular of 40 to 65 wt . %, in the composition according to the invention . the silicone oils , in turn , are preferably selected from at least one compound from the group consisting of : ( i ) polyalkylsiloxanes , polyarylsiloxanes , polyalkylarylsiloxanes , which are volatile or non - volatile , straight - chain , branched or cyclic , cross - linked or not cross - linked ; ( ii ) polysiloxanes including , in the general structure thereof , one or more organofunctional groups , which are selected from ( per ) fluorinated groups ; ( iii ) or the mixtures thereof . especially particularly preferred cosmetic agents are characterized by including , as the oil , at least one silicone of formula ( si - 1 ) where x denotes a number from 0 to 200 , preferably from 0 to 100 , and more preferably from 0 to 20 . the preferred cosmetic agents according to the invention include at least one silicone of above formula ( si - 1 ) as the oil . according to inci nomenclature , these silicones are referred to as dimethicone . likewise preferred silicone oils according to the invention are selected from silicones of formula ( si - 2 ), where x is selected from integers from 1 to 20 , preferably 1 to 3 . a preferred silicone oil of formula ( si - 2 ) is available under the inci name phenyl trimethicone . it is also possible , of course , for mixtures of the above - mentioned silicones of formulas ( si - 1 ) and ( si - 2 ) to be present as silicone oil in the preferred agents according to the invention . preferred silicone oils that can be used according to the invention , in particular according to formula ( si - 1 ), have a kinematic viscosity of 1 to 200 mm 2 s โ 1 , particularly preferably of 5 to 100 mm 2 s โ 1 , at 25 ยฐ c . such silicone oils are commercially available , for example as dimethicone , under the trade name xiameter pmx 200 sil fluid 50 cs ( formerly : dow corning 200 fluid 500 cst ). within the scope of a further embodiment of the invention , preferred cosmetic agents according to the invention are those that include , as the liquid oil , at least one ester of formula ( i ) where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 22 carbon atoms . it is particularly preferred if , according to formula ( i ), r 1 is a linear or branched hydrocarbon group having 3 to 22 carbon atoms , and r 2 is a branched hydrocarbon group having 3 to 22 carbon atoms . preferred liquid oils are selected from esters according to formula ( i ) of c 6 to c 22 fatty acids ( r 1 = linear or branched c 5 to c 21 hydrocarbon ) having c 3 to c 22 fatty alcohols ( r 2 = linear or branched c 3 to c 22 hydrocarbon ). preferred examples of fatty acid components used in the esters of formula ( i ) are caproic acid , caprylic acid , 2 - ethyl - hexanoic acid , capric acid , lauric acid , isotridecanoic acid , myristic acid , palmitic acid , palmitoleic acid , stearic acid , isostearic acid , oleic acid , elaidic acid , petroselinic acid , linoelic acid , linolenic acid , eleostearic acid , arachyinic acid , gadoleic acid , behenic acid and erucic acid , and the mixtures thereof , such as the technical mixtures that develop , for example , in the hydrolysis of natural fats and oils under pressure , in the oxidation of aldehydes from roelen &# 39 ; s oxo synthesis , or the dimerization of unsaturated fatty acids . preferred examples of the fatty alcohol components in the esters of formula ( i ) are isopropyl alcohol , caproic alcohol , caprylic alcohol , 2 - ethylhexyl alcohol , capric alcohol , lauryl alcohol , isotridecyl alcohol , myristyl alcohol , cetyl alcohol , palmoleyl alcohol , stearyl alcohol , isostearyl alcohol , oleyl alcohol , elaidyl alcohol , petroselinyl alcohol , linoleyl alcohol , linolenyl alcohol , eleostearyl alcohol , arachyl alcohol , gadoleyl alcohol , behenyl alcohol , erucyl alcohol , and brassidyl alcohol , and the mixtures thereof , such as the technical mixtures that develop , for example , in the high - pressure hydrogenation of technical methyl esters based on fats and oils or aldehydes from roelen &# 39 ; s oxo synthesis , and as monomer fraction in the dimerization of unsaturated fatty acids . it is particularly preferred according to the invention if the compound according to formula ( i ) is selected from 2 - ethylhexyl palmitate , 2 - ethylhexyl stearate , 2 - ethylhexyl cocoate , 2 - ethylhexyl laurate , 2 - ethylhexyl isostearate , hexyldecyl stearate , hexyldecyl laurate , isodecyl neopentanoate , isononyl isononanoate , isopropyl myristate , isopropyl palmitate , isopropyl stearate , isopropyl isostearate , isopropyl oleate , isooctyl stearate , isononanoic acid - c 16 - 18 - alkyl ester , isononyl stearate , isocetyl stearate , isononyl isononanoate , isotridecyl isononanoate , cetearyl isononanoate , 2 - octyldodecyl palmitate , 2 - octyldodecyl myristate , 2 - octyldodecyl laurate , 2 - octyldodecyl stearate , butyloctanoic acid - 2 - butyl octanoate , coconut fatty alcohol caprinate / caprylate , n - butyl stearate , n - hexyl laurate , n - decyl oleate , cetyl oleate , oleyl oleate , oleyl erucate , erucyl oleate , erucyl erucate , or mixtures of two or more of the above - mentioned compounds . it is particularly preferred according to the invention to select the respective hydrocarbon groups of the esters of formula ( i ), in particular within the scope of the preferred embodiments of said esters ( vide supra ), from saturated hydrocarbons . the agents according to the invention preferably include the compounds of formula ( i ) in an amount from 1 to 60 wt . %, in particular from 5 to 30 wt . %, in each case based on the total weight of the agent . within the scope of this embodiment of the invention , preferred cosmetic agents according to the invention are again those that at least include , as the liquid oil , where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , within the scope of this combination , in turn , the preferred embodiments of the compounds of formula ( i ) and of the silicone oils can be used as particularly preferred components . within the scope of the above embodiment of the invention , particularly preferred cosmetic agents according to the invention are those that at least include , as the liquid oil , where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %. within the scope of this combination , in turn , the preferred embodiments of the compounds of formula ( i ) and of the silicone oils can be used as particularly preferred components . triglyceride oils , such as the liquid fractions of suet , and synthetic triglycerides are also suitable as liquid oil according to the invention . preferred triglycerides are selected from the triglycerides of linear or branched , saturated or unsaturated , optionally hydroxylated , c 8 - 30 fatty acids . the use of natural oils can be particularly suitable , such as soy bean oil , cottonseed oil , sunflower oil , palm oil , palm kernel oil , linseed oil , almond oil , castor oil , corn oil , rapeseed oil , olive oil , sesame oil , safflower oil , wheat germ oil , peach kernel oil , and the liquid components of coconut oil , glyceryl trioleate ( triolein ), capric / caprylic triglycerides , glyceryl triisostearin , glyceryl triisopalmitate , and mixtures of two or more of the aforementioned compounds . preferred vegetable oils are selected from at least one representative from the group consisting of amaranth oil , sunflower oil , olive oil , soy bean oil , rapeseed oil , almond oil , jojoba oil , orange oil , apricot kernel oil , macadamia nut oil , wheat germ oil , peach kernel oil , and the liquid components of coconut oil . preferred di - n - alkyl ethers are selected from di - n - alkyl ethers having in total between 12 and 36 carbon atoms , in particular 12 to 24 carbon atoms , such as di - n - octyl ether , di - n - decyl ether , di - n - nonyl ether , di - n - undecyl ether , di - n - dodecyl ether , n - hexyl - n - octyl ether , n - octyl - n - decyl ether , n - decyl - n - undecyl ether , n - undecyl - n - dodecyl ether and n - hexyl - n - undecyl ether , and di - tert - butyl ether , di - iso - pentyl ether , di - 3 - ethyldecyl ether , tert - butyl - n - octyl ether , iso - pentyl - n - octyl ether and 2 - methyl - pentyl - n - octyl ether . the compounds 1 , 3 - bis ( 2 - ethylhexyl ) cyclohexane ( cetiol ยฎ s ) and di - n - octyl ether cetiol ยฎ oe ) available as commercial products may be preferred . preferred dicarboxylic acid esters are selected from at least one compound of the group consisting of di - n - butyl adipate , di -( 2 - ethylhexyl ) adipate , di -( 2 - ethylhexyl ) succinate and diisotridecyl acelaate , and diol esters such as ethylene glycol dioleate , ethylene glycol diisotridecanoate , propylene glycol di ( 2 - ethylhexanoate ), propylene glycol diisostearate , propylene glycol dipelargonate , butanediol diisostearate , and neopentyl glycol dicaprylate . natural and synthetic hydrocarbons , such as paraffin oils , c 18 to c 30 isoparaffins , in particular isoeicosane , polyisobutene or polydecene , which are available under the designation emery ยฎ 3004 , 3006 , 3010 or under the designation ethylflo from albemarle or nexbase ยฎ 2004g from nestle , for example , and 1 , 3 - bis ( 2 - ethylhexyl ) cyclohexane ( available under the trade name cetiol ยฎ s from cognis , for example ) are likewise among the liquid oils that can preferably be used according to the invention . further preferred liquid oils according to the invention are selected from the benzoic acid esters of linear or branched c 8 - 30 alkanols . particularly preferred are benzoic acid - c 12 - c 15 - alkyl esters , for example available as the commercial product finsolv ยฎ tn , benzoic acid isostearyl esters , for example available as the commercial product finsolv ยฎ sb , ethylhexyl benzoate , for example available as the commercial product finsolv ยฎ eb , and benzoic acid 2 - octyldodecyl esters , for example available as the commercial product finsolv ยฎ bod . further preferred liquid oils according to the invention are selected from the dicarboxylic acid esters of linear or branched c 2 to c 10 alkanols , in particular diisopropyl adipate , di - n - butyl adipate , di -( 2 - ethylhexyl ) adipate , dioctyl adipate , diethyl -/ di - n - butyl / dioctyl sebacate , diisopropyl sebacate , dioctyl malate , dioctyl maleate , dicaprylyl maleate , diisooctyl succinate , di - 2 - ethylhexyl succinate , and di -( 2 - hexyldecyl ) succinate . further preferred liquid oils according to the invention are selected from the symmetrical , asymmetrical or cyclic esters of carbonic acid comprising alkanols , such as glycerol carbonate , di - n - caprylyl carbonate ( cetiol ยฎ cc ) or the esters according to the teaching of de 19756454 a1 . it is furthermore essential that the agents according to the invention include at least one wax . waxes are generally understood to mean solids that are reaction products of carboxylic acids and alcohols . these reaction products in the form of wax are solid to brittle - hard , kneadable up to 20 ยฐ c ., and melt at 30 ยฐ c . to 90 ยฐ c . waxes according to the invention preferably have a melting point in a range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . it is preferred according to the invention if at least half the amount of the wax that is present ( particularly preferably at least 75 % of the amount of the wax that is present ) is present in dissolved form in the liquid oil of the cosmetic agent according to the invention . when , in connection with this embodiment , at least one ester of formula ( i ) ( vide supra ) is present in the liquid oil component , it is preferred according to the invention within the scope of the production process to dissolve wax in an amount of at least one ester of formula ( i ) ( vide supra ), and then incorporate it in this dissolved form into the cosmetic agent according to the invention . it is especially particularly preferred according to the invention if the agent according to the invention includes at least one wax , selected from at least one wax of the group of waxes having the inci names cocoglycerides , cetyl palmitate , myristyl myri state . the agents according to the invention preferably include wax in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %, in each case based on the total weight of the agent . it is essential that the cosmetic agents according to the invention include solid matter dispersed in particulate form . within the meaning of the invention , particles are particles ( see din 66160 : 1992 - 09 ) of solids which are present as grains . consequently , particles of solids which are present as grains are present in the agent according to the invention in dispersed form . the particles preferably have a mean particle diameter ( volume mean ) of 0 . 01 to 3 . 0 ฮผm , in particular of 0 . 05 to 1 . 0 ฮผm , especially particularly preferably of 0 . 1 to 0 . 5 ฮผm . according to the invention , preferred cosmetic agents are those that include solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %. in preferred cosmetic agents according to the invention , at least one inorganic solid , in particular at least one metal oxide , is present as the solid matter dispersed in particulate form . the metal oxides , in turn , are preferably selected from aluminates , aluminum silicates , titanium dioxide , zinc oxide , iron oxides , tin dioxide , nacreous pigments , and mixtures of two or more of the aforementioned metal oxides . frequently used nacreous pigments include mother of pearl ( made of ground shells ), monocrystalline nacreous pigments , such as bismuth oxychloride , and nacreous pigments based on mica , mica / metal oxide , or titanium dioxide / metal oxide . the mixed nacreous pigments mentioned last are provided with a metal oxide coating that is different from the particulate material of the core . through the use of nacreous pigments , color effects and / or brilliance are achieved in the agents according to the invention or on the substrate treated therewith . particularly preferred aluminates are selected from active aluminum oxide , alpha - aluminum oxide , beta - aluminum oxide , gamma - aluminum oxide , and the mixtures thereof . particularly preferred aluminum silicates ( also referred to as aluminosilicates ) are selected from phyllosilicates , tectosilicates . particularly suitable phyllosilicates are selected from kaolins ( here , in particular from kaolinite , dickite , halloysite and nacrite ), serpentine , talcum , pyrophyllite , montmorrillonite , quartz , bentonite , mica ( here , in particular from illite , muscovite , paragonite , phlogopite , biotite , lepidolite , margarite , smectite ( here , in particular from montmorrillonite , saponite , nontronite , hectorite )). preferably suitable tectosilicates are selected from feldspar minerals ( in particular albite , orthoclase , anorthite , leucite , sodalite , hauyne , labradorite , lasurite , nosean , nepheline ). preferred titanium dioxides are those distributed under the trade name kronos by kronos , in particular kronos 1171 . preferred iron oxides are fe 2 o 3 , for example having inci ci 77491 , in particular commercially as unipur red lc 281 em ยฎ by sensient , fe 2 o 3 . nh 2 o , for example having inci ci 77491 , in particular commercially as unipur red lc 281 em ยฎ by sensient , feo . fe 2 o 3 , for example having inci ci 77499 , in particular commercially as unipur black lc 989 em ยฎ by sensient . preferred cosmetic agents according to the invention are characterized in that they ( together with aforementioned inorganic solids , or without the presence of aforementioned inorganic solids as solid matter dispersed in particulate form ) include at least one starch as the solid matter dispersed in particulate form . starch is a reserve carbohydrate that is stored in many plants in the form of usually 1 to 200 ฮผm large starch grains ( granules ) in various parts of the plants , such as in bulbs or roots , grain seeds , fruits , and in the marrow . starch belongs to the family of homoglycans and is a polycondensation product of d - glucose . starch is composed of three structurally different polymers of d - glucopyranose , namely amylose , amylopectin and what is known as an intermediate fraction . higher plants include 0 to 45 wt . %, based on the dry substance . the intermediate fraction , which is also referred to as abnormal amylopectin , is between the amylosis and the amylopectin from a structural perspective . the quantity information for amylopectin defined within the scope of the present application include the intermediate fraction . amylose is predominantly composed of a linear chain of d - glucose units linked by ฮฑ - 1 , 4 - glycosidic bonds , mr 50000 to 150000 . the resulting chains form double helices in the starch . in addition to the ฮฑ - 1 , 4 bonds described for amylose , amylopectin also includes ฮฑ - 1 , 6 bonds as branching points in an amount from 4 to 6 %. the average distance between the branching points is approximately 12 to 17 glucose units . the molar mass of 107 to 7 ยท 108 corresponds to approximately 105 glucose units , whereby amylopectin belongs to the largest biopolymers . said branching points are distributed across the molecule in such a way that a cluster structure having relatively short side chains develops . two of these side chains in each case form a double helix . as a result of the many branching points , amylopectin has relatively good solubility in water . a starch that can preferably be used according to the invention is selected from at least one polycondensation product of d - glucose , obtained from the starch of potatoes , corn , rice , peas , acorns , chestnuts , wheat , bananas , sago , millet , sorghum , oats , barley , rye , beans , batata , arrowroot or tapioca . it is particularly preferred if the agent according to the invention includes at least one starch which is tapioca starch , potato starch , corn starch or rice starch . mixtures of the aforementioned starch compounds are also covered according to the invention . tapioca starch is especially particularly preferred . the starch compound is preferably present in the agents according to the invention in amounts of 0 . 05 to 8 . 0 wt . %, and in particular of 0 to 7 . 0 wt . %, in each case based on the weight of the agent . it is preferred according to the invention within the scope of a further embodiment of the invention if the solid matter dispersed in particulate form is coated on the surface of the solid matter particle with at least one water - in - oil emulsifier . particularly suitable water - in - oil emulsifiers are preferably selected from at least one compound from the group consisting of : partial esters of polyglycerols having n = 2 to 10 glycerol units and esterified with 1 to 5 saturated or unsaturated , linear or branched , optionally hydroxylated c 8 to c 30 fatty acid esters ; linear or branched , saturated or unsaturated c 12 to c 30 alkanols , each being etherified with 1 to 4 ethylene oxide units per molecule , which are exceptionally preferably selected from steareth , ceteth , myristeth , laureth , trideceth , arachideth and beheneth , each having 1 to โ 4 ethylene oxide units per molecule , in particular steareth - 2 , steareth - 3 , steareth - 4 , ceteth - 2 , ceteth - 3 , ceteth - 4 , myristeth - 2 , myristeth - 3 , myristeth - 4 , laureth - 2 , laureth - 3 , laureth - 4 , trideceth - 2 , trideceth - 3 and trideceth - 4 , and mixtures thereof ; linear saturated alkanols comprising 12 to 30 carbon atoms , in particular comprising 16 to 22 carbon atoms , in particular cetyl alcohol , stearyl alcohol , arachidyl alcohol , behenyl alcohol , and lanolin alcohol , or mixtures of these alcohols , as they are obtainable from the technical hydrogenation of vegetable and animal fatty acids ; esters , and in particular partial esters , made of a polyol having 2 to 6 carbon atoms , and linear saturated and unsaturated fatty acids having 12 to 30 , in particular 14 to 22 , carbon atoms , which can be hydroxylated . such esters or partial esters are , for example , the monoesters and diesters of glycerol or ethylene glycol , or the monoesters of propylene glycol having linear saturated and unsaturated c 12 to c 30 carboxylic acids , which can be hydroxylated , in particular those comprising palmitic and stearic acid , the sorbitan monoesters , diesters or triesters of linear saturated and unsaturated c 12 to c 30 carboxylic acids , which can be hydroxylated , in particular those of myristic acid , palmitic acid , stearic acid , or mixtures of these fatty acids , the pentaerythrityl monoesters , diesters , triesters and tetraesters , and the methyl glucose monoesters and diesters of linear , saturated and unsaturated c 12 to c 30 carboxylic acids , which can be hydroxylated , of which the monoesters , diesters , triesters and tetraesters of pentaerythritol comprising linear saturated fatty acids having 12 to 30 , in particular 14 to 22 , carbon atoms , which can be hydroxylated , and mixtures thereof , are particularly preferred as stabilizers and / or water binders . the monoesters and diesters are particularly preferred according to the invention . preferred c 12 to c 30 fatty acid groups according to the invention are selected from lauric acid , myristic acid , palmitic acid , stearic acid , arachinic acid and behenic acid groups , the stearic acid group being particularly preferred ; sterols , which is to say steroids , which carry a hydroxyl group at the c3 atom of the steroid skeleton and are isolated both from animal tissue ( zoosterols , such as cholesterol , lanosterol ), from plants ( phytosterols , such as ergosterol , stigmasterol , sitosterol ) and from fungi and yeasts ( mycosterols ) and which may be low - ethoxylated ( 1 to 5 eo ); alkanols and carboxylic acids , each having 8 to 24 c atoms , in particular having 16 to 22 c atoms , in the alkyl groups and 1 to 4 ethylene oxide units per molecule , which have an hlb value of greater than 1 . 0 and / or smaller than / equal to 7 . 0 ; glycerol monoethers of saturated and / or unsaturated , branched and / or unbranched alcohols having a chain length of 8 to 30 , in particular 12 to 18 carbon atoms . liquid partial esters of polyglycerols having n = 2 to 10 glycerol units and esterified with 1 to 5 saturated or unsaturated , linear or branched , optionally hydroxylated c 8 to c 30 fatty acid esters are particularly preferred water - in - oil emulsifiers that are available according to the invention . it is especially particularly preferred if the water - in - oil emulsifier is selected from at least one emulsifier that comprises 2 to 6 glycerol units bonding covalently to each other and at least one ( in particular branched ) alkyl group having 8 to 20 carbon atoms . it is essential that the agents according to the invention have a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ). these viscosity levels can also be set without the addition of an additional thickening agent for thickening oil . if this should not be the case , it is recommended to add a thickening agent for thickening oil to the formulation . further preferred cosmetic agents according to the invention are therefore characterized by additionally including at least one thickening agent for thickening oil . these additional thickening agents for thickening oil are different from the above - mentioned components , whose presence in the agent according to the invention is essential . it is expedient according to the invention that , if the additional thickening agents for thickening oil are used in the cosmetic agent according to the invention , said thickening agents are added only in such an amount until the viscosity is in the viscosity range according to the invention . preferred thickening agents according to the invention for thickening oil are selected from hydrophobized clay minerals , silica ( in particular fumed silica ), ethylene / propylene / styrene copolymers , butylene / ethylene / styrene copolymers , dextrin esters and / or silicone elastomers . preferred hydrophobized clay minerals are selected from hydrophobized montmorrillonites , hydrophobized hectorites and hydrophobized bentonites , particularly preferably made of disteardimonium hectorite , stearalkonium hectorite , quaternium - 18 hectorite , and quaternium - 18 bentonite . the commercially available thickening agents provide these hydrophobized clay minerals in the form of a gel in an oil component , preferably in cyclomethicone and / or a non - silicone oil component , such as propylene carbonate . such gels are available , for example , under the trade name bentone ยฎ or thixogel . preferred compositions according to the invention are characterized by including hydrophobized clay mineral in a total amount of 0 . 5 to 10 wt . %, preferably 1 to 7 wt . %, particularly preferably 2 to 6 wt . %, exceptionally preferably 3 to 5 wt . %, in each case based on the total weight of the composition according to the invention . further especially particularly preferred thickening agents according to the invention for thickening oil are selected from silica , in particular fumed silica ( such as the commercial products of the aerosil ยฎ series from evonik degussa ). these may be hydrophobized on the surface thereof by way of chemical modification ( such as the silylated silica having the inci name silica silylate ); however , this is not preferred . particularly preferably suitable fumed silica according to the invention has the inci name silica . if fumed silica is additionally used as a thickening agent for thickening oil , particularly storage - stable cosmetic agents of the present invention are obtained . preferred cosmetic agents according to the invention are characterized by including silica , preferably fumed silica , in a total amount of 0 . 1 to 6 wt . %, preferably 0 . 5 to 5 wt . %, particularly preferably 1 . 0 to 4 . 5 wt . %, especially particularly preferably 1 . 5 to 3 . 0 wt . %, exceptionally preferably 1 . 9 to 2 . 6 wt . %, in each case based on the total weight of the composition according to the invention . further lipophilic thickening agents that can be used according to the invention are selected from ethylene / propylene / styrene copolymers and butylene / ethylene / styrene copolymers . the copolymers are particularly preferably used as a pre - thickened oil - based gel . such gels are available , for example , under the trade name versagel ยฎ ( ex penreco ). gels including mineral oil , hydrogenated polyisobutene , isoparaffins such as isohexadecane or isododecane , and including ester oils , in particular isopropyl palmitate or isopropyl myristate , are preferred . further lipophilic thickening agents that can be used according to the invention are selected from silicone elastomers . a further preferred embodiment of the invention is characterized by including at least one silicone elastomer , obtainable by cross - linking an organopolysiloxane that includes at least 2 c 2 to c 10 alkenyl groups having a terminal double bond in each molecule with an organopolysiloxane that includes at least 2 silicone - bonded hydrogen atoms in each molecule . particularly preferred organopolysiloxanes according to the invention comprising at least 2 c 2 to c 10 alkenyl groups having a terminal double bond in the molecule are selected from methylvinylsiloxanes , methylvinylsiloxane - dimethylsiloxane copolymers , dimethylpolysiloxanes including dimethylvinylsiloxy end groups , dimethylsiloxane - methylphenylsiloxane copolymers including dimethylvinylsiloxy end groups , dimethylsiloxane - diphenylsiloxane - methylvinylsiloxane copolymers including dimethylvinylsiloxy end groups , dimethylsiloxane - methylvinylsiloxane copolymers including trimethylsiloxy end groups , dimethylsiloxane - methylphenylsiloxane - methylvinylsiloxane copolymers including trimethylsiloxy end groups , methyl -( 3 , 3 , 3 - trifluoropropyl ) polysiloxanes including dimethylvinylsiloxy end groups , and dimethylsiloxane - methyl -( 3 , 3 , 3 - trifluoropropyl )- siloxane copolymers including dimethylvinylsiloxy end groups . particularly preferred cross - linking organopolysiloxanes according to the invention comprising at least two silicone - bonded hydrogen atoms are selected from methyl hydrogen polysiloxanes including trimethylsiloxy end groups , dimethylsiloxane - methyl hydrogen siloxane copolymers including trimethylsiloxy end groups , and cyclic dimethylsiloxane - methylhydrogen - siloxane copolymers . particularly preferred silicone elastomers according to the invention , which , as raw material , are present already pre - swelled in a silicone that is liquid at room temperature under normal conditions and represent a silicone - based gel , are commercially available , for example under the trade name corning 9040 silicone elastomer blend ( a cyclomethicone ( and ) dimethicone crosspolymer from dow corning ; silicone elastomer content 12 to 13 wt . %), sfe 168 , a cyclomethicone ( and ) dimethicone / vinyl dimethicone crosspolymer from ge silicones , vinyl dimethicone crosspolymers , included in ksg - 15 ( cyclomethicone ( and ) dimethicone / vinyl dimethicone crosspolymer , silicone elastomer content 4 to 10 wt . %), ksg - 16 ( dimethicone ( and ) dimethicone / vinyl dimethicone crosspolymer , silicone elastomer content 20 to 30 wt . %), ksg - 17 ( cyclomethicone ( and ) dimethicone / vinyl dimethicone crosspolymer ), ksg - 18 ( phenyl trimethicone ( and ) dimethicone / phenyl vinyl dimethicone crosspolymer , silicone elastomer content 10 to 20 wt . %); and ksg - 20 , available from shin etsu silicones of america ( akron , ohio ), and from grant industries inc . ( elmwood park , n . j . ), the products from the gransil ยฎ series , in particular gransil sr - cyc ( cyclomethicone and stearyl - vinyl / hydromethylsiloxane copolymer ), gransil ยฎ rps gel ( inci name : cyclopentasiloxane and polysilicone - 11 ), gransil ยฎ gcm - 4 ( inci name : cyclotetrasiloxane and polysilicone - 11 ), gransila gcm - 5 ( inci name : cyclopentasiloxane and polysilicone - 11 ), gransil ยฎ rps ( inci name : cyclopentasiloxane and polysilicone - 1 ), gi - cd 10 ( inci name : cyclopentasiloxane ( and ) stearoxymethicone / dimethicone copolymer ( and ) dimethicone ), gransil ยฎ ids ( inci name : isododecane ( and ) cyclotetrasiloxane ( and ) polysilicone - 11 ), gransil ยฎ pc - 12 ( inci name : isododecane ( and ) polysilicone - 11 ), gransil ยฎ ids - 5 ( inci name : isododecane ( and ) cyclopentasiloxane ( and ) polysilicone - 11 ), gransil apk - 1 ( inci name : dimethicone and cyclopentasiloxane and polysilicone - 11 and nylon - 12 and methyl methacrylate / acrylonitrile copolymer and peg - 10 dimethicone and polysorbate - 40 and isohexadecane and ammonium polyacryloyldimethyl taurate ), gransil ยฎ dmcm - 5 ( inci name : dimethicone and cyclopentasiloxane and polysilicone - 11 ), gransil ยฎ dmg - 6 with dimethicone ( 6 cst ) ( inci name : dimethicone and polysilicone - 11 ), gransil ยฎ dmg - 20 with dimethicone ( 20 cst ) ( inci name : dimethicone and polysilicone - 11 ), gransil ยฎ am - 8 gel ( inci name : caprylyl methicone and cyclopentasiloxane and polysilicone - 11 ), gransil ยฎ dm 5 with dimethicone ( 5 cst ) ( inci name : dimethicone and polysilicone - 11 ), gransil ยฎ dmid ( inci name : dimethicone and isododecane and polysilicone - 11 ), gransil ยฎ pm ( inci name : phenyl trimethicone and polysilicone - 11 ), gransil ยฎ inin ( inci name : isononyl isononanoate ( and ) polysilicone - 11 ). silicone elastomers which , as raw material , are present already pre - swelled in a silicone oil , fat or wax that is liquid at room temperature under normal conditions and represent a silicone - based / non - silicone - based gel , are likewise preferably used in the compositions according to the invention . such silicone elastomer compositions are likewise commercially available , for example under the trade name gransil ยฎ mlb ( inci name : cyclopentasiloxane and polysilicone - 11 and beeswax ), gransil ยฎ ps ( inci name : cyclotetrasiloxane and polysilicone - 11 and petrolatum ), gransil ยฎ ps - 5 ( inci name : cyclopentasiloxane and polysilicone - 11 and petrolatum ), gransil ยฎ dmg - 20 p with dimethicone ( 20 cst ) and petrolatum ( inci name : dimethicone and polysilicone - 11 and petrolatum ), gransil ยฎ rjo ( inci name : cyclopentasiloxane and polysilicone - 11 and jojoba oil ), gransil ยฎ lano ( inci name : cyclopentasiloxane and polysilicone - 11 and lanolin ), gransil ยฎ ohs - 5 ( inci name : cyclopentasiloxane and polysilicone - 11 and octyl hydroxystearate ), and gransil dml ( inci name : dimethicone ( and ) neopentyl glycol diheptanoate ( and ) polysilicone - 11 ). a further preferred embodiment of the invention is characterized in that the silicone elastomer can be obtained by cross - linking an organopolysiloxane that includes at least 2 c 2 to c 10 alkenyl groups having a terminal double bond in each molecule with at least one alpha , omega - diene . particularly preferred cross - linking alpha , omega - dienes according to the invention have the formula ch 2 โ ch ( ch 2 ) x ch โ ch 2 , where x = 1 to 20 . particularly preferred alpha , omega - dienes are selected from 1 , 4 - pentadiene , 1 , 5 - hexadiene , 1 , 6 - heptadiene , 1 , 7 - octadiene , 1 , 8 - nonadiene , 1 , 11 - dodecadiene , 1 , 13 - tetradecadiene , and 1 , 19 - eicosadiene . preferred compositions according to the invention are characterized by including at least one silicone elastomer in a total amount of 0 . 05 to 3 wt . %, preferably 0 . 1 to 2 wt . %, particularly preferably 0 . 2 to 1 . 0 wt . %, exceptionally preferably 0 . 3 to 0 . 5 wt . %, in each case based on the total weight of the composition according to the invention . oil - based compositions that include particulate solids typically have a density of greater than 1 . 2 g / cm 3 at 20 ยฐ c . the agents according to the invention have a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . the density of the agents according to the invention is consequently significantly lower than in customary comparable compositions of the related art . a person skilled in the art knows reliable measuring methods for reproducibly and unambiguously determining the density . within the scope of the present application , the density was determined by way of a digital density meter ( such as chempro dma 4100m or mettler - toledo density meter dm40 ). the measuring principle is based on what is known as the flexural vibration method , in which the substance is filled into a u - shaped glass tube , which is open at the ends , of the measuring device . said glass tube is maintained at a constant temperature ( 20 ยฐ c . here ), caused to oscillate electronically , and the natural frequency of the oscillation is determined . this natural frequency is characteristic of the density of the sample . lowering of the density is particularly preferably achieved by way of dispersion of gas . particularly preferred cosmetic agents according to the invention therefore include dispersed gas . preferably suitable gases according to the invention are air , nitrogen , oxygen , carbon dioxide , argon , nitrous oxide ( air being particularly preferred ). for example , gas can be incorporated into the cosmetic agent according to the invention by way of injection , recirculation , extrusion or stirring . the gas component is particularly preferably dispersed into the cosmetic agent according to the invention by way of a homogenizer . a particularly preferred embodiment of the invention is characterized by the following items : ( a ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; solid matter dispersed in particulate form ; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( b ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; solid matter dispersed in particulate form ; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( c ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( d ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %; at least one wax having a melting point in a range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; solid matter dispersed in particulate form ; optionally further ingredients ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( e ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( f ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( g ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( h ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , at least one wax having a melting point in a range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; the cosmetic agent has a viscosity from 300000 to 800000 mpas , in particular from 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ); and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( i ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %/ o ; at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( j ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( k ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular of 50 to 75 wt . %, in particular of 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, and silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in the range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c . ; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( l ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 40 to 80 wt . %, in particular of 50 to 75 wt . %, in particular of 60 to 70 wt . %, wherein , at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %, and silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in a range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . ( m ): a cosmetic agent , including in each case based on the total weight of the agent : 0 to 3 wt . %, in particular 0 to 2 wt . %, free water ; one or more liquid oils in a total amount of 50 to 75 wt . %, in particular 60 to 70 wt . %, wherein at least the following is present as the liquid oil : where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , in a total amount of 1 to 15 wt . %, in particular of 5 to 15 wt . %, and silicone oil in a total amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %; at least one wax having a melting point in a range from 30 ยฐ c . to 60 ยฐ c ., particularly preferably in a range from 30 ยฐ c . to 50 ยฐ c ., especially particularly preferably in a range from 30 ยฐ c . to 40 ยฐ c ., in a total amount of 0 . 05 to 8 . 0 wt . %, particularly preferably of 0 . 1 to 5 . 0 wt . %, and especially particularly preferably of 0 . 5 to 3 . 0 wt . %; solid matter dispersed in particulate form in a total amount of 10 to 30 wt . %; the cosmetic agent has a viscosity of 300000 to 800000 mpas , in particular of 400000 to 600000 mpas ( in each case measured at 20 ยฐ c ., brookfield , 4 revolutions per minute , spindle te ), and the cosmetic agent has a density of 0 . 95 to 1 . 10 g / cm 3 at 20 ยฐ c . it is preferred according to the invention if each of the embodiments ( a ) through ( m ) additionally includes at least one thickening agent for thickening oil ( in particular silica , particularly preferably fumed silica ). a second subject matter relates to a production method for cosmetic agents , in which wax is dissolved in a liquid oil phase forming a wax solution ; solid matter in particulate form is dispersed in this wax solution ; optionally further ingredients are added to the wax solution ; optionally a ) together with the solid matter in particulate form , or b ) together with the further ingredients , or c ) separately , at the end , at least one thickening agent for thickening oil is added , and a gaseous substance is dispersed in the resulting mixture , or during the mixing process , until the cosmetic agent has a density ( measured at 20 ยฐ c .) of 0 . 95 to 1 . 10 g / cm 3 . for example , the gaseous substance can be incorporated into the cosmetic agent according to the invention by way of injection , recirculation , extrusion or stirring . the gaseous substance is particularly preferably dispersed into the cosmetic agent according to the invention using a homogenizer . preferably suitable gaseous substances according to the invention are air , nitrogen , oxygen , carbon dioxide , argon , nitrous oxide , or mixtures of two or more of the aforementioned gases ( air being particularly preferred ). the cosmetic agent according to the invention is particularly preferably produced using the following method , comprising the following steps : i ) in a stirrer vessel comprising a stirrer ( and preferably a homogenizer ), wax is dissolved in a liquid oil component while stirring at a temperature of at least 40 ยฐ c ., in particular 40 ยฐ c . to 45 ยฐ c . ; ii ) the resulting wax solution is cooled down to a temperature of no more than 25 ยฐ c . ; iii ) solid matter in particulate form is dispersed in the wax solution while stirring ( preferably using a homogenizer ) at a temperature of no more than 25 ยฐ c . ; iv ) further ingredients are added while stirring at a temperature of no more than 25 ยฐ c . ; v ) at least one thickening agent for thickening oil , in particular silica , is added while stirring at a temperature of 20 ยฐ c . to 25 ยฐ c . ; and vi ) a gas pressure in the stirrer vessel is applied at an overpressure in the range of 10 to 250 mbar , and the mixture is stirred for a time period of 10 to 60 minutes , in particular of 20 to 40 minutes . a mixer such as symex 1000 from schrรถder & amp ; boos gmbh & amp ; co . kg , germany , is suitable for production , for example . it is preferred according to the invention to use , as the liquid component according to step i ), one or more esters of formula ( i ), where r 1 and r 2 , independently of one another , denote a linear or branched hydrocarbon group having 3 to 20 carbon atoms , preferably in a total amount of 1 to 20 wt . %, in particular of 5 to 15 wt . %. it is preferred according to the invention to add at least one silicone oil ( preferably in an amount of 30 to 60 wt . %, in particular of 40 to 60 wt . %) after or during step ii ) ( preferably between step ii ) and before step iii )). furthermore , all preferred embodiments of the parameters of the agents according to the invention of the first subject matter of the invention are also preferred , mutatis mutandis , for the second subject matter of the invention . a third subject matter of the invention relates to the use of a cosmetic agent of the first subject matter of the invention as a skin cosmetic . in a stirrer vessel ( symex 1000 from schrรถder & amp ; boos gmbh & amp ; co . kg , germany ) comprising a stirrer and a homogenizer , wax was dissolved in the liquid oil component ( see raw materials of table 1 bearing the number 1 ) while stirring at a temperature of 43 ยฐ c . the resulting wax solution was cooled down to a temperature of no more than 25 ยฐ c . the raw materials bearing the number 2 according to table 1 were added while stirring . at a temperature of 25 ยฐ c ., the solids in particulate form bearing the number according to table 1 were dispersed in the wax solution while stirring and additionally using a homogenizer for 20 minutes . the ingredients bearing the number 4 according to table 1 were added while stirring at a temperature of 25 ยฐ c . the ( fumed ) silica was added as a thickening agent for thickening oil while stirring at a temperature of 25 ยฐ c . finally , the gas pressure in the stirrer vessel was increased to an overpressure of + 150 mbar compared to the ambient pressure , and the mixture was stirred for a time period of 30 minutes . while at least one exemplary embodiment has been presented in the foregoing detailed description of the invention , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment of the invention , it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope of the invention as set forth in the appended claims and their legal equivalents .
| 0 |
as used herein , room temperature refers to about 25 ยฐ c . to 30 ยฐ c . in accordance with the present invention , there is provided a novel crystalline form of imatinib mesylate , designated as form h1 , characterized by an x - ray powder diffraction spectrum having peaks expressed as 2ฮธ at about 9 . 9 , 11 . 1 , 16 . 3 , 17 . 3 , 18 . 1 , 19 . 1 , 19 . 6 , 20 . 3 , 21 . 1 , 21 . 9 , 23 . 2 , 23 . 6 , 24 . 2 , 24 . 9 , 25 . 6 , 26 . 0 , 27 . 3 , 27 . 9 , 28 . 9 , 29 . 4 , 30 . 4 and 30 . 5 degrees . fig1 shows typical form h1 x - ray powder diffraction spectrum . in accordance with the present invention , a process is provided for preparation of imatinib mesylate form h1 . imatinib free base is dissolved in a chlorinated solvent , methanesulfonic acid is added and imatinib mesylate form h1 is isolated . examples of chlorinated solvents are chloroform , methylene dichloride , ethylene dichloride and a mixture thereof . preferable solvents are chloroform and methylene dichloride . imatinib free base may be dissolved in the chlorinated solvents at room temperature or at an elevated temperature . the quantity of methanesulfonic acid per mole of imatinib free base is not critical but preferably at least one mole of methanesulfonic acid per mole of imatinib free base is used to obtain maximum yield of imatinib mesylate . methanesulfonic acid can be added to the solution of imatinib free base in chlorinated solvent preferably between about 5 ยฐ c . to reflux temperature , more preferably between room temperature to reflux temperature . most preferably , methanesulfonic acid is added at room temperature . then , the precipitated imatinib mesylate form h1 is collected by filtration or centrifugation . in accordance with the present invention , an another process is provided for preparation of imatinib mesylate form h1 . a mixture of imatinib mesylate and a chlorinated solvent is stirred for about 10 hours to 48 hours and imatinib mesylate form h1 is isolated . examples of chlorinated solvents are chloroform , methylene dichloride , ethylene dichloride and a mixture thereof . preferable solvents are chloroform and methylene dichloride . imatinib mesylate in a previously known crystalline or amorphous form may be used in the process . imatinib mesylate hydrate obtained by the process described below may also be used . particularly ฮฑ - form , ฮฒ - form or amorphous imatinib mesylate may be used . preferably , the mixture of imatinib mesylate and a chlorinated solvent is stirred between about 5 ยฐ c . to reflux temperature , more preferably between room temperature to reflux temperature , for about 24 hours to 48 hours . then imatinib mesylate form h1 is collected by filtration or centrifugation . in accordance with the present invention , there is provided a novel hydrate of imatinib mesylate . the water content of the hydrate of imatinib mesylate is between 2 . 0 to 3 . 2 % by weight of hydrate of imatinib mesylate , typically between 2 . 2 to 2 . 9 % by weight of hydrate of imatinib mesylate . the amorphous form of imatinib mesylate hydrate , designated as amorphous imatinib mesylate hydrate , is characterized by having broad x - ray diffraction spectrum as in fig2 . in accordance with the present invention , a process is provided for preparation of imatinib mesylate hydrate . imatinib mesylate hydrate is prepared by dissolving imatinib mesylate in a mixture of a suitable solvent and water and removing the solvents from the solution . imatinib mesylate in a crystalline or amorphous form may be used in the process . particularly ฮฑ - form , ฮฒ - form or amorphous imatinib mesylate may be used . the suitable solvent is selected from the group consisting of alcohols , e . g ., methanol , ethanol , isopropyl alcohol ; ketones , e . g ., acetone ; acetonitrile ; and a mixture thereof . the solvent may be removed from the solution by vacuum drying or spray drying to give amorphous imatinib mesylate hydrate . the drying time and the drying temperature depend on the solvent used in the process . for example if the solvent is methanol , the solvent and water can be removed at about 50 ยฐ c . for about 9 hours . imatinib free base and imatinib mesylate obtained by the previously known methods may be used in the above processes . in accordance with the present invention , there is provided a pharmaceutical composition comprising imatinib mesylate form h1 and a pharmaceutically acceptable carrier or diluent . in accordance with the present invention , there is provided a pharmaceutical composition comprising imatinib mesylate hydrate and a pharmaceutically acceptable carrier or diluent . amorphous imatinib mesylate hydrate may also be used in the composition . fig1 is a x - ray powder diffraction spectrum of imatinib mesylate form h1 . fig2 is a x - ray powder diffraction spectrum of amorphous imatinib mesylate hydrate . x - ray powder diffraction spectrum was measured on a bruker axs d8 advance x - ray powder diffractometer having a copper - kฮฑ radiation . the invention will now be further described by the following examples , which are illustrative rather than limiting . imatinib free base ( 5 . 0 gm ) is dissolved in chloroform ( 50 ml ) at room temperature and then methanesulfonic acid ( 0 . 75 ml ) is added . the contents are stirred for 5 hours at room temperature and separated crystals are filtered and dried to give 5 . 0 gm of imatinib mesylate form h1 . the mixture of imatinib mesylate ( ฮฑ - form , 5 . 0 gm ) and chloroform ( 150 ml ) is heated to 50 ยฐ c . and stirred for 36 hours at this temperature . then the contents are cooled to 25 ยฐ c ., maintained for 5 hours at room temperature and filtered and dried to give 4 . 5 gm of imatinib mesylate form h1 . the mixture of imatinib mesylate ( ฮฒ - form , 5 . 0 gm ) and chloroform ( 150 ml ) is heated to 50 ยฐ c . and stirred for 36 hours at this temperature . then the contents are cooled to 25 ยฐ c ., maintained for 5 hours at room temperature and filtered and dried to give 4 . 3 gm of imatinib mesylate form h1 . imatinib free base ( 5 . 0 gm ) is dissolved in methylene dichloride ( 50 ml ) at room temperature and then methanesulfonic acid ( 0 . 75 ml ) is added . the contents are stirred for 5 hours at room temperature and filtered and dried to give 4 . 9 gm of imatinib mesylate form h1 . the mixture of imatinib mesylate ( 5 . 0 gm ) and methylene dichloride ( 150 ml ) is heated to 50 ยฐ c . and stirred for 5 hours at this temperature . then the contents are cooled to 25 ยฐ c ., maintained for 25 hours at room temperature and filtered to give 4 . 6 gm of imatinib mesylate form h1 imatinib mesylate form h1 ( 3 . 5 gm ) is dissolved in a mixture of methanol ( 25 ml ) and water ( 5 . 0 ml ) at room temperature . the solution is subjected to vacuum drying at about 50 ยฐ c . for 9 hours to give 3 . 0 gm of amorphous imatinib mesylate hydrate . example 6 is carried out using imatinib mesylate ( ฮฑ - form ) instead of imatinib mesylate form h1 to give imatinib mesylate hydrate . example 6 is carried out by subjecting the solution to spray drying instead of vacuum drying to give amorphous imatinib mesylate hydrate .
| 2 |
referring now more specifically to the drawings and to fig1 in particular , a device or body 10 is shown having a surface configuration 12 ( fig2 and 3 ) of the present invention . surface configuration 12 includes a plurality of formations 14 closely packed on body 10 . only some formations 14 and the components thereof to be described hereinafter and not all formations 14 or the components thereof are labeled in fig1 , for purposes of clarity . body 10 can be made of a variety of materials , including plastics for which the present invention is applied easily . in plastic articles , surface configurations 14 can be formed during molding of an article or thing made of the plastic , such as a buckle for a strap , a frame piece of a backpack , plastic components of weapons or tools or other articles manufactured by any of various molding processes . a mold for the plastic article can be shaped to include surface formations 14 in forms to be described hereinafter . in such devices and things , surface configuration 12 becomes an integral feature of the outer surface of the device or thing , or the part thereof including body 10 , as shown in fig3 . alternatively , as seen best in fig2 , surface configuration 12 can be formed on one face of a relatively thin , discrete body 10 . thereafter , adhesive 16 can be used in a layer on an opposite face of body 10 to attach body 10 to another article . in this way , the present invention can be used not only as a surface on newly manufactured devices by molding it into the surface , the present invention also can be added or applied on surfaces of other things , which may or may not be made of plastic . articles made of other materials can be rendered less visible to night vision devices by adhering a body 10 to the existing article or thing , the body 10 having surface configuration 12 on one face thereof further , panels of body 10 with surface configuration 12 can be placed so as to hide other things behind the panels . surface configuration 12 includes closely adjacent , three - dimensional formations 14 defining an inner surface 18 and an outer surface 20 . advantageously , inner surface 18 and outer surface 20 are spaced from each other by a significant distance , preferably by as much as available space and other design constraints allow in body 10 . individual formations 14 preferably are smaller rather than larger , and are more tightly arranged rather than more loosely arranged , for more thoroughly disrupting the reflected light from the object . formations 14 are configured and arranged to provide outer surface 20 with a small surface area relative to the size of body 10 . each formation 14 includes a nested arrangement of an outer wall 22 and inner projection 24 . the combination of nested features provides inconsistent reflectivity of light , reducing the clarity and distinctness by which the surface is detected with night vision devices . in a preferred form , outer wall 22 is formed as a plurality of panels 26 between inner surface 18 and outer surface 20 . panels 26 define a laterally closed cell that is open at outer surface 20 . preferably , six panels 26 are provided to define hexagonal cells that can be tightly packed adjacent each other . each panel 26 is wider at outer surface 20 than at inner surface 18 so that the exposed surface thereof angles inwardly in the cell defined thereby . inner projection 24 extends outwardly from inner surface 18 and has a distal end 28 . projection 24 preferably is shorter than outer wall 22 , and distal end 28 is located between inner surface 18 and outer surface 20 . an advantageous form of inner projection 24 , particularly useful with hexagonally shaped wall 22 , is configured with a plurality of flat surfaces 30 , preferably six flat surfaces 30 . projection 24 is wider at inner surface 18 than at distal end 28 , tapering smoothly from inner surface 18 to distal end 28 . hexagonally shaped walls 22 and six - sided projections 24 are one preferred arrangement of surface configuration 12 ; however , other arrangements also can be used . for example , instead of being made of flat segments , wall 22 can be continuously curved . fig4 illustrates an embodiment of the present invention in which a continuously curved wall 32 is round , and a projection 34 arranged therein is a frustum or truncated cone . in a preferred form , curved wall 32 is of greater diameter at outer surface 20 than at inner surface 18 . other geometric arrangements are also believed to be suitable , if sufficiently closely arranged on the article or thing . to be suitable , the geometric arrangement includes surfaces arranged at various angles to provide inconsistent angles of incidence and reflection with respect to a light source shinning on the object . with each formation being relatively small , and with all formations being closely and compactly arranged , large expanses forming areas of consistent reflectivity are minimized , and the surface is less detectable to a variety of vision enhancing devices . in the preferred embodiments shown and described herein , a projection 24 or 34 is shown within each wall 22 or 32 . in some uses of the invention , it may be suitable to provide random or patterned arrangements in which not all walls 22 or 32 have a projection 24 or 34 contained there within . further , combinations may be used in which a continuously curved wall 32 has a flat sided projection 24 therein , or a wall 22 made of flat panels 26 has a frustoconical or other curved projection 34 therein . the present invention can be combined with other light controlling features . for example , when used on plastic components , resin compounds can be formulated to include light absorbing and / or light - reflecting dyes . features such as these can be used to reduce visibility of an object within the range of between about 300 and 3000 nanometer wavelength , and preferably in the range of about 600 to 2000 nanometers . a suitable dye for a variety of applications is shepard 473 or 474 available from the shepard color company , 4539 dues drive , cincinnati ohio 45246 . surface configurations 12 of the present invention can be used with a variety of materials for a variety of purposes , especially when device or body 10 is a discrete body configured to attachment to another structure . the material from which surface configuration 12 is formed can be relatively rigid and plate - like , or the material can have flexibility to conform to an irregularly shaped article upon which it is applied . the material can be bi - axially stretchable or uni - axially stretchable , as required for a specific application . for example , material having a surface configuration of the present invention can be applied as cushioning on the inside of vehicles , to provide padding for occupants in addition to reduced visual detectability and improved sound muffling . the cell structure can deflect or crush slightly when impacted , thereby also functioning as a cushion or padding for people and objects . in one suitable use of the present invention , thermo setting urethanes such as isocyanate urethanes are used . materials of different durometer can be used , depending on the need for softness or stiffness of the material . a suitable material for a variety of applications is poly 33925 available from bayone urethane systems , llc ., 2700 papin street , st . louis , mo . 63103 . the material can be made more or less flexible or more or less rigid by the addition or removal of various additives . again , by way of example , fillers or reinforcing material can be added , such as glass fibers , fabric fibers , mineral fillers or nanoparticles . in a preferred configuration , the overall thickness of body 12 , as indicated by the dimensional line 40 in fig2 , is about 0 . 0080 inch . the depth of each cell formed therein , between inner surface 18 and outer surface 20 , as indicated by the dimensional line 42 in fig2 , is approximately 0 . 0060 inch . thus , the material remaining at the bottom of each cell , as indicated by the dimensional line 44 in fig2 , has a thickness of about 0 . 0020 inch in general , preferred cell sizes are small at the outer surface , and relatively deep in comparison to the surface opening . cells are closely packed , with minimal regions of material disposed along the outer surface between cells . it is preferred that ridge areas 46 between cells have a width , as indicated by the dimensional line 48 in fig2 , of between about 0 . 001 and 0 . 050 inch , and more preferably less than about 0 . 002 inch . as a result , the exposed area of the outer surface is kept small . the three dimensional shape and openness of the cells provides a cushioning effect that creates sound muffling when an object having the material thereon is contacted by another object or thing . thus , normal use of equipment having the present surface configuration generates less noise than otherwise would be created . the cushioning effect can be increased by reducing the rigidity of the material , such as by using fewer fiber additives or other reinforcing techniques . however , because of the open cell structure , even relatively rigid embodiments of the present invention provide significant sound muffling . adhesives used for attaching sheets of material having the surface configuration of the present invention can be of a variety of types . acrylic - based as well as urethane based adhesives of different tackiness have been used advantageously . chemical resistivity can be built into the material and / or adhesives used so that the material and adhesive are resistive to petrochemical and hydrocarbon degradation . a suitable adhesive for a variety of applications is hs00463 - b available from coating and converting technologies , 80 east morris street , philadelphia , pa . 19148 . the pitted or open cell outer surface area further provides an improved gripping surface so that items such as weapons or other equipment are more easily grasped and held . graspability can be further improved by forming the surface configuration of the present invention from a material such as thermoset urethanes that have a tactile or grip enhancing surface . variations and modifications of the foregoing are within the scope of the present invention it is understood that the invention disclosed and defined herein extends to all alternative combinations of two or more of the individual features mentioned or evident from the text and / or drawings . all of these different combinations constitute various alternative aspects of the present invention . the embodiments described herein explain the best modes known for practicing the invention and will enable others skilled in the art to utilize the invention . the claims are to be construed to include alternative embodiments to the extent permitted by the prior art . various features of the invention are set forth in the following claims .
| 5 |
specific embodiments of the lip applicator disclosed herein will now be described in detail with reference to the foregoing figures , wherein like reference numerals identify similar or identical elements . in the drawings , and in the description which follows , the term โ beauty aid โ may refer to a lipstick , a lip gloss , or any such product that may be topically applied to one &# 39 ; s lips . in addition , the term โ user โ may refer either to the person to whom the beauty aid is applied , or to the person handling the lip applicator and applying a beauty aid to the lips of another . finally , the terms โ proximal โ and โ distal โ will be understood as referring to those portions of the lip applicator that are closest to , and furthest from , respectively , the applying portion , as defined below . referring now to the drawings , fig1 generally illustrates a lip applicator 10 for applying a beauty aid 12 to one &# 39 ; s lips ( see also fig1 ). lip applicator 10 includes a generally lip - shaped applying portion 14 , which is configured to retain beauty aid 12 thereon , a stem portion 16 that extends distally from and supports the applying portion 14 , and a base portion 18 that is configured to support the lip applicator 10 in an upward , or free - standing orientation , as seen in fig1 , if so desired . in each embodiment of the present disclosure described herein , a variety of configurations and sizes are contemplated for applying portion 14 , such that lip applicator 10 may be compatible with a greater multitude of user &# 39 ; s . base portion 18 may be configured to facilitate handling and may include various contours , scallops , protuberances and / or gripping surfaces to enhance a user &# 39 ; s grip thereof . the base portion 18 includes a bottom surface 20 which is configured and dimensioned to stabilize the lip applicator 10 atop a table or other surface 22 when not in use . bottom surface 20 may be configured and dimensioned in any suitable manner that facilitates the stabilization of lip applicator 10 . configurations for bottom surface 20 may include , but are not limited to , a flat surface , a concave surface , a surface including independent support legs , or a surface that includes an adhesive mechanism , e . g ., a suction - cup , as would be appreciated by one of ordinary skill in the art . as depicted in fig1 , bottom surface 20 is flat and rectilinear in shape , but a base portion 18 having another geometric configuration , or an ornamental shape , is not beyond the scope of the present disclosure . bottom surface 20 may also be textured , or may include a plastic , rubberized , or any other suitable surface that may enhance the stability and / or handling of lip applicator 10 . referring still to fig1 , applying portion 14 is generally โ lip - shaped โ. this configuration allows for the even and facile application of a beauty aid 12 to one &# 39 ; s lips . the present disclosure contemplates that applying portion 14 may be integrally formed with stem portion 16 through any suitable method or mechanism including , but not being limited to , screws , adhesives , or monolithic formation therewith . it is further contemplated that applying portion 14 may be releasably connected to stem portion 16 , again through any suitable method , including , but not limited to , a snap - fit arrangement or interference fitting , such that applying portion 14 may be selectively engagable therewith , or replaceable . in one embodiment , as seen in fig2 , lip applicator 100 includes an applying portion 114 , a stem portion 116 , and a base portion 118 . it is contemplated that applying portion 114 and base portion 118 may each be releasably or integrally connected to stem portion 116 . stem portion 116 includes a first portion 116 a configured and dimensioned to be selectively movable with respect to a second portion 116 b . first and second stem portions 116 a , 116 b may allow for continuous or incremental movement with respect to one another such that applying portion 114 may be adjusted relative to base portion 118 during or prior to use . first and second stem portions 116 a , 116 b may be configured and dimensioned in any manner such that one of the first and second stem portions 116 a , 116 b is movable in relation to , and may be received by , the other , e . g . telescopically . in the embodiment depicted in fig2 , first stem portion 116 a is telescopically moveable in the direction indicated by arrow โ a โ within lower stem portion 116 b , such that lip applicator 100 is selectively extendable . in an alternate embodiment , it is contemplated that second stem portion 116 b may be received by , and may be movable within , first stem portion 116 a , again enabling the selective extension of the lip applicator 100 . in another embodiment , as seen in fig3 , lip applicator 200 includes an applying portion 214 , a stem portion 216 and a base portion 218 that defines a cavity 224 therein which is dimensioned to releasably retain a beauty aid 212 . beauty aid 212 may be releasably engageable with base portion 218 through any suitable mechanism or structure including , but not limited to , snap - fit or interference fit arrangements , to allow for the selective removal , replacement , and / or substitution of various beauty aids , or beauty aid 212 may be integrally associated with , or formed within , base portion 218 such that beauty aid 212 may not be replaced , substituted , or removed therefrom . referring now to fig4 a - 4b , a lip applicator 300 is disclosed that includes an applying portion 314 , a stem portion 316 , and a base portion 318 rotatably connected to the stem portion 316 through any suitable mechanism or structural adaptation , such that lip applicator 300 may be selectively transitioned or moved from a first position to a second position . in the first position , seen in fig4 a , beauty aid 312 is disposed within cavity 324 , whereas in the second position , seen in fig4 b , beauty aid 312 at least partially extends therefrom . to move lip applicator 300 from the first position to the second position , and thereby selectively extend beauty aid 312 from cavity 324 , either base portion 318 , or stem portion 316 , may be rotated . to move lip applicator 300 from the second position to the first position , and thereby selectively retract beauty aid 312 , again , either base portion 318 , or stem portion 316 , may be rotated . in transitioning from the first position to the second position , or from the second position to the first position , base portion 318 , or stem portion 316 , may be rotated either clockwise , in the direction of arrow โ b โ, or counterclockwise , in the direction of arrow โ c โ. in the embodiments shown in fig3 and 4 a - 4 b , it is contemplated that the configuration and dimensions of the cavity may be varied such that base portion may accommodate a variety of beauty aids . in addition , with respect to each embodiment discussed heretofore , it is contemplated that the lip applicator may employ a plurality of cavities , each of which may vary in size and / or configuration , thereby allowing for the incorporation of a multitude of beauty aids . it is further contemplated , in each embodiment described thus far , that the stem portion may include two or more sections configured and dimensioned to be respectively movable with respect to each other , e . g ., telescopically , as disclosed in the embodiment depicted in fig2 . in fig5 a - 5b , a lip applicator 400 is disclosed that includes an applying portion 414 , a stem portion 416 , and a base portion 418 . lip applicator 400 further includes a release mechanism 426 and a cavity 424 defined in base portion 418 that is configured and dimensioned to removably receive stem portion 416 and applying portion 414 , as will be discussed in further detail below . applying portion 414 is movably secured to stem portion 416 , e . g . rotatably or pivotably secured , such that applying portion 414 and stem portion 416 are selectively movable in relation to one another , either in the direction of arrow โ d โ or arrow โ e โ, from a first position , seen in fig5 a , to a second position , seen in fig5 b . in the first or applying position , seen in fig5 a , lip applicator 400 defines a first height h 1 , and applying portion 414 is substantially horizontal in orientation , thereby facilitating the application of beauty aid 412 by a user . if desired , applying portion 414 may be rotated and moved into the second position , in which applying portion 414 is substantially vertical in orientation and at least a portion thereof is removably disposed within cavity 424 , together with at least a portion of stem portion 416 , as seen in fig5 b . in the second position , lip applying portion 414 may be substantially protected from the ambient , thereby remaining free of dust , particulates , or the like during non - use . in the second position , the overall height h 2 of lip applicator 400 is substantially reduced when compared to that of lip applicator 400 in the first position . this reduction in height may facilitate the convenient storage or transport of the lip applicator 400 , if so desired . it is contemplated that stem portion 416 may include two or more sections that may be configured and dimensioned to move with respect to one another in any suitable manner such that one of the portions may be movable in relation to , and may be received by , the other portion , e . g . telescopically , as depicted in the embodiment of fig2 . referring still to fig5 a - 5b , as discussed above , lip applicator 400 includes release 426 . release 426 maintains lip applicator 400 in either the first position , or the second position , until it is desired by the user to move therebetween . at such time , the user may actuate release 426 and configure the lip applicator 400 either for storage , or for use . release 426 may be any mechanical mechanism suitable for the intended purpose of preventing the unintentional transitioning between the first and second positions , illustrative examples of which include , but are not limited to , a depressible button , a rotatable knob , or a slidable button set within a track 428 , as seen in fig5 a - 5b . fig6 a - 6b illustrate a lip applicator 500 having an applying portion 514 with two individual portions 514 a , 514 b and a hinge portion 530 , a stem portion 416 , and a base portion 418 . lip applicator 500 functions in a manner identical to that disclosed with respect to the previous embodiments depicted in fig5 a - 5b , in that lip applicator 500 is adapted to transition from a first , applying position , to a second storage position in which lip applying portion 514 and stem portion 516 are at least partially disposed within and removable from a cavity 524 in base portion 518 . portions 514 a and 514 b are selectively foldable in the direction of arrow โ g โ relative to one another about hinge portion 530 , such that the dimensions of applying portion 514 may be substantially reduced , thereby facilitating the storage thereof in base portion 518 while in the second position . in one aspect of the present disclosure , applying portion 514 may be manually folded about hinge portion 530 at the will of the user , whereas in another aspect , applying portion 514 may only be folded upon the actuation of release 526 . release 526 , therefore , may serve dual purposes . first , release 526 may facilitate the folding of applying portion 514 about hinge portion 530 . and second , release 526 may facilitate the movement or transition of lip applicator 500 from the first position , seen in fig6 a , to the second position , seen in fig6 b , or from the second position to the first position , as discussed above . in a further aspect of the present disclosure , lip applicator 500 may employ multiple , independent release mechanisms ( not shown ), one to permit the folding and / or the unfolding of the applying portion 514 about a hinge portion 530 , and a second to permit the transition of the lip applicator from the first position to the second position . with respect to the folding and unfolding of the applying portion , the release , or releases , employed may be any mechanism or structural adaptation suitable for preventing against the inadvertent folding or unfolding of the applying portion . with respect to the embodiments of fig5 a - 6b , the base portion may be configured and dimensioned to retain a beauty aid therein , either integrally or selectively , as disclosed in the embodiments of fig2 - 4b . it is also contemplated that the dimensions of the cavity may be varied such that base portion may accommodate a variety of beauty aids . in addition , the lip applicator may employ a plurality of cavities , each of which may vary in size and / or configuration , thereby allowing for the incorporation of additional beauty aids . it is also contemplated that the stem portion may include two or more sections that may be configured and dimensioned to move with respect to one another in any suitable manner such that one section may be movable in relation to , and may be received by , the other section , e . g . telescopically , as disclosed in the embodiment of fig2 . referring now to fig7 a , lip applicator 600 includes an applying portion 614 with an aperture 638 , a stem portion 616 having a conduit 632 defining proximal and distal ends 634 , 636 disposed therein , and a base portion 618 . base portion 618 is configured and dimensioned to retain a beauty aid 612 therein , and is formed , either in whole or in part , of any resilient or semi - resilient material capable of transitioning from a first , initial position ( not shown ) to a second , deformed position ( not shown ), upon the application of a force โ f โ thereto , as may be appreciated by one of ordinary skill in the art . force โ f โ may be generated by squeezing base portion 618 , or in any other suitable manner , including , but not being limited to , twisting . in the first position , base portion 618 is not subject to any external force . accordingly , in this position , beauty aid 612 remains within the base portion 618 . however , upon the application of force โ f โ thereto , the walls 640 of base portion 618 may begin to deform inwardly , thereby decreasing the volume of base portion 618 , as would be appreciated by one of ordinary skill in the art , such that the beauty aid 612 may be forced outwardly therefrom . conduit 632 is in fluid communication with base portion 618 such that beauty aid 612 may enter conduit 632 through the distal end 636 thereof upon expulsion from base portion 618 , subsequently being communicated therethrough , and exiting onto applying portion 614 through proximal end 634 and aperture 638 . it is contemplated herein that base portion 618 may be rotatably secured to stem portion 616 such that the force โ f โ required to deform the base portion 618 , and expel beauty aid 612 therefrom , may be generated through the rotation , or twisting , of base portion 618 . base portion 618 may be selectively engageable with stem portion 616 through any suitable mechanism or arrangement , including , but not limited to , screw - type or snap - fit arrangements , such that base portion 618 and the beauty aid 612 retained therein , may be replaced when necessary or desired . alternatively , base portion 618 may be integrally formed with stem portion 616 such that the lip applicator 600 may be considered disposable . referring now to fig7 b , lip applicator 700 includes an applying portion 714 , a stem portion 716 , and a base portion 718 having a bladder 742 disposed therein and secured thereto through any suitable means , including , but not being limited to , adhesives . base portion 718 and bladder 742 may be formed , either in whole or in part , of any resilient or semi - resilient material capable of transitioning from a first , initial position ( not shown ) to a second , deformed position ( not shown ) upon the application of a force โ f โ thereto , again generated in any suitable manner . conduit 732 is in fluid communication with bladder 742 such that a beauty aid 712 , retained therein , may enter conduit 732 through a distal end 736 thereof upon being expelled from bladder 742 , as discussed above with respect to the disclosure in fig7 a . subsequently , beauty aid 712 may be communicated through conduit 732 , and the proximal end 734 thereof , onto applying portion 714 through an aperture 738 . in one embodiment , base portion 718 may be rotatably secured to stem portion 716 such that the force โ f โ required to deform bladder 742 and expel beauty aid 712 therefrom may be generated through the rotation of base portion 718 . in this embodiment , the force โ f โ created through the rotation of base portion 718 is transmitted to bladder 742 through the connection therebetween . base portion 718 , and therefore bladder 742 , may be selectively engagable with stem portion 716 through any suitable mechanism or arrangement , including , but not limited to , screw - type or snap - fit arrangements , such that base portion 718 , bladder 742 , and the beauty aid 712 retained therein , may be replaced when necessary or desired . it is further contemplated that base portion 718 may be integrally formed with stem portion 716 such that lip applicator 700 may be considered disposable . in one embodiment , as seen in fig8 , lip applicator 800 is disclosed which includes an applying portion 814 , a stem portion 816 , and a base portion 818 that defines a recess 844 therein configured and dimensioned to releasably retain at least one cleaning sheet 846 , e . g ., a tissue or an anti - bacterial wipe , for selective distribution . base portion 818 may be selectively engagable with stem portion 816 such that base portion 818 , and the cleaning sheets 846 retained therein , may be replaced when necessary . it is further contemplated that base portion 818 may be integrally formed with stem portion 816 such that lip applicator 800 may be considered disposable . in another embodiment , as seen in fig9 , a lip applicator 900 is disclosed that includes an applying portion 914 , a stem portion 916 , and a base portion 918 including at least one reflective surface 948 . reflective surface 948 may be disposed on any suitable surface of base portion 918 , including , but not limited to , any face 950 , or the bottom surface 952 . reflective surface 948 may also be disposed in any other suitable location , including , but not being limited to applying portion 914 . it is further envisioned that base portion 918 itself be formed , in whole or in part , of a reflective material , thereby obviating the need for an additional reflective element . referring now to fig1 , a lip applicator 1000 is illustrated . as illustrated , base portion 1018 and / or stem portion 1016 may be grasped by the user . applying portion 1014 may then be raised and pressed to the user &# 39 ; s lips , either by the user , or by another party , as shown . applying portion 1014 is then pressed against the user &# 39 ; s lips until such time that the desired beauty aid ( not shown ) is sufficiently applied thereto . fig1 discloses yet another embodiment of the present disclosure . lip applicator 1100 is generally similar to lip applicator 10 shown in fig1 and includes applying portion 1114 , stem portion 1116 , and base portion 1118 . applicator 1100 further includes an applicator surface 1154 configured to releasably retain an applicator sponge 1156 . applicator sponge 1156 has a general configuration mimicking that of applicator surface 1154 . applicator sponges of various shapes and sizes , in particular , but not limited to , small , medium , and large sponges 1156 a , 1156 b , 1156 c may be used in conjunction with lip applicator 1100 dependent upon the labial characteristics of the person to whom a beauty aid ( not shown ) need be applied . in preparation for use , the user orients applicator sponge 1156 with respect to applicator surface 1154 and applies a force thereto in the direction of arrow โ h โ. applicator sponge 1156 may include an adhesive substrate ( not shown ) disposed on any suitable surface thereof , including , but not being limited to , underside 1158 , which may releasably adhere to applicator surface 1154 . applicator sponge 1156 may also include a peel - away liner ( not shown ) to protect the adhesive substrate ( not shown ) prior to use . any adhesive substrate may be employed , including water or liquid - activated adhesives . alternatively , applicator surface 1154 may include an adhesive - like substance ( not shown ) which adheres to applicator sponge 1156 when placed upon applicator surface 1154 . a reusable or tacky substance may be utilized to accomplish this purpose . as best shown in fig1 a and 12b , a plurality of applicator sponges 1156 a - 1156 c , that may vary in size , may be arranged on sheet 1160 and sold as a package . sheet 1160 may be made from a releasable film ( e . g ., wax - like paper ) that allows a user to simply peel - away one or more sponges 1156 a - 1156 c for use . sheet 1160 may also simply be a support structure , e . g ., cardboard , for selling a large number of sponges in a single package . after use , the user simply peels applicator sponge 1156 from surface 1154 and discards the sponge 1156 . the present disclosure contemplates that a beauty aid ( not shown ) may be pre - applied to applicator sponges 1156 . to preserve the integrity of the beauty aid ( not shown ) prior to application , the beauty aid may by disposed beneath and protected by a peel - away film ( not shown ), or the like , as would be appreciated by one of ordinary skill in the art . following the orientation of sponge 1156 atop applicator surface 1154 , as describe above , the user may simply remove the protective film ( not shown ), and thereby expose the beauty aid ( not shown ). from the foregoing and with reference to the various figure drawings , those skilled in the art will appreciate that certain modifications can also be made to the present disclosure without departing from the scope of the same . while several embodiments of the disclosure have been shown in the drawings , it is not intended that the disclosure be limited thereto , as it is intended that the disclosure be as broad in scope as the art will allow and that the specification be read likewise . therefore , the above description should not be construed as limiting , but merely as exemplifications of particular embodiments . those skilled in the art will envision other modifications within the scope and spirit of the claims to be appended hereto .
| 0 |
as shown in fig1 a tangential blower consists of deflector 1 , side members 2 , impeller 3 and vortex former 4 . when the impeller 3 is rotated by a motor , in the direction indicated by the arrow 5 , then air is sucked - in from the space above the vortex former and blown out of the pressure space below the vortex former 4 in the direction as indicated by the arrow 6 . from the cross sectional view of the tangential blower as shown in fig2 the deflector 1 can be very clearly recognized . the impeller is supposed to have the diameter d . fig3 shows the invention and the mode of operation thereof . the impeller 3 as rotated in the direction as indicated by the arrow 5 , effects in the space c above the vortex former 4 as suction flow . within the impeller 3 there exists the vortex flow 7 with the vortex center 8 , and below the vortex former 4 , in the space a , the flow is on the pressure side . as can be seen from fig3 the blades of the impeller on their way from space a to space c , pass through the space b in which there exists a highly turbulent flow . this highly turbulent flow is caused by the interfering body 9 on the vortex former 4 . this has the consequence , that the blade does not abruptly change from the pressure into the suction zone , but that the change over is effected gradually . within the space b there may be effected a certain equalization of pressure between a and c . the highly turbulent flow within the space b is produced at a sharp edge of the interfering body 9 at which the flow starts to break off . as is apparent from the drawings , the interfering body 9 is non - rotatably fixed to the vortex former 4 . the interfering body 9 may be a ridge punched out of the vortex former 4 and which , either continuously or in sections , extends over the entire length of the vortex former 4 . it is not absolutely necessary for the interfering body 9 to have the same length as the vortex former , but it should at least have a length corresponding to half the length of the vortex former . if the interfering body is shorter than the vortex former it may be located symmetrically with respect to the center line of the vortex former . instead of being punched out , the interfering body may also be placed on the vortex former . fig4 to 6 show three different types of embodiments of the interfering body 9 . in the embodiment as shown in fig4 the interfering body 9 is a ridge which is inclined ( tilted ) in the direction of the direction of rotation of the impeller ( arrow 5 ). in the embodiment as shown in fig5 the ridge is inclined ( tilted ) in opposition to the direction of rotation of the impeller , and in the type of embodiment in fig6 the ridge is placed at a right angle in relation to the surface of the vortex former . the spacing a between the ends of the ridges and the surface of the vortex former should amount from 0 . 01 to 0 . 08 times the impeller diameter d . comparison measurements carried out on embodiments whose impeller had twenty blades and which were operated at rotational speeds ranging between 1 , 800 and 2 , 000 revolutions per minute , have proved that with the tangential blower whose vortex former was provided with the interfering body , the peak frequencies were very strongly reduced within the range from 600 to 700 hz .
| 8 |
the following detailed description is the best currently contemplated modes for carrying out the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention . referring to fig1 a drilling rig 10 may include a transport vehicle 12 with drilling fluid equipment 14 , power source 16 and drilling machine 20 installed thereon . the drilling machine 20 may have rotation support 22 supporting pipe container 24 that may be rotated about axis 26 by power source 16 . a drill pipe 60 may be contained in and extend from the pipe container 24 through aperture 28 . while pipe may be used as a general descriptor , it will be understood by those skilled in the art that this may include flexible drill pipe , tubing and the like . a drill pipe drive mechanism 40 may be positioned rearward of aperture 28 . drill pipe 60 may be moved through the drive mechanism 40 in a forward or rearward direction . as the drill pipe 60 is moved through the drive mechanism 40 in a rearward direction the drill pipe 60 may be routed through a conduit 80 to guide it to drill in for example a horizontal direction in the earth 100 . as drilling progresses drill pipe 80 may be supplied from pipe container 24 . the conduit 80 may be attached rearward of the drive mechanism 40 and positioned to have a drilling end 82 located in a trench 122 , hole or other prepared entry opening for horizontal drilling in the earth 120 . the conduit 80 may also have a rotation connector 84 that may be attached to the vehicle 12 to aid in initial guiding of the drill pipe 60 and drill bit 110 . while a generally horizontal rotation connector 84 is illustrated , other connection joints may be used as for example a three dimensional universal rotation connector ( not shown ). also , the drilling end 82 of the conduit 80 may have other directional orientations than the illustrated generally horizontal drilling direction . the drill bit 110 may be a directional drill bit with a slanted or spade front surface element to aid in changing direction when drilling in the earth . when the drill pipe 60 is not rotating the drill bit 110 may be urged forward using drilling fluid and drive mechanism 40 . the slanted front surface of the drill bit 110 may cause the drill bit 110 to move away from the previous boring axis . when the drill pipe 60 is rotating the drill bit 110 may tend to bore in a straight line axis . also , a mud motor apparatus may be used for applying rotational torque to a drill bit by hydraulic action . the pumping of drilling fluid through the tubing 92 causes rotation of the drill bit without rotating the drill string or tubing 92 . the tubing 92 may be rotated for directional steering , see fig1 . a mud motor has a slight bend in it that may cause turning as the drill bit progresses through the earth . referring to fig2 through 4 , a drill pipe 60 may have an inner conduit 62 for flow of fluid , such as , drilling mud , under pressure to aid in drill bit 80 cutting as such cutting is understood in the art . a wire coil 64 may be located coaxially around the inner conduit 62 . the wire coil 64 may have coil elements 66 oriented at an angle other than orthogonal to the drill pipe axis 68 . as illustrated in fig2 the coil elements 66 are oriented at an approximate 70 degree angle from the drill pipe axis 68 . a second wire coil 70 may be located coaxially around the wire coil 64 . the second wire coil 70 may have second coil elements 72 oriented at an angle other than orthogonal to the drill pipe axis 68 . as illustrated in fig2 the second coil elements 72 are oriented at an approximate 110 degree angle from the drill pipe axis 68 as measured in the same angular rotation as coil elements 66 . wire 74 , flexible metal rods or the like may be positioned intermediate the wire coil 64 and second wire coil 70 that may provide additional longitudinal support for drill pipe 60 . the wire coils 62 , 70 and the wire 74 may be attached along the longitudinal length by for example welding or other appropriate attachment methods . the drill pipe elements 62 , 66 , 70 , 74 may be fastened in a coupling 76 at each end thereof . the couplings 76 may be used for attachment of a drill bit , for attachment to a pipe container and for attachment to the output of a drilling fluid equipment system . the couplings 76 may also be used to connect two sections of drill pipe as illustrated in fig4 . referring to fig5 through 7 , a drill pipe drive mechanism 40 may have a pair of rotating gear mechanisms 42 that engage and drive a pair of continuous loop chains 44 . drive blocks 46 may be attached at sides 48 , 50 thereof between chains 44 . the drive blocks 46 may have a pipe trough 52 with ridges 54 for engaging the coil elements or second coil elements of a drill pipe 60 to be moved through the drive mechanism 40 . the drill pipe 60 may be supported for movement through the drive mechanism 40 by a guide trough 56 positioned opposite the path of the drive blocks 46 . in operation , when the gear mechanism 42 is rotated to move chains 44 and drive blocks 46 , the drill pipe 60 may be moved through the drive mechanism 40 by engagement of the ridges 54 in drill pipe 60 . when the pipe container 24 is rotated , as for example , to rotate the drill pipe 60 and drill bit 90 to cut into the earth , the movement of the drive mechanism 40 may be synchronized with the rotation of the pipe container 24 to inhibit retraction of the drill pipe 60 into the pipe container 24 . the drive mechanism 40 may also be operated at a speed during any such rotation motion to urge the drill pipe 60 and drill bit 90 forward into the earth to advance the bore hole formation . when desired , the drive mechanism 40 may be operated to retract the drill pipe 60 . referring to fig8 a drill pipe drive mechanism 40 may have a rotating gear mechanism 58 to move the drill pipe 60 therethrough . the gear elements 59 may have gear teeth ( not shown ) that engage the coil elements of the drill pipe 60 . movement and synchronization would be similar to that described above . while the invention has been shown and described using a drill pipe 60 having one or more wire coils , other flexible drilling pipe or tubing may be used . referring to fig9 a conventional drilling machine 20 has a reel 90 on which coiled steel tubing 92 may be wound as commonly understood by those skilled in the art . the tubing 92 is routed through a tube guide 94 that may be supported by a tube guide support 96 attached to the reel axis 98 . as the tubing 92 is unwound it may be guided through and moved by an injector unit 100 for drilling into the earth . the tubing 92 may have a hydraulic or jet spray drill bit 110 attached thereto . coiled steel tubing 92 may also be used in the drilling machine 20 illustrated in fig1 . the drive mechanism 40 may be modified to facilitate movement of the tubing 92 in a rearward and forward direction by use of an injector unit 100 or a variation thereof . referring to fig1 and 11 , the drive mechanism 40 may be replaced with a reel 90 and appropriate reel support 22 elements as well as fluid connection to the drilling fluid equipment 14 and power source 16 illustrated in fig1 . a tube guide 94 may be structured to guide the tubing 92 from the reel 90 to exit the tube guide 94 at tube aperture 95 coincident with the reel axis 98 . the tube guide 94 may be supported by a guide support arm 102 . the guide support arm 102 and tube guide support 96 may be attached to the reel axis 98 by rotating coupling 104 located with a reel mount 106 . the tubing 92 may be unreeled and moved by drive mechanism or injector unit 100 to drill into the earth . when it is desired to change the drilling direction the tube guide 94 may be rotated by engaging rotating coupling 104 to lock reel 90 and tube guide 94 . rotating the reel 90 may cause the tube guide 94 and tubing 92 to rotate thereby causing the drill string and drill bit 110 to rotate and change the down hole orientation . referring to fig2 through 4 , the drill pipe 60 may be fabricated in lengths for use with rigid steel drill pipe ( not shown ). the drill pipe 60 may then be inserted in a drill pipe string to add flexibility to such drill pipe string . drill pipe 60 may also be used to form larger portions of a drill pipe string for down hole drilling flexibility . while the invention has been particularly shown and described with respect to the illustrated and preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details may be made therein without departing from the spirit and scope of the invention .
| 4 |
as explained more fully herein , the preferred embodiment of the fabric of the present invention is formed on a warp - knitting machine which may be of any conventional type of an at least three - bar construction having three or more yarn guide bars and a needle bar , preferably a conventional raschel warp - knitting machine ( although it is also contemplated that the fabric and variations thereof could also be produced utilizing a tricot or like warp - knitting machine ). the construction and operation of such machines are well known in the knitting art and need not herein be specifically described and illustrated . in the following description , the yarn guide bars of the knitting machine are identified as &# 34 ; top ,&# 34 ; &# 34 ; middle ,&# 34 ; and &# 34 ; bottom &# 34 ; guide bars for reference purposes only and not by way of limitation . as those persons skilled in the art will understand , such terms equally identify knitting machines whose guide bars may be referred to as &# 34 ; front ,&# 34 ; &# 34 ; middle ,&# 34 ; and &# 34 ; back &# 34 ; guide bars , which machines of course are not to be excluded from the scope and substance of the present invention . as further used herein , the &# 34 ; bar construction &# 34 ; of a warp - knitting machine refers to the number of yarn guide bars of the machine , while the &# 34 ; bar construction &# 34 ; of a warp - knitted fabric refers to the number of different sets of warp yarns included in the fabric , all as is conventional terminology within the art . as is conventional , the needle bar n of the warp - knitting machine carries a series of aligned knitting needles 15 , while each guide bar i , ii , iii of the machine carries a series of guide eyes 16 , the needle and guide bars of the machine preferably having the same gauge , i . e ., the same number of needles and guide eyes per inch , all as depicted schematically in fig1 . in the accompanying drawings , one particular preferred embodiment of the present warp - knitted fabric of a three - bar construction knitted according to the present invention on a three - bar raschel warp - knitting machine is illustrated . in particular , the fabric is knitted utilizing three sets of warp yarns respectively wound on and delivered from three separate warp beams , with the accompanying drawings of fig2 and 3 depicting the stitch constructions of the three sets of yarns as carried out by the respective lateral traversing movements of the guide bars of the knitting machine according to the preferred embodiment of the fabric utilizing a traditional dot or point diagram format , wherein the individual points 15 represent the needles of the needle bar n of the knitting machine in the formation of several successive fabric courses c across several successive fabric wales w . according to the present invention , a series of guide eyes 16s at the opposite ends of each yarn guide bar i , ii , iii are designated for carrying yarns to be warp knitted into the selvedges of the fabric ( e . g ., a series of 60 successively - adjacent guide eyes 16b at each end of each guide bar ), while the series of guide eyes extending between the two groups of selvedge - forming guide eyes 16s are designated for knitting the main mesh body of the fabric ( e . g ., a series of 600 successively - adjacent guide eyes on each guide bar extending between the two sets of selvedge - forming guide eyes ). one main warp beam 20 carries a series of warp yarns equivalent in number to the number of guide eyes on each guide bar designated for knitting the main fabric body ( e . g ., 600 warp yarns ), with alternating ones of the warp yarns forming a first set of fabric body yarns 26 being threaded through every alternate guide eye 16b &# 39 ; of the middle guide bar ii designated for knitting the main fabric body and the intervening yarns forming a second set of fabric body yarns 28 being threaded through every intervening guide eye 16b &# 34 ; of the bottom yarn guide bar iii designated for knitting the main fabric body . a second warp beam 24 carries a first set of selvedge yarns 32 corresponding in number to the number of guide eyes 16s on the guide bars designated for knitting the fabric selvedges ( e . g ., 120 yarns ), which are delivered to and threaded through every guide eye 16s of the top yarn guide bar i designated for knitting the fabric selvedges . similarly , a third warp beam 22 carries a second set of selvedge yarns 30 of a number twice the number of guide eyes 16s on the guide bars designated for knitting the fabric selvedges , with two such yarns 30 being threaded through each guide eye 16s of the guide bar iii designated for knitting the fabric selvedges . preferably all of the yarns are multifilament synthetic yarns , such as polyester , but may be of differing denier and filament makeup to achieve and enhance the desirable physical characteristics of the fabric . for example , in the preferred embodiment depicted in the drawings , the body yarns 26 , 28 delivered from the warp beam 20 to form the main fabric body are non - textured polyester yarns , commonly referred to in the industry as &# 34 ; flat &# 34 ; yarns , of a relatively high denier , e . g ., 450 denier , and the selvedge yarns 30 , 32 delivered from the two warp beams 22 , 24 are preferably texturized polyester yarns , selected so that the three selvedge yarns 30 , 32 delivered to each selvedge needle 15s on the needle bar n ( i . e ., two selvedge yarns 30 from the warp beam 22 and one selvedge yarn 32 from the warp beam 24 ) collectively have a denier comparable to that of the main body yarns 26 , 28 , e . g ., each selvedge yarn 30 , 32 being a 150 denier , 34 filament textured polyester yarn . of course , those persons skilled in the art will recognize that various other types of yarns may also be employed as necessary or desirable according to the fabric weight , feel and other physical characteristics sought to be achieved . as diagrammatically depicted in fig2 and 3 , the stitch patterns for the body and selvedge yarns 26 , 28 , 30 , 32 as controlled by the three yarn guide bars i , ii , iii form the main fabric body m in an open mesh construction defining diamond - shaped openings 34 and form the selvedges s of a stabilized non - mesh stitch construction of essentially twice the stitch density of the mesh construction of the main fabric body m due to the division of the body yarns in the first warp beam 20 into the two sets of body yarns 26 , 28 whereby the effective needle gauge utilized in the knitting the main fabric body is one - half the needle gauge utilized in knitting the selvedges s . specifically , the middle yarn guide bar ii of the machine manipulates the first set of body yarns 26 to traverse laterally back and forth relative to the alternate body yarn needles 15b &# 39 ; of the needle bar n to stitch the body yarns 26 in a repeating 1 - 0 , 1 - 2 , 2 - 3 , 2 - 1 stitch pattern ( diagrammatically indicated at bar ii of fig2 ) as the yarns 26 are fed progressively from their respective warp beam 20 . simultaneously , the bottom yarn guide bar iii of the knitting machine manipulates the second set of body yarns 28 as they are also fed from the same warp beam 20 to traverse relative to the intervening body yarn needles 15b &# 34 ; of the needle bar n to stitch the body yarns 28 in a repeating mirror image 2 - 3 , 2 - 1 , 1 - 0 , 1 - 2 stitch pattern ( diagrammatically indicated at bar iii of fig2 ). at the same time , the bottom yarn guide bar iii identically manipulates the selvedge yarns 30 to traverse relative to the selvedge needles 15s in the same 2 - 3 , 2 - 1 , 1 - 0 , 1 - 2 repeating stitch pattern as the yarns 30 are fed from their respective warp beam 22 . the selvedge yarns 32 delivered from the warp beam 24 are simultaneously manipulated by the top yarn guide bar i to traverse relative to the selvedge needles 15s in a repeating 0 - 1 , 1 - 0 chain stitch pattern ( as indicated diagrammatically at bar i of fig2 ). as will thus be understood , the body yarns 26 , 28 are inter - knitted with one another in their above - described mirror - image stitch constructions , with each body yarn 26 , 28 being formed from one fabric course c to the next fabric course c in a series of needle loops 26n , 28n and in connecting underlaps 26u , 28u extending between the successive needle loops , whereby the guide bar threading patterns and the respective stitch patterns of the body yarns 26 , 28 dispose one of the needle loops 26n or 28n in every wale w of every course c in the fabric while defining the diamond - shaped mesh openings 34 aligned coursewise , walewise and diagonally throughout the main fabric body m . within the selvedges s , the selvedge yarns 30 are interknitted with one another in the described stitch construction in needle loops 30n and connecting underlaps 30u extending between the successive needle loops 30n , while the selvedge yarns 32 are interknitted with the selvedge yarns 30 in the described chain stitch pattern forming needle loops 32n interknitted in plated relationship with the needle loops 30n of the selvedge yarns 30 in every wale w and in connecting chain stitch underlaps 32u extending between the successive needle loops 32n . in this manner , the chain stitch pattern of the selvedge yarns 32 provides walewise resistance to elongation and distortion within the selvedges s while the coursewise traversing stitch pattern of the selvedge yarns 30 provides coursewise resistance to elongation and distortion within the selvedges s , the selvedge yarns 30 , 32 thereby cooperating with one another to provide a highly - stabilized structure to the selvedges . as such , the selvedges s exhibit a high degree of resistance to curling and tend naturally to lay substantially flat and essentially co - planar with the main fabric body m when the fabric is opened into a flattened full - width condition . in turn , the selvedges s tend to resist any tendency of the immediately - adjacent lateral side margins of the mesh main fabric body m to curl inwardly ( i . e ., normal to the lengthwise extent of the fabric ). thus , the fabric promotes substantially - uniform winding into cylindrical roll form with suppressed tendency of the side edges of the fabric to cause the roll to enlarge at its lateral ends . to best promote these physical characteristics of the fabric , the selvedges s should be of a minimum width sufficient at least to naturally lay substantially flat in an open - width condition of the fabric against any tendency of the side margins of the fabric body to induce curling of the selvedges and most preferably the selvedges should be sufficiently wide to be capable of being held by a gripping means of a tenter frame ( e . g ., tenter frame pins or clamps ) without imparting distortion to the laterally - adjacent portions of the main fabric body m . presently it is contemplated that , depending upon the physical characteristics of the main fabric body m which affect the tendency thereof to curl ( most significantly , the stitch construction of the main fabric body ), each selvedge s should preferably be of a width between approximately one inch and six inches . for example , in the particular preferred embodiment of the fabric depicted in fig1 and 2 , the selvedges are preferably at least four inches in width . advantageously , the curl - resistive characteristics of the present fabric enable the fabric to be much more easily handled and processed subsequent to knitting than the conventional known fabrics described above . specifically , the tendency for the selvedges s of the fabric to lay essentially flat considerably enhances and improves the handleability of the fabric in feeding into a tenter frame for heat setting such that fabrics in accordance with the present invention should be susceptible of being uniformly fed into a tenter frame at significantly higher lineal traveling speeds than is possible with conventional mesh fabrics while tenter frame operators should still be capable of maintaining coursewise and walewise alignment of the mesh openings without introducing bow or bias into the fabric . in experimental processing of the preferred embodiment of the fabric described above , satisfactory results have been achieved ( i . e ., bowing and biasing of the mesh openings were maintained at or below acceptable threshold values ) utilizing only a single pass of the fabric through a tenter frame at a traveling speed in the range of 30 - 40 yards per minute , as contrasted to the conventional process described above utilizing three passes of the fabric through a tenter frame at traveling speeds normally not exceeding 20 yards per minute . as those persons skilled in the art will readily recognize , the time and labor expense as well as the efficiency of processing the present fabric will therefore be substantially improved over the best known results achievable using conventional fabrics . it will therefore be readily understood by those persons skilled in the art that the present invention is susceptible of broad utility and application . many embodiments and adaptations of the present invention other than those herein described , as well as many variations , modifications and equivalent arrangements will be apparent from or reasonably suggested by the present invention and the foregoing description thereof , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to its preferred embodiment , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for purposes of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended or to be construed to limit the present invention or otherwise to exclude any such other embodiments , adaptations , variations , modifications and equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof .
| 3 |
embodiments of the invention relate to a supporting apparatus with a supporting device that may be easily adjusted to allow for variation in a position of a supported keyboard ( or other type of electronic device ). specifically , the supporting device may include multiple pairs of panels โ one pair being provided near a front of the supporting device , and another pair being provided near a back of the supporting device . with regard to each pair , the panels of the pair may be coupled to each other at a pivot line ( e . g ., via a hinge ). a front edge of one panel and a back edge of an adjacent panel may be configured to slide along rails along a length of the supporting device . as then one panel &# 39 ; s front edge is slid close to the adjacent panel &# 39 ; s back edge , the pivot line may move further from the rails , thereby affecting a height of the supporting device at the pivot line . a keyboard positioned on the supporting apparatus may thus be tilted forwards when the back pair of panels are compressed ( raising a back portion of the supporting device ) or tilted backwards when the front pair of panels are compressed ( raising a front portion of the supporting device ). fig1 a - 1c show a supporting apparatus comprising a frame 250 , and supporting device 100 engaged and exposed by the frame 250 . as shown , the keyboard - supporting device 100 includes a plurality ( e . g ., five ) of interconnected panels 105 , 110 , 115 , 120 and 125 . panels 105 , 110 , 115 , 120 and 125 can each be substantially flat and substantially rectangular in shape . they can be made of any suitable material including a plastic material . in this embodiment , panel 125 is a central third panel and is larger ( e . g ., twice as wide ) than outer panels 105 , 110 , 115 , 120 . in some instances , a width ( i . e ., characterizing a dimension of the panel along the axis 150 ) of each of one or more of panels 105 , 110 , 115 and 120 is between ยผ inch and 2 inches . in some instances , a width of panel 125 is between 1 inch and 6 inches . adjacent panels in the plurality of panels can be coupled together via a rotation - enabling component , such as a hinge . fig1 a shows an instance in which all five panels are flat along a base plane . however , the panels may be compressed in an accordion style along a length - wise axis 150 . specifically , part or all of one or more panels may engage with a rail system associated with frame 250 , to thereby prevent one or more vertically fixed edges from changing in heights relative to the base plane . for example , engagement of the first panel 125 with a rail system may prevent edge 110 b from moving perpendicular to the base plane . these rail - locked edges may then move along axis 150 ( e . g ., via movement along the rails ). further , one or more panels may each include a vertically non - fixed edge . heights of these vertically non - fixed edges may depend on locations of the vertically fixed edges along axis 150 relative to positions of other vertically fixed edges . each panel may be coupled to one or more adjacent panels , e . g ., as shown in fig1 a - 1c . the panel may be able to pivot relative to one or more adjacent panels , such that , e . g ., a surface of the panel is not in a same plane ( and / or , in some instances , parallel to ) a surface of the one or more adjacent panels . a panel may be coupled to an adjacent panel using a hinge or another pivoting component . for example , each of the panel and the adjacent panel may include or be coupled to a rigid edge . the rigid edges may be coupled by a flexible coupling component , such as a piece of fabric . in fig1 a , supporting device 100 includes a first pair of panels : front first panel 105 and back second panel 110 . front first panel 105 includes a front edge 105 a and a back edge 105 b . back second panel 110 includes a front edge 110 a and a parallel back edge 110 b . front edge 105 a and back edge 110 b are vertically fixed ( due to direct or indirect engagement with an underlying rail system ). back edge 105 b and front edge 110 a are also vertically fixed . back edge 110 b may be moved close to front edge 105 a , thereby causing the front pair of panels to move from the flat positions shown in fig1 a to a pointed position shown in fig1 b , away from the underlying keyboard 200 . conversely , a second pair of fourth and fifth panels 115 and 120 may be compressed to cause these back panels to move from the flat positions shown in fig1 a to a pointed position shown in fig1 c , away from underlying keyboard 200 . as shown in fig1 a , 1 b , and 1 c , supporting device 100 can be completely flat within frame 150 , one end of the supporting device 100 can form a v - shaped protrusion , and the other end of the supporting device 100 can form a v - shaped protrusion . as described in further detail below , a default state of supporting device 100 may be to lock a length - wise position of the rail - locked edges . however , a user may be able to temporarily unlock the edges ( e . g ., by pressing buttons 160 ) to move the edges to a desired position . fig2 a - 2c show the supporting apparatus coupled to a keyboard 200 . as shown in fig2 a , keyboard 200 may include a cavity 205 sized to receive supporting device 100 . for example , the cavity may have a length and width approximately the same as or slightly larger than a respective length and width of supporting device 100 . in some instances , a depth of cavity 205 is approximately the same as a depth of supporting device 100 . as noted above , the supporting apparatus may comprise a restraining unit configured to engage the series of connected panels such that at least one edge of each of four or more panels of the series of connected panels is restricted to movement within a base plane 265 . the base plane 265 may be the plane along which the panels lie while the supporting device is completely flat ( e . g ., as in fig1 a ). the restraining unit may take the form of a frame 250 in some embodiments . frame 250 may lock supporting device 100 to keyboard 200 . for example , after supporting device 100 is positioned within cavity 205 of keyboard 200 , frame 250 may be positioned over supporting device 100 . screws or tabs 260 may then be inserted through apertures of frame 250 to engage keyboard 200 . in some instances , supporting device 100 and / or frame 250 are provided separately from an electronic device . a user may then lock supporting device 100 to an electronic device ( e . g ., keyboard 200 ). such embodiments may allow a user freedom to enjoy tilt flexibility provided by supporting device 100 while simultaneously enjoying the freedom of choosing his preferred electronic device . in some instances , supporting device 100 is provided with an electronic device . for example , supporting device may be fixedly attached to the electronic device and / or attached to the electronic device at a time of sale . frame 260 may be ( e . g ., permanently ) contiguous with and / or adhered to the electronic device . as shown in fig2 b , panel edges of supporting device 100 may remain free to move along the length - wise axis of the supporting device ( so long as the supporting device is not in a locked state ). in this instance , movement of third panel 125 towards a back of the supporting device may cause fourth and fifth panels 115 and 120 to compress and form an apex or point . as shown in fig2 c , the apex formed by fourth and fifth panels 115 and 120 may cause a back of keyboard 200 to be raised relative to a front of keyboard 200 . in some embodiments , the described movement of the panels may be performed even while a keyboard is positioned over the supporting device โ without requiring that the combined device - keyboard system be turned upside down . for example , a user may be able to easily ( e . g ., and blindly ) locate buttons 160 ( see fig3 ) to unlock the supporting device and then slide the panels along axis 150 . pushing buttons 160 may cause supporting device 100 to switch from a locked state ( where length - wise position of the rail - locked edges are fixed ) to an unlocked state ( where the rail - locked edges can move along the length - wise axis 150 ). in some instances , supporting device 100 remains in the unlocked state while , and only while , button 160 are pushed . as shown in fig2 b , panels may be configured to have contact - improving or stability - improving features . for example , a hole 280 may be formed between panels 115 and 120 . thus , two feet 285 a and 285 b will contact an underlying surface rather than an extended edge . in this embodiment , a height of a front or back apex may be finely controlled merely by moving third panel 125 towards a front or back of supporting device 100 . a component of the supporting device or the frame may fix or restrain length - wise motion of an extreme edge ( e . g ., edge 105 a ). thus , a movement of a single piece along a single axis allows the user to have a large degree of control over a tilt of a keyboard supported by the supporting device . though not shown , other variations are contemplated . in one embodiment , fewer panels ( e . g ., three ) may be included ( e . g ., panels 115 , 120 and 125 ). movement of third panel 125 would then allow a height of a single back apex to be adjusted . flipping supporting device 100 prior to attachment of frame 250 may allow a user the ability to still achieve a positive or negative flip . in one embodiment , no third panel 125 is included . in one embodiment , more than five panels are included . fig3 shows a position - locking component 300 according to embodiments of the invention . position - locking component 300 may include a spring arm that may be positioned on and / or coupled to a panel , such as third panel 125 . position - locking component 300 may include a user - operating feature such as a button 160 . upon activation of the feature ( e . g ., pressing of the button ), position - locking component 300 may move from a default locked state to an unlocked state . in the unlocked state , an associated panel ( e . g ., third panel 125 ) may be free to move lengthwise . when the feature is activated , teeth 310 may move inwards towards button 160 . the teeth may then be free to move through a rail guide . when the feature is released from activation , teeth 310 may move outwards away from the button and engage complementary mating teeth present along an outer edge of a rail guide . close spacing of the teeth 310 may allow a user to finely control a position of panel 125 and thus , a tilt of a keyboard supported by supporting device 100 . in one embodiment , teeth 310 are sized and spaced to allow for a user to control a tilt of a supported keyboard with precision of greater than about 5 ยฐ or 1 ยฐ. fig4 shows a cross section of frame 250 . frame 250 may include a keyboard - receiving feature 405 . for example , keyboard receiving feature 405 may include a track configured to wrap around a portion or edge of the keyboard 100 . frame 250 may further include a rail guide 410 . rail guide 410 may be configured to allow underlying panels to move in a length - wise direction and may be configured to restrain vertical movement of engaged panel edges . rail guide 410 may further include a locking feature , such as mating teeth that only allows length - wise movement of panels when the locking feature is disengaged . for example , rail guide 410 may include mating teeth along an outer edge 410 a of the guide . the above description is illustrative and is not restrictive . many variations of the invention will become apparent to those skilled in the art upon review of the disclosure . the scope of the invention should , therefore , be determined not with reference to the above description , but instead should be determined with reference to the pending claims along with their full scope or equivalents . one or more features from any embodiment may be combined with one or more features of any other embodiment without departing from the scope of the invention . where approximate or โ about โ is described for measurements , embodiments herein also contemplate the exact measurement . where a shape is disclosed , such as a cylinder , embodiments herein contemplate other suitable shapes , such as multi - sided blocks ( octagonal structures , decagonal structures , etc . ), other rectangular structures , etc . in certain implementations , structures with multiple sides approaching the shape of cylinders , as well as substantially cylindrical shapes ( e . g ., a cylinder with a flat sidewall portion ) may be considered cylinders as described herein , unless otherwise specified .
| 6 |
fig1 illustrates a breakaway view of a blood filter assembly 8 of the present invention . the blood filter assembly 8 comprises a disposable blood filter 10 and a motor drive 26 . the disposable blood filter 10 comprises a shell 12 , an impeller 14 , a blood outlet port 16 , a gas outlet or central port 18 , a blood inlet port 20 , an optional baffle 22 , and a bearing shaft 24 . the optional baffle 22 optionally comprises a plurality of vent holes 28 . the impeller 14 comprises a magnetic coupler 30 . the shell 12 optionally comprises a plurality of lock down tabs 46 , a gas trap 57 and a bleed valve 58 . the motor drive 26 comprises a motor 32 , a power cable 34 , a power switch 36 , a central shaft 38 , a magnetic driver 40 , a housing 42 , and a plurality of optional lock - down or clamping mechanisms 44 to hold the disposable blood filter shell 12 to the motor drive housing 42 . the motor drive 26 optionally comprises a power - on lamp 48 , an extension arm 54 , and a pole clamp 50 . the optional pole clamp 50 further comprises a setscrew 52 . the shell 12 of the disposable blood filter 10 is an axially elongate cylinder or vessel , most preferably disposed with its axis parallel to the direction of gravity . the top of the shell 12 is , preferably , conical . the gas outlet port 18 is preferably disposed along the central axis at either the top or the bottom of the shell 12 . the blood inlet port 20 and the blood outlet port 16 are , preferably located on the periphery of the shell 12 . the blood inlet port 20 may be located lower or higher on the periphery of the shell 12 than the blood outlet port 16 but the gas outlet port 18 , otherwise known as a gas vent , is most preferably located higher than the blood inlet port 20 and the blood outlet port 16 . the gas outlet port 18 is located at the entrance of the gas trap 57 and the bleed valve 58 is located at or near the highest point of the gas trap 57 . the gas outlet port 18 , in another embodiment , is located at the center of the bottom of the blood filter . the gas and blood , which is removed from either gas outlet port 18 is routed back to the venous reservoir of the cardiopulmonary bypass system thus minimizing blood loss during the surgical procedure . the bottom - mounted gas outlet port 18 may be able to take advantage of fluid patterns generated within the shell 12 to enhance separation of gas from the blood . the diameter of the blood inlet port 20 and the blood outlet port 16 is generally 1 . 2 cm and ranges from 0 . 2 cm to 3 . 0 cm . the diameter of the gas outlet port 18 is from 0 . 1 cm to 2 . 0 cm . the diameter of the shell 12 is generally from 1 cm to 30 cm , more preferably from 3 cm to 15 cm and most preferably 5 to 10 cm . the length of the shell 12 ranges from 2 cm to 30 cm . smaller lengths and diameters of the shell 12 are preferable because the priming volume of the disposable blood filter 10 is minimized with minimized dimensions and a small priming volume reduces patient blood lost during a bypass procedure . the baffle 22 is a cylindrical structure located inside the conical top of the disposable filter 10 under the gas outlet port 18 . the series of vent holes 28 perforate the circumferential periphery of the baffle 22 . the diameter of the baffle 22 is optimized to shunt the blood with gas bubbles away from the blood outlet port 16 . the length of the baffle 22 is generally such that the lowermost portion of the baffle 22 is at or below the height of the blood outlet port 16 . the maximum radius of the baffle 22 is equal to or less than the distance from the innermost extent of the blood outlet port 16 from the center of the shell 12 . the gas outlet port 18 directs gas out of the disposable blood filter 10 and into the gas trap 57 where the small gas bubbles coalesce into macroscopic amounts of gas that is then bled off through the bleed valve 58 . the gas trap 57 is , preferably , transparent so that the clinician may monitor the buildup of macroscopic amounts of gas within the gas trap . the bleed valve 58 is either a manual valve , such as a stopcock , or it is an automatic valve that opens when a pre - determined amount of gas builds up within the gas trap 57 . the blood and foam collected in the gas trap 57 are preferably returned to a reservoir for recombination with the rest of the blood in the extracorporeal circulation . the bearing shaft 24 holds the impeller 14 at the center of the bottom inside surface of the shell 12 , which is along the central axis of the disposable filter 10 . the impeller 14 rotates freely around the bearing shaft 24 . the impeller 14 may be designed as a simple axially elongate stirring bar with its axis perpendicular to the axis of the shell 12 , like that used by laboratory stirrers . preferably , the impeller 14 is an axially elongate structure with its axis parallel to that of the shell 12 and a plurality of vanes that engage the blood and force the blood to spin . more preferably , the impeller 14 is a smooth axially elongate cylinder , cone , or other axially elongate shape that rotates and causes the blood to rotate by viscous effects . such a smooth cylinder is known in the art to move the blood gently , through shear effects , causing minimal damage to blood components such as red cells and leucocytes . in this embodiment , the impeller 14 contains the magnetic coupler 30 . the magnetic coupler 30 is preferably a permanent magnet with a north and a south pole which are disposed at diametrically opposed positions on the impeller 14 and distributed so that the center of mass and the center of force is aligned with the rotational central axis of the impeller 14 . typical permanent magnet materials include , but are not limited to , samarium cobalt , neodymium iron boron , ceramics , and the like . a coupling magnet on a drive unit will be similarly configured and will attract opposing polarities on the magnetic coupler 30 in the impeller 14 . the magnetic coupler 30 is in one embodiment , embedded and enclosed within the impeller 14 . typical methods of embedding the magnetic coupler 30 include injection molding , insert molding , machining the cavity and inserting the magnetic coupler 30 followed by gluing or bonding a cap over the magnetic coupler 30 . the impeller 14 with the magnetic coupler 30 is preferably balanced carefully so that the impeller 14 does not vibrate or wobble when it spins . the lockdown tabs 46 are located around the bottom outside edge of the cylindrical shell 12 of the disposable filter . correspondingly , the motor drive 26 has lockdown or clamping mechanisms 44 located around the top outside edge of the cylindrical housing 42 . the lockdown tabs 46 mate with the lockdown mechanisms 44 and when the lockdown mechanisms 44 are in the locked position , the disposable filter 10 is attached to the motor drive 26 . in order to allow for disposability of the blood handling components , the lock - down or clamping mechanisms 44 permit reversible fastening of the blood filter shell 12 to the motor drive 26 . this is important since cross - contamination of patients &# 39 ; blood must be prevented in order to control the spread of infectious diseases . the motor drive 26 may be reusable . in this embodiment , the clamping mechanism 44 is a set of latches that grasp protrusions 46 on shell 12 and hold it to the housing 42 of the motor drive 26 . in other embodiments , the clamping mechanism 44 may also be a bayonet mount , spring - loaded catch , magnetic latch or other fastening mechanism . the motor 32 of the motor drive 26 is affixed to the housing 42 . the central shaft 38 is affixed to , and protrudes from , the rotating armature of the motor 32 . the motor drive 26 most preferably uses an electric motor 32 powered by a 6 to 24 volt direct current ( dc ) power supply . such dc power supplies comprise batteries or electronics to convert alternating current electricity to direct current . the motor 32 could also be designed to use standard 110 vac to 220 vac . a direct current power source is preferable to an alternating current power source because patient and hospital staff protection is maximized with the dc system . the motor 32 is powered through the power cable 34 . the power switch 36 and the power on light 48 are physically affixed to the housing 42 and electrically connected to the power line 34 . the power on light 48 turns on only when the motor 32 is electrically energized by activating the power switch 36 . the electric motor 32 spins at a pre - determined constant speed . the central shaft 38 rotates from 100 to 10 , 000 rpm and most preferably from 500 to 5 , 000 rpm . alternative embodiments of the motor 32 include , but are not limited to , compressed air or hydraulically driven motors . in this embodiment , the magnetic driver 40 is affixed to the shaft 38 and rotates with the shaft 38 . the magnetic driver 40 is located near the perimeter of the housing 42 so that when the disposable blood filter 10 is positioned against the motor drive 26 , the magnetic driver 40 is magnetically engaged to the magnetic coupler 30 that is affixed to the impeller 14 of the disposable blood filter 10 . the motor 32 spins the shaft 38 and the magnetic driver 40 . the magnetic driver 40 has a magnetic field that acts through the housing 42 of the motor drive 26 and through the shell 12 of the disposable blood filter 10 . the magnetic field interacts with the magnetic coupler 30 in the impeller 14 and causes the impeller 14 to rotate at the same rate as that of the motor 32 . the magnetic driver 40 is preferably a bar magnet that spins about its central region with north and south poles diametrically opposed and equidistant from the center of rotation . the magnetic driver 40 and magnetic coupler 30 may both be permanent magnets . alternatively , at least one of either the magnetic driver 40 or the magnetic coupler 30 may be permanent magnets with the other being a material that is magnetically attracted to a magnet . in another embodiment , the magnetic coupler 30 or the magnetic driver 40 may be electromagnets energized by batteries or by another type of electrical power supply . typical permanent magnets are fabricated from materials such as , but not limited to , neodymium iron boron , iron , ceramics , samarium cobalt and the like . materials that are magnetically attracted to a magnet include , but are not limited to , iron or metallic alloys of iron . the magnetic coupler 30 is desirable because it allows for a sealed disposable blood filter 10 to be attached to the reusable motor drive 26 . in an alternate embodiment , a direct coupling between the central shaft 38 and the impeller 14 may be made using interlocking fingers on the impeller 14 that mate with the shaft 38 through a rotary seal . attachment of the blood filter assembly 8 to a cardiopulmonary bypass system is accomplished using the optional pole clamp 50 . the pole clamp 50 is connected to the housing 42 of the motor drive 26 by the arm 54 and is secured to a pole by the setscrew 52 . by attaching the reusable motor drive 26 of the blood filter assembly 8 to a pole or other part of a pump console in the cardiopulmonary bypass system , interchange of the disposable blood filter 10 is more easily accomplished . typical materials from which the disposable blood filter shell 12 and baffle 22 are fabricated include polycarbonate , polypropylene , polyethylene , polystyrene , polyvinyl chloride , fluorinated ethylene polymer ( fep ), poly tetrafluoroethylene ( ptfe ), polysulfone , and the like . these same materials are used to fabricate the housing 42 of the motor drive 26 , although metals such as aluminum , stainless steel and the like would also work . optionally , the interior of the shell 12 of the disposable blood filter 10 may be treated with an antithrombogenic material such as heparin and a bonding agent . the impeller 14 is made from materials that include polycarbonate , polypropylene , polyethylene , polystyrene , polyvinyl chloride , fluorinated ethylene polymer ( fep ), polysulfone , poly tetrafluoroethylene ( ptfe ), and the like . fig2 a shows a breakaway view of the shell 12 of the disposable blood filter 10 , which comprises the blood inlet port 20 and the impeller 14 . the impeller 14 further comprises the bearing shaft 24 , the magnetic coupler 30 and a plurality of vanes 15 . referring to fig2 a , the vanes 15 are affixed to , or are integral to , the impeller 14 and appear as fins , rotors or propeller blades . the magnetic coupler 30 is embedded within or affixed to the impeller 14 . the vanes 15 are rotated by the impeller 14 , which in turn , is rotated by the magnetic coupler 30 around the bearing shaft 24 . the blood enters the shell 12 through the blood inlet port 20 and is rotated by the vanes 15 on the impeller 14 . fig2 b shows a top cross - sectional view of the shell 12 of the disposable blood filter 10 . in this embodiment , the impeller 14 has four vanes 15 . any number of vanes 15 from one to 50 may be employed in the impeller 14 . the length and diameter of the vanes 15 are roughly equal to the overall length and diameter of the impeller 14 . fig3 a shows an exterior view of the blood filter assembly 8 , comprising the disposable blood filter 10 and the motor drive 26 , viewing along the axis of the blood inlet port 20 and blood outlet port 16 . also shown in fig3 a are the gas outlet port 18 , the gas trap 57 , the bleed valve 58 , the lock - down mechanisms 44 , and the lock - down tabs 46 on the shell 12 . fig3 b shows an exterior view of the blood filter assembly 8 , comprising the disposable blood filter 10 and the motor drive 26 , viewing perpendicular to the axis of the blood inlet port 20 and the blood outlet port 16 . also shown in fig3 b are the gas outlet port 18 , the gas trap 57 , the bleed valve 58 , the lock - down mechanisms 44 , and the lock - down tabs 46 on the shell 12 . fig3 a and 3b clearly show the tangential disposition of the blood inlet port 20 and the optional tangential disposition of the blood outlet port 16 . the blood inlet port 20 is disposed so that blood enters the disposable filter 10 in a direction tangential to the shell 12 to assist with generation of a rotational fluid field within the shell 12 . fig4 shows a schematic diagram of a typical cardiopulmonary bypass circuit 60 comprising the blood filter assembly 8 of the present invention . the cardiopulmonary bypass circuit 60 further comprises a patient 62 , a venous drainage cannula 64 , a venous reservoir 66 , a circulatory assist pump 68 , a heat exchanger 70 , an oxygenator 72 , an optional gas pump 74 , a gas bleed line 76 , a particulate filter 78 , and an arterial inlet cannula 80 . the venous circuit of the patient 62 is connected to a blood inlet of the venous reservoir 66 through the venous drainage cannula 64 . an outlet of the venous reservoir 66 connects to an inlet of the circulatory assist pump 68 and an outlet of the circulatory assist pump 68 connects to an inlet of the heat exchanger 70 . an outlet of the heat exchanger 70 connects to an inlet of the oxygenator 72 and an outlet of the oxygenator 72 connects to the blood inlet port 20 of the blood filter assembly 8 . the gas outlet port 18 of the blood filter assembly 8 connects , by way of the gas trap 57 and bleed valve 58 , to an inlet of the gas pump 74 . an outlet of the gas pump 74 connects to an inlet of the venous reservoir 66 through the gas bleed line 76 . the blood outlet port 16 of the blood filter assembly 8 connects to an inlet of the particulate filter 78 . an outlet of the particulate filter 78 connects to the patient 62 through the arterial inlet cannula 80 . in yet another embodiment , the disposable blood filter assembly 10 is integrated into the venous reservoir 66 to minimize the need for additional priming volume . since the venous reservoir 66 holds between 10 cc and 1000 cc of blood , the disposable blood filter 10 may be affixed thereto or integrated therein so that the internal volume of the disposable blood filter 10 does not add significantly to the priming volume of the cardiopulmonary bypass circuitry . in this embodiment , the drive unit or motor drive 26 for the filter 10 attaches to a component of the venous reservoir 66 to rotate the impeller 14 of the blood filter 10 . typically , during cardiopulmonary bypass , venous blood is removed from the patient 62 by the venous drainage cannula 64 and is collected , generally by gravity feed , in venous reservoir 66 where it is de - foamed using standard technology such as de - foaming sponges and bonded surfactants . the venous reservoir 66 generally comprises a blood - air interface and blood entering the reservoir entrains air and other gasses into the blood . in addition , a suction line , used to remove blood from the operative field , returns air and blood to the venous reservoir 66 . the de - foaming devices in the venous reservoir 66 are incapable of removing micro - bubbles or small gas bubbles that have become entrained in the blood , thus the need for a blood filter . the blood is pumped from the venous reservoir 66 and through the rest of the cardiopulmonary bypass circuit 60 by the circulatory assist pump 68 . the blood passes through the heat exchanger 70 where it is cooled for the majority of the procedure to reduce the metabolic requirements of the patient 62 . typical hypothermia temperatures range from 28 to 35 degrees centigrade . toward the end of the procedure , the heat exchanger 70 is used to warm the blood to normothermia , approximately 37 degrees centigrade . the blood is next pumped through the oxygenator 72 where it is oxygenated and cleared of carbon dioxide . from the oxygenator 72 , the blood is pumped to the blood filter assembly 8 . referring to fig1 , 3 a , 3 b , and 4 the blood filter assembly 8 of the present invention is designed to move gas bubbles present in the blood toward the center of the shell 12 so that blood may flow from the outside of the shell 12 through the blood outlet port 16 , free of these bubbles . the blood enters the blood filter assembly 8 through the blood inlet port 20 . preferably , the blood inlet port 20 is positioned tangential to the shell 12 of the disposable filter 10 . the rotating impeller 14 pushes the blood and causes the blood to rotate . tangential entry of the blood into the disposable filter 10 imparts a rotational velocity to the blood , thus requiring less shear stress on the blood for the motor 32 to turn the impeller 14 and rotationally accelerate the blood to the required velocity . the gas bubbles , many as small or smaller than 10 to 25 microns in diameter , need to be moved to the center of the disposable blood filter 10 in the time it takes for the blood to make a single pass through the filter 10 . by way of example , a typical blood flow rate through the cardiopulmonary bypass circuit 60 is approximately 5 liters per minute . a typical diameter for the blood filter 10 is 7 . 5 centimeters . with a 10 - centimeter height , the blood filter will have a priming volume of about 440 cubic centimeters . that means blood will dwell within the blood filter 10 for about 5 seconds . the gas bubbles , therefore , have about 5 seconds to move radially inward to within the diameter of the baffle 22 and , thus , be separated from the blood that flows through the blood outlet port 16 . rotational rates specified for this blood filter assembly 8 are sufficient to move bubbles as small as 7 to 10 microns to the center of the blood filter 10 within 5 seconds by means of centrifugal force . buoyancy causes the gas bubbles to rise , relative to gravitational attraction , and pass out of the gas outlet port 18 and into the gas trap 57 , although the gas removal may be augmented by an optional external pump 74 , powered by electricity , for example . gas and some blood , removed from the gas outlet port 18 of the disposable blood filter 8 are collected in the gas trap 57 and pumped back into the venous reservoir 66 by optional gas pump 74 through the gas bleed line 76 where the blood component can be reclaimed . the optional gas pump 74 is a continuously operating pump . optionally , gas pump 74 is a demand pump and pumps only when the volume of gas collects in sufficient quantity to warrant return to the venous reservoir 66 . this may be accomplished using a fluid level sensor mounted in the blood filter assembly 8 or gas bleed line 76 that controllably turns power to the gas pump 74 on and off . the bleed valve 58 is optional and not necessary if the gas pump 74 is used . referring again to fig4 , the blood is pumped from the blood filter assembly 8 through the blood outlet port 16 to the particulate filter 78 . the particulate filter 78 may be integral to the blood outlet port 16 . the particulate filter 78 filters solid debris and particulates , generally larger than 25 microns , using screens or filter meshes . the oxygenated blood is cleared of most particulates greater than 25 microns and most gas bubbles greater than 7 to 10 microns when it is returned to the patient 62 via the arterial inlet cannula 80 . fig5 shows another embodiment of the disposable blood filter 10 wherein the impeller 14 is an axially elongate , smooth shape without any vanes or protrusions . this type of impeller 14 uses viscosity to create shear forces that cause the blood to spin . referring to fig1 and 5 , the impeller 14 is driven through the magnetic coupler 30 that is adapted to interact with the magnetic driver 40 . the preferred shape of the impeller 14 is conical and helps reduce the priming volume of the system . the blood inlet port 20 , the blood outlet port 16 , and the gas outlet port 18 are disposed in the same configuration as that shown in fig1 . fig6 shows yet another embodiment of the disposable blood filter 10 wherein the impeller 14 is an axially elongate perforated structure such as a cylinder or cone . the impeller 14 , in this embodiment , comprises a filter mesh wall 56 . the filter mesh wall 56 is made from a mesh material or screen to provide particulate filtering for the blood that eliminates the need for a secondary particulate filter . the mesh material or screen has a maximum pore size of 25 to 35 microns to limit the size of particulates that can pass through the mesh wall 56 . the blood outlet port 16 is disposed tangential to the shell 12 of the disposable blood filter 10 . however , the blood inlet port 20 is disposed along the central axis of the disposable blood filter 10 . the blood inlet port 20 , optionally , rotates with the impeller 14 to pre - rotate the blood as it enters the filter system and to reduce shear forces acting on the blood at the center of the disposable blood filter 10 . the blood enters the filter 10 inside the impeller 14 . the gas outlet port 18 is disposed coaxially around the blood inlet port 20 to allow for gas entrapment and removal . the blood outlet port 16 is disposed outside the filter mesh wall 56 of impeller 14 and blood must pass through the filter mesh walls 56 to reach the blood outlet port 16 . in another embodiment , the blood is spun by magnets that directly interact with the ionic potential of the blood . this embodiment requires multiple high output electromagnets that are disposed circumferentially around the perimeter of the disposable blood filter 10 . these electromagnets are fired sequentially to form a rotational magnetic field on the blood . a central magnet or a plurality of central magnets is disposed on the core of the disposable blood filter 10 and serves as the alternative pole for the magnets disposed circumferentially around the filter . the blood inlet port 20 and blood outlet port 16 are disposed tangential to the shell 12 of the disposable blood filter 10 . the gas outlet port 18 is disposed as close to the axis of the disposable blood filter 10 as possible , given the central magnet structure , at its highest point . in another embodiment of this device , the blood filter assembly 8 also serves as a primary pump in a cardiopulmonary bypass circuit since centrifugal type pumps are regularly used in a large number of clinical cases . centrifugal pumps are considered less damaging to the blood than their less - expensive roller - pump alternatives . in yet another embodiment , the blood filter assembly 8 can be used as a hemoconcentrator . a one - pass hemoconcentrator is useful in separating non - cellular fluids from the cells in the blood at the end of the bypass procedure . the rotational rates of the hemoconcentrator of the current invention will enable such separation of cells . the blood cells are forced to the perimeter of the shell 12 of the disposable blood filter 8 where they are drawn off through the blood outlet port 16 . non - cellular materials , such as plasma , migrate to the center of the filter where the non - cellular materials are drawn out through the central port 18 . rotational spin rates of 1 , 000 to 20 , 000 rpm , and more preferably 5 , 000 to 10 , 000 rpm , are required to cause adequate centrifugation effects to separate the cellular components from the non - cellular components in a device of 5 to 15 cm diameter . in a further embodiment , a pressure less than the ambient pressure within the cardiopulmonary bypass circuit 60 is applied to the interior of the disposable blood filter shell 12 . the pressure within the cardiopulmonary bypass circuit 60 is , generally , within the range of 0 to 200 mm hg . by locally reducing the pressure within the blood filter shell 12 , the bubble size will be increased and the efficiency of the bubble separation will be likewise increased . the internal pressure within the disposable blood filter 12 is reduced by adding a pump to forcefully remove blood from the interior of the shell 12 through either the blood outlet port 16 or the gas outlet port 18 . additionally , an optional restriction , or narrowing of the channel , is added to the blood inlet port 20 . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is therefore indicated by the appended claims rather than the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope .
| 1 |
in the following description of the invention , like numerals and characters designate like elements throughout the figures of the drawings . referring generally to the drawings and more particularly to fig1 and 2 , a two chest pocket t - shirt 10 according to applicant &# 39 ; s invention has a front 12 , a back 14 , a left sleeve 16 , a right sleeve 18 , a neck opening 20 , a front chest portion 22 , a left chest pocket 24 , a right chest pocket 26 , and a neck band 28 . the front 12 , the back 14 , the sleeves 16 , and the neckband 28 are sewn together by well - known and traditional sewing techniques . the pockets 24 , 26 are assembled separately and attached to the chest portion 22 of the front 12 , in the style of an applique , for the reasons explained in detail hereinafter . referring now to fig3 , shown therein are the steps required to fabricate the pockets 24 , 26 . it will be understood by one skilled in the art that the left pocket 24 and the right pocket 26 are of identical construction and interchangeable . a pocket piece 30 is folded along a center line 32 as shown in fig3 , steps 1 - 3 and sewn , right sides together , in seams ( not shown ) adjacent edges 34 , 36 to create a double - walled pocket panel 38 having an open end 40 . it will be understood by one skilled in the art that the double - walled pocket panel can also be created by sewing on three sides , rights sides together , two separate identical pieces of fabric . still referring to fig3 , the edge portions 42 , 44 of the double - walled pocket panel 38 are folded over as illustrated in step 3 to create reinforced edge portions 46 , 48 ( see fig3 , steps 7 - 9 ). the reinforced edge portions 46 , 48 consist of 4 layers of pocket piece 30 fabric , i . e ., double - walled edge portions 42 , 44 folded each on itself . still referring to fig3 , steps 4 - 8 , a pocket top piece 50 has opposing long edges 52 , 54 and opposing short edges 56 , 58 . one short edge 54 is folded under to create a double thickness portion 60 . the remaining pocket top piece 50 is oriented in an inverted u - shape as shown in step 5 and placed over the open end 40 of the double - walled pocket panel 38 . end portions 62 , 64 of the pocket top piece 50 extend outwardly beyond the reinforced edge portions 46 , 48 , respectively , of the double - walled pocket panel 38 . in step 8 , the end portions 62 , 64 are folded around the reinforced edge portions 46 , 48 adjacent the open end 40 of the double - walled pocket panel 38 to form the pocket 24 / 26 shown in fig3 , step 9 , and double - stitched in place along double - stitching lines 66 . the double - walled pocket panel 38 is sewn to the chest portion 22 of the front 12 using double - stitching lines 68 , 70 , 72 along the reinforced edge portions 46 , 48 and adjacent the center line fold 32 , all as shown in step 9 . referring again to fig1 - 3 , it will be understood by one skilled in the art that the sleeve 16 , the sleeve 18 , the front 12 , and the back 14 are hemmed to complete the process of making the two chest pocket t - shirt 10 . although the two chest pocket t - shirt 10 according to applicant &# 39 ; s invention can be made of any typical t - shirt fabric , a ribbed polyester - cotton blend is preferred . the ribbed polyester - cotton blend stretches slightly to accommodate the weight and volume of items placed in the chest pockets but returns to its normal shape when the pocket contents are removed . optionally , the neckband 28 can be made from the same ribbed polyester - cotton fabric , thereby increasing durability . referring now to fig4 , applicant &# 39 ; s two chest pocket t - shirt 10 , partially cut away , has bulges 76 in the pocket 24 / 26 caused by pocket contents . the double - walled pocket panel 38 stretches to accommodate the pocket contents , including a pen p . yet the open edge 78 of the pocket 24 / 26 resists stretching , thereby reducing the likelihood of loss of pocket contents , as a result of the attachment of the pocket top piece 50 . in fig5 , a greatly enlarged detail shows the ribbed polyester - cotton fabric 80 , a portion of the pocket top piece 50 , and the double - stitching lines 66 across the top of the pocket 24 / 26 . referring now to fig6 - 7 , another two chest pocket t - shirt 110 according to applicant &# 39 ; s invention has a chest pocket 124 / 126 . instead of a pocket top piece 50 , as shown in fig1 - 5 , a lightweight elastic piece 82 across the top 84 of the chest pocket 124 / 126 helps to keep the chest pocket 124 / 126 closed to prevent loss of pocket contents . the foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application , to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents .
| 0 |
fig1 is a flowchart illustrating the method for suppressing impulse noise according to an exemplary embodiment of the present invention . referring to fig1 , the method for suppressing impulse noise includes two phases , i . e . the first phase s 110 and the second phase s 120 . fig2 a is a block diagram of a device 200 for suppressing impulse noise according to the method illustrated in fig1 . device 200 includes a first phase detecting and suppressing device 210 corresponding to the first phase s 110 , a second phase detecting and suppressing device 220 corresponding to the second phase s 120 , and other input / output or control signals . in addition , fig2 b is a diagram illustrating the first phase s 110 ( or the first phase detecting and suppressing device 210 in fig2 a ) and the second phase s 120 ( or the second phase detecting and suppressing device 220 in fig2 a ) in fig1 respectively operating on the sample stream . in various digital system ( e . g . dvb - t system with cofdm ) receivers , the received analog signals are sampled according to a sampling periods to generate a sample stream x [ n ]. the sample stream x [ n ] includes a plurality of samples , wherein the 1 st sample is denoted as x [ 1 ], the 2 nd sample is denoted as x [ 2 ], . . . , the k th sample is denoted as x [ k ], and k is a positive integer . in addition , the energy of the sample x [ 1 ] is denoted as e [ 1 ], the energy of the sample x [ 2 ] is denoted as e [ 2 ], . . . , the energy of the sample x [ k ] is denoted as e [ k ]. moreover , as shown in fig2 c , sample x [ k + 3 ] is sample x [ k + 4 ] after delaying a sampling period t , sample x [ k + 2 ] is sample x [ k + 3 ] after delaying a sampling period t , . . . , sample x [ k โ 1 ] is sample x [ k ] after delaying a sampling period t , wherein the delays 251 ห 255 all have the delay time with the duration of a sampling period t . similarly , energy e [ k + 3 ] is energy e [ k + 4 ] after delaying a sampling period t , energy e [ k + 2 ] is energy e [ k + 3 ] after delaying a sampling period t , . . . , energy e [ k โ 1 ] is energy e [ k ] after delaying a sampling period t . referring to both fig1 and fig2 b , according to the method for suppressing impulse noise , three consecutive samples ( i . e . x [ k โ 1 ], x [ k ], and x [ k + 1 ]) are processed in the first phase s 110 . in step s 111 , the energy e [ k โ 1 ] of the sample x [ k โ 1 ] is added to the energy e [ k ] of the sample x [ k ], while since the weights of the energies of the samples x [ k โ 1 ] and x [ k ] may not be the same , the sum of the two energies is expressed as e [ k โ 1 ]+ c 1 ร e [ k ], wherein the first constant c 1 represents the weight ratio between the energies of the samples x [ k ] and x [ k โ 1 ]. however , for the convenience of description , below the first constant is assigned value 1 , accordingly , next , the energy sum e [ k โ 1 ]+ e [ k ] of the samples x [ k โ 1 ] and x [ k ] is compared with the first threshold th 1 . in step s 112 , it is determined that whether the energy sum e [ k โ 1 ]+ e [ k ] is greater than the threshold th 1 . step s 113 is proceeded when the energy sum e [ k โ 1 ]+ e [ k ] is greater than the threshold th 1 . in step s 113 , the energy sum e [ k ]+ c 2 ร e [ k + 1 ] of the samples x [ k ] and x [ k + 1 ] is compared with the second threshold th 2 , wherein the second constant c 2 represents the weight ratio between the energies of the samples x [ k + 1 ] and x [ k ]. however , for the convenience of description , below the second constant is assigned value 1 , thus , whether the energy sum e [ k ]+ e [ k + 1 ] is greater than the threshold th 2 is determined in step s 114 . in an embodiment , the threshold th 1 may be equal to the threshold th 2 . in step s 114 , the energy sum of the sample x [ k ] with its previous sample x [ k โ 1 ], and the energy sum of the sample x [ k ] with its next sample x [ k + 1 ] both exceed the threshold if the energy sum e [ k ]+ e [ k + 1 ] is greater than the threshold th 2 . here , the possibility of the sample x [ k ] being interrupted by impulse noise is very high , thus step s 115 is executed to suppress the impulse noise and to replace the likely interrupted sample x [ k ] with a first replacement sample da 1 . thus , after the samples x [ k โ 1 ], x [ k ], and x [ k + 1 ] are processed in the first phase s 110 , sample x [ k โ 1 ], replacement sample da 1 , and sample x [ k + 1 ] are output in sequence . here , the replacement sample da 1 may be the long - term average or the moving average of the signal , or may also be a digital value . as to the situations of the energy sum e [ k โ 1 ]+ e [ k ] being smaller than the threshold th 1 in step s 112 , or the energy sum e [ k โ 1 ]+ e [ k ] being greater than the threshold th 1 in step s 112 but the energy sum e [ k ]+ e [ k + 1 ] being smaller than the threshold th 2 in step s 114 , the sample x [ k ] is determined being not interrupted by impulse noise , so the sample x [ k ] is not replaced . in other words , the original samples x [ k โ 1 ], x [ k ], and x [ k + 1 ] are output in sequence after they are processed in the first phase if in the first phase s 110 , the sample x [ k ] is determined being interrupted by impulse noise , the following several samples ( i . e . x [ k + 1 ], x [ k + 2 ], . . . , x [ k + m ], wherein m is a positive integer and is greater than 1 ) have high possibility of being interrupted by impulse noises . thus , according to the method for suppressing impulse noise , the samples x [ k + 1 ]ห x [ k + m ] are processed during the second phase s 120 . in the present embodiment , m = 4 . in step s 121 , the energy e [ k + 1 ] of sample x [ k + 1 ], the energy e [ k + 2 ] of sample x [ k + 2 ], the energy e [ k + 3 ] of sample x [ k + 3 ], and the energy e [ k + 4 ] of sample x [ k + 4 ] are respectively compared with the third threshold th 3 . in step s 122 , it is determined that whether the energy of at least one sample among the samples x [ k + 1 ]ห x [ k + 4 ] is greater than the threshold th 3 . when there is at least one sample having its energy greater than threshold th 3 , the possibility of sample x [ k + 1 ] being interrupted by impulse noise is very high . here , step s 123 is executed to suppress the impulse noise and to replace the likely interrupted sample x [ k + 1 ] with a second replacement sample da 2 . accordingly , the replacement sample da 2 and samples x [ k + 2 ]ห x [ k + 4 ] are output sequentially after the samples x [ k + 1 ]ห x [ k + 4 ] are processed during the second phase s 120 . in an embodiment of the present invention , the replacement sample da 2 may be equal to the replacement sample da 1 . referring to fig2 a , the device 200 for suppressing impulse noise includes a first phase detecting and suppressing device 210 and a second phase detecting and suppressing device 220 . the first phase detecting and suppressing device 210 receives a sample stream x [ n ], a first threshold th 1 , and a second threshold th 2 , and outputs a first output signal out 1 and a first control signal ctrl 1 . the second phase detecting and suppressing device 220 receives a sample stream x [ n โ 1 ], a first control signal ctrl 1 , and a third threshold th 3 , and outputs a second output signal out 2 . wherein , the diagrams of the sample streams x [ n ] and x [ n โ 1 ] are illustrated in fig2 d , and the sample stream x [ n ] is an advanced version of the sample stream x [ n โ 1 ] shifted by one sampling period t . the detailed circuit block diagrams of the detecting and suppressing devices 210 and 220 are respectively illustrated in fig3 a and 3b . referring to fig3 a , the first phase detecting and suppressing device 210 includes a first delay 301 , a second delay 303 , a third delay 306 , a first energy obtainer 302 , an adder 304 , a comparator 305 , a first and gate 307 and a first selector 308 . in an embodiment of the present invention , the first selector 308 may be a multiplexer . for example , the detecting and suppressing device 210 receives the sample x [ k ] of the sample stream x [ n ]. the delay 301 receives the sample x [ k ] and delays a sampling period t to output the sample x [ k โ 1 ]. the energy obtainer 302 receives the sample x [ k ] and outputs the energy e [ k ] of the sample x [ k ]. the delay 303 receives the energy e [ k ] of the sample x [ k ] and delays a sampling period t to output energy e [ k โ 1 ], i . e . the energy of the sample x [ k โ 1 ]. the adder 304 receives the energies of the samples x [ k ] and x [ k โ 1 ], which are respectively e [ k ] and e [ k โ 1 ], and outputs the sum e [ k โ 1 ]+ e [ k ] of the two energies . the comparator 305 compares the energy sum e [ k โ 1 ]+ e [ k ] with the threshold th 1 and outputs a first comparison result comp 1 . the delay 306 receives the first comparison result comp 1 and delays a sampling period t to output a second comparison result comp 2 , i . e . the result of comparing the energy sum e [ k ]+ e [ k + 1 ] and the threshold th 2 . based on the foregoing analysis , the result of comparing the energy sum e [ k ]+ e [ k + 1 ] and the threshold th 2 is generated while the detecting and suppressing device 210 receives the sample x [ k + 1 ] of the sample stream x [ n ], here the output of the delay 301 is the sample x [ k ]. when the energy sum e [ k โ 1 ]+ e [ k ] of the samples x [ k โ 1 ] and x [ k ] is greater than the threshold th 1 , i . e . the comparison result comp 1 is โ 1 โ, and when the energy sum e [ k ]+ e [ k + 1 ] of the samples x [ k ] and x [ k + 1 ] is also greater than the threshold th 2 , i . e . the comparison result comp 2 is also โ 1 โ, the control signal ctrl 1 output by the and gate 307 is โ 1 โ, which means the sample x [ k ] is interrupted by impulse noise . here , the control signal ctrl 1 is โ 1 โ and controls the selector 308 to select the replacement sample da 1 to output as the output signal out 1 . as to the situations of the energy sum e [ k โ 1 ]+ e [ k ] being smaller than the threshold th 1 , or the energy sum e [ k โ 1 ]+ e [ k ] being greater than the threshold th 1 but the energy sum e [ k ]+ e [ k + 1 ] being smaller than the threshold th 2 , the sample x [ k ] is not interrupted by impulsive noise . here , the control signal ctrl 1 is โ 0 โ and controls the selector 308 to select the sample x [ k ] output by the delay 301 to output as the output signal out 1 . referring to fig3 b , the second phase detecting and suppressing device 220 includes a first delay set 310 , a second delay set 320 , a second energy obtainer 340 , a comparator set 330 , an or gate 350 , a second and gate 360 , and a second selector 370 . in an embodiment of the present invention , the second selector 370 may be a multiplexer . wherein , the delay sets 310 and 320 can both delay the inputs thereof m โ 1 sampling period t , i . e . the delay sets 310 and 320 both can be formed by coupling m โ 1 delays , which can delay one sampling period t , in series . the comparator set 330 includes m comparators . in the present embodiment , m = 4 . accordingly , the delay set 310 includes delays 312 ห 314 , the delay set 320 includes delays 322 ห 324 , and the comparator set 330 includes comparators 331 ห 324 . for example , the detecting and suppressing device 220 receives the sample x [ k + 4 ] of the sample stream x [ n โ 1 ]. the delay set 310 receives the sample x [ k 4 ] and delays three sampling period t to output a sample x [ k + 1 ]. the energy obtainer 340 receives the sample x [ k + 4 ] and outputs the energy e [ k + 4 ] of the sample x [ k + 4 ]. the delay set 320 receives the energy e [ k + 4 ] of the sample x [ k + 4 ] and delays it to output the energies of three delayed samples , wherein the energy e [ k + 3 ] of the 1 st delayed sample x [ k + 3 ] output by the delay 322 is the output e [ k + 4 ] of the energy obtainer 340 after delaying a sampling period t , the energy e [ k + 2 ] of the 2 nd delayed sample x [ k + 2 ] output by the delay 323 is the energy e [ k + 3 ] of the first delayed sample x [ k + 3 ] after delaying a sampling period t , and the energy e [ k + 1 ] of the 3 rd delayed sample x [ k + 1 ] output by the delay 324 is the energy e [ k + 2 ] of the 2 nd delayed sample x [ k + 2 ] after delaying a sampling period t . the output e [ k + 4 ] of the energy obtainer 340 and the energies e [ k + 3 ]ห e [ k + 1 ] of the delayed samples are respectively received by the corresponding comparators 331 ห 334 in the comparator set 330 to be respectively compared with the threshold th 3 and to output the comparison results . the or gate 350 receives these comparison results and performs logic or operation to output the third control signal ctrl 3 . when at least one of the energies e [ k + 4 ]ห e [ k + 1 ] is greater than the threshold th 3 , e . g . the energy e [ k + 3 ] is greater than the threshold th 3 , the comparison result output by the comparator 331 is , e . g . โ 1 โ, so that the control signal ctrl 3 output by the or gate 350 is โ 1 โ. here , if the control signal ctrl 1 is also โ 1 โ ( i . e . the sample x [ k ] is interrupted by impulse noise ), then the and gate 360 outputs a second control signal ctrl 2 according to the control signals ctrl 1 and ctrl 3 to control the selector 370 to select the replacement sample da 2 to output as the second output signal out 2 . when the energies e [ k + 4 ]ห e [ k + 1 ] are all smaller than the threshold th 3 , which means the possibility of the sample x [ k + 1 ] being interrupted by impulse noise is very low , the comparison results output by the comparators 331 ห 334 are , e . g . all โ 0 โ, so that the control signal ctrl 3 output by the or gate 350 is โ 0 โ. thus , no matter what the control signal ctrl 1 is , the control signal ctrl 2 output by the and gate 360 are all โ 0 โ, and which controls the selector 370 to select the sample x [ k + 1 ] output by the comparator set 310 to output as the output signal out 2 . actually , the method for suppressing impulse noise as shown in fig1 can be achieved with only the first phase s 110 , however , with the second phase s 120 integrated , better performance , e . g . bit error rate about 1 db lower , can be achieved . similarly , in fig2 a , the device 200 for suppressing impulse noise employing the method in fig1 can also be achieved with only a first phase detecting and suppressing device 210 , however , if integrated with the second phase detecting and suppressing device 220 , better performance can be achieved . moreover , the method and device of the present invention are applicable to an intermediate frequency system , wherein the sample stream x [ n ] is a plurality of signals , but are also applicable to a baseband system , wherein the sample stream x [ n ] is real number signals . furthermore , the method and device of the present invention are applicable to an orthogonal frequency division multiplexing ( ofdm ) system or a coded orthogonal frequency division multiplexing ( cofdm ) system . when the device for suppressing impulse noise of the present invention includes a first phase and a second phase detecting and suppressing devices , the circuit thereof can be altered appropriately to simplify the structure , e . g . the devices for suppressing impulse noise as shown in fig4 and 5 . referring to fig4 , the precondition of implementing the device 400 for suppressing impulse noise is that the first replacement sample and the second replacement sample respectively used by the first detecting and suppressing device and the second detecting and suppressing device should be the same ( both are da 1 ). when the or gate 409 outputs โ 0 โ, the selector 470 selects the output of the delay set 410 as its output ; otherwise , when the or gate 409 outputs โ 1 โ, the selector 470 selects the replacement sample da 1 as its output to suppress impulse noise . wherein , when one of the control signals ct 1 and ct 2 received by the or gate 409 is โ 1 โ, the or gate 409 outputs โ 1 โ. here , the control signal ct 1 being โ 1 โ means that the energy sum of the samples x [ k โ 1 ] and x [ k ] is greater than the threshold th 1 and the energy sum of the samples x [ k ] and x [ k + 1 ] is greater than the threshold th 2 , and this can be deduced by assuming that the input of the delay set 410 is the sample x [ k + 3 ] and the output thereof is the sample x [ k ]. when the input of the delay set 410 is the sample x [ k + 3 ] and the output thereof is the sample x [ k ], the adder 404 a outputs the energy sum of the samples x [ k โ 1 ] and x [ k ] and compares it with the threshold th 1 through the comparator 405 a , and the adder 404 b outputs the energy sum of the samples x [ k ] and x [ k + 1 ] and compares it with the threshold th 2 through the comparator 405 b . when the energy sum of the samples x [ k โ 1 ] and x [ k ] is greater than the threshold th 1 and the energy sum of the samples x [ k ] and x [ k + 1 ] is greater than the threshold th 2 , the control signal ct 1 output by the and gate 407 is โ 1 โ, so that the or gate 409 outputs โ 1 โ to control the selector 470 to select the replacement sample da 1 . in addition , the control signal ct 2 being โ 1 โ requires both control signals ct 1 โฒ and ct 3 to be โ 1 โ. wherein , the control signal ct 1 โฒ being โ 1 โ means that the sample x [ k ] ever be replaced by the replacement sample da 1 , and the control signal ct 3 being โ 1 โ means that the energy of at least one of the samples x [ k + 1 ]ห x [ k + 4 ] is greater than the threshold th 3 , which can be deduced by assuming that the input of the delay set 410 is sample x [ k + 4 ] and the output thereof is sample x [ k + 1 ]. when the input of the delay set 410 is the sample x [ k + 4 ] and the output thereof is the sample x [ k + 1 ], the comparator 405 a compares the energy sum of the samples x [ k ] and x [ k + 1 ] with the threshold th 1 , and the comparator 405 b compares the energy sum of the samples x [ k + 1 ] and x [ k + 2 ] with the threshold th 2 . when the energy sum of the samples x [ k ] and x [ k + 1 ] is greater than the threshold th 1 and the energy sum of the samples x [ k + 1 ] and x [ k + 2 ] is greater than the threshold th 2 , the output of the and gate 407 is โ 1 โ. here , the output of the and gate 407 is delayed a sampling period by the delay 408 to become the control signal ct 1 โฒ, which means the energy sum of the samples x [ k โ 1 ] and x [ k ] is greater than the threshold th 1 and the energy sum of the samples x [ k ] and x [ k +] is greater than the threshold th 2 , i . e . the sample x [ k ] will be replaced by the replacement sample da 1 . moreover , the comparator set 430 and the or gate 450 are used for determining whether the energy of at least one of the samples x [ k + 1 ]ห x [ k + 4 ] is greater than the threshold th 3 , if the energy of at least one of the samples x [ k + 1 ]ห x [ k + 4 ] is greater than the threshold th 3 , then the control signal ct 3 output by the or gate 450 is โ 1 โ. referring to fig5 , the precondition of implementing the device 500 for suppressing impulse noise is that the first and the second replacement samples respectively used by the first phase and the second phase detecting and suppressing devices have to be the same ( both are da 1 ), and the first and the second thresholds have to be the same ( both are th 1 ). according to the analysis of the device 400 for suppressing impulse noise as shown in fig4 , the outputs of the delay set 510 are respectively assumed to be the samples x [ k ] and x [ k + 1 ], so that those skilled in the art should be able to analyze the device 500 for suppressing impulse noise , so will not be described again here . in summary , in the present invention , the energy sums of a plurality of samples are compared with the thresholds to determine whether the samples are interrupted by impulse noise and to suppress the samples interrupted by impulse noises , and the structure thereof is easy to be implemented . in addition , besides one phase of detection and suppression , the method and device of the present invention can also employ two phases of detection and suppression to obtain lower bit error rate . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure of the present invention without departing from the scope or spirit of the invention . in view of the foregoing , it is intended that the present invention cover modifications and variations of this invention provided they fall within the scope of the following claims and their equivalents .
| 7 |
one embodiment of this invention will now be described with reference to an automatic ink quantity adjusting device shown in fig3 through 6 . as shown in fig3 through 5 , an ink fountain roller 3 , an ink ductor roller 4 and ink rollers 5 are rotatably supported between frames 1 and 1 &# 39 ; in the stated order from an ink fountain 2 towards a plate cylinder ( not shown ). a ratchet 7 is fixedly mounted on the outer end portion of the shaft 6 of the ink fountain roller 3 which is extended through the frame 1 &# 39 ;. a pawl 8 pivotally mounted on a rod 8a is provided on a feed plate 9 . the feed plate is loosedly fitted on the outer end portion of the shaft 6 . the pawl 8 is engaged with the ratchet 7 to form a ratchet mechanism 10 ( see fig4 ). the feed plate 9 is coupled through a lever 11 to the drive section of a printing machine ( not shown ). when the printing machine is started , the ink fountain roller 3 is turned in the direction of the arrow f in fig5 by the ratchet mechanism 10 , so that the ink g in the ink fountain 2 will be carried on the outer wall of the ink fountain roller 3 . the amount of ink carried by the ink fountain roller 3 is controlled by adjusting the position of an ink blade 12 provided for the ink fountain , i . e . by adjusting the clearance h between the ink blade 12 and the ink fountain roller 3 as desired . an ink adjusting roller 13 is rotatably supported between the frames 1 and 1 &# 39 ; in such a manner that it is between and in contact with both the ink fountain roller 3 and the ink ductor roller 4 . gears 25 and 26 are fixedly mounted on the shaft 13a of the ink adjusting roller 13 and the shaft 6 of the ink fountain roller 3 , respectively , and the gears 25 and 26 are engaged with each other . therefore , when the printing machine is driven , the ink adjusting roller 13 is turned in the direction of the arrow i in fig5 . the ink adjusting roller 13 comprises a plurality of movable blocks 14 which are substantially arcuate as viewed from the front . more specifically , a plurality of pairs of movable blocks 14 are provided . each pair of movable blocks 14 are symmetrically arranged with their longer arcs set outside as shown in fig5 . disk - shaped blocks 15 and 15 are fixedly mounted on the shaft 13a in such a manner that they are spaced a predetermined distance from each other , each block carrying a pair of fulcrum shafts 16 . for each block pair except the right - most pair in fig3 a plate 13b is provided which is keyed to and rotatable with the shaft 13a . each plate carries a pair of fulcrum shafts 16 . first end portions of the movable blocks 14 of each block pair are rotatably mounted on the fulcrum shafts 16 , so that the movable blocks 14 and 14 can swing radially about the fulcrum shafts . the movable end portions 14 &# 39 ; and 14 &# 39 ; of the movable blocks 14 and 14 of each pair are coupled through tension springs 17 and 17 to the fulcrum shafts 16 and 16 , respectively , so that the movable end portions 14 &# 39 ; and 14 &# 39 ; are normally pulled towards the first end portions , i . e . toward the pivotal end portions 14 &# 34 ; and 14 &# 34 ; of the opposed movable blocks 14 and 14 . thus , the movable end portions 14 &# 39 ; of all of the movable blocks 14 are normally pulled towards the center by the tension springs 17 . it should be noted that the pivotal end portions 14 &# 34 ; of the movable blocks 14 are mounted on the shafts 16 as follows : the movable blocks 14 are so positioned that , even when the movable end portions 14 &# 39 ; are pulled towards the center , the outer surface of the pivotal end portions 14 &# 34 ; of each movable block 14 , i . e ., an ink sticking surface 14a which is the longer arcuate surface of the movable block 14 , can contact with the ink fountain roller 3 and the ink ductor roller 4 . an adjusting mechanism 18 having a motor 19 which is operated on and off according to an ink quantity detection signal from the printing machine , a link 20 and an adjusting rolls 21 , 21 are provided to radially move each movable block pair . each adjusting mechanism 18 , as shown in fig5 comprises : the motor 19 ; a worm gear 19a on the shaft of the motor 19 ; a gear wheel 22 engaged with the worm 19a ; and an arm 23 cooperating with the gear wheel 22 . the movable end portions of the arms 23 are rotatably coupled to the end portions of the links 20 . each adjusting roll 21 , 21 is rotatably mounted on an end portion of an arm 24 the middle of which is loosely fitted on the shaft 13a . one of the ends of the arm 24 is pivotally coupled to the other end of the link 20 . i . e ., as viewed in fig5 the rollers 21 and 21 are both mounted on the far side of arm 24 at either end thereof , while the shaft 21a for mounting the other roller 21 extends through the arm 24 to the rear side thereof where it is rotatably coupled to the lower end of link 20 . thus , the rolls 21 , 21 are coupled through the arm 24 and the link 20 to the adjusting mechanism 18 . when the motor 19 is rotated in a direction so that the link 20 is moved upwardly in fig5 through the arm 23 , the arm 24 is turned counterclockwise , and accordingly the adjusting roll 21 in contact with the inner surface of the pivotal end portion of the movable block 14 is turned counterclockwise . as a result , the movable block 14 is moved radially outwardly against the elastic force of the tension spring 17 so that the contact length between the ink sticking surface 14a and the ink fountain roller 3 is increased . the upper arcuate member is similarly moved . the above - described adjusting mechanism 18 is provided for every movable block 14 . an ink densitometer of a well - known type , shown schematically at 30 , adapted to detect ink densities at various points on a printing machine , outputs ink density detection signals as to various points on a print . in response to the detection signals the motors 19 of the adjusting mechanisms 18 are rotated in the forward direction or in the reverse direction , so that the movable blocks 14 are suitably moved as was described above , to increase or decrease the contact length of the ink sticking surfaces 14a , whereby the quantity of ink to be supplied from the ink fountain roller 3 to the ink ductor roller 4 , i . e . the quantities of ink to be supplied to printing plates on the plate cylinder , are set to predetermined values . thus , the ink densities of the printing plate can be suitably adjusted . with the above - described arrangement , an automatic ink quantity adjusting operation is carried out as follows : when a printing machine ( not shown ) starts , the ink fountain roller 3 is turned by the ratchet mechanism 10 , while the ink adjusting roller 13 is also turned through the gears 25 and 26 . as shown in fig6 ( a )- 6 ( c ), depending on the positions of the adjusting rolls 21 , the movable blocks 14 are displaced radially , and accordingly the contact lengths between the ink fountain roller 3 and the ink sticking surfaces 14a are changed , with the result that the quantities of ink carried to the ductor roller 4 by the ink sticking surfaces 14a are changed . a plurality of ink densitometers detect ink densities from a print sheet surface , and the ink densities thus detected are compared with predetermined values . when the quantity of ink in a particular print region is found to be low , for instance , then the motor 19 of the respective adjusting mechanism 18 is operated in response to a signal representing the fact that the ink quantity is too low . as a result , the adjusting roll 21 is moved in the direction of the arrow j as shown in fig6 ( a ) and 6 ( b ) to move the movable block 14 outwardly , so that the contact length between the ink sticking surface 14a and the ink fountain roller 3 is increased . when , on the other hand , the quantity of ink is detected to be too much , the motor 19 is turned so as to move the adjusting roll 21 in the direction of the arrow k in fig6 ( b ). in this operation , the movable block 14 is pulled towards the center by the tension spring 17 , so that the contact surface between the ink sticking surface 14a and the ink fountain roller 3 is decreased . it is assumed that , when the adjusting roll 21 is positioned at the middle of the movable block 14 as shown in fig6 ( b ), the contact length between the ink sticking surface 14a and the ink fountain roller 3 is represented by l . if , under this condition , the adjusting roll 21 is moved in the direction of the arrow j in fig6 ( b ), then the movable block 14 is moved radially outwardly as shown in fig6 ( c ), as a result of which the contact length l is increased to l &# 39 ;. if , on the other hand , the adjusting roll 21 is moved in the direction of the arrow k in fig6 ( b ), then the movable block 14 is moved radially inwardly as shown in fig6 ( a ), as a result of which the contact length l is decreased to l &# 34 ;. thus , in the former case , the quantity of ink sticking on the ink sticking surface is increased ; and in the latter case , the quantity of ink is decreased . that is , the quantity of ink supplied to the ink ductor roller 4 is adjusted . as was described above , a plurality of ink densitometers detect ink densities at various points on a print to provide the ink density detection signals . in response to the ink density detection signals , the adjusting mechanisms 18 operate to suitably move their respective movable blocks . therefore , the quantities of ink at various points on the print can be individually adjusted . after the clearance h between the ink fountain roller 3 and the ink blade 12 has been adjusted to coarsely control the quantity of ink sticking onto the ink fountain roller 3 , the movable blocks 14 are finely adjusted . therefore , the quantity of ink can be accurately adjusted . the embodiment of this invention has been described with reference to an ink quantity adjusting device ; however , the technical concept of the invention can equivalently applied to a water quantity adjusting device . as is apparent from the above description , in the ink ( or water ) quantity adjusting device according to this invention , the adjusting roll 13 , which is rotatably supported in such a manner that it is in contact with the fountain roller 3 and the ductor roller 4 is operated to move its respective movable blocks 14 radially , so that the contact lengths of the ink sticking surfaces with the fountain roller 3 are adjusted as desired , whereby the quantities of transferred ink are finely adjusted . therefore , with the ink ( or water ) water quantity adjusting device of this invention , unlike the conventional one which adjusts the quantity of ink ( or water ) by controlling the clearance only , the quantity of ink ( or water ) can be delicately controlled even if ink ( or water ) of a differend density is used . therefore , by finely adjusting the quantities of ink with the movable blocks 14 after the total quantity of ink to be supplied to the fountain roller 13 has been adjusted with the blade 12 , the quantities of ink can be finely adjusted in conformance to predetermined ink densities on a print sheet surface . the adjusting roller 13 is made up of the plurality of movable blocks 14 . the movable blocks 14 are moved radially by the adjusting mechanisms 18 which operate in response to the detection signals outputted by the ink densitometers adapted to detect ink densities at various points on a print sheet surface , so that each movable block 14 adjusts the quantity of ink which is suitable for the respective point on the print sheet surface . therefore , the fine adjustment is effected uniformly over the entire print sheet surface , and the print surface is of uniform ink density .
| 1 |
fig1 shows a longitudinal and cross sectional view of the present invention . in fig1 outer tube 101 and inner tube 103 define an annulus 105 . tube 101 has a lower inlet check valve 107 that allows working fluid to flow into annulus 105 . tube 101 also has an upper outlet check valve 109 that allows working fluid to flow out of annulus 105 . inner tube 103 penetrates the upper end 113 of tube 101 . inner tube 103 is in fluid communication through its upper end 111 with a source of controllable fluid pressure , not shown . inlet check valve 107 and outlet check valve 109 may be any check valve currently used with positive displacement pumps . use of a section of thinner wall flex tubing at the bottom of tube 101 can function as the bottom inlet check valve in many applications . thus the check valve may be made of the same plastic material as the inner and outer tubes . this can make the pump very inexpensive to build . outer tube 101 and inner tube 103 may be any semi - rigid plastic tubing capable of withstanding a fall vacuum . these tubes may be made of highly chemically resistant materials such as kynar , viton or teflon . no metallic parts are required . the tubes 101 and 103 may be of small diameter , allowing the pump to be inserted into locations that would be inaccessible to other pumps . functionally , fluid pressure is introduced into inner tube 103 , causing it to expand . this compresses the working fluid in annulus 105 and expels some of the working fluid out of upper outlet check valve 109 , as is shown in fig1 by arrow 117 . the fluid pressure in tube 103 is then reduced . this reduces the pressure on the working fluid in annulus 105 and draws more working fluid into annulus 105 through lower inlet check valve 107 as is shown in fig1 by arrow 115 . it may be desirable to place a small tube or string in annulus 105 to prevent complete closure of the annulus during the pump &# 39 ; s operation . the fluid used to pressurize inner tube 103 can be anything from common gases to liquid blends designed to be compatible with the intended service . in general highest efficiency is obtained with low viscosity fluids having a specific gravity similar to the material to be pumped . this is particularly true for pumps over 20 feet long intended for vertical pumping . pump performance characteristics can be affected by many factors . the primary design parameters are overall length , internal and external diameters of the outer and inner tubes and the elastimeric characteristics of each tube . the present invention shares most of the characteristics of positive displacement pumps . differences are due to the &# 34 ; long thin &# 34 ; nature of the invention &# 39 ; s design , which places the pump suction at the point of pickup and the discharge closer to final discharge . the pumps taught by the preferred embodiment of the present invention are capable of near perfect vacuum suctions and discharge pressures are limited only by the strength of the outer tube and valving . the pump is inherently inexpensive to manufacture , easy to clean , easy to repair and easily inspected if the outer tubing is clear . pumps made according to the present invention can vary in cross section from round to any practical shape ( oval , square , triangle , or irregular ). pump length is limited only by the practical limitations of hydraulic flow through the interior of the inner tube . fig2 shows a long thin embodiment of the pump taught by the present invention . fig2 shows how the present invention can operate even when it is long , thin and bent through several sharp angles . in fig2 outer tube 201 and inner tube 203 define annulus 205 . outer tube 201 is sealed at its upper end with upper outlet check valve 209 . outer tube 201 is sealed at its lower end by lower inlet check valve 207 . inner tube 203 penetrates the upper end of tube 201 at position 211 and is in fluid communication by outlet 213 with a controllable source of fluid pressure , not shown . inner tube 203 is sealed at one end and attached mechanically by any convenient means near the end of tube 201 . functionally , in fig2 fluid pressure is introduced from a controllable source , not shown , through inlet 213 to inner tube 203 as is shown in fig2 by arrow 217 . this pressure makes tube 203 expand applying force on the working fluid in annulus 205 . this force moves part of the working fluid through the upper outlet check valve 209 . the pressure in inner tube 203 is then reduced . this lowers the pressure on the working fluid in annulus 205 , whereby working fluid is drawn through lower inlet check valve 207 as is shown in fig2 by arrow 215 . this cycle is then repeated as required to make the pump operate at the desired rate of flow . fig3 shows a partial cross section detail of the discharge end of the pump shown in fig2 . in fig3 a check valve 301 has an inlet attachment fitting 303 and an outlet attachment fitting 313 . outer tube 305 is disposed in close fitting engagement and hermetically sealed , by adhesive or any other well know means , to valve inlet fitting 303 . inner tube 307 is hermetically sealed to elbow fitting 309 that penetrates fitting 303 through opening 310 . elbow 309 is hermetically sealed to and in fluid communication with elbow fitting 311 . discharge end fitting 313 is shown attached to and in fluid communication with output tube 315 . the lines and valves may be made of any material capable of physically and chemically tolerating the environment of the working fluid . fig4 shows a partial cross section detail of the inlet end of the pump shown in fig2 . in fig4 check valve 401 has an outlet fitting 403 that is in exterior close fitting engagement and fluid communication with outer tube 405 . the bond between fitting 403 and tube 405 is hermetic and may be made by adhesive or in any other way well known to those with skill in the art or mechanical engineering . the lines and valves may be made of any material capable of physically and chemically tolerating the environment of the working fluid . fitting 406 describes one of many ways to supply a method of attaching / anchoring the bladder tube to the end of the pump , fig5 shows the pressure vs . volume curve for the pump taught by the embodiment of the present invention shown in fig2 . fig6 shows another embodiment of the pump taught by the present invention . in fig6 pump 601 is shown with its lower end input end 603 in a sump 605 that is filled with thick sludge 607 . pump 601 has an outer tube 609 and an inner tube 611 that define annulus 613 . the lower end of inner tube 611 is mechanically attached to , but not in fluid communication with lower inlet check valve 615 at the inlet end 603 of outer tube 601 . the upper end of inner tube 611 is attached to and in fluid communication with connector tube 621 . the upper end 617 of outer tube 601 is attached to and in fluid communication with elbow 619 . elbow 619 is attached to and in fluid communication with outlet tube 629 . outlet tube 629 is attached to and in fluid communication with outlet check valve 631 . connector tube 621 penetrates elbow 619 and is attached to and in fluid communication with pressure line 623 . pressure line 623 is attached to and in fluid communication with bottle outlet 625 of squeeze bottle 627 . functionally , in fig6 an operator , not shown , squeezes pressure bottle 627 . this puts pressure in inner tube 611 , which causes tube 611 to expand . the expansion of tube 611 applies force to the working fluid in annulus 613 forcing some of the working fluid up through elbow 619 and outlet check valve 631 where it exits the pump as effluent stream 633 . the pressure on bottle 627 is then relaxed , which reduces the pressure on the working fluid and causes suction to draw more working fluid into the pump through inlet check valve 615 . fig7 shows another embodiment of the pump taught by the present invention . in fig7 pump 701 has an outer tube 703 and an inner tube 705 that define annulus 707 . outer tube 703 is sealed at its upper end by upper plug 714 and at its lower end by lower plug 709 . lower plug 709 is penetrated by lower inlet check valve 708 . the lower end of inner tube 705 is mechanically attached to the top of check valve 708 , but is not in fluid communication with the valve . upper plug 714 is penetrated by connection line 717 and upper outlet check valve 718 in valve section 715 . the upper end of inner tube 705 is attached to and in fluid communication with connection line 717 . line 717 is attached to and in fluid communication with line 723 that is in turn connected to and in fluid communication with reciprocating fluid pump 725 . check valve 718 is in fluid communication with and attached at its output side 719 to output line 721 . pump 725 comprises a rotary prime mover 727 connected via connecting rod 730 to a piston 733 disposed within a cylinder 735 , said cylinder being in fluid communication with pressure line 723 and thence with inner tube 705 . functionally , prime mover 727 causes piston 733 to move back and forth within cylinder 735 which applies varying pressure to the interior of inner tube 705 , causing it to expand and contract . as tube 705 expands , it applies force to the working fluid in annulus 707 , which forces some of the working fluid through check valve 718 and out line 721 . when inner tube 705 contracts , more working fluid is drawn into the pump through inlet check valve 708 , as was described in connection with fig1 and 6 , above . fig8 shows a pump according to the present invention wherein the inner tube 801 and outer tube 803 are separately coaxial within a third tube 805 . the present invention has been described in this specification in terms of its preferred embodiments , these being the best embodiment of the invention known to the inventor at the time this specification was prepared . the present invention is , however , broader than these specific embodiments and should be limited only by the appended claims .
| 5 |
a twist collapsible bag in accordance with the present invention can be a single stack design , double - stack design , triple - stack design or any design having more than four stacks wherein the frame structure in each stack is collapsible , including one annular frame member horizontally disposed at each of the top and bottom sides and a plurality of vertical support rods vertically and equiangularly arranged between the two annular frame members . fig1 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a first embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a , a second annular frame member 1 b and a third annular frame member 1 c horizontally arranged at three different elevations , one first vertical support rod 2 a and one second vertical support rod 2 b vertically arranged between the first annular frame member 1 a and the second annular frame member 1 b at two opposite sides and another first vertical support rod 2 a and another second vertical support rod 2 b vertically arranged between the second annular frame member 1 b and the third annular frame member 1 c at two opposite sides . the vertical support rods 2 a and 2 b are kept apart from the adjacent annular frame members 1 a and / or 1 b and / or 1 c at a predetermined gap . fig2 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a second embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a , a second annular frame member 1 b and a third annular frame member 1 c horizontally arranged at three different elevations , one first vertical support rod 2 a , one second vertical support rod 2 b and one third vertical support rod 2 c vertically and equiangularly arranged between the first annular frame member 1 a and the second annular frame member 1 b , and another first vertical support rod 2 a , another second vertical support rod 2 b and another third vertical support rod 2 c vertically and equiangularly arranged between the second annular frame member 1 b and the third annular frame member 1 c at two opposite sides . the vertical support rods 2 a , 2 b and 2 c are kept apart from the adjacent annular frame members 1 a and / or 1 b and / or 1 c at a predetermined gap . fig3 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a third embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a , a second annular frame member 1 b and a third annular frame member 1 c horizontally arranged at three different elevations , one first vertical support rod 2 a , one second vertical support rod 2 b , one third vertical support rod 2 c and one fourth vertical support rod 2 d vertically and equiangularly arranged between the first annular frame member 1 a and the second annular frame member 1 b , and another first vertical support rod 2 a , another second vertical support rod 2 b , another third vertical support rod 2 c and another fourth vertical support rod 2 d vertically and equiangularly arranged between the second annular frame member 1 b and the third annular frame member 1 c at two opposite sides . the vertical support rods 2 a , 2 b , 2 c and 2 d are kept apart from the adjacent annular frame members 1 a and / or 1 b and / or 1 c at a predetermined gap . fig4 illustrates a collapsible frame structure for a twist collapsible bag in accordance with a fourth embodiment of the present invention . according to this embodiment , the collapsible frame structure comprises a first annular frame member 1 a and a second annular frame member 1 b horizontally arranged at different elevations , one first vertical support rod 2 a , one second vertical support rod 2 b and one third vertical support rod 2 c vertically and equiangularly arranged between the first annular frame member 1 a and the second annular frame member 1 b . the vertical support rods 2 a , 2 b and 2 c are kept apart from the annular frame members 1 a and 1 b at a predetermined gap . the number of the annular frame members and the number of vertical support rods are determined subject to the pressure the twist collapsible bag to be received , however at least two vertical support rods must be set between each two adjacent annular frame members to provide sufficient support strength . fig5 illustrates a twist collapsible bag using the collapsible frame structure of the aforesaid second embodiment . as illustrated , the twist collapsible bag further comprises a bag body 3 made from a certain thickness of strong and tough fabric ( for example , canvass ) supported on the collapsible frame structure . the bag body 3 , when extended out , is shaped like a single open end container , having an opening 30 at one end , namely , the top end thereof . the bag body 3 is a double - layer wall structure . the first annular frame member 1 a is embedded in the double - layer wall structure of the bag body 3 around the opening 30 and secured thereto with stitches ; the third annular frame member 1 c is embedded in the double - layer wall structure of the bag body 3 around the closed bottom end of the bag body and secured thereto with stitches ; the second annular frame member 1 b is embedded in the double - layer wall structure of the bag body 3 between the first annular frame member 1 a and the third annular frame member 1 c and secured thereto with stitches ; the vertical support rods 2 a , 2 b and 2 c are embedded in the double - layer wall structure of the bag body 3 and stitched thereto at the selected locations . when the twist collapsible bag is extended out , the annular frame members 1 a , 1 b and 1 c are horizontally disposed at different elevations , and the vertical support rods 2 a , 2 b and 2 c are vertically disposed at different elevations and equiangularly spaced between each two adjacent ones of the vertically spaced annular frame members 1 a , 1 b and 1 c ( see fig6 ), thus , the collapsible frame structure supports the bag body 3 in shape for holding things . when not in use , twist the first annular frame member 1 a relative to the second annular frame member 1 b to bias the respective vertical support rods 2 a , 2 b and 2 c downwards ( see fig7 ), and then twist the second annular frame member 1 b relative to the third annular frame member 1 c to bias the respective vertical support rods 2 a , 2 b and 2 c downwards ( see fig8 ), thus , the twist collapsible bag is collapsed into a flat condition where the annular frame members 1 a , 1 b and 1 c are received together ( see fig9 ). when wishing to use the twist collapsible bag again , twist the collapsed twist collapsible bag in the reversed direction . in the aforesaid various embodiments of the present invention , each annular frame members can be made by bending a metal wire rod into a circular shape and then fixedly fastening the two ends of the metal wire rod together by means of welding or with an adhesive . alternatively the annular frame members can be injection - molded from plastics . although particular embodiments of the invention have been described in detail for purposes of illustration , various modifications and enhancements may be made without departing from the spirit and scope of the invention . accordingly , the invention is not to be limited except as by the appended claims .
| 1 |
for clarity , the same elements have been designated with the same reference numerals in the different drawings and , as usual in the representation of integrated components , the various drawings are not to scale . further , only those steps which are useful to the understanding of the present invention have been shown in the drawings and will be described hereafter . in particular , the forming of possible active circuits has not been described in detail , the present invention being compatible with any conventional technique . the present invention will be described hereafter in relation with an example of the forming of a tridimensional capacitance , of a well or trench forming a substrate contact area , and of a dielectric insulating trench in a substrate of silicon - on - insulator type ( soi ). however , the present invention more generally applies whatever the type of concerned substrate ( solid or not ) and whatever the destinations of the wells and / or trenches ( insulating or conductive ) formed in this substrate , provided that at least two of these wells or trenches have different destinations requiring , after etching , distinct steps . fig1 to 8 are very simplified cross - section views of trench and well manufacturing steps in an soi substrate according to an embodiment of the present invention . it is started from a thin single - crystal silicon substrate 1 , for example , of type n , on an insulating layer 2 ( for example , silicon oxide ) supported by a wafer w ( for example , made of silicon ). active areas ( not shown ) are likely to have been previously formed in substrate 1 . in a first step ( fig1 ), an insulating layer 3 , for example , silicon oxide ( sio 2 ), is deposited ( or thermally obtained ) on the upper surface of substrate 1 . then , a masking and a deep etch are performed to dig wells and trenches 4 , 5 , and 6 . for example , well 5 and trench 6 have a same depth , d 1 , reaching layer 2 , while trenches 4 have a smaller depth , d 2 . such different depths can be obtained in a same anisotropic etch step by providing for trenches 4 to have a width l 2 smaller than width l 1 of well and trench 5 and 6 . for example , widths l 1 and l 2 respectively are on the order of 1 . 2 ฮผm and of 0 . 8 ฮผm . trenches 4 are , for example , intended to form a tridimensional capacitance ; in top view , this might be trenches in the form of parallel strips or an array of wells . well 5 is intended for a substrate contact area ; in top view , this may be a local well , a strip - shaped trench , or yet a peripheral trench . trench 6 is intended to form a dielectric insulation area ; in top view , it will be a peripheral trench . in a second step ( fig2 ), an oxidation is carried out ( for example , a thermal oxidation ) to form an oxide layer 7 in the walls of the wells and trenches . this oxide layer is also formed in the bottom of trenches 4 which do not reach layer 2 . as a specific example of embodiment , layer 7 has a thickness on the order of from 0 . 1 to 0 . 2 ฮผm . in a third step ( fig3 ), a silicon nitride layer 8 ( si 3 n 4 ) is deposited over the entire structure . layer 8 will be used as a stop layer for the different subsequent etchings and covers the walls and the bottom of cavities 4 , 5 , and 6 . the thickness of the silicon nitride layer is , for example , approximately 0 . 01 ฮผm . in a fourth step ( fig4 ), a silicon oxide layer 9 , relatively thick as compared with layers 3 and 7 , is deposited by non - conformal deposition over the entire structure . the thickness of layer 9 is at least equal to half the width , preferably approximately equal to the width , of the widest trenches and wells ( well 5 and trench 6 in this example ). layer 9 forms caps or plugs at the top of all the trenches and wells . preferably , the cavities formed according to the present invention have a maximum width of approximately 2 ฮผm and layer 9 is then deposited with a thickness slightly greater than 1 ฮผm . any non - conformal deposition technique is appropriate to implement this fourth step , for example , a plasma - assisted chemical vapor deposition ( pecvd ) or a physical vapor deposition ( pvd ). in a fifth group of steps ( fig5 ), thick layer 9 is opened at the level of well 5 to make it accessible . nitride layer 8 is then eliminated by wet etch from the walls and the bottom of well 5 and oxide layer 7 is eliminated by wet etch from the walls of well 5 . then , the walls are doped , for example , by phosphorus diffusion , to form a heavily - doped n - type layer 10 . in a sixth step ( fig6 ), a new thick oxide layer 11 is non - conformally deposited to close well 5 . in a seventh step ( fig7 ), layer 11 above well 5 and layers 9 and 11 above trench 6 are etched to make well 5 and trench 6 accessible . layer 9 could be directly opened above trench 6 without closing back hole 5 . however , the etching of silicon oxide 9 would also etch silicon oxide 3 at the bottom of the hole , which would then no longer be protected . it is thus preferred to close well 5 with layer 11 to prepare a simultaneous etch without going too far . at this step , the silicon nitride may be removed by wet etch . well 5 and trench 6 are then integrally filled by conformal deposition to obtain in this well and this trench fillings 15 and 16 . filling material 16 of trench 6 may indifferently be conductive or insulating , the insulation being performed by layers 7 and possibly 8 . however , since filling material 15 of well 5 must be conductive , the same conductive material , for example , phosphorus - doped polysilicon , is used . the surface localization of this polysilicon may be performed by a planarization technique . the forming of an insulation trench and of a substrate contact area has thus been completed . in an eighth step ( fig8 ), thick oxide layers 9 and 11 are etched at the level of trenches 4 . silicon nitride layer 8 is used as an etch stop layer protecting the trenches and is removed once the silicon oxide has been completely eliminated . the forming of the capacitance is conventional . for example , the first electrode is formed by a first polysilicon layer 12 deposited on the walls and on the bottom of trenches 4 . layer 12 is covered with an insulating layer 13 , for example , silicon nitride . then , a polysilicon layer 17 is deposited again to form the second electrode , and fill the trench . a multidimensional capacitance 18 is thus obtained . according to a variation , thick oxide layer 9 , deposited at the fourth step ( fig4 ) of the above - described sequence , is also used as an etch mask for the case where the respective etchings of the trenches and of the wells only have a common portion due to too high a depth difference . an advantage of a non - conformal deposition in the trenches and wells to be closed is to avoid the cleaning steps to deoxidize the deep trenches and wells . another advantage of the present invention is that it enables forming at least one common etch portion which is a particularly long step in the trench and well forming , while these trenches and wells have different final destinations . of course , the present invention is likely to have various , alterations , improvements , and modifications which will readily occur to those skilled in the art . in particular , three specific types of wells and trenches having specific functions have been described herein . wells and trenches having other functions may be provided , other types of wall layers and other filling types may be provided . the practical implementation of the present invention based on the functional indications given hereabove and by using techniques currently used in the microelectronics is within the abilities of those skilled in the art . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and the scope of the present invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the present invention is limited only as defined in the following claims and the equivalents thereto .
| 7 |
[ 0026 ] fig1 shows one embodiment of the application apparatus 10 of the present invention , which is comprised substantially of a base body 12 and an application element or applicator 14 which may be carried by the base body 12 , but which is removed during use . the base body 12 comprises a socket 16 which projects upwardly from a base plate 18 when the parts are in their normal working position shown in fig2 . a channel 20 , configured as a capture rim , is disposed adjacent the socket 16 and captures the remnants of the substance which are occasionally spilled as the applicator 14 is moved away from the socket 16 . the base plate 18 is , in the illustrated embodiment , configured slightly asymmetrically . the socket 16 is disposed in the rear half of the base plate and is encircled by an edge of the base plate 18 which is comprised of a comparatively small width of , for example , 2 to 10 mm . in contrast , the front half of the base plate is substantially enlarged . it comprises , in the illustrated embodiment , an annular recess defining a grip region 22 . the front half forms a projection , as viewed with respect to the socket 16 , and extends in a substantially semi - annular shape having a width and depth of approximately the same dimension . the configuration of the one embodiment of the application apparatus permits the area around the socket 16 , which is available for hand - gripped movement of the application apparatus in narrow quarters such as , for example , in the proximity of the mouths of patients , to be maintained slim and small . due to the lateral or side widening of the projection of the base plate 18 in the grip region 22 , a set down position stability is nonetheless ensured . it is to be understood that the grip region 22 can be configured in any suitable desired manner such as , for example , of a right angled shape or a quadratic shape , each such shape having rounded - off corners . also , it is possible to provide , in lieu of a closed grip plate , a grip plate having through apertures . the socket 16 of the one embodiment of the application apparatus comprises a first receptacle 24 and a second receptacle 26 as can be seen particularly well in fig2 . the first receptacle 24 is provided with an insert 28 . the insert 28 is โ as can be clearly seen in fig2 โ inserted in a flush manner into the socket 16 . the insert comprises a bulging , substantially deep extent which , in accordance with the invention , is designated for the receipt of a fluid 30 . the fluid 30 is retained solely in the lower half of the first receptacle 24 , which is configured as a bulging depth receptacle , while the upper half of the first receptacle remains unfilled . the first receptacle 24 is , before deployment of the substance , closed off in a sealed manner by a cover foil 32 . the cover foil is fused to the insert in a conventional annular ring configuration . the cover foil comprises a grip tab or latch 34 which extends to the grip region 22 and which permits tearing or pulling off of the cover foil 32 . the first receptacle 24 has approximately double the diameter of the second receptacle 26 . the second receptacle 26 is configured for the insertion thereinto of the applicator 14 and is correspondingly configured for this purpose . the second receptacle comprises a substantially cylindrical cross - section and is configured in the manner of a blind hole . the second receptacle has a height / diameter relationship of approximately 4 : 1 , whereby it is to be understood that the exact configuration can be adjusted through a wide range to accommodate the operational requirements . in the illustrated embodiment , the applicator 14 includes a neck 40 intermediate a widened element 36 , which serves as the guide region , and a working end 38 , the neck 40 having an outer diameter which fits exactly flush in the second receptacle 26 and which , upon insertion of the applicator 14 into the second receptacle 26 , cooperates with the widened element 36 to seal off the upper end of the second receptacle 26 . the working end 38 of the applicator 14 is provided with a substance transfer element 42 which can be configured in any suitable desired manner . for example , the substance transfer element 42 can be configured as a brush , as bristles , as flocking , or as a sponge , and is preferably coated with a component of the substance which is to be applied . upon dipping or submersion of the working end 38 of the applicator into the fluid 30 , a chemical reaction occurs between the component of the substance which has previously been applied on the working end 38 of the applicator and the fluid 30 such that the chemical reaction results in the creation of the desired substance to be applied . the applicator 14 is configured in an ergonomically favorable manner while , nonetheless , having a slim shape . in this connection , the applicator includes a gripping end in the form of a shaft 44 which is grippable by hand . in connection with the use of the application apparatus 10 , the application apparatus 10 is initially disposed onto a base or counter . the socket 16 is held between two fingers and , via gripping and pulling the latch 34 , the cover foil 32 is pulled off . the securement force which retains the insert 28 in the socket 16 is chosen to be of a sufficient magnitude such that the insert remains in the socket during pulling off or removal of the cover foil 32 . the applicator 14 is then removed from the second receptacle 26 and is disposed into the first receptacle 24 . the dimensions of the applicator 14 and the first receptacle 24 are compatibly selected such that the applicator 14 can also be inserted and retained in a stable manner in the first receptacle 24 . in this connection , it is advantageous to maintain the configuration of the first receptacle 24 as a relatively slim configuration โ that is , with a comparatively large height / diameter relationship . alternatively , it is also possible to select the height of the first receptacle 24 such that , upon insertion of the applicator 14 into the first receptacle , the applicator lies against the region of the widened element 36 such that the applicator 14 is supported in a favorable manner from the side . preferably , while in this position , the application apparatus can be brought into proximity of the application location โ that is , in proximity to the mouth of the patient , via gripping of the grip region 22 or the shaft 44 between the thumb and index finger of , for example , the left hand of the user . the substance which has now been mixed in its final form via the reaction of the fluid 30 with the component on the substance transfer element 42 can now be transferred to the application location by means of the applicator in an ergonomically favorable manner from a position immediately adjacent the application location . following the application of the substance onto the application location , the application apparatus 10 can again be placed onto the planar base or counter . in order to avoid a drying out of the substance during the intermediate storage of the substance , the applicator 14 is inserted into the second receptacle 26 wherein it is sealed off against the exterior . the first receptacle 24 also permits the storage therein of the applicator . as can be seen from fig2 the first receptacle ( 24 ) and the second receptacle ( 26 ) are spaced from one another and each has a central longitudinal axis with the central longitudinal axes of the first receptacle ( 24 ) and of the second receptacle ( 26 ), preferably , being substantially parallel to one another . preferably , a substantially thick aluminum foil is used as the cover foil 32 of the first receptacle , which foil should not be an elastically deformable foil such as the foil of the type used for a compound foil application , in order to facilitate a re - closing of the receptacle . alternatively , in connection with , for example , the use of a compound foil having a comparatively good tearing resistance in relation to its material strength , an adhesive edge can be formed between the access aperture of the first receptacle 24 and the cover foil to thereby make possible a short term intermediate storage capability . in a further embodiment of the application apparatus of the present invention , a weld seam in an annular shape is disposed between the cover foil 32 and the insert 28 and is encircled by an adhesive seam between the cover foil 32 and the socket 16 . in this configuration , a re - closing of the receptacle is possible . this configuration ensures that dislodged portions of the adhesive seam are prevented from contaminating the retained fluid 30 during long term stockage of the application apparatus while nonetheless permitting an intermediate closure of the application apparatus in connection with a premature storage event as a result of less than complete consumption of the substance . while a preferred form of this invention has been described above and shown in the accompanying drawings , it should be understood that applicant does not intend to be limited to the particular details described above and illustrated in the accompanying drawings , but intends to be limited only to the scope of the invention as defined by the following claims . in this regard , the term โ means for โ as used in the claims is intended to include not only the designs illustrated in the drawings of this application and the equivalent designs discussed in the text , but it is also intended to cover other equivalents now known to those skilled in the art , or those equivalents which may become known to those skilled in the art in the future .
| 0 |
in a general aspect , the invention is an immunoassay for an analyte ( which analyte may be one of several analytes being tested for in the immunoassay ), said immunoassay a process that comprises the steps of : 1 ) reacting a sample with an antibody preparation , said sample comprising an unknown amount of analyte , said antibody reactive against said analyte , 2 ) reacting a known amount of standard with an antibody preparation of the same specificity as that used in step ( 1 ), it being required that the standard is a compound that is immunoreactive with the antibody preparation , 3 ) calculating the amount or an upper or lower limit to the amount of analyte present in the sample used in step ( 1 ), wherein the analyte is a compound that comprises at least two fused benzene rings , ( and , if the analyte consists of rings in addition to the two fused benzene rings , then preferably there are not more than six rings , and each of the additional rings is either a six atom - ring , such as benzene , or a five atom - ring such as cyclopentane , the atoms of the additional rings being selected from carbon , oxygen , nitrogen , and sulfur ), wherein a benzene ring in the analyte may be substituted at one or more of its six carbon atoms , wherein any substituent on said benzene ring that is not i , cl , br , oh , -- ch 3 , or -- no 2 , has a backbone chain that does not have more than six atoms , wherein either the standard is a compound with the structure ## str1 ## wherein r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , and r 10 , are substituents , wherein one or two of said substituents are not h ( i . e ., not hydrogen ) and the other substituents are h , and a substituent that is not h is either oh , coh ( i . e ., carboxaldehyde ), ch 2 oh , ch 2 ( ch 2 ) x oh , co 2 h , nh 2 , cn , so 3 h , no 2 , or ## str2 ## wherein the leftmost carbon is the point of attachment to the phenanthrene moiety ( a substituent that is not h is preferably either oh , coh , ch 2 oh , or ch 2 ( ch 2 ) x oh ), or the standard is a compound with a structure ## str3 ## wherein x is an integer between 1 and 12 ( preferably between 1 and 6 ). the positions on the phenanthrene moiety are numbered in the following manner : ## str4 ## in a particular embodiment , step ( 3 ) of the immunoassay above comprises three steps , 3a , 3b , and 3c : 3a ) quantitating the amount of the antibody preparation that reacted with the sample in step ( 1 ), 3b ) quantitating the amount of the antibody preparation that reacted with the known amount of standard in step ( 2 ), and 3c ) utilizing the amounts quantitated in steps ( 3a ) and ( 3b ) and the known amount in step ( 2 ) to calculate the amount or an upper or lower limit to the amount of analyte present in the sample used in step ( 1 ). in a particular embodiment , the immunoassay of the invention comprises reacting an antibody preparation with the analyte , said antibody preparation prepared by using an immunogen that comprises both anthracene and chrysene linked to a carrier ( preferably a protein ) or carriers . preferably the analyte has a 50 % b / bo that is not more than four times the 50 % b / bo of phenanthrene and not less than one fifth the 50 % b / bo of phenanthrene . the immunoassay is particularly useful when the analyte is part of a mixture selected from the group , creosote , diesel fuel , fuel oil ( 1 , 2 , 3 , 4 , 5 , 6 ), coal tar and home heating oil . in a preferred embodiment of the invention , the immunoassay is one wherein the standard is a substantially pure preparation of a single compound . however , the standard may , for example , be a mixture of one or more substantially pure compounds , said mixture constructed by mixing together portions of substantially pure preparation of said compounds . a substantially pure preparation of a compound is one in which substantially all of the compounds have the same structure . a substantially pure preparation is therefore different from home heating oil or other mixtures of compounds . the immunoassay of this invention is an assay for an analyte that may be one of several analytes detectable in the assay . the fact that the immunoassay can test for more than one analyte at the same time is because of the crossreactivity of the antibody used in the assay . in example 2 , below , a number of pahs will be seen to have reactivity to the antibody used in the immunoassay . ( such cross - reactivity occurs in pah immunoassays in general , not just the one exemplified herein .) therefore , if the nature of the analyte in the sample is unknown , then for each possible analyte one can only assign an upper limit to the concentration of that analyte . alternatively , for example , if the color ( or other response ) generated in a competitive immunoassay is greater than the amount generated by a standard then the assay provides a lower limit ( that of the standard ) to the amount of analyte . for many purposes , however , such information is sufficient to determine the extent and degree of contamination , to delineate pollutant plumes in ground water , to monitor well placement , and for preliminary identification and quantitation of pollutants . a highly preferred standard is phenanthrene - 9 - carboxaldehyde , which is commercially available from aldrich chemical company , milwaukee , wis . and chem service , west chester , pa . the standards chosen for superior stability are ones expected to show both cross - reactivity with the antibody and good solubility in the co - solvents used to store them . the immunoassays to which the present invention is applicable include : ( 1 ) competition assays where the analyte competes with a detectable conjugate ( e . g ., as used in the examples , an antibody - reactive moiety linked to an enzyme that can catalyze a reaction generating a colored compound ) for binding sites provided by an antibody and detection is accomplished by measuring the decrease in the amount of detectable conjugate bound to the antibodies ; ( 2 ) non - competition assays , where the analyte does not have to compete for such binding sites and the antibody is labelled with a detectable label ; ( 3 ) sandwich assays , where one anti - analyte antibody acts as a bridge to bind the analyte to a solid phase , and detection is accomplished with a detectably - labelled second anti - analyte antibody that is allowed to attach the solid phase - bound analyte ; or ( 4 ) any other immunoassay format . indeed the term &# 34 ; immunoassay &# 34 ; is intended here in a very general sense and is any assay in which an antibody specific for an analyte of interest is used . nevertheless , for the smallest analytes , sandwich assays may be difficult because of the need for two antibody binding sites . the antibodies may be polyclonal or monoclonal . the use of hybridomas to create monoclonal antibodies is well known in the art . the fact that polyclonal antibodies against a compound can be created is an indicator that a monoclonal antibody against that compound can be created . detectable labels include enzymatic , fluorescent , radioactive , and chemiluminescent labels . the labels may be linked directly to other molecules of interest , such as antibodies , or indirectly by streptavidin - biotin linkages or other linkages . the labels may be bound directly to the antibodies or conjugates , or alternatively , be generated from substrates by enzymes attached to antibodies or substrates . preparation and structure of the immunogen used to make the antibodies used in the examples 2 - succinamidoanthracene was synthesized as follows : 2 - aminoanthracene was reacted with succinic anhydride in dioxane at 90 ยฐ c . for 3 hours . on cooling to room temperature , the crystals formed were collected by suction filtration . the product was 2 - succinamidoanthracene . 6 - succinamidochrysene was synthesized as follows : 6 - aminochrysene was reacted with succinic anhydride in dioxane - dmf ( 4 : 1 ) at 60 ยฐ- 70 ยฐ c . for 4 hours . water was then added and the solution allowed to stand at room temperature ( about 20 ยฐ c .) overnight . the solid obtained was collected by suction filtration . the product was 6 - succinamidochrysene . the ligand ( 0 . 6 mmole ), either 2 - succinamido anthracene or 6 - succinamido chrysene in 10 ml of dry dimethylformamide (&# 34 ; dmf &# 34 ;), was treated with 2 . 4 ml of 0 . 25m triethylamine . the solution was cooled in ice - water , then 2 . 4 ml of 0 . 25m iso - butyl chloroformate was added and after 10 min the reaction solution was removed from the ice - water bath . after a total of 30 min of reaction time , the solution was added dropwise to a stirred and ice - cold solution of 300 mg carrier protein dissolved in 45 ml of 0 . 2m sodium borate , ph 8 . 7 and 30 ml of dmf . cooling was maintained in an ice - water bath . the addition of the activated ligand required about 10 min . one hr after the complete addition , the solution was removed from the ice - water bath and stirred at room temperature another 2 hr . dialysis was carried out against 0 . 1m sodium borate , ph 8 . 7 , and then against two changes of water , all at 4 ยฐ c . the product was freeze dried . the immunogens were injected into rabbits and the antibodies were prepared as follows : the immunogen was dissolved or suspended in sterile saline to a concentration of 4 mg / ml . it was mixed with an equal amount of freund &# 39 ; s complete adjuvant and then emulsified . on day 1 , a total of 0 . 5 ml of the emulsion was injected into the hip muscle of the rabbit and a control bleed was done . on day 20 , the back of the animal was shaved and , in 6 - 8 sites , a total of 0 . 5 ml of emulsion was injected . on day 30 , a test bleed was done . on day 45 , the immunization of day 20 was repeated . on day 55 , a test bleed was done . the immunization described for day 20 is repeated at 30 - day intervals using freund &# 39 ; s incomplete adjuvant . the interval is lengthened if antibody production was inadequate or the animal was distressed . the animal was bled 7 - 10 days after immunization ( 30 - 50 ml ). bleeds were then screened for cross - reactivity to the various pahs and selected bleeds from the anthracene and chrysene immunized rabbits were pooled to obtain a pool of rabbit anti - pah antisera with broad specificity against pahs . the anthracene ligand , 2 - succinamido anthracene ( 10 mg ), was dissolved in 0 . 5 ml dmf and placed in an ice - bath . tributylamine ( 80 ฮผl ), followed by isobutylchloroformate ( 40 ฮผl ) were added to the ligand solution . stirring for 30 minutes at 8 ยฐ- 12 ยฐ c . followed . the reaction mixture was then centrifuged to remove any precipitates . added ( 124 ฮผl ) of the anhydride formed to 500 ฮผl of a 3 mg / ml hrp ( horse radish peroxidase ) solution in carbonate buffer , ph 9 . 0 , and stirred overnight at 4 ยฐ c . the reaction mixture was then centrifuged and the supernatant purified through a sephadex g - 25 column using pbs , ph 5 . 0 ( phosphate buffered saline , 25 mm phosphate , 150 mm sodium chloride , ph 5 . 0 ) as the mobile phase . attachment of the rabbit anti - pah antibodies to magnetic particles was done as follows : one ml of a 50 mg / ml suspension of biomag 4100 amine - terminated particles ( perseptive diagnostic , cambridge , mass .) was activated with 5 % ( v / v ) glutaraldehyde in 2 ml of 0 . 01m mes buffer , ph 6 ( mes is 2 - n - morpholine ) ethanesulfonic acid ) for 3 hours . unreacted glutaraldehyde was removed by washing four times with 5 ml of 0 . 01m mes buffer . goat anti - rabbit igg was diluted to an antibody concentration of 5 mg / ml and 1 ml was reacted with the activated magnetic particles by shaking for 16 hours . a 1m glycine solution was then used to quench any unreacted sites for 30 minutes . the particles were washed four times with 5 ml of tris buffered saline with 0 . 1 % bovine serum albumin ( bsa ), ph 7 . 4 and diluted in tris buffered saline with 0 . 1 % gelatin , ph 7 . 4 to achieve an iron concentration of 12 - 15 mg / ml . rabbit anti - pah antisera was then added at a 1 : 30 , 000 dilution and incubated for at least 30 minutes to allow coupling . the sample to be tested was added , along with the enzyme conjugate , to a disposable test tube followed by the addition of paramagnetic particles with analyte - specific antibodies attached . at the end of an incubation period , a magnetic field was applied to hold the paramagnetic particles ( with analyte and enzyme - conjugate bound to the antibodies on the particles , in proportion to their original concentration in the tube ) in the tube and allow the unbound reagents to be decanted . after decanting , the particles were washed with washing solution . the presence of analyte was detected by adding the enzyme substrate ( hydrogen peroxide ) and the chromogen ( 3 , 3 &# 39 ; 5 , 5 &# 39 ;- tetramethylbenzidine ). the enzyme - conjugate bound to the anti - analyte antibody catalyzes the conversion of the substrate / chromogen mixture to a colored product . after an incubation period , the reaction was stopped and stabilized by the addition of acid . since the conjugate was in competition with the unlabeled analyte for the antibody sites , the color developed was inversely proportional to the concentration of analyte in the sample . the anti - analyte antibody was a rabbit antibody covalently bound to paramagnetic particles , which were suspended in 150 mm tris , 150 mm nacl , 1 mm edta , 0 . 1 % gelatin , with 15 ppm active proclin ( manufactured by rohm and haas , purchased from supelco ), ph 7 . 4 . the enzyme - conjugate was in 25 mm sodium acetate , 150 mm nacl , 4 mm dns , 0 . 1 mm luminol , 0 . 1 % gelatin with 15 ppm active proclin , ph 5 . 0 . each standard , calibrated to have an immunoreactivity equivalent to specific total phenanthrene concentrations , was in 25 mm sodium acetate , 150 mm nacl , 0 . 1 % gelatin , with 15 ppm active proclin containing 25 % methanol , ph 5 . 0 . a solution containing 25 % methanol can be made , for example , by adding 25 ml of methanol to 75 ml of an aqueous solution containing the other ingredients needed to make the desired final solution . the diluent / zero standard was 25 mm sodium acetate , 150 mm nacl , 0 . 1 % gelatin , with 15 ppm active proclin containing 25 % methanol , ph 5 . 0 but without detectable analyte . the color solution used in the examples was obtained as a 3 , 3 &# 39 ;, 5 , 5 &# 39 ;- tetramethylbenzidine / peroxide system from kirkegaard and perry laboratories ( gaithersburg , md .). the washing solution was deionized water with 0 . 05 % triton x - 100 with 15 ppm active proclin . a photometer was used to absorb the absorbance at 450 nm . all reagents were allowed to come to room temperature and the antibody - coupled paramagnetic particles were mixed thoroughly just prior to pipetting into the assay . the magnetic separation rack consisted of two parts : an upper rack which securely held the test tubes and a lower separator which contained the magnets used to attract the antibody - coupled paramagnetic particles . during incubations , the upper rack was removed from the lower separator so that the paramagnetic particles remained suspended during the incubation . for separation steps , the rack and the separator were combined to pull the paramagnetic particles to the sides of the tubes . the rack was decanted by inverting it away from the operator using a smooth turning action so that the liquid flowed consistently along only one side of the test tube . while still inverted , the rack was placed on an absorbent pad and allowed to drain . the rack was lifted replaced gently onto the pad several times to insure complete removal of the liquid from the rim of the tube . the total time required for pipetting the magnetic particles was kept to two minutes or less . 1 . 250 ฮผl of either standard or control was added to each tube . 2 . 250 ฮผl of enzyme conjugate was added to each tube . 3 . the antibody - coupled paramagnetic particles were mixed thoroughly and 500 ul of them were added to each tube ( the stock solution was diluted to obtain a concentration of 12 - 15 mg iron / ml in 150 mm tris , 150 mm nacl , 1 mm edta , 0 . 1 % gelatin with 15 ppm proclin , ph 7 . 4 , and 500 ul was added to each tube ). 4 . tubes were vortexed for 1 to 2 seconds minimizing foaming . 5 . tubes were incubated for 30 min at room temperature ( 15 ยฐ- 30 ยฐ c .). 6 . tubes in the magnetic rack were placed over a magnetic base for two minutes . 7 . the tubes were decanted and gently blotted briefly in a consistent manner . 8 . one ml of washing solution was added to each tube , the tubes are vortexed for 1 - 2 seconds , and the tubes were allowed to remain in the separation rack for two minutes . 9 . the tubes were decanted and gently blotted briefly in a consistent manner . 11 . the rack was removed from the separator and 500 ฮผl of color solution was added to each tube . 12 . vortexing was done for 1 to 2 seconds minimizing foaming . 14 . 500 ฮผl of stopping solution was added to each tube . 15 . the results were read at 450 nm within 15 minutes after adding the stopping solution . it is recommended that , in general , precision pipets capable of delivering 250 ul and 500 ฮผl , and a 1 . 0 ml repeating pipet be used ; that reagents are added directly to the bottom of the tube while avoiding contact between the reagents and the pipet tip ; that clean pipets be used for each sample ; and that contact between reagent droplets on the tubes and pipet tips be avoided . to minimize loss of volatile compounds , the sample , conjugate and particle addition steps are performed in as timely a fashion as possible . a thermolyne maxi mix , scientific industries vortex genie , or equivalent vortex mixer may be used . data can , if desired , be analyzed by a commercially available data storer and analyzer , such as the ohmicron rpa - i analyzer available from ohmicron , newtown , pa . 18940 . such automated analyzers are used to make direct optical readings and use a microprocessor to convert optical readings to sample concentrations by comparing the results to those obtained with calibration curves . for use in the field , the sample to be tested for analyte concentration is water or diluted soil extract . water samples are collected in glass containers with teflon caps and diluted 3 : 1 with methanol ( 3 parts water and 1 part methanol ). soil samples may be analyzed by extracting them with calcium chloride in 100 % methanol and then diluting them 1 : 50 in diluent . samples containing gross particulate matter are filtered ( e . g ., with 0 . 2 ฮผm anotop ยฎ 25 plus , whatman , inc .) to remove particles . if the analyte concentration of a sample exceeds 50 ppb of phenanthrene or its immunoreactive equivalent , the sample is subject to repeat testing using a diluted sample . prior to assay , a ten - fold or greater dilution of the sample is recommended with an appropriate amount of diluent / zero standard and mixing thoroughly . although not used in the examples , a control sample is recommended for routine use of the immunoassay . the control , calibrated to have an immunoreactivity equivalent to a concentration of approximately 25 ppb phenanthrene , is in 25 mm acetate , 150 mm nacl , 0 . 1 % gelatin , 25 % methanol , with 15 ppm active proclin , ph 5 . 0 . the control sample can be used to determine whether the assay is providing the correct value for analyte concentration . a standard curve is constructed by plotting the % b / b o for each standard on vertical logit ( y ) axis versus the corresponding analyte concentration on a horizontal algorithmic ( x ) axis . the % b / b o for controls and sample will then yield levels in ppb of analyte by interpolation using the standard curve . standards were prepared by weighing 100 +/- 1 mg of phenanthrene and dissolving it in 10 . 0 ml of dmf ( dimethylformamide ). this 10 mg / ml solution was diluted 1 . 0 ml into 100 ml methanol for a 100 ฮผg / ml solution . the 100 ฮผg / ml solution was then diluted 1 . 0 ml into 100 ml of diluent ( 25 mm sodium acetate , 150 mm nacl , 0 . 1 % gelatin , 25 % methanol , 15 ppm proclin ) to provide a 1 ฮผg / ml solution . standards were prepared from the 1 ฮผg / ml solution volumetrically at 2 , 10 , and 50 ppb by dilution with diluent . phenanthrene has a 50 % b / bo of 16 . 5 ppb and phenanthrene - 9 - carboxaldehyde has a 50 % b / bo of 13 . 0 ppb . phenanthrene - 9 - carboxaldehyde solutions were prepared by first preparing a 10 mg / ml solution of that compound in dmf . this 10 mg / ml solution was then diluted 1 . 0 ml into 100 ml methanol for a 100 ฮผg / ml solution . the 100 ฮผg / ml solution was then diluted 1 . 0 ml into 100 ml of diluent to provide a 1 ฮผg / ml solution from which standards were prepared at 1 , 7 . 5 and 50 ppb of phenanthrene - 9 - carboxaldehyde by dilution with diluent . stability studies were conducted by aliquoting prepared standards ( 0 , 2 , 10 and 50 ppb for phenanthrene and 0 , 1 , 7 . 5 and 50 ppb for phenanthrene - 9 - carboxaldehyde ) into 5 ml glass vials at a volume of 2 . 5 ml . the vials were then capped with teflon coated caps and crimped . the vials were then separated into five groups . each group was then placed at a different temperature (- 20 ยฐ c ., 2 ยฐ- 8 ยฐ c ., 20 ยฐ- 25 ยฐ c ., 37 ยฐ c . and 50 ยฐ c .) in an upright position . standards were tested for b / bo at specified intervals by assaying each standard level in duplicate for each temperature . the results were then graphed as a function of time ( x ) versus b / bo ( y ) by temperature level . ( see fig1 - 5 ) ( b / bo is the absorbance at 450 nm observed for phenanthrene or phenanthrene - 9 - carboxaldehye at the specified concentration divided by the absorbance using diluent / zero standard instead of either phenanthrene or phenanthrene - 9 - carboxaldehyde .) the results show that the b / bo of phenanthrene - 9 - carboxaldehyde shows less change as a function of time of storage than the b / bo of phenanthrene does . the superior stability of the phenanthrene - 9 - carboxaldehyde solutions becomes more marked as the temperature of storage is increased . in fig2 . for example , there was an apparent 25 percent increase in the b / bo of the phenanthrene after 200 days of storage at 4 ยฐ c . because , as illustrated in example 3 , there is not a linear relationship between b / bo and concentration of a standard ( or analyte ), a 25 % error in b / bo will result in considerably more than a 25 % error in the analyte concentration determined by the immunoassay . the cross - reactivity , of the antibodies used in the assay , for various hydrocarbons was tested and the results expressed both as 50 % b / bo and as least detectable dose ( ldd ) which is estimated as the dose needed to generate a b / b o of 90 %. ( if the mean absorbance value for the standard is 0 . 5 times the mean absorbance value for the diluent / zero standard then the % b / b o is 50 % and the concentration of standard used is the 50 % b / b o concentration . a b / bo of 90 % means b equals 0 . 9 times b o ). the results are tabulated in table 1 : table 1______________________________________cross - reactivity studies ldd 50 % b / bocompound ( ppb ) ( ppb ) ______________________________________phenanthrene 0 . 70 16 . 5fluoranthene 0 . 32 4 . 7benzo ( a ) pyrene 0 . 50 6 . 9pyrene 0 . 20 7 . 7chrysene 0 . 40 7 . 8anthracene 0 . 54 11 . 0indeno ( 1 , 2 , 3 - c , d ) pyrene 0 . 78 27 . 21 , 2 benzoanthracene 0 . 77 28 . 4fluorene 1 . 65 35 . 2benzo ( b ) fluoranthene 0 . 91 54 . 2benzo ( k ) fluoranthene 0 . 77 524______________________________________ an example of a curve plotting the % b / b o for a standard on vertical logit ( y ) axis versus the corresponding analyte concentration on a horizontal algorithmic ( x ) axis is shown in fig6 . the curve is for phenanthrene . the value for 50 % b / b o is 16 . 5 ppb . four environmental water sources ( two ground waters and two municipal waters ) were each spiked with four different amounts of phenanthrene then , using phenanthrene - 9 - carboxaldehyde as a standard , each sample was analyzed with the immunoassay for phenanthrene as if the phenanthrene concentration was unknown . for each amount of spiked phenanthrene , the mean of the phenanthrene value obtained with the immunoassay for the four samples was calculated , as was the standard deviation ( s . d .) and the % recovery . the results are shown in table 2 . table 2______________________________________recovery studiesphenanthrene mean s . d . % added ( ppb ) ( ppb ) ( ppb ) recovery______________________________________ + 5 . 0 5 . 09 0 . 58 102 + 7 . 5 8 . 13 0 . 56 108 + 20 . 0 21 . 46 2 . 47 107 + 40 . 0 40 . 91 2 . 99 102______________________________________
| 8 |
detailed descriptions of one or more embodiments of the invention follow , examples of which may be graphically illustrated in the drawings . each example and embodiment are provided by way of explanation of the invention , and not meant as a limitation of the invention . for example , features or described as part of one embodiment may be utilized with another embodiment to yield still a further embodiment . it is intended that the present invention include these and other modifications and variations . fig1 is a perspective view taken from the left side from the ground standing upwind of the tethered wind turbine constructed in accordance with the invention . the funnel shaped front inlet ( 14 ) is shaped with an annulus ( 12 ) that directs the oncoming apparent wind into the interior . the lighter - than - air device is passively stabile . it has an elongated airfoil shape . stability is facilitated by , but not limited to , the overall shape of the lighter - than - air device , or in one embodiment , passive stabilizer aerodynamic surfaces such as non - articulating horizontal , vertical , v - shaped or ring - wing stabilizers . a lower portion of the invention has attachment brackets ( 18 ) that are used to connect the harness ( 20 ) and tether ( 22 ) to the main body casing ( 10 ). large quantities of wind pass through the inlet ( 14 ), the turbine area of the tethered wind turbine , finally exiting the invention through the outlet ( 16 ). the energy harvesting invention is lighter than air and thus remains aloft in various wind conditions . fig2 is a perspective view taken from the right side from the ground standing upwind of the tethered wind turbine constructed in accordance with the invention . the wind entering the inlet ( 14 ) passes over the energy converter . energy extraction is facilitated by an energy converter such as and for example a turbine ( 24 ) or an impeller rotor ( 26 ) or the like . in this embodiment turbine ( 24 ) is shown near the narrowest part of the hourglass - like internal shape . fig3 is a longitudinal cross sectional view of the tethered wind turbine drawn in accordance with the invention . both the interior and exterior surface profiles , as shown in this view , are designed to be as aerodynamically efficient as is feasible . in the preferred embodiment of this invention the ring - wing section profile optimally would have a very low coefficient of drag . a large portion of the physical aerodynamic shape of the tethered wind turbine is filled with a lifting gas ( 40 ), such as helium . this lifting gas is contained within sealed inflated structures ( 42 ) made from polymers such as aluminized polyester film , polyethylene , or other film . the entire tethered wind turbine may also use an exterior lightweight flexible or lightweight rigid exterior skin to act as a shape structure and to protect the tethered wind turbine from the deteriorating effects of ultraviolet solar radiation . one flexible film that would work well for this purpose in this invention is tedlar ( dupont ) film . a rigid material for the exterior could be composite material such as carbon fiber matrix or carbon nanotubes matrix . the tethered wind turbine has an intake flow concentrator nozzle ( 32 ) just to the interior of the leading edge annulus ( 12 ). there is a flow expansion nozzle ( 34 ) at the outlet ( 16 ) of the invention . between the concentrator and expansion nozzles there is an energy converter such as and for example a turbine ( 24 ) that energizes an electric generator ( 28 ). it is also envisioned , though not shown , that other types of energy converter devices could be used . for example , one concept envisioned in this invention is to directly convert the rotary motion into electricity and use it onboard the tethered wind turbine to separate water into hydrogen and oxygen through electrolysis , delivering the valuable gases to the ground station through a tubular tether ( or a multi - tubular tether ), without any conductive wires at all . the hydrogen could be stored in containment vessels on the ground and used for any number of useful purposes . the structure of the tethered wind turbine is achieved by several elements . the structural ribs ( 46 ) support the overall shape of the tethered wind turbine and spread the loads of the turbine &# 39 ; s ( 24 ) and generator &# 39 ; s ( 28 ) mass into the craft in a stable manner . in one embodiment , a light weight way to create the structure of the annulus ( 12 ) is shown , using an inflated toroidal structure ( 44 ) that is filled with pressurized lifting gas ( 40 ). there are many ways to achieve the necessary structure , and what is shown is meant to be an example of one embodiment of the invention . the rotor impeller ( 26 ) is fitted with a streamlined impeller nosecone ( 36 ) and impeller tail cone ( 38 ). the electric generator ( 28 ) can be any combination of magnetic rotor or magnetic stator designs , either brush or brushless , and made of a variety of materials . the preferred embodiment would use ultra - light - weight rare earth permanent magnets with brushless dc components and windings that could possibly consist of carbon nanotube hyper - conductive wires in place of copper to save even more weight . there are conductive generator output wires ( 76 ) connecting the generator to the harness ( 20 ). the harness ( 20 ) is secured to the tethered wind turbine at attachment brackets ( 18 ). said attachment brackets ( 18 ) could be hard mounted to the internal structure or physically attached or bonded to the outer skin of the tethered wind turbine . the harness ( 20 ) can be rigidly attached , or mounted in such as was as to allow controllable adjustments by mechanical servo - actuators . one embodiment of this feature , a harness pitch adjustor ( 50 ), is shown and is a way to control the tethered wind turbine &# 39 ; s angle of attack by lengthening or shortening the central member of a three point harness ( 20 ). the control box ( 48 ) is the central brain for the onboard functionality of the tethered wind turbine , controlling such as the harness pitch adjustor ( 50 ), the flight settings , the generator loading , and any aerodynamic control surfaces , etc . fig4 is a perspective front view of the tethered wind turbine and shows an embodiment of the invention that includes a vertical stabilizer ( 52 ) mounted at the top and to the rear of the craft . the full front of the impeller rotor ( 26 ) and impeller nose cone ( 36 ) are visible and are described visually as having 5 blades . any number of impeller rotor ( 26 ) blades would be acceptable and part of the intent of this invention . the outer casing ( 10 ) of the lighter - than - air is shown , as well as the flow concentrator nozzle ( 32 ) and the annulus ( 12 ). attachment brackets ( 18 ) secure the harness ( 20 ) to the tethered wind turbine . the harness ( 20 ) is also shown secured to the tether ( 22 ). fig5 is a perspective left side view of the tethered wind turbine . showing an embodiment built in accordance with the invention that uses a number of aerodynamic lifting and control surfaces to enhance the overall stability and performance of the wind energy extracting craft . vertical stabilizer ( 52 ) and horizontal stabilizers ( 56 ) act to further help keep the longitudinal axis of the turbine ( 24 ) aligned with the apparent wind direction . these aerodynamic surfaces can be either passive , or actively controlled with the use of stabilizer control surfaces ( 54 ). a wing ( 58 ) is shown in this embodiment and can add additional lift to the tethered wind turbine to help it remain at altitude even when the wind conditions attempt to blow the craft downwind and downward . wing control surfaces ( 60 ) are shown and help control roll as needed . these control functions are envisioned to be fully controlled by the onboard control module ( 48 ). fig6 a , 6 b , and 6 c show the tethered wind turbine as a system that is managed from a base shelter structure ( 68 ). this base shelter structure ( 68 ) would be pre - built and carried to the site or it could be built on the site . it would also be installed atop housing or buildings or concealed below grade . fig6 a is a left - side perspective with cutaway view of the tethered wind turbine and base shelter structure ( 68 ) showing the invention in operation . the tethered wind turbine is flying at a reasonable height above the ground , downwind of the base shelter structure ( 68 ), and is constrained by the tether ( 22 ). the craft can be expected to float freely downwind in any direction as a result of changes in true wind direction . the total airspace occupied by the tethered wind turbine in the long term can be described as an inverted cone emanating from the tether main attachment at the robotic control torus ( 72 ). the top diameter and half angle of the inscribed cone is dependent on many variables such as the total buoyancy force of the invention , maximum wind speed , amount of active flight controls used to maintain altitude , and active tether extension / retraction deployed , and turbine generator load levels . to send the tethered wind turbine to a higher or lower altitude while in flight , the tether ( 22 ) is unwound or wound - up on the tether retractor reel ( 74 ) by the tether retractor mechanism ( 64 ). the cutaway view of the base shelter structure ( 68 ) also shows a wish - bone launch arm ( 100 ) that swings up when the tethered wind turbine is about to be launched and also swings down when the craft is retrieved and tucked into the base shelter structure ( 68 ) for safe storage . this wish - bone launch arm ( 100 ) mechanism may be shaped differently , such as having one leg instead of the wish - bone shape , but all versions act as a lever to initially move the tethered wind turbine up out of the base shelter structure ( 68 ) or down within the its walls . the entire base shelter structure ( 68 ) sits on a site pad ( 98 ). fig6 b is a perspective cutaway view of the tethered wind turbine near the middle phase of the launching process , or the retrieving for storage process . in the latter , the tethered wind turbine has been pulled down out of the sky to a point where the harness ( 20 ) touches and interacts with the robotic control torus ( 72 ). it shows the base shelter structure ( 68 ) with its hinged bay doors ( 92 ) opened wide . the wish - bone launch arm ( 100 ) is in the upright position and the launch arm actuators ( 102 ) are fully extended . energizing the reel motor ( 66 ) causes the rotation of the tether retraction reel ( 74 ), which is bi - directional in this embodiment of the invention . it rolls the tether retraction reel ( 74 ) in one direction to wind - up ( retract ) the tether ( 22 ) and rotates the reel in the opposite direction to unwind the tether ( 22 ), allowing the buoyant tethered wind turbine to ascend upward into the airspace above . the control of the reel motor ( 66 ) is accomplished with the logic that is built into the retractor control module ( 62 ). also shown are the reel - to - power box cables ( 78 ) that deliver electricity from the tether ( 22 ) to the power control / conditioning box ( 70 ) where the electrical characteristics are tailored to meet desired output specifications of a particular application . power from the tethered wind turbine invention is delivered to the end use through the output plug box ( 96 ). fig6 c is a perspective left - side cutaway view of the entire tethered wind turbine and base shelter structure ( 68 ) as a system that has been put into the storage mode where the inflated casing ( 10 ) and other components are safe from excessive weather conditions such as lightning , turbulent high winds , and wintry blizzards . in this state , the tether ( 22 ) is fully wound - up by the tether retractor mechanism ( 64 ) onto the tether retractor reel ( 74 ). the wish - bone launch arm ( 100 ) is in the lower position and the launch arm actuators ( 102 ) are fully retracted . the hinged bay doors ( 92 ) are shown in the closed position . meteorological sensors ( 104 ) on the base shelter structure ( 68 ) monitor the air - space and keep the tethered wind turbine safely contained until conditions are appropriate for launching in the future . fig6 d is a perspective detail view of the tether ( 22 ) itself . within the outer casing ( 82 ) of the tether are two critical components . they are the main tensile members ( 84 ) and the electrical wires . both the positive conductor wires ( 86 ) and negative conductor wires ( 88 ) are sheathed in an insulation jacket that prevents short - circuiting and power drainage . ideally , the main tensile members ( 84 ) and the positive conductor wires ( 86 ) and negative conductor wires ( 88 ) would be comprised of carbon nanotubes materials . although these materials are not a requirement , the use of carbon nanotubes materials in these components of the tether ( 22 ) would greatly enhance the overall performance of the tethered wind turbine . that is because the tether ( 22 ) itself is a parasitic weight loss acting against the tethered wind turbine &# 39 ; s buoyancy . carbon nanotube materials would make the tether ( 22 ) itself many times lighter and allow the tethered wind turbine to fly much higher using less lifting gas ( 40 ). electrical conductance of nanotube wires would be many times higher than copper and would enhance overall efficiency greatly . in lieu of carbon nanotubes materials , many other materials would also work well . some examples are copper core conductors , spectra โข fiber tensile members , kevlar โข fiber tensile members , or polyester fiber tensile members . fig7 a , 7 b , and 7 c are longitudinal cross - sectional views that show how pitch attitude of the tethered wind turbine interacts with the apparent wind . in fig7 a the aerodynamic shape of the inflated casing ( 10 ) is a ring - wing that is in a neutral angle of attack . fig7 b shows the tethered wind turbine in a negative angle of attack ( 106 ). this maneuver is accomplished by various means . shown in this view the harness pitch adjustor ( 50 ) has let out some length of the central line of the harness ( 20 ) causing the buoyant rear end of the inflated casing ( 10 ) to be moved upward relative to the front end . in this state the flying ring wing is going to descend . another way to accomplish this negative angle of attack ( 106 ) is by using the aerodynamic control surfaces of the horizontal stabilizer ( 56 ) or the wing control surface ( 60 ). conversely , as is shown in fig7 c , the harness pitch adjustor ( 50 ) has pulled in the central line of the harness ( 20 ) causing the rear end of the inflated casing ( 10 ) to be moved downward relative to the front end . this positive angle of attack ( 108 ) would cause the flying ring - wing tethered wind turbine to ascend , and allow the energy harvesting turbine system to increase electrical output without as much loss of altitude . the higher loading of the turbine would mean more total drag on the impeller rotor ( 26 ), and a tendency to descend . this could be balanced - off or improved by calling for an even larger positive angle of attack ( 108 ) maneuver , and a tendency to ascend . fig8 a is a perspective left - side view of the tethered wind turbine showing how in one embodiment of the invention a tubular tail boom ( 110 ) could be used to mount rear stabilizer wing surfaces . fig8 b is a longitudinal cross - sectional view of the wind turbine of fig1 and 2 , showing how the fluted tail section ( 112 ) could be built to allow outlet air ( 114 ) to exit through slots in the tail boom section itself . fig9 a shows a longitudinal cross - section of the wind turbine of fig1 and 2 that has a elongated profile of the airfoil - shaped inflated casing ( 10 ) of the invention . fig9 b is a potential shape that embraces a very short longitudinal airfoil profile of the inflated casing that may be efficacious due to its large annulus ( 12 ) outside diameter relative to its turbine diameter and air outlet ( 16 ) outside diameter . a prominent feature of this embodiment of the invention is the large concentration ratio of the front inlet ( 14 ) flow concentrator nozzle ( 32 ). it appears the concentration ratio is nearly 6 to 1 , or higher . fig9 c shows almost the opposite inlet ( 14 ) style . that is , it shows a very minor attempt to concentrate the wind at the inlet ( 14 ) flow concentrator nozzle ( 32 ). the concentration ratio is nearly 1 to 1 . fig9 d is a longitudinal cross - sectional view of yet a different section shape and construction style . in this view the bulk of the lifting gas ( 40 ) within the inflated casing ( 10 ) is located in the annulus ( 12 ) of the front inlet ( 14 ). the remainder of the flow concentrator nozzle ( 32 ) in this embodiment is analogous to a wind - sock , comprising a thin cone - shaped wall , whether of rigid or flexible material . as with a wind - sock , the cone - shape become more pronounced by the wind flowing through it , all of these gas inflated structures and many more could be designed and manufactured without materially or significantly diverging from the scope of this invention . fig1 and fig2 show the component of the tethered wind turbine invention that extracts energy from wind currents . the inflated casing ( 10 ) is filled with helium or other lifting gas ( 40 ) which makes the tethered wind turbine lighter than air . it also is shaped to scoop - up and aerodynamically force large amounts of air to move through its own interior . the inflated casing ( 10 ) is shaped like an airfoil wing that has been bent all the way around into a ring . at the front , a funnel - shaped inlet ( 14 ) is surrounded with an annulus ( 12 ) at the leading edge . together they direct oncoming apparent wind into the central part of the ring - wing shape and into a smaller and smaller opening . the wind then passes into the mouth of a rotary engine turbine ( 24 ), and finally exits out the rear outlet ( 16 ) to return to the atmosphere . the flow concentrator nozzle ( 32 ) gradually directs a large cross - sectional area of slower - moving air to a smaller cross - sectional area , but higher velocity duct full of air . the laws of aerodynamics say that air moving two times faster will carry eight times more energy . it is apparent that an aerodynamically shaped device that can concentrate and accelerate the apparent wind in a controlled manner will be very helpful in extracting energy from the wind . it is the intent of this invention to use the flow concentrator nozzle ( 32 ) to make a large cross - sectional area of slower - moving air to move through a smaller cross - sectional area at a higher velocity through the turbine ( 24 ). this reduces the size of the physical hardware of the turbine ( 24 ) and enables it to operate at a higher speed without the need for an up - ratio gear - box . fig3 shows that the turbine ( 24 ) is mounted centrally in the inflated casing ( 10 ). air currents can flow through it imparting energy to the turbine ( 24 ). the kinetic energy of a flowing fluid ( 30 ), such as flowing wind or running water or the like , is converted into mechanical or electrical energy by causing the blades of the impeller rotor ( 26 ) on the turbine ( 24 ) to rotate as it passes through . output of electrical energy harvested from the wind will be maximized when the wind throughput of the turbine is maximized . so every effort to streamline the interior surfaces is very important and has been attempted to be shown in this preferred embodiment of the invention . in most places on earth , the wind speed , and thus potential kinetic energy that could be harvested is distributed in a gradient relative to ground , which could be described as increasing as one moves to a higher altitude . unlike most windmills currently available , the tethered wind turbine of this invention operates without a tower . it simply does not need a tower . the preferred embodiment of this invention uses a tether ( 22 ) to hold the inflated casing ( 10 ) and its turbine ( 24 ) from sailing downwind with the force of available winds . the tethered wind turbine also has no need for a complicated rotating nacelle as is currently used in the prior art to align properly with the direction of the true wind . the tethered wind turbine has a unique ability to keep itself aligned properly to the wind automatically , even in changing wind conditions . the inflated casing ( 10 ) will naturally drift to the most downwind position in the sky , being restrained only by the tether ( 22 ). just like the rudder on an airplane , the invention directs itself in response to the changing wind &# 39 ; s direction . fig6 a is a view looking downwind at the invention while it is operating . the tether ( 22 ) can be let - out , or pulled - in , in a controlled way so as to position the inflated casing ( 10 ) in the most favorable part of the natural wind velocity gradient . that is an altitude where the energy extracted from the wind can be maximized . as is shown in fig6 a , 6 b , 6 c the tethered wind turbine invention uses a base shelter structure ( 68 ) to store the lighter - than - air device during inclement weather conditions , violent lightning , periods of non - use , or for routine maintenance . fig6 a shows the tether ( 22 ) after it has been let out and the hinged bay doors ( 92 ) are closed . the retractor control module ( 62 ) remains idle while the production of energy aloft in the turbine ( 24 ) proceeds uninterrupted . the electrical power sent down the tether ( 22 ) travels through the tether retractor mechanism ( 64 ), through the reel - to - power box cables ( 78 ), and into the power conditioner box ( 70 ). at this stage the electricity is adjusted to a form that is compatible with the end user electrical specifications and exits the system through the output plug box ( 96 ). fig6 b shows the tethered wind turbine in the middle stage of launching or retracting . at this stage the tether ( 22 ) is fully retracted , the wishbone launch arm ( 100 ) is in the upright position and the hinged bay doors ( 92 ) are wide open . if in launching mode , the tether ( 22 ) would be let out , the lighter - than - air inflated casing ( 10 ) would ascend slowly upward . if in the retracting stage , the robotic control torus ( 72 ) would rotate the inflated casing ( 10 ) until the craft aligned properly with the hinged bay doors ( 92 ) and then ready the system for final stage . fig6 c shows the final stage of the tethered wind turbine when the inflated casing ( 10 ) is in the completely stored mode . the wishbone launch arm ( 100 ) is in the lowered and horizontal position resting underneath the inflated casing ( 10 ). the hinged bay doors ( 92 ) are closed and the entire system is in standby mode . the preferred embodiment of the invention would have a smart logic circuitry built into it . the control module ( 48 ), shown in fig3 , would make many decisions about when , where and how to fly the tethered wind turbine . the onboard automatic - pilot feature of the control module ( 48 ) would send control voltage signals to various aerodynamic control mechanisms to tune the flight of the tethered wind turbine and thereby achieve a desired ascent trajectory and altitude . at launch , there would be software programmed to fly the lighter - than - air tethered wind turbine in a controlled , stable ascent . the tethered wind turbine &# 39 ; s ascension could be stable in zero - wind conditions , or , even in rough and gusty wind conditions . this auto - pilot feature to maintain straight and level flight during fluctuating of wind currents broadens the potential application to many geographic locations that otherwise may not have been feasible . controlling the angle of attack of the inflated casing ( 10 ) is essential for flight control . by controlling the angle of attack , the flying ring - wing - like tethered wind turbine would be able to ascend on command to a predetermined altitude to achieve the best position in a given environment . once at the favorable altitude the tethered wind turbine would electronically load - up the electrical generator ( 28 ) to increase electrical output . as shown in fig7 a , 7 b , 7 c one way this invention controls the angle of attack , the flight , and ultimately the altitude , of the inflated casing ( 10 ) is to change the characteristics of its attachment at the top of the tether ( 22 ). the attachment as shown in this embodiment of the invention utilizes a three - point flexible harness ( 20 ). it has a method to adjust it as so as to change the angle of attack and therefore the amount of lift on the inflated casing ( 10 ). it is the intent of this invention to use the tether &# 39 ; s ( 22 ) harness pitch adjustor ( 50 ) device to vary the overall amount of lift on the inflated casing ( 10 ) and thereby control the altitude it operates at . the harness pitch adjustor ( 50 ) does this by extending or reeling - in the center rear harness tension member with a servo motor mechanism . by adjusting the harness ( 20 ) attachment in the above described way the overall angle of attack and hence the total lift of the ring - wing - like inflated casing ( 10 ) is controlled . the desired altitude is either dialed into the control module ( 48 ) or determined automatically by a software algorithm that takes into account several variables . the benefit using the harness pitch adjustor ( 50 ) as envisioned in this invention to control angle of attack of the inflated casing ( 10 ), a larger amount of electrical output would be achieved with less loss of altitude . in the absence of any angle of attack flight controls such as the harness pitch adjustor ( 50 ), higher loading of the turbine ( 24 ) would mean increased drag on the blades of the impeller rotor ( 26 ), an increased total drag on the inflated casing ( 10 ), and a general tendency for it to descend . this suboptimal condition could be improved by the use of the harness pitch adjustor ( 50 ) of this invention , as described above . there is one balance of forces that naturally occurs with the tethered wind turbine invention . if winds escalate while the invention is operating , the overall forces increase on the inflated casing ( 10 ). the natural reaction is for it to be drawn farther downwind and arc - tangentially lower according to the radius struck by the length of tether extended at that time . other things remaining equal , the craft moves down to a lower altitude and hence a lower energy level in the natural wind velocity gradient . this will reduce forces on the inflated casing ( 10 ) and result in a convergence toward a natural equilibrium . the control module ( 48 ) also sends control signals to the tethered wind turbine &# 39 ; s electric generator ( 28 ) circuitry . for example , in favorable wind conditions the kinetic energy of the moving air flow develops lift on the turbine ( 24 ) blades , turning the impeller rotor ( 26 ) and electric generator ( 48 ). the only thing resisting the impeller rotor ( 26 ) turning motion is the amount of load , or field resistance , that the electric generator ( 28 ) demands at a given point in time . the load setting is a controllable variable that the control module ( 48 ) can monitor and adjust . the tethered wind turbine utilizes the generator loading configuration to maximize power output but at the same time retain adequate air stability and altitude . the more load levied on the impeller rotor ( 26 ), the more overall wind drag will be developed on the craft . the total induced drag on the lighter - than - air inflated casing ( 10 ) shows up as a tensile force on the tether ( 22 ) along a vector in the downwind direction . the tension in the tether ( 22 ) is resisted by a mass below . the control module ( 48 ) ideally should balance power output versus positional stability and drag management . the control module uses electronic hardware and software as is necessary to accomplish this goal . the control module ( 48 ) also may condition the electricity that is output by the electric generator ( 28 ). in may invert the voltage up to a higher voltage for the purpose of efficiently transferring the generated power down the tether ( 22 ) to the base shelter structure ( 68 ) below . there would be lower line losses experienced if the electricity traveling down the tether ( 22 ) were voltage - adjusted higher . the control module ( 48 ) would handle this function . in summary , the control module ( 48 ) of the tethered wind turbine performs the following functions : controls straight and level flight of the inflated casing ( 10 ) using aerodynamic control surfaces controls straight and level flight of the inflated casing ( 10 ) using harness pitch adjustor ( 50 ) controls load levels applied to electric generator ( 48 ) converts or inverts voltages as necessary to optimize efficient energy transfer down the tether ( 22 ) there are actually two ways this invention proposes to accomplish varying the angle of attack so as to control the flight and altitude of the inflated casing ( 10 ). the first way to would be to use automatic electrical control of the harness pitch adjustor ( 50 ) as described above . in an additional embodiment of the invention , angle of attack would be controlled using additional wings , stabilizers and other aerodynamic control surfaces . the net affect would be increased control of total lift of the inflated casing ( 10 ) and an ability to control its altitude . fig5 shows one such additional embodiment of the tethered wind turbine invention using aerodynamic control surfaces of many types . these include any and all types of active or passive in - stream surfaces as are typically found on , but not limited to , conventional aircraft such as a horizontal stabilizer ( 56 ), vertical stabilizer ( 52 ), stabilizer control surface ( 54 ), and any type of wing ( 58 ), or wing control surface ( 60 ). it is unlikely that all of these would be necessary . it is also the intent in this additional embodiment of the invention , for inflated casing ( 10 ) to use its aerodynamic surfaces to soar to higher heights than would otherwise be possible in an effort to counteract the craft &# 39 ; s downward altitude tendency caused by power extraction induced drag of the turbine ( 24 ). it should be noted that the inflated casing ( 10 ) of the tethered wind turbine could be secured to ground through a less sophisticated tether system and it will still be a valuable energy extracting machine in the sky . or it could be outfitted to operate somewhat autonomously with its own internal smart - chip controller and sophisticated controls for its harness pitch adjustor or its aerodynamic wing control surfaces ( 60 ). the latter would probably come closer to maximizing energy production efficiency , but would likely cost more to manufacture . it is a trade - off . the tethered wind turbine invention as described in this document leaves room to cover both . it is envisioned that an additional embodiment of the invention would have a micro - meteorological analysis module ( 104 ) onboard that could automatically obtain samples and or use sensors to collect enough data in real time to be able to judge the likelihood of lightning or other hazardous weather conditions . with knowledge of the meteorological facts , including but not limited to , data on humidity , precipitation , temperature , atmospheric pressure , the presence of ozone , or audio - visual signatures , the tethered wind turbine could be programmed to do certain things . it would run the data through a decision formula that could prompt actions such as immediately descending the inflated casing ( 10 ) to a safer altitude by reeling in the tether ( 22 ). other times in truly inclement weather , it could fully retract the invention to the safety of the base shelter structure ( 68 ). this could all be done automatically and would prevent catastrophic failures as otherwise could be experienced from such hazards as lightning strikes , tornado - like wind currents , or destructive hail . the meteorological analysis module ( 104 ) could optionally be located in the base shelter structure ( 68 ) or other place not onboard the inflated casing ( 10 ). fig8 a shows an alternative design of the tethered wind turbine that utilizes a very simple boom and rear stabilizer arrangement . it represents a direct and simple method of construction . fig8 b shows another more fanciful arrangement where the exit of air from the turbine ( 24 ) is through a number of slots in the sidewalls of the tail structure . fig9 a , 9 b , 9 c , and 9 d show how the tethered wind turbine invention could still perform as explained above but with different ring - wing cross - sectional profiles . fig9 a is an elongated version of the preferred embodiment of this invention . fig9 b is a more exaggerated version with the turbine ( 24 ) located very near to the air outlet ( 16 ) and the flow concentrator nozzle ( 32 ) exhibiting a larger concentration of cross - sectional area ratio . fig9 c shows a profile that has the turbine ( 24 ) located near the leading edge annulus ( 12 ) with a very small concentration of cross - sectional area ratio . fig9 d is profile with most of the inflated part reserved to the front annulus ( 12 ) itself . it can be seen that the tethered wind turbine of this invention : provides a new way to extract the kinetic energy from the wind . allows use of a smaller , lighter - weight , higher - speed turbine generator that does not need for an expensive and bulky up - ratio gearbox between the impeller rotor ( 26 ) and the electric generator ( 28 ). operates without the need for a tower . has no need for a complicated rotating nacelle to align rotating blades with the wind . uses lift generated from its overall shape or from horizontal wings so that it can operate higher aloft than would otherwise be possible while extracting energy from the wind . has a control module that can monitor flight and weather variables and then react to control trajectory , position , stability , altitude , generator loading levels and power output . has the capacity to retract the tether ( 22 ) and inflated casing ( 10 ) to a lower altitude or ultimately all the way into the base shelter structure ( 68 ) to avoid damage from lightning or severe weather . while embodiments of the present invention have been described with reference to the aforementioned applications , these descriptions of the embodiments are to be construed in a limiting sense . it shall be understood that all aspects of embodiments of the present invention are not limited to the specific depictions , configurations or dimensions set forth herein which depend upon a variety of principles and variables . various modifications in form and detail of the disclosed apparatus , as well as other variations of the embodiments of the present invention , will be apparent to a person skilled in the art upon reference to the present disclosure . it is therefore contemplated that the appended claims shall cover any such modifications or variations of the described embodiments as falling within the true spirit and scope of the present invention .
| 8 |
fig1 shows a hand - held paste pump 11 having a turret - type nozzle or spout 13 at the top thereof . the nozzle includes a ball 12 rotatably seated within a housing 12a . nozzle 13 has a spout portion connected to ball 12 movable therewith and includes a channel 13a terminating in a dispensing spout 13b . channel 13a extends through ball 12 and terminates in a material receiving opening 13c . housing 12a is fitted to -- and may be an integral part of -- a container body 15 which has a base 16 , the latter having a base cover 16a . disposed within container body 15 is a piston 17 with flexible side seals 18 which is vertically moveable in the body 15 . a tube 20 which has an upper opening 20a , extends through piston 17 and has a lower opening 20c . there is provided a compression spring 19 , which may be helical , between the upper interior surface of body portion 12b and the top of piston 17 , whereby spring 19 continuously exerts downward force on piston 17 . paste ( or other previously mentioned viscous matter ) m is loaded into the body of the pump below piston 17 and above bottom 16a . as shown in fig1 material m is blocked from movement beyond the opening 20a of tube 20 by the surface of ball 12 , but it will be observed tube 20 has been filled with paste by the downward pressure of piston 17 under force of spring 19 up through opening 20c in the tube 20 . fig2 shows the tube of fig1 with the turret nozzle 13 in the open position , i . e ., the user has rotated the nozzle to the left in fig1 so that opening 13c of the tube channel is in registry with the opening 20a of dip tube 20 , whereby the contents of the tube , m , are flowing continously from nozzle 13b as indicated by the arrow . thus , the embodiment illustrated in fig1 and 2 is remarkably uncomplicated and , in fact , comprises only five elements : a body , a nozzle , a piston , a dip tube and a spring ( or other functionally equivalent means of exerting force ), all of which have the further advantage of being easy to mold and assemble . by contrast , for example , the pump currently on the market sold under the trademark &# 34 ; crest &# 34 ; for tartar control paste has at least eight elements and represents an extremely complicated design which , presumably , is difficult to mold and assemble , and therefore relatively expensive . further , prior art pumps of the draw - up variety have a piston which moves upwardly within the pump housing to dispense the paste , so that the pump becomes increasingly top - heavy and therefore more likely to fall over . sometimes this is merely an annoying inconvenience , but in the event the pump falls from , say , a bathroom sink onto a tile or other hard bathroom floor , the pump can be damaged . in addition , paste pumps according to the present invention are very easy to fill with paste on a high - speed assembly line . as indicated previously , it has also been discovered that pumps made in accordance with the present invention can be modified to be re - fillable , thereby even further increasing the cost - savings to the consumer . one embodiment of a re - fillable pump is shown in in fig3 and 4 wherein parts identical or functionally equivalent to those shown in fig1 and 2 are marked with a prime , so that it is unecessary to specifically reiterate them here . in the embodiment of fig3 and 4 , the body wall 15 &# 39 ;, preferably cylindrical in cross - section , terminates in an edge 15a &# 39 ; which defines an opening 15b &# 39 ;. inserted into this opening is a refill container 22 with paste m already loaded therein . ( although not shown , it will be understood that container 22 , as sold , will have a suitable cover which the consumer removes just before inserting container 22 within the pump 11 &# 39 ;.) refill container 22 is inserted within pump 11 &# 39 ; by threading it into the wall 15 &# 39 ;. thus , wall 15 &# 39 ; has screw threads 26 on its inner surface adjacent bottom edge 15a and container 22 has matching threads 25 on its outer surface . once container 22 is securely threaded into pump 11 &# 39 ;, the flared top portion 24 of the container 22 forms a tight seal against the inner surface of wall 15 &# 39 ; above piston 17 &# 39 ;. similarly , the bottom surface 23c of container 22 preferably fits against the lower edge 15a &# 39 ; of the pump wall 15 &# 39 ;, thereby enhancing the seal provided by threads 25 , 26 to provide a sealed compartment for the material m . the refill has feet 23a and 23b to provide a base for maintaining the assembly in an upright position . fig3 shows the refillable pump with its dispensing nozzle 13 &# 39 ; in the closed position , while fig4 shows such nozzle in the open position with the material m being discharged as indicated by the arrow . thus , in addition to the advantages of the pump shown in fig1 and 2 , the pump of fig3 and 4 has the great benefit of being capable of utilizing refills , at substantial savings to the consumers . another embodiment of a refillable container according to this invention is illustrated in fig5 wherein the pump 11 &# 34 ; does not have a long body wall extending down the length of the container , but instead comprises what might be termed a head block 28 terminating in a lower edge 29 . just above the line of termination 29 the body 28 is provided with external threads 33 . the latter are for the purpose of receiving a refill 27 which has a body wall 30 and threads 32 on the inner wall at the top which engage threads 33 of the body 28 . refill 27 has a closed bottom end 31 and , as packaged for retail sale , will have its open top end closed by a cap , foil or other suitable cover which will protect the contents m and which may be easily removed just prior to attachment as described above . it will be evident that the refill container 27 in fig5 offers great advantages . in particular the consumer need only purchase the pump mechanism once and , thereafter , simply purchase the refill 27 , thus saving the cost of buying an entire new pump on each occasion . fig6 illustrates a pump 11 &# 34 ;&# 39 ; which is similar in construction to pump 11 of fig1 . however , in the embodiment shown in fig6 pump 11 &# 34 ;&# 39 ; has an open bottom end equipped with external threads 43 . these are designed to engage threads 44 on the inner surface of a lip 42a of a removable bottom cover 42 . the purpose of this configuration is to permit the cover to be removed and the insertion of a refill 40 , preferably a cylinder , containing paste m . refill cylinder 40 has a closed bottom 45 and terminates in an open top end 41 . the refill of fig6 includes a multilayer structure 41 , 47 preferably fabricated of a barrier material . as in the case of the embodiment shown in fig5 the invention of fig6 offers similar substantial advantages in cost and product safety to both the consumer and manufacturer . indeed , the refill 40 can be easily slid into the interior housing of pump 11 &# 34 ;&# 39 ;, and readied for instant use by attaching cover 42 . the refill containers thus described and illustrated should be considered as part of the present invention . moreover , the refills may take a number of different forms and comprise not only a refill container per se , but , if desired , may include a new piston , such as the piston 17 &# 34 ; in fig5 in which case the original piston will be discarded . in addition , the refills may be made of a wide variety of suitable materials . for example , currently sold toothpaste pumps employ polypropylene ( pp ) or polyethlene ( pe ) or polyethylene terephthalate ( pet ) or copolymers of pp and pe for the body walls of the pump which contains the paste and these body walls typically are relatively thick in order to prevent loss of flavorants , etc . through the body wall , which can occur when long shelf - life is required . alternatively , the refills shown herein can be made relatively thin and of said current materials , where long shelf - life is not needed . or , where long shelf - life is desired , the refill may be made relatively thin and utilize so - called gas barrier materials , such as ethylene alcohol copolymer ( evoh ), polyamides such as nylon ( pa ), polyvinyildine chloride and copolymers thereof ( pc ), etc ., which prevent the escape of flavorants or other components of the paste which can convert into a gas phase . these materials may be formed in a single layer , such as by extruding the same as a tube or by extrusion blow molding ( ebm ), the latter being more desirable since the bottom of the refill is formed in the mold , as well as the threads or other means of attachment . more preferably , these barrier materials are incorporated in a multiple layer structure which is extruded , again preferably by ebm coestrusion . this latter use of barrier materials formed into a refill is believed to be preferable particularly for refill 40 of fig6 . further , although only certain specific embodiments thereof have been shown and described , it is well within this invention that refill containers having the same inventive concept but different designs may be used . for example , the particular means whereby the refill container is attached to the pump or inserted therein is , to some degree , a matter of choice . further , by way of additional modifications which are within the scope of this invention , the pump body may be other than circular in cross - section . for example , the body can just as well be square or rectangular in cross - section , in which case the re - fill would have the same cross - section and means other than screw threads would normally be employed .
| 1 |
the present invention provides a method of treating inflammatory skin conditions , particularly psoriasis , by orally administering a prodrug of 5 - fu . in a preferred embodiment , the present invention employs oral administration of capecitabine for treating psoriasis . it has now been unexpectedly discovered that oral administration of 5 - fu prodrugs can be used to treat psoriasis in humans . in a preferred embodiment , capecitabine ( a 5 - fu prodrug ) is orally administered to treat psoriasis in humans . the 5 - fu prodrugs that have been found to be useful for treatment of psoriasis in humans are capecitabine ( n 4 - pentyloxycarbonyl - 5 โฒ- deoxy - 5 - fuorocytidine ), 5 - fluoro - pyrimidinone ( 5fp ), ts - 1 ( s - 1 , ftorafur ), fdump , 1 -( 2 โฒ- oxopropyl )- 5fu , and alkyl - carbonyl - 5 - fu . the preferred 5 - fu prodrug for use in the present invention is capecitabine . capecitabine is a prodrug of the antimetabolite 5 - fu , crosses the gastrointestinal barrier intact , and is rapidly and almost completely absorbed . surprisingly , this drug , which is responsible for the skin disease known as hand - foot syndrome , is effective as a treatment for another skin disease , psoriasis . the effectiveness of capecitabine for the treatment of psoriasis is especially surprising because hand and foot syndrome ( which involves erythema , pain and ulceration ) and psoriasis may occur in the same area of the body . as an example , inverse psoriasis occurs in intertriginous areas , which are areas between folds or juxtaposed surfaces of skin . ( stedman &# 39 ; s medical dictionary , 26 th edition ) intertriginous areas include the skin beneath pendulous breasts and abdominal skin folds . hand - foot syndrome is known to occur at the intertriginous areas of the bra - line and belt - line . moreover , pustular psoriasis is known to localize to the palms and soles . ( merck manual of diagnosis and therapy , 17 th edition , section 10 ch . 117 ). the use of capecitabine to treat psoriasis is a significant advance because it avoids the serious side effects of 5 - fu . furthermore , capecitabine can be reliably and effectively administered via the oral route . most adverse events associated with capecitabine administration are reversible and do not require discontinuation of the drug . ( physician &# 39 ; s desk reference , supra ) a benefit of oral prodrugs of 5 - fu , and capacitabine particularly , is that patients are more likely to initiate treatment if the active agent can be taken orally rather than undergo the additional pain , expense and inconvenience of iv treatment . treatment with oral capecitabine does not require hospitalization as does initial iv therapy with 5 - fu . ( malet - martino et al ., supra ) in addition to the 5 - fu specific toxicities , any intravenous catheterization carries the risk of local infection and / or thrombophlebitis . ( de bono j s , twelves c j , supra ). the 5 - fu prodrugs capecitabine ( n 4 - pentyloxycarbonyl - 5 โฒ- deoxy - 5 - fuorocytidine ), 5 - fluoro - pyrimidinone ( 5fp ), ts - 1 ( s - 1 , ftorafur ), fdump , 1 -( 2 โฒ- oxopropyl )- 5fu , and alkyl - carbonyl - 5 - fu can be orally administered to treat psoriasis and other inflammatory skin conditions ( e . g ., keloid ( hypertrophic scar ), atopic dermatitis , lichen simplex chronicus , prurigo nodularis , reiter syndrome , pityriasis rubra pilaris , pityriasis rosea , stasis dermatitis , rosacea , acne , lichen planus , scleroderma , seborrheic dermatitis , granuloma annulare , rheumatoid arthritis , dermatomyositis , alopecia greata , lichen planopilaris , vitiligo , and discoid lupus erythematosis ) in humans . therapeutically effective oral doses of 5 - fu prodrugs for treating psoriasis and other inflammatory skin conditions in humans in a non - pulse dosing regimen are between 5 and 2500 milligrams per square meter of body surface area per day , a preferred effective amount is between 100 and 1500 milligrams per square meter of body surface area per day and an especially preferred dose is 1250 milligrams per square meter of body surface area per day . the preferred prodrug , capecitabine , is therapeutically effective for treating psoriasis and other inflammatory skin conditions in humans at doses below 2500 milligrams per square meter of body surface area per day , and capecitabine does not produce a 5 - fu like adverse effect profile until dose levels exceed 2500 milligrams per square meter of body surface area per day . adverse effects experienced at levels in excess of 2500 milligrams per square meter of body surface per day include nausea , vomiting and skin rashes . a therapeutically effective amount is that amount of capecitabine which will relieve or improve to some extent one or more of the symptoms or signs of psoriasis or other inflammatory skin condition . an effective amount of capecitabine for treating psoriasis or other inflammatory skin condition in a non - pulse dosing regimen is between 100 and 2500 milligrams per square meter of body surface area per day , a preferred effective amount is between 750 and 1500 milligrams per square meter of body surface area per day and an especially preferred dose is 1250 milligrams per square meter of body surface area per day . capecitabine ( offered under the brand name xeloda ยฎ by roche labs , nutley , n . j . 07110 ) is commercially available in 150 mg and 500 mg tablets . xeloda ยฎ is indicated for the treatment of patients with metastatic breast cancer resistant to both paclitaxel and an anthracyline - containing chemotherapy regimen , or resistant to paclitaxel and for whom further anthracycline therapy is not indicated . ( physician &# 39 ; s desk reference 2002 ) peak plasma concentrations for capecitabine and its two main metabolites occur about 0 . 5 to 1 . 5 hours after administration . plasma concentrations decline exponentially with a half - life of about 0 . 5 to 1 hour . an additional dosing regimen is pulse - dosing . in pulse - dosing , an effective amount of a biologically active agent is administered to the patient and then sufficient time is allowed to permit the active agent to clear from the patient &# 39 ; s body ( i . e . to be metabolized or discharged ) prior to the administration of additional doses . the quantity of drug administered to the patient in pulse - dosing may be greater than the dosage administered in a non - pulse - dosing regimen . the quantity , length of administration and interval between doses in pulse - dosing vary according to an individual patient &# 39 ; s response to the pulse - dosing regimen . an effective amount of oral 5 - fu prodrug for treating psoriasis or other inflammatory skin condition by pulse dosing is between 5 and 5000 milligrams per square meter of body surface area , a preferred effective amount is between 100 and 3000 milligrams per square meter of body surface area and an especially preferred dose is 1250 milligrams per square meter of body surface area . a preferred pulse - dosing regimen is administration of the effective amount of the 5 - fu prodrug daily for one week , an interval of two weeks without administration , repeat the schedule . a preferred pulse - dosing regimen for treating psoriasis or other inflammatory skin condition is administering oral capecitabine in an effective amount between 100 and 5000 milligrams per square meter of body surface area , a preferred effective amount of between 750 and 3000 milligrams per square meter of body surface area and an especially preferred dose of 1250 milligrams per square meter of body surface area . in the pulse - dose regimen , the effective amount of capecitabine is administered orally each day for one week followed by an interval of one week without administration ; the weekly cycle is repeated . pulse - dose quantity , the period of time during which the effective amount is administered , and interval without dosing are adjusted for patient response and occurrence of adverse effects . a 5 - fu prodrug of the present invention is preferably administered as a pharmaceutical composition in hard shell dosage form such as a pill , tablet , capsule , or caplet . the pharmaceutical composition may be formulated as unit dosage forms , such as tablets , pills , capsules , boluses , powders , granules , elixirs , tinctures , metered aerosol or liquid sprays , drops , ampoules , autoinjector devices or suppositories . unit dosage forms may be used for oral , intranasal , sublingual or rectal administration , or for administration by inhalation or insufflation , transdermal patches , and a lyophilized composition . preferably the unit dosage form is an oral dosage form , most preferably a solid oral dosage , therefore the preferred dosage forms are tablets , pills , and capsules . the pharmaceutical composition may contain capecitabine or an enantiomer , diastereomer , n - oxide , crystalline form , hydrate , solvate , active metabolite or pharmaceutically acceptable salt of the compound . the pharmaceutical composition may also include optional additives , such as a pharmaceutically acceptable carrier or diluent , a flavouring , a sweetener , a preservative , a dye , a binder , a suspending agent , a dispersing agent , a colorant , a disintegrator , an excipient , a diluent , a lubricant , an absorption enhancer , a bactericide and the like , a stabiliser , a plasticizer , an edible oil , or any combination of two or more of said additives . suitable pharmaceutically acceptable carriers or diluents include , but are not limited to , ethanol , water , glycerol , aloe vera gel , allantoin , glycerine , vitamin - a and e oils , mineral oil , phosphate buffered saline , ppg2 myristyl propionate , magnesium carbonate , potassium phosphate , vegetable oil , animal oil and solketal . suitable binders include , but are not limited to , starch , gelatine , natural sugars such as glucose , sucrose and lactose , corn sweeteners , natural and synthetic gums such as acacia , tragacanth , vegetable gum , sodium alginate , carboxymethylcellulose , polyethylene glycol , waxes and the like . suitable disintegrators include , but are not limited to , starch such as corn starch , methyl cellulose , agar , bentonite , xanthan gum and the like . suitable lubricants include , but are not limited to , sodium oleate , sodium stearate , magnesium stearate , sodium benzoate , sodium acetate , sodium chloride and the like . suitable dispersing and suspending agents include , but are not limited to , synthetic and natural gums such as vegetable gum , tragacanth , acacia , alginate , dextran , sodium carboxymethylcellulose , methylcellulose , polyvinylpyrrolidone and gelatine . suitable edible oils include , but are not limited to , cottonseed oil , sesame oil , coconut oil and peanut oil . examples of additional additives include , but are not limited to , sorbitol , talc , stearic acid and dicalcium phosphate . solid unit dosage forms may be prepared by mixing the active agents of the present invention with a pharmaceutically acceptable carrier and any other desired additives as described above . the mixture is typically mixed until a homogeneous mixture of the active agents of the present invention is obtained and the carrier and any other desired additives are formed , i . e . the active agents are dispersed evenly throughout the composition . tablets or pills can be coated or otherwise prepared so as to form a unit dosage form that has delayed and / or sustained action , such as controlled release and delayed release unit dosage forms . for example , the tablet or pill can comprise an inner dosage and an outer dosage component , the latter being in the form of a layer or envelope over the former . the two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release . biodegradable polymers for controlling the release of the active agents include , but are not limited to , polylactic acid , polyepsilon caprolactone , polyhydroxybutyric acid , polyorthoesters , polyacetals , polydihydropyrans , polycyanoacrylates and crosslinked or amphipathic block copolymers of hydrogels . for liquid dosage forms , the active substances or their physiologically acceptable salts are dissolved , suspended or emulsified , optionally with the usually employed substances such as solubilizers , emulsifiers or other auxiliaries . solvents for the active combinations and the corresponding physiologically acceptable salts can include water , physiological salt solutions or alcohols , e . g . ethanol , propanediol or glycerol . additionally , sugar solutions such as glucose or mannitol solutions may be used . a mixture of the various solvents mentioned may be used in the present invention too . the active agents of the present invention may also be coupled with soluble polymers such as targetable drug carriers . such polymers include , but are not limited to , polyvinylpyrrolidone , pyran copolymers , polyhydroxypropylmethacrylamidophenol , polyhydroxyethylaspartamidophenol , and polyethylenoxypolylysine substituted with palmitoyl residues . a transdermal dosage form also is contemplated by the present invention . transdermal forms may be a diffusion - driven transdermal system ( transdermal patch ) using either a fluid reservoir or a drug - in - adhesive matrix system . other transdermal dosage forms include , but are not limited to , topical gels , lotions , ointments , transmucosal systems and devices , and iontohoretic ( electrical diffusion ) delivery system . transdermal dosage forms may be used for timed release and sustained release of the active agents of the present invention . the total daily dose should be taken as two divided doses approximately 12 hours apart , within 30 minutes of eating . the tablets should be taken with water . ( xeloda โข patient package insert ). the number of daily tablets of a 5 - fu prodrug to be taken by a patient for treatment of psoriasis or other inflammatory skin condition is shown in the following dosing table . the body surface area ( bsa ) is calculated using a bsa nomogram well known to those skilled in the art and the patient &# 39 ; s height and mass . ( mosteller rd . simplified calculation of body - surface area . nejm 1987 ; 317 : 1098 ). for any given bsa in the first column of table 1 , the total daily dose is disclosed in the second column of the table . the third and fourth columns of table 1 show , respectively , the number of 150 milligram tablets and the number of 500 milligram tablets to be taken at each administration ( morning and evening ). duration of individual patient treatment will depend on individual response and tolerance . however , treatment with an effective amount of a 5 - fu prodrug for 2 to 12 weeks should provide relief from psoriasis and other inflammatory skin conditions in most patients . the dosing regimen may be modified in the event of adverse events . an adverse event includes any adverse change from the patient &# 39 ; s pre - treatment condition . the following example is intended to illustrate more specifically the operation of the invention . the example is intended to illustrate and not to limit the scope of the invention . other aspects , advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains . treatment of an adult with active psoriasis involving 10 โ 75 % body surface area ( bsa ) is carried out as follows . the physician obtains a complete medical history from the patient and conducts a physical examination . a psoriasis area and severity index ( fredriksson t , petersson u , severe psoriasis โ oral therapy with a new retinoid . dermatologica 1978 ; 157 : 238 โ 244 ), is obtained . a hematology profile ( complete blood count and platelet count ), chemistry profile ( bun , creatinine , sgot , sgpt , total protein , and albumin ), hiv screen , and urinalysis are also obtained . women of child - bearing potential must have a negative serum pregnancy test within 7 days of the first dose of capecitabine . the bsa is calculated using a bsa nomogram based on the patient &# 39 ; s height and mass . a patient with a normal history , physical exam , blood and urine profiles is started on a course of capecitabine at 1250 milligrams per square meter of bsa per day according to table 1 . for example , a patient with a bsa of 1 . 50 square meters would receive a total daily dose of 1900 mg of capecitabine . the patient is to take three 150 mg tablets and one 500 mg tablet with a glass of water within 30 minutes after eating breakfast . the same dose is repeated in the evening , approximately 12 hours later , with a glass of water within 30 minutes after dinner . the patient takes the daily dose for two days of the week and repeats this dosing schedule on the same days of the week on subsequent weeks . from the foregoing disclosure it is evident that the present invention provides an advance in the treatment for psoriasis and inflammatory skin conditions . the present invention is preferably administered orally , which improves patient compliance with treatment and does not require hospitalization . oral administration avoids the complications associated with intravenous catheterization . 5 - fu prodrugs , preferably capecitabine , are effective for the treatment of psoriasis and other inflammatory skin conditions , and are safer than other drugs used for the treatment of psoriasis and other inflammatory skin conditions .
| 0 |
the compressor 10 is shown in fig1 . externally the compressor has a solid , non - vented motor housing 12 , a non - vented back 13 , a rear plate 14 , a solid non - vented shroud 16 , a front plate 18 and a muffler box 20 . the components are bolted together so as to form a unit . two ports 22 and 24 are provided in the muffler box for the entry of air and exit of compressed air . muffler constructions 26 and 28 are provided for use in the muffler box . the rear or back 13 of the compressor is shown in fig2 and includes a solid non - vented plate . referring now to fig3 , an exploded view of the compressor is shown and the internal mechanism can be seen . in the housing there is positioned an electric motor which can be generally characterized as a one - sixth horsepower motor , having a four pole stator and a six pole rotor . the housing 12 has a maximum length of about 5 . 22 inches so as to reduce the vibrations . the motor &# 39 ; s rotor drives a drive shaft 30 which is mounted on a plurality of deep groove ball bearings 32 . an inlet ring 34 is positioned against the motor housing 12 . there is provided the rear plate 14 which includes a centrally positioned bolting and bearing support section 38 which is held in position by a plurality of webs such as 40 . it is seen that the drive shaft 30 is also supported by a second set of bearings 42 which is secured to the section 38 . the rear plate 14 is secured to the motor housing with the inlet ring 34 positioned therebetween like a gasket . bolts such as 44 from the motor housing are secured to the periphery of the rear plate 14 . the shroud 16 is non - vented and made of a laminated material and fits against the rear plate 14 . the body 36 defines a rotor cavity 46 therein , fits within the shroud 16 , has a radius of at least about 2 . 62 inches , a minimum weight of about 4 . 63 pounds , and is made of a gray iron casting , more specifically sae j4321 g2500 . a rotor and vane assembly 48 is positioned within the cavity 46 . the drive shaft 30 extends to and engages the rotor and rotates the assembly 48 . the assembly 48 includes the rotor 50 and four vane receiving slots such as 52 within each of which there is a positioned a vane 54 . it will be appreciated that the motor rotates the drive shaft which , in turn , rotates the assembly 48 for compressing incoming air and expelling compressed air . when the rotor is rotated , each vane can slide within a rotor slot and can engage the cavity wall or body 36 . the front plate 18 engages the front face of the body 36 and is divided into two chambers or sections 58 and 60 by the by a central rib 62 and peripheral edge 64 . the muffler box 20 which is preferably made from a gray iron , but can be made from die cast aluminum , is secured against the front end plate . the muffler box defines the exit and inlet ports 22 and 24 and each communicates with a chamber 58 or 60 . the muffler box is deep enough to receive the muffler elements 26 and 28 . elements or components of the compressor are also seen in fig4 and include the motor housing 12 , the drive shaft 30 , the inlet ring 34 , the rear plate 14 , the shroud 16 , the rotor assembly 48 , the body 36 , the front plate 18 and muffler box 20 . the inlet ring 34 is seen in fig5 . the ring 34 has a small wall thickness 66 [ i . e ., the difference between the outside diameter ( od ) and inside diameter ( id )] of about 1 . 25 inches and is made of 20 gage cold rolled steel . the ring is positioned between the motor housing 12 and the rear plate 14 . the ring is crushable and acts like a gasket to seal against both the housing and plate . the ring od is fixed by the compressor size and the id is increased as much as possible so as to reduce vibration and maintain sealing . the body 36 is shown in fig6 and 8 . the body has a positioning groove 62 located at the top thereof , has an increased mass or , a weight of about 4 . 63 pounds , as well as an increased outer radius 68 of about 2 . 62 inches . the body is fabricated of gray iron , as specified hereinbefore , which exhibits sound - dampening characteristics . in addition , the size , weight and mass of the body is maximized so as to maximize sound dampening . the outside diameter is increased , but is limited by the size of the compressor . the inside diameter or cavity is maintained for cooperation with the rotor assembly . the rotor body 50 which has vane - carrying slots such as 52 is shown in fig3 and 9 . each of the slots carries a vane , extends into the rotor body , is at right angles to an adjacent vane slot and forms a chord - like construction which extends from the circumference or periphery of the rotor into the rotor body as shown . the positioning of the slot relative to the center and relative to the other slots is important in reducing the sound of operation . the intersection of the slot or its centerline with the circumference is at about a 24 ยฐ angle relative to a line extending through the center of the rotor and normal to an adjacent slot . the angular relation can vary between 23 ยฐ and 25 ยฐ. this angular relationship is important as it permits vane movement in the slot and reduces vane bounce during rotation . the mass or weight of each vane is important to maximize radial force . the weight of the vane herein is about 6 . 75 grams . the combination of vane mass and angular relation also reduces vane bounce and noise . fig1 , 11 and 12 show the shroud 16 . the shroud 16 is a cylindrical member which fits about the body 18 and engages the rear plate 14 and the front plate 56 . the shroud is a solid non - vented member which can be made of a laminated structure seen in fig1 . the laminated structure includes an outer metal layer 70 , an inner metal layer 72 and an intermediate viscous layer 74 . the solid or non - vented structure and the laminated structure contributes to the dampening or sound reduction . the inner and outer layers are 24 to 26 gauge galvaneal steel ( galvaneal steel is electro - galvanized steel which is made for painting ) and the sound dampening material is a viscous material such as acrylic pressure sensitive adhesive . the laminate can be purchased from roush anatrol main office , 11953 market street , livonia , mich . 48100 , under the trade name anatrol 980 . the bearings such as 32 and 42 are referred to as deep groove ball bearings ( see nsk catalog , rolling bearings , cat . no . a 140b , 19933 - 10 printed in japan , copyright nsk ltd . 1989 ) are sealed and utilize a grease or lubricant to dampen sound . this grease or lubricant is a polyurea grease ( available as polyrex em , from exxon mobile corporation , 3225 gallows road , fairfax , va . 22037 . the combination of the deep groove bearing and grease reduce the sound of operation . the motor itself is one - sixth horse power , 6 - pole rotor and 4 - pole stator type . the motor housing is less than about 5 . 22 inches in length and is solid or non - vented . sound emanating from the motor during operation has been minimized . the back or closure 13 for the motor housing 12 is a solid non - vented member which is secured to the housing . the fact that the back is solid and non - vented minimizes sound emanating from the rear of the compressor . the combination of above - identified factors reduces the sound emitted from the compressor during operation to about 50 db at 1 meter . those factors include the solid non - vented motor housing 12 , the solid non - vented housing back 13 , the 6 - pole rotor 4 - pole stator motor , the deep groove bearings 32 and 42 and lubricant , the rotor - vane angular relationship and vane weight or mass , the increased body size and mass 18 and the non - vented solid or laminated shroud 16 . in addition , the muffler 20 can be made of various materials so as to enhance the sound deadening property . it will be appreciated that numerous changes and modifications can be made to the embodiments detailed above .
| 5 |
as is shown in fig1 prior art vacuum dust collection systems which may be advantageously installed in pelletizing plants ; iron ore sintering plants ; plants producing abrasive materials for industry ; gold , silver and copper collection systems , etc ; utilize a dust collector system ( schematically labeled as 16 ) which have discharge conduits 14 that are capable of dumping the dust accumulations into the atmosphere . connected to each conduit 14 are a pair of dust valves 10 , 12 which are connected in series and operable such that the valve gates therein are never open at the same time ; thus , the vacuum in dust collectors 16 is never allowed to be exposed to the atmosphere . in this regard , pneumatic motors 20 and 26 are controlled by controller 18 such that via suitable linkages gates 22 and 24 will be opened and closed ( to thus allow dust to pass through valve seat members 78 , 79 , respectively ) in alternate fashions . thus , in operation , gate 22 is caused to open ( move away from seat portion 74 of valve seat member 78 in a clockwise direction ) when dust is to pass from discharge conduit 14 into space 23 ( gate 24 being in a closed position , i . e ., sealingly engaged against seat portion 75 of valve seat member 79 ), and once space 23 is filled to the desired level , gate 22 is caused to close ( move counterclockwise into sealing engagement with seat portion 74 of valve seat member 78 ) and thereafter gate 24 is caused to open ( move away from seat portion 74 of valve seat member 78 in a clockwise direction ). the dust will then be dumped by gravity into the atmosphere . both the seat portions of the valve seat members and the flap portions ( not shown ) of the gates are subject to wear , and periodically require cleaning and / or replacement . for these reasons , access to the interior of the valves is provided by openings in the sides of the valve bodies which are normally covered by plates 90 , 91 . these plates are normally sealingly connected to the valve body sides by multiple screws or other such fastening means ( not shown ). the flap portion of the gate is removable and replaceable by disconnection from the supporting arm , and the seat portion of the valve seat member is replaced by removal and replacement of the entire valve seat member . turning now to fig2 which shows a perspective view , partially broken away , of a dust trap of the present invention , two dust traps 50 and 80 are shown serially mounted to one another . pneumatic motors 30 and 40 , which are controlled by air pressure from a suitable conventional controller ( see 18 in fig1 ), are connected to respective levers 31 and 41 so as to control the positioning of the valve gates within each respective valve 50 and 80 . such control is achieved via rotational movement of shafts 32 and 42 to which the levers 31 and 41 are respectively connected , the shafts being respectively mounted on brackets 33 and 43 to extend through the side walls 51 and 81 and into the interior of valves 50 and 80 . an opening in the front wall 53 and 83 of each valve , sealingly covered by a removable rectangular plate , allows for periodic access into the interior of each valve . as depicted best in fig3 which for the illustrative purposes shows only a single valve 50 , each dust valve according to the present invention includes an actuating arm 35 which at one end includes a collar 35a for connection to a portion of rotatable shaft 32 which extends within the valve 50 , and at the other end 35b includes a bore 35c through which a wrist pin ( not shown ) can be inserted so as to securely attach thereto a holding bracket 100 . holding bracket 100 is composed of two interconnectable members 110 and 140 ( see fig5 ). member 110 includes spaced apart elements 115 and 130 which are connected at one end by a bridge element 117 , and located at the lower portions of each of the elements 115 and 130 are aligned bores 116 and 131 through which the noted wrist pin is insertable ( the end 35b of actuating arm 35 being dimensioned to fit between spaced apart elements 115 and 130 ). to provide for snug interconnection with member 130 , member 110 includes rectangular block extension elements 120 and 121 which respectively extend away from elements 115 and 130 , the ends of each extension element comprising a flat surface . rectangular flat abutment surfaces 101 and 102 on elements 115 and 130 , positioned below extension elements 120 and 121 , include threaded holes 103 and 104 for the end of adjustment bolts ( or screws ) 164 and 165 . member 140 includes spaced apart elements 150 and 160 which are connected at one end by a bridge element 155 . the opposed ends include rectangular flat abutment surfaces 152 and 162 which correspond with rectangular abutment surfaces 101 and 102 on member 110 , as well as rectangular block indent portions which are dimensioned to correlate with the dimensions of rectangular extension elements 120 and 121 . holes 168 and 169 which extend through the lower portions of elements 150 and 160 are aligned with holes 103 and 104 in elements 115 and 130 to allow bolts 164 and 165 to pass therethrough . surfaces 171 and 172 provide abutment means for the heads of bolts 164 and 165 . at the opposite ends of members 110 and 140 are attached to bridge elements 117 and 155 are flange members 119 and 159 which extend upwardly of the elements 117 and 155 to a point which overhangs the flat top surfaces of elements 117 and 115 , i . e ., so as to define acute angular recesses 119a and 159a together with the contiguous top flat surfaces of elements 117 , 115 , 130 , 155 , 150 and 160 . these flange members act to grip and retain against the flat top surfaces of elements 117 , 115 , 130 , 155 , 150 and 160 a suitable door element ( to be described below ). the door element can be removed by loosening of bolts 164 and 165 and causing a sliding separation of members 110 and 140 . the door element 200 ( see fig7 ) is a rectangular - shaped member which is composed of a wear - resistant material such as ni metal alloy ( an abrasion and heat resistant metal alloy ). two of the opposite sides include v - shaped recesses 205 and 210 which are shaped to correspond with the configuration of flange members 119 and 159 on holding bracket 100 , i . e ., so as to be gripped thereby and thus fixedly supported on the flat top surfaces of elements 115 , 130 , 150 and 160 of bracket 100 . the door element includes two wear surfaces 215 and 220 which are each separately usable for sealingly engaging with a valve seat portion of a valve seat member as will be described below . the valve seat member 80 ( discussed hereinafter as closet 80 ) is depicted in fig3 , 5 , and 7 . it comprises v - shaped side walls 300 and 301 , a rectangular front wall 303 , a rear connecting beam 304 , and flanges 310 and 320 which extend along the top and bottom edges of the side and front walls 300 , 301 , 303 , as well as the rear beam 304 and intersect at the extremities of the v - shaped side walls adjacent the rear connecting beam 304 . these flanges have flat exposed sealing surfaces 325 and 330 ( see fig3 ), one of which at any given time functions as the valve seat of the valve 50 . these flanges also include supporting lips 311 and 321 ( see fig6 ) for support of the closet within the interior of the valve body . the inside of the closet is hollow so as to allow dust to pass therethrough when mounted within the valve body . the mounting of the closet is achieved by locating the closet within the valve body such that at least a portion of the supporting lip of the lowermost flange is supported by opposed mounting brackets 400 within the interior of the valve body ( only one such bracket is shown in fig2 ) as well as adjustment of opposed set screws 405 and 410 ( see fig4 ) which abut against opposite abutments surfaces 420 and 421 which are formed as part of the closet 80 between the flanges 310 and 320 near their intersection point . when operating , a dust valve according to the present invention includes a door member 200 mounted on a holding bracket 100 ( via engagement of flanges 119 and 159 within recesses 210 and 205 , together with abutting contact between members 110 and 140 ) which sealingly contacts the sealing surface of a flange on closet 80 which is mounted within the valve body ( via mounting brackets 400 and tightened set screws 405 and 410 ). after a long period of use , the wear flange of the closet 80 ( either flange 310 or 320 depending on how the closet is positioned within the valve body ) will wear such that an uneven surface is formed , and the peripheral wear portion of the door member 200 ( the peripheral portion of either the surface 214 or 220 ) will wear , such that pressure contact between the respective wear surfaces will not result in a sealing engagement . vacuum loss from the dust collection system will be the undesirable result . with respect to closet 80 , set screws 405 and 410 can be unscrewed from contact with abutment surfaces 420 and 421 and the closet 80 lifted off mounting brackets 400 and inverted ( such that the other flange becomes the functioning wear surface ), and then fixed again in position by positioning on the mounting brackets 400 and retightening of set screws 405 and 410 . with respect to door member 100 , bolts 164 and 165 can be loosened such that members 110 and 140 are slidingly moved away from one another , door member 200 is turned over , and then fixed again in position by sliding the members 110 and 140 back together with tightening of bolts 164 and 165 . thus , it can be easily seen that both the closet and the valve door member have twice the useful life of prior art structures . while there has been shown and described what is considered to be a preferred embodiment of the present invention , it is obvious that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined in the appended claims .
| 5 |
referring to fig4 , a core logic circuit 20 according to a first preferred embodiment of the present invention includes an interface controller portion , a geometry engine 24 and a control circuit 25 . the interface controller portion includes the similar controllers in fig1 , for example , a host controller 230 , a dram controller 231 , an agp / pci controller 232 and other i / o interface controllers 233 , which are used for controlling data exchange with a cpu , a system memory , a graphics accelerator ( not shown ) and other i / o interfaces , respectively . a demultiplexer 242 is electrically connected to the host controller 230 for receiving a first graphing command from the cpu via the host controller 230 , and outputting the first graphing command to either of the transforming / lighting ( t / l ) unit 241 and the agp / pci controller 232 . a transform / lighting operation is performed by the geometry engine 24 so as to realize a second graphing command prior to a setup / rendering operation performed by the graphic accelerator . a multiplexer 243 is electrically connected to the t / l unit 241 , the demultiplexer 242 and the agp / pci controller 232 for selecting one of the first graphing command and the second graphing command to be outputted to agp / pci controller 232 . moreover , the demultiplexer 242 and the multiplexer 243 are respectively controlled by a first control signal s 1 and a second control signal s 2 of the control circuit 25 for controlling whether the first graphing command flows to the geometry accelerator via the geometry engine 24 . it is of course that the control circuit 25 can also include registers for storing these control signals . since the transform / lighting operation is performed by the geometry engine 24 of the core logic circuit 20 , the transform / lighting operation will be no longer required to be done by the cpu . in addition , the architecture for performing transform / lighting operation could be removed from the graphics accelerator . therefore , the cost of the 3d graphics accelerator is dramatically reduced without impairing the graphics functions of the whole computer system . since the core logic 20 is pad - limited , the extra gates can be utilized for installing the geometry engine 24 and make use of the area of the core logic circuit 20 . referring to fig5 , a core logic circuit 30 according to a second preferred embodiment of the present invention also includes an interface controller portion , a geometry engine 34 and a control circuit 35 . the interface controller portion includes the similar controllers in fig4 , e . g . a host controller 330 , the dram controller 331 , an agp / pci controller 332 and other i / o interface controllers 333 . the core logic circuit firmer includes a first demultiplexer 342 and a first multiplexer 343 . a data flow control unit 344 is provided between the t / l unit 341 and the multiplexer 343 . the data flow control unit 344 includes a second demultiplexer 3441 and a second multiplexer 3442 , which are interconnected with each other and both electrically connected to the memory controller 331 for determining the second graphing command to be outputted to either one of the system memory and the graphing accelerator via the memory controller 331 and the agp / pci controller 332 , respectively . the second demultiplexer 3441 and the second multiplexer 3442 are respectively controlled by a third control signal s 3 and a fourth control signal s 4 of the control circuit 35 . similarly , the control circuit 35 can also includes registers for storing these control signals . it is noted second graphing command can be optionally stored in the system memory through the dram controller 331 and , if desired , it will be retrieved . therefore , the processing speed of geometry engine 34 can match the graphics accelerator so as to avoid being idle . since the system memory is provided for buffering the output of the geometry engine , the memory bandwidth of the local memory will not be fully occupied , and the performance of the rendering engine will not be adversely affected . certainly , the geometry engine 24 / 34 can have other functions in 3d graphics . for example , a primitive sorter can re - order 3d primitives in accordance with their depth information , and discard the covered triangles . thus , only the visible primitives will be saved and passed to the next stage , which prevent the graphics accelerator from memory bound and thus enhance its performance . if the 3d graphics accelerator of a computer system has a geometry engine with the same functions as that in the core logic circuit of the present invention , it is desirable to provide a process for coordinating 3d graphics operations of a core logic circuit and a 3d graphics accelerator in a computer system , thereby obtaining the highest throughout of the 3d graphing commands . the process of the present invention includes steps of detecting respective access conditions of the system memory and the local memory , and starting the 3d geometry engine of a selected one of the core logic circuit and the 3d graphics accelerator to perform a graphics operation according to the access conditions . the detection can be done once per frame or per scene . for illustration , the flow chart is shown in fig6 . if the system memory is busier than the local memory , the graphics operation is performed by the 3d geometry engine of the 3d graphics accelerator . if the local memory is busier than the system memory , the graphics operation is performed by said 3d geometry engine of the core logic circuit . while the invention has been described in terms of what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention needs not be limited to the disclosed embodiment . on the contrary , it is intended to cover various modifications and similar arrangements included within the spirit and scope of the appended claims which are to be accorded with the broadest interpretation so as to encompass all such modifications and similar structures .
| 6 |
referring now to fig1 there is shown a reinforced filter assembly 20 which is comprised of a plurality cells 22 - 27 , vertically stacked one upon the other . disposed along the circumference of each filter cell is an edge 28 which is utilized to retain the various components of each individual cell together , as described more fully below . a relatively large filtration area 30 is used for the introduction of unfiltered fluid ( not shown ) therethrough which exits through the center aperture or core 31 . disposed at either end of the assembly 20 is an retainer ring assembly 32 . the entire filter assembly 20 is disposed inside a chamber ( not shown ) having an unfiltered fluid inlet for the chamber and a filtered fluid outlet connected to one or both retainer ring assemblies 32 . referring now to fig2 there is shown a cross - sectional view taken through a portion of the filter cell assembly shown in fig1 . a retainer ring assembly 32 is disposed at either end of the filter assembly 20 . retainer ring assembly 32 is comprised of an end fitting 34 having an annular slot 36 therein . disposed in the annular slot 36 is a gasket 38 which coacts with an annular outlet conduit ( not shown ) thereby preventing the migration of unfiltered fluid adjacent the filtration area 30 into the central aperture or core 31 . a plurality of filter assemblies may be disposed inside a chamber in stacked relationship thereto , thereby allowing replacement of groups of filter assemblies ( not shown ). a plurality of annular ribs 40 are disposed on the underside of end fitting 34 and provide a fluid - tight fitting between the end fitting 34 and the surface of the filtration area 30 , while holding and retaining mesh 42 thereon . optionally , the mesh 42 may be sealed , e . g . ultrasonically welded , to end fitting 34 . still referring to fig2 filter cell 22 , 24 is comprised of netting 42 disposed on the outer surfaces thereof . the netting is preferably a mesh of the desired thickness and mesh size sufficient to withstand the forward and backward fluid flow requirements and provide for relatively undiminished fluid flow therethrough while preventing flaking and the like . hence , this netting supplements , enhances or increases the tensile strength of the filter medium 44 when wet . generally , any type of netting or mesh may be used which is pervious to flow . it is preferred however to use a polymeric mesh or netting , e . g . polypropylene . it is also preferred to have a rigidized netting or mesh which forms parallel fluid flow channels tangential to the media . a filter material separator 46 is disposed between each of the two adjacent layers of filtration material 44 . the separator 46 is utilized to prevent collapse of the filter cell in use and provide integrity to each individual filter cell while providing relatively unimpeded fluid flow therethrough . further , it has been observed that for &# 34 ; dense &# 34 ; filter cell cartridges when cell - to - cell spacing is minimal , the netting 42 acts as a separator between adjacent cells and therefore aids in fluid flow along the surface . disposed between each cell is an inter filter cell spacer 48 . the spacer 48 is preferably comprised of the same material as the retainer ring assembly 32 . the spacer 48 has a plurality of annular recesses 50 and ridges 51 disposed on both sides . it is preferable that at least two ridges 51 are utilized ( and hence two recesses 50 ) to form a fluid - tight seal between adjacent filtration material disposed on adjacent filter cells . since the netting has a plurality of apertures therethrough , it has been found that two annular ridges are usually necessary to prevent migration of unfiltered fluid along the netting 42 into the central aperture or core 31 . a plurality of bands 52 engage slots 54 in the retainer ring assembly 32 and extend from the retainer ring assembly at one end to the retainer ring assembly at the other end and are used to form a rigid filter cell assembly 20 . the bands 52 are preferably of stainless steel , although any other suitable material may be utilized . further , it is possible to utilize a plurality of threaded bolts or the like extending through the filter cell assembly and suitably attached to the retainer ring assemblies 32 in order to form a rigid assembly . referring now to fig3 there is shown a top view of a cutting die utilized in the present invention . a netting cutting die , indicated generally at 56 , is utilized to cut netting 56 into the appropriate configuration . the cutting die 56 is comprised of a cutting area , shown generally at 58 , disposed on a base 60 . three cutting blades are disposed on the base 60 . an outer circumference cutting blade 62 is utilized to cut the outer diameter of the netting to the approximate size of the filter cell with which it is to be used . radially inward is disposed an additional cutting blade , designated 64 . another blade is shown at 66 and is an inner circumference cutting blade . disposed between adjacent blades are spacers 68 ( shown more clearly in fig4 ) which are preferably of a sponge - type material to provide some backing to the netting during the cutting operation so that cutting is more uniform along the annular edge of the blade and to free the netting from the die after being cut . the inner circumference cutting blade has axially disposed therein a centering hole 70 which is used for alignment or registration purposes in cutting the netting . several non - cutting portions , designated respectively as notches 72a , 72b , are disposed on cutting blade 64 . each cutting blade is generally a thin sheet stock bent into an annular configuration having one end sharpened so as form blade tip 74 . referring to fig5 use of the cutting die 56 is more clearly illustrated via a representation of how the netting utilized is cut . the netting blank , shown generally at 76 , is larger than the desired area required . the netting is placed onto the cutting die 56 thereby forming the appropriate cuts resulting in a number of portions . these portions include discard material 78 and filter netting 80 which is material that is actually used with the filter cell . the cutting blade 64 results in respectively netting flaps 82a , 82b which remain attached to the netting via netting notches 84a , 84b . this therefore results in a frangible type of plug / donut 86 . it has been found that it is necessary to produce the donut - type structure 86 in order to facilitate assembly of each filter cell . more particularly , the center aperture is utilized to center the netting with respect to the filtration material during the actual assembly . referring to fig7 preliminary alignment and assembly of a filter cell is shown . more specifically , a cell assembly mandrel 102 is utilized to align the various components of a filter cell . initially placed onto mandrel 102 is a filter material separator 46 . on either side of separator 46 is the filtration material 44 , followed by filter netting 80 . this forms the assembly shown in fig6 ( without the mandrel 102 ). molding of the edge 28 on each filter cell is accomplished as shown in fig8 and 9 . there , a cell assembly press 100 disposed on mandrel 102 ( or any other suitable or subsequent mandrel ) and comprised of essentially two halves are axially urged along mandrel 102 towards each other until mated as shown in fig9 . this causes the edge of netting 80 to be compressed against filtration material 44 . a cavity , as part of injection mold 96 contained on cell assembly press 100 , is configured so as to be in the shape of edge 28 along the annular edge of the compressed filter cell . molten material is then injected through sprue 97 , of die 96 , and enters into cavity 94 so as to form edge 28 . in the preferred embodiment of the present invention , the edge material is the same as retainer ring assembly 32 and inter filter cell spacer 48 , although any other suitable type of material may be utilized . the press 100 is remained closed until sufficient cooling of the injected material is accomplished after which time the mold is then separated and the filter cell removed from mandrel 102 . the netting 80 thus becomes sealed to and / or an integral part of the edge seal 28 . referring now to fig1 and 11 , final construction of a filter cell assembly is shown . the edge 28 , as mentioned , is comprised of plastic and has a plurality of elongate slots or apertures 110 having spacer portions 112 disposed therebetween . after the molding process shown by fig8 and 9 , the plug or donut 86 is removed as shown . in order to facilitate removal of the plug or donut 86 , netting notches 84a and 84b are utilized . therefore it is possible to merely pull on donut 86 in order to remove it from the netting 80 without performing a further cutting operation . the inner diameter of the plug or donut 86 is only used for centering purposes about mandrel 102 during preliminary assembly steps and is removed prior to construction of the filter cell assembly 20 . actual assembly of the filter cell assembly is accomplished by use of a filter assembly mandrel 114 , which is utilized to properly align the various components in the filter cell assembly an inter filter cell spacer 48 is placed between adjacent filter cells 22 , 24 . on the outside of the end filter cells there is an end fitting 34 having a gasket 38 therein . thereafter , the mandrel 114 is removed and the bands 52 are placed into slots 54 , compressing the cells and components thereof to thereby form a rigid cohesive filter cell assembly structure 20 wherein retainer rings 34 and separators 48 are urged against the filter media and netting to thereby seal the central core 31 . referring now to fig1 and 13 , top and cross - sectional views of filter netting 80 overlaid onto filtration material 44 are shown . the netting 80 may have a relatively smooth or planar undersurface to contact the filtration material 44 or may protrude into the filter media . both types of netting minimize cracking , flaking and the like . the netting holds down the filtration material 44 to the maximum extent possible without impeding fluid flow therethrough . tests were conducted to compare the present invention with prior art filter cell designs . these tests produced the following results : ______________________________________back pressure testtype of cell burst pressure ( psi ) ______________________________________standard / prior art 1 . 5 - 3 . 0reinforced with netting 16 . 0 - 22 . 0______________________________________ further , while a number of different types of netting were tried , type no . xn 7020 manufactured by conwed plastics of minneapolis , minnesota , were found to produce the best results . however , other types of netting produced by conwed plastics , such as part numbers xn 7025 , xn 4210 , xn 4700 and xn 3900 are workable . the first two of these part numbers respectively performed mos satisfactorily and had a strand configuration of 7 by 5 and are a standard resin pp / pe blend . however , it is to be understood that other reinforced netting produced by other manufacturers is acceptable as individual circumstances dictate . it is to be remembered that many variations of the present invention may be practised without departing from the spirit and scope of the present invention . for example , the filter cells may be of different configurations , such as cylindrical , while different edge - type mechanisms may be utilized . further , different types of materials may be utilized while different methods of assembly may similarly be used . additionally , it is envisioned that it is possible to place the netting on the interior of the filter cell adjacent the filtration material so as to prevent flaking , cracking and the like during filter operation without departing from the spirit and scope of the present invention . accordingly , the present invention produces an improved cell - type filter cartridge having an injection - molded edge which resiliently engages and holds reinforced netting tightly to the filter medium . a method of manufacturing is provided for assembling the improved filter cell cartridges so as to minimize leakage and produce an aesthetically improved filter cell which does not prematurely fail or aesthetically indicate failure . the present invention also produces an inexpensive means for improving the physical and aesthetic characteristics of a filter cell by use of a netting which minimizes the frequency at which the filter cell blinds or closes itself off while increasing mechanical and tensile strength as well as burst strength and the like . having thus described the present invention in detail , it is to be understood that the foregoing description is not intended to limit the spirit and scope thereof . what is desired to be protected by letters patent is set forth in the appended claims .
| 1 |
[ 0023 ] fig1 is a circuit diagram that illustrates a fast transient response dc - dc converter 100 according to the invention . generally , the dc - to - dc converter 100 stabilizes output voltage v out 112 according to the reference signal at the input of the comparator . during a transient , the output load is in the process of switching from one dc state to another . the dc - to - dc converter 100 effectively reduces recovery time from a transient by modifying duty cycle in order to drive the v out 112 to the desired steady state . the dc - to - dc converter 100 uses a reference dc voltage source v ref 114 , a reference signal generator 116 , a comparator 118 , a driver 120 , and a pair of switches 122 . the signal generator 116 generates a reference signal 126 , which is preferably a 300 khz saw - tooth signal , or alternatively , any shape of periodic signal such as a triangular signal or a sinus signal , with a dc offset determined by the dc voltage generated by vref 114 . the reference signal 126 is received by the comparator 118 as its first input . through a feedback loop 124 , the output voltage v out 112 is received by the comparator 118 as its second input . the comparator 118 compares the v out 112 with the reference signal 126 , and generates a pwm signal 128 with a duty cycle determining an increase or decrease in v out 112 . further , the comparator 118 forces v out 112 to follow the reference signal 126 by increasing or decreasing the pulse width of its output pwm signal 128 if v out 112 is lower or higher than signal 126 respectively . specifically , the driver 120 receives the pwm signal 128 as its input and drives the switches 122 , which are preferably implemented as metal oxide semiconductor field effect transistors ( mosfets ), high and low alternatively to control the v out 112 . preferably , as a result , v out 112 approximates v ref and is maintained within the limits of the reference signal 126 . for example , where the reference signal generator 116 generates a saw - tooth reference signal 126 with peak to peak sawtooth fluctuations of 100 mv at a particular dc v ref voltage , v ref โ 50 mv & lt ; v out & lt ; v ref + 50 mv . additionally , a lc low pass filter is coupled in series with the output load ( v out ) 112 . the inductance of the inductor 130 in the low pass filter should be kept as small as possible in order to reduce the recovery time for a transient of the load . [ 0024 ] fig2 provides an exemplary application circuit 200 illustrating an application of the dc to dc converter circuit 100 of fig1 . the circuit 200 uses a reference voltage generator built with , for example , d 1 ( tl 431 ) 202 , compensating for the varying of input voltage 114 to ensure the generation by comparator 118 of a pwm signal 128 which regulates the output voltage v out in accordance with the reference voltage as described above . a ramp generator 116 , generating a triangular signal 126 with peak to peak amplitude of approximately 100 mv , is built with part u 3 ( lm 311 ) 204 . the comparator 118 described above , which receives as inputs the output voltage v out 112 and the triangular signal 126 and generates a pwm signal 128 , is built with u 2 ( lm 311 ) 206 . the driver 120 in the exemplary application is built with u 1 ( tps 2830 ) 208 . finally , a power block 210 consisting of mosfets q 1 and q 2 , 122 , inductor l 1 , 130 , resistor r 10 , and capacitor c 4 , drives the output voltage v out 112 . this dc to dc converter circuit provides for improved recovery time of a transient of the load . note that this invention includes but is not limited by the components and circuit of the application schematic of fig2 . alternative embodiments of the invention may include two or more converter circuits 100 in a multiphase architecture , wherein the angle of the phase shifting between two circuits depends on the number of phases used . for example , in a four - phase architecture , the shifting angle is 90 degrees . a concern with the multiphase architecture is the undesired current flow between two phases . for instance , when a load is applied on the output , if one phase delivers much more current than the other to the load , the conversion efficiency will be severely affected . the problem is similar with putting in parallel two voltages sources . if the two voltage sources are different , a current will flow between them . to solve this problem in a multiphase dc - to - dc converter , a current balancing mechanism is necessary . for example , in a two phase dc - to - dc converter , a current balancing block is used to adjust the output voltage of the second phase to be identical with the output voltage of the first phase . by using current sense resistors , the current information is available to the current balancing block that will generate an offset voltage used to adjust the output voltage of the second phase . there are two options to execute the current balancing mechanism : ( 1 ) by modifying the reference voltage for the second phase ; or ( 2 ) by modifying the feedback voltage for the second phase . referring to fig3 illustrated is an embodiment of a two - phase dc - to - dc converter 300 with a current balancing block that acts on reference signal of the second phase . the first phase 100 a establishes the output voltage 112 depending on the reference signal 126 a applied on the input of the comparator 118 . the current balancing block 301 shifts the dc value of the reference signal 116 for the second phase 100 b to obtain the same current magnitude delivered by each phase . assuming the current through the first phase 100 a is of a higher value than the current through the second phase [ 0027 ] 100 b , the voltage on the non - inverting input of the error amplifier 302 is higher than the voltage on the inverting input . the error amplifier 302 acts to reduce the value of the offset voltage 303 and thus the dc values of the reference voltage for the second phase 100 b increases . accordingly , the duty cycle of the second phase increases . consequently , the second phase delivers a current with higher value than before . when the currents delivered by each phase are equal , the offset voltage 303 is maintained at that value to keep a current balance . referring to fig4 illustrated is another embodiment of a two - phase dc - to - dc converter 400 with a current balancing block that acts on feedback side of the second phase . the first phase 100 a establishes the output voltage v out 112 depending on the reference signal 126 a applied on the input of the comparator 128 . the current balancing block 401 shifts the dc value of the feedback voltage for the second phase 100 b to obtain the same current magnitude delivered by each phase . assuming the current through the first phase 100 a is of a value higher than the current through the second phase 100 b , the voltage on the inverting input of the error amplifier 402 is higher than the voltage on the non - inverting input . the error amplifier 402 acts to increase the value of the offset voltage 403 and thus the dc value of the feedback voltage for the second phase 100 b decreases . accordingly , the duty cycle of the second phase 100 b increases . consequently , the second phase 100 b delivers a current with a higher value than before . when the currents delivered by each phase are equal , the offset voltage 403 is maintained at that value to keep a current balance . note that the inverting and non - inverting inputs of the current balancing block in fig4 is reversed than in fig3 because the current balancing block in fig4 is acting on the feedback voltage . the main advantage of the current balancing mechanism used in the converters illustrated in fig3 and fig4 is that when alteration of the load generates a transient , both phases act to recover the output voltage to its steady state . because the behavior of each phase in transient is almost the same ( only minor differences exist due to the spreading of the values of components used ), the current balancing circuit only needs to correct slight differences modifying a little bit of the offset voltage on reference side as in fig3 or feedback side as in fig4 to balance the currents for the new steady state . note that both types of current balancing methods could be used in a multiphase architecture where the current balancing block has as inputs the current information from each n phase and the output voltage and generates the offset voltages for phase 2 to n to balance the currents with the current on the first phase . referring to fig5 a , illustrated is a diagram showing the variation of the output voltage with the input voltage . for a certain input voltage v in , because the reference signal is constant , the duty cycle will be d 1 = v out 1 / v in . this means that the voltage v out 1 crosses the reference signal at such a value that the duty cycle is obtained . if the input voltage decrease , for example , to k * v in where k & lt ; 1 , the output voltage decreases in order to increase duty cycle , because the new value of the duty cycle is d 2 = v out 2 / k * v in . therefore , the output voltage decreases with a value of ( d 2 โ d 1 )*( amplitude of saw tooth reference signal ). even for very low amplitudes of the reference signal , because the input voltage may vary between large limits , the output voltage varies with the input voltage . referring to fig5 b , illustrated is a method to compensate the output voltage with a varying input voltage . one way to prevent the output voltage from varying with the input voltage is to generate a saw tooth signal with an amplitude proportional with the input voltage and its top to be maintained at a fixed dc voltage level vref . this means that for the input voltage equal with v in , the output voltage is v out 1 corresponding to a value where the output voltage and the saw tooth signal cross each other to obtain duty cycle d 1 = v out 1 / v in . therefore , if the amplitude of the saw tooth signal is a saw tooth and the top of it has a value v ref , then v out 1 = v ref โ d 1 * a sawtooth , i . e ., v out 1 = v ref โ v out 1 * a sawtoot / v in , or v out 1 = v ref /( 1 + a sawtooth / v in ). when the input voltage is decreasing with a k & lt ; 1 factor , the amplitude of the saw tooth decreases with the same k factor maintaining the top of the saw tooth signal at v ref . the duty cycle corresponding to the new value of input voltage is : d 2 = v out 2 /( k * v in ). however , because v out 2 = v ref โ d 2 *( ka sawtooth )= v ref โ v out 2 * k * a sawtooth /( k &# 39 ; v in ), v out 2 = v ref /( 1 + a sawtooth / v in ). this means that the v out 1 = v out 2 . therefore , the output voltage does not vary with the input voltage . the major advantages of the method described above include : ( 1 ) the output voltage does not depend on the input voltage ; ( 2 ) the gain of the loop does not depend on the input voltage and thus the behavior of the dc - to - dc converter maintains the same for various input voltages . the gain of the loop is actually v in / a sawtooth because a sawtooth is proportional to v in , the gain is constant ; and ( 3 ) at a higher input voltage , there is a higher noise on the output due to the switching . when the saw tooth signal amplitude is increased , the pwm comparator works correctly , without generating parasitic pulses due to the noise in the output voltage . [ 0035 ] fig6 is a circuit diagram illustrating the method to compensate the output voltage to the varying of the input voltage . the clock pulses 601 close the switch 602 for a very short time which is long enough to charge capacitor 603 to v ref value . in this way , the top of the saw tooth signal is exactly v ref . the switch 602 opens and the capacitor 603 is discharged with a constant current proportional to the input voltage . the elements of the circuit will be adjusted to obtain the desired amplitude of the saw tooth . this circuit compensates the output voltage to the varying of the input voltage . one application of this circuit is the case in a notebook computer where the input voltage could be the battery voltage or the adapter voltage . adapter voltage is usually 20v where a discharged battery voltage could be as low as 8v or less . the system is required to work over the entire range . [ 0036 ] fig7 is a screen capture showing the waveforms of a transient when a load is applied to and removed from a two phase dc - to - dc converter . the load current step is 20 amperes . ch 1 is the waveform of the output voltage ( v out ). ch 2 is the waveform of the pwm signal of the first phase ( pwm 1 ). ch 3 is the waveform of the pwm signal of the second phase ( pwm 2 ). ch 4 is the waveform of _ load current . when the load is applied ( i . e . the current increases from 0 amperes to 20 amperes ), the v out drops . because the converter has an increased duty cycle , the output voltage returns to its steady state after a very short time ( the transient response of the converter is about 100 ns that allows recovery times below 10 ฮผs ). when the load is removed , the converter acts to reduce duty cycle to recover v out . as shown in fig7 each phase modifies its own pwm in order to recover v out from the transient condition . therefore , when a multiphase architecture is used , the transient on v out will be recovered much faster depending on the number of phases . although the invention is described herein with reference to the preferred embodiment , one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the spirit and scope of the present invention . accordingly , the invention should only be limited by the claims included below .
| 7 |
in order to make the structure and characteristics as well as the effectiveness of the invention to be further understood and recognized , the detailed description of the invention is provided as follows along with preferred embodiments and accompanying figures . fig1 shows a structural schematic diagram according to a preferred embodiment of the invention . as shown in the figure , the present embodiment provides a light - emitting diode ( led ) 1 , which comprises an led die 10 , one or more metal pads 12 , and a fluorescent layer 16 . the led die 10 includes two electrodes 107 . the number of the metal pads 12 according to the present embodiment is two . the two metal pads 12 are set on the two electrodes 107 , respectively . the fluorescent layer 16 is set on the led die 10 . in addition , the fluorescent layer 16 does not cover the two metal pads 12 completely . instead , the metal pads 12 are exposed for the convenience of subsequent wiring and packaging processes . the fluorescent layer 16 converts partial or all of light with a first wavelength produced by the led die 10 to light with at least a second wavelength for producing light mixing . the led 1 provided according to the present embodiment is a light - mixing chip , which can be packaged directly without the need of coating fluorescent powders on the package . the thickness of the fluorescent layer 16 is greater than 30 ฮผm . the materials of the fluorescent layer 16 include fluorescent powders and an organic polymer material . the fluorescent powders are chosen from the group comprising red fluorescent powders , green fluorescent powders , blue fluorescent powders , and the combination of the fluorescent powders described above . the led die 10 described above further comprises a first semiconductor layer 101 , a light - emitting layer 103 , and a second semiconductor layer 105 . the light - emitting layer 103 is set on the first semiconductor layer 101 ; the second semiconductor layer 105 is set on the light - emitting layer 103 ; the metal pads 12 are set on the electrodes 107 . when the first semiconductor layer 101 is p - type , the second semiconductor layer 105 is n - type . alternatively , when the first semiconductor layer 101 is n - type , the second semiconductor layer 105 is p - type . fig2 shows a flowchart according to a preferred embodiment of the invention . as shown in the figure , in contrast to fig1 , which shows an led 1 , the present figure shows a method for manufacturing the led 1 . to manufacture the led 1 , the step s 10 is first executed for forming an led die 10 , which includes two electrodes 107 . referring together to fig3 , the method for forming the led die 10 comprises the step s 101 forming a first semiconductor layer 101 ; the step s 103 forming a light - emitting layer 103 on the first semiconductor layer 101 ; and finally the step s 105 forming a second semiconductor layer 105 on the light - emitting layer 103 . after the step s 10 is completed , the step s 12 is executed for forming one or more metal pads 12 on the two electrodes 107 of the led die 10 . next , the step s 14 is executed for forming a fluorescent layer 16 on the led die 10 . the fluorescent layer 16 does not cover the metal pads 12 completely . instead , the metal pads 12 are left exposed for the convenience of subsequent wiring and packaging processes . for forming the fluorescent layer 16 on the led die 10 , glue dispensing , spraying , or pouring methods are applied . for avoiding the fluorescent layer 16 from covering the metal pads 12 completely during the forming process of the fluorescent layer 16 , prior to forming the fluorescent layer 16 on the led die 10 using the glue dispensing , spraying , or pouring methods , a mask is used on the metal pads 12 . the mask can mask the metal pads 12 and expose the location to form the fluorescent layer 16 . besides , the mask is manufactured by lithography or by screen - printing using organic polymer materials such as photoresist . the led die is divided a plurality of chips . the glue ratio in the glue dispensing , spraying , or pouring methods is controlled according to the photoelectric properties of each the chip . fig4 a and 4b show structural schematic diagrams according to other preferred embodiments of the invention . as shown in the figures , according to the present embodiments , two led structures are provided . the difference between the present embodiments and the one described above is that , according to the present embodiments , the shape of the fluorescent layer 16 can be changed by etching . the shapes of the fluorescent layer 16 can be trapezoidal or upside - down trapezoidal . fig5 shows a structural schematic diagram according to another preferred embodiment of the invention . as shown in the figure , the present embodiment provides an led 1 comprising an led die 10 , one or more metal pads 12 , a dielectric layer 18 , and a fluorescent layer 16 . the led die 10 includes two electrodes 107 . the metal pads are set on the electrodes 107 of the led die 10 . the dielectric layer 18 is set on the led die 10 , and is located on the periphery of the metal pads 12 . the fluorescent layer 16 is set on the dielectric layer 18 , and is located on the periphery of the metal pads 12 . the fluorescent layer 16 converts partial or all of light with a first wavelength produced by the led die 10 to light with at least a second wavelength for producing light mixing . in addition , the fluorescent layer 16 does not cover the metal pads 12 completely . instead , the metal pads 12 are exposed for the convenience of subsequent wiring and packaging processes . the led 1 provided according to the present embodiment is a light - mixing chip , which can be packaged directly without the need of coating fluorescent powders on the package . besides , the thickness of the fluorescent layer 16 is greater than 30 ฮผm . the led die 10 further includes a first semiconductor layer 101 , a light - emitting layer 103 , and a second semiconductor layer 105 . fig6 shows a flowchart according to a preferred embodiment of the invention . as shown in the figure , in contrast to fig5 , which shows an led 1 , the present figure shows a method for manufacturing the led 1 . to manufacture the led 1 , the step s 10 is first executed for forming an led die 10 . then the step s 12 is executed for forming one or more metal pads 12 on the electrodes 107 of the led die 10 . next , the step s 13 is executed for forming a dielectric layer 18 on the led die 10 . finally , the step s 14 is executed for forming a fluorescent layer 16 on the dielectric layer 18 . the fluorescent layer 16 does not cover the metal pads 12 completely . instead , the metal pads 12 are left exposed for the convenience of subsequent wiring and packaging processes . for forming the fluorescent layer 16 on the led die 10 , glue dispensing , spraying , or pouring methods are applied . for avoiding the fluorescent layer 16 from covering the metal pads 12 completely during the forming process of the fluorescent layer 16 , prior to forming the fluorescent layer 16 on the led die 10 using the glue dispensing , spraying , or pouring methods , a mask is used on the metal pads 12 . the mask can mask the metal pads 12 and expose the location to form the fluorescent layer 16 . besides , the mask is manufactured by lithography or by screen - printing using organic polymer materials such as photoresist . fig7 shows a structural schematic diagram according to another preferred embodiment of the invention . as shown in the figure , for packaging the led 1 provided in fig1 , the led 1 is set on a carrier 2 . then , the metal pads 12 are connected by wiring . finally , use packaging glue 3 to cover the carrier 2 and the led 1 . the material of the packaging glue 3 is organic polymer , and fluorescent powders can be further contained therein . the organic polymer material of the packaging glue 3 differs from the organic polymer material of the fluorescent layer described in fig1 . in addition , the packaging glue 3 and fluorescent layer 16 are not processed simultaneously . the baking time of the two is also different , which can reduce the stress problem effectively produced in the package of the led 1 . moreover , the packaging structure according to present embodiment can be applied to the embodiment of fig5 . fig8 shows a flowchart according to a preferred embodiment of the invention . as shown in the figure , for packaging the led 1 provided in fig1 , the step s 16 is first executed for setting a carrier 2 to the led 1 and opposite to the fluorescent layer 16 . then the step s 18 is executed for connecting the metal pads 12 by wiring . finally , the step s 19 is executed for coving the carrier 2 and the led 1 by packaging glue 3 . the packaging method provided according to the present embodiment can be applied to the led 1 provided in fig5 , and will not be described in detail . it is known from above that the invention provides an led and a method for manufacturing the same . the characteristics of the invention include that the metals pads are left exposed for the convenience of subsequent wiring and packaging processes . in addition , the led provided by the invention is a single light - mixing chip , which can be packaged directly without the need of coating fluorescent powders on the packaging glue . because the fluorescent layer and the packaging glue are not processed simultaneously and are of different materials , the stress problem in the packaged led can be reduced effectively . accordingly , the invention conforms to the legal requirements owing to its novelty , nonobviousness , and utility . however , the foregoing description is only embodiments of the invention , not used to limit the scope and range of the invention . those equivalent changes or modifications made according to the shape , structure , feature , or spirit described in the claims of the invention are included in the appended claims of the invention .
| 7 |
the technical solutions of the present invention are further described in detail below with reference to following specific embodiments and accompanying drawings : a v - pulley manufacturing process ( referring to fig1 ). first , a pulley is formed . gray iron material ht250 is chosen as a casting raw material . a sand - casting process is used for gray iron . the casting material ht250 is heated and melted , and liquid ht250 is poured into a sand cavity through a pouring opening . once cooled , a cast piece is taken out after the mold is released . the cast piece is an integrally formed cylindrical pulley blank 1 . a connecting hole 7 penetrating two ends of the cylindrical pulley blank 1 is drilled to connect a connecting shaft in an axial center of the pulley blank 1 . after the pulley blank 1 is cast , stress - relieving annealing , surface quenching , and low - temperature annealing are performed on the pulley blank 1 sequentially . the process of stress - relieving annealing includes : the pulley blank 1 is placed in a furnace at 150 ยฐ c ., the temperature of the furnace is increased to 550 ยฐ c ., the temperature is kept for 6 hours , and then the pulley blank 1 is air cooled . the process of surface quenching includes : the pulley blank 1 after stress - relieving annealing is placed in the furnace and heated to 800 ยฐ c ., and the pulley blank 1 is then placed in oil for quenching . the process of low - temperature annealing includes : the pulley after quenching is placed in the furnace at 200 ยฐ c . to perform annealing . the process of thermal treatment removes the internal stress of the pulley blank 1 , and increases hardness and abrasive resistance of the pulley blank 1 and extends service life of the pulley . next , v - belt grooves are machined on the outer wall of the pulley blank 1 . the pulley blank 1 is held on a cnc machine tool and cutting is performed on the outer surface of the pulley blank 1 to form several v - belt grooves 2 in a shape of a v belt on the outer wall of the pulley blank 1 . in certain embodiments , the belt grooves are spaced at a substantially equal distance . based on the number of v belts required , a corresponding number of v belt grooves are made . a machining allowance is kept after the belt grooves are machined . after the belt grooves have been machined , a key groove 8 is machined inside the connecting hole of the pulley blank 1 , and the pulley blank 1 is held in a slotting machine to cut the key groove . after the key groove is made , precise machining is performed on the pulley , and the cnc machine tool is used once again to perform precise machining on the outer surface of the pulley and the side surfaces of the belt grooves , and remove the machining allowance . the cnc machine tool performs machining only once to complete both coarse and precise machining of the pulley . after this machining is completed , a bright smooth surface is formed on the outer surface of the pulley and the side surfaces of the belt grooves . after the precise machining is completed , a drilling operation is performed . the pulley is mounted and fastened on a drilling machine , and six axial fixing holes are drilled in evenly spaced around the connecting hole 7 . the axial fixing holes are used for connection and fastening of the connecting shaft and the connecting hole . after the pulley has been drilled , a shot blasting operation is performed on the pulley . a crawler shot blasting cleaner is used for a shot blasting machine . the pulley is placed in the shot blasting machine , and the shot blasting machine performs shot blasting operation on the side surfaces of the belt grooves . for ease of machining , shot blasting is performed on the entire pulley , instead of shot blasting of the side surfaces of the belt grooves only . a propelled material used in the shot blasting machine is steel shot . the hardness of steel shot is greater than 40 hrc . the linear velocity of propelling steel shot is not less than 60 m / s . the diameter of steel shot is about 0 . 6 mm . the duration of shot blasting is around 8 minutes . after shot blasting is completed , dense indentations are formed on the side surfaces of the belt grooves , and a rough shot blasting layer 3 is formed on the side surfaces of the belt grooves . the shot blasting layer 3 has a high friction coefficient , and a frictional force between the v belt and the shot blasting layer is great . after shot blasting is completed , the pulley is made , packed and warehoused . a v - pulley manufacturing process . the v - pulley manufacturing process resembles that of embodiment 1 described above referring to fig1 . the key differences lie in the selection of a casting material of a pulley blank and the process of thermal treatment associated with the casting material . in this embodiment , alloy steel is chosen to form a pulley blank 1 through casting . the alloy steel may be one of alloy steel such as low - carbon alloy structural steel , cemented steel , and tempered steel . in one embodiment , 16 mn is used . the pulley blank 1 is cast and then taken out after its mold is released . thermal treatment processes of quenching and low - temperature annealing are performed in sequence . in the quenching process , the pulley blank 1 is placed in a furnace and heated to 900 ยฐ c ., and then placed in oil for quenching . in the low - temperature annealing process , the pulley blank 1 after quenching is annealed in the furnace at 250 ยฐ c . a martensitic substrate having high strength and high hardness is obtained , thereby enhancing the abrasive resistance performance of the pulley and extending service life of the pulley . once the pulley blank 1 is made and thermal treated , steps such as machining of v - belt grooves , precise machining , drilling , and shot blasting are performed , and these processes are almost the same as those in embodiment 1 , and these steps will not be repeated here . a v - pulley manufacturing process ( referring to fig2 ) includes all process steps described in embodiment 1 . after a shot blasting process on the pulley is completed , a through hole 4 is drilled axially on the pulley . the through hole penetrates two ends of the pulley . the through hole connects all belt grooves . the axis of the through hole is on an outer side of the groove bottoms of the belt grooves . after the through hole is drilled on the pulley , several tooth rings 5 are then cast . in the casting process , a mold of casting tooth rings 5 is first mounted on an outer side of the pulley , the tooth rings are cast at the groove bottoms of the belt grooves . meshing teeth 6 are disposed on the outer surfaces of the tooth rings 5 , and these meshing teeth 6 on the tooth rings 5 are designed according to a principle of mesh transmission . the mold includes bosses fitting the belt grooves . meshing tooth molds of casting tooth ring meshing teeth are provided on the surfaces of the bosses . the tooth rings 5 are cast between the surfaces of the bosses and the groove bottoms of the belt grooves . the through holes 4 are connected to cavities between the surfaces of the bosses and the groove bottoms of the belt grooves . after the mold is mounted and fastened , casting aluminum melt is poured into the cavities between the surfaces of the bosses and the groove bottoms of the belt grooves from the opening position at the end portion of the through hole . after the tooth rings 5 are cooled in air , the mold of casting tooth rings is detached , and finally the v - pulley manufacturing process is completed . the v - pulley has both a shot blasting layer having a relatively high friction coefficient on the side surfaces of the belt grooves and meshing teeth at the groove bottoms of the belt grooves . the v - pulley forms a combined transmission manner of friction transmission and mesh transmission , so that overall performance is greatly improved and desirable . the v - pulley may be then packed and warehoused . a v - pulley manufacturing process resembles that of embodiment 3 described above referring to fig2 , and includes all process steps in embodiment 2 . the material used in the casting process of alloy steel is 40cr . after mold is released , the cast piece undergoes thermal treatments of quenching at 900 ยฐ c . and high temperature annealing at 580 ยฐ c . therefore , a pulley blank with relatively desirable overall performance is obtained . after a shot blasting process on the pulley is completed , a through hole 4 is drilled axially on the pulley . the through hole 4 penetrates two ends of the pulley . the through hole 4 connects all belt grooves . the axis of the through hole is on an outer side of the groove bottoms of the belt grooves . after the through hole 4 is drilled on the pulley , several tooth rings 5 are cast . in the casting process , a mold of casting tooth rings 5 is first mounted on an outer side of the pulley , the tooth rings 5 are cast at the groove bottoms of the belt grooves . meshing teeth 6 are disposed on the outer surfaces of the tooth rings , and the meshing teeth 6 on the tooth rings are designed according to a principle of mesh transmission . the mold includes bosses fitting the belt grooves . meshing tooth molds of casting tooth ring meshing teeth are provided on the surfaces of the bosses . the tooth rings are cast between the surfaces of the bosses and the groove bottoms of the belt grooves . the through hole 4 connects to cavities between the surfaces of the bosses and the groove bottoms of the belt grooves . after the mold is mounted and fastened , casting aluminum melt is poured into the cavities between the surfaces of the bosses and the groove bottoms of the belt grooves from the opening position at the end portion of the through hole . after the tooth rings 5 are cooled in the air , the mold of casting tooth rings is detached , and finally the pulley is packed and warehoused . a v - pulley made according to the present invention has a shot blasting layer with a relatively high friction coefficient on the side surfaces of the belt grooves , and meshing teeth at the groove bottoms of the belt grooves . when this v - pulley is used , the v - pulley performs both friction transmission and mesh transmission , therefore overall performance is desirable . the foregoing embodiments are only a few preferred embodiments of the present invention . they are by no means intended to limit the present invention to their described embodiments . other variations and changes are possible without departing from the technical solutions presented in the claims . while there has been shown several and alternate embodiments of the present invention , it is to be understood that certain changes can be made as would be known to one skilled in the art without departing from the underlying scope of the present invention as is discussed and set forth above and below including claims . furthermore , the embodiments described above and claims set forth below are only intended to illustrate the principles of the present invention and are not intended to limit the scope of the present invention to the disclosed elements .
| 8 |
the present invention discloses a portable accessory box formed by folding a paper material , and the portable accessory box can be formed in one piece . therefore , the portable accessory box is easily fabricated , the cost thereof can be reduced , and manpower expended in the manufacture thereof can be saved . in order to make the illustration of the present invention more explicit and complete , the following description is given in conjunction with the drawings from fig1 to fig7 . referring to fig1 , fig1 is a diagram showing an unfolded portable accessory box in accordance with a preferred embodiment of the present invention . a material of a portable accessory box 100 is preferably a paper material having a buffer structure , such as corrugated paper . the portable accessory box 100 comprises a bottom plate 102 , a side plate 104 and a side plate 106 fixedly connected to two sides of the bottom plate 102 , respectively , and a lower side plate 108 fixedly connected to the lower side of the bottom plate 102 . the side plate 104 comprises an outer side piece 110 , an upper side piece 112 , an inner side piece 114 and a lower side piece 116 connected in sequence , wherein the outer side piece 110 is connected with the bottom plate 102 . the side plate 104 further comprises an embedded slot 118 and an insertion slot 144 , wherein the embedded slot 118 is in the inner side piece 114 and the upper side piece 112 , and the insertion slot 144 is located between the inner side piece 114 and the lower side piece 116 . similarly , the side plate 106 comprises an outer side piece 120 , an upper side piece 122 , an inner side piece 124 and a lower side piece 126 connected in sequence , wherein the outer side piece 120 is connected with the bottom plate 102 . the side plate 106 further comprises an embedded slot 128 and an insertion slot 146 , wherein the embedded slot 128 is in the inner side piece 124 and the upper side piece 122 , and the insertion slot 146 is located between the inner side piece 124 and the lower side piece 126 . the lower side plate 108 comprises an outer side piece 136 , an upper side piece 138 and an inner side piece 140 connected in sequence , wherein the outer side piece 136 is connected with the bottom plate 102 . the lower side plate 108 further comprises an opening hole 142 located in the inner side piece 140 and the upper side piece 138 , and the opening hole 142 also can be directly located on the upper side piece 138 . the bottom plate 102 comprises a hand - held hole 130 , as well as a fixed piece 132 and a fixed piece 134 respectively located at the two sides of the hand - held hole 130 . the hand - held hole 130 is used to carry the portable accessory box 100 ; and the locations of the fixed piece 132 and the fixed piece 134 correspond to the locations of the insertion slot 144 and the insertion slot 146 , respectively . the fixed piece 132 and the fixed piece 134 can be inserted into the insertion slot 144 and the insertion slot 146 , respectively . referring to fig2 to fig3 , fig2 to fig3 are assembly diagrams showing a portable accessory box in accordance with a preferred embodiment of the present invention , with simultaneous reference to fig1 . the portable accessory box 100 is assembled by first folding the side plate 104 and the side plate 106 , and then folding the lower side plate 108 . the side plate 104 is folded toward the interior of the bottom plate 102 along the folding lines between the side pieces of the side plate 104 to form a side rectangular body 148 . the embedded slot 118 is in the upper side and the inner side of the side rectangular body 148 . when the side plate 104 is folded inwardly , the fixed piece 132 of the bottom plate 102 can be inserted into the insertion slot 144 between the inner side piece 114 and the lower side piece 116 to fix the side rectangular body 148 . after the side rectangular body 148 is formed , the side plate 106 is folded inwardly by the same method to form a side rectangular body 150 . the embedded slot 128 is in the upper side and the inner side of the side rectangular body 150 . when the side plate 106 is folded inwardly , the fixed piece 134 of the bottom plate 102 can be inserted into the insertion slot 146 between the inner side piece 124 and the lower side piece 126 to fix the side rectangular body 150 . after the side plate 104 and the side plate 106 are folded , the side rectangular body 148 and the side rectangular body 150 are formed at the two sides of the bottom plate 102 , respectively , as illustrated in fig2 . the sequence of folding the side rectangular body 148 and the side rectangular body 150 can be changed to fold the side rectangular body 150 first and then fold the side rectangular body 148 , and the sequence of folding the side rectangular body 148 and the side rectangular body 150 is not limited in the present invention . after the side rectangular body 148 and the side rectangular body 150 are formed , the lower side plate 108 is folded toward the interior of the bottom plate 102 along the folding lines between the side pieces of the lower side plate 108 to insert the inner side piece 140 of the lower side plate 108 into the embedded slot 118 of the side rectangular body 148 and the embedded slot 128 of the side rectangular body 150 . the side rectangular body 148 is thus separated into a rectangular sub - body 152 and a rectangular sub - body 154 . the side rectangular body 150 is separated into a rectangular sub - body 156 and a rectangular sub - body 158 . a lower rectangular body 160 is formed between the side rectangular body 148 and the side rectangular body 150 , as illustrated in fig3 . after the lower rectangular body 160 is formed , the opening hole 142 is located in the upper side of the lower rectangular body 160 . the opening hole 142 not only has a benefit for opening the lower rectangular body 160 conveniently , but also provides a window for viewing the objects deposed therein when the lower rectangular body 160 is closed . in the embodiment , the portable accessory box 100 is formed by folding a paper material and is one piece , and the portable accessory box 100 provides five independent sections , i . e . the rectangular sub - body 152 , the rectangular sub - body 154 , the rectangular sub - body 156 , the rectangular sub - body 158 and the lower rectangular body 160 , for storing accessories of a product . moreover , the portable accessory box 100 further comprises a hand - held hole 130 . since the portable accessory box 100 is typically packed in the same packaging carton , such as a packaging carton of a notebook , with the product , the hand - held hole 130 is convenient for carrying the portable accessory box 100 . referring to fig4 , fig4 is a diagram showing an unfolded portable accessory box in accordance with another preferred embodiment of the present invention . a material of a portable accessory box 200 is preferably selected from a paper material having a buffer structure , such as corrugated paper . the portable accessory box 200 comprises a bottom plate 202 , a side plate 204 and a side plate 208 fixedly connected to two sides of the bottom plate 202 respectively , a upper side plate 210 fixedly connected to the upper side of the bottom plate 202 , and a lower side plate 206 fixedly connected to the lower side of the bottom plate 202 . the side plate 204 comprises an outer side piece 212 , an upper side piece 214 , an inner side piece 216 and a lower side piece 218 connected in sequence , wherein the outer side piece 212 is connected with the bottom plate 202 . the side plate 204 further comprises an embedded slot 220 , an insertion slot 226 , and hole 222 and hole 224 . the embedded slot 220 is in the inner side piece 216 and the upper side piece 214 . the insertion slot 226 is located between the inner side piece 216 and the lower side piece 218 . the hole 222 and the hole 224 are located in the upper side piece 214 and at two sides of the embedded slot 220 , respectively . similarly , the side plate 208 comprises an outer side piece 228 , an upper side piece 230 , an inner side piece 232 and a lower side piece 234 connected in sequence . the outer side piece 228 is connected with the bottom plate 202 . the side plate 208 further comprises an embedded slot 236 , an insertion slot 242 , and hole 238 and hole 240 . the embedded slot 236 is in the inner side piece 232 and the upper side piece 230 ; the insertion slot 242 is located between the inner side piece 232 and the lower side piece 234 ; and the hole 238 and the hole 240 are located on the upper side piece 230 and at two sides of the embedded slot 236 , respectively . the lower side plate 206 comprises an outer side piece 244 , an upper side piece 246 and an inner side piece 248 connected in sequence , wherein the outer side piece 244 is connected with the bottom plate 202 . the lower side plate 206 further comprises an opening hole 250 , and a lower embedded slot 252 and a lower embedded slot 254 . the opening hole 250 is located in the inner side piece 248 and the upper side piece 246 , and the opening hole 250 also can be directly located in the upper side piece 246 . the lower embedded slot 252 and the lower embedded slot 254 are located in the inner side piece 248 and at two sides of the opening hole 250 , respectively . the upper side plate 210 comprises an outer side piece 256 , an upper side piece 258 and an inner side piece 260 connected in sequence , wherein the outer side piece 256 is connected with the bottom plate 202 . the upper side plate 210 further comprises an opening hole 262 , a hand - taken hole 268 and a hand - taken hole 270 , and a lower embedded slot 264 and a lower embedded slot 266 . the opening hole 262 is located in the inner side piece 260 and the upper side piece 258 , and the opening hole 262 also can be directly located in the upper side piece 258 . the lower embedded slot 264 and the lower embedded slot 266 are located in the inner side piece 260 and at two sides of the opening hole 262 , respectively , and the hand - taken hole 268 and the hand - taken hole 270 are located in the outer side piece 260 and separated by a distance . the hand - taken hole 268 and the hand - taken hole 270 are provided for carrying the portable accessory box 200 . the bottom plate 202 comprises a fixed piece 272 and a fixed piece 274 . the locations of the fixed piece 272 and the fixed piece 274 correspond to the locations of the insertion slot 226 and the insertion slot 242 , respectively , and the fixed piece 272 and the fixed piece 274 can be inserted into the insertion slot 226 and the insertion slot 242 , respectively . referring to fig5 to fig7 , fig5 to fig7 are assembly diagrams showing a portable accessory box in accordance with another preferred embodiment of the present invention , with simultaneous reference to fig4 . the assembly of the portable accessory box 200 is to fold the side plate 204 and the side plate 208 first , and then to fold the lower side plate 206 and the upper side plate 210 . the side plate 204 is folded toward the interior of the bottom plate 202 along the folding lines between the side pieces of the side plate 204 to form a side rectangular body 276 . the embedded slot 220 is in the upper side and the inner side of the side rectangular body 276 , and the hole 222 and the hole 224 are located in the upper side of the side rectangular body 276 . when the side plate 204 is folded inwardly , the fixed piece 272 of the bottom plate 202 can be inserted into the insertion slot 226 between the inner side piece 216 and the lower side piece 218 to fix the side rectangular body 276 . the hole 222 and the hole 224 provide windows for viewing objects stored therein when the side rectangular body 276 is closed . after the side rectangular body 276 is formed , the side plate 208 is folded inwardly by the same method to form a side rectangular body 278 . the embedded slot 236 is in the upper side and a portion of the inner side of the side rectangular body 278 , and the hole 238 and the hole 240 are located in the upper side of the side rectangular body 278 . when the side plate 208 is folded inwardly , the fixed piece 274 of the bottom plate 202 can be inserted into the insertion slot 242 between the inner side piece 232 and the lower side piece 234 to fix the side rectangular body 278 . after the side plate 204 and the side plate 208 are folded , the side rectangular body 276 and the side rectangular body 278 are formed at the two sides of the bottom plate 202 , respectively , such as shown in fig5 . the sequence of folding the side rectangular body 276 and the side rectangular body 278 is not limited to the above description , and the side rectangular body 278 can be folded first , and then the side rectangular body 276 is folded . the hole 238 and the hole 240 provide windows for viewing the objects stored therein when the side rectangular body 278 is closed . after the side rectangular body 276 and the side rectangular body 278 are formed , the lower side plate 206 is folded toward the interior of the bottom plate 202 along the folding lines between the side pieces of the lower side plate 206 to insert the inner side piece 248 of the lower side plate 206 into the embedded slot 220 of the side rectangular body 276 and the embedded slot 236 of the side rectangular body 278 , and to inset the lower embedded slot 252 and the lower embedded slot 254 of the inner side piece 248 of the lower side plate 206 into the embedded slot 220 and the embedded slot 236 , respectively . the inner side piece 248 embedded into the embedded slot 220 and the embedded slot 236 separates the side rectangular body 276 into a rectangular sub - body 280 and a rectangular sub - body 282 and separates the side rectangular body 278 into a rectangular sub - body 284 and a rectangular sub - body 286 , as well as forms a lower rectangular body 288 between the side rectangular body 276 and the side rectangular body 278 , as illustrated in fig6 . after the lower rectangular body 288 is formed , the opening hole 250 is located in the upper side of the lower rectangular body 288 . the opening hole 250 not only allows convenient opening of the lower rectangular body 288 , but also provides a window for viewing the objects stored therein when the lower rectangular body 288 is closed . after the lower rectangular body 288 is formed , the upper side plate 210 is folded toward the interior of the bottom plate 202 along the folding lines between the side pieces of the upper side plate 210 to insert the inner side piece 260 of the upper side plate 210 into the embedded slot 220 of the side rectangular body 276 and the embedded slot 236 of the side rectangular body 278 , and to insert the lower embedded slot 264 and the lower embedded slot 266 of the inner side piece 260 of the upper side plate 210 into the embedded slot 220 and the embedded slot 236 , respectively . an upper rectangular body 290 is formed between the side rectangular body 276 and the side rectangular body 278 , such as shown in fig7 . after the upper rectangular body 290 is formed , the opening hole 262 is located in the upper side of the upper rectangular body 290 . the opening hole 262 not only allows convenient opening of the upper rectangular body 290 , but also provides a window for viewing the objects stored therein when lower rectangular body 290 is closed . in the embodiment , the portable accessory box 200 is formed by folding a paper material and is one piece , and the portable accessory box 200 provides six independent sections , i . e . the rectangular sub - body 280 , the rectangular sub - body 282 , the rectangular sub - body 284 , the rectangular sub - body 286 , the lower rectangular body 288 and the upper rectangular body 290 , for storing accessories of a product . moreover , the portable accessory box 200 further comprises a hand - taken hole 268 and a hand - taken hole 270 . since the portable accessory box 200 is typically packed in the same packaging carton , such as a packaging carton of a notebook , with the product , the hand - taken hole 268 and the hand - taken hole 270 are convenient for carrying the portable accessory box 200 . in a preferred embodiment of the present invention , the portable accessory box of the present invention can sustain an impact of about 50 g in a drop test when the portable accessory box falls from a height of 107 centimeters while containing accessories having a weight of 4 kilograms . according to the aforementioned description , one advantage of the present invention is that the portable accessory box of the present invention is formed by folding a paper material and is made in one piece . therefore , the portable accessory box is formed easily , thereby reducing production cost . according to the aforementioned description , another advantage of the present invention is that a material of the portable accessory box of the present invention is paper , and thus reducing the environmental burden thereof and meeting the requirement of environmental protection . according to the aforementioned description , still another advantage of the present invention is that the portable accessory box of the present invention is made in one piece and can replace the conventional portable accessory box composed of an outer box and inner spacers . therefore , complicated operation in transportation , control of materiel and supplies , and fabrication manpower in the production line can be left out . according to the aforementioned description , a further another advantage of the present invention is that the portable accessory box of the present invention comprises a hand - held hole or a hand - taken hole , and therefore is conveniently carried . as is understood by a person skilled in the art , the foregoing preferred embodiments of the present invention are illustrative of the present invention rather than limiting of the present invention . it is intended that various modifications and similar arrangements be included within the spirit and scope of the appended claims , the scope of which should be accorded the broadest interpretation so as to encompass all such modifications and similar structure .
| 1 |
fig1 is a perspective view of one embodiment of a washing machine according to the present invention and fig2 illustrates a cross sectional view of fig1 as seen along ii - ii line . with reference to fig1 and 2 , a washing machine 100 according to the present invention comprises a cabinet 110 ; a outer tub 125 disposed inside the cabinet 110 and storing washing water ; an inner tub 122 disposed inside the outer tub 125 and receiving laundry ; a driving apparatus 170 rotating the inner tub 122 in both directions alternately or in one direction by delivering driving force to the inner tub 122 ; a discharge apparatus 150 discharging washing water of the outer tub to the outside ; and a washing water provision apparatus 120 disposed in one side of the cabinet 110 and providing washing water from the outside to the outer tub 125 and the inner tub 122 . a pulsator 140 is disposed in the bottom surface of the inner tub 122 . the pulsator 140 can be formed as a single body with the inner tub 122 ; and at the same time , the pulsator 140 can be formed separately and combined as such therewith . an operation method varied according to the structure of the inner tub 122 and the pulsator 140 will be described in detail later . the cabinet 110 comprises a cabinet main body 111 having an opening ; a base ( not shown ) disposed in a lower side of the cabinet main body 111 and fastened to the cabinet main body 111 ; a cover ( not shown ) fastened to the opening ; and a control panel 126 formed on one side of the cover and fastened to the cabinet main body 111 . a door 123 capable of rotational movement together with the cover is installed at the cover to open and close the opening . meanwhile , the control panel 126 incorporates an input unit 116 which receives input signals from a user . the driving apparatus 170 comprises a motor including a rotor and a stator and generating rotational force ; a rotation axis delivering rotational force of the motor ; and a clutch delivering rotational force of the motor selectively to at least one of the inner tub and the pulsator 140 . fig3 illustrates a block diagram of a control flow of a washing machine 100 of fig1 . with reference to fig3 , a washing machine 100 according to the present invention further comprises an input unit 116 disposed on the control panel and receiving input signals entered by the user ; and a controller 190 controlling the operation of the washing machine 100 according to the input signals entered to the input unit 116 . the input signal is formed in various ways and determines a washing step or a method for handling laundry . for example , the washing step can include a blue jean step , a bedclothes step , and a wool step . also , the treatment method of fabric can include a washing method , a dehydration method , and a rinsing method . when the user enters the input signal , the washing machine 100 performs a washing step . in the washing step , the controller 190 makes washing water flow into the inner tub 122 by operating the washing water provision apparatus 120 . when the washing water provision apparatus 120 begins to operate , washing water is provided to the inner tub 122 from the outside . fig4 illustrates a flow diagram of a washing method of a washing machine according to a first embodiment of the present invention . with reference to fig4 , when provision of the washing water is completed , the controller 190 performs a washing step , removing dirt of fabric while controlling the operation of the driving apparatus 170 . according to a control method of the driving apparatus 170 , the washing step can be classified as described below . the washing step can include a first washing step s 120 forming a circulating water flow fed back to the inner tub after washing water has risen in between the inner tub 122 and the outer tub 125 due to centrifugal force developed as the inner tub 122 is rotated in one direction with a first rotation speed ; and a second washing step s 130 rotating at least one of the inner tub 122 and the pulsator 140 in both directions alternately with a second rotation speed different from the first rotation speed . in the first washing step s 120 , the driving apparatus 170 rotates the inner tub 122 in one direction with the first rotation speed . by centrifugal force generated by accelerated rotation of the inner tub 122 in one direction , a part of fabric put inside the inner tub 122 can be distributed being adhered closely to the inner wall of the inner tub 122 together with washing water . at this time , washing water can make an inclination with a predetermined angle with respect to the inner wall of the inner tub 122 . in other words , the washing water can be so formed that width from the inner wall of the inner tub 122 is thicker in a lower part than that in an upper part . also , the washing water flows out to the outer tub 125 through a plurality of holes formed in the inner tub 122 . if the inner tub 122 continues to rotate , washing water moves from a space between the inner tub 122 and the outer tub 125 to the upper side . washing water which has moved to the upper side of the outer tub 125 runs into the tub cover disposed in the upper side of the outer tub 125 and then drops into the inside of the inner tub 122 . washing water dropping into the inside of the inner tub 122 runs into laundry ; fabric is washed being forced from dropping washing water . at this time , the first rotation speed can be set to exceed a second rotation speed described later s 120 . meanwhile , in the second washing step s 130 , the driving apparatus 170 can rotate at least one of the pulsator 140 and the inner tub 122 in both directions alternately with a second rotation speed different from the first rotation speed . at this time , when the pulsator 140 and the inner tub 122 are combined together being formed separately , the controller 190 , by controlling the operation of the clutch ( not shown ), can rotate selectively at least one of the pulsator 140 and the inner tub 122 in a predetermined direction . the driving apparatus 170 can rotate the pulsator 140 and the inner tub 122 in different directions from each other . at least one of the pulsator 140 and the inner tub 122 can be rotated in clockwise direction and then in counter clockwise direction after a predetermined time . also , the driving apparatus 170 can rotate the other one from the pulsator 140 and the inner tub 122 in counter clockwise direction and then again in clockwise direction after a predetermined time . in case the pulsator 140 rotates , washing water inside the inner tub 122 can form a water flow due to the pulsator 140 . due to the water flow , washing water flows and produces friction against laundry ; and fabric can be washed owing to the friction . meanwhile , in case the pulsator 140 and the inner tub 122 are formed as a single body , the controller 190 , while rotating the inner tub 122 with the second rotation speed , can control the driving apparatus 170 to rotate in both directions alternately . when the inner tub 122 rotates , the pulsator 140 can rotate in the same direction as the inner tub 122 . during the rotation of the inner tub 122 , washing water does not move to the upper side of the outer tub 125 . when the inner tub 122 repeats rotation in both directions , washing water can form a water flow inside the inner tub 122 . washing water inside the outer tub 125 rotates according to the rotation direction of the inner tub 122 . fabric can be washed as washing water and fabric are rotated in the same direction as that of the inner tub 122 , s 130 . at the time , the first washing step s 120 and the second washing s 130 are performed alternately , performing order thereof being allowed to be changed . meanwhile , after a predetermined time , the controller 190 measures a number n of performance of the first washing step s 120 and the second washing step s 130 . s 140 when the number n is less than a predetermined number n , the controller 190 adds one to the number n of performance of the washing steps s 141 . then , the controller 190 repeats performing the first washing step s 120 and the second washing step s 130 sequentially . if the number n of performance of the washing steps is determined to be more than the predetermined number n , the controller 190 terminates the steps . in other words , the controller 190 terminates the washing step . when the washing step is terminated , the controller 190 performs a distribution step s 150 . in the distribution step s 150 , the controller 190 rotates the inner tub 122 in one direction by controlling the driving apparatus 170 while washing water is contained in the inner tub 122 . fabric inside the inner tub 122 can be distributed across a side wall of the inner tub 122 by centrifugal force developed by rotation of the inner tub 122 in one direction . also , the controller 190 operates a discharge pump of a discharge apparatus 150 to discharge washing water of the inner tub 122 to the outside . at this time , the controller 190 can operate the discharge pump not only after the inner tub 122 has been rotated in one direction for a predetermined time but also while the inner tub 122 is being rotated in one direction . as fabrics distributed across a side wall of the inner tub 122 and washing water is discharged to the outside by the operation of the discharge apparatus 150 , unbalance of the inner tub 122 can be minimized . also , moisture of fabric can be removed quickly . moreover , since washing water is not provided to compensate unbalance of the inner tub 122 , amount of water used can be reduced . s 150 when the distribution step s 150 is terminated , the controller 190 , by accelerated rotation of the inner tub 122 with a dehydration speed , performs dehydration step to remove moisture of fabric s 160 . at this time , since the inner tub 122 has been made to rotate in the distribution step s 150 before the dehydration step s 160 , accelerated rotation of the inner tub 122 can be possible without a operation of the clutch in the dehydration step s 160 . therefore , noise due to the operation of the clutch , operation time , and energy can be reduced . since additional washing water is not provided to accommodate unbalance of the inner tub 122 before entering into the dehydration step s 160 , not only amount of water used can be reduced but also amount of washing water to be drained during the dehydration step s 160 is reduced ; therefore , an advantageous effect can be obtained that dehydration time can be reduced . fig5 illustrates a flow diagram of a washing method of a washing machine according to a second embodiment of the present invention . with reference to fig5 , a washing method of a washing machine according to a second embodiment of the present invention is described . first , after washing water is supplied , the controller 190 performs washing which removes dirt of fabric while controlling the operation of the driving apparatus 170 . the washing includes a first washing s 220 which rotates the inner tub 122 in one direction and a second washing s 230 which rotates at least one of the inner tub 122 and the pulsator 140 in both directions alternately . since detailed description thereof is the same as in the first embodiment , description associated therewith is not provided further . meanwhile , after a predetermined time is passed , the controller 190 measures a number n of performance of the first washing step s 220 and the second washing step s 230 . s 240 . when the number n is less than a predetermined number n , the controller 190 adds one to the number n of performance of the washing step s 241 . then , the controller 190 repeats performing the first washing step s 220 and the second washing step s 230 sequentially . if the number n of performance of the washing step is determined to be more than the predetermined number n , the controller 190 terminates the steps . in other words , the controller 190 terminates the washing step . after the washing is completed , the controller 190 performs a balancing step s 250 to form a rotating water flow of washing water . at this time , washing water is rotated by rotating at least one of the inner tub 122 and the pulsator 140 selectively . in the balancing step s 250 , employed is rotation speed slower than that in the washing or distribution step s 260 described later . after performance of the balancing step s 250 for a predetermined time , distribution step s 260 is performed . both the distribution step s 260 and the balancing step s 250 aim to remove unbalance by distributing laundry ; the two steps are different by rotation speed , washing water flow , and discharge state . in other words , the distribution step s 260 makes fabric adhere closely to a side wall of the inner tub 122 by centrifugal force developed by rotation of the inner tub 122 with higher speed than in the balancing step s 250 . at this time , the controller rotates the inner tub 122 while washing water is contained in the inner tub 122 . and since a discharge pump of the discharge apparatus 150 is turned on in the distribution step , washing water of the inner tub 122 is discharged to the outer tub 125 through the holes of the discharge apparatus 150 , helping fabric adhere to the inner wall of the inner tub 122 . as fabric is distributed across a side wall of the inner tub 122 and washing water is discharged to the outside by the operation of the discharge apparatus 150 , unbalance of the inner tub 122 can be minimized . also , moisture of fabric can be removed quickly . moreover , since washing water is not provided to compensate unbalance of the inner tub 122 , amount of water used can be reduced . when the distribution step s 260 is completed , the controller 190 determines the degree of unbalance of the inner tub 122 , s 270 . if it is found that unbalance of the inner tub exists , the controller 190 performs the distribution step s 260 again . at this time , even if unbalance is detected , the controller 190 does not provide additional water supply . if it is determined that unbalance of the inner tub 122 does not exist , the controller 190 performs dehydration step s 280 which removes moisture of fabric by accelerated rotation of the inner tub 122 with a dehydration speed . at this time , because the inner tub 122 is rotated in the distribution step s 260 before the dehydration step s 280 , accelerated rotation of the inner tub 122 can be possible without the operation of the clutch in the dehydration step s 280 . therefore , noise due to the operation of the clutch , operation time , and energy can be reduced . since additional washing water is not provided to accommodate unbalance of the inner tub 122 before entering into the dehydration step s 160 , not only amount of water used can be reduced but also amount of washing water to be drained during the dehydration step s 160 is reduced ; therefore , an advantageous effect can be obtained that dehydration time can be reduced . a washing method of a washing machine according to a second embodiment of the present invention can minimize unbalance of the inner tub 122 by repeating the distribution step s 260 according to the existence of unbalance of the inner tub 122 , thereby improving the user satisfaction owing to the improvement of quietness at the time of spin drying . fig6 illustrates a flow diagram of a washing method of a washing machine according to a third embodiment of the present invention . with reference to fig6 , a washing method of a washing machine according to a third embodiment of the present invention is described . first , after washing water is supplied , the controller 190 performs washing which removes dirt of fabric while controlling the operation of the driving apparatus 170 . the washing includes a first washing step s 320 which rotates the inner tub 122 in one direction and a second washing step s 330 which rotates at least one of the inner tub 122 and the pulsator 140 in both directions alternately . since detailed description thereof is the same as in the first embodiment , description associated therewith is not provided further . meanwhile , after a predetermined time is passed , the controller 190 measures a number n of performance of the first washing step s 320 and the second washing step s 330 . s 340 . when the number n is less than a predetermined number n , the controller 190 adds one to the number n of performance of the washing steps s 341 . then , the controller 190 repeats performing the first washing step s 320 and the second washing step s 330 sequentially . if the number n of performance of the washing step is determined to be more than the predetermined number n , the controller 190 terminates the steps . in other words , the controller 190 terminates the washing step . after the washing is completed , the controller 190 performs balancing step s 350 to form a rotating water flow of washing water . since the balancing step s 350 is the same as in the second embodiment , description associated therewith is not provided further . after performance of the balancing step s 350 for a predetermined time , distribution step s 360 is performed . the distribution step s 360 makes fabric adhere closely to a side wall of the inner tub 122 by centrifugal force developed by rotation of the inner tub 122 with higher speed than in the balancing step s 350 . also , since a discharge pump of the discharge apparatus 150 is turned on in the distribution step , washing water of the inner tub 122 is discharged to the outer tub 125 through the holes of the discharge apparatus 150 , helping fabric adhere to the inner wall of the inner tub 122 . as fabric is distributed across a side wall of the inner tub 122 and washing water is discharged to the outside by the operation of the discharge apparatus 150 , unbalance of the inner tub 122 can be minimized . also , moisture of fabric can be removed quickly . moreover , since washing water is not provided to compensate unbalance of the inner tub 122 , amount of water used can be reduced . when the distribution step s 360 is completed , the controller 190 performs dehydration step s 370 which removes moisture of fabric by accelerated rotation of the inner tub 122 with a dehydration step speed . a washing method of a washing machine according to a third embodiment of the present invention , when the distribution step s 360 is completed , does not determine the existence of unbalance and not readily enter into the dehydration step s 370 ; therefore , operation time of a washing machine can be reduced . it will be apparent to those skilled in the art that other specific embodiments of the invention can be made without departing from the spirit or modifying fundamental characteristics of the invention . thus , it should be understood that the embodiments described above are provided as examples in all aspects and do not limit modifications and variations of the invention . the scope of the invention is specified by the appended claims rather than the detailed description given above . it should be interpreted that the spirit and the scope of the claims and all the modifications or variations derived from their equivalents belong to the scope of the invention .
| 3 |
fig1 is a perspective view of an assembled deep water offshore mobile drilling unit as described in the present invention . a deck structure 1 supports the drilling , production , utility systems , and living quarters of the offshore platform . the deck structure is supported by legs 2 on top of buoyant leg structure 3 that is largely submerged . the buoyant leg structure 3 is moored by vertical tethers 4 connected to a disk - shaped gravity base 5 . as can be seen in fig1 the buoyant leg structure 3 has a first surface end 10 that is elevated above the surface of the water in the assembled unit and a second keel end 12 that is submerged underneath the water in the assembled unit . the buoyant leg structure 3 is comprised of multiple tanks or ballast compartments 6 . a buoyant leg structure using different anchoring systems are disclosed in prior u . s . pat . nos . 5 , 443 , 330 and 5 , 118 , 221 to one of the inventors hereof . the disclosures of these patents are incorporated by reference . as shown in fig2 the gravity base 5 is also comprised of multiple ballast compartments 7 . the bottom compartments of buoyant leg structure 3 are ballasted after installation to provide the unit with positive stability . as shown in fig3 the buoyant leg structure 3 contains a centerwell 8 through which the drill string is extended through the keel of the buoyant leg structure during drilling operations . the centerwell 8 is situated along the central ( long ) axis of the buoyant leg structure . the unit is assembled as follows . first the component parts are transported to the drill site . several options exist for transporting the component parts . the buoyant leg structure 3 and the gravity base 5 may be either wet - towed or dry - towed to the site . the buoyant leg structure and gravity base are designed to float horizontally on the water surface when their ballast compartments are empty . the gravity base 5 is connected to the buoyant leg structure 3 with tethers 4 . this step can be done at the drilling site or the gravity base 5 and the buoyant leg structure 3 may be tethered together and wet - towed to the drill site as a unit . referring to fig4 the tethers are connected to the top of the buoyant leg structure by means of hoists 9 such that the tethers can later be extended . the buoyant leg structure is upended by adjusting the ballast tanks of the gravity base and the buoyant leg structure in a series of steps . first , the ballast of the gravity base 5 is increased to achieve near - neutral buoyancy . then , the keel - end ballast compartments of the buoyant leg structure 3 are flooded to achieve a trim angle of the center axis of the buoyant leg structure of approximately 12 to 13 degrees with respect to the water surface . the ballast compartments of the gravity base 5 are then flooded , with the additional force coupled from the gravity base to the buoyant leg structure elevating the surface end of the buoyant leg structure 3 above the water surface and increasing the trim angle of the center axis to a 90 degree angle with respect to the water surface . additional adjustment of the ballast in the ballast compartments 7 is then performed to achieve the desired draft of the buoyant platform and to provide sufficient buoyancy for the platform to support the weight of the work deck above the surface of the water . the top deck structure 1 is then mounted to the top of the buoyant leg structure 3 by attaching the legs 2 of the deck structure to the buoyant leg structure . if desired , heavy mud or other materials can be pumped into the gravity base 5 to increase its mass further . the gravity base 5 is then lowered to the sea floor by means of hoists 9 that let out the tether cables 4 . the length of the tethers 4 is then set and the tethers pre - tensioned by adjusting the ballast of the buoyant leg structure 3 to create a desired tension in the tethers . the unit can be moved short distances in a drilling region by hoisting the gravity base off of the sea floor and using either dynamic - assist thrusters or tugboats to relocate the unit to other sites in a drilling region . for long distance relocation to new oil regions , the unit can be disassembled by reversing the order of the assembly process . the gravity base 5 , can be retracted from the sea floor ; the work deck demounted ; and the gravity base and buoyant leg structure deballasted . the gravity base 5 can then be untethered from the buoyant leg 3 , and the three major components transported separately to the new location . alternatively , the gravity base can remained tethered to the buoyant leg structure for wet - towing of the gravity base and the buoyant leg as a single unit . as in the assembly process , the buoyant leg structure and the gravity base can be either wet - towed or dry - towed to the new site . the unit can then be reassembled , as described above . the present invention is distinguishable over conventional retractable anchoring schemes used to moor ships and retractable anchoring schemes proposed to moor offshore platforms . while ships and floating platforms can be securely moored in shallow waters by using anchors and a multitude of anchor lines , such schemes are not practical for deep water offshore drilling . conventional retractable anchoring schemes only secure a vessel or platform to within some fraction of the anchor line length . conventional retractable anchoring systems with multiple cables and anchors also create elastic systems , that as described above , can suffer from resonance effects , thus leading to unacceptable heaving , pitching , and rolling of a platform in high seas . moreover , these problems are exacerbated in the context of deep water drilling because of the long anchor line lengths and the heavy seas and strong ocean currents often experienced at many deep water sites far away from the shelter of land . conventional retractable anchoring systems are thus not practical ways to secure a drilling platform in a deep water site . the present invention has a combination of design features that make a retractable anchor design practical for deep water drilling . the combination of a buoyant leg structure and a multiplicity of precisely pre - tensioned tethers in the present invention leads to a greatly improved dynamic response over other retractable anchoring designs . the buoyant leg configuration itself minimizes excitational loads on the unit . the unit has positive stability because the bottom compartments of the buoyant leg 3 are ballasted to have a center of gravity below the buoyant leg &# 39 ; s center of buoyancy . that , combined with the semi - compliant pre - tensioned tethering system minimizes the unit &# 39 ; s response to excitational loads . the unit is a positively buoyant floater whose motion is fully restrained in only one ( heave ) of the six degrees of freedom by the pre - tensioned tethers . however , the tethers provide supplemental rotational and lateral restoring forces . the basic buoyant leg configuration has a low applied wave load because a large portion of total displacement is away from the water surface and thus subjected to relatively small water particle accelerations . furthermore , the semi - compliant tethering system minimizes the platform &# 39 ; s response to excitational loads . additional dynamic assist thrusters may be added to supplement the tethering system in severe storm conditions . the present invention is also distinguishable from conventional retractable anchoring systems in its method of installation . if one attempted to increase the tension on the anchor lines in a conventional anchoring system by winching in the anchor cables it would reduce the freeboard of the platform . in the present invention , however , the tethers are tensioned by adjusting the ballast of the buoyant leg structure . this permits the tethers to be tensioned while maintaining a nearly constant freeboard of the platform . the combination of elements in the present invention thus not only permits the tethers to be precisely tensioned but also allows for the simultaneous control of platform freeboard , buoyant leg draft , and ballast distribution . this control enables several key parameters affecting platform stability to be simultaneously optimized . the dynamic response of the unit is a function of such factors as buoyant leg draft , size , and ballasting ; tether number , tension , flexibility , weight , and length ; platform load ; and water depth . the methods of analyzing the dynamic response of such a unit are generally known to those skilled in the art . for a desired platform load and a given water depth , the buoyant leg and tether parameters can be analyzed and selected for optimum dynamic response . the dynamic response of a preferred embodiment was analyzed using conventional modeling and computer analysis . the buoyant leg structure in the preferred mode is as follows . a platform deck area of 46 by 46 m and a payload of 13 , 000 tons ( 11 , 801 metric tons ) was chosen as being consistent with an exploratory and extended production test system . an additional 3000 tons ( 2 , 722 metric tons ) of associated deck and riser steel is assumed . an assumed water depth of 915 m was selected as being consistent with deep water drilling . the corresponding buoyant leg structure has a 23 . 8 m outer diameter , a length of 141 . 8 m , and a 8 . 0 m centerwell . the estimated weight of the buoyant leg and appurtenances is 10 , 600 tons ( 9 , 616 metric tons ). the buoyant leg structure has 9 inner watertight flats separated by approximately 15 . 2 m intervals . of the 9 inner watertight compartments , the lowest three or four tanks are permanently ballasted with a weight of 29 , 900 tons ( 27 , 125 metric tons ) of ballast to provide positive stability to the buoyant leg . additional stiffening of the outer shell with stringers and rings is desirable , with the preferred arrangement consisting of 96 stringers and ringers spaced from 1 . 2 m to 2 . 4 m . the tethers may consist of either wire rope or synthetic materials . initial analysis indicates that eight tethers , each consisting of 43 / 4 inch spiral strand wire ropes with a breaking strength of 12 . 2 mn ( 2 , 750 kips ) is suitable for water depths from 500 to 1 , 500 m . the combined tension and weight of the tethers is 3 , 800 tons ( 3 , 447 metric tons ). in the preferred mode , the hoists would be comprised of synchronized winches to precisely control all of the tether lengths simultaneously . the gravity base is a cylindrical shell with an inner diameter of 25 . 0 m and an outer diameter of 35 . 0 m . eight non - watertight bulkheads on the gravity base serve as structural supports for the vertical tethers . computer modeling for these choices of parameters indicate that the motions of this unit are smaller than a similar free - floating unit with deeper draft due to the beneficial effects of tether stiffness and pretension . the natural heave period in the free - floating mode is 25 . 0 seconds . when tethered to the sea floor at an ocean depth of 915 m by eight 4 . 75 in diameter wire ropes , the heave natural period is reduced to 19 seconds while the pitch / roll natural period is reduced from 83 seconds to 75 seconds . the lateral displacement ( surge and sway ) natural period is 297 seconds . all of the natural periods remain above the energy - intensive wave spectra , which mitigates against resonance effects and the problems of ringing and springing . fig5 illustrates both the free floating and the tethered heave response amplitude operators ( raos ), demonstrating that the tethering substantially reduces the heave raos . as illustrated in fig6 tethering also reduces the pitch and roll motion raos as well . the platform is expected to exhibit desirable motion characteristics even when subjected to severe storms in water depths from 500 to 3 , 000 m . although a particular embodiment has been described , it is apparent that a wide choice in design parameters is possible . the tether tension and the mass and mass distribution of the unit can be adjusted to obtain close - to - optimum pitch / roll raos for a given configuration . other design parameters can be adjusted for particular applications . for example , one or more of the compartments of the buoyant leg can be used for oil storage and the diameter of the buoyant leg increased for greater oil storage capacity . the size and shape of the buoyant leg structure and the anchor configuration may also be varied , such as , for example , the use of multiple buoyant legs or multiple retractable anchors .
| 4 |
embodiments of the present invention are described in detail below with reference to the drawings . referring to fig1 a and 1b , in this embodiment , the wavelength conversion device includes a support structure 104 and two wavelength conversion modules 108 a and 108 b . each wavelength conversion module includes a ceramic carrier 103 , and a phosphor layer and a reflective layer 102 disposed on the ceramic carrier 103 . as shown in fig1 a and 1b , the support structure 104 is a round base plate , preferably formed of a metal , a metal alloy , or a composite material of metal and inorganic materials . the metal may be aluminum , copper , silver , etc . the metal alloy may be brass , aluminum alloy , copper aluminum alloy , etc . the composite material of metal and inorganic material is a composite of metal and inorganic material , such as diamond - copper , boron nitride - copper , etc . the support structure has a ring shaped region which is centered on the center of the round base plate . there are two ceramic carriers 103 , respectively shaped like a half of a ring ; they are arranged together on the ring shaped region of the base plate , to form a matching ring shape . preferably , the ceramic carrier 103 is made of aluminum oxide , aluminum nitride , silicon nitride , silicon carbide , boron nitride , or beryllium oxide , all of which are ceramic plates with a dense structure , and not porous . the thermal conductivities of these materials are above 80 w / mk , and their melting points are mostly above 200 degrees c . thus , these materials have good thermal conductivity and at the same time can withstand high temperature . of course , in applications that do not place a high requirement on the thermal conductivity , other types of ceramic plates may be used as the ceramic carriers 103 . it should be noted that the two ceramic carriers 103 may be made of the same material or different materials . in practice , the bottom surface of the ceramic carriers may be adhered to the ring shaped region of the support structure using a high thermal conductivity adhesive , such as silver adhesive or a silica gel mixed with high thermal conductivity filling particles . the high thermal conductivity filling particles may be aluminum oxide , aluminum nitride , boron nitride , yttrium oxide , zinc oxide , or titanium oxide particles or a mixture of two or more of the above . on the top surface of each ceramic carrier is a reflective layer 102 , to reflect the converted light generated by the phosphor when illuminated by the excitation light . in this embodiment , the reflective layer 102 is a total reflection film , such as silver film , aluminum film , etc . the total reflection film can be formed by electroplating , chemical plating , electron beam sputtering , plasma sputtering , vapor deposition , etc . on the top surface of the ceramic carrier . a phosphor material is provided on the reflective layer to form a phosphor layer 101 , which is used to absorb the excitation light and emit a converted having a different wavelength than the excitation light . examples of phosphor materials include yag ( yttrium aluminum garnet ) phosphor , which absorbs blue light , ultraviolet light etc . to generates a yellow converted light ; a red phosphor , which absorbs an excitation light to generate a red converted light ; and a green phosphor which generates a green converted light , or other phosphors . in this embodiment , the ceramic carrier of one wavelength conversion module 108 a carries a phosphor layer of a red phosphor , and the other wavelength conversion module 108 b carries a yellow phosphor on one half of it and a green phosphor on the other half . of course , combinations of other single color phosphors can be provided on any one of the ceramic carrier 103 . the phosphor layer 101 is an integral piece formed of a phosphor powder sealed by an adhesive . the adhesive may be a silica gen adhesive , which has stable chemical properties and high mechanical strength . but silica gel cannot withstand very high temperature , typically 300 degrees c . to 500 degrees c . for applications of high power light emitting devices , preferably , an inorganic adhesive is used to adhere the phosphor powder to form an integral piece ; for example , it can use sodium silicate , glass powder , etc . which is sintered into a glass body , to obtain a reflective type phosphor wheel that can withstand high temperature . it should be noted that this invention does not exclude using silica gel as the adhesive for the phosphor powder ; this is because due to the presence of the ceramic carrier , the heat generated by the phosphor layer can be rapidly conducted to the ceramic carrier and dissipated . moreover , silica gel does not deform easily , so it has sufficient advantages over the conventional aluminum substrate . preferably , the phosphor layer 101 is formed by sintering a slurry that contains the phosphor powder and a first glass powder , where the first glass powder is sintered to form a first glass body . glass powder is an irregularly shaped , particulate , homogeneous glass substance , which is highly transparent and has stable chemical properties . the glass powder may be one of silicate glass , lead silicate glass , aluminum borosilicate glass , aluminate glass , soda lime glass , or quartz glass , or a mixture of two or more of the above . the first glass powder may be one or more selected from the above glass powders . because the first glass powder is required to have high transmission rate for the incident light and to have good thermal conductivity , preferably , the first glass powder is borosilicate glass powder , which has stable properties and high light transmission rate , and has a relatively high thermal conductivity compared to other glass powders . of course , based on the heat resistance of different phosphors , glass powders of different softening point may be selected accordingly . the drive mechanism 105 is fixed to the support structure 104 , to drive the support structure 104 and in turn the wavelength conversion modules 108 a and 108 b to rotate around the center of the round plate . as a result , the excitation light periodically illuminates the various positions along the ring shaped phosphor plate 101 . in this embodiment , the drive mechanism 105 is a motor . in this embodiment , the ceramic carrier 103 includes two pieces , each piece and the corresponding reflective layer 102 and phosphor layer 101 form a wavelength conversion modules 108 a / 108 b . multiple wavelength conversion modules are arrange together , and adhesively fixed to the support structure 104 . such a modular structure has significant advantages over an integral structure which uses one piece of ceramic material to form the entire substrate and have different phosphor materials on the ceramic substrate . this is because when the entire substrate is formed of one piece of ceramic material , when the phosphor layer is illuminated by a high intensity excitation light , the area of the ceramic substrate that is in contact with the phosphor layer will have a relatively high temperature , while other areas will have a relatively low temperature , so different areas of the ceramic substrate will have different degrees of thermal expansion . because ceramic materials have relatively low toughness and relatively high brittleness , such different degrees of thermal expansion may cause the substrate to crack . in this embodiment , on the other hand , because the ceramic carriers are separate pieces , the interference among different regions due to high temperature is reduced . the heat of each ceramic carrier is separately conducted to the support structure to be dissipated , which prevents the situation where one region has a crack and the entire wavelength conversion device cannot function properly . in addition , by dividing them into pieces , each ceramic carrier is relatively small , so the illumination light spot can approximately cover the entire ceramic carrier , so heating is more uniform . even if one ceramic carrier cracks in a very low probability event , only one carrier needs to be replaced . in the above embodiment , the ceramic carriers include two pieces ; clearly they can be divided into multiple same shaped or different shaped arc shaped pieces , without limitation . here โ multiple pieces โ means two or more pieces . also , the support structure is formed of metal , metal alloy , or a composite material of metal and inorganic materials , which have high toughness and strength . ceramic carriers are only provided in the ring shaped region of the support structure where the phosphor layer is required , and the phosphor is formed on the ceramic carriers , so that each ceramic carrier is uniformly heated , greatly reducing the probability of cracking of the ceramic carriers due to large differences of thermal expansion in different positions . even if the ceramic carrier cracks in a very low probability event , because it still has surface contact with and is adhered to the support structure , the wavelength conversion device can still function even with the crack , thereby extending the life of the wavelength conversion device . further , the base plate has good thermal conductivity , so the contact between the ceramic carriers and the base plate promotes heat dissipation of the ceramic carriers . moreover , because the wavelength conversion device is driven by the drive mechanism to rotate around the central axis , different positions of the phosphor layer periodically pass through the optical path of the excitation light and are excited by the excitation light . thus , the phosphor layer at each position is only momentarily excited by the excitation light when it passes through the optical path of the excitation light , so the illumination time is short , and the temperature of the phosphor layer is greatly reduced and its efficiency is greatly improved . as shown in fig2 , in this embodiment , the support structure 204 , drive mechanism , ceramic carriers , adhesives , reflective layers and phosphor layers are similar to those in the first embodiment and detail descriptions are omitted here . a difference between this embodiment and the first embodiment is that , there are three wavelength conversion modules 208 a , 208 b and 208 c , each having an arc shape ; they are arranged on and adhered to a ring shaped region of the support structure 204 to form a ring shape . moreover , the phosphor material in the phosphor layer on each ceramic carrier is a monochromatic phosphor that is excited to emit a converted light of one color , and different colored phosphor materials are provided on different ceramic carriers . for example , as shown in fig2 , the phosphor materials on the three wavelength conversion modules 208 a , 208 b and 208 c are respectively red phosphor , yellow phosphor and orange phosphor . the sequence of the three phosphors can be arranged according to need , and the colors of the single color phosphors can be selected and combined as needed . also , one color phosphor material may be provided on two ceramic carriers . more generally , the number of ceramic carriers may be more than three , and different choices of color , sequence and distribution of the phosphors are possible . an advantage of this embodiment over the first embodiment is that different color phosphors are located on different ceramic carriers . different phosphors , along with the same or different first glass powder used for each phosphor , use different processing conditions when sintering to form the phosphor layers . for example , because red phosphor and orange phosphor have poorer temperature resistance , lower temperature glass powders having lower softening point should be used even though they have slightly poorer light transmission rate , so sintering may be done at a lower temperature . yellow phosphor and green phosphor have better temperature resistance , so glass powders having higher softening points and higher light transmission rates may be used , and sintering may be done at higher temperatures . if red phosphor and yellow phosphor layers are sintered onto the same ceramic substrate , the phosphor layers need to be sintered separate times at different sintering temperatures ; thus , the ceramic substrate will be heated multiple times , which is unfavorable for the stability of the ceramic substrate . using this embodiment , on the other hand , because different wavelength conversion modules containing different color phosphors are separately and individually fabricated , and the modules are then adhered to the support structure , production cycle can be shortened significantly . meanwhile , for each module , based on the phosphor it contains and the glass powder , reflective layer , and ceramic carrier of the module , a fabrication process can be designed to achieve optimum results for the module without limitations imposed by the phosphors or other components of the other modules . in this embodiment , except for the reflective layer , the other components are similar to those of the first and second embodiments , and detailed descriptions are omitted here . a difference between this embodiment and the first and second embodiments is that for the reflective layer , a diffuse reflection layer replaces the total reflection film . the diffuse reflection layer is located between the phosphor layer and the ceramic carrier , and includes white scattering particles , which function to scatter the incident light . the white scattering particles are typically a powder of a salt or an oxide , and the particle size ranges from 50 nanometers to 5 microns . examples include aluminum oxide , titanium oxide , aluminum nitride , magnesium oxide , boron nitride , zinc oxide , zirconium oxide , barium sulfate , etc . which are ultra - white single powder particles , or a mixture of two or more of the above powder particles . these white scattering material absorbs virtually no light , and are stable and will not oxidize or decompose under high temperature . considering that the diffuse reflection layer should have good reflectivity and heat dissipation property , a preferred choice is aluminum oxide powder which has desirable properties overall . to achieve sufficient reflection of the incident light , the white scattering material in the diffuse reflection layer should have sufficient density and thickness , and the particle size distribution should be in an appropriate range . the smaller the particle size and the denser the packing , the better the scattering effect . on the other hand , it is easy to understand that , for the same white scattering particles , the higher the ratio of the particles in the layer and the thicker the diffuse reflection layer , the higher the reflectivity . however , when the diffuse reflection layer is too thick , its thermal resistance will be too high ; thus the thickness should be within an appropriate range . the density and thickness can be determined through experimentation . in one example , a diffuse reflection layer of aluminum oxide powder is formed on the surface of an aluminum nitride ceramic carrier , where the thickness of the diffuse reflection layer is 0 . 1 - 1 mm , the particle size distribution is 0 . 1 - 1 ฮผm , and the weight ratio of the aluminum oxide powder to the adhesive agent is 1 : 1 to 10 : 1 . based on experiments , such a diffuse reflection layer has a reflectivity that is up to 99 . 5 % of that of the of mirror - surface aluminum substrate , i . e ., its reflectivity is almost as high as that of mirror - surface aluminum substrate . of course , the particle size of the scattering particles , and the thickness and density of the diffuse reflection layer can be other values , which can be determined by those skilled in the art through routine experimentation . similarly , the white scattering powder is adhered together by an adhesive to form an integral piece . the adhesive may be silica gel , sodium silicate , etc . preferably , the white scattering particles are sintered with a second glass powder , where the second glass powder is sintered into a glass body to adhere the white scattering particles . here , the choices of the second glass powder may be the same as those of the first glass powder in the first embodiment . the second glass powder and the first glass powder may be the same or different glass powders . the diffuse reflection layer may be affixed to the ceramic carrier using an adhesive . however , when using an adhesive , the existence of the adhesive means that there is an intermediate layer between the diffuse reflection layer and the ceramic carrier , which may hinder the heat conduction from the diffuse reflection layer to the ceramic carrier . thus , preferably , the diffuse reflection layer is directly sintered to the ceramic carrier , so that the bonding between the ceramic carrier and the diffuse reflection layer is strong , and thermal conductivity is high . meanwhile , the matching of the thermal expansion coefficients of glass and ceramics is better than the matching of the thermal expansion coefficients of glass and metal . further , because the ceramic carrier has relatively high thermal conductivity coefficient , it can conduct heat well , like a metal substrate . it is noted that when the diffuse reflection layer is first formed on the ceramic carriers and then the phosphor layer is formed on the surface of the diffuse reflection layer by sintering , to prevent the sintering process from adversely impacting the diffuse reflection layer , the sintering temperature for the phosphor layer is preferably lower than the softening point of the second glass powder . thus , the softening point of the second glass powder should be higher than that of the first glass powder . similarly , when the phosphor layer is formed first and then the diffuse reflection layer is formed on the surface of the phosphor layer by sintering , the sintering temperature is preferably lower than the softening point of the first glass powder , and the softening point of the second glass powder should be lower than that of the first glass powder . also , because the softening points of the first and second glass powders should be different , and borosilicate glass powder has a higher softening point , this glass powder may be used as the one of the first and second glass powders that has a higher softening point . an advantage of this embodiment over the first and second embodiments is that it uses a diffuse reflection layer to replace the total reflection film , and uses the diffuse reflection layer combined with the ceramic carrier to replace conventional mirror - surface metal plate . the diffuse reflection layer formed of the scattering particles scatters the incident light and can achieve a similar or even the same result as mirror reflection . further , white scattering particles will not change their color and property due to oxidation , decomposition or other reactions under high temperature so will not reduce its reflection of the incident light . thus , a diffuse reflection layer can withstand relatively high temperatures . meanwhile , because the melting point of the ceramic material is higher than that of metal , it can withstand higher temperatures than metal , so that even after prolonged operation under high temperature , it still does not suffer significant oxidation , softening or other property changes . thus , it can replace conventional metal substrate and reflective surface . in the diffuse reflection layer the second glass powder adheres the white scattering particles ; it can insulate the white scattering particles from the atmosphere , to prevent the white scattering particles from becoming damp in the air . it can also increase the strength and light transmission rate of the diffuse reflection layer . further , when the adhesive of both the phosphor layer and the diffuse reflection layer are glass powders , the phosphor layer can be sintered on the surface of the diffuse reflection layer , or the diffuse reflection layer can be sintered on the surface of the phosphor layer , so that the two layers have a high bonding force and can withstand relatively high temperature . in addition , in a conventional aluminum substrate with a phosphor layer on its surface , the surface of the substrate is smooth , so when the phosphor layer is formed on the mirror - surface of the aluminum substrate , the contact interface between the phosphor layer and the mirror - surface aluminum substrate will shrink , and the phosphor layer may be partially separated from the substrate . this reduces the contact interface area between the phosphor layer and the mirror - surface aluminum substrate , so the thermal resistance between the phosphor layer and the mirror - surface of the aluminum substrate is relatively high . for a wavelength conversion device using ceramic carriers , on the other hand , because both the ceramic carrier and the diffuse reflection layer have a rough surface , the contact interface areas between the phosphor layer and the diffuse reflection layer and between the diffuse reflection layer and the ceramic carrier are relatively large , so the thermal resistance of the interface between the ceramic carrier and the phosphor materials is relatively low , and the heat generated by the phosphor materials can be effectively conducted to the ceramic carrier , so that the wavelength conversion device can withstand higher temperature . as shown in fig3 , this embodiment includes four wavelength conversion modules ( two of them , 408 a and 408 b , are shown in the drawings and the other two are not shown ) and the support structure 404 . the four wavelength conversion modules are arranged in a ring shape and affixed on a ring shaped region of the surface of the support structure 404 . the support structure 404 is similar to that of the first to third embodiments . each wavelength conversion module includes a fluorescent ceramic piece 401 and a reflective layer 403 , and the reflective layer 403 is disposed between the fluorescent ceramic piece 401 and the surface of the support structure 404 . the fluorescent ceramic piece 401 includes a ceramic carrier and a phosphor material dispersed within the ceramic carrier . in other words , the ceramic carrier and phosphor layer in each wavelength conversion module in the first to third embodiments are combined into one component here . the fluorescent ceramic piece 401 is a ceramic body that can be excited by the excitation light to generate a converted light , such as yag glass ceramics , sintered yag ceramics , or other systems of yellow , green or red fluorescent ceramics . the fluorescent ceramic piece 401 of each wavelength conversion module may be the same type of fluorescent ceramic , or different colors or different types of fluorescent ceramic as needed . in this embodiment , the reflective layer 403 is a total reflection film having high reflectivity , such as silver film , aluminum film , etc . preferably , the total reflection film can be deposited on the bottom surface of the fluorescent ceramic piece by a coating technique , such as electroplating , chemical plating , electron beam sputtering , plasma sputtering , vapor deposition , etc . further , a metal protection film may be coated over the reflective layer 403 on the fluorescent ceramic piece 401 , using one of the coating methods mentioned above . the metal protection film may be a metal such as ti , ni , cu , al , or mo , or a mixed film of two or more of the above metals . or , the film may be a composite film formed by alternating coatings of multiple metals . the function of the metal protection film is to protect the reflective layer as well as to facilitate adhesion with the base plate . the coated fluorescent ceramic pieces 401 are arranged and affixed to the base plate of the support structure 404 using adhesion or soldering . if using adhesion , the adhesive may be the same type of adhesive used in the first embodiment to adhere the ceramic carriers to the support structure . if using soldering , preferably , low temperature vacuum brazing is used . this can reduce the air cavities and thickness of the soldering layer , which enhances heat conduction . of course , the reflective layer 403 in this embodiment may also be a diffuse reflection layer containing white scattering particles as described in the third embodiment . when forming a diffuse reflection layer on the surface of the support structure 404 , preferably , the white scattering particles are adhered together using a silica gel , to increase the bonding between the diffuse reflection layer and the support structure 404 . alternatively , the reflective layer 403 may have other structures , as long as it can effectively reflect the incident light . an advantage of this embodiment over the first to third embodiment is that , by using a fluorescent ceramic piece that has a dense structure and high thermal conductivity to replace the structure of a ceramic carrier with a phosphor layer adhered to it , the structure of the device is simpler and the fabrication process is simplified , which reduces material and processing cost . also , because fluorescent ceramics have a dense structure , air cannot penetrate the fluorescent ceramic piece to react with the reflective layer , which improves the stability of the reflective layer . moreover , fluorescent ceramics have very high thermal conductivity , and are more suitable for illumination by a high power excitation light . a difference between this embodiment and the fourth embodiment is that in this embodiment , of the four wavelength conversion modules , three of them are replaced by the module structure of the third embodiment , i . e . a ceramic carrier with a diffuse reflection layer and a phosphor layer sequentially adhered to it . it should be understood that it is also possible to replace only two of the wavelength conversion modules , or the number of replaced modules may be any number above two , and the number of each type of wavelength conversion modules can be any suitable numbers based on need . in the descriptions below , the various components and their structure and relationship with each other are similar to the earlier described embodiments ; only the differences from the earlier embodiments are described here . as shown in fig4 a and 4b , wavelength conversion modules 508 a , 508 b , 508 c and 508 d are affixed to the surface of the support structure 504 using adhesion or soldering . the drive mechanism 505 drives the support structure 504 and the various wavelength conversion modules to rotate together . in this embodiment , each of wavelength conversion modules 508 a , 508 b and 508 d includes a ceramic carrier 503 with diffuse reflection layer 502 and phosphor layer 501 sequentially adhered to its surface , similar to the corresponding structure in the third embodiment . among them , wavelength conversion module 508 a uses an orange phosphor as the color phosphor material , wavelength conversion module 508 b uses a green phosphor , and wavelength conversion module 508 d uses a red phosphor . as mentioned earlier , different color phosphors have different temperature resistance properties ; correspondingly , different first glass powders , ceramic carriers and sintering processes are used for these different wavelength conversion modules based on need . wavelength conversion module 508 c includes a fluorescent ceramic piece 511 with a total reflection film 513 on its surface , similar to the corresponding structure in the fourth embodiment . in this embodiment , the fluorescent ceramic piece 511 is a yag glass ceramic which can be excited to generate a high brightness yellow light . the four wavelength conversion modules are fabricated using their respective optimum processing conditions , and are then respectively affixed on one surface of the support structure , to form a ring shape . an advantage of this embodiment over the first to fourth embodiments is that : in the segmented and modular wavelength conversion device of this embodiment , by combining two types of modules , namely those using ceramic carriers with reflective layers and phosphor layers on the top surface , and those using fluorescent ceramic pieces with reflective layers on the bottom surface , the applications are broadened which can meet higher design requirements . a difference between this embodiment and the first to fifth embodiments is that , a wavelength conversion module in the first to fifth embodiment is replaced with a light transmission segment , or one of them is replaced with a light reflection segment , or both . other aspects of this embodiment are similar to the first to fifth embodiments , except for the following . when one wavelength conversion module is replaced by a light transmission segment , as shown in fig5 a , an arc shaped region of the base plate of the support structure 604 that corresponds to that wavelength conversion module is cut into an arc shaped opening 609 . or , an arc shaped high transmission glass piece is provided in the opening 609 , where the glass piece may be sintered using one of the earlier mentioned glass powders . when the wavelength conversion device is rotated by the drive mechanism 605 to a position such that the excitation light illuminates the arc shaped opening 609 , the excitation light passes through the opening 609 directly and becomes output . thus , the opening is the light transmission region . when one wavelength conversion module is replaced by a light reflection segment , as shown in fig5 b , an arc shaped region of the base plate of the support structure 604 that corresponds to that wavelength conversion module is coated with high reflection particles to form a high reflection layer 619 . preferably , to ensure that the high reflection particles are secured adhered to the surface of the support structure 614 , the high reflection particles are mixed with silica gel to form a slurry , which is coated on the surface of the support structure 614 and then cured . further , to increase the reflectivity , a silver - coated aluminum plate having a matching arc shape is prepared first , and then a slurry of the high reflection particles mixed with silica gel is coated on the surface of the silver - coated aluminum plate and then cured . the aluminum plate is then affixed to the corresponding region of the support structure 614 , to form the reflection segment . when the wavelength conversion device is rotated by the drive mechanism 615 to a position such that the excitation light illuminates the reflection segment , the excitation light is reflected . an advantage of this embodiment over the first to fifth embodiments is that , when the excitation light itself is one of the desired monochromatic light such as blue light , it is not necessary to use wavelength conversion of a phosphor of a wavelength conversion module to generate such monochromatic light . rather , the monochromatic excitation light can be directly transmitted through the transmission segment to be output or reflected by the reflection segment to be collected . this can save materials , simplify fabrication process , and can generate the monochromatic light that has as little light loss as possible . a difference between this embodiment and the first to sixth embodiments is that , the support structure of any of the first to sixth embodiments is modified . this embodiment is similar to the first to fifth embodiments except for the following . as shown in fig6 , the support structure 704 is a round shaped base plate , and a ring shaped groove 707 is formed on the top surface in the ring shaped region that corresponds to where the wavelength conversion modules 708 a and 708 b are mounted . the wavelength conversion modules 708 a and 708 b are affixed on the inner bottom surface of the groove 707 using adhesion or soldering as described earlier . mechanical fastening means may also be used , such as pressing by elastic plates , screws , bolts or other fastening devices , or the wavelength conversion modules can be bucked inside the groove 70 by thermal expansion and contraction of the support structure . the inner and outer side surfaces of the wavelength conversion modules preferably contact the two side surfaces of the groove 707 . an advantage of this embodiment over the earlier embodiments is that , because the wavelength conversion modules are disposed inside the groove , the contact surface areas between the support structure and the wavelength conversion modules are increased , which facilitates heat dissipation of the wavelength conversion modules . further , when the wavelength conversion modules rotate by the drive mechanism , due to centrifugal force , the wavelength conversion modules have a tendency to be spun outwardly ; by placing them inside the groove , the side surface of the groove can protect the modules and prevent them from being spun off , which can improve the structural stability of the wavelength conversion device and increase its life . of course , based on the above descriptions , it should be understood that the groove may have many variations , such as two ring shaped protrusions located respectively just inside and just outside of the ring shaped region of the base plate , so that the wavelength conversion modules are located in the ring shaped region between the two protrusions . or , a number of protrusions may be formed in the ring shaped region of the base plate , and the wavelength conversion modules correspondingly have recesses on their bottoms , such that the protrusions and the recesses engage with each other to form a restraint against radial movements . or the protrusions and recesses may be swapped . all these designs are within the scope of this embodiment . the first to seventh embodiments all use a reflective type wavelength conversion device , so reflective layers are provided on the wavelength conversion modules . the wavelength conversion device of this invention may also be a transmission type , which will not require the reflective layers . their structures are shown in fig7 a and 7b as examples . as shown in fig7 b , the support structure 804 includes two half - circle arc shaped slots , which are arranged facing each other and joined together using detachable mechanical means such as threads on the outside surfaces of the support structure components 804 a and 804 b , elastic snaps , bolting , etc ., or joined together using non - detachable means such as adhesion , soldering , etc . as shown in fig7 a and 7b , the outer edges of the multiple wavelength conversion modules 808 a , 808 b and 808 c are inserted into the slot , and the radial direction side edges of adjacent wavelength conversion modules abut each other and help to keep each other in place . the adjacent modules can also be joined to each other by adhesion , soldering , etc . also , a light transmitting glass plate is provided above and / or below the entire ring shaped combination of wavelength conversion modules , where the edge of the glass plate is inserted into the slot together with the modules . this can improve the overall structural strength of the device and prevent breakage . the choices and combinations of the wavelength conversion modules may be the same as any of the earlier described embodiments . also , one of the wavelength conversion modules may be replaced with a light transmitting glass plate or a light transmitting aperture . to improve the efficiency of the transmitted excitation light and converted light , preferably , a light collection assembly is preferably provided on one side of the round plate formed by the wavelength conversion modules . the light collection assembly may be a flat reflecting mirror , paraboloid reflecting mirror , condensing lens , etc ., to collect the light for utilization . an advantage of this embodiment is that it omits the fabrication step for the reflective layer , and can directly utilize available reflective devices to collect the light . although under current technologies the efficiency of transmission type devices is lower than reflective type devices , in applications that do not imposed a high requirement on light emitting efficiency , or if the light conversion efficiency of the phosphor layers or fluorescent ceramics can be improved by other means , this embodiment can be an acceptable option . a difference between this embodiment and the earlier described embodiments is in the drive mechanism . this embodiment is similar to the first to fifth embodiments except for the following . in this embodiment , the drive mechanism is coupled to the excitation light source , and drives the excitation light sources to move , so that the emitted excitation light sequentially illuminates different wavelength conversion modules , to sequentially generate different colored converted lights . when the wavelength conversion modules are stationary , and are arranged in a ring shape , the drive mechanism drives the excitation light source to move laterally along a corresponding circular path . when the wavelength conversion modules have rectangular shapes and are arranged sequentially in a linear manner , the drive mechanism drives the excitation light source to move laterally along a linear path . in the latter case , the drive mechanism is not necessarily a rotating motor , but can be a moving bar , crankshaft , etc . mechanical structure that can generate a linear movement . it should be understood that the wavelength conversion modules may be arranged in any suitable manner depending on need , and the drive mechanism drives the excitation light source in a corresponding manner . on the other hand , when the excitation light source is stationary , and the drive mechanism is coupled to the support structure and drives the wavelength conversion modules , then depending on the shape of the wavelength conversion modules such as a ring shape , a linear shape , or a wavy shape , the drive mechanism can be provided correspondingly such that the drive mechanism drives the wavelength conversion modules to move in order to sequentially generate different converted lights . in this case , the drive mechanism is not limited to a motor . an advantage of this embodiment over the earlier described embodiments is that it allows the overall wavelength conversion device to have various different structures to suit the need for various permutations and combinations of the wavelength conversion modules . the various embodiments of the invention are described in this disclosure in a progressive manner ; each embodiment is described by focusing on its difference from other embodiments , while identical or similar aspects of the different embodiments can be understood by referring to other embodiments . embodiments of the present invention are not limited to the above ; the invention generally relates to a wavelength conversion device that can be illuminated by an incident excitation light to generate converted lights of different wavelengths than the excitation light , which uses a ceramic material as carriers to carry phosphor materials , where the ceramic carriers are divided into multiple segments to reduce and prevent cracking due to high temperature . all such devices are within the scope of this invention . this invention is also directed to a light source system based on any of the above wavelength conversion devices . the light source system includes an excitation light source generating an excitation light , and the above wavelength conversion device , where the phosphor materials of the wavelength conversion device are located on the light path of the excitation light , to convert the excitation light into converted lights for output . this invention is also directed to a projection system for forming images , which includes the above light source system . the projection system may use any suitable projection technologies such as liquid crystal display ( lcd ) and digital light processor ( dlp ) projection technologies . moreover , the light emitting device can also be used in lighting systems , such as stage lighting . it will be apparent to those skilled in the art that various modification and variations can be made in the wavelength conversion device and related systems of the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover modifications and variations that come within the scope of the appended claims and their equivalents .
| 6 |
the ball retriever and storage device of this invention is shown generally by the number 10 in fig1 . the device includes an open metal wire or rod frame which provides the receptacle or storage compartment for the device . a bottom or entrance opening 12 to the storage receptacle is provided by a wire rod 14 bent to form a rectangle . an access opening 16 is provided by a wire rod 18 of rectangular configuration . a u - shaped framing rod 19 , shown most clearly in fig1 includes a first portion 20 , a second portion 22 extending substantially parallel to the first portion and an end joining portion 24 . the open ends of portions 20 and 22 are each secured to a point on the front side of the rectangular wire rod 18 . the ends of portions 20 and 22 adjacent end joining portion 24 are secured to the front side of the rectangular wire rod 14 . a second , like u - shaped wire rod 19 is secured to the wire rods 14 and 18 on the rear or opposite side thereof opposite the locations to which the first rod 19 is secured . a wire rod 26 , which includes first and second portions 28 and 30 respectively which extend parallel to one another is provided as part of the wire frame of the device 10 . an end joining portion 32 interconnects first and second portions 28 and 30 at one end of these portions . portions 34 and 36 extend from the other ends of first and second portions 28 and 30 respectively and converge towards one another . the distal ends of portions 34 and 36 are bent at right angles and fit into an end of handle 40 for carrying the device 10 . the ends are shown in phantom extending into handle 40 in fig1 . portions 28 and 30 are secured to one side of the rectangular rod 18 at the ends adjacent portions 34 and 36 , and are secured to one side of the rectangle formed by wire rod 14 adjacent end joining portions 32 . a second wire rod 26 is secured to wire rods 14 and 18 on the opposite side of the rectangle in the same manner as and at the same locations as described and shown with respect to the above described rod . four additional wire rods 42 each have one end thereof secured to the center of a side of the rectangle formed by wire rod 14 and the other end secured to the center of the corresponding side of the rectangle formed by wire rod 18 . portions 20 and 22 of wire rods 19 , portions 28 and 30 of wire rods 26 , wire rods 42 , 14 and 18 , secured together as described above , form the elongate frame defining a central storage area or receptacle for storing balls . as previously noted , wire rod 14 forms an entrance opening 12 and wire rod 18 forms an access opening 16 . the portions 20 and 22 of rods 19 , 28 and 30 of rods 26 and rods 42 are positioned with respect to another when secured to rods 14 and 18 such that the tennis balls can only enter and exit the central storage area via openings 12 and 16 . that is , the spacings between these rods and rod portions are so small that a tennis ball cannot be squeezed between adjacent rods or rod portions . as preveously noted , portions 20 and 22 of wire rods 19 extend beyond the entrance opening 12 formed by wire rod 14 and terminate at end joining portion 24 . these extensions and end joining portion 24 define support feet for unit 10 . the portions 28 and 30 of wire rod 26 extending below the entrance opening 12 formed by wire rod 14 , and end joining portion 32 of wire rod 26 also form support feet for unit 10 . these support feet , in addition to supporting unit 10 , maintain entrance opening 12 a predetermined distance above the ground as can be seen by reference to fig1 and 2 . with the entrance opening 12 supported above ground , balls which may be stored in unit 10 cannot come in contact with the ground . a closure 44 formed from bent wire has one end 46 bent around the rear section 18a of wire rod 18 . closure member 44 can be pivoted selectively to open or closed positions . closure member 44 includes a pair of parallel portions 48 which extends from bend end portion 46 the width of exit opening 16 and terminates in a latch 50 . when closure member 44 is in its closed position , latch 50 engages against wire rod 18 and rod 42 to releasably lock the closure 44 in position preventing the stored balls from inadvertently escaping from the device 10 . the restraining means for the entrance is provided by a pair of wire rod fingers 54 , shown in fig3 . the wire fingers 54 are v - shaped . the base or wider ends of the fingers are secured to the front and rear sides of the rectangular entrance opening 12 . the fingers are aligned facing one another and extend into entrance opening 12 in a plane which is substantially perpendicular to the vertical axis of the storage area . the apices 55 of fingers 54 are spaced apart a short distance or space 56 . fingers 54 and the rod 14 form two entry spaces 57a and 57b into the storage area for retrieving and storing the balls . each of these two spaces has a point of maximum width being slightly less than the width of a tennis ball so that the tennis ball must be squeezed between rod 14 and fingers 54 at space 56 in order to permit entry of the ball into the central storage area of device 10 . when balls are to be retrieved , the device 10 is placed over the tennis balls and pressed downwardly . the support feet 24 and 32 prevent the tennis balls from being deflected away from the entrance opening 12 as the unit is lowered over the balls , as shown in fig4 . the members 54 and side parts of rectangular bar 14 also act as guides or cam means which urge or roll the ball towards the space 56 , thus reducing the pressure necessary to allow the ball to be admitted or squeezed into the the central storage area . with slight downward pressure on the handle 40 , the ball is compressed and forced between fingers 54 and rod 14 into the central storage area of device 10 , thus retrieving a ball . when stored balls are to be removed , closure member 44 is pivoted to an open position and the user may reach into the unit to remove a ball . alternately , the user may lift the entire device 10 and pour all of the balls stored therein into a machine , such as has previously been described . in order to prevent corrosion of the unit 10 and damage to the tennis balls due to sharp edges as the balls are squeezed into unit 10 , all of the rods used in the formation of unit 10 may be coated with a colored plastic material . this material is mar and chip proof in the preferred embodiment thus minimizing the chance of rusting and corrosion to the unit and damage to the stored tennis balls . although the device may have special utility for retrieving tennis balls , other kinds of balls may be retrieved , so long as they have some degree of resilience which will enable them to be squeezed into the device . for instance , balls used in the game of lacrosse can be retrieved with this device .
| 0 |
referring now to the drawings , as shown in fig1 reference numeral 10 generally identifies a hand - held , gun - shaped scanner head having a barrel 12 and a handle 14 . the head need not be gun - shaped as any suitable configuration may be used , such as box - like . a manually - operable trigger 16 is situated below the barrel 12 on an upper , forwardly - facing part of the handle 14 . as known from the above - identified patents and application incorporated by reference herein , a light source component , typically , but not necessarily , a laser , is mounted inside the head 10 . the light source emits a light beam along a transmission path which extends outwardly through a window 18 that faces indicia , e . g . bar code symbols , to be read . also mounted within the head is a photodetector component , e . g . a photodiode , having a field of view , and operative for collecting relected light returning through the window 14 along a return path from the symbol . a scanner component is mounted within the head 10 , and is operative for scanning the symbol and / or the field of view of the photodetector . the scanner component includes at least one light reflector positioned in the transmission path and / or the return path . the reflector is driven by an electrically - operated drive to oscillate in alternate circumferential directions , preferably at the resonant frequency of the scanner component . the photodetector generates and electrical analog signal indicative of the variable intensity of the reflected light . this analog signal is converted into a digital signal by an analog - to - digital converter circuit . this digital signal is conducted , according to one embodiment , along an electrical cable 20 to a decode module 22 located exteriorly of the head 10 . the decode module 22 decodes the digital signal into date descriptive of the symbol . an external host device 24 , usually a computer , serves mainly as data storage in which the data generated by the decode module 22 is stores for subsequent processing . in operation , each time a user wished to have a symbol read , the user aims the head at the symbol and pulls the trigger 16 to initiate reading of the symbol . the trigger 16 is an electrical switch that actuates the drive means . the symbol is repetitively scanned a plurality of times per second , e . g . 40 times per second . as soon as the symbol has been successfully decoded and read , the scanning action is automatically terminated , thereby enabling the scanner to be directed to the next symbol to be read in its respective turn . in addition , the head need not be a portable hand held type as fixedly mounted heads are also contemplated in this invention . furthermore , the heads may have manually operated triggers or may be continuously operated by direct connection to an electrical source . the oscillations need only last a second or so , since the multiple oscillations , rather than time ; increase the probability of getting a successful decode for a symbol , even a poorly printed one . the resonating reflector has a predetermined , predictable , known , generally uniform , angular speed for increased system reliability . as shown in fig2 one embodiment 30 of high speed scanning arrangement of the present invention , includes a flexible support member or beam , e . g . a generally planar leaf spring 34 . leaf spring 34 has one end portion 36 fixedly mounted to an upright of an l - shaped bracket 38 which is anchored to base support 40 . spring 34 has an opposite end portion 42 fixedly mounted to an upright of another l - shaped bracket 44 which is anchored to the base support 40 . the uprights are oriented at 90 ยฐ relative to each other . a central portion of the spring 34 is guided around a cylindrical clamping pin 46 . the central portion of the spring 34 is clamped between the clamping pin 46 and a bearing surface of a v - block 48 by means of a set screw 50 . the clamping pin 46 imparts a 90 ยฐ bend to the leaf spring at the central portion . a scanner component , e . g . a light reflector 52 , is fixedly mounted to a rear support 54 which , in turn , is fixedly secured to the v - block . the rear support 54 has a permanent magnet 56 mounted at one of its ends . an electromagnetic coil 58 is mounted adjacent the magnet 56 on an upright of another l - shaped bracket 60 which , in turn , is mounted on the base support 40 . the coil 58 has a central passage 62 through which the magnet enters with clearance each time a momentary , periodic energizing pulse is applied to input leads 64 . the frequency of the energizing pulse is preferably selected at the resonant frequency of 1 / 2ฯ โ k 7 / i where k equals the spring constant of leaf springs 34 , and where i equals the moment of inertia of the magnet / reflector assembly suspended from the leaf spring . the assembly is oscillated about the axis 66 . the spring is advantageously constituted of plastic or metal material . non - metal materials would be more rugged . in operation , each time the energizing pulse is applied to the soil 58 , the magnet 56 is drawn into the passage 62 , thereby pulling the reflector 52 , the rear support 54 , the v - block 48 , the clamping pin 46 , the set screw 50 therealong . at the same time , the leaf spring is bent . in the illustrated rest position , each arm , of the leaf spring is generally planar . upon being displace , each arm of the leaf spring is bent , thereby storing energy therein . an l - shaped step 68 mounted on the base support 40 is located behind the clamping pin 46 to prevent movement of the same past the stop . the pin 46 does not normally engage the step ; it is intended as safety feature in the event that the arrangement is subjected to external shock forces . the flexible support near the center of rotation of the component provides an excellent shock absorber . once bent , the leaf spring 20 releases its stored energy , thereby displacing the magnet / reflector assembly back to and past the rest position . the entire assembly oscillates in a damped manner , until eventually coming to a halt in the rest position . each arm of the leaf spring alternately assumes a concave and then a convex shape during such oscillation . light directed from a source , e . g . a laser 70 , onto the reflector 52 is wept in one direction in a scan across indicia to be read . another embodiment of the same configuration utilizes constant amplitude excitation , with continuous oscillation . in this embodiment , the driving signal is a continuously applied ac signal that caused the magnet 56 to be cyclically drawn into the passage 62 and forced out of the passage 62 . the spring 34 vibrates to oscillate the reflector 40 between scan end positions . by providing a well defined center of rotation at axis 66 that is close to the scan component , image translation is minimized . in addition , in this configuration the scan pattern stays centered regardless of the scan position . it be understood that each of the elements described above , or two or more together , also may find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in a power - saving scanning arrangement , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention and , therefore , such adaptations should and are intended to be comprehended within the meaning and range of equivalence of the following claims . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims .
| 6 |
for purposes of describing the preferred embodiment , the terminology used in reference to the numbered components in the drawings is as follows : 1 . clothes hanger , generally 2 . first side of clothes hanger 3 . second side of clothes hanger 4 . center of clothes hanger 5 . horizontal angle 6 . apex 7 . rod hanging hook 8 . strap hanging hook 9 . rear surface of clothes hanger 10 . front surface of clothes hanger 11 . bottom surface of clothes hanger 12 . top surface of clothes hanger 13 . vertical angle 14 . base 15 . elongated arm 16 . top end of elongated arm 17 . bottom end of elongated arm 18 . top surface of base 19 . bottom surface of base 20 . perimeter edge of base 21 . panel 22 . aperture 23 . joint with reference to fig1 - 4 , a perspective side view , a front view , a rear view and a top view , respectively , of a clothes hanger 1 of the present invention are illustrated . the clothes hanger 1 comprises a first side 2 and a second side 3 meeting at a center 4 of the clothes hanger 1 and extending away from each other a predetermined distance . the first side 2 and second side 3 may be parallel to each other or the first side 2 and second side 3 of the clothes hanger 1 may angle downward from the center 4 to create a horizontal angle 5 and a substantially boomerang - like shape having an apex 6 . a rod hanging hook 7 extends upward from the center 4 of the clothes hanger 1 . the rod hanging hook 7 is used to hang the clothes hanger 1 in a closet from a hanging rod . at least two strap hanging hooks 8 are located on the first side 2 and at least two strap hanging hooks 8 are located on the second side 3 . each strap hanging hook 8 located on the first side 2 is preferably located to mirror the location of each strap hanging hook 8 located on the second side 3 . for example , each strap hanging hook 8 is an equal distance from the center 4 of the clothes hanger 1 as compared to the countering strap hanging hook 8 located on the opposite side of the clothes hanger 1 . the placement or location of the strap hanging hooks 8 allows for the clothes hanger 1 to be counterbalanced so the clothes hanger 1 remains in a level position while hanging in a closet . the strap hanging hooks 8 located on the first side 2 may also be located on a surface that is opposite to a surface the strap hanging hooks 8 located on the second side 3 are located on . as illustrated here , the strap hanging hooks 8 located on the first side 2 are located on a rear surface 9 of the clothes hanger 1 and the strap hanging hooks 8 located on the second side 3 are located on a front surface 10 of the clothes hanger 1 . this further allows for the clothes hanger 1 to be counterbalanced so the clothes hanger 1 remains in a level position while hanging in a closet . however , although the strap hanging hooks 8 are illustrated as being located on the front surface 10 and the rear surface 9 of the clothes hanger 1 , the strap hanging hooks 8 may also be located on a bottom surface 11 of the clothes hanger 1 , a top surface 12 of the clothes hanger 1 and / or be notches located on a top surface 12 of the clothes hanger 1 . in addition , the first side 2 and second side 3 may angle outward from each other in the same or opposite directions to create a vertical angle 13 at the center 4 of the clothes hanger 1 . this vertical angle 13 provides for a further counter balance to the clothes hanger 1 . the hanger 1 of the present invention may also comprise at least one joint 23 located thereon , such as a hinge , locking hinge , male / female interlocking locking joint , pivot point or other type of engagement means that allows the hanger 1 to be collapsible for travel as illustrated in fig2 . with reference to fig5 and 6 , a perspective side view and a front view , respectively , of a clothes hanger 1 of the present invention having a base 14 are illustrated . an elongated arm 15 having a top end 16 and a bottom end 17 extends downward from the center 4 of the clothes hanger 1 a predetermined distance where the bottom end 16 connects to a base 14 having a top surface 18 , a bottom surface 19 , and at least one perimeter edge 20 . at least one panel 21 may extend upward from the perimeter edge 20 and have at least one aperture 22 located thereon . a user may store earrings on the at least one panel 21 by connecting the earrings to the apertures 22 . it is to be understood that while a preferred embodiment of the invention is illustrated , it is not to be limited to the specific form or arrangement of parts herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and drawings .
| 0 |
referring to the drawings and initially to fig1 there is shown an apparatus for evaluating manual dexterity and object manipulation in humans indicated generally by the reference numeral 1 . the apparatus 1 comprises a hand held unit 2 and a control unit 3 . the control unit 3 is connected to the hand held unit 2 by electrical cable 4 . the hand held unit 2 comprises a pair of handles 5 and a joining member 6 . the handle 5 on the left hand side of the unit 2 has parallel grip surfaces 7 and the handle 5 on the right hand side of the hand held unit 2 has tapered grip surfaces 8 . transducers ( not shown ) are fitted to the grip surfaces 7 and 8 and additionally on or about the connection between the handles 5 and the joining member 6 . straight and curved arrows indicate examples of directions of forces and torques measured by fitted transducers . the control unit 3 comprises a computer 9 having a monitor 10 and speakers ( not shown ). referring now to fig2 there is shown a handle 5 of the hand held unit 2 . the grip surfaces 12 of the handle 5 are provided by longitudinally extending hemi - cylindrical ridges 11 . the ridges 11 are co - axial with the longitudinal axis of the joining member 6 when the handle 5 is mounted on said member 6 . the handle 5 is pinched on grip surfaces 12 between a thumb 13 and an index finger 14 of a subject &# 39 ; s hand 15 . the distance between grip surfaces 12 is typically between 10 mm and 40 mm . in fig3 there is shown a hand held unit 31 having a pair of handles 32 , a joining member 33 and a display screen 34 . the handles 32 have parallel grip surfaces 35 and the display screen 34 is mounted on the joining member 33 of the hand held unit 31 . referring now to fig4 there is shown a hand held unit 41 having a pair of handles 42 and a joining member 43 . the joining member 43 has two sections 44 and 45 and a coupling 46 mounted between the two sections 44 and 45 . the two sections 44 , 45 are inter - engaged to allow compression and extension of the hand held unit 41 about the longitudinal axis of the joining member 43 . the coupling 46 is designed to oppose the extension and compression of the hand held unit 41 and is also designed to allow a momentary removal of the opposing force and subsequent latching . fig5 shows a further embodiment of the invention wherein a hand held unit 51 has a pair of handles 52 , a joining member 53 , a display screen 54 and a shield 55 . in this example , the shield 55 is mounted between the hand held unit 51 and the display screen 54 in order to prevent a subject from seeing the shape of the handles 52 on the hand held unit 51 . fig6 to 9 each show a hand held unit indicated generally by the reference numeral 61 . the units 61 each have a joining member 62 and a pair of handles with various geometries . fig6 shows a hand held unit 61 with both the left handle and the right handle having parallel grip surfaces 64 . fig7 shows a hand held unit 61 with the left handle having grip surfaces 74 tapered at 30 ยฐ to the horizontal and the right handle having parallel grip surfaces 75 . fig8 shows a hand held unit 61 with the right handle having grip surfaces 84 tapered at 30 ยฐ to the horizontal and the left handle having parallel grip surfaces 85 . fig9 shows a hand held unit 61 with both the left handle and the right handle having grip surfaces 94 tapered at an angle of 30 ยฐ to the horizontal . referring to the drawings and now to fig1 there is shown a representative graph of pull force on the x - axis versus grip force on the y - axis . line 101 represents a handle with parallel grip surfaces and line 102 represents a handle with tapered grip surfaces . finally , fig1 shows one possible visual display generated by the computer 9 when configured by the control program and output via a display screen 111 . an image of an electronic stick - man 112 holding a hand held unit 113 demonstrates what a subject is required to do . a visual display of a scale 114 is marked with vertical lines 115 and displays force . this scale 114 shows a subject the zero force marker 116 and the target force marker 117 by highlighting the relevant line 115 along the scale 114 . the dot 118 shows the current force . a target for maximum pull force 119 is located at the right end of the scale . in use , a subject or an examiner starts a test by striking any key on a keyboard of the computer 9 . this initiates the demonstration on the display screen 34 , 54 , 111 or initiates an audible demonstration . the audible demonstration includes a list of verbal instructions output via speakers connected to the computer 9 and is useful for a subject with impaired vision or blindness . when a visual demonstration is used , a pull or push prompt is displayed on the computer screen 34 , 35 , 111 and in response the stick man 112 stretches or compresses the electronic hand held unit 113 in order to show a subject the correct action to take in response to a specific prompt . within the same display screen 34 , 54 , 111 , the scale 114 shows the effect of the stick man 112 stretching or compressing the electronic units 113 by simultaneously moving the current force marker 118 between the zero force marker 116 and the target force marker 117 . once a subject is satisfied with the demonstration , they can proceed with the test by striking any key on the keyboard of the computer 9 . the hand held unit 2 , 31 , 41 , 51 , 61 is held by a subject by the grip surfaces 7 , 8 , 12 , 35 , 64 , 74 , 75 , 84 , 85 and 94 between digits of their hands . the subject then follows a list of prompts displayed on the display screen 34 , 54 , 111 or a list of verbal instructions output via speakers which are connected to the computer 9 . the display also includes the scale 114 which shows the effect of the subject stretching or compressing the hand held unit 2 , 31 , 41 , 51 , 61 by simultaneously moving the current force marker 118 between the zero force marker 116 and the target force marker 117 . the visual display may also include a prompt for the subject to maintain the target force for a predetermined period of time . once the target force has been attained , the computer 9 monitors the quality of the data received from the transducers ( not shown ) comparing it with control data . the computer 9 outputs a signal to the display screen 34 , 54 , 111 informing the subject to release the applied force if the data received is acceptable . alternatively , these prompts can be output via the speakers . the subject follows the audible or visual instructions until completion of the test . in order to prevent the subject using their vision to alter grip - load force co - ordination a shield 55 is placed between the hand held unit 2 , 31 , 41 , 51 , 61 and the subject for certain parts of the test . the hand held unit 2 , 31 , 41 , 51 , 61 is grasped bimanually and manipulated according to a pre - defined ( standardized ) protocol . an automated test protocol combined with automated data analysis allows efficient assessment of the subject &# 39 ; s manual status based on the data obtained from the force / torque transducers of units 2 , 31 , 41 , 51 or 61 . there now follows a detailed description of an example of a test protocol and data analysis . 1 . the subject familiarizes themselves with the apparatus 1 by doing a few ramp - and - hold pull forces and push forces to certain target forces ( e . g . + 4 newtons ( n ), โ 4n ). before the action , the task is demonstrated on the display screen 34 , 54 , 111 by the icon stickman 112 performing the task . the subject &# 39 ; s task is to copy the demonstration . 2 . the subject performs a series of ramp - and - hold pull forces of different magnitudes according to the predetermined protocol ( e . g ., 1 , 4 , 2 , 8 newtons ( n )) three times followed by a series of push forces ( e . g . 4 , 4 , 4 n ). these tests are repeated for the different geometric configurations of the handles , shown in the drawings . quality control of the data occurs on - line and is dependent upon the subject maintaining the target push / pull force ( within a predefined tolerance ) for two seconds . in response to successful completion of the task by the subject , the target marker 118 on the display screen 34 , 54 , 111 is turned off . an audible signal indicating that this section of the test has been successfully completed could also be generated . analysis : the computer 9 configured by the control program automatically reads and stores the measured variables during a 2 second epoch while the subject maintains the target force . the coordination between grip force and the load at each hand ( and at the level of the individual &# 39 ; s digits ) is automatically analyzed . the subject &# 39 ; s capacity to scale the grip force with the load force and to adjust the balance between the grip force and load with changes in geometry of grip surfaces 7 , 8 , 12 , 35 , 64 , 74 , 75 , 84 , 85 and 94 is assessed for each hand . 3 . the subject makes sinusoidal pull forces at different frequencies . the amplitude ( e . g . 4n with approximately +/โ 20 % tolerance ) is guided by the display screen 34 , 54 , 111 . a metronome sound guides the pace . the frequency range to be explored is 0 . 5 - 3 hz . again , quality control of the data occurs on - line . before changing to the next frequency , a certain number of cycles with an accepted amplitude and frequency are collected . ( the grip surfaces 7 , 12 , 35 , 64 , 75 , 85 are parallel on all handles .) analysis : the phase between grip force and the load is analysed ; normally there is no phase lag , which indicates that the grip force predicts adequately the self - generated load forces ( for grip stability ). the depth of grip force modulation is assessed as a function of frequency ; normally there is a steep decrease in the modulation with increased frequency , starting at about 1 . 5 - 2 hz . 4 . the subject makes sinusoidal pull - push forces at different frequencies ( 0 . 5 - 1 . 5 hz ) and at constant push - pull amplitudes ( e . g . โ 4n ( push ) to + 4n ( pull )). ( the grip surfaces 7 , 12 , 35 , 64 , 75 , 85 are parallel on all handles .) in this task , the absolute value of the tangential load increases and decreases with twice the frequency of the sinusoidal load . normal subjects respond to this โ frequency doubling โ by generating two grip force increases per load cycle i . e . the grip force predicts the actual load although it does not match the frequency of the load cycles . analysis : the phase between grip force and the absolute value of the load and the depth of grip force modulation is analyzed ( cf . above ). this analysis assesses the subject &# 39 ; s ability to generalize the directional consequences of self - generated fingertip loads in terms of grip force requirements ( and thus grip force predictions ). 5 . the subject produces their maximum bimanual pull force . normally , a subject &# 39 ; s right hand is stronger than their left โ yet subjects never allow the left hand to slip off the unit 2 , 31 , 41 , 51 , 61 during bimanual operations because the knowledge of their musculoskeletal system is incorporated as a control constraint in the neural networks of the brain . to assess asymmetries of force generating capacity by the two hands , the maximum grip force is assessed for each hand separately . 6 . finally , by imposing the transient load impact at a few unpredictable points during the test protocol numbered 2 ( see above ) the reflex status of the reactive grip force control of the two hands is assessed . normally , with two healthy hands , the load impact triggers automatic grip force increases at both hands with similar amplitudes and onset latencies . 1 . a weakened or lost capacity of the impaired hand to adjust the balance between the grip forces and the load forces in response to changes in geometry of the grip surfaces 7 , 8 , 12 , 35 , 64 , 74 , 75 , 84 , 85 and 94 . 2 . with sensory impairment of one hand , the accompanying healthy hand also controls the grip - load force coordination of the numb hand . likewise , the healthy hand uses strategies that reflect constraints imposed by the impaired hand during bimanual actions . 3 . the impaired hand generates increased internal forces upon the hand held unit 2 , 31 , 41 , 51 or 61 due to asymmetric grip force applications at the opposing grip surfaces 7 , 8 , 12 , 35 , 64 , 74 , 75 , 84 , 85 and 94 . this causes unnecessary / uneconomical load of the grasp . 1 . a temporal mismatch between the grip and load force changes and is revealed during the test with sinusoidal load changes . 2 . a reduced modulation of grip forces with load force changes compared to healthy conditions . one or several of the following items revealed impaired reactive grip force control : ( 1 ) no response to the transient load impact . ( 2 ) a prolonged onset latency of the reactive grip force increases . ( 3 ) smaller amplitudes than normal of the reactive grip force increases . with unilateral impairments , asymmetries between the hands in these respects are important . with impaired proprioceptive knowledge concerning one diseased hand the healthy contralateral hand shows incompetence in controlling its actions based on constraints imposed by the diseased hand during bimanual tasks . impaired proprioceptive knowledge is assessed in the present protocol by an inability of the healthy hand to limit the application of pull force to the hand - held unit as to match the capacity of the companion diseased hand . this is critically revealed during the test of maximum voluntary bimanual pull along the hand - held unit 2 , 31 , 41 , 51 , 61 . with proprioceptive knowledge the hand - held unit 2 , 31 , 41 , 51 , 61 does not slip at the diseased hand , whereas with loss of proprioceptive knowledge the unit 2 , 31 , 41 , 51 , 61 slips from the subjects grip .
| 0 |
fig1 depicts a side view of one embodiment of the present device . in some embodiments , as shown in fig1 , the present device can comprise a rotating generator 104 and a controller 106 . a generator 104 can have a rotor 103 that can be attached to a hub 101 , and an exterior shell that can be fixed to a controller 106 . a stator 102 and rotor 103 can have an interior plurality of indentations and protrusions that can serve as poles . the controller 106 can lock onto generator 104 with a plurality of dual purpose quick - release snap fittings 112 containing system control electrical and electronic input / output devices . a controller 106 can convert the energy flow into streamable electricity and flow it to the electrical control system using capacitors 107 , seed coils 105 , transfer bars 112 , and regulators 108 . a controller 106 can further comprise a seed coil 105 that can be first energized by electrical flux from a generator 104 . a seed coil 105 can then electrify a transfer bar 112 . an embedded card 110 and a rf transmitter 109 are part of a real - time system to act upon a generator 104 . stabilizer lines 111 , which can be flexible , can connect a controller 106 to a vehicle &# 39 ; s electrical control system from a generator 102 . a controller 106 utilizing an embedded card 110 as part of a real - time system to act upon a generator 104 and a controller 106 . in some embodiments of the present device , real - time deadlines and operations can be accomplished in an inverse peer - to - peer manner . while the controller can over - ride instructions from the generator , the generator can perform functions autonomously while monitored by controller so that function speed is optimized . in some embodiments of the present device , as shown in fig2 control of on / off and regulation of heat and power in a motor / generator can be accomplished by a shape - adaptive mechanism . although depicted in fig2 as a 3 - phase motor with a four - pole rotor and a six - pole stator , the motor can have any other known and / or convenient configuration . a rotational generator 104 can have an inner and outer housing allowing expansion 203 . this space of any known and / or convenient geometry can exist between these housings to allow for radial expansion and contraction of a stator 201 . a rotor 211 can be connected to a hub 217 . a stator 201 can be comprised of a plurality of radially separated plates 204 . although depicted in fig2 as having six plates 204 , a stator 201 can have any known and / or convenient number of plates 204 . expansion shields 214 can be housed in expansions shield pockets 215 , which can be located at the interior edges of seams of plates 204 to cover the seams when open . a plate 204 can have a linear motion controller 219 positioned in a substantially central location on a surface of a plate 204 . a linear motion controller 219 can employ a ball - and - screw mechanism , as shown in fig2 or any other known and / or convenient mechanism . a linear motion controller 219 can also further comprise of a rechargeable battery 212 and an embedded card 213 . at least one wire 218 can connect a linear motion controller 219 to an output / input device 210 . to operate the embodiment shown in fig2 , a user can switch on a generator 104 via a dashboard control system or any other known and / or convenient device . an embedded card 213 can analyze speed , temperature , braking , acceleration / deceleration , and / or any other desired parameters . this data is fed into an algorithm that can best determine the pole position in a generator 104 . when system data indicates a โ normal โ range , as determined by an embedded card 213 , the plates 204 can be moved via linear motion controllers 219 to a position of maximum charge for a 3 - mm air gap , for example . however , if less than optimal conditions are detected , plates 204 can be moved to create a 3 . 04 - mm , or any other known and / or convenient spacing between the rotor and stator poles , for example . assuming that a 3 - mm air gap is optimal for harvesting the maximum amount of energy in a generator 104 , any air gap greater than 3 - mm can yield less energy , but prevents heat build - up and frequent on / off cycling , which can smooth the waveform , and , therefore power efficiency of a motor . in a โ full - on โ position , as depicted in fig2 , plates 204 can be in the maximum radially inward position , with no gaps between the plate seams , to give an air gap on 3 - mm , for example . when a generator 104 is running at less than โ full - on โ capacity , plates 204 can be moved radially outward such that gaps between plate seams would open up . in this situation , expansion shields 214 can slide out of expansion - shield pockets 215 and be attached to neighbor poles to shield these gaps . when a generator 104 is in an โ off โ position , creating a 7 - mm air gap , for example , no power can be generated and expansion shield 214 can be fully deployed if plates are fully deployed outward . when โ full - on operation resumes , plates 204 can move radially inward to close the gaps , while expansion shields 214 can slide back into expansion - shield pockets 215 . by controlling power at the source , i . e . flux levels directly in the generator , if desired , a user can choose various power - generating need / settings . for example , using lower desired range preset algorithms , a generator 104 can deactivate after a recharging goal is achieved ( i . e . charging on - demand ), thus extending the life of the device . an algorithm can control a generator 104 by using parameters such as potential , velocity and geometric progression to predict speed , braking , acceleration , or deceleration similar to that in anti - lock braking systems ( abs ). the success of a generator 104 can be predicated on the waveform of the power output . an algorithm &# 39 ; s primary function can be to matched against a waveform preset allowing optimal waveforms by prediction of the rotation of a hub 217 so that an algorithm can then signal linear motion controllers 219 to radially move plates 204 , and therefore , stator poles , to accomplish a desired task , that is to deliver clean and usable power to a controller 104 and subsequent output to batteries or directly to the electrical system . the embodiment depicted in fig2 , the device can include a primary / secondary coil wire 205 , a primary coil 209 , secondary coil 206 , a transfer bar 207 , and a plate movement track 208 . the transfer bar 207 can be located proximate to the edge of a stator plate 204 and can be coupled with a plate movement track 208 adapted to allow radial , rectilinear motion of the transfer bar relative to the device . in some embodiments , any desired number of transfer bars 207 can be incorporated . a primary coil 209 can be coupled with the stator plate and located adjacent to the transfer bar 207 and the transfer bar 207 can be coupled with a secondary coil 206 via a primary / secondary coil wire 218 . in some embodiments , the secondary coil 206 can be located in any other known and / or convenient location within the device and / or may be coupled in any other known and / or convenient manner . introduction of the primary and secondary coils 209 206 and transfer bar 207 can result in generation of a greater amount of heat than would be anticipated from the device . the configuration can increase the energy generated by the device at the source and increase the energy supplied to the controller 104 . heat generation can be mitigated and / or controlled by appropriate control of the stator plates 201 and design factors including the number of poles including primary and / or secondary coils 206 209 . in operations , the device can include any number of desired paired and / or unpaired primary and / or secondary coils 206 209 which can be located in any desired and / or convenient location within the device . depicted in fig4 , electrical generation can be switched on / off by radio - frequency ( rf ) receiver 409 from signal sent by controller 104 deactivating rotor rotation by slip - ring 405 ( bearings 407 ) via controller 408 . while hub 402 speed is constant , rotor 403 rotation works with toggle 404 ( depicted engaged ) by tilt mechanism 406 or any other known and / or convenient mechanism . fig3 depicts a front view of another embodiment of the present device . in this embodiment , which can be used in circumstances , where limited space is not an impediment , such as in some industrial applications , an idler rim 306 can be attached to a spinning axle or hub 305 via a collar 304 . idler rim 306 can have a plurality of indentations on the outer perimeter edge or one or both surfaces of an idler rim 306 with attached rotor poles 303 . heat vents 300 / 302 assist cooling . depicted in fig3 a side view detail is a single rotor / stator embodiment 309 on the idler rim perimeter edge 310 . in a vehicular application , only one side of an idler rim 310 or the idler rim perimeter edge 310 ( depicted ) are available where space may be limited . a linear motion controller 308 on track 313 can regulate the optimal distance ( air gap ) of the stator poles 312 from rotor poles 311 formed by indentations 316 in an rotor pole 309 . a seed coil 307 than can be first energized by electrical flux from rotor poles 311 passing through stator poles 312 . a seed coil 307 can then electrify a transfer bar 315 , which can ramp the wattage potential approximately by a factor of 10 when a secondary coil 314 is energized . a secondary coil 314 can then generate electricity . fig3 c side view depicts a detail drawing of an integrated dual - sided controller / generator 320 . in dual embodiments , a plurality of stators can be on both sides of an idler rim 324 . a plurality of rotor posts 322 , on each side of an idler rim ( wheel ) 324 , can be directly fixed , attached , or part of an idler rim 324 . stator pole 321 , depicted in a full - outward position or maximum air gap via linear motion controller 325 . secondary coil then streams electricity at no or minimal levels . in use , the embodiments shown in fig3 operates similarly to that shown in fig1 and 2 . an algorithm can signal linear motion controllers 325 to regulate power . by increasing or decreasing the air gap and regulating the distance between stator poles 321 and rotor poles 322 , power generation efficiencies and deficiencies regulate the power efficiencies demanded by the integrated controller caliper 320 . although the invention has been described in conjunction with specific embodiments thereof , it is evident than many alternative , modifications , and variations will be apparent t those skilled in the art . accordingly , the invention as described and hereinafter claimed intended to embrace all such alternative , modifications and variations that fall within the spirit and broad scope of the claims .
| 7 |
in the following detailed description of embodiments of the present disclosure , reference is made to the accompanying drawings in which like references indicate similar elements , and in which is shown by way of illustration specific embodiments in which the present disclosure may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the present disclosure , and it is to be understood that other embodiments may be utilized and that logical , mechanical , electrical , functional , and other changes may be made without departing from the scope of the present disclosure . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present disclosure is defined only by the appended claims . as used in the present disclosure , the term โ or โ shall be understood to be defined as a logical disjunction and shall not indicate an exclusive disjunction unless expressly indicated as such or notated as โ xor .โ as used herein , the term โ real time โ shall be understood to mean the instantaneous moment of an event or condition , or the instantaneous moment of an event or condition plus short period of elapsed time used to make relevant measurements , optional computations , etc ., and communicate the measurement , computation , or etc ., wherein the state of an event or condition being measured is substantially the same as that of the instantaneous moment irrespective of the elapsed time interval . used in this context โ substantially the same โ shall be understood to mean that the data for the event or condition remains useful for the purpose for which it is being gathered after the elapsed time period . as used herein , the term โ compressible member โ shall be understood to mean devices that cause a gas or fluid to be compressed when a gas or fluid is placed into a chamber where the compressible member is disposed . examples of compressible members include , for example , closed cell foams , elastomeric diaphragms , pistons , and secondary chambers charged with a fixed volume of gas , wherein when a gas or fluid is placed into the chamber in which the compressible member is disposed , the gas or fluid in the compressible member compresses . the present inventor has discovered a device and method for preventing inadvertent flow of flow materials from a pump . the device comprises a stopcock having a chamber built in that is charged with aliquots of flow material . the stopcock is moved from a first position that is used for charging ( filling ) the stopcock into at least a second position that is configured for dispensing the stored aliquots of flow material . one or more pressure sensors are disposed to measure , in real time , the pressure of the chambers holding the flow materials , thereby deriving the volume of flow material dispensed from the stopcock device . because flow volumes and the elapsed time are also know , the flow rate of the dispensed flow material may be calculated , according to embodiments . temperature sensors may similarly be disposed to improve the accuracy of the calculations used to measure the flow volume or rate . according to embodiments , stopcock device 100 is illustrated generally in fig1 . stopcock device 100 comprises first chamber 110 , stopcock 150 , and conduits placing first chamber 110 and stopcock 150 into fluid communication and allowing for dispensing of the flow material . stopcock is connected to positioning device 158 , which positions stopcock 150 into one of a plurality of positions for at least charging chambers within stopcock with flow material and into position for dispensing flow material . within stopcock 150 is at least one second chamber 152 and corresponding second chamber conduit 154 . according to embodiments , first pressure sensor 120 and second pressure sensor 122 are disposed at locations in stopcock device 100 that allow for the accurate measurement of the pressure of first chamber 110 and second chamber 152 , thereby allowing calculation of flow volume and flow rates of flow materials based on change of pressure calculations , as described in detail below . a computer performs the relevant calculations . the computer comprises at least a timing device for measuring elapsed time , which may comprise a clock or a timer , for example ; devices to receive input from the pressure sensors , temperature sensors , and users ; and a processor for performing the calculations disclosed herein . first chamber 110 is a chamber of known volume . according to embodiments , first chamber 110 volume comprises first chamber 110 and first chamber / stopcock conduit 132 . according to embodiments , first pressure sensor 120 is disposed such that it is in at least gas communication with first chamber 110 or first chamber / stopcock conduit 132 , depending on the components of the present disclosure comprising first chamber 110 . fill conduit 130 comprises a conduit for filling first chamber 110 with a flow material . conduits may comprise any conventional device used to sealably transport gases or flow materials , for example pipes , tubes , or other conduits defined by a sealed body terminating in one or more open ends through which a flow material or gas enters and exits the interior of the sealed body . according to embodiments , first chamber 110 comprises a chamber having a quantity of gas contained in a compressible member . filling of first chamber 110 does not displace gas ; in other words , the net number of gas molecules remains constant as flow material fills first chamber 110 , thereby pressurizing the gas as the volume of the gas decreases . this may be accomplished by installing a one way valve , such as a check valve , as part of fill conduit 130 . the exact amount of gas does not need to be known , provided the differential pressure can be measured and the total volume of first chamber is known . according to embodiments , gas in first chamber 110 may be contained in a secondary chamber ( i . e ., the compressible member ). the secondary chamber comprises , according to various embodiments , a gas โ pillow โ formed from a flexible diaphragm that compresses when flow material fills first chamber 110 ; a movable , sealed divider ( e . g ., a piston ) that compresses when flow material fills first chamber 110 , etc . according to embodiments , gas may also be contained in a closed cell foam that occupies substantially all or part of first chamber 110 . in each of these embodiments , the compressed gas will exert pressure on the flow material whereby flow material will flow into second chamber 152 , as described below . according to embodiments , in addition to , or instead of pressure , gravity or a pump such as a lead screw may be used to move flow material from first chamber to second chamber 152 , as described below . according to embodiments and as illustrated in fig1 , first chamber 110 has disposed therein compressible member 112 . according to embodiments , compressible member 112 comprises closed cell foam . compressible member 112 may also comprise rubber or another compressible material that effects a differential gas pressure in first chamber 110 when first chamber 110 is charged with flow material verses when first chamber 110 is not charged with flow material . according to embodiments , compressible member 112 comprises a pocket of air contained within a compressible bag or โ pillow .โ according to embodiments , compressible member is disposed in first chamber 110 to ensure sufficient pressure to move the last amount of flow material from first chamber 110 to second chamber 152 . according to other embodiments , compressible member is not used , as described above . indeed , as flow material is put into first chamber 110 , the flow material is under pressure or delivered through a one - way valve . thus , flow material will naturally flow from first chamber 110 to second chamber 152 due to the pressure exerted by the gas that is pressurized as first chamber 110 is filled . because the gas or closed cell foam will tend to equalize as flow material moves out of first chamber , the last amount of flow material will be difficult to remove . removal of this last amount of flow material may be accomplished by placing the gas in first chamber 110 under pressure initially , according to embodiments . according to other embodiments , closed cell foam will mechanically tend to remove this last amount of flow material in much the same way as the foam relaxes into substantially the entire chamber as the flow material flows out . finally , gravity or a pumping mechanism may be used to remove the last amount of flow material . according to embodiments , stopcock device 100 is disposed along a flow path to prevent flow of a flow material except in pre - determined configurations . stopcocks are well known and understood by artisans , and include any generic two - or three - way valves , for example . according to embodiments , stopcock 150 comprises second chamber 152 , which is a cavity disposed within stopcock 150 and second chamber conduit 154 , which provides fluid communication between second chamber 152 and other components of stopcock device 100 , as detailed herein . according to embodiments , second chamber conduit 154 comprises a plurality of conduits or chambers , whereby the fluid / gas communication features of the present disclosure connect with the different conduits or chambers . according to other embodiments , second chamber conduit 154 is a single conduit wherein each connecting conduit is situated to articulate with second chamber conduit 154 in substantially the same location relative to stopcock 150 depending on the position of stopcock 150 . within second chamber 152 , the amount of gas is constant like with first chamber 110 , and need not be known . the same devices may be used in second chamber with respect to the gas compressible member or secondary chambers may be configured with one or more one - way valves for the filling and dispensing of flow material to prevent back flow , as would be known and understood by artisans . for example , and according to embodiments , second chamber 152 likewise has disposed therein compressible member , such as a closed cell foam . like compressible member 112 , compressible member compresses when charged with flow material , thereby creating a pressure differential in second chamber 152 when second chamber 152 is charged with flow material versus when second chamber 152 is not charged with flow material . according to other embodiments and as shown in fig2 , second chamber 152 comprises flow material reservoir 152 a and a pressurized reservoir 152 b separated by a flexible or movable separator , such as an elastomeric membrane or piston . as flow material reservoir is charged , the membrane or piston stretches or moves , thereby compressing gas in the pressurized reservoir . the same gas in pressurized reservoir is used as the gas from which second pressure sensor 122 takes measurements . second pressure sensor 122 is disposed to be in gaseous communication with second chamber 152 . for example , second pressure sensor 122 is disposed immediately adjacent to second chamber 152 , as shown in fig1 . according to alternative embodiments , second pressure sensor 122 is separated from second chamber 152 by a pressure sensing conduit . according to embodiments , dispensing conduit 134 serves as a conduit from second chamber 152 to a target , for example a patient , where the flow material is intended . according to embodiments , flow regulator 160 may be disposed to modulate flow rate . flow regulator 160 comprises flow restrictors , for example . according to embodiments where it is used , a pressure sensing conduit serves as a conduit between second pressure sensor 122 and second chamber 152 when stopcock 150 is positioned so as to be in gaseous communication with pressure sensing conduit . according to embodiments , pressure sensing conduit comprises a small cavity having a pressure sensor ; according to other embodiments , pressure sensing conduit comprises a tube , pipe , or other conduit with second pressure sensor 122 disposed somewhere therein to measure the pressure . in all cases , the total volume of second chamber 152 , second chamber conduit 154 , and pressure sensing conduit is a known volume . positioning device 158 connects to stopcock 150 and effects repositioning of stopcock 150 . according to embodiments , positioning device 158 is a motor that rotates stopcock 150 . according to embodiments , positioning device 158 may also be a device that moves a slideable stopcock back and forth . according to embodiments , stopcock 150 occupies one of three positions : a fill position ( fig3 ) where second chamber 152 is in fluid communication with first chamber 110 , but not in communication with dispensing conduit 134 ; a closed position ( fig4 ) where second chamber 152 it is not in fluid communication with either first chamber 110 or dispensing conduit 134 ; and a dispense position ( fig5 ) where second chamber 152 is in fluid communication with dispensing conduit 134 , but not first chamber 110 and in which second pressure sensor 122 is in gaseous communication with second chamber 152 . according to embodiments and as illustrated in fig3 - 5 , when stopcock 150 is in a fill position ( fig3 ), an aliquot of flow material is moved from first chamber 110 into second chamber 152 , wherein second chamber 152 is filled with a flow material . once filled , flow material is ready to be dispensed to a target , according to embodiments . after second chamber 152 is filled with an aliquot of flow material , stopcock 150 is positioned in a closed position ( fig4 ) wherein second chamber 152 is sealed . according to embodiments , the pressure is measured in first chamber 110 or second chamber 152 to determine the volume of the aliquot transferred from first chamber 110 to second chamber 152 . artisans will note that pressure cannot be sensed for first chamber while first chamber 110 and second chamber 152 are in fluid or gas communication . when stopcock 150 is positioned in a closed or dispensing position ( fig4 and 5 ), second chamber 152 is in gaseous communication with second pressure sensor 122 , but not with first chamber 110 . in these positions , the pressure of the gas in second chamber 152 is sensed with second pressure sensor 122 . the total volume of second chamber 152 is known , thereby allowing the amount of flow material dispensed or remaining in second chamber 152 to be calculated based on the change in pressure of second chamber 152 . according to embodiments , after filling second chamber 152 with an aliquot of flow material or after dispensing flow material , stopcock 150 is positioned in the closed position , the pressure is measured , and the flow material volume calculated ( because the total volume of second chamber 152 when stopcock 150 is in the pressure sensing position is known ). to dispense flow material , stopcock 150 is positioned in its dispense position ( fig5 ) for a period of time . according to embodiments , stopcock 150 is then rotated to the closed position ( fig4 ) for a period of time that is used to measure the pressure . according to embodiments , pressure measurements are taken in the dispense position ( fig5 ) to determine the flow rate in about real time without changing the position of stopcock 150 . because the volume of the aliquot of flow material that filled second chamber 152 is calculated from the pressure in first chamber 110 or second chamber 152 , and because the total volume and initial values for the pressure of second chamber 152 are known , according to embodiments , stopcock need not be positioned in the closed position prior to dispensing the flow material , according to embodiments . according to alternate embodiments , stopcock 150 occupies one of four positions : a fill position ( fig3 ) wherein second chamber 152 is in fluid communication with first chamber 110 , but not in communication with dispensing conduit 134 ; a closed position ( fig4 ) where second chamber 152 is not in fluid communication with either first chamber 110 or dispensing conduit 134 ; a pressure sensing position , wherein second chamber 152 is in gaseous communication with second pressure sensor 122 and the pressure of second chamber may be measured ; and a dispense position where second chamber 152 is in fluid communication with dispensing conduit 134 , but not first chamber 110 . according to embodiments and as illustrated in fig6 , a method is disclosed for effecting flow of flow material from a source and through stopcock device 100 . during the fill operation , according to embodiments , stopcock 150 is initially positioned into the closed position ( fig4 ), wherein it is not in fluid communication with either first chamber 110 or second chamber 152 . in this position , an initial pressure measurement of first chamber 110 is made in operation 702 . according to alternate embodiments , no initialization is necessary as the system will be in a known state prior to filling ( for example , known volume of flow material in first chamber 110 and known initial volume of first chamber 110 ). in operation 704 , first chamber 110 is filled with flow material to a desired level and a second pressure measurement is taken in operation 706 , from which the total amount of flow material in first chamber 110 is calculated . after charging first chamber 110 with flow material , fill conduit 130 is closed and substantially sealed . according to embodiments , the filling of first chamber 110 may be omitted where the device comprises a disposable that is discarded when the flow material in first chamber is spent . in operation 704 , according to embodiments , flow material enters through fill conduit 130 and into first chamber 110 . flow of flow material into first chamber 110 via fill conduit 130 may be effected from any conventional pump , including specialized infusion pumps , for example those disclosed in u . s . pat . nos . 7 , 008 , 403 ; 7 , 341 , 581 ; and 7 , 374 , 556 , which are hereby incorporated by reference in their entirety . as flow material enters first chamber 110 , compressible member 112 or gas is compressed . thus , compressible member 112 or the gas stores the energy that will later be used to effect movement of an aliquot of flow material from first chamber 110 to second chamber 152 . after first chamber 110 is filled , flow material is ready to be dispensed from first chamber 110 to second chamber 152 . prior to filling second chamber 152 with and aliquot of flow material , an initial pressure measurement of second chamber 152 is taken , according to embodiments in operation 708 . stopcock 150 is positioned into the fill position in operation 710 , whereby flow material flows from first chamber 110 , through first chamber / stopcock conduit 132 and second chamber conduit 154 , and into second chamber 152 . as flow material enters into first chamber 110 , it compresses compressible member , according to various embodiments . according to embodiments , only a small aliquot of flow material moves from first chamber 110 into second chamber 152 as second chamber 152 charges . for example , first chamber 110 may have a volume of 3 ml and second chamber 152 may have a volume of 0 . 3 ml . the small aliquot of flow material transferred is the max amount of flow material that can be inadvertently delivered in the event of an error . after second chamber 152 is charged with flow material , the pressure of second chamber 152 is measured in operation 712 . the volume of the aliquot transferred to second chamber may be calculated either from the change in pressure from first chamber 110 or by measuring the change in pressure in second chamber 152 . for example , first pressure sensor 120 again measures the pressure of first chamber 110 . because flow material has been removed from first chamber 110 into second chamber 152 , the volume of compressible member 112 or the gas is increased , thereby reducing the pressure . thus , because the total volume of first chamber 110 is known , the amount of flow material transferred to second chamber 152 may be calculated , as shown below . similarly , the volume of the aliquot of flow material in second chamber 152 may be calculated from the difference in pressure in second chamber measured before the aliquot of flow material is transferred and after the aliquot of flow material is transferred to second chamber 152 . according to embodiments , both calculations may be used and an average value taken . once the volume of flow material in second chamber 152 is known , according to embodiments , stopcock 150 is positioned in its dispense position in operation 714 . because second chamber 152 also has disposed therein compressible member 112 or gas that is pressurized , flow material in second chamber 152 is dispensed due to the pressure exerted on it by compressible member 112 or the gas . according to embodiments , dispensing conduit 134 has disposed therein flow regulator 160 , which is , for example , a flow restrictor or clamping device designed to regulate the flow rate of flow material . second pressure sensor 122 , according to embodiments , measures the change in pressure as flow material is dispensed in operation 716 . according to embodiments in which stopcock 150 has a pressure sensing position , stopcock 150 is alternated between a dispensing position ( fig5 ) and a pressure sensing position to determine the volume of flow material that has been dispensed . according to embodiments in which stopcock does not have a pressure sensing position , the pressure changes are sensed in real time in the dispense position ( fig5 ). thus , the pressure change of the gas in second chamber 152 is gradual and predictable , allowing for a flow rate to be calculated . because the volume of second chamber 152 is known , the rate of flow may be calculated , as shown below . according to embodiments , the aliquot of flow material in second chamber 152 is small enough that determination of the flow from second chamber 152 is not required . in other words , because the aliquot size is so small , a flow rate with an acceptable level of error may be determined from the number of aliquots delivered over a period of time . according to embodiments , gas from first chamber 110 and second chamber 152 is not dispensed with the flow material . thus , the number of gas molecules in each respective chamber remains constant , as is required for the exemplary equations below to be true . artisans will readily appreciate that these exemplary equations illustrate the principles by which the volume of flow material dispensed is calculated . according to embodiments , stopcock device 100 is configured as an accessory to other pump devices whereby sterility of the flow material is maintained , but volumes of flow material are determined in about real time accurately . for example , the present disclosure is provided as an accessory to infusion pumps . the pumps may be conventional or nonconventional pumping devices . specialized pumps may also be used , including those with two , three , or more chambers , for example as disclosed in u . s . pat . nos . 7 , 008 , 403 ; 7 , 341 , 581 ; and 7 , 374 , 556 , and u . s . utility patent application ser . nos . 11 / 744 , 819 filed may 4 , 2007 and 12 / 020 , 498 , filed jan . 25 , 2008 ( the contents of each above listed patent and patent application are incorporated by reference ). indeed , the devices of the present disclosure may be provided as accessories for pumps that are able to measure flow rate in about real time . the devices of the present disclosure are also useful as safety devices for any pump , whereby upon an error state the maximum flow material that can be delivered to a patient upon a given error state is the small volume contained in second chamber 152 at the time of the error . according to embodiments and as illustrated in fig7 , stopcock device 100 also comprises computer 810 for controlling and performing the functions disclosed herein . computer may be any computer that is capable of being configured to receive input from users 822 or pressure sensors or temperature sensors 824 . computer also calculates flow volumes and flow rates 832 , checks for and detects error states 836 , and repositions stopcock 834 , and output audiovisual content 836 . according to embodiments , the ideal gas law is used to calculate the dispensed volumes of flow material . generally , the ideal gas law is expressed as : where p is the pressure of the gas in the chamber , v is the volume of the chamber , t is the temperature of the chamber , n is the number of moles of gas , and r is the universal gas constant . according to embodiments , first chamber 110 is of known total volume , containing a volume of gas . similarly , second chamber 152 is of known total volume , containing a volume of gas . as disclosed earlier , first and second chambers 110 , 152 may not have gas according to some embodiments , but other mechanical devices such as closed cell foam having therein a known volume of gas and a known compression profile , whereby the pressure readings of first chamber 110 are useful for the purposes of calculating a volume of flow material held in first chamber 110 . the following exemplary calculations may be adapted for such embodiments without undue experimentation . according to embodiments , because the total volume of first chamber 110 is known , the volume of flow material filling first chamber 110 , as well as the volume of aliquots of flow material dispensed into second chamber 152 may be calculated . likewise , because the total volume of second chamber 152 is known , the volume of flow material dispensed out of stopcock device 100 may be calculated . the exemplary calculations illustrate an embodiment whereby the volume of flow material dispensed is calculated . assuming constant temperature , the initial pressure of first chamber 110 is known or measured using first pressure sensor 120 . additionally , the total volume of first chamber 110 ( v 1 ) and second chamber 152 ( v 2 ) are known . accordingly , an initial volume of flow material is placed in first chamber 110 , thereby increasing the pressure of first chamber 110 . the amount of flow material in first chamber 110 ( v flowmaterial ) is calculated : where the volumes here measuring the initial and final gas volume , not flow material volume . if first chamber 110 is empty , then v 1initial = v 1 . otherwise , the computer will keep track of the initial volume of first chamber 110 for each successive aliquot . according to embodiments , where closed cell foam is placed in first chamber 110 , the calculation for pressure will account for the physical characteristics imparted by compression of the foam , as well . after filling first chamber 110 with a flow material and calculating the volume of flow material that is in first chamber 110 , fill conduit 130 is sealed . flow material may then flow from first chamber 110 to second chamber 152 . according to embodiments , stopcock 150 is rotated whereby it is in its fill position , as illustrated in fig3 . the pressure within first chamber 110 causes flow material to move from first chamber 110 to second chamber 152 , according to embodiments . according to other embodiments , gravity or mechanical devices can effect flow material movement from first chamber 110 to second chamber 152 . the volume ( v aliquot ) of flow material that fills second chamber is calculated : after second chamber is charged with an aliquot of flow material , stopcock is changed from its fill position ( illustrated in fig3 ) to another position , for dispensing , pressure measurement , or closed for accurate measurement of the pressure in first chamber 110 . to determine an amount of flow material dispensed at a given point , according to embodiments , similar calculation are performed for second chamber 152 to determine the amount of flow material dispensed . the gas volume of second chamber 152 after having receiving an aliquot is first determined : when stopcock 150 is positioned in its dispense position , flow material is dispensed from stopcock 150 by virtue of the pressure within second chamber 152 , gravity , or other mechanical forces , according to embodiments . accordingly , as flow material is dispensed out of second chamber 152 , the volume dispensed is calculated . the dispensed flow material volume is determined exactly opposite of the method by which the volume filled into first chamber 110 is calculated , according to embodiments . for example : according to embodiments , stopcock 150 is alternated between its dispense position and its pressure sensing position to make pressure measurements . according to other embodiments , stopcock 150 remains in its dispense position and the pressure of second chamber 152 is periodically assayed to determine the volume of flow material dispensed . a shortened version of the equations follows , where it isn &# 39 ; t necessary to determine the gas volume in second chamber 152 . v dispensed = v 2 โข filled - v 2 โข dispensed v dispensed = v 2 โข filled - p 2 โข filled โข v 2 โข filled p 2 โข dispensed v dispensed = p 2 โข dispensed โข v 2 โข filled p 2 โข dispensed - p 2 โข filled โข v 2 โข filled p 2 โข dispensed v dispensed = v 2 โข filled โก ( p 2 โข dispensed - p 2 โข filled ) p 2 โข dispensed v dispensed = v 2 โข filled p 2 โข dispensed โข ฮด โข โข p 2 v dispensed = v 2 - v aliqout p 2 โข dispensed โข ฮด โข โข p 2 . according to embodiments , temperature sensors may be disposed in substantially the same locations as each pressure sensor to improve the accuracy of the calculations . the application of temperature into the exemplary calculation shown below are will within the skill and understanding of a person of ordinary skill in the art . according to embodiments , the above equations are adaptable to a single pressure sensor 122 in second chamber 152 . such a configuration is possible when knowing the initial volume in first chamber 110 is not necessary or desirable , or when the volume of first chamber 110 is known , for example when the device disclosed herein is a disposable . according , only the volume of each aliquot of flow material is calculated by measuring the pressure differentials in the second chamber 152 . for example , the volume of each aliquot ( p 2filled ) may be calculated independent of any calculations related to first chamber 110 : knowing the p 2filled value allows for the calculation of the dispensed volume as disclosed above . according to embodiments , because stopcock 150 eliminates direct fluid communication between the pump and the target of the flow material , it provides a safety mechanism for the pump . if a malfunction of the pump or stopcock device 100 occurs , the maximum unintended amount of flow material that can possibly be dispensed to the target is the small aliquot in second chamber 152 . in certain applications , for example in the delivery of insulin , these types of safety mechanisms are important for preventing unintended delivery of insulin due to malfunction . while the apparatus and method have been described in terms of what are presently considered to be the most practical and preferred embodiments , it is to be understood that the disclosure need not be limited to the disclosed embodiments . it is intended to cover various modifications and similar arrangements included within the spirit and scope of the claims , the scope of which should be accorded the broadest interpretation so as to encompass all such modifications and similar structures . the present disclosure includes any and all embodiments of the following claims .
| 0 |
the apparatus of fig1 comprises a frame 1 , a vacuum turbine 2 , a drive motor and reduction gear assembly 3 , a first drive shaft 4 , a second drive shaft 5 , a clutch 6 , a third drive shaft 7 , a left side brush 11 , a bevel gear 9 , a toe brush 10 , a bevel gear 8 , a left sole brush 12 , a left instep brush 13 , a right sole brush 14 , a right instep brush 15 , a right side brush 16 , a train of gears 17 which receive power from shaft 7 and drive all the sole and side brushes , a bevel gear 19 , a heel brush 21 , a drive shaft 20 , and a bevel gear 18 which engages the bevel gear 19 to drive the heel brush 21 through the drive shaft 20 . in the operation of the system shown in fig1 the drive motor 3 is directly connected to the vacuum turbine 2 by means of shaft 4 . the direct connection to the motor without an intervening reduction gear operates at a speed that is sufficiently high to directly drive the vacuum turbine and produce a suction . the suction is applied through ducts , not shown , in the lower portion of the system , to draw the dust produced by the cleaning operation downward into a collection tray 22 located beneath the brushes as shown in fig2 and 3 . within the motor and reduction gear assembly is a reduction gear train and right angle drive that actuates shaft 5 at a lower speed than is obtained from the direct drive connection of shaft 4 used to power the vacuum turbine . power from the shaft 5 is applied to all brushes by way of clutch 6 , which is designed to slip in the event the brushes are jammed . shaft 7 is the drive shaft for the left side - brush 11 . this shaft also supports the bevel gear 9 . bevel gear 9 drives the bevel gear 8 which in turn drives toe brush 10 . shaft 7 continues through the brush 11 where it powers gear train 17 and bevel gear 18 . bevel gear 18 drives heel brush 21 by way of the bevel gear 19 and the shaft 20 . the gear train 17 comprises a gear on shaft 7 which drives in turn a first idler gear , a gear on the shaft of the left sole brush , second and third idler gears , a gear on the shaft of the right sole brush 14 , a fourth idler gear and finally a gear on the shaft of the right sole brush 16 . as a result of this arrangement of gears , all the side and sole brushes are driven in the direction shown by the direction arrows in fig1 . the upper surfaces of the left and right sole brushes turn towards the center of the apparatus and the heel and toe brushes also turn towards the center of the apparatus . to clean the lower portions of the shoe , the shoe is placed into the center of the apparatus with the rear of the heel touching the heel brush and the tip of the toe touching toe brush . the left and right instep brushes clean the instep area while the sole brushes clean the soles . the left and right side brushes clean the ledge of the sole at the connection to the vamp , while the toe and heel brushes accomplish the same task in their respective regions of the shoe . shoes smaller than the length of the sole brushes may be cleaned by the apparatus of fig1 by moving the shoe forward and back to contact the toe and heel brush and from side to side to contact the side brushes . an alternate method of accommodating various size shoes , not shown in the drawings , is to alternately drive each set of brushes against the shoe . for example , side brushes 11 and 17 are moved towards the center of the apparatus until they contact the shoe . these brushes remain in contact with the shoe for a predetermined time and then are withdrawn . the toe and heel brush are then drawn toward the shoe in the same manner and are also withdrawn after a predetermined period . the mechanism to drive this system is similar to that of fig1 with the exception that instead of direct gear drive to the brushes , belt and pullies are applied to permit the rollers to move and the brushes are slideably mounted to the frame . the slideable mounting is achieved by mounting the brush bearings in slotted portions of the frame which are designed to guide the brushes over a path to the shoe and back to a rest position away from the shoes . spring bias is applied to the brushes to keep the brushes at the rest position until they are to be applied to the shoe . the brush sets are advanced toward the shoe by means of a cam coupled to the brushes by way of a spring linkage . the spring linkage prevents the brushes from advancing beyond the part of the shoe first contacted by a brush . returning now to the configuration shown in fig1 and 2 , it should be noted that although a single sole brush may be used , a pair of counterrotating brushes , such as brushes 12 and 14 , provide several advantages . this can be understood by first noting that a support plate 24 , shown in fig2 is used as a support for the shoe in the areas where there are no sole brushes . the direction of rotation of the pair of sole brushes tend to move the shoe towards the center of the apparatus and away from the side brushes , thereby preventing the shoe from becoming jammed between the side brush and the support plate . the use of two or more sole brushes permits lowering the profile of the equipment . to cover the relative wide area of the sole of the shoe with a single brush would require a large diameter brush . such a brush requires a relatively high profile apparatus to accommodate its large diameter and the high profile would be generally unsatisfactory from an aesthetic point of view . it is easier to clean shoes with two or more sole brushes . the larger diameter brush would be more difficult to use because its larger size would result in a relatively high protrusion of the brush above the support plate . if the shoe were forced to the side by the brush rotation , the shoe may be twisted appreciably before it touched the support plate . the drop from top of the brush to the support plate for the smaller diameter brushes is considerably less than that of a single large diameter brush and therefore the smaller brushes provide a safety advantage . fig2 is a cross sectional end view of the system shown in fig1 and comprises the frame 1 , a dust shield 55 , and a removable collection tray 22 located in the lower portion apparatus . the sole brushes are shown located in the lower portion of the equipment . the left and right side brushes are located adjacent to the sole brushes in the upper portion of the equipment . a portion of the dust shield 23 extends over the side brushes to expose only one edge of the brushes . in a similar manner , the supporting plate , which contains a number of openings to permit the debris from the shoes to fall through , also contains two larger openings corresponding to and aligned with the sole brushes to expose the upper portion of these brushes , while protecting the shoe from the gears and other drive mechanisms located below the plate . a comb 25 comprised of two rectangular bars or a single &# 34 ; v &# 34 ; shaped bar is oriented to extend a longitudinal edge of each bar into the sole brushes to dislodge accumulated debris from the brushes . the combs are located with respect to the brushes at a position which causes the debris on the brush to be sprayed into the collection tray . although not shown , similar combs are installed in each brush in appropriate position to direct the spray of debris away from the shoe and preferably downward towards the collection tray comb bars 60 and 61 for brushes 11 and 16 are typical examples . fig3 shows a side cross sectional view of the system of fig1 with a shoe placed on the sole brush . in this figure , the way in which the toe the heel brushes clean and shoe can be seen . the instep brush is designed to remove the debris collecting in front of the heel . the instep brush may be a separate brush or a raised portion of the brushing surface on the sole brush . fig4 shows a plan view of an alternate arrangement for the side brushes . rather than a single side brush for each side of the shoe , a plurality of small vertical brushes is used . the advantage of this arrangement is that the vertical brushes are better able to enter the crevice between the sole and vamp . the drive mechanism for this arrangement comprises a cam 31 , a linking member 32 , a rack 35 , and a series of pinion gears 36 connected to the shaft of each of the vertical brushes , such as brushes 33 and 34 . the rack and pinion drive is designed to cause the brushes to make at least a complete revolution for each revolution of cam 31 . in this way , the brushes are scraped against their respective combs over their complete periphery so that the brushes are completely cleaned during each revolution . fig5 is a side cross sectional view of the alternate side brush arrangement shown in fig4 . fig6 is an alternate arrangement of the sole brush . this arrangement comprises a drive motor 4 , an alternate form of toe brush 43 and heel brush 48 produced by extending a portion of the sole brush above the level of the main section , an alternate arrangement for the instep brush 46 , wherein a taper is employed to conform to the contour of the shoe between the heel and sole , and a vacuum turbine , all coupled to a single drive shaft 42 . the alternate arrangement shown in fig6 represents a low cost version of the invention . cost savings are made possible by mounting all the components on a single shaft to eliminate all the gears and many of the bearings required in the embodiment of fig1 and by using a single brush to replace all the brushes in the previously described systems . the cleaning of the side of the shoe is achieved by pressing the side to be cleaned into the brush . for the purposes of safety , the brush may be run at a low speed from a reduction train within the motor housing , while the vacuum turbine may be driven directly at higher speed from the motor shaft as was done in the system of fig1 . to automatically actuate all variations of the invention , a light source 53 located beneath the dust shield as shown in fig3 is directed at a light receiver 54 . whenever the light beam between the light source and light detector is broken , such as occurs when a shoe is placed through the port 50 in the dust cover , outlined by the dashed line in fig1 the equipment is actuated . located outside the equipment is a manual switch indicated by drawing numeral 52 , on fig3 . as a safety feature , this switch can be used to shut off the equipment manually thereby overriding the automatic system . although not shown , combination of known additional apparatus with the invention is contemplated as being within the spirit of this invention , such as combining with the present invention additional brushes to clean and polish the upper portion of the shoe at the same time or immediately after the cleaning of the lower portion .
| 0 |
reference will now be made in detail to embodiments , examples of which are illustrated in the accompanying drawings . in the following detailed description , numerous specific details are set forth in order to provide a thorough understanding of the present invention . however , it will be apparent to one of ordinary skill in the art that the present invention may be practiced without these specific details . in other instances , well - known methods , procedures , components , circuits , and networks have not been described in detail so as not to unnecessarily obscure aspects of the embodiments . it will also be understood that , although the terms first , second , etc ., may be used herein to describe various elements , these elements should not be limited by these terms . these terms are only used to distinguish one element from another . for example , a first gesture could be termed a second gesture , and , similarly , a second gesture could be termed a first gesture , without departing from the scope of the present invention . the terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used in the description of the invention and the appended claims , the singular forms โ a ,โ โ an โ and โ the โ are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will also be understood that the term โ and / or โ as used herein refers to and encompasses any and all possible combinations of one or more of the associated listed items . it will be further understood that the terms โ comprises โ and / or โ comprising ,โ when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . embodiments of the system and method of customer detection are described . for purposes of explanation , the โ computer system โ means a computer system that has the means to utilize some embodiments of the present invention , for example , personal computer with windows , mac or linux ; portable multifunction device , such as cellphone , smartphone , pda , tablet pc ; laptop . fig1 illustrates the method for customer detection according to some embodiments of the present invention . the method 101 comprises the following steps : creating , on a first computer system , one or more filters 102 . the first computer system can be represented by a desktop computer , laptop , tablet pc , portable multifunction device , cellphone , smartphone , music player , gps navigator . for purposes of explanation , the term โ filter โ means an array of one or more objects . in some embodiments of the present invention , the term โ geographical filter โ will be used . in some embodiments of the present invention , the term โ geographical filter โ means an array of one or more geographical objects . in some embodiments of the present invention , the geographical filter comprises one or more areas . in some embodiments of the present invention , the area can be set by absolute coordinates . in some embodiments , the area can be set using gps coordinates or a like system , for example , glonass . in some embodiments of the present invention , the area can be set using relative coordinates . in some embodiments of the present invention , the area can be set by a user of the one or more computer systems with one or more programs launched . in some embodiments of the present invention , the one or more programs comprise a graphical user interface with a map where a user of the one or more computer systems can select one or more areas and add it to the filter . in some embodiments of the present invention , the one or more programs comprise means for input coordinates of the area , or title of the place , or address of the area or company name . in some embodiments of the present invention , the filter comprises a set of one or more geographical objects . in some embodiments of the present invention , the filter comprises a set of one or more geographical objects along with a parameter that indicates a radius . this parameter might be applied to part or all geographical objects in the set and used for covering an area around the geographical object ; application of the one or more filters 103 to the one or more objects . in some embodiments of the present invention , one or more filters can be applied to one object . in some embodiments of the present invention , one filter can be applied to one or more objects . in some embodiments of the present invention , the object can be represented in the form of a promo - campaign . for purposes of explanation , the term โ promo - campaign โ means an offer for one or more goods and / or services promotion . typically , a promo - campaign comprises information about sale conditions , discounts and geographical location of the place where the potential customer can purchase one or more goods and / or services . however , the present invention is not limited to typically used promo - campaigns and can be used with any possible promo - campaign . in some embodiments of the present invention , the object can be represented in the form of an offer . for purposes of explanation , the term โ offer โ means information about one or more goods and / or services and purchasing conditions . in some embodiments of the present invention , the object can be represented in the form of one or more links . in some embodiments of the present invention , the link comprises an address to the one or more websites . in some embodiments of the present invention , the link comprises one or more e - mail addresses . in some embodiments of the present invention , the link comprises an itunes ยฎ address to the one or more software applications , or games , or pass - cards , or coupons . in some embodiments of the present invention , the link comprises a google play ยฎ address to the one or more software applications , or games , or coupons ; one or more objects , having one or more filters , distribution 104 . in some embodiments of the present invention , both the one or more objects with the one or more filters that were applied on the previous step , and one or more objects with one or more filters that were applied at the moment of part or whole object creation , are subject for the distribution . in some embodiments of the present invention , only one or more objects with the one or more filters that were assigned on the previous step will be distributed . in some embodiments of the present invention , in case of error in distribution , the one or more objects with the one or more filters will not be distributed . in some embodiments of the present invention , in case only part of the filters raise one or more errors , the one or more objects having one or more filters applied , including those that raise an error in the distribution process , will be distributed only to those objects that don &# 39 ; t raise one or more errors . additionally , in some embodiments of the present invention , in case one or more objects from the one or more filters raise one or more errors in the distribution process , the one or more objects having one or more filters applied , including those that comprise one or more objects that raise one or more errors in the delivery process , will be distributed in accordance with the filter with the exception of those objects in the filter that raise one or more errors in the distribution process . in some embodiments of the present invention , the one or more errors raised in the distribution and / or creating process , which have an informative nature , for example , an error that notifies that there are one or more potential vulnerabilities and , therefore , don &# 39 ; t affect the creation and / or distribution process . this means that one or more objects with one or more filters that raise one or more above - mentioned errors with informative nature , will be delivered and / or distributed with accordance to the one or more elements from the one or more filters as it will be delivered and / or distributed in case of no error with informative nature raised while in the distribution and / or creation process . according to the present invention , the object can be represented by one or a combination of the following elements : promo - campaign ; advertisement ; image ; text ; sound record ; video record ; sms ; ems ; mms ; web page ; script ; personal information ; public information ; payment information ; coupon ; credit card information ; news ; private information ; book ; magazine ; journal ; weather ; protocol ; request ; cad drawing ; contract ; legal document ; hotel check - in and / or check - out information ; taxi order ; order ; bill ; government form ; beauty shop information ; beauty shop request ; beauty shop order . distribution and / or delivery of the one or more objects can be implemented immediately and / or after a period of time that has been set preliminarily by one or more users manually and / or automatically or by one or more computer systems automatically . in some embodiments of the present invention , one part of the objects can be distributed immediately after filter application , another part after the period of time that was set preliminarily . fig2 illustrates the system that implements the method shown in fig1 , according to some embodiments of the present invention . the computer system 201 comprises at least one or more processors 202 and one or more devices for storing data 203 . the one or more devices for storing data 203 comprise at least one or more programs 204 , which can be executed by the one or more processors 202 . the one or more programs 204 comprise instructions for : creation of one or more filters ; application of the one or more filters to one or more objects ; distribution of the one or more objects in accordance with the filters . fig3 illustrates the graphical user interface of promo - campaign creation according to some embodiments of the present invention . in this exemplary embodiment , the object is represented by a promo - campaign . the filter is represented by a geographical coordinate of the point of sale location and by a radius parameter , which defines an area ( in this exemplary embodiment โ a circle ) around the geographical coordinate of the point of sale location . the graphical user interface ( gui ) 301 comprises the following elements : the brand name of the company and / or software application 302 which implements the present invention . in this exemplary embodiment , the brand name of the software application is โ askedon food .โ in some embodiments , the gui 301 does not comprise the element 302 . in some embodiments of the present invention , the element 302 comprises one or combination of the following elements : text , image , sound record , video record , link . the title of the operation 303 . in this exemplary embodiment of the present invention , the gui 301 is used to create a new promo - campaign for a food restaurant and / or coffee shop . this is why the element 303 has the title : โ promo - campaign creation .โ in some embodiments , the gui 301 does not comprise the element 303 . in some embodiments of the present invention , the element 303 comprises one or more combinations of the following elements : text , image , sound record , video record , link . the title of the promo - campaign 304 . in this exemplary embodiment , the title comprises only text . in some embodiments of the present invention , the title comprises text , images , sound and video record ; the short description of the promo - campaign 305 . in this exemplary embodiment , the short description is limited to 140 characters . in some embodiments of the present invention , the short description does not have any size limitation . in some embodiments of the present invention , the short description 305 comprises one or combination of the following elements : text , graphical image , sound record , video record , link , web link , link to itunes ยฎ store ; the description 306 . in this exemplary embodiment , the element 306 is similar to element 305 with the exception of character limitation โ there is no limitation in size ( amount of characters ) of the element 306 . however , in some embodiments of the present invention , the gui 301 does not comprise the field 306 at all as the present invention can reach the declared technical result without the element 306 ; the means for choosing the geographical location 307 . in this exemplary embodiment , the element 307 is represented by a map ( for example , google ยฎ map ), where one or more users of the computer system on which gui 301 is running can find the exact location of the point of sale and mark it . marking ( or choosing ) of the geographical location using element 307 means getting the geographical coordinates for the chosen place on the map . in some embodiments of the present invention , the means for choosing the geographical location is represented by not only the map of the city and / or other outside area , but also by an inside map . in terms of the present invention , the โ inside map โ means a map of the interior of the building . for example , the inside map of the shopping mall shows the location of shops and allows the user to make a route from one place to another . in some embodiments of the present invention , the user of the computer system on which the gui 301 is running can choose two or more points of sale location where the promo - campaign will be distributed and available . in some embodiments of the present invention , each chosen geographical location of the point of sale has an individual radius parameter . for example , a point of sale on a street normally has a one mile radius around it . this means that the promo - campaign is only visible for people who are physically located in this designated area . if the point of sale is located in a mall , then typically the radius parameter is reduced to 0 . 1 - 0 . 2 miles , because of the large number of messages that can be delivered to potential customers located within the designated area ; the means for choosing responsible person ( s ) 308 . in this exemplary embodiment , the responsible persons are chosen from the list of preliminarily invited one or more persons . in some embodiments , the one or more preliminarily invited persons are employees of the company who have access to the application and / or service . in some embodiments , the one or more software applications and / or services comprise a list of one or more persons who are not employees of the company , who have access to the application and / or service . typically , such persons are called โ freelancers .โ the button 309 is used to add additional responsible persons for the promo - campaign management and processing . in some embodiments , the gui 301 comprises means for responsible persons ( managers ) management , which functionality comprises , but is not limited to : deleting a manager from the promo - campaign , adding a person to the promo - campaign , editing information about a person , assigning working time , activity management ; the means for choosing and / or assigning the one or more images that will be associated with the promo - campaign . in this exemplary embodiment , these means are represented by text field 310 and button 311 , which is used for choosing the one or more images from the computer system . in some embodiments , the gui 301 comprises the means for choosing and / or assigning the one or more video records . in some embodiments of the present invention , the gui comprises the means for downloading and / or choosing the image from one or more remote computer systems and / or cloud services ( for example , amazon ยฎ web services ). in this exemplary embodiment , the gui 301 comprises means for previewing the one or more chosen and / or assigned images 312 . in some embodiments , the promo - campaign comprises one gui . in this situation , the one or more chosen and / or assigned images will be placed to the gui . if user of the gui 301 chooses more than one image , then the computer system which shows the promo - campaign to the potential customer will have the means for scrolling the images and / or means for randomly selecting the chosen and / or assigned images , and / or means for changing images periodically ( for example , every five seconds ). in some embodiments , the one or more images comprise one or more additional elements . in some embodiments , the one or more additional elements are used to get more information about the promo - campaign and / or company that created it . in some embodiments , the one or more additional elements are used for advertisement and / or marketing purposes ( for example , location of the point of sale , feedback from customers of the company that created the promo - campaign ); the means for setting a time period of promo - campaign availability . in this exemplary embodiment , the means for setting a time period of promo - campaign availability is represented by the following elements : 313 , 314 , 315 , 316 . it should be noted that elements 313 , 314 , 315 , 316 are only one example of the means for setting a time period of promo - campaign availability representation and the present invention should not be limited to only the above - mentioned representation . the elements 315 and 316 are used for correspondingly increasing and decreasing the amount of time of promo - campaign availability . typically , elements 315 and 316 are buttons , but in some embodiments of the present invention , elements 315 and 316 can be represented by other elements . in some embodiments , the gui 301 does not comprise elements 315 and 316 ; and elements 313 , 314 are editable . in order to set the time period of promo - campaign availability , the one or more users of the gui 301 enter information into the fields 313 and 314 directly . in this exemplary embodiment , the gui 301 comprises only fields for hours ( 313 ) and minutes ( 314 ). in some embodiments , the gui 301 comprises one editable field where the user of the gui 301 can type in the amount of hours of the promo - campaign availability . in this exemplary embodiment , the promo - campaign will become available right after clicking on the button 322 . however , in some embodiments of the present invention , the gui 301 comprises means for setting the date and / or time of promo - campaign start along with duration of promo - campaign availability . for purposes of explanation , the term โ duration of promo - campaign availability โ means the time period which begins from the start date when the potential customer can see the promo - campaign , interact with it , use it and purchase one or more goods and / or services mentioned in the promo - campaign ; the term โ active time of the promo - campaign โ means the time period which in some embodiments is longer than the duration of promo - campaign , where the potential customer and / or customer can redeem a coupon in the company that created the promo - campaign and in which the potential customer and / or customer participated , and / or read conditions of the promo - campaign and / or purchasing and / or redeeming of the coupon and / or code generated by the one or more programs . the means for area designation . in this exemplary embodiment , the means for area designation is represented by elements 317 , 318 , 319 . for purposes of explanation , โ the area of designation โ or โ designated area โ or โ chosen are โ means the one or more geographical areas where the one or more promo - campaigns are available . it should be noted that in some embodiments of the present invention , the promo - campaign will not be visible for users of computer systems that are located outside the chosen area . in some embodiments of the present invention , the user of the computer system specifies one or more geographical locations where he wants to get information about advertisement and / or promo - campaign and / or events and / or special events . by clicking on the buttons 318 or 319 , the user of the computer system that shows the gui 301 changes the radius of the designated area for the promo - campaign . for purposes of explanation , the term โ promo - campaign โ means a promo - campaign and / or an event and / or a special event and / or an advertisement . in some embodiments of the present invention , the user can choose the exact area where the promo - campaign should be available by clicking on the map and drawing the area on it . in some embodiments , the means for area designation is represented by one or more text fields . by using the above - mentioned one or more text fields , the user of the computer system that shows the gui 301 inputs the coordinates of places where the promo - campaign will be available . the availability of the promo - campaign , in terms of the present invention , means that one or more users with one or more computer systems that are geographically located within the designated area for the promo - campaign , will be able to see and / or review and / or send one or more messages and / or purchase one or more goods and / or services mentioned in the promo - campaign . if there are no computer systems within the designated area , then nobody will see it . however , in some embodiments of the present invention , the one or more users of the one or more computer systems can set the location where one or more users want to see and / or review and / or send a message and / or purchase one or more goods and / or services mentioned in the promo - campaign . but when the one or more users with one or more computer systems enter the designated area , they will immediately be able to see and / or review and / or send a message and / or purchase one or more goods and / or services mentioned in the promo - campaign . accordingly , when one or more users leave the area designated for the promo - campaign , the promo - campaign will disappear from the one or more computer systems of one or more users who left the designated area for promo - campaign , unless the one or more have already begun browsing and / or reviewing the promo - campaign , chatting with the promo - campaign &# 39 ; s one or more representative persons and / or purchasing goods and / or services mentioned in the promo - campaign ; the management buttons . in this exemplary embodiment , the management buttons are represented by buttons 320 , 321 and 322 . in terms of the present invention , the โ management button โ represents means for changing the status of the one or more promo - campaigns , for example , changing the status from โ draft โ to โ work ,โ which , in this exemplary embodiment , can be made by clicking on the button 322 โ create & amp ; distribute .โ additionally , in this exemplary embodiment , the user can change the status of the promo - campaign from โ draft โ to โ new , not distributed โ by clicking on the button 321 . it should be noted that the titles of all statuses are used only for explanation purposes . the button 320 , in this exemplary embodiment , is used for cancelling the operation of the promo - campaign creation . the button 321 , in this exemplary embodiment , is used to change the status of the promo - campaign from โ draft โ to โ created .โ it should be mentioned that before the gui 301 appears , the one or more users of the one or more computer systems sent a command to the one or more computer systems for one or more promo - campaign creation , for example , by clicking on the button โ create a new promo - campaign โ ( not shown on fig3 ) or by touching a touch - sensitive display . it should be mentioned that the present invention should not be limited to the methods of sending one or more commands for the one or more promo - campaign creations mentioned above . fig4 illustrates one of the embodiments of the present invention . fig4 comprises a part of the map of the city . the element 402 represents the point of sale of the company whose one or more employees have successfully created and distributed the promo - campaign for point of sale 402 promotion and / or goods and / or services that can be purchased at the point of sale 402 promotion . the circle 403 represents the area of designation . the one or more users with one or more means for promo - campaign receiving , viewing and interaction , for example computer systems , within the area marked by the circle 403 , will be able to receive and participate in the promo - campaign . in this exemplary embodiment , the following persons will be able to receive , view details of the promo - campaign , send one or more messages to the person responsible for the promo - campaign and / or participate in the promo - campaign and / or purchase one or more goods and / or services mentioned in the promo - campaign and / or promoted by a promo - campaign representative and / or one or more other persons who have the ability and rights to offer goods and / or services to the potential customers and / or customers : 408 , 405 , 404 and person in car 410 . in this exemplary embodiment , the following persons will not be able to receive , view details of the promo - campaign , send one or more messages to the person responsible for the promo - campaign and / or participate in the promo - campaign and / or purchase one or more goods and / or services mentioned in the promo - campaign and / or promoted by a promo - campaign representative and / or one or more other persons who have the ability and rights to offer goods and / or services to the potential customers and / or customers : 407 , 406 , persons in car 409 , 412 , unless : the above - mentioned persons were located within the area designated by circle 403 in the previous moments in time when the promo - campaign was available for all users with one or more computer systems located within the area designated by circle 403 ; and the users 406 , 407 , 409 and 412 opened the promo - campaign and / or sent one or more messages to the one or more persons responsible for the promo - campaign and / or purchased one or more goods and / or services mentioned in the promo - campaign and / or promoted by a promo - campaign representative and / or one or more other persons who have the ability and rights to offer goods and / or services to the potential customers and / or customers . in some embodiments of the present invention , the radius 411 of the circle 403 which designates the area where one or more promo - campaigns will be available , can be changed by the one or more persons who create a new promo - campaign . additionally , in some embodiments of the present invention , the radius 411 of the circle 403 which designates the area where one or more promo - campaigns will be available , can be changed by the one or more persons who have rights to do so , on - the - fly , i . e ., when one or more promo - campaigns are available . it can be done in the following situations : 1 the radius 411 of the circle 403 is very small for the particular one or more promo - campaigns which are available within part or all of the designated area . for purposes of explanation , the term โ small designated area โ or โ small radius of circle โ means the area where a small amount of potential customers and / or customers are be able to review and / or send one or more messages to the one or more promo - campaign representative and / or one or more other persons who have the ability and rights to offer goods and / or services to the potential customers and / or customers and act of behalf of one or more organizations and / or companies to which the one or more point of sale belongs and / or which have rented the one or more points of sale mentioned in the promo - campaign . โ small amount of customers โ is a very specific term and it is determined in each case individually . it should be noted that the present invention should not be limited to the specific numbers of the terms โ small amount of customers โ and / or โ small area โ and / or โ small radius of circle .โ in this exemplary embodiment , it is presumed that one or more organizations and / or companies to which the one or more points of sale belong and / or which have rented the one or more points of sale mentioned in the promo - campaign already determined in percents and / or numbers corresponding to and / or describing the โ small amount of customers โ and / or โ small radius of circle โ and / or โ small area โ and the current numbers and / or percents are equal or smaller preliminarily determined amounts and / or percents . for example , the above - mentioned situation can appear when the manager of the one or more points of sale is not satisfied with the amount of people who opened and / or purchased the goods and / or services mentioned in the promo - campaign . so , in this case , the area can be increased by increasing the radius parameter . in this exemplary embodiment , the area can be increased by one or combination of the following ways : a manually by one or more users of the one or more computer systems and / or one or more remote computer systems which have the means for changing promo - campaign parameters directly or indirectly , by changing one or more parameters responsible directly and / or indirectly for the area size of the one or more promo - campaigns ; b automatically by one or more computer systems and / or one or more remote computer systems which have the means for changing promo - campaign parameters directly or indirectly , for example , by comparing preliminarily defined one or more parameters , which indicate and / or define โ small amount of customers โ with current parameters of the available promo - campaign . 2 the radius 411 of the circle 403 is very big for the particular one or more promo - campaigns which are available within part or all designated area . for purposes of explanation , the term โ big designated area โ or โ big radius of circle โ means the area where a large amount of potential customers and / or customers will be able to review and / or send one or more messages to the one or more promo - campaign representatives and / or one or more other persons who have the ability and rights to offer goods and / or services to the potential customers and / or customers and act on behalf of one or more organizations and / or companies to which the one or more point of sale belongs and / or which have rented the one or more point of sale mentioned in the promo - campaign . โ large amount of customers โ is a very specific term and it is determined in each case individually . it should be noted that the present invention should not be limited to the specific numbers of the terms โ big amount of customers โ and / or โ big area โ and / or โ big radius of circle .โ in this exemplary embodiment , it is presumed that one or more organizations and / or companies to which the one or more points of sale belongs and / or which have rented the one or more points of sale mentioned in the promo - campaign already determined in percents and / or numbers corresponding to and / or describing the term โ big amount of customers โ and / or โ big radius of circle โ and / or โ big area โ and the current numbers and / or percents are equal to or bigger than preliminarily determined amounts and / or percents , corresponding to and / or describing one or more parameters and / or terms which affect directly and / or indirectly the characteristics determined by the one or more above - mentioned terms . for example , the above - mentioned situation can arise when the amount of people who opened and / or purchased the goods and / or services mentioned in the promo - campaign is very big and one or more points of sale are not able to service all customers who want to purchase one or more goods and / or services sold by the company which created the one or more promo - campaigns or sent a request to third party one or more companies to create one or more promo - campaigns . so , in this case , the area can be decreased by decreasing the radius parameter . in this exemplary embodiment , the area can be decreased by one or a combination of the following : a manually by one or more users of the one or more computer systems and / or one or more remote computer systems which have the means for changing promo - campaign parameters directly or indirectly by changing one or more parameters that are responsible directly and / or indirectly for the area size of the one or more promo - campaigns ; b automatically by one or more computer systems and / or one or more remote computer systems which have the means for changing promo - campaign parameters directly or indirectly , for example , by comparing preliminarily defined one or more parameters which indicate and / or define โ big amount of customers โ with current parameters , responsible directly and / or indirectly for the area size of the available promo - campaign . in this exemplary embodiment , the present invention works in the following way : the one or more employees of the point of sale 402 and / or one or more persons who have rights to create one or more promo - campaigns for point of sale 402 ( for purposes of explanation , such persons will be called โ creating person โ), create one or more promo - campaigns for the point of sale 402 and set the radius 411 with the center in the point of sale 402 , where the one or more promo - campaigns have been planned to be available . optionally , the one or more creating persons can set the time period and the date when the one or more new promo - campaigns will be available . after all the promo - campaign parameters are set , for example , those that are displayed in the gui 301 , the one or more creating persons submit the promo - campaign . if date and time were explicitly set , then the newly created promo - campaign will remain idle until the date and time which were explicitly set during the promo - campaign creation . if date and time were not explicitly set , then the newly created promo - campaign will be published and / or distributed immediately . when one or more persons enter the designated area ( in this exemplary embodiment , the designated area is circle with radius 411 and center in the point of sale 402 ), while the promo - campaign is available and request one or more promo - campaigns , then such persons will be able to see , review , ask one or more questions ( for example , by using an invention described in the u . s . patent application ser . no . 13 / 689 , 763 filed nov . 30 , 2012 , entitled โ system and method of interaction ,โ first named inventor : โ mikhail leonidovich liubachev โ), purchase one or more goods and / or services ( for example , by using an invention described in the u . s . patent application ser . no . 13 / 680 , 123 filed nov . 19 , 2012 entitled โ system and method for goods and services promotion โ, first named inventor : โ mikhail leonidovich liubachev โ), mentioned in the promo - campaign and / or promoted by one or more salespersons of the point of sale 402 and / or other goods and / or services related to the one or more companies which create the one or more promo - campaigns . if , while interacting with one or more promo - campaigns , the one or more users with one or more means for interacting with one or more promo - campaigns leave the designated area , the promo - campaign will be available for one or more users until the one or more users close one or more promo - campaigns . after closing one or more promo - campaigns ( in some embodiments of the present invention , closing one or more promo - campaigns is made in the form of โ back โ button ), the one or more users with one or more means for interacting with one or more promo - campaigns will be able to see and / or interact with those one or more promo - campaigns which are available at the geographical location of the one or more users with one or more means for interacting with one or more promo - campaigns . if one or more users purchased one or more goods and / or services mentioned in the promo - campaign and / or promoted by one or more salespersons of the point of sale 402 and / or other goods and / or services related to the one or more companies which created the one or more promo - campaigns , the information about purchase is saved to the one or more storage of the one or more computer systems which have the means to interact with one or more computer systems of the one or more companies which created and / or used the one or more promo - campaigns . in some embodiments of the present invention , the information about purchase is saved to the one or more computer systems on which the purchase and / or request for purchase was made . in some embodiments of the present invention , the information about purchase comprises one or a combination of the following elements : identification of the one or more computer systems from which the purchase was made ; identification of the one or more users of the one or more computer systems ; terms of the purchase ; conditions of the purchase ; list of the purchased goods and / or services ; categories of the purchased goods and / or services ; geographical location from which the purchase was made ; one or more geographical locations , indicating the path of the one or more users &# 39 ; movement during interaction with one or more promo - campaigns ; one or more actions which were made by the one or more users during the interaction with one or more promo - campaigns ; one or more actions which were made by the one or more representatives of the one or more companies during communication with one or more users ; information about previous purchases of the one or more users ; information about bonus points and / or money balance ; information about one or more friends of the one or more users ; information about one or more friends of the friends of the one or more users . fig5 illustrates the description of the promo - campaign according to some embodiments of the present invention . according to some embodiments of the present invention , the gui 501 comprises the following elements : the title of the company 502 which sells the products mentioned in the promo - campaign ; the image 503 associated with the promo - campaign ; the brief description 504 of the promo - campaign ; block of interaction 518 , which is used for interaction between a company representative or salesperson with the potential customer . the block of interaction comprises the following elements : the company representative or salesperson &# 39 ; s full name and company name 505 ; time stamp ( date and time ) 506 of message delivery ; the message 507 from the company representative or salesperson . in this exemplary embodiment , the message 507 comprises additional promotion of goods and / or services which company 502 sells to customers ; time stamp 508 of reply delivery prepared by the user of the computer system on which the gui 501 is running ; the reply 509 , prepared by the user of the computer system , on which the gui 501 is running . in some embodiments of the present invention , the one or more replies are prepared by one or more persons who have the means to establish a network connection to one or more computer systems which have one or more programs executed on one or more processors and stored in the one or more devices for storing data , with instructions and / or commands for sending a reply to one or more computer systems which have the means for receiving replies from one or more computer systems and to which one or more potential and / or existing customers have an access ; the order confirmation section 519 , which , in this exemplary embodiment , comprises the following elements : the full name of the sales manager and company title 510 . it should be noted that in some embodiments of the present invention , the element 510 comprises one or more full names of the sales managers . in some embodiments of the present invention , the element 510 comprises one or more full names of the persons who are responsible for communication with customers and potential customers , and one or more companies &# 39 ; identification information ; the information about date and / or time of the message delivery 511 . in this exemplary embodiment , the element 511 comprises the date and time when one or more messages were received at one or more computer systems which show the gui 501 . in some embodiments of the present invention , the element 511 comprises only time of the delivery ; the title of the receipt 512 ; the list of purchased goods and / or services 520 which comprises the product 513 and product 514 . in some embodiments of the present invention , the list of purchased goods and / or services comprises one or more goods and / or services . in some embodiments of the present invention , the list of the goods and / or services comprises one or a combination of the following elements : title of the goods and / or services , amount of goods and / or services , price of the one item of goods and / or one service , total price of all goods and / or services as stated in the list 520 , information about taxes , discount rate of each product , total discount rate of goods and / or services as stated in the list 520 , contact information of the one or more company representative , means for payment , means for receiving information about payment , means for adding additional goods and / or services , means for editing the contents of the list 520 ; the means for one or more orders confirmation . in this exemplary embodiment , the means for one or more orders confirmation is represented by the button โ approve โ 516 . in some embodiments of the present invention , the means for order confirmation is represented by one or more graphical elements which are used for payment for the order ; the means for one or more orders termination . in this exemplary embodiment , the means for one or more orders termination is represented by button โ decline โ 517 . in some embodiments of the present invention , the one or more orders are terminated after some period of time , for example , 5 minutes , started from one or more orders delivery to the one or more users . in some embodiments of the present invention , the user will be hidden to the one or more promo - campaign representatives until the reply 509 is sent . in some embodiments of the present invention , in order to avoid spam , the one or more users of the one or more computer systems are invisible by default . if the one or more users of the one or more computer systems want to receive one or more offers from the one or more companies , they can mark themselves as visible on the map . by changing the state from the invisible to visible , the one or more computer systems become visible for one or more companies . the one or more employees of the one or more companies can immediately begin interaction with the one or more users of the one or more computer systems that became visible . it should be mentioned that in some embodiments of the present invention , the terms โ visible ,โ โ invisible ,โ โ visible mark ,โ โ invisible mark ,โ โ visible state ,โ โ invisible state โ have other titles . fig6 shows the graphical user interface according to some embodiments of the present invention . fig6 illustrates a graphical user interface ( gui ) 601 , which comprises the following elements : the title of the application 602 . in some embodiments of the present invention , the title of the application has graphical and / or sound and / or video elements . in some embodiments of the present invention , if the title contains more characters than can be displayed on the top of the gui 601 , then one or more software applications cut the last part of the title 602 and replace the cut characters with , for example , โ . . . โ characters . in case of graphical elements in some embodiments of the present invention , the size of one or more images is adjusted to fit the space designated for the title 602 ; the first advertisement 603 , which comprises a link to the part or full promo - campaign description . in this exemplary embodiment , the first advertisement 603 comprises part of promo - campaign description , as follows : discount rate and information about apartments at askplat hotel . it should be noted that in some embodiments of the present invention , the first advertisement 603 comprises another element related to the promo - campaign description and / or terms ; the second advertisement 604 . in this exemplary embodiment , the second advertisement 604 comprises the following elements related to the advertisement description : an ellipse 607 , which represents graphical information about one or more products and / or services related to the promo - campaign , a very precise discount rate , and part of the terms of the advertisement ; the third advertisement 605 . in this exemplary embodiment , the third advertisement 605 comprises the following elements related to the advertisement description : a discount rate , part of the service description and video record 608 ; the check - box and description of the check - box 606 . in this exemplary embodiment , if a user clicks or taps on the check - box , the one or more programs change the state of the check - box to the โ checked โ status ( check appears in the check - box ) and the user of the one or more computer system becomes visible to the one or more employees of the nearby point of sale and / or companies which rent or own the one or more nearby points of sale . in some embodiments of the present invention , if the one or more users appear on the map of the one or more sales managers and / or other one or more companies representatives who have means to create , control and / or manage the one or more promo - campaigns , these employees , as stated above , can get additional information about the one or more users who are shown on the map , send one or more messages to the one or more users who are shown on the map , change the offer mentioned in the promo - campaign . in some embodiments of the present invention , after the one or more users clicked and / or tapped on the 606 check - box , the one or more programs which comprise one or more commands which when executed on the or more processors , displays the gui 601 , can change the gui 601 and add a list of the one or more messages and / or offers and associated promo - campaigns . in this exemplary embodiment , the list is sorted by time , which means that the most recent proposal will appear on top of the list . in some embodiments of the present invention , the message which appears in the list is represented by one or a combination of the following elements : text ; image ; one or more special characters ; sound record ; video record ; bill ; terms of the promo - campaign ; conditions of the promo - campaign ; contact information ; time period of the promo - campaign availability ; time period of the code availability ; full name of the representative of the company which sells the one or more goods and / or services mentioned in the one or more promo - campaign ; one or more elements for payment ; status of the advertisement ; path to the one or more points of sale ; amount of people who have already accepted and / or reviewed part or full promo - campaign description ; amount of customers who are located near the one or more users ; address of the one or more points of sale ; link to the one or more internet resources . fig7 shows the method of changing the state of the user according to some embodiments of the present invention . according to fig7 , when one or more users change the state of visibility to one or more representatives of the one or more companies , the one or more systems perform the following actions : a portable multifunction device receives one or more requests from the one or more users of the portable multifunction device to change the state to visible 701 . in this exemplary embodiment , the one or more users of the portable multifunction device click on the check - box 606 in order to change the state to visible . in some embodiments of the present invention , the one or more users change the state to visible by sending one or more voice commands to the speech recognition module of the portable multifunction device and / or to the one or more speech recognition systems including remote speech recognition systems . in some embodiments of the present invention , the one or more users change the state to visible by using one or more gestures . in some embodiments of the present invention , the gestures can be inputted to the gesture recognition module of the portable multifunction device , for example , a touch - screen . in some embodiments of the present invention , information about one or more gestures is sent to the one or more computer systems which have means for gesture recognition . in some embodiments of the present invention , the state is changed automatically by a portable multifunction device , for example , after a period of time and / or upon reaching a specific geographical location ; sending one or more parameters 702 , from the portable multifunction device , to the one or more computer systems . in this exemplary embodiment , the portable multifunction device sends the following parameters : the information about current geographical location of the portable multifunction device and / or the one or more users of the portable multifunction device ; the identification information of the portable multifunction device and / or the one or more users of the portable multifunction device . in some embodiments of the present invention , the portable multifunction device sends one or combination of the following elements : one or more users &# 39 ; authentication information ; one or more images associated with the portable multifunction device ; one or more images associated with the one or more users of the portable multifunction device ; one or more video records associated with the portable multifunction device ; one or more video records associated with the one or more users of the portable multifunction device ; one or more sound records associated with the portable multifunction device ; one or more sound records associated with the one or more users of the portable multifunction device ; geographical location of the portable multifunction device ; geographical location of the one or more users of the portable multifunction device ; one or more geographical locations of the portable multifunction device and / or one or more users of the portable multifunction device which was determined before sending one or more parameters ; information about friends and / or friends of the friends of the one or more users of the portable multifunction device ; information about payment methods which is registered in the one or more applications to which the portable multifunction device has access ; information about one or more goods and / or services which were purchased before sending one or more parameters ; text ; price requirements ; discount requirements ; one or more promotional messages ; terms and / or conditions of the offer . upon receiving at the one or more computer systems , the one or more parameters , the one or more computer systems compares the one or more parameters which were received with one or more parameters of the one or more promo - campaigns and / or one or more points of sale . if part or all received parameters are equal to the part or all and / or in the preliminary determined range of the one or more promo - campaigns and / or points of sale parameters , the one or more points of sale representatives who have access to the one or more promo - campaigns which parameters are equal to the part or all and / or in the preliminarily determined range of the one or more promo - campaigns and / or points of sales parameters , will be able to see the one or more users of the portable device as persons who wish to receive one or more offers . such one or more promo - campaigns and / or points of sale are considered , according to some embodiments of the present invention , as a place near the one or more users of the portable device . in all other situations , according to some embodiments of the present invention , the one or more points of sale representatives will not see information about one or more persons who wish to receive one or more offers as all other points of sale are considered as places which are located far from the current geographical location of the one or more users of the portable multifunction device . after the nearest one or more points of sale , to the one or more users of the portable multifunction device , are identified , the one or more computer systems โ connects โ the portable multifunction device with the one or more nearest points of sale representatives who have access to the one or more promo - campaigns which applied to at least one of the nearest , to the one or more users of the portable multifunction device , points of sale by sending 704 information about one or more users of the portable multifunction device who wished to receive one or more offers , and / or the portable multifunction device to the one or more computer systems of the one or more representatives of the one or more points of sale and / or promo - campaigns . in some embodiments of the present invention , the information could be sent to the one or more computer systems to which the one or more representatives of the one or more points of sale and / or promo - campaigns have access . it should be mentioned that the point of sale representative and / or promo - campaign representative ( in some embodiments , it is the same person ) can be located not only at the point of sale , but also anywhere in the world . additionally , in some embodiments of the present invention , one or more computer systems which have launched one or more promo - campaigns , could be located not only at the point of sale , but also anywhere in the world . in some embodiments of the present invention , one or more computer systems which have means for promo - campaigns management and means for establishing a network connection with one or more other computer systems , connects to the one or more computer systems which have launched the one or more promo - campaigns . in some embodiments of the present invention , one or more computer systems which have launched one or more promo - campaigns additionally have means for one or more promo campaign management and vice versa . also , it should be mentioned , according to some embodiments of the present invention , one or more persons can have access to the one or more promo - campaigns and / or points of sale . in some embodiments of the present invention , after one or more places nearest to the one or more users of the portable multifunction device are identified , the one or more users of the portable multifunction device receive information about one or more promo - campaigns which correspond to the nearest one or more places and / or points of sale and / or shops and / or places . in some embodiments of the present invention , one or more users of the one or more portable multifunction devices have one or more choices regarding visibility for the one or more companies and / or persons who wished to communicate about and / or promote one or more goods and / or services . fig8 shows gui 801 ( however , in some embodiments of the present invention , the one or more portable multifunction devices comprise one or more guis , which comprises gui 801 ), which comprises the following elements : the first circle 802 , which indicates that there are two offers from the nearest one or more places and / or points of sale . typically , in some embodiments of the present invention , before receiving offers and / or messages from the nearest one or more places and / or points of sale and / or persons , the one or more users of the one or more portable multifunction devices should mark themselves as visible for one or more persons and / or representatives of the one or more points of sale and / or places . by default , typically , all users are marked invisible in order to avoid spam . however , in some embodiments of the present invention , the one or more users of the one or more portable multifunction device can have the means for changing the default settings for visibility . according to some embodiments of the present invention , if one or more users of the one or more portable multifunction device want to choose the visibility and begin to receive one or more messages and / or offers from the one or more nearest persons and / or representatives of the nearest one or more points of sale and / or places , the one or more users of the one or more portable multifunction devices need to click on the first circle 802 and identify what the one or more users and / or other persons ( in some embodiments of the present invention , the one or more users of the one or more portable multifunction devices and / or computer systems can search for goods and / or services and / or messages , for example , for their friends , wives , husbands , babies . in some embodiments of the present invention , friends and / or relatives of the one or more users of the one or more portable multifunction device also become the users of the one or more portable multifunction devices ) want . for example , if the user wants to buy snacks at the nearest shop , he needs to click on the first circle 802 and input the following string to the text field 805 with title โ i want โ: โ i want snacks ,โ or โ i want to buy snacks for 0 . 5 usd .โ typically , the text field 805 appears near the circle 802 after interaction , for example , after one or more users of the one or more portable multifunction devices clicks on the first circle 802 . in some embodiments of the present invention , after interaction with the first circle 802 , the one or more software applications change the gui which comprises only the element 805 . in some embodiments of the present invention , the element 805 additionally comprises the means to submit wishes to the one or more persons and / or representatives of the one or more points of sale and / or shops . typically , according to some embodiments of the present invention , the means for submitting wishes is represented by a button . in some embodiments of the present invention , the means for submitting wishes is invisible to the one or more users of the one or more portable multifunction devices , and this means is activated by one or more events that appear on the one or more portable multifunction devices and / or computer systems . for example , most of the software applications don &# 39 ; t have a submit button , instead , the software application tracks the activity of the user ( idle is an activity too ) and when , for example , the one or more users of the one or more portable multifunction devices has finished writing one or more wishes to the element 805 , the software application submits it automatically . the second circle 803 , which indicates the nearest one or more points of sale and / or shops and / or places and / or persons which published one or more promo - campaigns and in which one or more users of the one or more portable multifunction devices can participate and / or purchase one or more coupons and / or purchase one or more goods and / or services . in some embodiments of the present invention , the one or more nearest points of sale and / or shops and / or places and / or persons don &# 39 ; t need to create and submit one or more promo - campaigns to be visible for the nearest one or more users of the one or more portable multifunction devices and / or computer systems . according to said embodiments , the one or more software products which implement part or entire present invention , have one or more instructions to make one or more companies and / or personal accounts visible for any person and / or company within the designated area . in order to designate one or more areas for the one or more companies and / or persons profiles , the one or more persons , which have rights and means for company &# 39 ; s profile management , click on the map and / or write the value of the radius parameter . radius parameter designate the area around the particular point of sale . the means for area designation are similar to those described above . the third circle 804 , which indicates the number of the nearest one or more points of sale and / or shops and / or places and / or persons which have a company and / or personal profiles in the one or more software which implements part or entire present invention . in some embodiments of the present invention , the third circle indicates only those companies and / or persons which have limited access to the one or more software which implements part or entire present invention , for example , companies with limited access can &# 39 ; t send and / or reply to the messages from the customers . in some embodiments of the present invention , the one or more users of the one or more computer systems creates a group and invites other one or more users of the one or more computer systems to join the group . also , in some embodiments of the present invention , the one or more companies and / or persons creates one or more promo - campaigns for the groups of users and / or one or more promo - campaigns comprises one or more special offers for the group of the users . according to said embodiments , a user of the one or more computer systems who wishes to create a group needs to be located within the designated area of the one or more promo - campaigns ( in order to see the promo - campaign , according to some embodiments of the present invention ). after choosing the promo - campaign ( even without special offer for the group of the users . it should be mentioned that the present invention should not be limited to the promo - campaigns which have a special offer or which are specially designed for the group of users in which the group of users can participate and / or purchase one or more coupons and / or purchase one or more goods and / or services . the present invention allows , in some embodiments of the present invention , the group of users to participate in any promo - campaign and / or interact with one or more representatives of the one or more points of sale and / or companies . ), the user creates a group by inviting other one or more users . it should be mentioned that the group of users comprises two or more users of the one or more computer systems . however , in some embodiments of the present invention , a group of users comprises one or more users of the one or more computer systems . it can happen , for example , after all users left the group except one . after the group was created , the user who created the group interacts with one or more promo - campaigns bound to the nearest one or more points of sale and / or shops and / or companies and / or persons . the group creator purchases one or more coupons and / or one or more goods and / or services corresponding to the one or more promo - campaigns . in some embodiments of the present invention , the group creator has the means to assign one or more roles to the group members . in some embodiments of the present invention , the one or more group members have the means to get information about one or more actions and / or interactions of the group creator and / or other one or more members of the group . in some embodiments of the present invention , the group members have means to interact ( for example , ask a question about the promo - campaign and / or company and / or person ) and / or purchase one or more coupons and / or goods and / or services . in some embodiments of the present invention , the group creator and / or other group members have the means to review promo - campaigns which are visible within the area where at least one of the group members is located . big cities have a very complicated traffic organizing system , for example , in some cities , the car driver needs , in order to get to the shop , located within 50 meters of the car &# 39 ; s driver current geographical location , to ride for more than one kilometer , because of the traffic system . so , in some embodiments of the present invention , the term โ radius โ, which is used to designate area around one or more points of sales , means a set of one or more paths from one or more places to the one or more points of sales , with the value not more than the value of the radius . if the value of the path from the current geographical location to the one or more points of sales , to which one or more promo - campaigns are applied , with the specific radius parameter value , will be equal or less than the value of radius , the car &# 39 ; s driver will be able to see above - mentioned one or more promo - campaigns . disclaimer . the example companies , organizations , products , people , places , and events depicted herein are fictitious . no association with any real company , organization , product , person , places , or events is intended or should be inferred . the foregoing description , for purpose of explanation , has been described with reference to specific embodiments . however , the illustrative discussions above are not intended to be exhaustive or to limit the invention to the precise forms disclosed . many modifications and variations are possible in view of the above teachings . the embodiments were chosen and described in order to best explain the principles of the invention and its practical applications , to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated .
| 6 |
embodiments of the present invention will be described below with reference to the drawings . fig1 is a block diagram showing a general configuration of a course creation support system according to the present embodiment . a social networking site ( sns ) 10 including a server 11 is connected to members &# 39 ; smartphone terminals 1 - 1 , 1 - 2 , 1 - 3 , wrist terminals 2 - 1 , 2 - 2 , 2 - 3 , and a personal computer ( pc ) 3 - 1 via the internet 500 . the wrist terminals 2 - 1 , 2 - 2 , 2 - 3 are of a watch type that can be worn on the wrist . the wrist terminals 2 - 1 , 2 - 2 , 2 - 3 can also be connected by radio to the smartphone terminals 1 - 1 , 1 - 2 , 1 - 3 . the number of terminals and pc is not limited to that shown in fig1 . an application program is installed on each of the smartphone terminals 1 - 1 , 1 - 2 , 1 - 3 so that the smartphone terminals 1 - 1 , 1 - 2 , 1 - 3 perform an operation of cooperating with the sns 10 . a relatively lightweight application program is also installed on each of the wrist terminals 2 - 1 , 2 - 2 , 2 - 3 so that the wrist terminals 2 - 1 , 2 - 2 , 2 - 3 operate to cooperate with the smartphone terminals 1 - 1 , 1 - 2 , 1 - 3 . furthermore , the wrist terminals 2 - 1 , 2 - 2 , 2 - 3 and the server 11 are directly connected together to provide a route through the wrist terminals 2 - 1 , 2 - 2 , 2 - 3 and the server 11 can exchange information without communicating with the smartphone terminals 1 - 1 , 1 - 2 , 1 - 3 . fig2 is a diagram schematically illustrating a course creation support system according to the present embodiment . the wrist terminals 2 - 1 and 2 - 2 worn by training members , the smartphone terminal 1 - 1 , and the pc 3 are connected together via the sns 10 . thus , a course created by the sns 10 can be transmitted to a member who is training with the wrist terminal 2 - 1 on or to another member who is training with the wrist terminal 2 - 2 on , or to another member &# 39 ; s smartphone terminal 1 - 1 or pc 3 . cloud services may be used as the sns 10 . fig3 is a block diagram showing a general configuration of the server 11 . in fig3 , a cpu 102 controls the whole system . a program memory 104 stores various control programs . the cpu 102 carries out various processes by executing the programs in the program memory 104 . a course setting program 1041 is a program for setting a course as described below . the course may be set by a user by tracing a course the user has actually run with the wrist terminal 2 - 1 on the arm or tracing on a map with the user &# 39 ; s finger or the like . alternatively , several landmarks may be specified to allow setting of a 5 - or 10 - kilometer course that circles around or passes the landmarks . any error between an actual map and a specified course can be corrected by a well - known map matching technique . a member management module 106 manages the members as an sns system . the member management module 106 also manages the friendships among the members . furthermore , profile images p 1 are stored and managed for the respective members . a history memory 120 stores a history of training so that the user can train a plurality of times and subsequently compare the results of the training with one another . a course memory 130 stores various courses . the various courses include a plurality of existing predefined courses pre - created by the server 11 , for example , a tokyo marathon course ( first predefined course ) 130 a , a honolulu marathon course ( second predefined course ) 130 b , an imperial palace jogging course ( third predefined course ) 130 c , . . . and a first custom course 1301 , a second custom course 1302 , a third custom course 1303 , . . . which are set and recorded by the user . fig4 is a schematic block diagram showing a configuration of the wrist terminal 2 - 1 . the other wrist terminals are similarly configured . a display unit 40 includes an lcd and a drive circuit that drives the lcd . a display controller 254 controls a display status of the display unit 40 . an input unit 256 includes various keys and switches . a course memory 230 stores various courses , for example , a plurality of courses pre - downloaded from the server 11 . as is the case with course memory 130 of the server 11 , for example , the tokyo marathon course , the honolulu marathon course , and the imperial palace jogging course may be stored in the course memory 230 . a gps module 250 utilizes a well - known gps ( global positioning system ) to measure the current position . that is , the gps module 250 receives , via an antenna 2 a , radio waves transmitted by a plurality of positioning satellites ( gps satellites ) to acquire position data including latitude and longitude , which are indicative of the current position , and supplies the acquired position data to a cpu 202 as location information indicative of the location of the user &# 39 ; s action . a sensor 252 includes a triaxial magnetic field sensor , a uniaxial acceleration sensor , and a uniaxial gyroscope . thus , the advancing direction of the wrist terminal 1 - 1 can be measured using , in addition to the gps module 250 , the sensor 252 including the triaxial magnetic field sensor , the uniaxial acceleration sensor , and the uniaxial gyroscope . this enables a further increase in accuracy . the cpu 202 controls the whole wrist terminal 2 - 1 . a program memory 204 pre - stores a control program 2041 , an application program 2042 , and the like . the control program 2041 is a basic program that controls the whole wrist terminal . the application program 2042 is a program for cooperation with the smartphone terminal 1 - 1 and the server 11 . the wrist terminal further includes an interface 258 for establishing a bluetooth ( registered trademark ) link with a cellular terminal and an interface 260 for establishing a wi - fi link or the like with the server . fig5 is a schematic block diagram showing a configuration of the smartphone terminal 1 - 1 and the pc 3 . the other smartphone terminals are similarly configured . the smartphone terminal 1 - 1 and the pc 3 differ from the wrist terminal 2 - 1 only in that neither of the smartphone terminal 1 - 1 and the pc 3 includes the gps module 250 or the sensor 252 . the remaining parts of the smartphone terminal 1 - 1 and the pc 3 are similar to the corresponding parts of the wrist terminal 2 - 1 . that is , a display unit 340 includes an lcd and a drive circuit that drives the lcd . a display controller 354 controls a display status of the display unit 340 . an input unit 356 includes various keys and switches for the smartphone terminal 1 - 1 and includes a mouse in addition to various keys and switches for the pc 3 . a course memory 330 stores various courses . the various courses include a plurality of courses pre - downloaded from the server 11 . the cpu 302 controls the whole smartphone terminal 1 - 1 and pc 3 . a program memory 304 pre - stores a control program 3041 , an application program 3042 , and the like . the control program 3041 is a basic program that controls the whole smartphone terminal 1 - 1 and pc 3 . the application program 3042 is a program for cooperation with the wrist terminal 2 - 1 and the server 11 . the smartphone terminal further includes an interface 258 for establishing a bluetooth ( registered trademark ) link with a cellular terminal and an interface 260 for establishing a wi - fi link or the like with the server . a first embodiment of the present invention relates to a course creation support system using the member &# 39 ; s wrist terminal 2 - 1 and the server 11 of the sns 10 which are connected together via the internet 500 . fig6 is a flowchart showing a process procedure of the server 11 according to the present embodiment . in step s 100 , the server 11 allows the wrist terminal 2 - 1 to display a map on the display unit 40 . the member operates the input unit 256 of the wrist terminal 2 - 1 to specify coordinates corresponding to a finishing point on the map displayed on the display unit 40 . then , information indicative of the finishing point is transmitted to the server 11 via the internet 500 , and the server 11 sets the finishing point for the member ( step s 101 ). on the other hand , the wrist terminal 2 - 1 detects , by means of the gps module 250 , the current position at regular time intervals to transmit the current position to the server 11 . the server 11 determines at step s 102 whether or not the member has started running depending on whether or not the current position has changed since the setting of the finishing point . upon determining that the member has started running , the server 11 sets the last current position received from the gps module 250 to be a starting point ( step s 103 ). when the member has thus started running , the server 11 checks , by the gps module 250 , whether or not the current position transmitted at the regular time intervals has been received as described above ( step s 104 ), and every time the current position is received , records the received position and the time ( step s 105 ). the server 11 also compares the received current position with the finishing point to determine whether or not the member has reached the finishing point ( step s 106 ). if the member has reached the finishing point , the server 11 joins together the positions recorded at the regular time intervals in step s 105 to generate a movement locus along which the member has run ( step s 107 ). the server 11 displays the movement locus on the map to create a course and calculates the distance of the course . the server 11 transmits the course and the distance to the wrist terminal 2 - 1 to allow the wrist terminal 2 - 1 to display the course and the distance on the display unit 40 ( step s 108 ). upon viewing the course and distance displayed on the display unit 40 , the member operates the input unit 256 of the wrist terminal 2 - 1 to transmit an ok signal if the member is satisfied with the course and the distance . the server 11 determines whether or not the ok signal has been received from the member &# 39 ; s wrist terminal 2 - 1 ( step s 109 ). if the ok signal has been received , the server 11 records the created course with the corresponding distance as one of the member &# 39 ; s custom courses 1301 to 1303 ( step s 110 ). thus , as shown in fig7 , when a member 503 performs an ok operation via the wrist terminal 2 - 1 after running 3 . 45 km ( 0 . 45 + 2 . 55 + 0 . 45 = 3 . 45 ) from a starting point 501 to a finishing point 502 , the 3 . 45 - km course from the starting point 501 to the finishing point 502 is recorded as the member 503 &# 39 ; s custom course . fig7 is a diagram conceptually showing how the course setting program 1041 of the server 11 sets a course . the above - described course is favored by the member 503 as a result of the member &# 39 ; s actual running and thus reflects the member 503 &# 39 ; s intension . furthermore , what course is set for running varies among the members , and thus , the set course is one of various courses . hence , any of the various courses which reflects the user &# 39 ; s intension can be created . furthermore , if the server 11 determines in step s 109 that the ok signal has not been received , the server 11 determines whether or not an instruction to change the starting point has been received from the wrist terminal 2 - 1 ( step s 111 ). if the instruction to change the starting point has been received , the server 11 changes the starting point in accordance with the content of the change subsequently transmitted by the wrist terminal 2 - 1 ( step s 112 ). thus , as shown in fig7 , when the member 503 specifies a corrected starting point 504 corresponding to a 0 . 45 - km reduction in distance , a 3 - km course from the corrected starting point 504 to the finishing point 502 is created . furthermore , in this state , performing an ok operation allows the 3 - km course from the corrected starting point 504 to the finishing point 502 to be recorded as a custom course . in step s 113 subsequent to step s 112 , the server 11 determines whether or not an instruction to change the finishing point has been received from the wrist terminal 2 - 1 . if the instruction to change the finishing point has been received , the server 11 changes the finishing point in accordance with the content of the change subsequently transmitted by the wrist terminal 2 - 1 ( step s 114 ). thus , as shown in fig7 , when the member 503 also specifies a corrected finishing point 505 corresponding to a 0 . 45 - km reduction in distance , a 2 . 55 - km course from the corrected starting point 504 to the corrected finishing point 505 is created . furthermore , in this state , performing an ok operation allows the 2 . 55 - km course from the corrected starting point 504 to the corrected finishing point 505 to be recorded as a custom course . that is , the present embodiment enables one of the following courses to be recorded as a custom course . ( 1 ) 3 . 45 - km course from the starting point 501 to the finishing point 502 ( 2 ) 3 - km course from the corrected starting point 504 to the finishing point 502 ( 3 ) 3 - km course from the starting point 501 to the corrected finishing point 505 ( 4 ) 2 . 55 - km course from the corrected starting point 504 to the corrected finishing point 505 a second embodiment of the present invention relates to also a course creation support system using the member &# 39 ; s wrist terminal 2 - 1 and the server 11 of the sns 10 which are connected together via the internet 500 . fig8 is a flowchart showing a process procedure of the server 11 according to the present embodiment . steps s 201 to s 210 in this flowchart are the same as steps s 101 to s 110 according to the first embodiment shown in fig6 . if the determination in step s 209 is no and the ok signal has not been received from the wrist terminal 2 - 1 , then the server 11 receives a subsequently transmitted corrected distance ( step s 211 ). upon receiving the corrected distance , the server 11 creates and transmits a pattern 1 to a pattern x that are x corrected courses including the corrected distance , to the wrist terminal 2 - 1 so that the patterns 1 to x can be displayed on the display unit 40 ( step s 212 ). that is , as shown in fig9 , it is assumed that the member 503 transmits , for example , 5 km as a corrected distance after running 3 . 45 km ( 0 . 45 + 2 . 55 + 0 . 45 = 3 . 45 ) from the starting point 501 to the finishing point 502 . then , to change the 3 . 45 - km course into a 5 - km course desired by the member , the server 11 creates a 4 . 1 - km course shown by an illustrated dashed line and passing illustrated points in the following order : 504 , 506 , 507 , 508 , 509 , 505 . moreover , the server 11 allows the display unit 40 to display a 5 - km ( 4 . 1 + 0 . 45 + 0 . 45 = 5 ) corrected course : pattern 1 obtained by adding a distance of 0 . 45 km from the starting point 501 to the point 504 and a distance of 0 . 45 km from the point 505 to the finishing point 502 to the 4 . 1 - km course passing the illustrated points in the following order : 504 , 506 , 507 , 508 , 509 , 505 . fig9 is a diagram conceptually showing how the course setting program 1041 of the server 11 sets a course . furthermore , although not shown in the drawings , courses with pattern 2 , . . . , and pattern x which are similarly 5 km in distance but which involve different paths are displayed on the display unit 40 in a switchable manner . then , with one of the courses with the pattern 1 , . . . , and pattern x displayed on the display unit 40 , an operation of selecting this course is performed on the wrist terminal 2 - 1 . a select signal is then transmitted from the wrist terminal 2 - 1 to the server 11 , resulting in an affirmative determination in step s 213 . hence , the server 11 advances the processing from step s 213 to step s 210 to record the selected corrected course as a custom course for the member . thus , the present embodiment allows various courses including a common actual starting point and a common actual finishing point but having a distance desired by the member and different paths to be recorded as custom courses . a third embodiment of the present invention relates to a course creation support system using any of the members &# 39 ; wrist terminal 2 - 1 , smartphone terminal 1 - 1 , and pc 3 ( hereinafter collectively referred to as a member terminal ) and the server 11 of the sns 10 which are connected together via the internet 500 . fig1 is a flowchart showing a process procedure of the server 11 according to the present embodiment . the server 11 transmits map data in accordance with a request from the member terminal to allow the member terminal to display a map ( step s 301 ). while referencing the displayed map , the member uses the closed loop 510 to specify an area in which a circuit course is to be set as shown in fig1 . then , the member terminal side transmits area information indicative of the specified area , which is received by the server 11 ( step s 302 ). fig1 is a diagram conceptually showing how the course setting program 1041 of the server 11 sets a course . subsequently , the server 11 creates a circuit course inside the closed loop 510 and transmits the created circuit course and the corresponding distance to the member terminal to allow the member terminal to display the circuit course and the distance ( step s 303 ). upon viewing the displayed course and distance , the member operates the input unit 256 of the wrist terminal 2 - 1 to transmit an ok signal if the member is satisfied with the course and the distance . the server 11 determines whether or not the ok signal has been received from the member wrist terminal 2 - 1 ( step s 304 ). if the ok signal has been received , the server 11 records the created course with the corresponding distance as one of custom courses 1301 to 1303 ( step s 305 ). if the ok signal has not been received from the wrist terminal 2 - 1 and the determination in step s 304 is no , the server 11 receives a subsequently transmitted corrected distance ( step s 306 ). upon receiving the corrected distance , the server 11 creates a pattern 1 to a pattern x that are x corrected circuit courses including the corrected distance , to the wrist terminal 2 - 1 to allow the wrist terminal 2 - 1 to display the patterns 1 to x on the display unit 40 ( step s 307 ). that is , as shown in fig1 , if the member specifies 5 km as a corrected distance , the server 11 presents a 5 - km circuit course shown by an illustrated dotted line and passing illustrated points in the following order : 501 , 511 , 512 , 513 , 514 , 515 , 516 , 517 , 501 . furthermore , although not shown in the drawings , corrected circuit courses with pattern 2 , . . . , and pattern x which are similarly 5 km in distance but which involve different paths are displayed on the display unit 40 in a switchable manner . then , with one of the corrected circuit courses with the pattern 1 , . . . , and pattern x displayed on the display unit 40 , an operation of selecting this course is performed on the member terminal . a select signal is then transmitted from the wrist terminal 2 - 1 to the server 11 , resulting in an affirmative determination in step s 308 . hence , the server 11 advances the processing from step s 308 to step s 305 to record the selected corrected circuit course as a course for the member . thus , the present embodiment allows recording of various circuit courses located inside the area desired by the member and having the desired distance and different paths . of course , in this case , if such a closed loop as includes the member &# 39 ; s house shown in fig1 is set , a circuit course including the member &# 39 ; s house can be recorded as a custom course . a fourth embodiment of the present invention relates to a course creation support system using the member terminal and the server 11 of the sns 10 which are connected together via the internet 500 . fig1 is a flowchart showing a process procedure of the server 11 according to the present embodiment . the server 11 transmits map data in accordance with a request from the member terminal so that the member terminal can display a map ( step s 401 ). while referencing the displayed map , the member specifies a landmark 512 desired to be the center of a circuit course as shown in fig1 . then , the member terminal side transmits information indicative of the landmark 512 . the server 11 receives the information and sets the central landmark ( step s 402 ). fig1 is a diagram conceptually showing how the course setting program 1041 of the server 11 sets a course . moreover , while referencing the displayed map , the member uses the closed loop 510 to specify an area in which a circuit course is to be set as shown in fig1 . then , the member terminal side transmits area information indicative of the specified area . the server 11 receives the area information and sets the area ( step s 403 ). at this time , the member terminal may transmit a maximum distance to specify the maximum distance for circuit courses to be created . subsequently , the server 11 creates a circuit course inside the closed loop 510 which is centered around the landmark 512 and which includes the maximum distance , and transmits the created circuit course and the corresponding distance to the member terminal for display ( step s 405 ). upon viewing the displayed course and distance , the member operates the input unit 256 of the wrist terminal 2 - 1 to transmit an ok signal if the member is satisfied with the circuit course and the distance . the server 11 determines whether or not the ok signal has been received from the member wrist terminal 2 - 1 ( step s 406 ). if the ok signal has been received , the server 11 records the created course with the corresponding distance as one of custom courses 1301 to 1303 ( step s 407 ). if the ok signal has not been received from the wrist terminal 2 - 1 and the determination in step s 406 is no , the server 11 receives subsequently transmitted information indicative of a closed loop for a corrected area ( step s 408 ). upon receiving the information indicative of the closed loop for the corrected area , the server 11 creates a circuit course centered around the landmark 512 again , and transmits the created circuit course and the corresponding distance to the member terminal for display ( step s 405 ). furthermore , if no corrected area has been set and the determination in step s 408 is no , the server 11 receives subsequently transmitted information indicative of a corrected distance ( step s 409 ). upon receiving the information indicative of the corrected distance , the server 11 creates a circuit course including the corrected distance and centered around the landmark 512 again , and transmits the created circuit course and the corresponding distance to the member terminal for display ( step s 405 ). upon receiving the ok signal , the server 11 records the created course with the corresponding distance as one of custom courses 1301 to 1303 ( step s 407 ). thus , the present embodiment allows a member &# 39 ; s desired circuit course to be selected from a plurality of circuit courses centered around a landmark desired by the member and having different paths and distances so that the selected circuit course can be recorded . in a modification of the fourth embodiment of the present invention , steps s 401 and s 402 in the flowchart in fig1 are performed . subsequently , the member further specifies the distance or duration of the circuit course . then , the member terminal side transmits information on the specified distance or duration , and the server 11 receives and sets the distance or the duration . the server 11 subsequently creates a circuit course centered around the landmark and including the specified distance or duration , and transmits the created circuit course and the distance to the member terminal for display . that is , if the distance is specified , a course circling the landmark and having the specified distance is calculated and created on the map . thus , for example , a 10 - or 20 - km course circling the landmark can be created . furthermore , if the duration is specified , a course circling the landmark and having the specified duration is calculated and created on the map so that when the user moves at an average speed or a specified speed or a speed suitable for the user , the movement takes the specified duration . thus , for example , a 30 - minute or one - hour course circling the landmark can be created . for adjustment of the distance or duration , the same path may be taken a plurality of times or a turn may be included in the course . upon viewing the displayed course and distance , the member operates the input unit 256 of the wrist terminal 2 - 1 to transmit an ok signal if the member is satisfied with the circuit course and the distance . the server 11 determines whether or not the ok signal has been received from the member wrist terminal 2 - 1 . upon receiving the ok signal , the server 11 records the created course with the corresponding distance as one of custom courses 1301 to 1303 . if the ok signal has not been received from the wrist terminal 2 - 1 and the determination is no , the server 11 receives subsequently transmitted information indicative of a corrected distance or duration . upon receiving the corrected information , the server 11 creates a circuit course centered around the landmark 512 again , and transmits the created circuit course and the corresponding distance to the member terminal for display . then , upon receiving the ok signal , the server 11 records the created course with the corresponding distance as one of custom courses 1301 to 1303 . thus , the present modification allows a member &# 39 ; s desired circuit course to be selected from a plurality of circuit courses centered around a landmark desired by the member and having different paths and distances or different durations so that the selected circuit course can be recorded . a fifth embodiment of the present invention relates to a course creation support system using the member terminal and the server 11 of the sns 10 which are connected together via the internet 500 . fig1 is a flowchart showing a process procedure of the server 11 according to the present embodiment . the server 11 transmits map data in accordance with a request from the member terminal to allow the member terminal to display a map ( step s 501 ). when the member specifies the distance ( for example , 3 km ) of a circuit course , the member terminal side transmits information indicative of the specified distance . the server 11 receives the information ( step s 502 ). moreover , while referencing the displayed map , the member uses the closed loop 510 to specify an area in which a circuit course is to be set as shown in fig1 . then , the member terminal side transmits area information indicative of the specified area . the server 11 receives the area information ( step s 503 ). fig1 is a diagram conceptually showing how the course setting program 1041 of the server 11 sets a course . the server 11 subsequently creates a plurality of circuit courses inside the closed loop 510 which are referred to as a first recommended course , a second recommended course , a third recommended course , and which include the circuit course with the specified distance . the server 11 transmits the created plurality of recommended courses and the distances to the member terminal for display ( step s 504 ). the processing in step s 504 allows the first recommended circuit course to the third recommended circuit course to be displayed as shown in fig1 . furthermore , the first recommended course to the third recommended course include the circuit course including the distance specified by the member ( first recommended course ). upon viewing the displayed courses and distances , the member operates the input unit 256 of the wrist terminal 2 - 1 to select one of the first recommended course to the third recommended course and transmit an ok signal if the member is satisfied with the selected recommended course . the server 11 determines whether or not a recommended course number and the ok signal have been received from the member wrist terminal 2 - 1 ( step s 505 ). if the ok signal has been received , the server 11 records the selected recommended course and the distance thereof as one of custom courses 1301 to 1303 ( step s 506 ). if the ok signal has not been received from the wrist terminal 2 - 1 and the determination in step s 505 is no , the server 11 receives a subsequently transmitted corrected distance ( step s 507 ). upon receiving the corrected distance , the server 11 creates and transmits a corrected circuit course including the corrected distance , to the member terminal for display ( step s 508 ). then , with the corrected circuit course displayed , an operation of selecting the corrected circuit course is performed on the member terminal . a select signal is then transmitted from the wrist terminal 2 - 1 to the server 11 , resulting in an affirmative determination in step s 505 . hence , the server 11 advances the processing from step s 505 to step s 506 to record the selected corrected circuit course as a custom course for the member . thus , the present embodiment not only allows one of a plurality of recommended circuit courses including different distances to be selected and recorded as a custom course but also allows the member to specify a distance and record a desired course as a custom course if the member favors none of the plurality of recommended circuit courses . in this case , when such a closed loop as includes an illustrated hotel where the member is staying is set , a circuit course including the member &# 39 ; s hotel can be recorded as a custom course . a sixth embodiment of the present invention relates to a course creation support system using the member terminal and the server 11 of the sns 10 which are connected together via the internet 500 . fig1 is a flowchart showing a process procedure of the server 11 according to the present embodiment . the server 11 transmits map data in accordance with a request from the member terminal so that the member terminal can display a map ( step s 602 ). while referencing the displayed map , the member specifies a plurality of landmarks such as a park 518 , a riverside 519 , and a post office 520 which are to be included in a circuit course . the server 11 receives this information and sets the plurality of central landmarks ( step s 602 ). fig1 is a diagram conceptually showing how the course setting program 1041 of the server 11 sets a course . when the member further specifies the order in which the member desires to pass the specified landmarks , the server 11 receives this information and sets the order in which the member passes the specified landmarks ( step s 603 ). thus , for example , the order of the landmarks is set as follows . the server 11 subsequently creates a recommended circuit course along which the member passes the landmarks in the above - described order , and transmits the created recommended circuit course and a distance ( 12 . 7 km ) to the member terminal for display ( step s 604 ). upon viewing the displayed course and distance , the member operates the input unit 256 of the wrist terminal 2 - 1 to transmit an ok signal if the member is satisfied with the recommended circuit course and the distance . the server 11 determines whether or not the ok signal has been received from the member wrist terminal 2 - 1 . if the ok signal has been received , the server 11 records the recommended circuit course with the corresponding distance as one of custom courses 1301 to 1303 . if the ok signal has not been received from the wrist terminal 2 - 1 and the determination in step s 606 is no , the server 11 determines whether or not information indicative of a corrected distance has been received ( step s 607 ). upon receiving information indicative of a corrected distance , the server 11 creates a corrected circuit course having the corrected distance and along which the member passes the landmarks in the above - described order , and transmits the created corrected circuit course and distance to the member terminal for display ( step s 604 ). thus , according to the present embodiment , when 10 km is specified as a corrected distance as shown in fig1 , distance correction is carried out as shown by a dotted line in fig1 . then , a corrected circuit course can be recorded which includes the distance desired by the member and which passes a plurality of landmarks desired by the member in the desired order . a seventh embodiment of the present invention relates to a course creation support system using the member terminal and the server 11 of the sns 10 which are connected together via the internet 500 . fig1 is a flowchart showing a process procedure of the server 11 according to the present embodiment . the server 11 determines whether or not a time priority mode has been selected ( step s 701 ). when the member operates the member terminal to select the time priority mode , information indicating that the time priority mode has been selected is transmitted to the server 11 , which then determines that the time priority mode has been selected ( step s 701 : yes ). thus , the server 11 advances the processing from step s 701 to step s 702 to create a 60 - minute course , a 30 - minute course , and a 15 - minute course , and transmits the created plurality of circuit courses and the corresponding distances to the member terminal for display ( step s 702 ). the processing in step s 702 allows display of a first recommended circuit course ( 60 - minute course ), a second recommended circuit course ( 30 - minute course ), and a third recommended circuit course ( 15 - minute course ) as shown in fig1 . fig1 is a diagram conceptually showing how the course setting program 1041 of the server 11 sets a course . in this process , a starting point may be pre - specified . in this case , a first recommended course to a third recommended course having the member &# 39 ; s house or hotel as a starting point are created and displayed . upon viewing the displayed courses and distances , the member operates the member terminal to select one of the first recommended course to the third recommended course and transmit an ok signal if the member is satisfied with the selected recommended course . the server 11 determines whether or not a recommended course number and the ok signal have been received from the member wrist terminal 2 - 1 ( step s 703 ). if the ok signal has been received , the server 11 records the selected recommended course and the distance thereof as one of custom courses 1301 to 1303 ( step s 706 ). if the ok signal has not been received from the wrist terminal 2 - 1 and the determination in step s 703 is no , the server 11 automatically sets a distance priority mode instead of the time priority mode , creates a 7 -, a 5 -, and a 3 - km course , and transmits the created plurality of circuit courses and the corresponding distances to the member terminal for display ( step s 704 ). upon viewing the displayed courses and distances , the member operates the member terminal to select any of the recommended courses and transmit an ok signal if the member is satisfied with the selected recommended course . the server 11 determines whether or not a recommended course number and the ok signal have been received from the member wrist terminal 2 - 1 ( step s 705 ). if the ok signal has been received , the server 11 records the selected course and the distance thereof as one of custom courses 1301 to 1303 ( step s 706 ). if the ok signal has not been received from the wrist terminal 2 - 1 and the determination in step s 705 is no , the server 11 corrects the duration based on correction information subsequently transmitted by the member terminal ( step s 707 ). the server 11 then creates a corrected course including the corrected duration , and transmits the corrected course to the member terminal along with the duration of the course for display ( step s 708 ). thus , if the member favors none of the first recommended course ( 60 - minute course ), the second recommended course ( 30 - minute course ), and the third recommended course ( 15 - minute course ) and corrects the duration to 20 minutes , a corrected course 521 ( 20 - minute course ) that is different from the first recommended course ( 60 - minute course ), the second recommended course ( 30 - minute course ), and the third recommended course ( 15 - minute course ) is created and displayed , as shown in fig1 . then , when the member selects the corrected course 521 ( 20 - minute course ) and performs an ok operation , the corrected course 521 ( 20 - minute course ) is recorded as a custom course . thus , according to the present embodiment , a plurality of courses with different durations are created in the time priority mode and a plurality of courses with different distances are created in the distance priority mode , so that the desired one of these courses can be recorded as a custom course . moreover , a course with a duration desired by the member may be automatically created . while the description above refers to particular embodiments of the present invention , it will be understood that many modifications may be made without departing from the spirit thereof . the accompanying claims are intended to cover such modifications as would fall within the true scope and spirit of the present invention . the presently disclosed embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims , rather than the foregoing description , and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . for example , the present invention can be practiced as a computer readable recording medium in which a program for allowing the computer to function as predetermined means , allowing the computer to realize a predetermined function , or allowing the computer to conduct predetermined means .
| 6 |
now , embodiments according to the present invention will be explained in accompanying with the attached drawings . throughout the following description , the same reference numerals or marks are used to denote and identify corresponding or identical components . fig1 shows a basic structure of an atm switching system employing a relief method of billing data according to the present invention . more particularly , it shows a basic concept for collecting the billing data . in fig1 the atm switching system includes an atm switch 1 , atm terminators 2 and 3 , a call controller 4 and a billing data collector 5 . the atm switch 1 , the atm terminators 2 and 3 , and a call controller 4 are duplicated . the billing data collector 5 is connected to a charging center 6 . the atm terminators 2 and 3 are further connected to subscriber terminals or other switching system 7 through a data path 8 . in the structure shown in fig1 the atm terminators 2 and 3 charges , i . e ., counts the number of the passed cells for charging , and the atm terminators 2 and 3 are independent from a call controller 4 which controls the atm switch 1 , so that the switching speed in the atm switch 1 becomes first . a cell counter 20 for counting the number of the passed cells is provided on each of the atm terminators 2 and 3 . on call termination , the billing data collector 5 edits the billing data according to a cell count value in the atm cell counter 20 and call control data stored in a call control memory 40 in the call controller 4 , i . e ., dates of call establishment and call termination and calling or called telephone numbers . the edited billing data is sent to the charging center 6 . in regard to fig2 a to 2c , operational flowing charts of operations for collecting the billing data will be now explained . fig2 a shows an atm termination processing executed by the atm terminator 2 , fig2 b shows a call control processing executed on the call controller 4 , and fig2 c shows a storing processing of the billing data . when the call controller 4 detects the call termination ( step sb - 1 ), the controller 4 leads connection data from the call control data ( step sb - 2 ). the call controller 4 requests to read the value counted in the charged cell counter 20 to the atm terminator 2 according to the led connection data ( step sb - 3 ). the atm terminator 2 receives a request for reading the count value of the charged cells ( step sa - 1 ), and reads out the cell data corresponding to the connection data in the cell counter 20 ( step sa - 2 ). the atm terminator 2 transfers the read cell data , i . e ., the cell count value , to the call controller 4 ( step sa - 3 ). the call controller 4 receives the cell count value ( step sb - 4 ). the call controller 4 sends a notification for confirmation of receiving the cell count value ( step sb - 4 ), and the atm terminator 2 receives them to confirm transmission of the cell count value ( step sa - 4 ). accordingly , the atm terminator 2 resets and initializes the count value in the charged cell counter 20 by the transmission of the cell count value ( step sa - 5 ). on the other hand , the call controller 4 releases path connection data due to the call termination ( step sb - 6 ). then , the controller 4 edits the billing data according to the call control data in the subscriber table and the cell count value ( step sb - 7 ), and transfers the edited billing data to the billing data collector 5 ( step sb - 8 ). therefore , the call controller 4 initializes the billing data and the call control data in the call control memory 40 ( step sb - 9 ). the billing data transferred from the call controller 4 is stored in the data collector 5 ( step sc - 2 ), and is sent to the charging center 6 at predetermined intervals . by the above - described procedure , the call controller 4 collects the cell count value from the atm terminator 2 every time of the call termination on a normal status . thereby , it becomes possible to edit the billing data . by the way , the initialization is executed when failures occur , and the call controller 4 resets the atm terminator . the cell counter , i . e ., a counter function included in the atm terminator 2 , is normally initialized by this reset operation . therefore , the counted value of the cells is unconditionally aborted on initialization . thereby , it becomes impossible to edit the billing data . it is a key of the present invention to overcome the above - described shortage . fig3 a to 3c are operational flowing charts of one embodiment according to the present invention . those are corresponding to the operational flowing charts for collecting the billing data shown in fig2 a to 2c . they show an operation for collecting the billing data by removing only the cell counter 20 from the parts to be reset on the reset operation in the atm terminator 2 on initialization . fig3 a shows an atm termination processing executed by the atm terminator 2 , fig3 b shows a call control processing executed by the call controller 4 , and fig3 c shows a billing data storing processing , which are the same as those shown in fig2 a to 2c . an operation in the call controller 4 is executed according to a processing program stored in the memory area 401 shown in fig4 and the controller 4 detects the initialization at first ( step sb - 10 ). when the initialization is detected , the controller 4 initializes operation and administration data stored in the data memory 402 of the call control memory 40 except the call control data ( step sb - 11 ). then , the controller 4 requests the atm terminator 2 to reset all the parts except the cell counter 20 ( step sb - 12 ). in reply to this request , the atm terminator 2 resets statuses of all the parts except the cell counter 20 ( step sa - 10 ). the call controller 4 leads connection data from the call control data ( step sb - 2 ). the controller 4 request the atm terminator 2 to read the count value of the billing cell counter 20 according to the led connection data ( step sb - 3 ). the atm terminator 2 receives the request for reading the billing cell count value ( step sa - 1 ), and reads the cell data corresponding to the connection data in the cell counter 20 ( step sa - 2 ). the atm terminator 2 transfers the read cell data , i . e ., the cell count value , to the call controller 4 ( step sa - 3 ). the call controller 4 receives the cell count value ( step sb - 4 ). then , the call controller 4 sends a notification for confirming to receive the cell count value from the call controller 4 ( step sb - 4 ), and the atm terminator 2 receives the cell count value to confirm the transmission of the cell count value ( step sa - 4 ). then , the atm terminator 2 resets and initializes the count value of the billing cell counter 20 according to the confirmation of transmitting the cell count value ( step sa - 5 ). on the other hand , the call controller 4 releases the connection data due to the call termination ( step sb - 6 ). then , the controller 4 edits the billing data according to the call control data in the subscriber table and the cell count value ( step sb - 7 ), and sends the edited billing data to the billing data collector 5 ( step sb - 6 ). at last , the call controller 4 initializes the billing data and the call control data in the call control memory 40 ( step sb - 9 ). the billing data transferred from the call controller 4 is stored in the data collector 5 ( step sc - 2 ), and is transferred to the charging center 6 at regular intervals . the cell count value for editing the billing data in the reset operation on initialization is removed from the values to be reset on the step sb - 12 , as mentioned above . this means that the cell counter value is saved in the atm terminator 2 , which is switched to a standby group . thereby , it becomes possible to create the billing data with the same procedure as that on the call termination . that is , the billing data is not created by the data evacuated by the call data save function on the initialization . it is possible to obtain the billing data that has high reliability on resuming and create the billing data by freezing the data included in the atm terminator 2 and the call controller 4 in a real time . fig4 shows other embodiment of the present invention . in fig4 the atm terminator 2 and the call controller 4 are shown as extracted from the structure shown in fig1 . the atm terminator 2 and the call control memory 40 in the call controller 4 are duplicated as active ( act ) and standby ( sby ) groups . fig4 shows a status that the active atm terminator 2 is switched to a standby group because of a fiber failure . in the embodiment shown in fig4 it is possible to use the data frozen as temporary call data for collecting and charging the data frozen on the standby group side by switching the duplicated device from the active group to the standby group . in the active group , a normal service can be resumed , and the standby group executes the relief processing of the billing data on the initialization . thereby , it becomes possible to relieve the billing data without losing the service . fig5 shows a structure of the call controller 4 including a call control processor 41 and a call control memory 40 . the memory 40 further includes a processing program memory area 401 and a data memory area 402 . the call control processor 41 executes the processing program stored in the processing program memory area 401 in order to freeze the cell count value on the initialization , and read the frozen cell count value sent from the standby group as well as to execute call control processing on a normal state . the data memory area 402 stores the call control data corresponding to each subscriber , and also stores the cell count value read out and transferred from the atm terminator 2 . the operational flowing chart will be explained here . the active atm terminator 2 in which the cell count value is frozen is switched to the standby group , and the call control memory 40 in which the call control data in the call controller 4 is frozen is switched to the standby group . after switching the groups in this way , the call controller 4 retrieves a call employed on the initialization from the call control data stored in the call control memory 40 at first and extracts the control data ( step 1 ). the cell count value corresponding to the cell counter 20 in the atm terminator 2 is read according to the call control data extracted on the step 1 ( step 2 ). further , the cell count value read on the step 2 is combined to the call control data to form the billing data ( step 3 ). further , the billing data formed on the step 3 is transferred to the charging center 6 through the billing data collector 5 ( step 4 ). after collecting the billing data from the sby groups in this way , the cell count value frozen in the sby group and the call control data can be initialized . in this way , it is possible to execute a normal service employing the act group on the call processing after resuming , because the standby group is employed on the relief processing of the billing data executed in the duplicated system according to the present invention . as described above , there is a case where a call on initialization is double charged according to a status of the appropriate call after creating the billing data and before the cell count value is initialized in a system for initializing the atm terminator after creating the billing data on the call termination . fig6 is an explanatory diagram for showing the status . in fig6 to 6 respectively show statuses when generating each call . further , i means that the data exists in the corresponding device , and ii means an idle status . therefore , for example , in fig6 the status 1 shows the cause where only the cell count value in the cell counter 20 of the atm terminator 2 and the call control data in the call control memory 40 of the call controller 4 exist . in fig6 the billing data has been already created and transferred to the billing data collector 5 on statuses 4 to 6 . when initialization is executed in this point , the cell count value is frozen , and the billing data is created again . this means double charging . however , on the status 6 , even if the billing data is constructed , the billing is not charged double because there is no more call control data so that there is no link to the call control data . then , the call control data is masked until becoming to the status 6 in order to prevent the charge from being double on the statuses 4 to 6 . thereby , it becomes possible to prevent the charge from being double similar to the status 6 because there is no call control data . a program stored in the processing program memory area 401 shown in fig5 can execute the mask control . fig7 shows a case before creating billing data for cells on the initialization and after initializing the cell count value in fig6 . the atm terminator 2 has been already initialized , and there is no data . in this case , the read out cell count value is treated as call control data . even if there is no cell count value in the cell counter 20 of the atm terminator 2 , the cell count value is secured on the initialization . fig8 a to 8c show diagrams explaining a case where a communication failure occurs between the atm terminator 2 and the call controller 4 so that it becomes difficult to read the cell count value . when a communication failure occurs between the atm terminator 2 and the call controller 4 , it becomes impossible to read the cell count value . then , the atm terminator 2 on which the cell count value is collected on restoring the communication is switched to the standby group . in here , the call control data is frozen on the call controller side and forms the billing data by reading the cell counter on the standby group from the data . thereby , it becomes possible to relieve the billing data on encountering the communication failure . fig8 a shows a normal status before the communication failure occurs . then , the active atm terminator 2 and the call controller 4 count the number of the cells in a real time . on the contrary , fig8 b shows a disconnected status . in this status , the call is disconnected by the failure of a communication path 8 , and therefore , the cell count value can not be read out . then , the corresponding call control data is frozen until restoring the path failure . further , the cell counted act group on the path failure is switched to the sby group . therefore , it is possible to execute a normal service if the act group and construct the billing data according to the call control data frozen in the sby group . in here , there is a possibility to loose the billing data when an operator switches the duplicated device under relief processing of the billing data as other problem . then , it is possible to inform the problem and warn the risk . for example , the operator requests to switch the group of the atm terminator 2 while relieving the billing data . when the system can confirm that the relief processing of the billing data is now executed , the system inquires the operator whether or not the group should be switched even while relieving the billing data before switching . when the operator still requests to switch the group , the group is switched and the billing data of the switching system is initialized . when the operator stops switching the group according to the warning , the group is not switched and the relief processing of the billing data is continued . it is possible to execute the above - described processing by the processing program stored in the processing program memory 401 of the call controller 4 . it is also possible to output the status for relief processing of the billing data according to the request of the operator . however , while executing the relief processing of the billing data , the status on relieving the billing data can be indicated . the outputted data is as follows : ii . when requesting the indication of the billing data while relieving the billing data , a ratio for performing the above described i or the relieving processing is calculated and outputted . iii . when finishing to relieve the billing data , the date when the cells are finished to relieve is pooled . iv . when requesting the indication , the above described data pooled in i and iii are outputted . furthermore , it is possible to inform the above - described pooled data on completing to relieve the billing data . then , the date of the completion of the relief processing is pooled and the pooled data is edited and informed , simultaneously . as described according to the embodiments employing the present invention , a relief system of the billing data in which the billing data can be relieved on resuming in the atm switching system is provided . it is possible to provide a relief method of the billing data in which the billing data can be relieve don initialization in the atm switching system composed of an exclusive device for collecting the billing data , i . e ., the number of the cells , and a call controller . the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the present embodiment is therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .
| 7 |
fig1 a to 1d show a fluid storage space 1 that is designed as a round basin , with an inlet 2 to the fluid storage space 1 and an opposite - positioned outlet 3 of the fluid storage space 1 the high point 4 of the basin floor 5 of the fluid storage space 1 is located in the middle of the round basin . along the outer wall 6 of the round basin runs a rinsing sump with a dry weather guttor 7 . in the middle of the basin , i . e ., in the region of the high point 4 of the floor , is a vertical pole 8 connected to the basin floor 5 , the pole bearing a container 9 that is open above and below , i . e ., is designed as a circular ring wall . on the inside the container has bearing supports 10 , that are connected to a bearing bushing 11 leading to the pole 8 . a latching element 12 , whose specific construction will be described later . is located on pole 8 and , with the container lowered , grasps from behind the bearing bushing 11 , as is shown in fig1 a to 1e . a controlling float 13 located in the region of the outlet 3 and of the rinsing sump with dry weather gutter 7 controls the latching element 12 via a hydraulic arrangement 14 along with hydraulic conduit 15 . fig1 a shows the condition in dry weather . in dry weather the accumulating water runs through the basin 16 along the rinsing sump with dry weather gutter 7 . for better recognition this is represented as a dashed line in the drawings of fig1 a to 1d in the region of inlet 2 and outlet 3 and of the rinsing sump with dry weather gutter 7 . as is to be inferred from the representation of fig1 a , the container 9 rests with its lower edge an the basin floor 5 and the controlling float 13 in lowered . with a slight accumulation of fluid in the fluid storage space 1 , i . e ., before the fluid gets up to the region of the container 9 , the controlling float 13 is slightly lifted and it activates latching element 12 . which consequently holds the container 5 firmly in this position . with a further accumulation of water as shown in fig1 b , storage fluid flows through a check valve 17 in the lower region of the container 9 and flows into it , whereby the storage fluid in the storage fluid space and the rinse fluid in the container 9 adjust themselves to the same fluid level . the controlling float 13 is lifted further and is flooded over . if the fluid state in the storage space again sinks , for example after a rain event , the fluid storage space 1 empties , and the fluid in the container 9 is retained , since the container was held back during the rise by the latching element 12 . fig1 c shows the conditions in nearly dry weather and with the again lowered controlling float 13 . if the controlling float 13 is in its lowered position , it controls the latching element 12 by means of the hydraulic arrangement 14 , by which this element is shifted into its unlatched position , and the container 9 is abruptly raised up . this occurs because the container displays at its lower region a steplike extended flat section 18 , from which an upward force component results that raises the container 9 . the result is that the contents of the container 9 abruptly gush out radially as a rinsing torrent toward the surrounding container wall 6 . finally the container 9 sinks again and with a new inflow of fluid it is latched in the fluid storage space 1 . fig2 a to 2d show a variant in which a damping element 20 is provided for , that hinders the abrupt sinking of the container 9 from its maximum raised position , so that the outflow of the contents of the container can occur at the optimal rinsing flood . fig2 a shows the filled container 9 shortly before emptying . the damping element 20 is attached between the upper end of the pole 8 and one of the bearing supports 10 . fig2 b shows the raised container 9 and the rinsing flood 19 released form it . the construction of the damping element 20 is illustrated in detail in fig2 c and 2d . a piston shaft 21 connected to the bearing support 10 passes through an opening in the cylinder 22 connected with the upper end of the pole 8 . the piston 23 arranged in the cylinder 22 is formed as two wings , where the two wings 24 are pivoted at the upper end of the piston shaft 21 and are swingable in the direction of the piston shaft 21 , a plate 25 arranged in the region of the end of the piston shaft 21 represents a stop for the wings 24 . this design 1a conditioned on the fact that with the raising of the container 5 the wings fold up , and the damping element 20 does not function . while with the lowering of the container 9 the wings 24 swing into their tended position whereby the container 9 can only sink slowly since only a low - volume stream can flow between the free ends of the wings 24 and the cylinder wall . in principle any kind of damping elements are possible , for example , shock absorbers , springs fig3 shows a plan view of the round basin 16 . the implementation form represented there is supposed to illustrate in particular that the container 9 can show any cross - section whatever , for example rectangular . fig4 illustrates the hydraulic arrangement 14 in the fluid storage space 1 in an enlarged representation depicting only the edge and the middle . there the motion of the controlling float 13 is transferred via its float arm 25 , shown in two positions , to a piston shaft 26 of a hydraulic cylinder 27 , by which , by way of the hydraulic conduit 15 , the hook - form latching elements 12 connected to the floor of the basin 5 are opened , to which elements the hydraulic cylinder 28 are assigned . the hook - form latching elements 12 in their latching position grasp from behind hook - form upward - oriented extensions 29 that are arranged in the lower region of the container 9 , at the basin floor 5 in the region in contact with the lower edge of the container 9 iron plate 30 or similar are introduced to form a flat surface intended for the dealing components . in this variant , in contrast to the implementation form according to fig2 a and 2b , the container is not provided with pressed - out buoyancy - generating sections 19 , but instead of this a float 31 surrounding the bearing bushing 11 is attached to the bearing bushing 11 placed on the bearing support 10 , which float produces the bouyancy of the container 9 . in principle , a pneumatic control can likewise be used in place of a hydraulic control . fig5 a and 5b show the container depicted in fig4 in an enlarged representation and for two operational states . fig5 a illustrates the filled container 5 with latching elements 12 positioned in the latched position . fig5 b illustrates the latching elements 12 in their un - latched position and the container 9 raised by means of the float 31 , with the rinsing flood 19 coming forth from this container . in the representation in the preceding figures and likewise in the following figures , the marking in of the means for the filling of the container 9 is mostly dispensed with . in the explanation of the representation in fig1 a through 1d , it was already pointed out that this filling can take place in each case via a checking shutter 17 located in the lower region of the container 9 which will yet be explained in detail below . the filling can also come about through the fact that upon the accumulation of fluid in the fluid - storage space 1 the container 9 is flooded over , so that the stored fluid enters this container 9 through its open top side . it is also conceivable to fill the container from above by means of a supply conduit , as far as possible in a free fluidfall . fig6 a and 6b show a container variant modified with respect to the implementation form according to fig5 a and 5b . here the container 9 in of a two - piece design with an upper container section 32 , which is situated stationary on the basin floor 5 by means of supports 33 , an well as with a lower container section 34 ; a bellows 35 joins the two container sections 32 and 34 together , as was previously described for the implementation form according to fig5 a and 5b , in the implementation , form according to fig6 a and 6b the lower container section 34 is guided via supports 10 and the bearing bushing 11 on the pole 8 connected to the basin floor 5 so as to be raisable and lowerable , and shows the same latching mechanism . fig6 a shows the filled container 9 . with an emptied fluid - storage space 1 the latching elements 12 are swung into their open position and the float 31 surrounding the bushing 11 raises the lower container section 34 until the bellows 35 is fully compressed , whereupon , in consequence of the abrupt lifting of the container section 34 , the rinsing flood 19 is again discharged underneath the container 9 , as illustrated in fig6 b . the implementation form according the fig7 a and 7b illustrates a container 9 that is round or angular in cross - section and is hinged on one side and can thus be tipped . the container 9 is swingably seated on one side on a bearing 36 connected to the basin floor 5 . at the opposite side are arranged one or several latching elements 12 for the latching of the container 9 . the latching elements are formed in a manner corresponding to those of the implementation form according to fig6 a and 6b and are correspondingly controlled . inside , the float 31 is attached to the container 9 in the region of the latching element or elements 12 at the greatest possible distance from the bearing 36 . this implementation form thus requires no poles 0 for the seating of the container 9 , fig7 a shows the filled container with the latching element 12 in the latched position . fig7 b shows the opened latching element 12 and the container 9 swung around the axis of the bearing 36 by means at the float 31 . as well as the rinsing flood 19 coming forth from the container 9 . fig8 a and 8b show a configuration modified with respect to the implementation form according to fig7 a and 7b . the container has lateral shutters 38 . fig8 a shows the filled container 9 with the lateral shutters 32 . fig8 b illustrates the unlatched , upward - swung container with the corresponding shutter 38 , which rest with their lower edges on the basin floor 5 and cover over the side opening of the container 9 . with such a swingable arrangement of the container 9 the rinsing flood discharges in a controlled manner in one direction . in principle the possibility could exist of dispensing with one of the shutters 38 . fig9 a through 99 illustrate a variant of the container 9 guided by means of a pole 8 , which variant has no float 31 and also in not controlled by means of a control float 13 . and likewise required no latching elements 12 . here the container wall of the container 9 has a double - walled design , so that between the two container walls 41 and 42 a ballast tank 43 is formed . this rank is provided above with an opening , into which a check valve 44 is inverted that permits an outflow from the ballast tank 43 , lead through the ballast tank in its lower region is a connecting piece 45 , whose opening , projecting into the container interior , in closable by means of a checking shutter 17 . the filling of the container with storage - space fluid takes place via the connecting piece 45 , just an this filling was described for the implementation form according to fig1 a through 1d . from the lower end of the ballast tank a water conduit 46 and above this an air duct 47 lead to a rinsing sump with dry weather gutter 7 in the region of the outlet 3 . fig9 b illustrated that with this implementation form the ballast tank 43 has a ring - shaped cross section . fig9 c shows the relationship of stored fluid in the storage - fluid space 1 to that in the container 9 when accumulation has taken place . the storage - space fluid enters into the container 9 through the connecting piece 45 and the checking shutter 17 , and at the same time the storage - space fluid enters into the ballast tank 43 through the water conduit 46 , the air located in the ballast tank being able to escape upward through the check valve 44 . in this way the same fluid level appears in the fluid - storage space 1 , in the container 9 , and in the ballast tank 43 upon accumulation . if the fluid level in the fluid - storage space 1 sinks , then the rinse fluid in the container 9 and the fluid in the ballast tank 43 are held back , since neither the water conduit 46 nor the air duct 47 is it contact with air and the check valve is closed . only when the fluid level in the fluid - storage space 1 has sunken far enough that it is below the level of the air duct 47 , as it shown in fig9 d , does air reach the ballast tank 43 via the air duct 47 , whereupon the fluid can flow out of the ballast tank via the water conduit 46 . with this the container 9 becomes as a whole lighter and the fluid located in the container 9 can raise the container above the surface section 18 arranged in the region of the lower end of the container 9 and already described for the implementation . form according to fig2 a and 2b , as shown in fig9 e . with this the rinse fluid held back in the container 9 can run out as a rinsing flood 19 . with the implementation form according to fig1 a and 10b the container is formed by a cylindrical , thin - walled container wall 90 and a container bottom 91 . the container bottom 91 is designed as a circular plate with a surrounding edge section 92 that rests upon the storage - space floor . positioned centrally in the container floor 91 it the pole 8 extending perpendicular to this , on which pole is guided the sliding bearing bushing 31 , which takes up the container wall 90 via the supports 10 the implementation form according to fig1 a and 10b thus differs from the implementation form according to fig5 a and 5b only by the fact that , instead of the sealing of the container 9 through the basin floor 5 , a container bottom 91 is now arranged . with the implementation form according to fig1 a and 10b the extensions 29 are accordingly attached to the container wall 90 and the latching elements 12 are situated with the hydraulic cylinders 26 on the container bottom , which also accepts the iron plate 30 that produces the sealing effect . fig1 a shows the container wall 90 in the lowered position with the container filled . fig1 b shows the container wall 90 in its position raised form the container bottom 91 in the end phase of the rinsing process . fig1 a and 11b show an implementation form in which the container 9 is not raised for rinsing , but is lowered . here the begin floor 5 shows a pedestal - like elevated point 4 that serves to support the container 9 . arranged on the pedestal 48 at its upper region are latching elements 12 that can be extended out radially towards the outside , as was described , for example , for the implementation form according to fig1 a through 1d . the container 9 supports itself on these elements in their extended position . the container in surrounded in the region of its upper edge with a ring - shaped float 31 . with a fluid accumulation in the fluid - storage space , the container 9 . situated in fig1 a in its sunken position , is raised up , and when the container 9 reaches the raised - up position reproduced in fig1 b the latching elements 12 disengage , for examples in consequence of spring force . stops , not shown in detail , prevent the container 9 from rising yet further upon a further accumulation of fluid in the fluid - storage space 1 . the rising fluid enters the container 9 over its upper edge . if the fluid level in the fluid - storage space 1 sinks to the level of the float 13 , which is illustrated in fig4 by dashed lines , the latching elements 12 are then moved into their opened position shown in fig1 a and with this the rinse fluid located in the container 9 streams outward radially as a rinsing flood . during this , the lower region of the container 9 in its sunken position enters into a depression formed as a ring in the basin bottom 5 . if the fluid level in the fluid - storage space 1 rises , then , at the point the the float 13 reaches the position drawn in solid lines in fig4 the unlatched position of the latching elements 12 is canceled , so that these elements , under the force of the springs , press against the inner wall of the container 9 and then , when the container 9 in raised far enough , those elements rest under the container . the cross section of the container pedastal 48 is , for example , of circular form , as is that of the interior container space . fig1 a and 12b show , similarly to the representation in fig1 a and 11b , a container 9 with which the rinsing fluid held inside is let out by means of a sinking of the container . here the container 9 is designed as a bellows connected to the float 31 in the region of its upper end , the float 31 being guided vertically outside or inside by guide rods 49 , in the region that does not serve for guiding , the guide rods are provided with support extensions for latching elements 12 . which grasp the float 31 underneath in its raised position , in which position the bellows container 9 is extended . fig1 a shows the float 31 sunken with the bellows container 9 arranged sealed between this and the basin floor 5 , which container is collapsed . in the sunken position of the container 9 , the container surrounds the container pedestal 48 , which by virtue of the bellows form of the container 9 has a lower height than the container pedestal 48 according to the implementation form in accordance with fig1 a and 11b . with a fluid accumulation in the storage space 1 the float 31 rises and extends the bellows container 9 . as soon as the float 31 reaches the level shown in fig1 b , the latching elements 12 , which are controlled by the hydraulics , grasp the float 31 underneath . since the container 9 is firmly connected to the container pedestal 48 , no stop is necessary to limit the extending motion of the container 9 . with an adequate fluid accumulation in the fluid - storage space , the container is flooded over and , as was described for the implementation form according to fig1 a and 11b , fluid enters into the container 9 . if the level in the fluid - storage space 1 sinks in the above - described sense , then the latching elements become unlatched and the float , together with the collapsing bellows container 9 , falls suddenly downward , no that the rinse fluid flown out in a rinsing flood . it is within the scope of the invention that the features described for the individual variants be combined with each other . the possibility of combination is valid in particular with respect to the hydraulic control of the container or its parts , to the damping of the movement of the container sinking towards its closing , and to the possibility that variants in which the container or parts of the container are raised up in order to discharge the rinsing flood can , instead of this , as well a be sunken in order to discharge the rinsing flood . the invention is not limited to round or curved implementations of the container or of its parts , but includes also angular configurations .
| 4 |
the drill bit shown partially in fig1 , 2 and 3 comprises a shaft 90 , with geometric axis of rotation 10 , there only being shown an end portion thereof which includes a pocket 50 in the form of a forwardly - open , i . e . in the direction of the bottom of fig1 , diametrical slot . unless otherwise stated , in this description , references to axial or radial orientation are with reference to axis 10 . similarly , the โ forward โ direction herein is the functional direction of the drill bit , in other words a direction running from its rear end towards its forward end , that includes pocket 50 . as can be seen better in fig2 and 3 , pocket 50 of fig1 is limited by two major lateral clamping surfaces 61 and 62 which are parallel and here axial , respectively belonging to two slightly flexible cheeks or jaws 63 , 64 , symmetrically opposed with respect to axis 10 . when fitting a cutting insert 9 into shaft 90 , the user will typically employ clamping surface 61 as a bearing surface , or base , against which the user will slide insert 9 to bring it to the desired registration position . in this embodiment , jaw clamping is achieved using a radial screw 18 , with geometric axis 80 a , the body of which passes freely through a passage 66 in jaw 64 , and a central hole 8 in cutting insert 9 , for engagement with a threaded hole 65 in cheek 63 . cutting insert 9 is consequently held in the diametrical plane defined by the two clamping surfaces 61 and 62 , but its orientation and position in this plane need to be set in advance , this corresponding to two degrees of freedom in translational motion and one degree of freedom in rotation . for practical purposes , we shall call the radial direction in this diametrical plane โ x โ and the axial direction , rearward directed , โ y โ. to facilitate flexing and bringing together of the two jaws 63 , 64 , an axial slot 92 , nevertheless optional , is provided in registering wall 53 delimiting the rear of pocket 50 , this slot extending widthwise between the two lateral walls of the rear registering wall 53 , whereby the two jaws 63 , 64 are functionally lengthened backwards by a corresponding amount thereby forming two elastically yielding gripping jaws , the anchor point or a point at which they pivot when flexing , being thus axially backward of pocket 50 . cutting insert 9 has one major supporting face 1 which can bear slidingly against clamping surface 61 , opposed to a major supporting face 2 , facing clamping surface 62 . abutment faces 1 and 2 each include a substantially axial groove 9 g with a rounded transverse profile for chip removal , groove 9 g of abutment face 2 extending over a rear registering nose portion member 39 , which consequently has a lesser thickness than the thickness of pocket 50 . shaft 90 similarly includes , in the rear extension of the two chip removal grooves 9 g , two flutes , respectively 90 g , 91 g running helically backwards . fig2 is a front view of the drill bit showing its shaft 90 and a larger diameter base rear portion for mounting into a tool . it will be seen that as a result of opposing flutes 90 g , 91 g substantially occupying two respective approximately 90 ยฐ sectors which each โ bite into โ a lateral edge of clamping surfaces 61 and 62 at each chip removal groove 9 g , the solid part remaining of the end portion of shaft 90 occupies two angular sectors , the radial direction of extension of one edge of which is inclined by about 30 ยฐ with respect to a normal to the clamping surfaces 61 , 62 . this inclination arises through the fact that screw axis 80 a is located in the back part of pocket 50 meaning that the two remaining solid material sectors , at the level of screw axis 80 a , have undergone rotation , as a result of the helical shape of the flutes 90 g , 91 g . axis 80 a of screw 80 is directed in this latter direction so as to be substantially in the center of the remaining material . for registration purposes , the rear ends of the two clamping surfaces 61 , 62 are united by the axially rearward registering wall 53 , constituting a rear abutment here extending in a radial plane with an overall direction of extension 40 . it will nevertheless be noted that , generally speaking , it is sufficient for registering wall 53 to have two mutually radial spaced portions which are at the least somewhat directed forwardly . provision could indeed have been made for registering wall 53 to have a lengthwise and / or thickness - wise direction of extension which is inclined on a radial plane . additionally , it could have been provided for registering wall 53 to be of any desired shape , in other words non - rectilinear and , for example , with a sequence of two mutually oblique segments , as its abutment function is limited to two remote portions . registering wall 53 includes a first portion for guiding registration comprising a radial and axial registering relief which here is formed by a relieved undercut portion or recess 49 in the form of a v - shaped notch or groove , i . e . female , with , here , branches which are concave when looking from the inside of the v . registering recess 49 forms a forwardly - open cradle and , in this example , has symmetrical branches i . e . their mean axis is axial , with thus branches that are generally inclined radially at two angles of the same value and opposite signs , and with a baseline 48 , here oriented thickness - wise in a circumferential direction , i . e . perpendicular to the plane in fig1 . the distance separating the peaks of the branches of the female v - shape represent the length of the first guiding registering portion . alternatively , baseline 48 can be oriented obliquely , in other words , in fig1 , the baseline can be tilted towards axis 10 and / or forwardly . the branches of the female v - shape respectively include first and second guiding registering lateral surfaces 41 , 42 generally situated at a radial distance d , starting from baseline 48 , from a third guiding registering lateral surface 43 which is part of a second portion of the registering wall 53 , at a diametrically opposed side . the first guiding registering surface 41 , which is the radially outer , is thus partially directed forwardly and partially towards axis 10 , in the direction of arrow 41 f , while the second guiding registering surface 42 , which is also partially turned forwardly , is partially directed away from axis 10 , in the direction of arrow 42 f , i . e . somewhat towards the first guiding registering surface 41 in this example . it will be noted that it is sufficient here for the two guiding registering surfaces 41 , 42 to be slightly turned one towards the other , meaning that it could be provided , alternatively , for one of the two surfaces to be axial , or even directed backwardly . in the latter case , the upward axial movement involved in bringing cutting insert 9 against guiding registering surface 41 or 42 would , if this surface were partially directed backwardly , be accompanied by a radial movement , for example by sliding over the forwardly directed guide registering surface 41 or 42 . we have called the first , second and third guiding registering surfaces , 41 , 42 , 43 , โ guiding surfaces โ as it is they which will bring the insert 9 up to its operating position . an intermediate , non - functional , lateral surface 44 which here is rectilinear and radial , joins the forward end edge of the second , radially inner , guiding registering surface 42 to a radially inner edge of third guiding registering surface 43 . registering wall 53 is limited radially by an optional radially outer lateral surface 45 , here radial , bearing in mind that the forward end edge of radially outer guiding registering surface 41 , could constitute an end portion of registering wall 53 . in this example , third guiding registering surface 43 extends right up to an opposite end . the major support faces 1 a 2 of insert 9 are linked by a rear positioning lateral registering face 3 adapted to co - operate with registering wall 53 , and by two diametrically opposed axial side faces 4 and 5 , as well as by two front side faces 6 , 7 at axially symmetric positions and including two respective cutting edges 6 a , 7 a forming a male v , in the plan view of fig1 , with the tip thereof on axis 10 . the two cutting edges 6 a and 7 a are respectively delimited by the two major support faces 1 and 2 , both being active for a predetermined direction of rotation about axis 10 , and linked by a short radial cutting edge of the forward tip 76 of insert 9 . it will be noted that we are dealing with a non - limiting example as the precise form of cutting insert 9 is not relevant to the invention . thus , the axial side faces 4 , 5 could be omitted or could delimit axial or axially inclined cutting edges for conical drilling , and the forward cutting edges 6 and 7 could for example together constitute a cutting nose with a rounded profile . similarly , when applied to a cutting tool of the milling type forming a wheel with a series of peripheral cutting inserts at the periphery thereof driven in circular translational motion and in which they would consequently not themselves be rotating about a virtual axis passing through them , the cutting edges would be all limited by one common major support face 1 or 2 . lateral positioning face 3 , extending generally in a radial direction of extension 30 has , close to one end , a first portion comprising a registering relief made up by v - shaped male nose portion 39 , here rounded , pointing backwardly with a back limiting curve 38 and , once in the registered position , having the same angle of opening and the same orientation as registering recess 49 . for the purposes of this description of the relative orientations of the various parts of cutting insert 9 , we have supposed that the latter has already become appropriately orientated , in other words that registering face 3 is backward and the direction of extension thereof , 30 , is radial . it can in particular be provided for the inclinations , i . e . angles of tilt in the direction of axis 10 , of limiting curve 38 defining the nose portion summit and line 48 at the pocket bottom not to be normal to the plane of the major support surfaces 1 and 2 , whereby the reaction force of registering nose portion 39 and its force of contact in registering recess 49 will set up a couple tending to cause insert 9 to pivot about a virtual axis parallel to axis 10 and passing through registering nose portion 39 , thereby tending to flatten a radially - opposite region of major support face 1 or 2 , close to lateral surface 5 , against the associated support surface 61 or 62 , the twisting couple thus set up ensuring better stability . registering nose portion 39 is radially limited , outwardly and inwardly , by first and second guided registering lateral surfaces 31 and 32 spaced along an extension direction 30 which is both local and general in this example , forming two radially separate branches of a male v - shape with its mean plane axial , the surfaces being directed at least partially in opposing senses with respect to direction of extension 30 , the radius of curvature of their convexity being substantially equal to the radius of curvature of the concavity of guiding registering surfaces 41 , 42 thereby coupling with them . what is now constituted is a cradle - shaped bearing facilitating eventual slight pivoting of insert 9 upon registration thereof . registering nose portion 39 thus constitutes an axis for pivoting . the distance separating the end of curvature of the arms of the male v - shape 31 , 32 , corresponds to the length of the first guided registering portion . the respective concave and convex shapes of registering recess 49 and registering nose portion 39 are such that there is only abutment at the facing registering surface branches 31 , 41 and 32 , 42 , meaning that a gap is left between line 38 defining the top of the relief and line 48 defining the base of the pocket . similarly , the forward lateral surfaces of registering recess 49 only constitute a widened mouth portion for facilitating placement of registering nose portion 39 , i . e . the two corresponding lateral surfaces , at the base of registering nose portion 39 are at a certain distance from the above mouth portion surfaces once the position of registration is achieved . registering face 3 further comprises a second registering portion constituted by a third lateral registering surface 33 generally situated at a distance d from registering nose portion 39 , in a radial direction in this example . the third registering surface 33 which should be directed at least partially forwardly to act as a rear abutment , is here of purely radial extension ( 30 ), in other words totally directed forwards . it could nevertheless be provided for the third registering surface 33 to extend obliquely with respect to radial direction 30 , i . e . functionally replacing one of the first and second lateral registering surfaces 31 , 32 , this surface then acting solely as a front abutment , in other words providing locally a clearance distance with respect to registering wall 53 . under these conditions , the choice of the precise relative position , on lateral registering surface 3 and / or the increased axial size , resulting from the heel portion , of third registering surface 33 , now oblique , makes it possible to determine also a local clearance distance opposite thereto . an intermediate lateral surface 34 , which here is rectilinear and radial , having no functional purpose , connects the radial inner edge of registering nose portion 39 to a facing radial inner edge of third registering surface 33 . registering face 3 is here bounded by an end lateral surface 35 , which here is rectilinear and radial , of small radial extension , in other words the distance โ d โ is preferably chosen to be relatively large with respect to the width of cutting insert 9 , typically at least 50 %, even 70 % or possibly even 80 %, to ensure good rear seating counteracting tilting . further , the possible presence of debris on one of registering surfaces 31 - 33 or 41 - 43 will not have the effect of axially amplifying , at the radial extremity 35 of registering face 3 , an error in axial positioning which the above registering abutment areas might exhibit . we can consider the first , second and third registering surfaces 31 , 32 , 33 as being โ guided โ since they will be guided by the surfaces 41 , 42 , 43 for โ guiding โ registering up to their desired operating position . in operation , cutting insert 9 is forced up against registering wall 53 by a reaction force transmitted by cutting edges 6 a , 7 a and 76 bearing on a workpiece , meaning that insert 9 acts like a transverse beam member supported at one end by registering nose portion 39 against first and second guiding registering surfaces 41 , 42 of recess 49 , and opposite thereto in the radial sense , by third guided surface 33 bearing against the third guiding registering surface 43 . to ensure axial clearance between the surfaces of each pair of facing nonfunctional surfaces 34 , 44 and 35 , 45 , one of either the third guided registering surface 33 or the third guiding registering surface 43 slightly projects axially with respect to the remainder of the relevant registering face or guiding registering wall , 3 or 53 , in other words is offset forwardly or backwardly , with respect to its general direction of radial extension 30 or 40 , in the direction of the other , here , it is the third guided registering surface 33 which is offset backwardly through a plateau - like extension forming a registering heel portion 33 t of which the rear surface forms the third guided surface . symmetrically , registering nose portion 39 is slightly longer than the axial depth of registering recess 49 , to ensure at least a minimum axial clearance . as discussed earlier , cutting insert 9 can be readily positioned by pushing it in the backward sense so as to cause registering nose portion 39 to enter somewhat into registering recess 49 . registering nose portion 39 now constitutes , in radial direction x , a radial centering pin so that third guided registering surface 33 comes up against third guiding registering surface 43 and occupies , at the opposite end , exactly the desired radial position when the first and second guided registering surfaces of registering nose portion 39 are respectively in contact with the first and second guiding registering surfaces 41 , 42 , and against which they bear . in particular , one useful manner of operation consists in forcing the registering nose portion 39 as far as possible into registering recess 49 even if cutting insert 9 is still not perfectly oriented ( axially ), after which insert 9 is pushed backwardly for instance at its forward pointed region 76 so that it is caused to pivot about registering nose portion 39 up until the third registering surfaces 33 and 43 come into contact . during this rotation , the orientation of registering nose portion 39 will approach the desired axial orientation so that registering nose portion 39 terminates its penetration movement as far as the bottom 48 of registering recess 49 . in this example , contact between registering nose portion 39 and registering recess 49 is established over a certain length of each branch of the female or male v - shape , with the exception of the region situated at the base of the registering nose portion which guarantees clearance . alternatively , contact at first and second registering surfaces 31 , 41 and 32 , 42 can be designed for a more punctual contact , for example along two respective lines generating a surface which are substantially parallel to the baseline of registering recess 48 , in other words perpendicular to the major supporting faces 1 and 2 . it will be also noted that it is not necessary for registering recess 49 , as in this example , to be a groove extending over a distance corresponding to the thickness of insert 9 . in other words , it is not essential for registering nose portion 39 to occupy the whole thickness of cutting insert 9 . generally speaking , the first , second and third registering surfaces 31 , 32 , 33 have a total registering surface which only makes up a small proportion of the surface of registering surface 3 of which they constitute a part . preferably , this proportion is less than 20 %, more preferably less than 10 % and even more preferably less than 5 %. when measuring each lateral guided registering surface 31 - 33 , in other words that surface region which is functional , we can suppose that the corresponding registering guiding wall 41 - 43 does have registering reliefs with surfaces with shapes and relative positions that exactly match those of the guided lateral registering surfaces 31 - 33 . additionally , as two of the lateral registering surfaces 31 , 32 are grouped together , the first registering portion that includes them preferably makes up less than 20 % of the total length of lateral surface 3 ( or alternative embodiments thereof ), and more preferably less than 10 %. intermediate lateral surface 34 linking the radial inner edge of second registering lateral surface 32 ( or alternative embodiments thereof ) with its facing radially inner edge of third registering surface 33 is of a length ( slightly less than overall distance d ) preferably making up at least 50 %, more preferably at least 70 % of the total length of lateral surface 3 of which they are a part , even more preferably at least 80 %. it is thus this length which mutually separates the first and second guided registering portions . the cutting insert of fig4 , 5 , 6 and 7 is an alternative embodiments which differs from that of fig1 to 3 by the fact that the securing screw 80 with head 81 and body 82 only passes through shaft 90 a , behind cutting insert 9 a , with the result that the latter insert is shorter than cutting insert 9 . those functional parts which are unchanged here carry the same reference numerals as those in fig1 to 3 and those the shape of which has been modified carry the same reference numeral as originally , followed by the suffix a . the various functions remain unchanged and for the sake of conciseness , we shall not repeat the explanations regarding general shape , function and operation of the various parts . we shall here only discuss differences with respect to fig1 to 3 . the central hole 8 in insert 9 is here omitted with the result that cutting insert 9 a is now axially shorter than cutting insert 9 . in effect , as insert 9 or 9 a forms a beam supported at the back at two extremities of its lateral positioning face 3 or 3 a and gets pushed backwards by its tip i . e . at the midpoint of the beam , a central hole 8 would constitute a region of weakness , requiring a relatively long ( in the axial sense ) insert 9 . to avoid having to provide a central hole 8 in insert 9 , rear end axial slot 92 is here necessary . the jaw portions 63 a , 64 a now form two levers one opposite to the other of which it suffices to bring their two respective base portions together to bring the two free end portions defining pocket 50 a together , thereby clamping cutting insert 9 a . nose portion 39 a defined by the line 38 a has a rounded top profile , with first and second guided lateral registering surfaces 31 a and 32 a , for co - operation with the first and second lateral guiding registering surfaces 41 a , 42 a of the mounting cradle or recess 49 a in the form of an open - armed u - shaped recess or groove . the third lateral registering surface 33 a co - operates with the third lateral guiding registering surface 43 a provided in registering wall 53 a . fig7 is a front view of the drill bit with its shaft 90 a showing the pocket 50 a and the rear axial slot 92 , together with two flutes 90 g , 91 g .
| 1 |
while the invention is susceptible of various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the invention to the specific form disclosed , but , on the contrary , the invention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention as defined in the claims . a general description of the equipment necessary to cut and process raw potatoes into a desired shape is described in u . s . pat . no . 4 , 807 , 503 ( mendenhall ), the disclosure of which is incorporated herein by reference . as shown in that patent &# 39 ; s fig1 raw whole potatoes ( 17 ) are dumped into a water filled receiving tank ( 13 ). a food pump ( 14 ), usually a single impeller centrifugal pump , draws its suction from receiving tank ( 13 ), and pumps water and the suspended potatoes ( 17 ) from the tank into nozzle gun ( 11 ). the nozzle gun ( 11 ) functions as a venturi , which is used to accelerate and align potatoes ( 17 ) immediately prior to impinging upon the knives of a cutter blade assembly ( 10 ). the cutter blade assembly ( 10 ) thus cuts the potatoes into the desired shapes and sizes . the cut pieces ( 19 ) then enter into deceleration loop ( 18 ) which in effect is the second half of the venturi . the deceleration loop returns to a point above receiving tank ( 13 ) where the water and cut pieces ( 19 ) are deposited onto chain separator ( 20 ). the water passes through chain separator and returns to receiving tank . chain separator is typically an endless loop chain or dewatering shaker , which is used to mechanically remove the cut pieces from the hydraulic cutting apparatus assembly . referring initially to fig1 and 2 of the present disclosure , one embodiment of the present invention is shown . the present invention is an improved cutter blade assembly for cutting vegetable products such as potatoes . the cutter blade assembly 10 has a body 12 that defines an axial bore 14 . the body 12 has a first end 6 extending to a second end 8 . between the first end 6 and the second end 8 , the body 12 has a plurality of attachments that are configured to connect with blades ( shown in fig2 ) which cut material passing though the cutter from the first end 6 . in this embodiment , the body 12 is made up of pairs of tensioning trees 16 , 16 โฒ. the first end 6 of the device is configured for attachment to a product source such as a nozzle gun shown in the prior patent (&# 39 ; 503 ). the second end 8 is configured for attachment to a venturi cap 120 , which leads material from the cutting assembly into the deceleration loop described in the &# 39 ; 503 patent . fig2 shows an exploded , perspective view of the embodiment shown in fig1 . the cutter blade assembly 10 is shown resting upon a front inlet adapter plate 125 . in use , the cutter blade assembly 10 and the adapter plate 125 would be connected and oriented so as to receive vegetable matter in a carrier medium through a receiving opening 126 in the front inlet adapter plate 125 . after passing through the receiving opening 126 in the front inlet adapter plate 125 , the vegetable matter travels generally along the longitudinal centerline of the cutter blade assembly 10 through a staggered array of cutting knives 40 before exiting the cutter blade assembly 10 in pieces near the second end 8 of the cutter assembly 10 ( fig1 ). in the preferred embodiment of the present invention , the cutter blade apparatus (โ cutter โ) 10 has a body 12 , which is configured for placement about the opening 126 in the front adapter plate 125 and defines a first axial bore 14 there through . in use , vegetable matter to be cut passes through this axial bore 14 . a number of elongated blades 40 are mounted to the body 12 and are configured and placed so as to intersect a path of travel of a product through the axial bore 14 . the blades 40 are preferably arranged in a crisscrossing pattern and provide spaces between the blades 40 that define a desired cross - sectional pattern for the vegetable pieces to be produced . as vegetable material passes through the cutting assembly 10 , the impact of the vegetable material against the blades 40 results in the vegetable material being cut into pieces having the cross section defined by the spaces between the blades 40 . in the embodiment shown , the blades 40 do not interlock , but obtain rigidity and cut integrity through tensioning . the preferred blades 40 are relatively thin having a thickness of only 0 . 008 inches . this reduces the amount of material wasted by the cutting blades 40 and improves the overall functioning of the device . by stacking without interlocking , there is no unequal friction to cause separation of vegetable matter at the junction of the blade intersection . thus , the blades 40 cut rather than tear the material . this results in a higher quality product without the problems of so - called shattering or feathering . it is preferred that the elongated blades 40 be oriented generally perpendicular to the axial bore 14 , however angular intersections are also envisioned within the scope of this invention . the body or โ blade - mounting device โ 12 of the cutter 10 is configured to attach to the front inlet adapter plate 125 . this front inlet adapter plate 125 is configured for mounting the cutting blade assembly 10 within the processing equipment used to process and cut the vegetable matter . preferably , this is done by connecting the front adapter plate 125 to a nozzle gun . the front adapter plate 125 is also configured to connect with the blade mounting device 12 . in the embodiment shown , the blade mounting device 12 comprises a plurality of tension trees 16 , 16 โฒ attaching to and extending generally perpendicular from the adapter plate 125 . these tension trees 16 , 16 โฒ are configured to be mounted to the adapter plate 125 through the use of a fastener such as a plurality of screws or bolts which attach to the bottoms or bases 26 of the trees 16 , 16 โฒ. in the embodiment shown in fig1 and 2 , four tension trees 16 , 16 , 16 โฒ, 16 โฒ are provided . these tension trees comprising two sets of opposing pairs . parallel sides of opposing pairs of tension trees provide first blade mounting surfaces 20 and second blade mounting surfaces 30 for mounting the elongated blades 40 there between . the blades 40 are connected to the first blade mounting surfaces 20 and the second blade mounting surfaces 30 through use of first blade clamps 90 and second blade clamps 100 , which are held in place by fasteners such as screws and / or bolts . detailed views of the connection between the blade 40 and the first and second blade mounting surfaces 20 , 30 are shown in fig3 , 5 , and 6 and will discussed later in detail . a tension cap or โ anti - compression stabilizer ring โ 108 interconnects the tops of the trees 16 , 16 โฒ thereby holding the tops of the trees 16 , 16 โฒ a fixed or spaced distance apart . this keeps the tops of the tension trees 16 , 16 โฒ from tilting in towards the center of the axial bore 14 when tension is applied to the blades 40 , and when the blades 40 are impacted by the vegetable being cut by the blades . it is preferred that the tops 24 of the tension trees 16 , 16 โฒ be configured to connect with the stabilizer ring 108 through the use of a fastener , i . e . a screw or bolt . the flow of material through the cutter 10 is enhanced by a flow control sleeve or โ flow alignment control tube โ 112 having a plurality of blade insertion slots 114 defined within it . the flow alignment control tube 112 is inserted within the axial bore 14 to increase the laminar flow of material through the tension cutter 10 and to reduce the amount of turbulence and interference that occurs therein . the blade insertion slots 114 are configured to allow portions of the elongated blades 40 to pass there through and to form a cutting pattern within the axial bore 14 . by containing the flow of liquid and material to be cut within the flow tube 112 , the amount of turbulence within the liquid is reduced as is the amount of tension against the blade 40 caused by turbulence . the flow tube 112 also assists the vegetable material being cut to be funneled and channeled in the same direction thus allowing the cutting blade assembly 10 to function more efficiently . it is also preferred that a venturi cap 120 be mounted to the top of the trees 16 , 16 โฒ to compress the flow of liquid and material out of the cutting assembly 10 . the venturi cap 120 also assists to keep the cut strips of vegetable matter together in a mass as they exit the cutter 10 . this reduces the number of vegetable pieces that are off - cut , broken , or damaged , and keeps these pieces together as they exit the cutter 10 . this translates into a reduction in the number of less commercially valuable pieces and an increase in the number of high quality and commercially valuable pieces being produced . referring now to fig3 - 6 , detailed views of the connection between the blades 40 and the tension trees 16 , 16 โฒ is shown . the preferred elongated blade 40 has a width 17 , a first end portion 44 , and a second end portion 46 . the first end portion 44 is configured for connection with the first blade mounting surface 20 of the first tree 16 and the second end portion 46 configured for mounting to the second blade mounting surface 30 of the second tree 16 โฒ. as shown in the figures , some trees 16 , 16 โฒ may contain both first and second blade mounting surfaces . likewise , any combination of first and second blade mounting surfaces may be present on any given tree . a first end 44 of a blade 40 is configured to be connected to a first blade mounting surface 20 by a first blade clamp 90 . a mounting fastener 94 is utilized to attach the first blade clamp 90 and the first end portion 44 of the blade to the first mounting surface 20 through a mounting hole 50 located in the first end portion 44 of the elongated blade 40 . likewise , a second mounting fastener 94 is utilized to attach a second blade clamp 100 and a second end portion 46 of the elongated blade 40 to the second mounting surface 30 through a second mounting hole 50 located in the second end portion 46 of the elongated blade 40 . the mounting fastener 94 is configured to be adjustable so as to compress the end portions of the elongated blade 44 , 46 between the blade clamps 90 , 100 and the mounting surfaces 20 , 30 . when the first end portion 44 of the elongated blade 40 is pressed between the first blade clamp 90 and the first mounting surface 20 , the blade 40 is deformed and anchored in place by compression between a first crimping flange 92 on the first blade clamp and a correspondingly configured first recess 70 on the first mounting surface 20 . likewise , when the second end portion 46 of the elongated blade 40 is pressed between the second blade clamp 100 and the second mounting surface 30 , the blade 40 is deformed and anchored in placed by compression between a second crimping flange 102 and correspondingly configured second recess 80 defined within the second mounting surface 30 . then , after such a connection , the end portions 44 , 46 of the elongated blade 40 are crimped so as to form a first crimp 52 on the first end portion 44 and a second crimp 54 near the second end portion of the blade 46 . a perspective assembly view of the blade 40 with the resulting crimps 52 , 54 is shown in fig4 and a detailed , top view of the resulting crimps in the blade is shown in fig5 . these crimped portions 52 , 54 provide for increased surface area and interaction between the clamping mechanism 20 , 30 , 90 , 100 and the end portions of the blade 44 , 46 . by providing increased area and support to the blade 40 , the force of impact from vegetable matter along the blade 40 is dispersed along a broader area and less impact is absorbed by the blade portions nearest the mounting holes 50 , 50 โฒ. as a result , less fatigue of the blade 40 results , particularly in the area nearest the mounting holes of the blade , and the blade 40 remains tighter and in a desired position for a longer period of time . the ability of the blade 40 to maintain tension can be further facilitated by the presence of a blade tensioner 110 formed and configured for connection with the first mounting surface and the first mounting clamp 90 . while the following description is described in the context of the first mounting clamping 90 and surface mounting portions 20 , it is to be distinctly understood that such a description is not to be limited thereto but may be equally applied to the second clamping 100 and mounting structure 30 and surfaces . the blade tensioner 110 functions to maintain tension upon the blade 40 by providing an adjustable tensioning bolt 96 that is configured to pass through a first clamping device 90 and engage a tensioning dowel pin 48 . this dowel pin 48 is configured to interfit with a tensioning recess 60 that is formed within the first mounting surface 20 . by tightening the adjustable tensioning bolt 96 , the dowel pin 48 pushes blade 40 into the tensioning recess 60 and increases the tension on the elongated blade 40 between the first and second clamps 90 , 100 , and the first and second mounting surfaces 20 , 30 . this procedure enables a user of the device to adjust and maintain the cutting blades 40 on a cutting apparatus 10 in proper tension and alignment in order to provide maximum results . referring specifically now to fig5 and 6 , the preferred embodiment of the present invention , in use , clamps down the end portion of the blade 44 , 46 thereby inhibiting the ability of the blade to stretch when impacted , thus reducing the likelihood that the blade &# 39 ; s mounting holes will be deformed from their original circular shape . the result is a blade that maintains its tension better , thereby resulting in less chatter and less feathered product . while in the preferred embodiment , a right angled step that extends the entire width of the blade is formed into each of the ends of the blade , any and all other manner of deforming portions of the blade so as to laterally lock the blade are equivalents . fig6 shows a preferred embodiment of the blade tensioning mechanism 110 . when engaged , the tensioning bolt 96 is manipulated inwardly against a roll or โ dowel โ pin 48 , which in turn urges blade 40 around blade tension anvils 64 and 66 and into the tensioning recess 60 of the first blade mounting surface 20 . blade tension roll pin 48 preferably extends the full width of the blade 40 , and is of a sufficiently large radius to avoid unduly high bending stresses in the blade 40 at the point of contact with the roll pin 48 . blade tension anvils 64 , 66 are also rounded in the preferred embodiment to minimize stress concentrations in blade 40 , which if unchecked could lead to premature failure of the blade . although rounded roll pins 48 and tension anvils 64 , 66 tend to extend blade life , the invention is not limited thereto , and other profiles could be employed for the roll pin 48 and tension anvils 64 , 66 without departing from the scope of the invention . through utilization of the present invention , a first crimp 52 is created within the first end portion 44 of the blade by contact with a first anvil portion 76 of the first mounting surface 20 and a second crimp 54 is created within the second end portion 46 of the blade by contact with the second anvil portion 86 . in doing so , the mounting holes 50 , 50 โฒ are less likely to be elongated through use thereby helping the blade maintain its original length , thereby reducing chatter . when used in combination with a blade tensioner 10 , as shown , the tension upon the blades can be maintained and feathering and chatter reduced . while there is shown and described the present preferred embodiment of the invention , it is to be distinctly understood that this invention is not limited thereto but may be variously embodied to practice within the scope of the following claims . from the foregoing description , it will be apparent that various changes may be made without departing from the spirit and scope of the invention as defined by the following claims .
| 8 |
fig1 illustrates casing 10 which defines an annulus 12 around a valve housing 14 that is connected to production tubing that is not shown . the valve assembly 16 is shown in the closed position . the housing 14 has inlets 18 . primary seal 20 and backup seal 22 are disposed between the inlets 18 and the slots 24 on the sliding sleeve 26 . seals 20 and 22 are fixed in the housing 14 so that as the sliding sleeve 26 is moved either mechanically with a shifting tool ( not shown ) or hydraulically using control lines ( not shown ) the slots 24 will move past seal 20 so that the fluid can flow from the annulus 12 into inlets 18 and to or past the diffuser assembly 28 and into slots 24 of the sliding sleeve 26 and on up to the surface . the diffuser assembly 28 is axially retained between radial surface 30 on housing 14 and top ring 32 , a part of which can be seen in fig2 . fig2 is a close up view of the diffuser assembly 28 shown in fig1 . the assembly 28 is bookended by rings 34 and 36 with each having an exterior radial surface such as 38 shown on ring 34 . once the slots 24 get past seal 20 pressure in the annulus 12 represented by arrow 40 enters the annular gap between the sliding sleeve 26 and the housing 14 . the force from pressure represented by arrow 40 moves all the illustrated components axially so that initially radial surface 38 abuts an opposing and stationary surface 42 on ring 32 . there are pairs of rings 44 and 46 with sloping end walls 48 and 50 that face away from each other . rings 44 and 46 are essentially mirror image trapezoidal shapes in section . adjacent the ring pair 44 and 46 is another ring pair 52 and 54 . rings 52 and 54 have opposed end surfaces 56 and 58 respectively so that on application of an axial force from pressure represented by arrow 40 the diffuser assembly 28 shifts axially and opposed surfaces 48 and 58 on one side and surfaces 50 and 56 on the other side create a net radial outward force on rings 44 and 46 and a net radial inward reaction force on rings 52 and 54 . rings 52 and 54 are essentially mirror image trapezoidal shapes in section . it should be noted that rings 44 and 46 are manufactured to preferably be in an interference fit against the housing 14 on assembly although a clearance fit can also be used . the application of pressure represented by arrow 40 simply pushes rings 44 and 46 harder against the housing 14 . similarly , ring pairs 52 and 54 are fabricated to have an initial interference fit to the sleeve 26 although a clearance fit is also possible . force created by pressure represented by arrow 40 enhances the contact force to the sleeve 26 for the ring pairs 52 and 54 . preferably the pattern on rings that are forced toward the housing 14 is alternated with a ring pair that is forced against the sleeve 26 . it should be noted that ring pair 52 and 54 have opposed contacting radial surfaces 60 and 62 that are preferably perpendicular to the axis of the sleeve 26 . similarly , ring pair 44 and 46 has opposed radial surfaces 64 and 66 that are preferably perpendicular to the axis of the sleeve 26 . the surface pairs 50 and 56 on one side and 48 and 58 on the other side of the pair of rings 44 and 46 are shown at a preferred angle of about 15 degrees to a plane perpendicular to the axis of the sleeve 26 but a range of 0 - 45 degrees is contemplates . at 0 degrees there is no radial sliding component of force while at 45 degrees such radial force is maximized . the various rings are preferably made of a softer material than the housing 14 or the sleeve 26 to avoid scoring either of those opposing surfaces . the rings can also be coated with a lubricious material to facilitate radial movement and in that case can also be of a material that is harder than the housing 14 or the sleeve 26 . fig3 illustrates ring pairs such as 44 and 46 or 52 and 54 can be rotationally locked to each other using a combination of a projection 68 on ring 52 mating with a depression 70 on the ring 54 . the locking mechanism of projection with depression can be reversed and other types of rotational locks can be used within the spirit of the invention . the rotational locking serves to keep splits 72 and 74 on adjacent rings circumferentially offset . adjacent splits are preferably kept 180 degrees apart . end rings 34 and 36 are preferably not split but optionally can also have a split . while the figures show rotational locking only between pairs such as 44 and 46 or 52 and 54 , those skilled in the art can appreciate that ring pairs that move toward housing 14 can be optionally rotationally locked to ring pairs that move toward sleeve 26 which in effect locks all the split rings between end rings 34 and 36 together rotationally . as an alternative to having a split 72 or 74 which can incorporate butted ends cut in a plane going through the ring axis or on a skew so that the cut ends overlap , the ring can simply have a flexible portion in a complete ring to achieve the same effect . a part of the ring can have a sinusoidal component or an alternating bend pattern that allows the diameter to increase or decrease without undue resistance . the flexible portions can also be circumferentially offset and maintained in their relative positions in the manner described above . in some respect the locking feature of projection and depression can integrate some diametric flexibility that can allow elimination of the split or use in conjunction with the splits in the rings . if the splits in the rings are eliminated in favor of flexible portions on the rings then the rotational locking can be optionally omitted . as another option the rings can be made of a shape memory alloy which allows rapid assembly but on exposure to well fluids or other heat sources before initially moving the sliding sleeve 26 the rings can revert to an original shape that can have some rings moving toward sleeve 26 and alternating rings moving in an opposite direction toward the housing 14 . in that manner initial clearances on assembly are closed before operation of the sleeve 26 . those skilled in the art will appreciate that the described diffuser assembly can slow down or stop migrating fluid that can potentially damage the seal in a sliding sleeve valve . the assembly uniquely has multiple components . more specifically the components can be manufactured with a bias toward the sleeve or the housing and preferably in alternating patterns . the bias can either be created in the manufacture of the rings or the shape can change using shape memory material exposed to a temperature above a critical temperature to gain at least a clearance fit but preferably an interference fit before the valve is opened . if the rings are made of shape memory alloy they may not need to have a split but can have a flexible segment . additionally , ring pairs need not be used as the reconfiguration of each ring can build into that ring movement in the desired direction toward the housing or the sleeve on an alternating basis after the critical temperature is reached . the rings can be shaped to create radial forces toward the sleeve or the housing in response to an axial force created by fluid as the valve is opened . the rings can be split for rapid assembly with the splits circumferentially offset and the relative positions held by a locking feature so that adjacent pairs can be rotationally locked to each other . the split or some flexibility in a whole ring structure also allows the rings to compensate for dimensional tolerances in the moving sleeve during operation of the valve . optionally all the pairs whether urged toward the sleeve or toward the housing can be rotationally locked to each other or to end rings or an internal housing shoulder on opposed ends of the assembly . although ring pairs are illustrated as moving radially in a given direction toward the housing or the sleeve one or more rings can be used to move in a given radial direction instead of the pairs illustrated in the figs . while the application in which the diffuser assembly is discussed in a sliding sleeve valve , other applications where an annular space is sealed and the seal is exposed to fluid flow that can potentially damage the seal can be also situations where the diffuser assembly can be deployed . the above description is illustrative of the preferred embodiment and many modifications may be made by those skilled in the art without departing from the invention whose scope is to be determined from the literal and equivalent scope of the claims below :
| 4 |
in a broad form of the invention with reference to fig1 there is provided a camper trailer 10 based on an integral chassis platform 11 provided at its forward end 12 with an โ a โ shaped towing hitch frame 13 , hitch mechanism 14 adapted for articulated connection to a towing motor vehicle ( not shown ), wheels 15 and suspension elements 16 at its rear end 17 . in preferred embodiments wheels 15 are placed as far back as practicable so as to leave minimum overhang at the rear of platform 11 . this arrangement facilitates the negotiation of rough terrain and significantly reduces the swaying and bouncing of conventional mid - axle trailers when towed at speed over poor road surfaces . as well , due to the greater length between towing hitch 14 and the wheels 15 , the maneuverability of backing the trailer with a tow vehicle is improved . it is a particular object of the present invention that , in so far as is possible , weight distribution is concentrated in the area overlying wheels 15 and transaxle 18 , with the overall width , height and length comparable to that of mid - sized car for ease of garaging . thus as may best be seen in the plan view of fig2 , all kitchen area 19 equipment such as cooktop 20 , propane gas bottles 21 , refrigerator 22 , water tank 23 , battery storage compartment 24 as well as a spare wheel / s storage 25 are accommodated in this area . battery and spare wheel storage compartments are accessible from separate kitchen area cupboards of the trailer . kitchen area is provided with a benchtop work space fitted with a sink and water tap and a fold - out extension 60 for added bench space . also arranged in this area as best seen in fig1 and 4 is a system of overhead storage cupboards 26 some of which are accessible from the kitchen area 19 and some from the middle portion 27 of the trailer . the placement of the bulk of the weight over the rearward mounted wheels further ads to the stability of the trailer under tow . with reference to fig1 and 2 , in preferred embodiments the forward portion 28 of trailer 10 is provided with a bathroom area 29 having fixed side walls 30 and an openable upper portion 31 . bathroom area 29 is rounded both in plan section as shown in fig2 and at its openable upper portion 31 as shown in side elevation view of fig1 so as to minimize wind resistance when towing . this forward portion of trailer 10 is fitted with chemical toilet 32 , shower 33 and handbasin 34 facilities . additionally , forward portion 28 is provided with cupboard space disposed along rear wall 40 with a portion of this cupboard space being accessible from within middle portion 27 . openable portion 31 is in the form of a hinged access hatch 35 forming the roof and part of the front wall 36 of bathroom area 29 and extending downwardly along the front of the bathroom area sufficient to allow access by a user 37 by stepping over a low fixed front wall 36 . access hatch 35 is adapted to swing forwardly and upwardly into the position shown dashed in fig1 . in this position hatch 35 provides a roof over forward portion 28 at a height allowing a user 37 of the facilities to stand under it . hatch 35 preferably is urged into its open position by suitable gas struts ( not shown ) and is further be provided with attached canvas or other flexible sheeting so arranged as to depend from hatch 35 to provide privacy to a user . this sheeting is provided with a zippered door in the front . towing hitch frame 13 is provided with a small platform area 38 and fold - down steps 39 so as to allow easy entry into bathroom area 29 . it will be appreciated that this arrangement allows the toilet facility to be used without any setting up of the trailer for camping and while still attached to the towing vehicle 56 if required , as shown in fig5 . the middle portion 27 of trailer 10 is closed off from both forward portion 28 and kitchen area 19 by internal walls 40 and 41 respectively , and provides a permanent sleeping area . middle portion 27 is further provided with fixed flexible sheeting with zippered access panels and flyscreen sections at both sides . its roof 42 is fixed , forming a continuous structural element from internal wall 40 and extending to cover kitchen area 19 . middle portion 27 is sufficiently large to accommodate a standard queen - sized mattress 43 ( or two single mattresses ) with optional fold - out bunk - bed 44 suitable for a child . access to middle portion 27 is from either side of trailer 10 by means of swing - up panels 45 . panels 45 are hinged from roof edges 46 and , when urged into fully opened positions as shown in fig3 , provide roofed accommodation annexes 47 and 48 . panels 45 may be assisted into their opened positions by for example gas struts ( not shown ) and are provided with attachable canvas or otherwise flexible sheeting so as to form enclosing side walls 49 during inclement weather , and end walls 50 around accommodation annexes 47 and 48 . entry doors 51 in the form of zippered or otherwise secured flaps are provided in suitable positions in side or end walls to give access to the accommodation annexes 47 and 48 . with reference to fig4 , kitchen area 19 is constructed with fixed side walls 52 joining roof 42 . access to the kitchen area 19 and other equipment at the rear of trailer 10 is provided by hinged panel 53 as shown in fig1 . when in its opened position as shown by dashed lines in fig1 , panel 53 provides a covered work area 54 at the rear of the trailer . being placed at the rear of trailer 10 and accessible by the opening of panel 53 the kitchen area 19 is readily available for use even during short roadside stops . optionally , when set up for camping , flexible sheeting side and end walls may be attached to panel 53 as shown in fig5 so as to form an enclosed kitchen area . kitchen area 19 is provided with drawer slide arrangements 55 for access to refrigerator 22 . propane gas bottles 21 are accommodated in an enclosed drawer , vented underneath , which may be slid rearwardly for access to the bottles . spare wheel / s are accessible via an access door provided in the rear of the middle portion . all panels 45 and 53 and hatch 35 when in the closed position are lockable and , with all equipment contained within the body of the trailer , there is a reduced likelihood of theft or damage . the above describes only some embodiments of the present invention and modifications , obvious to those skilled in the art , can be made thereto without departing from the scope and spirit of the invention .
| 1 |
with reference to fig1 and 2 , a flashlight according to the present invention is shown . the flashlight is shown mounted on rechargeable battery 1 as shown and described in u . s . pat . no . 5 , 489 , 484 , hereby incorporated by reference . battery 1 includes cup - shaped positive terminal 1a at the center of the forward open end , and metallic outer casing 1b which defines the open forward end of the battery and serves as the negative terminal . the flashlight includes housing assembly 2 , turning ring 5 , head 7 and bulbholder assembly 8 . housing assembly 2 is disposed directly on the forward end of battery 1 . turning ring 5 is rotatably secured on the forward open end of housing assembly 2 . bulbholder 8 is supported within turning ring 5 . head 7 is secured upon turning ring 5 by screw - threading and is rotatable jointly with ring 5 . the flashlight utilizes conventional flashlight bulb 100 including a bulb base defined by outer cylindrical metallic terminal 102 having integral flange 101 . central terminal 103 extends from a bottom tip of the base and is surrounded by an insulator to isolate it from terminal 102 . with further reference to fig5 and 8 - 8b , housing assembly 2 further includes housing 20 including rearward cylindrical peripheral wall 23 having a rearward opening into which the forward open end of battery 1 fits . the forward end of the opening is defined by inner surface 24 which is contacted by the forward open end of battery 1 . central metallic rivet 22 is secured to and extends rearwardly from inner surface 24 and is received by positive cup - shaped terminal 1a . two peripherally disposed and bent tab - shaped terminals 21 also are secured to and extend rearwardly from inner surface 24 and receive outer metallic casing 1b of battery 1 . rivet 22 and tab - shaped terminals 21 include nubs which extend through openings in inner surface 24 to allow the circuit to be completed from the battery terminals to the opposite side of inner surface 24 . forward of inner surface 24 , housing 20 includes forwardly projecting cup - like flange 26 which has opening 26a formed in the periphery for a predefined arcuate and axial extent . bulb spring 27 is disposed in flange 26 and is linked in electrical contact with the forward nub of rivet 22 . bulb spring 27 forms a positive contact for central terminal 103 of bulb 100 . the extending nub of one of tab - shaped terminals 21 is linked in electrical contact with arcuate contact plate 28 which is disposed about flange 26 . with reference to fig2 a , terminal end portion 28a of contact plate 28 is hook - shaped and is located at the position of opening 26a , adjacent to bulb outer terminal 102 . contact plate 28 is biased radially outwardly such that terminal end portion 28a is out of contact with terminal 102 . contact plate 28 also includes radially outward projecting protuberance 28b disposed between terminal end portion 28a and the location where plate 28 is linked to the nub of tab terminal 21 . housing 20 also includes two vertical posts 30a and 30b disposed outwardly of flange 26 and extending upwardly from inner surface 24 . post 30a is disposed adjacent opening 26a and outwardly of hook portion 28a . post 30b is disposed generally opposite post 30a . vertical wall 29 also extends upwardly from inner surface 24 , and is integral with and extends outwardly from flange 26 . housing 20 includes forward cylinder wall portion 25 flaring outwardly from wall 23 , and extending forward of flange 26 . the forward end of wall portion 25 is open . arcuate undercut tabs 25a extend inwardly at opposite locations along the forward periphery of wall portion 25 . with reference to fig1 - 10c , turning ring 5 includes forward cylindrical wall 52 having outer screw - threading 52a . rearward of wall 52 , ring 5 includes integral larger diameter outer collar 54 and smaller diameter outer collar 55 which are axially spaced from each other so as to define an axial surface therebetween . two spaced arcuate recesses 56 are formed on opposite sides of this axial surface . ring 5 snaps into housing 20 with inward tabs 25a fitting within recesses 56 . recesses 56 extend for a greater arcuate extent than tabs 25a to allow limited rotation of turning ring 5 relative to housing 20 . ring 5 includes inner ledge 63 defining central opening 64 . two oppositely disposed pins 62 protrude into opening 54 from ledge 63 . arcuate rib 58 extends downwardly from ledge 63 on one side of central opening 64 . rib 58 has end surfaces 58a and 58b and includes lower horizontal portion 59 extending inwardly beneath opening 64 . horizontal portion 59 further includes inner vertical wall 60 which extends for a limited arcuate extent and terminates at end 58b . though not shown , a second arcuate rib may extend downwardly along the opposite side of opening 64 . though not visible in fig2 and 3 , rib 58 also is shown in the cross - sectional view of fig4 . as shown in fig2 a , when turning ring 5 is snapped onto housing 20 , rib 58 is disposed between vertical posts 30a and 30b . inner vertical wall 60 is disposed radially outwardly of contact plate 28 . the rotation of turning ring 5 relative to housing 20 is limited in either direction by contact of circumferential end surfaces 58a and 58b of rib 58 with vertical posts 30a and 30b . at one limit of rotation , one circumferential end surface 58a contacts vertical post 30b . at this position , vertical inner wall 60 terminates at a position which is closer to vertical post 30a than protuberance 28a , that is , inner wall 60 is not adjacent to the protuberance . however , rotation of ring 5 causes vertical inner wall 60 to move adjacent and past protuberance 28a , until the inner wall contacts post 30b . with reference to fig7 - 7c and 9a - b , bulb holder 8 is disclosed . bulb holder 8 includes bulb holder base 80 and retainer or locking ring 90 . base 80 includes a surface portion defining a central opening 84 having a radius which is slightly larger than bulb outer contact 102 , but less than the radius of bulb flange 101 . base 80 also includes two raised tabs 82 at opposite locations of the surface portion . tabs 82 include outward overhanging portions 82a at the upper ends . locking ring 90 includes central opening 96 of approximately the same radius as central opening 84 , and two arcuate slots 92 disposed at opposite circumferential locations . arcuate slots 92 have a substantially constant inner diameter , and a stepped outer diameter such that a portion of the slots have a reduced radial thickness . ring 90 also includes two fins 94 extending upwardly from the upper surface at opposite circumferential locations which are approximately 90 ยฐ from the locations of the slots . bulb 100 is secured in holder 8 by inserting the bulb base through opening 84 of base 80 , with bulb flange 101 resting on the surface . ring 90 is disposed upon base 80 , with the bulb lamp fitting within opening 96 , and raised tabs 82 including overhanging portions 82a fitting within the larger radial thickness portions of arcuate slots 92 . ring 90 is twisted relative to base 80 by grasping fins 94 , such that tabs 82 move within the reduced radial thickness portions of slots 92 . overhanging portions 82a are disposed above the surface of ring 90 to secure the ring on the base . ring 90 fits over bulb flange 101 , thereby securing bulb 100 in the axial direction within holder 8 . base 80 includes outer collar 81 extending downwardly from the surface portion and having a radius approximately equal to the radius of opening 64 in turning ring 5 . outer collar 81 includes helical cam slots 85 formed at opposite locations . slots 85 begin at openings in the lowermost surface of collar 81 , and extend laterally upwardly along the collar , terminating at the surface portion of base 80 . slots 85 cause the wall portions of collar 81 to have flexibility in the radial direction . the ends of flexible wall portions include outward tabs 81a . bulb holder base 80 also includes inner collar 83 disposed slightly outwardly of central opening 84 . inner collar 83 includes vertical slot 87 extending to the surface portion of the base . base 8 is secured in turning ring 5 by disposing outer collar 81 through opening 64 . the flexible walls are pressed inwardly to pass collar 81 through the opening . as shown in phantom in fig7 c , pins 62 extend within helical cam openings 85 . tabs 81a of the wall portions extend below ledge 63 of ring 5 . when turning ring 5 is disposed on housing 20 as described above , vertical wall 29 extending from inner surface 24 of the housing fits within vertical opening 87 of base 80 thereby precluding rotation of base 80 and holder 8 . therefore , rotation of turning ring 5 causes pins 62 to move laterally within helical cam slots 85 . since the vertical position of pins 62 is fixed , base 80 must move vertically ( axially ) up or down to accommodate rotation of pins 62 . retainer ring 90 and bulb 100 retained thereby move with base 80 . accordingly , rotation of ring 5 relative to housing 20 causes axially upward or downward movement of bulb 100 . with reference to fig4 and 5 , head section 7 includes screw - threaded bezel 70 , lens 74 and reflector 72 . bezel 70 includes inner recesses 70a and reflector 72 includes tab 72a about the periphery . by insertion of tab 72a in recesses 70a , bezel 70 , lens 74 and reflector are secured together , with the reflector held stationary in the vertical direction . this combined assembly is fixedly secured to ring 5 by the screw - threading . after bezel 70 is secured to ring 5 by rotating the bezel relative to the ring , further rotation of bezel 70 causes joint rotation of ring 5 . therefore rotation of bezel 70 causes axial movement of bulb 100 , as well as rotational movement of rib 58 . bulb fits within a central opening of reflector 72 , and moves axially relative thereto . in operation , as shown in fig2 and 2a , with the flashlight initially off , pins 62 are located near the open ends of helical grooves 85 , which is the lowest - most point in the vertical direction . bulb holder 8 is in the uppermost position relative to turning ring 5 , and bulb 100 is in the uppermost position relative to reflector 72 . bulb spring 27 is in an extended state so as to make contact with central contact 103 of bulb 100 . end 58a of rib 58 abuts vertical post 30b , and vertical wall 60 of rib 58 is disposed out of contact with protuberance 28b . accordingly , hook end portion 28a of contact 28 is biased radially outwardly relative to opening 26a of flange 26 , and therefore is not in contact with outer terminal 102 of bulb 100 . the circuit is open , and bulb 100 is not illuminated . with reference to fig2 b , bezel 70 and turning ring 5 are then rotated relative to housing 20 . the initial rotation causes inner vertical wall 60 of rib 58 to slide over protuberance 28b , thereby pushing protuberance 28b and hook end 28a of contact 28 radially inwardly . hook end 28a moves inwardly relative to opening 26a of flange 26 and contacts outer terminal 102 of bulb 100 to complete the circuit and illuminate the bulb . simultaneously , pins 62 begin to travel along helical groove 85 of base 80 , forcing base 80 to begin traveling downwardly . thus , bulb 100 begins to move downwardly relative to reflector 72 . at the time of initial illumination , bulb 100 is at the maximum spacing above reflector 72 . accordingly , the light is focused in a narrow beam or spotlight pattern . with reference to fig3 and 3a , bezel 70 and turning ring 5 may be further rotated until end 58b of rib 58 contacts opposite vertical post 30a . throughout the extent of this further rotation , vertical wall 60 of rib 58 is maintained in contact with protuberance 28a and bulb 100 remains illuminated . however , the continued movement of pins 62 in helical cam grooves 85 causes continued downward movement of bulb holder 8 and bulb 100 . as bulb 100 moves closer to reflector 72 , the reflected light is dispersed to a wider , unfocussed beam . throughout , the extent of axial movement , bulb spring 27 remains in contact with bulb 100 . the circuit may be opened by rotation of bezel 70 and ring 5 in the opposite direction . further rotation , which is opposite of the direction in which bezel 70 was rotated to secure it on ring 5 , will cause bezel 70 to be unscrewed from ring 5 . bezel 70 may be removed in this manner to allow access to retainer ring 90 of bulb holder 8 . retainer ring 90 may be rotated relative to base 80 by grasping fins 94 until the tabs 82 align with the thicker portions of slots 92 and removed from base 80 , allowing the bulb to be replaced . in the figures , housing wall 21 is shown as truncated , such that the user would hold battery 1 to use the flashlight . of course , the present invention also is applicable to flashlights in which the wall extends further along the battery so as to more completely surround - the battery , and if desired , entirely encase the battery .
| 5 |
on the transmit side , skew can be injected on a per - lane basis to compensate for any skew added by the system , such as field programmable gate array ( fpga ) startup conditions . this injected skew achieves compliancy as specified by applicable standards , such as sxi - 5 . to determine how much skew should be injected to meet these standards , the following algorithm is implemented . the present invention consists of n + 1 transceivers for the purposes of data transmission and reception . the system is designed such that a deskewing algorithm can be used to determine the necessary per - lane skew to be added for total lane alignment . the term โ deskewing algorithm โ, as used herein , refers to a calibration method to achieve total lane alignment with respect to a desired lane - to - lane skew goal , usually defined by standards such as sxi - 5 . these standards often specify skew related characteristics in terms of the unit interval , or ui . ui is calculated via 1 /( data bit rate ). the method uses an iterative process to determine the correct combination of skew injection parameters for each transmitting lane . in order to determine this suitable combination , skew is systematically injected into each lane . on the receive side , a feedback signal is necessary to give status updates as to alignment of the lane . this feedback signal may be specific to the particular lane or can be an aggregation of some or all of the lanes . when alignment is successful , the feedback signal will indicate this success , thus indicating that the correct amount of skew has been injected and proper deskewing has occurred . if the feedback signal is particular to a single lane , then the process of injecting skew will have to be performed for each lane . for an aggregated feedback signal , the process of injecting skew will occur on all lanes , as only one combination will satisfy the aggregated status . this process will take much longer as the search space of combinations will be much larger . the system of the present invention enables the deskewing of lanes through the use of a deskewing algorithm . the following examples will illustrate the workings of possible systems in more detail . these examples will deal with smaller 3 transceiver systems . the 3 transceiver example is easily expandable into an sfi - 5 system with 17 transceivers , or any other transceiver - based system . transceivers are herein referred to also as mgts ( multi - gigabit transceivers ). the following examples are set forth to gain a better understanding of the algorithm portion of the invention described herein . these examples are provided for illustrative purposes only and they should not limit the scope of this invention in any way . the system in this case has a feedback signal for each individual lane that reports on the successful , error - free reception of the data stream on that particular lane . error free reception is expected when an appropriate amount of skew has been injected on the individual lane relative to a reference lane . when one lane &# 39 ; s feedback signal reports the correct alignment , the process begins with the next lane , until all lanes have been aligned and thus deskewed . this system is shown in fig1 . in example 1 , there is a plurality of feedback signals โ one for each lane as illustrated in fig1 . the variables and constants used in this example are defined as : for the three mgt system , there is an out - of - alignment alarm for each lane , labeled ooa โ 0 , ooa โ 1 , and ooa โ 2 . each alarm will report an error should one occur on its respective lane . these alarms are expected to remain set if the correct alignment has not occurred , and are expected to clear within a specified time ( t ) if correct alignment has been achieved . the search space , s , refers to the maximum ui that a lane may be expected to be out of alignment . with reference to the applicable standard , there is typically a specification as to the maximum allowable skew tolerance in order to achieve compliancy with said standard . for the sxi - 5 standard , that maximum allowable skew tolerance between lanes is set at 5 ui . the search space interval , i , must be set at a value less than this skew tolerance . to achieve the fastest possible search times , it is best to set the search space interval at 1 ui below the skew tolerance level specified in the applicable standard . thus , with reference to the sxi - 5 standard , the search space interval , i , should be set to 4 . for the purposes of this example , the search space , s , will be set at 20 ui , which is an arbitrary choice , with the search space interval , i , set to 4 ui . this gives five possible sets of interval choices for each lane , i . e . from 0 - 4 , 8 - 12 , 12 - 16 , and 16 - 20 . the process begins with lane 0 set in the first interval position . if the out - of - alignment alarm , ooa โ 0 , indicates an alarm condition after a specified wait - time ( t ), then the lane realigns to the next interval position . again , the ooa โ 0 alarm is checked and if the alarm condition is still active the next interval position is tested . this process continues until the ooa โ 0 alarm indicates alignment for a specific interval position or the entire search space has been exhausted . for this reason it is important to choose the search space such that it is large enough to take in the maximum expected lane skew deviation . assuming the ooa โ 0 alarm indicates that lane 0 has achieved alignment , the process begins for the next lane , lane 1 . when the alarm for lane 1 , ooa โ 1 , indicates successful alignment , the process continues for lane 3 . when the alarms for each lane have achieved alignment , the process ends . the maximum amount of search intervals for this example that have to be traversed through is 15 , i . e . five intervals for each of the three lanes . in order to determine the maximum amount of search intervals for a different system , the following variables need to be known : therefore , the maximum amount of search intervals , c , can be determined through the following formula : in order to determine an approximate maximum time for the searching process , the maximum amount of search intervals must be multiplied by the time , t , necessary to wait for an ooa alarm check . thus the maximum wait time , t , is given by : by following this process , all lanes can be deskewed sequentially to provide total lane alignment in compliancy with relevant standards , such as sxi - 5 . the system in this case has a feedback signal that reports the aggregated status across all lanes , i . e . there is only one feedback signal for the entire system . thus only when every lane has been deskewed will the feedback signal report success . this system is shown in fig2 . in example 2 , there is one aggregated feedback signal , i . e . the combination of all feedback signals as illustrated in fig2 . if there is an out - of - alignment error for either lane , the aggregated signal will report an error . the variables and constants used in this example are defined as : for the three mgt system , there is an aggregated out - of - alignment alarm combining the status for each lane , labeled ooa . the alarm will report an error should one occur on any lane . the search space , s , refers to the maximum ui that a lane may be expected to be out of alignment . with reference to the applicable standard , there is typically a specification as to the maximum allowable skew tolerance in order to achieve compliancy with said standard . for the sxi - 5 standard , that maximum allowable skew tolerance between lanes is set at 5 ui . the search space interval , i , must be set at a value less than this skew tolerance . to achieve the fastest possible search times , it is best to set the search space interval at 1 ui below the skew tolerance level specified in the applicable standard . thus , with reference to the sxi - 5 standard , the search space interval , i , should be set to 4 . for the purposes of this example , the search space , s , will be set at 20 ui , which is an arbitrary choice , with the search space interval , i , set to 4 ui . this gives five possible sets of interval choices for each lane , i . e . from 0 - 4 , 8 - 12 , 12 - 16 , and 16 - 20 . the process begins with all lanes set in the first interval position . if the out - of - alignment alarm , ooa , indicates an alarm condition after a specified wait - time then the first lane realigns to the next interval position . again , the ooa alarm is checked and if the alarm condition is still active the next interval position for the first lane is tested . this process continues for all five interval positions . if the ooa alarm still indicates an alarm condition then the next lane can be iterated through , while still iterating through the first lane . this process can be lengthy as since there is only one global alarm making the range of combinations much larger . the process ends when the ooa alarm indicates alignment for a specific interval position on each lane or the entire search space has been exhausted . for this reason it is important to choose the search space such that it is large enough to take in the maximum expected lane skew deviation . the maximum amount of search intervals for this example that have to be traversed through is 125 , i . e . five intervals for each of the three lanes . in order to determine the maximum amount of search intervals for a different system , the following variables need to be known : therefore , the maximum amount of search intervals , c , can be determined through the following formula : in order to determine an approximate maximum time for the searching process , the maximum amount of search intervals must be multiplied by the time , t , necessary to wait for an ooa alarm check . thus the maximum wait time , t , is given by : by following this process , all lanes can be deskewed to provide total lane alignment in compliancy with relevant standards , such as sxi - 5 . the previously explained deskewing methods are only considered as examples . different configurations of each are possible as long as deskewing is achieved . combined configurations , such as multiple aggregated signals for groups of lanes , are also possible as long as deskewing is achieved . in order to inject the appropriate amount of skew into each lane to traverse the different search space intervals , the unaligned transmit ( tx ) data lines enter a buffer for the purposes of lane deskewing . the skew values to be injected for each lane are supplied to the buffer . the buffer then bit shifts each lane the appropriate amount to move to a different alignment position as specified by the search space intervals . a representation of a possible embodiment of this injection system is shown in fig3 . the output from the buffer is the re - aligned tx data lines , which can then be tested for compliancy against the skew specifications for relevant standards , as per the description of the algorithm .
| 7 |
reference will now be made in detail to various embodiments of the presently disclosed subject matter , one or more examples of which are set forth below . each embodiment is provided by way of explanation , not limitation , of the subject matter . in fact , it will be apparent to those skilled in the art that various modifications and variations may be made to the present disclosure without departing from the scope or spirit of the disclosure . for instance , features illustrated or described as part of one embodiment , may be used in another embodiment to yield a still further embodiment . thus , it is intended that the present disclosure cover such modifications and variations as come within the scope of the appended claims and their equivalents . in general , the present disclosure is directed to an improved water valve and methods for regulating fluid flow . copending application ser . no . 13 / 804 , 835 , filed contemporaneously herewith , is also directed to valves and fluid regulation and is hereby incorporated in its entirety by reference . fig2 illustrates a plan view of one possible embodiment of water valve 100 of this disclosure . fig3 shows a cross sectional view of water valve 100 . as fig3 illustrates , a chamber 102 includes an inlet 101 and an outlet 103 . anchor 104 is disposed in chamber 102 and engages a pull element 106 . a sealing cylinder 108 in chamber 102 engages pull element 106 . membrane 110 is also located in chamber 102 and includes proximal surface 112 facing toward inlet 101 and distal surface 114 facing away from inlet 101 . membrane 110 may define a central cavity 116 . in some embodiments , membrane 110 may only define a single opening or passage extending from the proximal to distal face through membrane 110 , such as central cavity 116 . in other embodiments , membrane 110 may contain additional openings aside from central cavity 116 . however , in a preferred embodiment , membrane 110 only defines a single passage , central cavity 116 , extending through membrane 110 . membrane 110 may define a continuous , unbroken substantially radial surface 118 surrounding and extending from central cavity 116 . membrane 110 may also engage sealing cylinder 108 . engagement between membrane 110 and sealing cylinder 108 may be accomplished by frictional engagement between membrane 110 and sealing cylinder 108 . alternatively , sealing cylinder 108 may include a contoured or shaped geometry to engage , hold or otherwise interface with central cavity 116 . further , various mating configurations such as a male / female arrangement , tooth and slot , dovetail , etc ., may be used for engaging membrane 110 and sealing cylinder 108 . in a preferred embodiment , the inner diameter of membrane 110 may be sized smaller than the outer diameter of sealing cylinder 108 in order to ensure tight engagement between the two . sealing cylinder 108 may engage the main valve seat at a distal portion of sealing cylinder 122 located toward inlet 101 and outlet 103 . this engagement may be enhanced by incorporating flat seal 128 , which can be made from synthetics , rubbers or plastics . flat seal 128 , as well as any ring seal , ring seal rods , or membranes discussed herein , may be formed from rubber such as hnbr , nbr , or epdm . flat seal 128 may also be formed from neoprene , silicone and soft plastics . flat seal 128 may partially or completely surround sealing cylinder 108 and engage main valve seat 124 . flat seal 128 may be circular or otherwise shaped as known to those of skill in the art . flat seal 128 may engage sealing cylinder 122 by frictional engagement , mating geometries , adhesives , welding , etc ., as known to those of skill in the art . in one preferred embodiment , flat seal 128 is held in place by surrounding sealing cylinder 108 and being held in place between flat seal upper engagement surface 132 and flat seal lower engagement surface 134 of sealing cylinder 122 . sealing cylinder 122 may also form the small valve seat 120 as well as define small valve seat opening 130 by defining an opening in the proximal portion of sealing cylinder 108 through which fluid may flow once pull element 106 loses contact with sealing cylinder 108 . sealing cylinder 108 may also define an interior passage 122 through which fluid entering small valve seat opening 130 may flow and eventually escape via outlet 103 . fig4 illustrates water valve 100 with anchor 104 in a first position 200 . movement of anchor 104 may be effectuated by means known to those of skill in the art such as hydraulic activation , pneumatic , piezoelectric , electromagnetic , etc . reversal of the movement may be accomplished by deactivating the motivating means . in a preferred embodiment , electromagnet 202 and spring 204 work together to position anchor 104 within sleeve 206 contained within chamber 102 . anchor 104 is preferably corrosion resistant and formed from magnetic steel . it slides within sleeve 206 and may have specific geometries 208 on proximal surface 209 , closest to inlet 101 , that engages with pull element 106 , for instance , a round mating geometry may be formed on proximal surface 209 , or other shapes as known to those of skill in the art , that enable anchor 104 to engage and pull or push pull element 106 into and out of engagement with sealing cylinder 108 . spring 204 may be placed circumferentially around anchor 104 . a bobbin 208 may surround and enclose spring 204 and anchor 104 . a coil 210 may circumferentially , or otherwise as known to those of skill in the art , engage bobbin 208 surrounding at least a portion of bobbin 208 . in anchor first position 200 , electromagnet 202 is not activated . pull element 106 sits atop sealing cylinder 108 and closes small valve seat 120 and small valve seat opening 130 . water or fluid flowing into inlet 101 , shown by arrow a , flows through filter 126 , shown by arrow b , through fluid passage 212 , shown by arrow c , and engages distal surface 114 of membrane 110 , shown by arrows d . in anchor position 200 , the force generated by pressure on membrane distal surface 114 is greater than the force generated by pressure on membrane proximal surface 112 . small valve seat 120 and small valve seat opening 130 are both closed by pull element 106 , thereby preferably preventing any fluid flow through the interior 122 of sealing cylinder 108 and out via outlet 103 . fig5 illustrates anchor 104 in an anchor second position 300 . activation of electromagnet 202 , or other motivating means as known to those of skill in the art , moves anchor 104 , compresses spring 204 , and thereby moves pull element 106 , which is engaged to anchor 104 , away from sealing cylinder 108 . movement of pull element 106 thus opens small valve seat 120 and small valve opening 130 . based on this movement , water or fluid flowing into inlet 101 , shown by arrow a , flows through filter 126 , shown by arrow b , through fluid passage 212 , shown by arrow c , and engages distal surface 114 of membrane 110 , shown by arrow d . now , with small valve seat 120 and small valve seat opening 130 both open , water can flow through small valve seat 120 and small valve seat opening 130 , shown by arrow e . water or fluid may then pass through the interior 122 of sealing cylinder 108 , shown by arrow f , and exit valve 100 via outlet 103 , as shown by arrow g . in this configuration , pressure is still exerted on distal membrane surface 114 , but this pressure is now lessened due to water or fluid flowing through small valve seat 120 and small valve seat opening 130 and out of valve 100 via outlet 103 . fig6 illustrates anchor 104 in an anchor third position 400 . in anchor third position 400 , electromagnet 202 , or other motivating means as known to those of skill in the art , further moves anchor 104 distally , away from inlet 101 , further compresses spring 204 , and thereby further moves pull element 106 . as shown in fig6 , engagement portion 402 of pull element 106 contacts engagement surface 404 of sealing chamber 108 . this allows pull element 106 to move or displace sealing chamber 108 distally , away from inlet 101 , in order remove sealing chamber 108 from engagement or contact with main valve seat 124 in order to open main valve seat 124 . engagement between sealing chamber 108 and main valve seat 124 may occur directly , whereby a surface of sealing chamber 108 contacts and occludes or blocks main valve seat 124 . alternatively , engagement between sealing chamber 108 and main valve seat 124 may occur via flat seal 128 . flat seal 128 may partially or completely encircle or surround sealing cylinder 108 and may engage main valve seat 124 in order to block or occlude main valve seat 124 . as fig6 illustrates , movement of sealing cylinder 108 distally , away from inlet 101 , removes flat seal 128 from blocking or occluding main valve seat 124 , thereby opening the main valve seat 124 . as fig6 shows , anchor position 400 allows water or fluid to flow into valve 100 via inlet 101 , shown by arrow a . however , because main valve seat 124 and main valve seat opening 406 are open , water now flows and engages filter 126 , the lower portion of sealing cylinder 108 , as well as flat seal 128 , as well as flows toward main valve seat 124 , as shown by arrows h . further , water may then flow out main valve seat opening 406 and exit via the valve 100 outlet 103 , illustrated by arrow i . in anchor position 400 , water or fluid flow through passage 212 of sealing cylinder 108 is substantially reduced and may altogether cease . while some very minimal flow may still be possible , this is unlikely given that the diameter of the flow path created by opening main valve seat 124 and exposing main valve seat opening 406 is much greater than the diameter of the control path formed by fluid passage 212 and small valve set 120 and small valve seat opening 130 . this is also the case for water or fluid flow through small valve seat 120 and small valve seat opening 130 based on the water through inlet 101 now seeking the path of least resistance , escaping through main valve seat 124 and main valve seat opening 406 and exiting via outlet 103 . in the configuration illustrated by fig6 , pressure on membrane distal surface 114 is significantly less than the pressure on membrane proximal surface 112 , facing toward inlet 101 . moreover , membrane 110 , as shown by fig6 , due to the effects of the motivating means , such as , for example , electromagnet 202 , and of the changed pressure differential between the membrane &# 39 ; s proximal 112 and distal 114 surfaces has now โ flexed โ distally , away from inlet 101 , in order to further assist with moving sealing cylinder 108 distally and opening main valve seat 124 and main valve seat opening 406 . this further promotes fluid exiting via outlet 103 as a the movement of membrane 110 further opens the cavity 408 containing main valve seat 124 and thereby allowing a larger volume to flow through and exit via main valve seat opening 406 . as fig6 shows , in the anchor third position 400 , water or fluid flows substantially from the inlet 101 and exits via outlet 103 without flowing through passage 212 and the fluid flow through filter 126 is substantially , or altogether , reduced , as is any flow through small valve seat 120 or small valve seat opening 130 . indeed , this flow arrangement may clean filter 126 as water or fluid will engage the outward facing portion 410 of filter 126 and remove any detritus or debris , not shown , affixed thereto . thus , water passes substantially or predominately from the inlet to the outlet without being filtered and may even clean filter 126 used for water flowing through passage 212 to engage membrane distal surface 114 . while anchor 104 is described by the term โ position โ with respect to fig4 - 6 , those of skill in the art will recognize that a multitude , or range , of positions are possible as described herein based on the disclosure pertaining to a respective figure of a particular anchor โ position .โ the disclosure should not be considered or limited to anchor 104 as disposed statically or rigidly or in a particular fixed position via the positions illustrated in fig4 - 6 . variations and various placements of anchor 104 may accomplish the results described in each of fig4 - 6 and multiple such positions are not only possible but are herein fully supported and disclosed as would be recognized by those of skill in the art . fig7 illustrates one possible embodiment of a sealing cylinder 500 engaged with a pull element 502 . fig7 shows sealing cylinder 500 engaged with pull element 502 , which is also engaged with anchor 504 . as explained herein , when the anchor is displaced distally , away from the inlet , this effects movement in pull element 502 due to the mating geometry coupling anchor 504 with pull element 502 . pull element 502 and anchor 504 may have various capture or mating geometries 522 . this may include specific shapes for engaging with one another . anchor 504 and / or pull element 502 may be shaped or formed and may be ridged , curved , include flanges , grooves , struts , supports , or otherwise be formed to securely engage and / or hold to one another and not separate , especially during movement of anchor 504 under influence of motivating means such as electromagnet 202 . the mating geometries may include a male / female arrangement of corresponding structures as known to those of skill in the art . anchor 504 may additionally be shaped , as known to those of skill in the art , to allow water to pass over or around its surface in order to not impede flow during operation . pull element 502 may be formed from rubbers as described herein . in a preferred embodiment , pull element 502 is formed from rubber soft enough to seal small valve seat 120 but hard enough to maintain its shape when effecting movement of sealing cylinder 108 . sealing cylinder 500 may define an engagement chamber 524 for receiving pull element 502 . engagement chamber 524 allows for pull element 502 to initially separate from small valve seat 508 to open small valve seat opening 510 , without effecting movement of sealing cylinder 500 . this may be accomplished , as illustrated in one embodiment shown in fig7 , by having engagement chamber 524 shaped to allow pull element 502 to slidably move , both distally , away from the inlet , not shown , and proximally , toward the inlet , not shown , with respect to small valve seat 508 . thus , pull element 502 is capable of opening small valve seat 508 and small valve seat opening 510 without requiring movement of sealing cylinder 500 . thereby providing access to sealing cylinder interior 514 . further , in order to displace sealing cylinder 500 and / or flat seal 512 from a main valve seat , not shown , pull element 502 may be essentially โ t โ shaped with respect to the portion of pull element 502 enclosed or captured by engagement chamber 524 of sealing cylinder 500 . while shown as โ t โ shaped , one skilled in the art would recognize that other shapes and configurations are also possible . a pull element engagement surface 518 , may be formed on a distal surface 526 , facing away from the inlet , and may engage with a sealing cylinder engagement surface 520 formed on a proximal surface 528 , facing toward the inlet , that may be formed in an upper portion of engagement chamber 524 . by engagement of the respective engagement surfaces 518 and 520 , anchor 504 , via pull element 502 , may effectuate movement of sealing cylinder 500 away from a main valve seat , not shown . filter 516 may partially or full encircle sealing cylinder 500 . in a preferred embodiment , filter 516 encircles a portion of sealing cylinder 500 and covers sealing cylinder fluid passage 506 in order to filter fluid passing through fluid passage 506 . filter 516 may be welded , affixed with adhesives , โ snap fit โ or otherwise engaged with sealing cylinder 500 as known to those of skill in the art . filter 516 may be formed from wire , plastic mesh , perforated metal , or shaped plastic cylinders . in a preferred embodiment , filter 516 may be press - fitted onto sealing cylinder 500 . fig8 illustrates an enlarged , cut - away view of a fluid passage in a sealing cylinder 500 . fluid passage 506 may defined in sealing cylinder 500 either by boring , molding , heat forming , etc ., as known to those of skill in the art . in a preferred embodiment , allowed a slight overlap during molding may be used to form passage 506 . as fig8 illustrates , filter 516 covers fluid passage 506 such that only water or fluid entering passage 506 is filtered prior to exiting passage 506 . this arrangement may help prolong valve life as only a small or โ control โ portion of the water โ control in the sense that the water or fluid entering passage 506 helps โ control โ closure of the valve due to exerting pressure on the distal surface 114 , facing away from the inlet , side of membrane 110 โ entering the valve , as opposed to all water entering the inlet as discloses in various prior art mechanisms , needs to be filtered in order to maintain the integrity of the valve and prevent occlusion of the small valve seat 508 , small valve seat opening 510 and / or to prevent debris from interfering with the seal between pull element 502 and valve seat 508 or opening 510 . this also protects the membrane , not shown , from abrasion or other physical damage caused by debris or detritus in the water supply as filter 516 removes and screens same prior to water or fluid encountering the membrane . further , in a preferred embodiment , the diameter of fluid passage 506 is less than or smaller than the diameter of small valve seat opening 510 . even further , all openings in the flow line subsequent to water or fluid flowing through fluid passage 506 may be larger in diameter than the diameter of small valve seat opening 510 . fig8 also illustrates membrane engagement surface 525 formed into the exterior of sealing cylinder 500 . membrane 110 , not shown , may engage to sealing cylinder 500 via frictional engagement , mating geometries as described herein or known to those of skill in the art , adhesives , or other means as known to those of skill in the art . as fig8 discloses , lower lip 528 and upper lip 530 may serve to hold membrane 110 in engagement with the exterior of sealing cylinder 500 . fig9 shows a plan view of one embodiment of a sealing cylinder of the present disclosure . fig1 is a top down view of the sealing cylinder of fig9 . sealing cylinder 500 may be shaped to not impede water flow from water entering the control chamber , or membrane influencing , portion of the water valve via fluid passage 506 . this includes forming sealing cylinder 506 with open structures , such as engagement chamber 524 , so that water exiting fluid passage 506 may engage the distal surface of the membrane , not shown without being impeded by sealing cylinder 500 . fluid passage 506 , as shown in fig1 , may be created by allowing a small overlap when an injection molding arrangement is used to form sealing cylinder 500 . fig1 shows a plan view of one embodiment of a pull element of the present disclosure . pull element 502 may be solid or hollow . in a preferred embodiment , pull element 502 is hollow and defines a cavity 532 for containing mating geometry 522 , not shown , for affixing pull element 502 to anchor 504 , not shown . fig1 shows a cross - sectional view of the pull element of fig1 . pull element 502 includes cavity 532 that houses mating geometry 522 to allow for secure engagement between anchor 504 , not shown , and pull element 502 . mating geometry 522 may be shaped to have a specific engagement contour , shape , or geometry with anchor 504 , such as male / female engagement , tongue in groove , twist engagement , or other specific geometries as known to those of skill in the art . pull element 502 may also include engagement surface 520 for contacting and pulling sealing cylinder 500 , not shown . pull element 502 may be formed from various materials . in a preferred embodiment , pull element 502 is formed from rubber as well , including hnbr , nbr , or epdm . epdm ( ethylene propylene diene monomer rubber ) is preferred because of its resistance to chlorine that may be present in water supplies . fig1 illustrates one embodiment for a membrane 960 that may be employed in a valve as disclosed herein . fig1 illustrates a cross - sectional view of fig1 . while fig1 and 14 illustrate membrane 960 as having a generally circular appearance , the membrane may be shaped in any manner known to those of skill in the art in order to fit and function within water valve 100 , this includes but is not limited to oblong , ellipses , squares , rectangles , triangles , polygons , etc . the membrane may be constructed from suitable flexible materials , including but not limited to rubbers , silicones , neoprenes , etc . membrane 960 preferably is flexible to accommodate position shifts , as well as flexing under influence by anchor 504 and / or water pressure on the membrane &# 39 ; s proximal surface , facing toward the inlet , during use in water valve 100 . as fig1 illustrates , membrane 960 may have specifically shaped sealing geometries for engaging sealing cylinder 500 , membrane sealing chamber geometry 962 , as well as geometries for engaging sleeve 206 such as membrane sleeve geometry 964 . these sealing geometries render membrane 960 impervious to water flowing through the membrane as well as ensure a water - tight engagement between membrane 960 and sleeve 206 as well as sealing cylinder 500 . membrane 960 is free from openings that would allow water to pass through the membrane 960 , central cavity 116 , as discussed above , engages and seals against sealing cylinder 500 . membrane 960 may also have sleeve engagement features 966 for engaging sleeve 206 . while fig1 illustrates six sleeve engagement features 966 , the disclosure is not so limited and more or less sleeve engagement features 966 may be present ranging from one continuous engagement feature to separated features having one , two , three , four , five , six , or more separate sleeve engagement features 966 . membrane 960 should also be able to withstand pressure . for instance , in a preferred embodiment membrane 960 should be able to withstand a pressure of 24 bar , but lower and higher pressures are also included in this disclosure . for instance , membrane 960 should be able to withstand pressures ranging between 0 - 24 bar , including ranges therein such as 0 - 5 bar , 5 - 10 bar , 15 - 20 bar , and 20 - 24 bar , including individual pressures contained therein . membrane 960 may also be formed with engagements such as 966 to lock the membrane into engagement with connecting members . membrane 960 may also include a pressure ring 961 for engaging with sealing cylinder 500 via exerting pressure for frictional or other contact with membrane engagement surface 526 . fig1 is a cross sectional view of fig1 and shows proximal surface 845 ( inlet facing ) and distal surface 843 ( facing away from the inlet ). membrane 960 serves to seal the portions of water valve 100 containing the distal membrane surface 843 and proximal membrane surface 845 from one another as well as to prevent leakage around sealing chamber 500 . fig1 illustrates an alternative embodiment of membrane 700 that may be employed in the present disclosure . membrane 700 includes engagement members 702 for locking membrane 700 in place with opposing connecting members , not shown . membrane 700 also includes pressure ring 704 for engaging with sealing cylinder 500 via pressure or frictional engagement at membrane engagement surface 526 . membrane 700 has a distal surface 706 facing away from inlet 101 and a proximal surface 708 facing toward inlet 101 . membrane 700 also includes raised protrusions 710 that help prevent sticking between membrane 700 and any features in water valve 100 that may come into contact with membrane 700 in either its โ relaxed โ position in the anchor first position or its โ flexed โ configuration in the anchor third position or for positions between these two . fig1 illustrates a cross - sectional view of the membrane of fig1 . the current disclosure presents several advances over the prior art including a membrane free of holes , other than the central cavity 116 , that may become clogged by detritus or require completely filtered water . also , a smaller portion of water entering the valve is filtered , just the portion of water eventually contacting membrane distal surface 114 and / or passing through small valve seat 120 , as opposing to valve mechanisms that filter the entire volume of water entering the valve , thus leading to increased clogs that damage the valve and require periodic maintenance or upkeep , or valve replacement . further , opening of main valve seat 124 is accomplished by dual action of the pressure differential between the membrane proximal and distal surfaces and movement of the anchor . this arrangement also helps maintain the valve in a closed position when the anchor is not activated as pressure on the membrane distal surface 114 keeps sealing cylinder 108 in place on main valve seat 124 . further , filter 126 not only filters only a small portion of water entering valve 100 but it can be cleansed by water or fluid flowing over filter outer facing 410 and sweeping the debris along with the fluid flow out outlet 103 . also , by increasing the diameter of the control water pathway from its initiating point at fluid passage 212 through small valve seat opening 130 and main valve seat opening 406 , this encourages fluid flow from the control portion of the mechanism ( the area containing the membrane distal surface 114 ) as the anchor and membrane open small valve seat 120 and eventually main valve seat 124 . the small diameter of fluid passage 212 also discourages water from entering the control portion when main valve seat 124 is open , thus relieving pressure on the distal membrane surface 114 and reducing the amount of energy required to keep main valve seat 124 open . when small valve seat 120 , and therefore small valve seat opening 130 , are closed , pressure from inlet 101 through passage 212 and surrounding sealing cylinder 108 and both sides of membrane 110 are equal . pressure in sealing cylinder interior 122 through main valve seat 124 and outlet 103 is at ambient pressure . when anchor 104 moves to the anchor first position 200 , pressure in the valve changes . pressure on membrane distal surface 114 is now less than pressure on membrane proximal surface 112 but the pressure on membrane distal surface 114 remains higher than the ambient pressure existing in sealing cylinder interior 122 , main valve seat 124 and outlet 103 . here , fluid exits via small valve seat 120 but flow through passage 212 to enter the control portion of the valve ( the portion of the valve allowing for pressure to be exerted on membrane distal surface 114 ) is significantly reduced or ceases altogether as fluid flows through small valve seat 120 faster than it can enter passage 212 . this pressure differential begins to lift membrane 110 . when main valve seat 124 and main valve seat opening 406 are opened , pressure through inlet 101 , fluid passage 212 , on both sides of membrane 110 , and in main valve seat 124 are equal , while outlet 103 is subject to ambient pressure . as used herein the singular forms โ a ,โ โ an ,โ and โ the โ include plural referents . the term โ combination โ is inclusive of blends , mixtures , alloys , reaction products , and the like . unless defined otherwise , technical and scientific terms used herein have the same meaning as is commonly understood by one of skill . compounds are described using standard nomenclature . the term โ and a combination thereof โ is inclusive of a combination of one or more of the named components , optionally with one or more other components not specifically named that have essentially the same function . while the subject matter has been described in detail with respect to the specific embodiments thereof , it will be appreciated that those skilled in the art , upon attaining an understanding of the foregoing , may readily conceive of alterations to , variations of , and equivalents to these embodiments . accordingly , the scope of the present disclosure should be assessed as that of the appended claims and any equivalents thereto .
| 5 |
one or more embodiments of the present invention are described . nevertheless , it would be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the claims that follow this detailed description . this detailed description includes methods and means for managing and controlling one or more uv systems . the uvs utilize a networked swarm , or flock , awareness to allow operation of one or more uvs within a personalized augmented reality drone event . the uvs onboard systems may provide vehicle pose , object recognition , environmental interaction capabilities . the rdp parde experience is setup , configured , and initiated , from an operational control system and by a certified control pilot . the cp monitors the parde and all participants throughout for safety and real - time parde parameter modifications to maximize the experience . exemplary configurable event parameters include defining uv operating boundaries in terms of spatial geographical grids , image - triggered events , number of pilots participating , varc flight control sensitivity ( to allow users of varying skill levels to participate ), and โ swarm โ control level between pilots . these functionalities are enhanced both in precision and robustness by an outdoor distributed image network , a network of well - defined images or features which permits calculating vehicle pose to a higher degree than gps alone . during each parde , the cp continuously monitors each pilot from the ocs and controls the experience parameters to ensure optimal safety . the ocs also includes integrated communication systems to interact with current parde participants as well as local safety officials and weather information . control of the uv can be achieved by commands from the remote drone pilot or by the control pilot from the ocs โ control and monitoring systems , or autonomously from the ocs based on parde parameters and position of a uv within the configured parde environment . commands from the rdp and associated position of their uv in the parde environment are monitored for safety by an on - board autopilot and processor . the on - board autopilot and processor or on - board uv control system autonomously executes command overrides in event of a communications failure or inappropriate commands from the rdp in the varc . rdp control of the vehicle is additionally constrained by the user &# 39 ; s skill level , ranging from only field of view control to complete vehicle command . the rdp user experiences the parde through a virtual augmented reality cockpit . the varc provides an augmented reality ( ar ) visual and tactile experience tailored to the rdps . the varc , at its most basic embodiment may consist of virtual reality goggles for first person view from the uv and handheld uv remote controls . the full embodiment of the varc may include the following key features : remote piloting of rdps uv of choice within a defined geographical location ( air , land , and water ), a heads up display for remote piloting of the uv via fpv , integrated audio and visual interactive content superimposed on the hud , rdp control of the on - screen interactive content and camera , infrared beam targeting , or other system payload controls , integration of multiple varcs with the same uv allowing daisy chain of varcs so that multiple rdps are connected to the same uv , enjoying the same immersed parde experience , but controlling different payload systems to achieve their objectives . six degrees of cockpit motion and tactile feedback based on rdp &# 39 ; s flight control systems and real - time telemetry being received from the uv itself , and communication systems to interact with a cp when needed and with other rdps or rdcp who may be participating in the current pardes the autopilot unit receives and executes commands , as well as provides low - level environmental interaction such as vehicle stabilization by utilizing data from various sensors residing onboard the uv . this information can also be relayed to both onboard systems and ground - mounted ocs โ control and monitoring systems , which may provide correctional control to uvs to allow safe and objective operation . both the ground - mounted and onboard control systems may have the ability to safety check rdp commands to allow overriding a user &# 39 ; s input if deemed unsafe . this determination is based on pre - compiled site and event specific parde libraries , which may define an enforced geo - fence of allowed 3 - d volume , allowed speeds , and emergency obstacle avoidance parameters . the uv may be equipped with sensors and devices such as gps or visual and auditory sensors that provide real - time data to the onboard system and the ocs . either the onboard or gps may provide flight data information to external services such as emergency crews , as well as current parde mission plans and system status including uv condition . the ocs may allow new instructions to be configured during parde events to allow changes to pre - defined operational parde mission plans sent from the ocs . a parde mission plan may include multiple waypoints or destinations along which a uv may experience difficulties , which makes necessary the ability for the uv to receive real - time instructions given to facilitate an efficient and effective management of system conditions such as battery level and heat . to ensure compliance with operation parde mission plans , the ocs may continuously monitor the uvs current pose , speed , and acceleration . fig1 depicts and exemplary parde system including a plurality uvs 102 controlled from a plurality of varcs 101 by remote drone pilots and remote drone co - pilots rdcps 106 . an operational control system 103 communicates with both the uvs 102 and the varcs 101 via a wireless connectivity option 107 . co - located varc and uv deployment options are represented by 105 . the uvs 102 may be air , ground , surface water , or underwater based uv types . each uv type operating within a parde event does so within parde configuration settings which include data and settings such as rdp and rdcp control sensitivity and configuration preferences , all visual , audio , motion and tactile augmented content information , the parde universal geo - fence and each uv &# 39 ; s personal geo - fence . each uvs 102 on - board processing system and the ocs 103 monitor and manage the speed , acceleration , and directional characteristics of each uv within the active parde environment and ensure uv speed , acceleration and directional characteristics and controls remain within parde configuration settings and make autonomous adjustments based on calculated parde configuration setting violations due to rdp or rdcp 106 manual inputs from their varc 101 or other environmental and system factors that cause potential violations . the main components of each uv include a receiver , an on - board processing system , a global positioning system , one or more sensors , a transmitter , an on - board motion system , and an on - board payload and support system . the uvs 102 on - board processing system in combination with the ocs 103 monitor , manage and transmit augmented audio and video content to the varcs 101 , which are being operated by rdps and rdcps 106 . one or more varcs 101 may be bound to a single uv 102 . a single rdp 106 controls the motion and directional control systems of a single uv 102 via their varc 101 . multiple rdcps 106 may be bound to a single uv 102 and may control one or more on - board payload and support systems and provide sensor monitoring management . the varc 101 provides an augmented reality visual , audio and tactile experience tailored to the rdp or the rdcp 106 controlling the system . the varc 101 , in a basic embodiment may be virtual reality goggles for first person view from the uv 102 and handheld uv remote controls . a full deployment of the varc 101 immerses individual users into a sound and light proof environment where the rdp and rdcps 106 experience the parde . the varc 101 in this embodiment enables the user to remotely control their uv 102 while providing a real - time visual and tactile ( 6 degrees of motion ) experience of what the uv 102 they are piloting is seeing and how it is physically oriented and reacting to the environment around it . additionally , the varc system provides user communication options to a control pilot 104 and other users participating in the parde . the varc display includes heads - up - display and receives video and audio content from the ocs 103 and on - board processing systems that with which the rdp and rdcps 106 can interact . hud content may include a variety of information that has been pre - configured via the parde configuration settings , such as land - mark indications and information , flight routes , and may include active gaming information on current game activity , user score , or additional information on rdps and rdcps 106 participating in the parde . varcs 101 include visual , audio , control , tactile and motion feedback along with processing and transmission systems . at a minimum , all varc 101 embodiments include some form of visual , control , processing and transmission systems . the ocs 103 is controlled and operated by a single ( or multiple working in coordination with each other ) control pilot 104 . the ocs 103 enables the cp 104 to pre - configure the parde configuration settings , monitor all rdp and rdcps 106 and associated uvs 102 operating within the mission . the cp 104 can take direct or autonomous over - ride control of any parde active uv 102 and has the ability to modify any parde configuration settings . the cp 104 also communicates with local officials and with any one , multiple , or all rdps 106 within the parde . the ocs 103 receives and augments data from the uvs 102 and passes it to users 106 within the varcs 101 . the ocs 103 also receives user 106 commands and determines whether they violate any mission safety parameters , only passing through approved commands to the vehicles 102 . additionally , the ocs 103 generates pre - configured augmented audio and video content and delivers that information to varc users 106 to enhance the user &# 39 ; s parde environment and / or , increase probability of the user 106 successfully completing the parde objectives . the ocs 103 allows for configuration of all parde configuration settings including , but not limited to : configuration of mission spatial environment through three dimensional geo - coordinates , user accessible augmented audio and visual content tagged to geo - coordinates within a defined space , defined fail - safe return home position within the defined space , number and types of uvs 102 to be controlled within the environment , varc 101 to uv 102 pairing , varc 101 control system configuration ( i . e , pilot or payload system control ), varc 101 control system configuration for pilot experience level and preferences , varc 101 tactile motion level preference , communication with one or more pilots operating in the environment communication systems with faa , regulators , and local officials for pre , during , and post flight communication and includes the ability to visually monitor all pilots 106 operating within their varcs 101 , view each operating uv camera view , shut down varc control and pilot 106 varc experience , take over - ride control of one or more uvs through direct operator 104 control or by pre - defined or new geo - coordinate way points to direct the uv 102 to complete a task . connectivity between the ocs 103 and varcs 101 may be wired or wireless and connectivity 107 between ocs 103 and uvs 102 will be wireless . connectivity protocols from the ocs 103 include sufficient bandwidth to ensure undiscernible lag of uv video feeds or delivery of augmented video and audio content from the ocs to the varcs . based on the connectivity flexibility with the ocs 103 the varc deployment 105 may be central to the uv parde launch site or may be remote and limitless on the distance with the appropriate connectivity and bandwidth availability . as noted above , the ocs may over - ride varc command if safety considerations are violated , if universal geo - fence parameters are violated and if personal geo - fence parameters are violated . there are several variables capable of activating the over - ride if they go above or below a chosen threshold ( e . g ., safety considerations , geofence violations ). examples of such variables are velocity , altitude , proximity , global position etc . exemplary pseudo - code is given below for how two uvs 102 detecting a violation of the universal geofence 1501 and personal geofences 1502 and implement override commands . the illustrative pseudo - code is for a simple box - shaped geofence : include corn putereturncommandfunction include collisionavoidfunction ; float x1 , x2 , y1 , y2 , z1 , z2 . xmin ( 0 ), xmax ( 100 ), ymin ( 0 ), ymax ( 200 ), zmin ( 20 ), zmax ( 100 ), vechilemindist ( 2 ). the โ includes ( compute and collision )โ above tells the code where the functions it will need to run are defined . for example , if the uv 102 has gone beyond xmax or ymax ( universalgeofence ), a command in the negative x or y direction would be generated by the computereturncommandfunction . note that if none of the โ if โ statements apply , the command passed is simple varccommand , or the rdps command . the collision avoidance , or personal geofence ) is achieved much the same way , proximity in x or y is detected , and appropriate function called to generated override command . fig2 is a flow chart of an exemplary architecture for use with the embodiment depicted in fig1 . fig2 shows an example architecture for the example parde system in accordance to the embodiments of the invention . fig2 shows the three main parde system architectural components including the uv 102 , with the varcs 101 , and the ocs 103 and includes associated sub - components and interconnectivity and relationships between components . the uvs 102 include a receiver 205 , autopilot 211 , onboard processor 212 , global position system 206 , sensors 207 , transmitters 208 , and onboard motion , payload and support systems 213 . the ocs 103 includes one or more ocs - cpu node 203 , external communication systems 217 , ocs control & amp ; monitoring system ( ocscms ) 218 , transmitters 219 , receivers 220 , and parde configuration and settings 214 . a control pilot 104 , operates the ocs and overall parde event . the varcs 101 , include the varc - centric signal transmission , receiving and varc processing systems ( vop ) 201 and the controls and interface systems 223 . the uvs 102 , varcs 101 , and the ocs 103 each run parde operating system software ( reference numeral 901 in fig9 ) components that when initiated execute commands and manage systems and controls within the defined parde configuration settings 214 . the parde operating system software 901 runs and executes commands on the uv onboard processor 212 , ocs - cpu node ( s ) 203 , and the varc processing component 502 . communication and data transmission between systems is handled by the software components and transmitted between system components via either wireless or wired connectivity . connectivity between the uvs 102 and the ocs 103 is wireless for all audio , video , and control functions between varc 101 and ocs 103 . connectivity between the ocs 103 and varc 101 may be wired or wireless . wireless connectivity options may include , but is not limited to , wi - fi or satellite connectivity and optimal bandwidth will be employed to ensure no lag time or degradation of signal quality for audio , video , or control system transmissions . there is one ocs 103 to execute and manage each parde event . additional ocs systems may be used as long as their use is coordinated . one or more uvs 101 can be associated to each parde event and there may be one or more varcs associated to each uv . the ocs 103 and associated uvs 102 are deployed centrally to the parde event physical location . the varc 101 deployments may be central to the parde launch site or may be remote with limitless distance based on having appropriate connectivity and bandwidth availability . the ocs 103 consists of an ocs - cpu node # n 203 ground based processor , and a cp . the ground based processor may be much more capable than the onboard processor ( op ) 212 due to lack of weight restrictions , and in normal operating conditions is responsible for analyzing received uv data , determining vehicle pose , augmenting content received from uvs , forwarding the content to varcs and rdps , verifying rdp commands , and performing semi - autonomous overrides on rdp commands deemed dangerous . it also has the ability to send alerts to outside authorities in case of emergency . the cp has a manual override and acts as a redundant human safety check on the computers actions and decisions , and also can contact outside authorities . the ocs cpu node # n 203 includes required processing power and data storage necessary to execute the parde operating system software 901 ( fig9 ) and manage all associated processing required for generation and delivery of augmented video , audio , motion and tactile content to the varcs 101 . the ocs cpu node # n 203 may be single or multiple laptops , pc , or server systems with varying cpus and processing power . the combination of ocs cpus may be networked together locally at the parde event location and operating on battery or local power systems . alternately the ocs cpus may be networked together with some of the processing occurring at the parde event location and some of the processing being done at a remote location or with all processing being done remotely and the local parde event system processing is accessing the parde operating system software remotely to execute the parde event and all associated and required cpu processing requirements . the parde operating system software layer of this system is architected to ensure flexible in networking configurability such that all parde operating system software ocs processes may be executed either all centrally , all remotely , or a combination of central and remote processing to the parde event location and associated ocs - cpu node # n 203 . fig3 pictorially depicts exemplary unmanned vehicles 102 with the following sub - categories : unmanned aerial vehicles ( uav ) 301 , unmanned ground vehicles ( ugv ) 302 , unmanned surface water vehicles ( usv ) 303 and unmanned underwater vehicles ( uug ) 304 . unmanned aerial vehicles are categorized based on their primary flight mechanism : unmanned multi - rotor aerial vehicles 305 , unmanned fixed wing aerial vehicles 306 and unmanned aerial animal based robotic vehicles 307 . unmanned ground vehicles are categorized based on the machine to ground interface : unmanned track mounted ground vehicles 308 , unmanned wheel - based ground vehicles 309 , unmanned multi - pod ground vehicles 310 and unmanned humanoid robotic vehicles 311 . one subcategory for unmanned surface water vehicles is shown : unmanned fixed hull surface water vehicles 312 . unmanned underwater vehicles are unmanned fixed shell underwater vehicles 313 and unmanned animal based underwater robotic vehicles 314 . the term โ vehicles โ as used above and throughout this patent means electro - mechanical machines able to transport and move in three dimensional space with control , propulsion and payload systems as described below . as shown in fig3 , primary systems in each uv 102 include receiver ( s ) 205 , a global positioning system ( gps ) 206 , sensors 207 , transmitters and data link systems 208 , an onboard processing system ( ops ) 210 and onboard motion , payload and support systems ( ompss ) 213 . primary onboard motion , payload and support systems include structural and landing systems 409 and propulsion and steering systems 410 . secondary systems include parde dependent and specific onboard payload and support systems ( opss ) 408 . onboard motion systems 407 are the combination of structural and landing systems 409 and propulsion and steering systems 410 . uv 102 movement can be initiated by creating forces leading to movement . propulsion systems can have a source of mechanical power ( some type of engine or motor , muscles ), and some means of using this power to generate force , such as wheel and axles , propellers , a propulsive nozzle , wings , fins or legs . structural components can be metal , plastic or composite materials . landing system components can be vertical take off and landing ( vtol ) components , runway driven , low - impact parachute and / or balloon , airbags or cushions . components should be made of weatherproof and durable material and constructed and assembled to withstand environmental factors . propulsion and steering systems 410 include commercial available components such as electronic speed control ( esc ) motors . wireless receivers 205 can be infrared and ultrasonic remote control devices ; professional land mobile radio ( lmr ), professional specialized mobile radio ( smr ); consumer two way radio including family radio service , general mobile radio service ( gmrs ) and citizen &# 39 ; s band ( cb ) radios ; amateur radio ( ham radio ); consumer and professional marine vhf radios ; air - band and radio navigation equipment used by aviators and air traffic control ; cellular telephone ; wireless usb or bluetooth ; satellite , and / or wi - fi . most embodiments have a gps 206 that records and transmits the latitude and longitude of the uv 102 with an accuracy of less than one meter . the latitude and longitude of the gps unit is typically determined by receiving gps satellite broadcast signals ( carrier frequency with modulation ) that includes a pseudorandom code ( sequence of ones and zeros ) that is known to the receiver . by time - aligning a receiver - generated version and the receiver - measured version of the code , the time of arrival ( toa ) of a defined point in the code sequence , called an epoch , can be found in the receiver clock time scale . the message that includes the time of transmission ( tot ) of the code epoch ( in gps system time scale ) and the satellite position at that time is also received by the receiver . the receiver measures the toas ( according to its own clock ) of four or more satellite signals . from the toas and the tots , the receiver forms four time of flight ( tof ) values , which are ( given the speed of light ) approximately equivalent to receiver - satellite range differences . the receiver then computes its three - dimensional position and clock deviation from the four tofs . the receiver position ( in three dimensional cartesian coordinates with origin at the earth &# 39 ; s center ) and the offset of the receiver clock relative to gps system time are computed simultaneously , using the navigation equations to process the tofs . the receiver &# 39 ; s earth - centered solution location is usually converted to latitude and longitude relative to an ellipsoidal earth model . these coordinates may be displayed ( e . g . on a moving map display ) and / or recorded and / or used by other systems ( e . g ., vehicle guidance ). onboard sensors 207 are for flight or vehicle management and control capturing audio and visual signals from the uv location and field of view for transmission to the ocs โ control and monitoring systems 218 . for pardes that require a high level of precision with respect to uv locations , sensors may include the following to augment gps 206 data : laser sensors 401 , optical sensors ( including infrared ( ir )) 402 , altimeters and / or acoustic depth finders 404 . laser sensors 401 field measure in real time uv height and distances from site obstacles and features . as described in more detail later , optical sensors capture real time images of the parde location making sure to specifically locate in their field of view pre - located qr ( quick response ) codes ( or site specific landmarks ) for geo - referencing . there may be separate optical sensors for navigation assistance and for payload support systems . additional onboard sensors 207 include gyroscope ( s ) 403 for flight control , unexpected obstacle avoidance 405 and critical systems 406 for monitoring battery power and emergency maneuvers and notification . lidar ( light detection and ranging ) system sensors 414 can be used to real - time mapping , sonar sensors 415 and pressure sensors 413 may also be used to relay information back to the ocs 103 and rdp or cp . transmitters and data link systems 208 may include a radio controlled transmitter , wi - fi , or satellite wireless systems . a radio transmitter connected to an antenna producing an electromagnetic signal such as in radio and television broadcasting , two way communications or radar . transmitters must meet use requirements including the frequency of operation , the type of modulation , the stability and purity of the resulting signal , the efficiency of power use , and the power level required to meet the system design objectives . transmitters generate a carrier signal which is normally sinusoidal , optionally one or more frequency multiplication stages , a modulator , a power amplifier , and a filter and matching network to connect to an antenna . a very simple transmitter might contain only a continuously running oscillator coupled to some antenna system . more elaborate transmitters allow better control over the modulation of the emitted signal and improve the stability of the transmitted frequency . for transmitter and data link systems 208 relying on wi - fi , the uv has to be equipped with a wireless network interface controller . the combination of computer and interface controller is called a station . all stations share a single radio frequency communication channel . transmissions on this channel are received by all stations within range . the hardware does not signal the user that the transmission was delivered and is therefore called a best - effort delivery mechanism . a carrier wave is used to transmit the data in packets , referred to as โ ethernet frames โ. each station is constantly tuned in on the radio frequency communication channel to pick up available transmissions . wi - fi technology may be used to provide internet access to devices that are within the range of a wireless network that is connected to the internet . the coverage of one or more interconnected access points ( hotspots ) can extend from an area as small as a few rooms to as large as many square miles . coverage in the larger area may require a group of access points with overlapping coverage . electronic signal repeaters may be needed to extend the wireless signal to the entire parde local . onboard processing systems ( ops ) 210 include autopilot hardware and software 211 and an onboard processor ( op ) 212 . autopilot hardware and software can be open - source autopilot systems oriented toward inexpensive autonomous aircraft . an autopilot allows a remotely piloted aircraft to be flown out of sight . all hardware and software can be open - source and freely available to anyone under licensing or applicable agreements . free software autopilots provide more flexible hardware and software . autopilot hardware and software 211 is modified as described below to include special flight control requirements . an onboard processor 212 is a computer processing unit and uninterruptable power supply ( ups ) onboard individual uvs 102 . one function of the onboard processor is to process and compress video signals from optical sensors 402 prior to transmission to the ocs - cpu node # n 203 , processing of gps 206 data and optical sensor 402 data for determining uv 102 location ( s ), and return home fail - safe flight control in the event of loss of signal from the ocs 103 . fig4 illustrates exemplary architecture for an unmanned vehicle for use with embodiments disclosed herein . integral to the architecture is modularity and adaptability to vehicles regardless of their classification ( i . e ., uav 301 , ugv 302 , usv 303 or uuv 304 ). while components such as onboard processing systems 210 and onboard motion , payload and support systems 213 are adapted and designed for compatibility and functionality for the various vehicle classifications , several components including gps 206 , sensors 207 , receivers 205 and transmitters 208 have less need for specialization . on board payload and support systems ( opss ) 408 can include items such high - resolution cameras , ir and thermography imaging systems or other sensory systems . systems to include various camera types with different focal lengths and sensor sizes ( rgb , multi - spectral camera ), gaming accessories ( e . g ., ir beam for targeting , optical sensor / receiver for measuring โ hits โ). as shown in fig4 , the uvs are provided approved remote drone pilot ( rdp ) commands or override commands 209 from the ocs 103 . as previously discussed , rdps and rdcps commands are processed and assessed for consistency with the parde mission plan , safety requirements , etc . prior to being transmitted to the uvs 102 . override commands to the uv are implemented at the discretion of the control pilot 104 and parde specific flight rules . data from onboard sensors will be transmitted to the ocs 103 and onboard processor 212 . sensors have flight control and monitoring duties and may be used as the primary flight guidance tools in the event contact to the ocs 103 is lost and / or the gps 206 signal is unavailable . loss of signal and resulting control architecture is presented in more detail in fig1 a , 16 b and 16 c . basic functionality of the uv 102 is presented in table 1 . fig6 presents an exemplary virtual augmented reality cockpit ( varc ) # n 101 in accordance with embodiments disclosed herein . components of the varc can include : varc - centric signal transmission , receiving and varc onboard processing systems 201 , visual systems 602 , audio systems 603 , control systems 604 and tactile and motion feedback systems 601 . a varc can be used by remote drone pilots ( rdp ) s or remote drone co - pilots ( rdcp ) 106 or control pilots ( cp ) 104 . fig6 a through 6d present variations and embodiments of the various components . fig6 a illustrate varc system tactile and motion feedback components 601 such as : motion chair 610 with up to 6 degrees of freedom 625 . a self - enclosed 3d motion pod 611 would also have up to 6 degrees of freedom 625 with respect to motion . during a parde , tactile feedback is provided to the pilot ( s ) including scents delivered using spray nozzles or vaporizers and olfactory inputs 612 such as perfumes . moisture inputs 613 can be integrated through water spray nozzles . heat and air ( wind ) inputs 614 can be incorporated as well . fig6 b shows exemplary varc visual system components 602 including large screen televisions , monitors 615 or flexible wallpaper televisions . virtual reality ( vr ) goggles 616 are available from third party providers such as rift from oculus ( menlo park , calif . ), google glass from google ( mountain view , calif . ), samsung products ( ridgefield , n . j .) or equivalent product . lastly , a simple computer screen , tablet or smart phone 617 could be used to visualize content . fig6 c presents two examples for audio system components 603 delivering and receiving on the varc including a standard earbud and / or headset and microphone 618 and speakers 619 . control systems for the varc include : motion and control systems 605 , environmental interface systems ( speakers , lights , robotic physical and chemical sensors and manipulators ) 606 , payload control systems 607 , gaming systems 608 and sensors 609 . fig6 d presents exemplary varc control system components 604 and control methods that include the use of joysticks , yolks and / or pedals 620 , kinematic and motion sensor controls 621 and neurotelepathic control 622 either wired 623 or wirelessly 624 . variations and combinations of the audio and visual components could be made for instance into a gel - helmet , form fitting to the pilots head . the varc 101 at its simplest may consist of vr goggles 616 and a hand held radio controlled joystick and controllers 620 . a high end version of the varc could include a motion capable chair which will simulate the uv orientation , speakers , and a screen or goggles . a parde may contain one or more users all utilizing a single ocs 103 . a single uv may have multiple varcs 101 and rdps 106 utilizing it . one rdp may be โ primary โ and have vehicular control while the others may be โ secondary โ and may only have control over their field of view . a single varc and rdp may switch between different uv platforms , of either the same type ( uav 301 , ugv 302 , usv 303 or uuv 304 ) or of a different type . the parde experience in the varc 101 for the pilot may include augmented virtual content , overlaid on the uv data by the ocs 103 . this additional content may be visual , auditory , or tactile in nature , such as a virtual guide or the sound and overpressure of a virtual explosion . varc embodiments are listed below but it should be noted that the varc 101 can exist in a wide range of incarnations . the following exemplary combinations of motion and tactile configurations , audio and visual configurations and control configurations can be result several varc embodiments : video display with handheld remote control system , fpv goggles with handheld remote control system , fpv goggles with more realistic integrated seat and control systems , fpv goggles with virtual chair that provides motion and control systems , fpv goggles with virtual chair , full motion and control system tactile force feedback , and high definition , wrap around display in fully enclosed cockpit with full motion and cockpit and control system tactile force feedback . this varc embodiment is a cockpit / capsule ( pod ) that the pilot steps into and that closes completely around the pilot to provide a sound proof and light proof immersed environment . the multiple varcs 101 and rdp / rdcp 106 can interface with a single uv 102 . while only one โ primary โ rdp can give control commands at any given time , an unlimited number of rdcps can interface as โ secondary โ users . these rdps may have control of the field of view presented in their varc , comparable to a passenger in a regular vehicle looking out different windows . uv control may also be passed from the โ primary โ rdp to a โ secondary โ. rdps can also switch between interfacing with different uv platforms in a single varc . fig7 illustrates exemplary varc 101 architecture for use with embodiments of the system . each varc # n 101 has two main elements : varc - centric signal transmission , receiving and varc onboard processing systems ( vop ) 201 and controls and interface systems 223 . systems for delivering augmented content to the user , or rdp / rdcp 106 include tactile and motion feedback systems 601 , visual systems 602 and audio systems 603 . motion systems within the tactile and motion feedback 601 include the mechanical , electrical , and software systems that receive the pilot control input information and real - world - environment sensor data and translate the motion of the cockpit to simulate the real - world uv 102 motion . visual systems 602 are the means by which a user views real world images from the uv 101 and overlaid visual augmented content . audio systems 603 are the means by which a user views hear audio files and real time audio from the uv 102 location or communicate with other pilots , including the control pilot 104 . uv 102 control by the rdp or rdcp 106 are performed using specialized and personalized control systems 604 . this includes motion control systems 605 for vehicle motion control , environmental interface systems 606 specific to the parde mission at hand , payload control systems 607 , gaming systems 608 controls and sensors 609 . varc sensors may include gyroscopes , power sensors , temperature sensors , etc . pilots may control uv 102 payload control systems 607 through standard joysticks , buttons , etc . but may using head motion tracking systems ( e . g ., camera views may be controlled through head motion to simulate real - time environment viewing ). also shown on fig7 is exemplary architecture for personalization of rdp or rdcp settings 702 . settings can be set in advance or just prior to a parde event . they can be accessed and set via a user web portal 701 or other means . settings for personalization to the rdp or rdcp 106 include : language 703 , skill level 704 , augmented reality ( ar ) content preferences 705 , and additional settings 706 as needed . an example of personalized audio ar content delivery can as simple as having the rdp or rdcp 106 enter their preferred genre of music to be played in the background during a flight . visual ar content personalization could include wanting to have access to retrieve specific topical information about a location during parde . as for tactile and motion feedback related ar , the user may prefer a jarring experience while others may prefer a smooth and calming ride in the varc . depending on the embodiment , the varc - centric signal transmission , receiving and varc onboard processing systems 201 may be installed or integral to the motion chairs 610 or 3d motion chair pods 611 , vr goggles 616 , headset and microphones 618 , or any of the varc control system components 604 . a varc onboard processor ( vp ) # p will process the data and signals from the ocs 103 via receiver 221 and to the ocs 103 via a transmitter 222 . basic functionality of the varc 101 is presented in table 2 . the operational control system 103 includes control pilot interface 531 systems and components 509 - 520 that make up the computer system ( s ) associated to the ocs . the cp interface 531 includes sub - components that allow the cp to interface with the computer system and control the rde operating system software 901 for parde development and execution and parde launch time . the ocs includes local cpu ( s ) 510 for pre - parde development as well as during parde modifications of settings as and if needed . the ocs is connected to the internet 530 and additional local or regional cpu nodes 203 may be available for additional processing power as needed for execution of parde and delivery of augmented content to rdps in their associated varcs 101 . system components and descriptions associated with the ocs 103 include : ocs control and monitoring systems 218 , transmitters 219 , receivers 220 and local or regional ocs - cpu nodes # n 203 . sub - components of the ocs control and monitoring systems 218 include cp interface 531 , address and data bus 509 , local ocs - cpu 510 , disk controllers 511 , graphic cards 512 , sound cards 513 , network cards 514 , i / o ports 515 , modems 516 , mass memory 517 , rom 518 , ram 519 and clock 520 . cp interface 531 can be for one cp 104 or a network of cps as necessary . cp interface 531 systems include : keyboard 521 , printer 522 , mouse 523 , pen / tablet display input devices 524 , memory sticks 525 , hard drive 526 , dvd / cd drives 527 , monitors 528 , audio speakers 529 and internet 530 . the ocs draws from data parde configuration settings 214 and communicates either directly or through the cp 106 with regulatory , public relations , safety or information sources and entities through the external communication systems 217 . either the onboard processing systems 210 or ocs 103 may provide flight data , parde mission plan information , uv 102 condition , and system status to external and local services such as police , emergency crews , regulatory , public relations and local faa . communication of this information is facility through the external communications 217 systems . the ocs 103 or cp 104 may allow programming or real - time entry of new instructions to modify the pre - defined operational parde mission plans sent from the ocs . a parde mission plan may include multiple waypoints or destinations during the parde mission plan . a uv 102 may experience difficulties , which makes necessary the ability for the uv 102 to receive real - time instructions given to facilitate an efficient and effective management of system conditions such as battery level and heat . additionally , there may be a desire to modify the parde mission plan due to other factors such as environment conditions , cp or rdp preferences . to ensure compliance with operation parde mission plans , the ocs 103 may continuously monitor the uv &# 39 ; s 102 current pose , speed , and acceleration . the ocs 103 to interface with more than one varc at a time . 1 . safety communications and systems โ communication system ( s ) with required frequencies to connect to local and regional regulatory , public relations , and safety facilities . cp interface systems may include various types and forms of microphones and audio devices including table mounted , headsets , or other commercially available components . 2 . pilot communications and systems โ communication system ( s ) with variability in frequencies and internet connectivity to connect and communicate with local , regional , national , or global rdps and associated varcs and the associated control pilot running the parde . rdp and cp interface systems may include various types and forms of microphones and audio devices including table mounted , headsets , or other commercially available components . 3 . monitoring station and systems โ may include one or multiple local or regionally connected computer systems which may be portable , desktop , server , or micro - computer systems . the monitoring system may include one or more monitors to support visual monitoring for safety of pilots and uv activity . cps may view one , multiple , or all active rdps and uvs via the multi - monitor system and control of current view ( s ) for cp monitoring is managed through the rde operating system . basic functionality of the ocs 103 is presented in table 3 . functions are supported through the parde operating system software and executed by the cp via the ocs 103 systems as indicated below . a hierarchic object - oriented design ( hood ) diagram of the ocs 103 parde operating system software 901 is in fig9 . the system is integrated across ocs 103 , varc 101 , and uv 102 . hood diagrams ( fig9 through 13 ) present example hierarchical decompositions of the design into software units based on identification of objects , classes and operations reflecting problem domain entities and objects related to digital programming entities . the diagrams comprise textual and associated diagrammatic representations allowing formal refinement , automated checking , user customizable documentation generation and target language source code generation . an internet web portal for user access and pilot profile configuration may be used . the portal is a secure user portal ( web and mobile ) to support initial setup and configuration by administrative staff and access for profile updates by the users . for rdp and rdcp 106 profiles , the following information may be used : pilot id , demographics ( name , address , credit , etc . ), pilot call sign , pilot secure logon information , and pilot event based content ( audio / visual ). restricted access to the website will include systems management data , information and controls including : certification level , pilot & amp ; control profile settings , autonomy control settings ( over ride control ) ( direct , semi direct , and / or supervised ), direct control settings ( control sensitivity settings ) ( beginner , intermediate , or expert ). universal and personal geofencing computational aspects will be executed in the ocs 103 . a flight or parde mission planning software such as qgroundcontrol ( or similar ) will be loaded and run on the ocs 103 . in general , the parde mission planning software receiver end runs on the receiver version on the autopilot 211 . the ocs - control and monitoring systems 218 will subscribe to gps 206 on uvs 102 . gps will publish data to the ocs . the autopilot 211 will subscribe to the data that the ocs - control and monitoring system 218 processes . current ar ( augmented reality ) technology only uses qr codes and handheld devices to overlay ar content to a real environment ( layar , apple iphone application , 2015 ). embodiments disclosed herein include delivery of ar content to users who are simultaneously driving , flying or โ riding โ as rdcp in uvs in a predetermined 3d environment . fig8 presents an example of parde data and settings 214 architecture . hierarchic object - oriented design ( hood ) diagrams of the visual and audio data and settings are shown in fig1 and 11 , respectively . a hierarchic object - oriented design diagram of the motion and tactile content data and settings is shown in fig1 . fig8 presents data and settings that may require collecting new data , connecting to existing databases or downloading third party software and data for use in the parde whereas fig1 through 12 show primarily the software object hierarchy , some hardware systems interaction and a general , processes representation on the how software and hardware may interact . at least two sets of information , setting and services may be used in the parde system . they are : spatial data , site settings and preferences 215 and augmented content data and settings 216 . all of the information from these are directed to and processed at the ocs 103 โ specifically the ocs - cpu node # n 203 and ocs โ control and monitoring systems 218 . spatial data 801 includes restricted area and static 3d virtual boundary input data 803 and benchmarks and significant locating features 804 . topographic mapping 805 can be performed by high resolution surveying in the parde area or through 3 rd party satellite imagery and existing databases . similarly , vegetative mapping 806 can be performed by on - site surveys and / or existing databases . flora including trees , underbrush , groundcover mapping will be needed for parde mission planning and control and for augmented content delivery purposes . structure and obstacle mapping 806 could include buildings , poles , overhead utility lines , breakwaters , moorings , pits , signs , etc . this information will be used for parde mission planning and control as may be used to enhance or help deliver augmented content . changes in topography , vegetation , structures and obstacles can occur over time dating back through recent history or projecting and predicting over time . the system will be developed to include and record these changes for mission control , safety , research and educational purposes . this information will be used to develop a 3d point cloud map and to geo - locate mission control points and augmented reality enhancements delivery . specific to uv 102 location components , benchmarks and significant locating features 804 include gps coordinates , quick response , bluetooth beacons , and site monuments 808 that have a unique visual signature and a known or determined 3d location in space ( i . e ., latitude , longitude and elevation ). these can range in size from the 4 cm 2 to the size of a building or significant landscape horizon . the system will include options to have approved launch and landing areas 809 identified and used during pardes in the event of an emergency or cp 104 approved command . launch and landing areas will depend on site specific logistics and structural and landing systems 409 of the uv 102 . site settings and preferences 802 include event category identification ( id ) and information 810 , site contact data and protocols 811 , external traffic feed information 812 , regulatory requirements 813 , position , time and space restrictions 814 , site specific weather information feed 815 . adding to the safety and logistics of a parde , each of these settings and preferences will be configurable . event category id and information 810 may include settings for research protocols , educational system content requirements , health and wellness protocols or other market or user group categorization . site contact data and protocols 811 are easily retrievable and communications protocols for site owners and operators . external traffic feed information 812 may include air traffic , boating and navigational traffic feeds to help parde mission planning and ensure obstacle avoidance . regulatory requirements 813 will include requirements that may impact a parde . for example , allowable flight altitude or local zoning , privacy and noise ordinances might impact planned parde execution . site specific position , time and space restrictions 814 not otherwise accounted for and specific to the parde location will be used in parde mission planning and execution . examples might be no uv 102 flight next to a school during student drop off and pick up times or restrictions on habitat and natural resources . a site specific weather information feed will be available for parde mission planning and execution and to monitor conditions in and around the parde area . augmented reality ( ar ) content includes 2d and 3d graphics , video , audio , and text files , tactile , motion , olfactory and sensory protocols loaded onto ocs - cpu node # n 203 . ar content can be delivered at specific planer markers or gps 206 waypoints . content will be associated to planer markers or gps waypoints and presented visually through the varc 101 to the user when associated marker or waypoint is within the user &# 39 ; s field of view . ar will be superimposed in the real - world view at pre - defined coordinates , at appropriate corresponding gps coordinates , at qr codes or at known vector locations within the real - world view . ar content may be directly visible to the rdp or rdcp 106 or cp 104 or accessible to the users through a visual interactive interface . content can be adjusted in size and proportion in order to look near or far based on distance of uv to marker or waypoint and based on configured size of augmented content within the real world . visual interactive interfaces may also adjust size and proportion based on distance and rdps will interact through voice , mechanical , motion , or other means . augmented content data and settings 216 include , but are not limited to , the following : content category identification ( id ) and information 816 , tactile profile 817 data , olfactory and sensory profile 818 data , animation databases 819 , multimedia partner feeds 820 , site specific augmented reality content 821 , storyboards 822 and production elements 823 . content category id and information 816 is used to categorize and easily retrieve parde ar content from one parde to another . tactile profile 817 data includes the protocols for delivering a motion feedback pattern to the varc 101 and rdp and / or rdcp 106 . for example , a ugv 302 might feel differently to a user if it were moving over sand and rocks as opposed to asphalt . that tactile difference will be programmed to the varc 101 through the ocs 103 using these settings . similarly , olfactory and sensory profile 818 data will include initiating different particular scents perhaps when the uv is passing through a flower patch or pine forest . a usv 303 might participate in a parde that travels near a waterfall at which time these settings would initiate a water mist to the user for example . animation databases 819 include all the necessary software development to provide animation layered over the fpv of the rdp / rdcp 106 or cp 104 . animation will included polygon structures and skins programmed to move , react , and interact with the real environment via the varc 101 and ocs 103 . augmented reality visual content and animation can be achieved through proprietary software or open source object recognition library software such as aruco , for opencv . predetermined gps coordinates , qr visual aids within a parde will be used as anchor points to tie the visual ar content to real environment locations . data from optical sensors 402 will be sent to the ocs - cpu node # n 203 where object recognition software will be run . distinct and unique non - planar markers will be used for positioning reference , though may be possible to use gps waypoints as substitutes depending on type of content and needed location accuracy needed . augmented content can be pushed to or retrieved by the user . the goal is to render ar content to the user at between 27 to 30 frames per second ( fps ). augmented content preferences can be configured . multimedia partner feeds 820 from 3 rd party producers such as book , radio and television or internet based publishers ( e . g ., national geographic , or the history channel ), will provide content for delivery to the varcs 102 and users . site specific ar content 821 could be 2d or 3d graphics , video , text or audio content the parde location and event needs . multi - model , multiuser pardes may be choreographed and planned from beginning to end . as such , storyboards 822 and associated production elements 823 ( lighting , music , and staging ) will be developed and used for re - occurring parde themes and topics . augmented visual content development and delivery 1001 shown in fig1 have pre - programmed display 1002 features , real time display 1003 features prompted , or initiated by triggers 1004 ( e . g ., specific gps coordinate ), and site specific display requirements 1005 . there are common elements between the pre - programmed display 1002 and real time display 1003 to the varc 101 through the ocs . they include but are not limited to : video , animation , graphics , holograms , gps coordinates , speed , altitude , gaming scores or data , environmental interface data , wellness program plans of care and performance , floating icons , and movable maps . site specific display requirements 1005 might be age restricted material , skins and other animated settings , advertising and business - related requirements . information specific to a defined real - world location ( such as landmark information or topology information ) will be presented at the gps coordinates of that real - world location . telemetry associated to other uvs 102 operating within the current parde will be displayed in association with that uvs location as it is visible in the real - world view . augmented audio content development and delivery 1101 shown in fig1 have pre - programmed audio 1102 features , real time audio 1103 features prompted and site specific audio requirements 1104 . there are common elements between the pre - programmed audio 1102 and real time audio 1103 to the varc 101 through the ocs . they include but are not limited to : audio files , gps coordinates , 3 rd party content and services site specific audio requirements 1104 might be age restricted material , local audio files , or advertising and business - related requirements . information specific to a defined real - world location ( such as landmark information or topology information ) will be presented at the gps coordinates of that real - world location . telemetry associated to other uvs 102 operating within the current parde will be transmitted in association with that uvs as it is located the real - world view . augmented tactile and motion content development and delivery 1201 shown in fig1 have pre - programmed motion and tactile features 1202 , real time motion and tactile response 1203 and site specific motion and tactile requirements 1204 . there are common elements between the pre - programmed motion and tactile features 1202 and real time motion and tactile response 1203 to the varc 101 through the ocs . they include but are not limited to : motion signatures and profiles , olfactory profiles , moisture profiles , heat and air profiles , and gps coordinates . real - time motion and tactile response 1203 also includes protocols for setting responses to the uv &# 39 ; s 102 proximity to the universal geofence or its proximity to other uvs . site specific motion and tactile requirements 1204 might be age restricted motion , motion signatures profile settings , and advertising and business - related requirements . motion and tactile feedback specific to a defined real - world location ( e . g ., cold , moist tunnel ) will be presented at the gps coordinates of that real - world location . telemetry associated to other uvs 102 operating within the current parde will be processed and may impact the varc 101 motion and / or tactile feedback if another uv enters the personal geofence boundary as discussed later . a hierarchic object - oriented design diagram of the environmental interface , payload control and gaming systems is shown in fig1 . augmented environmental interface and gaming content development and delivery 1301 have pre - programmed payload requirements 1302 , real time payload 1303 requirements and site specific payload requirements 1304 . there are common elements between the pre - programmed payload requirements 1302 and real time payload 1303 requirements to the varc 101 through the ocs . they include but are not limited to chemical , physical and electrical manipulation profiles , and gps coordinates . real - time payload 1303 features also includes protocols for setting responses to the uv &# 39 ; s 102 proximity to the universal geofence or its proximity to other uvs . site specific payload requirements 1304 might be vibration restrictions , weather conditions , chemical , physical and electrical manipulation profile settings , and advertising and business - related requirements . payload response specific to a defined real - world location ( e . g ., environmental parameter measuring instrument such as a photoionization detector ) will be presented at the gps coordinates of that real - world location . telemetry associated to other uvs 102 operating within the current parde will be processed and may impact the varc 101 payload controls feedback . fig1 shows a generalized personalized augmented reality drone event ( parde ) run flowchart . 1404 shows a conceptual representation of the variable control a rdp 106 may be allowed to have by the ocs 103 and cp 104 based upon the pilot &# 39 ; s past performance and results of user skill level protocol assessment 1403 . the assessment can occur at any time before the parde is started . in - parde modifications can be made to the level of control a pilot is given by the cp 104 . an expert in 1404 may be give full attitude control while a less experience rdp , or beginner will only be give a perceived 1 - st order control . this would be analogous to riding a roller coaster on rails and have the speed controlled by either the ocs 103 or cp 104 . the safety and content override command 1412 are flight control related and ar elements of the approved remote drone pilot ( rdp ) command or override command 209 . controls and ar content are continually reviewed , assessed , processed and transmitted by the ocs 103 and / or cp 104 . as the level of sophistication and programmable protocols are automated in the ocs 103 , less direct control and / or supervision by the cp 104 will be needed . fig1 shows an example parde universal and personal geofencing in accordance with the invention . the parde universal geofence layout 1501 is developed by defined boundary locations of a 3d space . the parde personal geofence 1502 is defined as a sphere of radius โ x โ whereby autonomous behavior of the uvs 102 are initiated to avoid collisions for example . the universal boundaries are defined using universal geofence settings 1503 in cartesian coordinates ( latitude , longitude and elevation ). the accuracy of the grid is less than 1 foot depending on the gps 206 and parde spatial data 801 and point cloud resolution . the location of universal geofence settings 1503 will be such that a 3d space with contiguous sides can be rendered providing the uvs with an โ allowable โ space to execute the desired parde mission plan . the allowable space will be the 3d universal geofence setting boundaries minus some distance , or buffer zone . fig1 shows a typical universal geofence logic flowchart . autonomous corrective behavior of the uv 102 will be initiated to prevent passing through the geofence boundaries . uv 102 on - board gps 206 optimally provides uv 102 localization ; in cases of gps 206 signal loss the onboard processor 212 redundantly provides vehicle localization based on visual processing algorithms . field located visual quick response ( qr ) codes or equivalent 1504 will be placed in areas of the parde visible by the uvs 102 . equivalent visible markers will include some benchmarks and significant locating features 804 . this system of qr codes , markers and benchmarks is used to create an outdoor distributed image network ( odin ). the odin defines network of images which allows high accuracy localization which is important for motion control and stable transmission and delivery of ar . uv 102 on - board gps 206 optimally provides vehicle localization ; in cases of gps signal loss the onboard processor 212 redundantly provides vehicle localization based on visual processing algorithms . in case of command signal loss the autopilot will return the vehicle to its origin point , if gps signal is also lost it will do the same based off the onboard processor visual processing . fig1 a , 17 b and 17 c are visual representations of the safety protocols of this claim for various loss of signal scenarios . gps 206 , sensors 207 , receiver 205 and the onboard processing systems ( ops ) 210 function redundantly to allow for a high degree of certainty with respect to uv 102 location . loss of signal 1601 can occur from these systems . when the gps 206 signal is lost , sensor 207 visual cues can be used with processing by the ocs 103 for safe return to an approved โ home base โ, landing or staging area for example . if the loss of signal 1701 is to the receiver 205 , gps 206 and visual cues 1702 together are processed in the ops 210 to direct a safe return of the uv 102 for example . if the loss of signal is to both the receiver 205 and gps 206 system , visual cues 1702 from the sensor 207 could be processed in the ops 210 to direct a safe return of the uv 102 for example . the personal geofence is a defined 3d sphere around individual uvs which is not allowed to overlap with another uvs individual geofence . any command by a rdp ( s ) to bring uvs close enough to violate this rule will result in the ocs 103 overriding their commands and separating the vehicles to an acceptable distance . uv 1 and uv # m in the figure show the closest proximity two uvs may be allowed before override command 209 prevents a collision . fig1 a and 18b show examples of conceptual pardes for example gaming and eco - touring pardes . both are showing events in to occur in real time in real environments ( e . g ., school football field , forest and ocean ). multi - model uvs include aerial , ground and underwater vehicles . both universal geofences 1501 and personal geofences 1502 are shown . elements of the odin field located qr codes 1504 and universal geofence settings 1503 are shown . site specific augmented content 821 represented by two ar animated castles is visible through the varc 101 . an example 3d point cloud from topographic mapping 805 and vegetative mapping 806 are shown .
| 6 |
one object of the invention is to provide a method and a system for production of and use of carbon - isotope monoxide in labeling synthesis that overcomes the drawbacks of the prior art devices . this is achieved by the method and system claimed in the invention . one advantage with such a method and system is that nearly quantitative conversion of carbon - isotope monoxide into labeled products can be accomplished . there are several other advantages with the present method and system . the high - pressure technique makes it possible to use low boiling solvents such as diethyl ether at high temperatures ( e . g . 200 ยฐ c .). the use of a closed system consisting of materials that prevents gas diffuision , increases the stability of sensitive compounds and could be advantageous also with respect to good manufacturing practice ( gmp ). still other advantages are achieved in that the resulting labeled compound is highly concentrated , and that the miniaturization of the synthesis system facilitates automation , rapid synthesis and purification , and optimization of specific radioactivity through minimization of isotopic dilution . most important is the opening of completely new synthesis possibilities , as exemplified by the present invention . embodiments of the invention will now be described with reference to the figures . the term carbon - isotope that is used throughout this application preferably refers to 11 c , but it should be understood that 11 c may be substituted by other carbon - isotopes , such as 13 c and 14 c , if desired . fig1 shows a flow chart over the method according to the invention , which firstly comprises production of a carbon - isotope monoxide enriched gas - mixture and secondly a labeling synthesis procedure . more in detail the production part of the method comprises the steps of : providing carbon - isotope dioxide in a suitable carrier gas of a type that will be described in detail below . converting carbon - isotope dioxide to carbon - isotope monoxide by introducing said gas mixture in a reactor device which will be described in detail below . removing traces of carbon - isotope dioxide by flooding the converted gas - mixture through a carbon dioxide removal device wherein carbon - isotope dioxide is trapped but not carbon - isotope monoxide nor the carrier gas , the carbon dioxide removal device will be described in detail below . trapping carbon - isotope monoxide in a carbon monoxide trapping device , wherein carbon - isotope monoxide is trapped but not said carrier gas . the carbon monoxide trapping device will be described in detail below . releasing said trapped carbon - isotope monoxide from said trapping device , whereby a volume of carbon - isotope monoxide enriched gas - mixture is achieved . the production step may further comprise a step of changing carrier gas for the initial carbon - isotope dioxide gas mixture if the initial carbon - isotope dioxide gas mixture is comprised of carbon - isotope dioxide and a first carrier gas not suitable as carrier gas for carbon monoxide due to similar molecular properties or the like , such as nitrogen . more in detail the step of providing carbon - isotope dioxide in a suitable second carrier gas such as he , ar , comprises the steps of : flooding the initial carbon - isotope dioxide gas mixture through a carbon dioxide trapping device , wherein carbon - isotope dioxide is trapped but not said first carrier gas . the carbon dioxide trapping device will be described in detail below . flushing said carbon dioxide trapping device with said suitable second carrier gas to remove the remainders of said first carrier gas . releasing said trapped carbon - isotope dioxide in said suitable second carrier gas . the labeling synthesis step that may follow the production step utilizes the produced carbon - isotope monoxide enriched gas - mixture as labeling reactant . more in detail the step of labeling synthesis comprises the steps of : providing a high pressure reaction chamber having a liquid / gas reagent inlet and a gas inlet in a bottom surface thereof . the reaction chamber will be described in detail below . providing a substrate solution to be labeled mixed with a transition metal complex . providing h 2 gas , with optional water or hor , where r is independently linear or lower cyclic alkyl or aryl . introducing the carbon - isotope monoxide enriched gas - mixture into the reaction chamber via the gas inlet . introducing , at high pressure , said h 2 gas , with optional water or hor , into the reaction chamber via the liquid / gas inlet . introducing , at high pressure , said substrate solution mixed with transition metal complex into the reaction chamber via the liquid reagent inlet . waiting a predetermined time while the labeling synthesis occurs . removing the solution of labeled compound from the reaction chamber . reducing the labeled compounds to alcohol . substituting with a halogen atom to obtain organohalide compounds . the step of waiting a predetermined time may further comprise adjusting the temperature of the reaction chamber such that the labeling synthesis is enhanced . fig2 schematically shows a [ 11 c ] carbon dioxide production and labeling - system according to the present invention . the system is comprised of three main blocks , each handling one of the three main steps of the method of production and labeling : block a is used to perform a change of carrier gas for an initial carbon - isotope dioxide gas mixture , if the initial carbon - isotope dioxide gas mixture is comprised of carbon - isotope dioxide and a first carrier gas not suitable as carrier gas for carbon monoxide . block b is used to perform the conversion from carbon - isotope dioxide to carbon - isotope monoxide , and purify and concentrate the converted carbon - isotope monoxide gas mixture . block c is used to perform the carbon - isotope monoxide labeling synthesis . block a is normally needed due to the fact that carbon - isotope dioxide usually is produced using the 14n ( p , ฮฑ ) 11 c reaction in a target gas containing nitrogen and 0 . 1 % oxygen , bombarded with 17 mev protons , whereby the initial carbon - isotope dioxide gas mixture comprises nitrogen as carrier gas . however , compared with carbon monoxide , nitrogen show certain similarities in molecular properties that makes it difficult to separate them from each other , e . g . in a trapping device or the like , whereby it is difficult to increase the concentration of carbon - isotope monoxide in such a gas mixture . suitable carrier gases may instead be helium , argon or the like . block a can also used to change the pressure of the carrier gas ( e . g . from 1 to 4 bar ), in case the external system does not tolerate the gas pressure needed in block b and c . in an alternative embodiment the initial carbon - isotope dioxide gas mixture is comprised of carbon - isotope dioxide and a first carrier gas that is well suited as carrier gas for carbon monoxide , whereby the block a may be simplified or even excluded . according to a preferred embodiment ( fig2 ), block a is comprised of a first valve v 1 , a carbon dioxide trapping device 8 , and a second valve v 2 . the first valve v 1 has a carbon dioxide inlet 10 connected to a source of initial carbon - isotope dioxide gas mixture 12 , a carrier gas inlet 14 connected to a source of suitable carrier gas 16 , such as helium , argon and the like . the first valve v 1 further has a first outlet 18 connected to a first inlet 20 of the second valve v 2 , and a second outlet 22 connected to the carbon dioxide trapping device 8 . the valve v 1 may be operated in two modes a , b , in mode a the carbon dioxide inlet 10 is connected to the first outlet 18 and the carrier gas inlet 14 is connected to the second outlet 22 , and in mode b the carbon dioxide inlet 10 is connected to the second outlet 22 and the carrier gas inlet 14 is connected to the first outlet 18 . in addition to the first inlet 20 , the second valve v 2 has a second inlet 24 connected to the carbon dioxide trapping device 8 . the second valve v 2 further has a waste outlet 26 , and a product outlet 28 connected to a product inlet 30 of block b . the valve v 2 may be operated in two modes a , b , in mode a the first inlet 20 is connected to the waste outlet 26 and the second inlet 24 is connected to the product outlet 28 , and in mode b the first inlet 20 is connected to the product outlet 28 and the second inlet 24 is connected to the waste outlet 26 . the carbon dioxide trapping device 8 is a device wherein carbon dioxide is trapped but not said first carrier gas , which trapped carbon dioxide thereafter may be released in a controlled manner . this may preferably be achieved by using a cold trap , such as a column containing a material which in a cold state , ( e . g . โ 196 ยฐ c . as in liquid nitrogen or โ 186 ยฐ c . as in liquid argon ) selectively trap carbon dioxide and in a warm state ( e . g . + 50 ยฐ c .) releases the trapped carbon dioxide . ( in this text the expression โ cold trap โ is not restricted to the use of cryogenics . thus , materials that trap the topical compound at room temperature and release it at a higher temperature are included ). examples of suitable material are silica and porapac q ยฎ. the trapping behavior of a silica - column or a porapac - column is related to dipole - dipole interactions or possibly van der waal interactions . the said column 8 is preferably formed such that the volume of the trapping material is to be large enough to efficiently trap (& gt ; 95 %) the carbon - isotope dioxide , and small enough not to prolong the transfer of trapped carbon dioxide to block b . in the case of porapac q ยฎ and a flow of 100 ml nitrogen / min , the volume should be 50 - 150 ฮผl . the cooling and heating of the carbon dioxide trapping device 8 may further be arranged such that it is performed as an automated process , e . g . by automatically lowering the column into liquid nitrogen and moving it from there into a heating arrangement . according to the preferred embodiment of fig2 , block b is comprised of a reactor device 32 in which carbon - isotope dioxide is converted to carbon - isotope monoxide , a carbon dioxide removal device 34 , a check - valve 36 , and a carbon monoxide trapping device 38 , which all are connected in a line . in the preferred embodiment the reactor device 32 is a reactor furnace comprising a material that when heated to the right temperature interval converts carbon - isotope dioxide to carbon - isotope monoxide . a broad range of different materials with the ability to convert carbon dioxide into carbon monoxide may be used , e . g . zinc or molybdenum or any other element or compound with similar reductive properties . if the reactor device 32 is a zinc furnace it should be heated to 350 to 400 ยฐ c ., and it is important that the temperature is regulated with high precision . the melting point of zinc is 420 ยฐ c . and the zinc - furnace quickly loses it ability to transform carbon dioxide into carbon monoxide when the temperature reaches over 410 ยฐ c ., probably due to changed surface properties . the material should be efficient in relation to its amount to ensure that a small amount can be used , which will minimize the time needed to transfer radioactivity from the carbon dioxide trapping device 8 to the subsequent carbon monoxide trapping device 38 . the amount of material in the furnace should be large enough to ensure a practical life - time for the furnace ( at least several days ). in the case of zinc granulates , the volume should be 100 - 1000 ฮผl . the carbon dioxide removal device 34 is used to remove traces of carbon - isotope dioxide from the gas mixture exiting the reactor device 32 . in the carbon dioxide removal device 34 , carbon - isotope dioxide is trapped but not carbon - isotope monoxide nor the carrier gas . the carbon dioxide removal device 34 may be comprised of a column containing ascarite ยฎ ( i . e . sodium hydroxide on silica ). carbon - isotope dioxide that has not reacted in the reactor device 32 is trapped in this column ( it reacts with sodium hydroxide and turns into sodium carbonate ), while carbon - isotope monoxide passes through . the radioactivity in the carbon dioxide removal device 34 is monitored as a high value indicates that the reactor device 32 is not functioning properly . like the carbon dioxide trapping device 8 , the carbon monoxide trapping device 38 , has a trapping and a releasing state . in the trapping state carbon - isotope monoxide is selectively trapped but not said carrier gas , and in the releasing state said trapped carbon - isotope monoxide is released in a controlled manner . this may preferably be achieved by using a cold trap , such as a column containing silica or materials of similar properties , such as molecular sieves . such a cold trap selectively traps carbon monoxide in a cold state below โ 100 ยฐ c ., e . g . โ 196 ยฐ c . as in liquid nitrogen or โ 186 ยฐ c . as in liquid argon , and releases the trapped carbon monoxide in a warm state ( e . g . + 50 ยฐ c .). the trapping behavior of the silica - column is related to dipole - dipole interactions or possibly van der waal interactions . the ability of the silica - column to trap carbon - isotope monoxide is reduced if the helium , carrying the radioactivity , contains nitrogen . a rationale is that since the physical properties of nitrogen are similar to carbon monoxide , nitrogen competes with carbon monoxide for the trapping sites on the silica . according to the preferred embodiment of fig2 , block c is comprised of a first and a second reaction chamber valve v 3 and v 4 , the aforementioned reaction chamber 50 , a reagent valve v 5 , an injection loop 70 and a solvent valve v 6 . the first reaction chamber valve v 3 has a gas mixture inlet 40 connected to the carbon monoxide trapping device 38 , a stop position 42 , a collection outlet 44 , a waste outlet 46 , and a reaction chamber connection port 48 connected to a gas inlet 52 of the reaction chamber 50 . the first reaction chamber valve v 3 has four modes of operation a to d . the reaction chamber connection port 48 is : in mode a connected to the gas mixture inlet 40 , in mode b connected to the stop position 42 , in mode c connected to the collection outlet 44 , and in mode d connected to the waste outlet 46 . the reaction chamber 50 ( micro - autoclave ) has a gas inlet 52 and a liquid inlet 54 , which are arranged such that they terminate at the bottom surface of the chamber . gas inlet 52 may also be used as product outlet after the labeling is finished . during operation the carbon - isotope monoxide enriched gas mixture is introduced into the reaction chamber 50 through the gas inlet 52 , where after the liquid reagent at high pressure enters the reaction chamber 50 through the liquid inlet 54 . fig3 a and 3 b shows schematic views of two preferred reaction chambers 50 in cross section . fig3 a is a cylindrical chamber which is fairly easy to produce , whereas the spherical chamber of fig3 b is the most preferred embodiment , as the surface area to volume - ratio of the chamber is further minimized . a minimal surface area to volume - ratio optimizes the recovery of labeled product and minimizes possible reactions with the surface material . due to the โ diving - bell construction โ of the reaction chamber 50 , both the gas inlet 52 and the liquid inlet 54 becomes liquid - filled and the reaction chamber 50 is filled from the bottom upwards . the gas - volume containing the carbon - isotope monoxide is thus trapped and given efficient contact with the reaction mixture . since the final pressure of the liquid is approximately 80 times higher than the original gas pressure , the final gas volume will be less than 2 % of the liquid volume according to the general gas - law . thus , a pseudo one - phase system will result . in the instant application , the term โ pseudo one - phase system โ means a closed volume with a small surface area to volume - ratio containing & gt ; 96 % liquid and & lt ; 4 % gas at pressures exceeding 200 bar . in most syntheses the transfer of carbon monoxide from the gas - phase to the liquid phase will probably not be the rate limiting step . after the labeling is finished the labeled volume is nearly quantitatively transferred from the reaction chamber by the internal pressure via the gas inlet / product outlet 52 and the first reaction chamber valve v 3 in position c . the second reaction chamber valve v 4 has a reaction chamber connection port 56 , a waste outlet 58 , and a reagent inlet 60 . the second reaction chamber valve v 4 has two modes of operation a and b . the reaction chamber connection port 56 is : in mode a connected to the waste outlet 58 , and in mode b it is connected to the reagent inlet 60 . the reagent valve v 8 , has a reagent outlet 96 connected to the reagent inlet 60 of the second reaction chamber valve v 4 , an injection loop inlet 104 and outlet 98 between which the injection loop 108 is connected , a waste outlet 100 , a reagent inlet 102 connected to a reagent source , and a solvent inlet 106 . the reagent valve v 8 , has two modes of operation a and b . in mode a , the reagent inlet 102 is connected to the injection loop inlet 104 , and the injection loop outlet 98 is connected to the waste outlet 100 , whereby a reagent may be fed into the injection loop 108 . in mode b , the solvent inlet 106 is connected to the injection loop inlet 104 , and the injection loop outlet 98 is connected to the reagent outlet 96 , whereby reagent stored in the injection loop 108 may be forced via the second reaction chamber valve v 4 into the reaction chamber 50 , if a high pressure is applied on the solvent inlet 106 . the reagent valve v 7 , has a reagent outlet 82 connected to the solvent inlet 106 of the reagent valve v 8 , an injection loop inlet 90 and outlet 84 between which the injection loop 94 is connected , a waste outlet 86 , a reagent inlet 88 connected to a reagent source , and a solvent inlet 92 . the reagent valve v 7 , has two modes of operation a and b . in mode a , the reagent inlet 88 is connected to the injection loop inlet 90 , and injection loop outlet 84 is connected to the waste outlet 86 , whereby a reagent may be fed into the injection loop 94 . in mode b , the solvent inlet 92 is connected to the injection loop inlet 90 , and the injection loop outlet 84 is connected to the reagent outlet 82 , whereby reagent stored in the injection loop 94 may be forced via the reagent valve v 8 and the second reaction chamber valve v 4 into the reaction chamber 50 if a high pressure is applied on the solvent inlet 92 . the reagent valve v 5 , has a reagent outlet 62 connected to the reagent inlet 92 of the reagent valve v 8 , an injection loop inlet 64 and outlet 66 between which the injection loop 70 is connected , a waste outlet 68 , a reagent inlet 71 connected to a reagent source , and a solvent inlet 72 . the reagent valve v 5 , has two modes of operation a and b . in mode a the reagent inlet 71 is connected to the injection loop inlet 64 , and the injection loop outlet 66 is connected to the waste outlet 68 , whereby a reagent may be fed into the injection loop 70 . in mode b the solvent inlet 72 is connected to the injection loop inlet 64 , and the injection loop outlet 66 is connected to the reagent outlet 62 , whereby reagent stored in the injection loop 70 may be forced via the reagent valve v 7 , the reagent valve v 8 and the second reaction chamber valve v 4 into the reaction chamber 50 if a high pressure is applied on the solvent inlet 72 . the solvent valve v 6 , has a solvent outlet 74 connected to the solvent inlet 72 of the reagent valve v 5 , a stop position 76 , a waste outlet 78 , and a solvent inlet 80 connected to a solvent supplying hplc - pump ( high performance liquid chromatography ) or any liquid - pump capable of pumping organic solvents at 0 - 10 ml / min at pressures up to 400 bar ( not shown ). the solvent valve v 6 , has two modes of operation a and b . in mode a the solvent outlet 74 is connected to the stop position 76 , and the solvent inlet 80 is connected to the waste outlet 78 . in mode b the solvent outlet 74 is connected to the solvent inlet 80 , whereby solvent may be pumped into the system at high pressure by the hplc - pump . except for the small volume of silica in the carbon monoxide trapping devise 38 , an important difference in comparison to the carbon dioxide trapping device 8 , as well as to all related prior art , is the procedure used for releasing the carbon monoxide . after the trapping of carbon monoxide on carbon monoxide trapping devise 8 , valve v 3 is changed from position a to b to stop the flow from the carbon monoxide trapping devise 38 and increase the gas - pressure on the carbon monoxide trapping devise 38 to the set feeding gas pressure ( 3 - 5 bar ). the carbon monoxide trapping devise 38 is then heated to release the carbon monoxide from the silica surface while not significantly expanding the volume of carbon monoxide in the carrier gas . valve v 4 is changed from position a to b and valve v 3 is then changed from position b to a . at this instance the carbon monoxide is rapidly and almost quantitatively transferred in a well - defined micro - plug into the reaction chamber 50 . micro - plug is defined as a gas volume less than 10 % of the volume of the reaction chamber 50 , containing the topical substance ( e . g . 1 - 20 ฮผl ). this unique method for efficient mass - transfer to a small reaction chamber 50 , having a closed outlet , has the following prerequisites : a micro - column 38 defined as follows should be used . the volume of the trapping material ( e . g . silica ) should be large enough to efficiently trap (& gt ; 95 %) the carbon - isotope monoxide , and small enough (& lt ; 1 % of the volume of a subsequent reaction chamber 50 ) to allow maximal concentration of the carbon - isotope monoxide . in the case of silica and a reaction chamber 50 volume of 200 ฮผl , the silica volume should be 0 . 1 - 2 ฮผl . the dead volumes of the tubing and valve ( s ) connecting the silica column and the reaction chamber 50 should be minimal (& lt ; 10 % of the micro - autoclave volume ). the pressure of the carrier gas should be 3 - 5 times higher than the pressure in the reaction chamber 50 before transfer ( 1 atm .). in one specific preferred embodiment specifications , materials and components are chosen as follows . high pressure valves from valco ยฎ, reodyne ยฎ or cheminert ยฎ are used . stainless steel tubing with o . d . 1 / 16 โณ is used except for the connections to the porapac - column 8 , the silica - column 38 and the reaction chamber 50 where stainless steel tubing with o . d . 1 / 32 โณ are used in order to facilitate the translation movement . the connections between v1 , v2 and v3 should have an inner diameter of 0 . 2 - 1 mm . the requirement is that the inner diameter should be large enough not to obstruct the possibility to achieve the optimal flow of he ( 2 - 50 ml / min ) through the system , and small enough not to prolong the time needed to transfer the radioactivity from the porapac - column 8 to the silica - column 38 . the dead volume of the connection between v 3 and the autoclave should be minimized (& lt ; 10 % of the autoclave volume ). the inner diameter ( 0 . 05 - 0 . 1 mm ) of the connection must be large enough to allow optimal he flow ( 2 - 50 ml / min ). the dead volume of the connection between v 4 and v 5 should be less than 10 % of the autoclave volume . when column 8 is a porapac - column , it is preferably comprised of a stainless steel tube ( o . d .= โ
โณ, i . d .= 2 mm , 1 = 20 mm ) filled with porapac q ยฎ and fitted with stainless steel screens . the silica - column 38 preferably is comprised of a stainless steel tube ( o . d = 1 / 16 โณ, i . d .= 0 . 1 mm ) with a cavity ( d = 1 mm , h = 1 mm , v = 0 . 8 ฮผl ) in the end . the cavity is filled with silica powder ( 100 / 80 mesh ) of gc - stationary phase type . the end of the column is fitted against a stainless steel screen . it should be noted that a broad range of different materials could be used in the trapping devices . if a gc - material is chosen , the criterions should be good retardation and good peak - shape for carbon dioxide and carbon monoxide respectively . the latter will ensure optimal recovery of the radioactivity . below a detailed description is given of a method of producing carbon - isotope using an exemplary system as described above . preparations of the system are performed by the steps 1 to 7 : 1 . v 1 in position a , v 2 in position a , v 3 in position a , v 4 in position a , helium flow on with a max pressure of 5 bar . with this setting , the helium flow goes through the [ 11 c ] carbon dioxide trapping column , the zinc furnace , the [ 11 c ] carbon monoxide trapping column , the reaction chamber 50 and out through v 4 . the system is conditioned , the reaction chamber 50 is rid of solvent and it can be checked that helium can be flowed through the system with at least 10 ml / min . 2 . the zinc - furnace is turned on and set at 400 ยฐ c . 3 . the [ 11 c ] carbon dioxide and [ 11 c ] carbon monoxide trapping columns are cooled with liquid nitrogen . at โ 196 ยฐ c ., the porapac - and silica - column efficiently traps carbon - isotope dioxide and carbon - isotope monoxide respectively . 4 . v 5 in position a ( load ). the injection loop ( 250 ฮผl ), attached to v 5 , is loaded with the reaction mixture , or when the substrate is in gas form , a solution of transition metal complex . 5 . v 7 in position a ( load ). the injection loop ( 250 - 1000 ฮผl ), attached to v 7 , is loaded with h 2 gas , when used . 6 . v 8 in position a ( load ). the injection loop ( 250 - 1000 ฮผl ), attached to v 8 , is loaded with a substrate when it is in gas form . 7 . the hplc - pump is attached to a flask with freshly distilled thf ( or other high quality solvent ) and primed . v 6 in position a . production of carbon - isotope dioxide may be performed by the steps 8 to 9 : 8 . carbon - isotope dioxide is produced using the 14n ( p , ฮฑ ) 11 c reaction in a target gas containing nitrogen ( aga , nitrogen 6 . 0 ) and 0 . 1 % oxygen ( aga . oxygen 4 . 8 ), bombarded with 17 mev protons . 9 . the carbon - isotope dioxide is transferred to the apparatus using nitrogen with a flow of 100 ml / min . synthesis of carbon - isotope may thereafter be performed by the steps 10 to 19 : 10 . v 1 in position b and v 2 in position b . the nitrogen flow containing the carbon - isotope dioxide is now directed through the porapac - column ( cooled to โ 196 ยฐ c .) and out through a waste line . the radioactivity trapped in the porapac - column is monitored . 11 . when the radioactivity has peaked , v 1 is changed to position a . now a helium flow is directed through the porapac - column and out through the waste line . by this operation the tubings and the porapac - column are rid of nitrogen . 12 . v 2 in position a and the porapac - column is warmed to about 50 ยฐ c . the radioactivity is now released from the porapac - column and transferred with a helium flow of 10 ml / min into the zinc - furnace where it is transformed into carbon - isotope monoxide . 13 . before reaching the silica - column ( cooled to โ 196 ยฐ c . ), the gas flow passes the ascarite - column . the carbon - isotope monoxide is now trapped on the silica - column . the radioactivity in the silica - column is monitored and when the value has peaked , v 3 is set to position b and then v 4 is set to position b . 14 . the silica - column is heated to approximately 50 ยฐ c ., which releases the carbon - isotope monoxide . v 3 is set to position a and the carbon - isotope monoxide is transferred to the reaction chamber 50 within 15 s . 15 . v 3 is set to position b , v 5 is set to position b , v 7 is set to position b , v 8 is set to position 8 , the hplc - pump is turned on ( flow 7 ml / min ) and v 6 is set to position b . using the pressurized thf ( or other solvent ), the reaction mixture is transferred to the reaction chamber 50 . when the hplc - pump has reached its set pressure limit ( e . g 40 mpa ), it is automatically turned off and then v 6 is set to position a . 16 . the reaction chamber 50 is moved into the cavity of a heating block containing a high boiling liquid ( e . g . polyethylene glycol or mineral oil ). the temperature of the heating block is usually in the range of 100 - 200 ยฐ c . 17 . after a sufficient reaction - time ( usually 5 min ), v 3 is set to position c and the content of the reaction chamber 50 is transferred to a collection vial . 18 . the reaction chamber 50 can be rinsed by the following procedure : v 3 is set to position b , the hplc - pump is turned on , v 6 is set to position b and when maximal pressure is reached v 6 is set to position a and v 3 is set to position 3 thereby transferring the rinse volume to the collection vial . 19 . the labeled product obtained in step 18 may then be subsequently reduced and then substituted in the collection vial to obtain desired labeled organohalides . the synthesis of labeled organohalides , such as [ 1 - 11 - c ] ethyl iodide , [ 1 - 11 - c ] propyl iodide and [ 11 c ] aryl halides , prepared from [ 11 c ] carbon dioxide and a grignard reagent has been described in the literature . isotopic dilution originating from carbon dioxide in the environment is a potential drawback of the grignard method . careful preparation and handling of the grignard reagent is required in order to maximize the specific radioactivity of the labeled organohalides . the instant invention utilizes [ 11 c ] carbon monoxide and presents an efficient method to synthesize labeled organohalides . the invention overcomes the limitations of the grignard method in respect to specific radioactivity . the low atmospheric concentration of carbon monoxide compared to carbon dioxide makes it more advantageous to use [ 11 c ] carbon monoxide than [ 11 c ] carbon dioxide when synthesizing labeled products which are aimed to have high specific radioactivity . the syntheses of labeled organohalides from [ 11 c ] carbon monoxide consist of three reaction steps : the precursors used in the carbonylation reaction together with [ 11 c ] carbon monoxide are olefins , acetylenes , alkyl halides and triflates , and aromatic halides and triflates . other reagents , used as nucleophile sources , are selected from a list comprising of : h 2 o , roh and h 2 where r is independently linear or cyclic lower alkyl . h 2 may be used alone or together with h 2 o or roh , since it has shown to increase yield and purity of the labeled organohalide when used as an additive . a base , e . g . tetrabutylammonium hydroxide , may also be added to activate the nucleophiles when alkyl halides and triflates , or aromatic halides and triflates , are used as precursors in the carbonylation reaction . the labeled products obtained in the carbonylation reaction are reduced to alkoxides and subsequently converted to organohalides . when alkyl - or aromatic halide or triflate are used as substrates , the substrates have the formula of r โฒ 1 โ x โฒ, and the resultant labeled organohalides have the formula of wherein a is h 2 gas or hor with optional base , b is h or or , r โฒ 1 is defined as independently linear or cyclic lower alkyl or substituted aryl with cl , f or โ or , x โฒ is i , br or otf , x is i or br , m is pd , rh , co , pt or ru , l is phosphine ligand and r is defined as independently linear or lower cyclic alkyl or aryl . when olefin is sued as a substrate , the substrate has the formula of wherein a is h 2 gas or hor with optional base , b is h or or , r 1 is defined as independently linear or cyclic lower alkyl or aryl , x is i or br , m is pd , rh , co , pt or ru , l is phosphine ligand , p - tsoh is p - toluenesulfonic acid , and r is defined as independently linear or lower cyclic alkyl or aryl . when acetylene is used as substrates , there are two reaction schemes . under the first reaction scheme , the substrate has the formula wherein a is h 2 gas or hor and / or h 2 o with optional base , b is h and / or oh , or or and / or oh , r 1 is defined as independently linear or cyclic lower alkyl or aryl , x is i or br , m is pd , rh , co , pt or ru , l is phosphine ligand , p - tsoh is p - toluenesulfonic acid , dibal - h is diisobutylaluminiumhydride , and r is defined as independently linear or lower cyclic alkyl or aryl . wherein a is h 2 gas or hor and / or h 2 o with optional base , b is h and / or oh , or or and / or oh , r 1 is defined as independently linear or cyclic lower alkyl or aryl , x is i or br , m is pd , rh , co , pt or ru , l is phosphine ligand , naoac is sodium acetate , dibal - h is diisobutylaluminiumhydride , and r is defined as independently linear or lower cyclic alkyl or aryl . several applications for synthesizing useful pet tracers may then be accomplished through the use of the labeled organohalides as alkylating agents . some examples are illustrated below . wherein x - r 3 is a 11 c - labeled organohalide , r 2 is defined as independently substituted linear or cyclic alkyl or aryl , r โฒ 2 is defined as hydrogen or independently substituted linear or cyclic alkyl or aryl , and x is a halogen . wherein x - r 3 is a 11 c - labeled organohalide , li โ r 3 is a 121 c - labeled organolithium compound , r 2 and r โฒ 2 are defined as independently substituted linear or cyclic alkyl or aryl , and x is a halogen . they provide valuable pet tracers in various pet studies . in an embodiment of the present invention , it provides kits for use as pet tracers comprising [ 11 c ]- labeled compounds . such kits are designed to give sterile products suitable for human administration , e . g . direct injection into the bloodstream . suitable kits comprise containers ( e . g . septum - sealed vials ) containing the adrenergic interfering agent and precursor of the adrenergic imaging agent . the kits may optionally further comprise additional components such as radioprotectant , antimicrobial preservative , ph - adjusting agent or filler . by the term โ radioprotectant โ is meant a compound which inhibits degradation reactions , such as redox processes , by trapping highly - reactive free radicals , such as oxygen - containing free radicals arising from the radiolysis of water . the radioprotectants of the present invention are suitably chosen from : ascorbic acid , para - aminobenzoic acid ( i . e . 4 - aminobenzoic acid ), gentisic acid ( i . e . 2 , 5 - dihydroxybenzoic acid ) and salts thereof with a biocompatible . by the term โ antimicrobial preservative โ is meant an agent which inhibits the growth of potentially harmful micro - organisms such as bacteria , yeasts or moulds . the antimicrobial preservative may also exhibit some bactericidal properties , depending on the dose . the main role of the antimicrobial preservative ( s ) of the present invention is to inhibit the growth of any such micro - organism in the pharmaceutical composition post - reconstitution , i . e . in the radioactive diagnostic product itself . the antimicrobial preservative may , however , also optionally be used to inhibit the growth of potentially harmful micro - organisms in one or more components of the kit of the present invention prior to reconstitution . suitable antimicrobial preservatives include : the parabens , i . e ., ethyl , propyl or butyl paraben or mixtures thereof ; benzyl alcohol ; phenol ; cresol ; cetrimide and thiomersal . preferred antimicrobial preservative ( s ) are the parabens . the term โ ph - adjusting agent โ means a compound or mixture of compounds useful to ensure that the ph of the reconstituted kit is within acceptable limits ( approximately ph 4 . 0 to 10 . 5 ) for human administration . suitable such ph - adjusting agents include pharmaceutically acceptable buffers , such as tricine , phosphate or tris [ i . e . tris ( hydroxymethyl ) aminomethane ], and pharmaceutically acceptable bases such as sodium carbonate , sodium bicarbonate or mixtures thereof . when the ligand conjugate is employed in acid salt form , the ph - adjusting agent may optionally be provided in a separate vial or container , so that the user of the kit can adjust the ph as part of a multi - step procedure . by the term โ filler โ is meant a pharmaceutically acceptable bulking agent which may facilitate material handling during production and lyophilisation . suitable fillers include inorganic salts such as sodium chloride , and water soluble sugars or sugar alcohols such as sucrose , maltose , mannitol or trehalose . the invention is further described in the following examples which are in no way intended to limit the scope of the invention . [ 11 c ] carbon dioxide production was performed using a scanditronix mc - 17 cyclotron at uppsala imanet . the 14 n ( p , ฮฑ ) 11 c reaction was employed in a gas target containing nitrogen ( nitrogen 6 . 0 ) and 0 . 1 % oxygen ( oxygen 4 . 8 ) which was bombarded with 17 mev protons . [ 11 c ] carbon monoxide was obtained by reduction of [ 11 c ] carbon dioxide as described in the instant application . the syntheses with [ 11 c ] carbon monoxide were performed with an automated module as part of the system โ synthia 2000 โ. [ 11 c ] carbon dioxide was trapped on a column ( porapac q ) at โ 196 ยฐ c . and released by heating and reduced during its passage through a zinc filled tube at 400 ยฐ c . hplc analysis was performed with a beckman 126 - gradient pump and a beckman 166 variable wavelength uv - detector in series with a ฮฒ + - flow detector . the analytical column was a beckman ultrasphere ods c 18 ( 250 ร 4 . 6 mm id ). alternatively , when acids are obtained due to small amount of water in the reagents , the reaction scheme becomes : tris ( dibenzylideneacetone ) dipalladium ( 0 ) ( 0 . 80 mg , 0 . 87 ฮผmol ) and triphenylphosphine ( 2 . 7 mg , 10 . 3 ฮผmol , 12 equiv .) were placed in a 0 . 8 ml vial equipped with a rubber septum . thf ( 360 ฮผl ) was added and the resulting solution was degassed with argon . methyl iodide ( 1 . 0 ฮผl , 16 ฮผmol , 18 equiv .) was added . the solution was loaded into an injection valve loop . a second injection valve loop was loaded with hydrogen gas ( 1 . 0 ml , 1 atm .). thf was pumped through the two injection loops and the reagents were pumped into a 200 ฮผl teflon coated stainless steel micro - autoclave containing [ 11 c ] co . the micro - autoclave was heated for 5 min at 120 ยฐ c . the reaction mixture was transferred to a 2 ml septum - equipped evacuated glass vial containing lithium aluminium hydride ( 100 ฮผl , 1 m ). the vial was heated at 120 ยฐ c . for 2 - 3 min during the removal of thf under a stream of nitrogen gas . then the vial was cooled down to sub - zero temperature . hydriodic acid ( 1 . 0 ml , 57 wt . % in water ) was added and the vial was heated for 5 min at 120 ยฐ c . the vial was removed from the heating and [ 1 - 11 c ] ethyl iodide was transferred in a stream of nitrogen gas ( 20 ml / min ) through a drying tower ( phosphorus pentoxide desiccant ) to a trapping vessel . analytical lc was used to assess the identity and radiochemical purity . radiochemical yield of [ 1 - 11 c ] ethyl iodide was 66 ยฑ 6 % with a radiochemical purity of 87 ยฑ 2 %. [ 11 c ] methyl iodide was the only radiochemical by - product . in a 0 . 8 ml glass vial equipped with a rubber septum , ( r )- 3 -( 1 - phenyl - ethyl )- 3h - imidazole - 4 - carboxylic acid ( 1 . 2 mg , 5 . 5 ฮผmol ) was dissolved in dichloromethane ( 200 ฮผl ) at room temperature . tetrabutylammonium hydroxide in methanol ( 4 . 8 ฮผl , 1 m , 4 . 8 ฮผmol ) was added . the vial was gently heated and the solvent was thoroughly removed under a stream of nitrogen gas . dimethylformamide ( 300 ฮผl ) was added . [ 1 - 11 c ] ethyl iodide , prepared as described above , was transferred in a flow of nitrogen gas ( 20 ml / min ) to the glass vial and bubbled through the solution . the vial was heated for 5 min at 120 ยฐ c . the reaction mixture was injected onto a semi - preparative hplc column and ( r )-[ o - ethyl - 1 - 11 c ] etomidate was isolated . mobile phase a1 : b2 ( 52 : 48 ). flow 4 ml min 31 1 . r . t 12 . 1 .- 13 . 5 min . analytical lc was used to assess the identity and radiochemical purity . mobile phase a1 : b2 ( 45 : 55 ). flow 1 . 5 ml min โ 1 . r . t . 8 . 4 min . radiochemical purity & gt ; 99 %. initial product specific radioactivity yield a amount radioactivity substrate product 11 co ( gbq ) (%) ( nmol ) ( gbq / ฮผmol ) 2 . 5 ยฑ 0 . 5 7 10 45 ยฑ 0 . 5 25 22 31 ยฑ 6 15 15 8 . 4 ยฑ 1 . 2 22 36 a isolated decay - corrected radiochemical yield calculated from the initial amount of radioactivity used in the [ 1 - 11 c ] ethyl iodide synthesis tris ( dibenzylideneacetone ) dipalladium ( 0 ) ( 0 . 7 mg , 0 . 76 ฮผmol ), triphenylphosphine ( 2 . 7 mg , 10 . 3 ฮผmol , 12 equiv .) and p - toluenesulfonic acid ( 3 . 9 mg , 20 . 5 ฮผmol ) were placed in a 0 . 8 ml vial equipped with rubber septum . thf ( 360 ฮผl ) was added and the resulting solution was degassed with argon . the solution was loaded into an injection valve loop . a second injection valve loop was loaded with ethene ( 1 . 0 ml , 1 atm .). a third injection valve loop was loaded with hydrogen gas ( 0 . 7 ml , 1 atm .). thf was pumped through all three injection loops and the reagents were pumped into a 200 ฮผl teflon coated stainless steel micro - autoclave containing [ 11 c ] co . the reagents were contained in the autoclave for 5 min at room temperature . then the reaction mixture was transferred to a 2 ml septa - equipped evacuated glass vial containing lithium aluminium hydride ( 100 ฮผl , 1 m ). the vial was heated at 120 ยฐ c . for 2 - 3 min during the removal of thf under a stream of nitrogen gas . then the vial was cooled down to sub - zero temperature . hydriodic acid ( 1 . 0 ml , 57 wt . % in water ) was added and the vial was heated for 5 min at 120 ยฐ c . the vial was removed from the heat source and [ 1 - 11 c ] propyl iodide was transferred in a stream of nitrogen ( 20 ml / minute ) through a drying tower ( phosphorus pentoxide desiccant ) to a trapping vessel . analytical lc was used to assess the identity and radiochemical purity . radiochemical yield of [ 1 - 11 c ] propyl iodide was 58 ยฑ 4 % based on [ 11 c ] carbon monoxide . the radiochemical purity was 93 ยฑ 2 %. [ 11 c ] methyl iodide was the only radiochemical by - product . the present invention is not to be limited in scope by specific embodiments described herein . indeed , various modifications of the inventions in addition to those described herein will become apparent to these skilled in the art from the foregoing description and accompanying figures . such modifications are intended to fall within the scope of the appended claims . various publications and patent applications are cited herein , the disclosures of which are incorporated by reference in their entireties .
| 2 |
the subsequent embodiment examples relate to drive arrangement , with which the inner part of the pump is designed as a rotor and is driven in rotation . accordingly , the outer part of the eccentric screw pump is designed as a non - rotating stator . i . e . the relative movement between the rotor and the stator is produced alone by the rotation of the rotor . however , it is to be understood that the principle on which the invention is based may be used for setting the fit between the rotor and the stator , also with arrangement with which the outer part , hereinafter described as a stator rotates , relative to the inner part . the eccentric screw pump represented in fig1 is designed as a submersible pump , which at its lower end comprises an electric drive motor 2 , on which the actual pump unit 4 is flanged in an axial manner . the pump unit 4 comprises peripheral entry openings 6 and a pressure union 8 at its upper , axial end in the direction of the longitudinal axis x . the eccentric screw pump arranged in the inside of the pump unit 4 comprises an annular stator 10 , as well as a screw - like rotor 12 arranged in its inside . in the shown example , the stator inner side is coated with an elastomer material 14 , which comes into contact with the outer surface of the rotor 12 at the contact locations . the rotor 12 is preferably designed of steel , in particular stainless steel or ceramic . the rotor 12 and the stator 10 in the known manner , form an eccentric screw pump or moineau pump , with which the rotor 12 rotates in the inside of the stator 10 about its longitudinal axis . thereby , the longitudinal axis simultaneously describes a circle movement about the stator longitudinal axis , i . e . the rotor rotates eccentrically in the stator 10 . the pump effect is produced by way of the stator inner wall and the rotor inner wall having a different number of helical windings . with the pump assembly shown in fig1 , the eccentric screw pump is designed in a conical manner , i . e . the stator 10 or the inner space of the stator 10 , and the rotor 12 , taper towards an axial end - side 16 . the end - side 16 forms the pressure side of the pump , whilst the opposite end - side 18 of the stator 10 is situated on the suction side of the pump . the rotor 12 , via a rotor shaft 20 connecting to the end - side 18 , at an articulation point 22 , is connected to the driven shaft 24 of the drive motor 2 . the rotor shaft 20 is designed in an articulated manner , such that the rotor shaft 20 on its rotation additionally may carry out an eccentric movement . the flexibility of the rotor shaft 20 is realized by the bellows 30 on the end of the rotor shaft 20 , which faces the drive motor 2 , and which will be described later . this eccentric movement is effected in a manner such that a fictive joint point 23 on the longitudinal axis of the bellows 30 forms the tip of the cone , on whose surface the rotor shaft 20 with the rotor 12 , moves eccentrically , whilst the rotor shaft 20 and the rotor 12 driven by the drive motor 2 , rotate about their longitudinal axis . this means that the rotor 12 together with the rotor shaft 20 in the inside of the stator 14 , carries out an eccentric movement which is effected in a conical manner about the longitudinal axis x and the joint point 23 in the bellows 30 . the eccentricity results on account of the design of the stator 10 and rotor 12 , so that the rotor 12 automatically carries out the described eccentric movement on rotation of the rotor about its own axis . the eccentric movement is effected such that the eccentricity is the greatest , i . e . the diameter of the circle on which the middle axis of the rotor moves on rotation is the greatest , at the end - side 16 . eccentricity is no longer given at the joint point 23 in the bellows 30 . the rotor at the end - side 18 moves with a lower eccentricity than at the end - side 16 , i . e . the diameter of the circle on which the middle axis of the rotor moves on its rotation , is smaller . the eccentric screw pump according to the invention is designed such that the fit between the rotor 12 and the stator 10 is automatically set in dependence on the pressure conditions at the pressure side and the suction side of the eccentric screw pump , and in particular on the pressure difference between the pressure side and the suction side . this means that the pressing pressure at the contact surfaces between the rotor 12 and the stator 10 is adapted automatically in dependence on the fluid pressure . with the example shown in fig1 , this is effected by way of the fluid pressure prevailing on the pressure side , i . e . the end - side 16 , acting on a pressure surface 26 facing the suction side , as is described in more detail by way of fig3 to 4 . the rotor 12 comprises a centrally arranged channel which extends in the longitudinal direction from the end - side 16 up to the pressure surface 26 , which here forms the opposite end - side of the rotor 12 . at the pressure surface 26 , the channel 28 opens into the inside of the hollowly designed rotor shaft 20 . thus the fluid pressure bearing at the end - side 16 , i . e . the pressure side of the eccentric screw pump , may be led through the channel 28 onto the pressure surface 26 which is distant to the end - side 16 , i . e . the pressure side . this leads to force conditions as are represented essentially in fig4 by way of a detailed view . a force f z which is caused by the fluid pressure on the pressure side of the pump acts on the end - side of the rotor 12 which faces the end - side 16 . this force f z is dependent on the size , i . e . the diameter b of the end - side of the rotor 12 . since the fluid pressure is led from the suction side through the channel 28 , into the inside of the rotor shaft 20 , a force f a is produced on the inner surface which faces the rotor 12 and which forms the pressure surface 26 , by way of the fluid pressure bearing on the pressure side of the rotor 12 . this force is moreover dependent on the size of the pressure surface 26 , i . e . on the inner diameter a of the rotor shaft 20 , which corresponds to the diameter of the pressure surface 26 . ideally , the pressure surface 26 is greater than the end - side surface of the rotor 12 at the end - side 16 . this leads to the fact that the force f a is always greater than the force f z , since the same pressure prevails on both sides , so that it is ensured that the rotor 12 is pressed into the stator 10 in the direction towards the end side 16 . the pressing force acting in the axial direction thereby is the difference of the forces f a and f z , i . e . the force which results from the surface area difference of the two end - sides of the rotor 12 , multiplied by the fluid pressure prevailing at the pressure side , as well as the components from pressure conditions in the cavities between the rotor 12 and the stator 10 . from this , it results that the pressing force between the rotor and stator increases with an increasing fluid pressure at the pressure side . the rotor shaft 20 is designed such that an axial displaceability of the rotor 12 is given in the direction of the longitudinal axis w of the rotor 12 and the rotor shaft 20 . this longitudinal displacement ability is likewise realized by the bellows 30 , which forms an elastic wall of the rotor shaft 20 . the bellows 30 may be designed of metal or plastic , in particular of an elastomer . apart from the elasticity in the axial direction w , is must also have a torsional stiffness for transmitting the torque which acts on the rotor shaft 20 , as well as a flexibility for the eccentric movement of the rotor 12 . the rotor shaft 20 with the bellows 30 is designed in a hollow manner , so that a pressure space 32 and 34 is formed in the inside . the pressure space 32 thereby lies in the rigid part of the rotor shaft 20 , the pressure space 34 lies in the part of the rotor shaft 20 which is formed by the bellows 30 . the pressure spaces 32 and 34 are separated from one another by a separating wall 36 . the separating wall 36 is arranged at the axial end of the rigid part of the rotor shaft 20 , adjacent to the part formed by the bellows 30 . the separating wall 38 comprises a channel , which extends between the two end - sides , and which connects the two pressure spaces 32 and 34 adjacent to the end - sides , to one another . the channel 38 forms a throttle location , by way of which the fluid which led through the channel 28 from the pressure side of the rotor 12 , may flow from the pressure space 32 into the pressure space 34 and back . this throttle location periodically damps occurring pressure fluctuations which occur on operation of the eccentric screw pump , which is inherent of the design . in this manner , fluctuations of the pressing force f a on account of the pressure fluctuations are eliminated . only larger pressure fluctuations with a greater period lead to a change in the force f a . the bellows 30 on account of its elasticity , acts as a spring element in the axial direction , which produces a bias between the rotor 12 and the stator 40 . on account of the elasticity of the bellows 30 , the rotor 12 is pressed in the direction of the longitudinal axis w into the inside of the stator . a second embodiment according to the invention is described by way of fig5 . this embodiment differs from the previously described embodiment in that here , the pressure side is situated at the end of the conically designed rotor , which has the largest diameter . inasmuch as this is concerned , the arrangement is exactly the opposite of that previously described . with this embodiment , a pressure channel which is not shown in fig5 is provided , which connects the pressure side to a surface of the stator 40 , which faces the suction side . the eccentric screw pump shown in fig5 comprises a stator 40 , in which a rotor 42 is arranged , wherein the stator 40 and the rotor 42 comprise the spiral - like surface design which is usual with eccentric screw pumps . the stator 40 is arranged in a housing 44 , which at a first axial end comprises a suction opening 46 , through which the fluid to be delivered penetrates into the pump . the suction opening 46 faces the end - side 48 of the stator 40 and the rotor 42 , which has the smallest diameter . at the opposite end - side 50 , the rotor 42 and the inside of the stator 40 have a larger diameter . the inside of the stator 40 and the outer periphery of the rotor 42 are thus designed in a conical manner . the end - side 50 faces the pressure side of the eccentric screw pump which is formed by the stator 40 and the rotor 42 . the rotor 42 , on the axial side , merges into a rotor shaft 52 , wherein here , the rotor 42 and the rotor shaft 52 are designed as an integral component . the rotor shaft 52 at its axial end 54 which is distant to the rotor 42 , is connected to a motor shaft of a drive motor which is not shown here . with this embodiment form too , the rotor shaft 52 with the rotor 42 executes an eccentric movement in the inside of the stator 40 , wherein the rotor shaft 52 on the one hand rotates about its longitudinal axis x , and on the other hand executes an eccentric movement about the longitudinal axis x of the stator 40 . thereby here , the rotor 42 , as described with the first embodiment example , executes a movement with which the longitudinal axis w runs on the cone superficies surface on account of the conical design of the rotor 42 and the stator 40 . thereby , the tip of this cone is situated in the articulation point of the rotor shaft 52 on the motor shaft . this means that the end of the rotor 42 which is situated at the end - side 48 executes an eccentric movement about the longitudinal axis x , with a greater diameter than the end region of the rotor 42 at the end - side 50 . preferably , an eccentricity of the movement is no longer given at the axial end 54 of the rotor shaft which is connected to the motor shaft . at its end which is distant to the rotor 42 , the rotor shaft 52 comprises a seal 56 which seals the space 58 which connects to the stator 40 to the motor on the pressure side . shoulder surfaces 60 are formed on the seal 56 , which are distant to the rotor 42 and thus to the suction side on the end - side 48 . since these shoulder surfaces 60 are situated in the inside of the space 58 , in which the pressure - side fluid pressure acts , the fluid pressure acts onto these shoulder surfaces 60 , and produces a force in the direction of the longitudinal axis w of the rotor shaft 52 , which presses the rotor shaft 52 with the rotor 42 , towards the end - side 48 in the stator 40 . in this manner , a pressing force between the rotor 42 and the stator 40 is produced by the fluid pressure at the pressure side , and this pressing force increases with an increasing fluid pressure on the pressure side of the pump , and reduces with a reducing fluid pressure . this with this embodiment too , an automatic setting of the fit and thus of the pressing force between the rotor 42 and the stator 40 is ensured on operation of the pump . in the shown example , the rotor shaft is designed as one piece with the rotor 42 , of a ceramic material , and in its inside comprises a cavity 62 . the cavity 62 has a polygonal cross - sectional shape and is engaged at it face - end which is distant to the rotor 42 , to a coupling element 64 which has a corresponding polygonal , outer cross - sectional shape . the coupling element 64 forms the axial end 54 of the rotor shaft 52 . the coupling element 64 may be displaced axially in the inside of the cavity 62 in the direction of the longitudinal axis w . in this manner , an axial displaceability of the rotor shaft 52 or the rotor 42 relative to the stator 40 is achieved . moreover , the coupling element 64 permits the eccentric movement of the rotor shaft 52 about a fictive joint point 65 on the middle axis of the coupling element 64 . for this , the coupling element 64 is formed on an elastomer material , preferably rubber , or comprises a coating of an elastomer material or rubber at least on its region which faces the inside of the rotor shaft 52 . this leads to an articulated mounting of the coupling element 64 in the cavity 62 , in the inside of the rotor shaft 52 . thus the rotation shaft executes an eccentric movement about the coupling element 64 and the joint point 65 on account of the flexibility of the connection between the rotor shaft 52 and the coupling part 64 . the pressing force with which the rotor 42 presses into the stator 40 , is sets automatically on account of the pressures at the suction side and pressure side of the rotor 42 , as well as the pressure of the surroundings , and in particular on the basis of the force conditions between the pressure forces acting on the shoulder surfaces 60 as well as on the end - face of the rotor 42 at the axial side 48 , and the pressure of the surroundings acting on the axial end 54 . additionally , here , a spring element 66 is provided in the region of the seal 56 and this produces a biasing of the rotor in the direction of the stator 40 . the stator 40 on its inner surface which faces the rotor 42 , has a coating 68 of an elastomer material . a further embodiment of an eccentric screw pump is described by way of fig6 . with this embodiment , in contrast to the two previously described embodiments , it is not the rotor , but the stator which is axially movably mounted . the rotor 72 is arranged in the inside of a stator 74 as with the embodiment according to fig1 to 4 . the stator 74 is movably guided in a housing 76 on the axial direction x , i . e . in the direction of the longitudinal axis of the stator 72 . the arrangement as is shown schematically in fig6 , is applied in a manner such that the suction side 70 of the pump is situated at the axial end of the conical rotor 72 with the smaller diameter . thus the exit - side pressure of the eccentric screw pump bears on the end - face 80 at the axial side , wherein the rotor 72 is fixed by an axial bearing which is not shown . then the pressure - side pressure may be led through a channel or gap 82 between the housing 76 and the stator 74 , onto an end - face 84 of the stator 74 , which faces the suction side 70 of the pump . thus a pressure force is produce on this end - face 84 , which presses the stator onto the rotor 72 . it is to be understood that for setting the fit or the pressing force between the rotor and stator , it is merely a question of the relative movement between the rotor and the stator . thus the embodiments according to fig6 and fig1 to 5 may be combined with one another , i . e . a rotor as well as a stator may be provided , on which the pressure prevailing on the pressure side of the pump acts in a manner such that the rotor and stator which are designed conically to one another in a complementary manner , are pressed against one another . with the shown embodiment examples , the rotor shaft which drives the rotor , is always arranged at that end of the conical rotor which has the greater diameter . the invention may however also be realized with an arrangement in which the rotor shaft is arranged at the end of the rotor with the smaller diameter . fig7 shows an embodiment with which the rotor 86 driven by the rotor shaft 88 may execute a purely rotational movement . with this embodiment , the occurring eccentricity between the rotor 86 and the stator 90 given a rotation of the rotor 86 is compensated by a movement ability of the stator 90 . thus the stator 90 is part of a stator housing which is extended beyond the axial end - side 92 of the rotor 86 . the extension 94 of the stator housing is designed in a tubular manner , and at its end which is distant to the rotor 86 , merges into a bellows 96 , which is connected to the pressure union 98 of the surrounding pump housing 100 . with the embodiment example shown in fig7 , the pressure side of the pump bears on the side of the rotor 86 and stator 90 , which has the greatest cross section . i . e . the end 102 of the eccentric screw pump which is formed of the rotor 86 and the stator 90 , forms the suction side of the pump which is in connection with the inside of the surrounding pump housing 100 and with a suction connection 104 which runs into this pump housing . on operation of the pump , the rotor 86 executes a rotational movement about its longitudinal axis . the stator 90 with the connecting extension 94 simultaneously carries out an eccentric movement with respect to the longitudinal axis x , wherein the eccentric movement is made possible on account of the bellows 96 which forms a joint . a fictive joint point 106 about which the eccentric movement of the stator 90 is effected , is situated in the inside of the bellows 96 on the longitudinal axis x . thereby , here too , the eccentric movement describes a path along a cone surface , wherein the joint point 106 forms the cone tip . i . e . the eccentricity is greatest at the face - end 102 of the stator 90 , and is equal to zero in the joint point 106 . the inside of the extension 94 forms a pressure chamber in which the pressure - side pump pressure of the eccentric screw pump acts . thereby , the pressure - side pressure on the one hand acts on the end - face 92 of the rotor 86 , and simultaneously on the annular surface 108 which surrounds the bellows 96 and which is arranged in the inside of the pressure space formed by the extension 94 . the rotor 86 thereby is fixed by way of an axial bearing which is not shown . the annular surface 108 thereby is arranged at the side of the extension 94 , which is distant to the end - side 92 of the rotor 86 , and on the rotor 86 , i . e . faces the suction side of the pump . since the suction - side pressure prevails in the inside of the pump housing 100 , the suction pressure also bears on the outer wall of the extension 94 , which is opposite to the annular surface 108 , said pressure being lower than the pressure in the inside of the extension 94 . in this manner , on account of the pressure in the inside of the extension 94 , the stator 90 is pressed towards the pressure union 86 , wherein the longitudinal compensation is effected by the bellows 96 . thus with this embodiment too , one may effect an automatic setting of the fit between the rotor 86 and the stator 90 , in dependence on the pressure difference between the suction side and the pressure side of the eccentric screw pump .
| 5 |
the invention provides a light fibre illumination source for plastic light fibres that achieves a high illumination intensity while preventing heat generated by various heating mechanisms from damaging or destroying the light fibres . the main heating mechanisms are : absorption of non - visible radiation by the light fibres ; absorption of radiation by the adhesive retaining the light fibres in the light fibre connector ; and absorption of radiation by the light fibre connector and other components in direct or indirect thermal contact with the light fibres . in the light fibre illumination source according to the invention , absorption of non - visible radiation is reduced by a high - efficiency non - visible radiation filter which removes infra - red and ultra - violet energy from the output of the lamp , and provides an output in which the majority of the energy is visible light energy in the wavelength range of 400 - 700 nm . absorption of radiation by the adhesive retaining the light fibres in the light fibre connector is reduced by using an adhesive that is non - absorbent in the range of wavelengths emitted by the lamp . absorption of radiation by the light fibre connector and other components in direct or indirect thermal contact with the light fibres is reduced by an aperture arrangement that is thermally isolated from the light fibres and the light fibre connector . as an alternative to aperturing , a taper can be used to reduce heat conduction and to increase the amount of light coupled into the light fibres . although primarily intended to operate with plastic light fibres , the light fibre illumination source according to the invention may additionally be used with advantage with glass light fibres . glass light fibres are less susceptible to thermal damage , but the radiation emitted by the light fibre illumination system according to the invention operating with glass light fibres ( and also with plastic light fibres ) is restricted substantially to visible wavelengths . such visible light radiation is clinically preferable to radiation covering a broader range of wavelengths . the optical arrangement of the light fibre illumination source 10 according to the invention is shown in fig3 a . in this , the high - intensity light source 12 typically includes a xenon arc lamp ( not shown ). a suitable lamp is an cermax โข xenon short arc lamp made by ilc technology . this lamp has an pre - aligned internal parabolic reflector that produces a beam half - angle of about 3 degrees . the lamp is connected to a suitable power supply ( not shown ). the radiation ( i . e ., visible and non - visible light ) from the high - intensity light source 10 passes through the dichroic filter 14 to the condenser lens 16 . alternatively , the internal reflector in the lamp may be dichroic , in which case the external dichroic filter 14 may be omitted . the condenser lens 16 focuses the radiation from the high - intensity light source on the end of a bundle of plastic light fibres 18 . the bundle of light fibres is connected to the light fibre illumination source 10 by the connector 20 . super eska โข fibres are suitable fibres for the plastic light fibres 18 . the parts thus far described can also be found in a known light fibre illumination source . the radiation leaving the dichroic filter 14 includes considerable non - visible energy , which , when absorbed by the light fibres 18 , heats the light fibres . the radiation falling on the adhesive retaining the bundle of light fibres 18 in the light fibre connector 20 is absorbed , and is turned into heat . the light fibre connector conducts this heat to the light fibres , and the conducted heat additionally contributes to heating the light fibres . the condenser lens 16 focuses the radiation ( i . e ., visible and non - visible light ) from the high - intensity lamp 10 on the proximal ends of the light fibres . stray radiation additionally falls on the light fibre connector 20 and the connector mounting 22 on which the light fibre connector is mounted . the light fibre connector and connector mounting absorb the stray radiation falling on them , turn the radiation into heat , and conduct the heat to the light fibres . this heat additionally contributes to heating the light fibres . with such a known arrangement , the lamp output must be reduced , or the inefficient glass fibre coupler described above must be used if plastic light fibres are to be used . either of these measures results in the light fibre illumination system producing an unsatisfactory illumination level . in the light fibre illumination source 10 according to the invention , the non - visible radiation filter 24 is placed between the dichroic filter 14 and the condenser lens 16 . in the preferred embodiment , the non - visible radiation filter is a piece of a non - visible radiation absorbing glass , such as types kg - 1 and kg - 3 filter glass made by schott glass company . the transmissivity versus wavelength characteristics of the kg - 1 and kg - 3 filter glass is shown in fig4 . a reduction by a factor of three in the residual level of infra - red radiation ( ฮป & gt ; 700 nm ) passed by a typical dichroic filter has been measured in an embodiment using this type of filter glass as the non - visible radiation filter . the residual level of near infra - red radiation passed by the non - visible radiation filter 24 is insufficient to cause significant heating of the light fibres 18 , even though the light fibres have a high absorption of near infra - red radiation . if the radiation generated by the lamp 12 includes significant levels of ultra - violet radiation in addition to visible radiation and infra - red radiation , the non - visible radiation filter 24 can additionally be made ultra - violet absorbent to attenuate such radiation . the radiation beam downstream of the non - visible radiation filter 24 will be referred to as a &# 34 ; light beam .&# 34 ; the non - visible radiation filter 24 may be placed anywhere in the optical path downstream of the dichroic filter 14 and before the light fibre connector 20 . however , if the non - visible radiation filter operates by absorbing radiation energy at non - visible wavelengths , and therefore heats up , the filter 24 is preferably placed at a point in the optical path where the diameter of the radiation beam is greatest , or is as large as other design constraints allow . this allows the energy absorption to be spread over a relatively large volume of the filter . in the optical arrangement shown , placing the non - visible radiation filter 24 between the dichroic filter 14 and the condenser lens 16 fulfills these requirements . alternative , more complex , filters that combine infra - red reflection and absorption are available from various manufacturers for use as the non - visible radiation filter 24 . however , such filters may require customizing to give good color characteristics in the visible region of the spectrum , and so are less preferable than a glass filter that operates by absorption . in the light fibre illumination source 10 according to the invention , the aperture plate 26 is placed in the light beam between the condenser lens 16 and the proximal end of the light fibres 18 . the aperture plate restricts the extent of the light beam such that the extent of the light beam is similar to the extent of the bundle of light fibres in the light fibre connector . by restricting the extent of the light beam in this way , the aperture plate 26 prevents much of the light beam from spilling onto the light fibre connector 20 and the connector mounting 22 . this prevents the light fibre connector and connector mounting from absorbing a significant amount of the stray light , which , in turn , prevents heat resulting from the absorption of stray light from heating the light fibres by conduction from the light fibre connector . the size and shape of the aperture 25 is chosen so that the extent of the light beam is similar to the extent of the proximal end of the light fibres 18 . for example , if the light fibres are in a circular bundle at the light fibre connector 20 , the aperture 25 is made circular . ideally , the diameter of the aperture should be chosen such that the light beam falling on the bundle of light fibres is circular with a diameter equal to that of the diameter of the bundle of light fibres . however , the aperture 25 does not cast a perfectly sharp shadow on the proximal ends of the light fibres , so if the diameter of the aperture is chosen to make the diameter of the light beam falling on the light fibres equal to the diameter of the bundle of light fibres , the resulting illumination of the light fibres will fall off towards the periphery of the bundle . to illuminate all the light fibres in the bundle uniformly , the diameter of the aperture is chosen to make the diameter of the light beam falling on the light fibres slightly larger than the diameter of the bundle of light fibres . this provides uniform illumination of all the light fibres at the cost of a small amount of light spillage onto the light fibre connector 20 . for example , the aperture 25 with a diameter of about 2 . 5 mm mounted about 1 . 5 mm away from the light fibre connector 20 is used to illuminate a 1 . 5 mm diameter bundle of light fibres . in the arrangement just described , stray light energy is still absorbed , and the absorbed stray light energy is turned into heat . however , nearly all of the stray light energy is absorbed by the aperture plate 26 , and the amount of stray light energy absorbed by the light fibre connector 20 and the connector mounting 22 is minimized . to prevent heat reaching the light fibres 18 from the aperture plate 26 , the aperture plate is thermally isolated from the light fibre connector 20 . thermal isolation is achieved by attaching the aperture plate 26 to the heat sink 28 , which dissipates the heat resulting from the aperture plate absorbing the stray light . the aperture plate 26 and heat sink 28 are mounted at some distance from the light fibre connector 20 so that the heat sink can dissipate heat at a point remote from the light fibre connector 20 . this reduces conduction of heat between the aperture plate and the light fibre connector . mounting the aperture plate and the heat sink remotely from the light fibre connector also reduces heat transfer from the aperture plate to the light fibre connector by secondary radiation . further reductions in heat conduction between the aperture plate 26 and the connector 20 can be achieved by including a thermal insulator in the path from the aperture plate 26 and its heat sink 28 to the light fibre connector 20 . convection cooling or some form of forced cooling , such as a fan , can alternatively or additionally be provided for the aperture plate and / or for the space between the aperture plate and the proximal ends of the light fibres . finally , as shown in fig3 b , radiation absorption by the adhesive retaining the light fibres 18 in the light fibre connector 20 is reduced by using an adhesive that is transparent to visible light is used for the adhesive 21 . the adhesive 21 is also preferably transparent at other wavelengths present in the light beam falling on the proximal end of the bundle of light fibres 18 . preferred adhesives are type lcr 1 . 52 by ici resins , and epotek 301 - 2 . adhesive absorption may be further reduced by customizing the bore 23 of the connector 20 to the shape of the light fibre bundle . if few , large diameter light fibres are used , as shown in fig3 c , the bore of the light fibre connector 20 is formed to profile of the individual fibres . this minimizes the space that must be filled with adhesive . if many small - diameter light fibres are used , the amount of adhesive may be minimized by providing the light fibre connector 20 with a hexagonal bore . the bore of the connector is customized by extrusion , machining , or by some other forming process . in the simple arrangement shown in fig3 a , there is a practical limit to the physical separation between the aperture plate 26 and the light fibre connector 20 . as the distance between the aperture plate and the light fibre connector increases , the sharpness of the shadow cast by the aperture plate on the light fibre connector decreases . a less - sharp shadow requires that a choice be made between increased stray light spillage on the light fibre connector and a fall - off in illumination towards the periphery of the bundle of light fibres . increased light spillage results in increased heating of the light fibre connector ; illumination fall off results in a lower illumination level , and an impaired angular distribution of the light pattern at the distal end of the light fibre . fig5 shows an arrangement in which the physical separation between the aperture plate 26 and the light fibre connector 20 is considerably increased while allowing the aperture plate to cast a sharp shadow on the light fibre connector 20 . this arrangement is similar to that shown in fig3 a , and like components are indicated with the same reference numeral . in fig5 the physical separation , and hence thermal isolation , between the aperture plate 26 and the light fibre connector 20 is increased . the relay optics 30 form a focused image of the aperture 25 on the proximal ends of the light fibres 18 and refocus the light beam diverging from the aperture on the proximal ends of the light fibres . the diameter of the aperture and the focal length of the relay optics are chosen relative to the distance between the aperture and the proximal ends of the light fibres so that the image of the aperture formed on the proximal ends of the light fibres has substantially the same extent as the bundle of light fibres . fig5 shows relay optics 30 made of two simple plano - convex lenses : a more complex lens arrangement could be used if necessary . alternatively , a single , multi - element lens , or more than two lenses may be used . the lenses may be spherical or aspherical . if the relay optics are constructed using two or more axially - separated lenses , all or part of the non - visible radiation filter 24 may be disposed between the lenses of the relay optics 30 . as an alternative to the aperture plate 26 , the taper 32 can be added to the optical path , as shown in fig6 a . this arrangement is similar to that shown in fig3 a , and like components are indicated with the same reference numerals . the taper 32 separates the heat source from the focal point of the light beam , homogenizes the light beam , and provides aperturing . additionally , the taper may concentrate and condense the light beam , similarly to a wide - aperture ( low f - number ) focusing lens . the taper may be provided using a non - tapered glass rod , a tapered glass rod , or a fibre - glass taper . the term &# 34 ; taper &# 34 ; will be understood to apply to at least these types of tapers . the taper 32 shown in fig6 a has opposed , plane , parallel faces 34 and 36 . unless the taper 32 is formed from a non - tapered glass rod , the face 34 through which light enters the taper is larger than the face 36 from which light leaves the taper . the faces 34 and 36 are normally round , as shown in fig6 a , but , alternatively , can be other shapes such as elliptical , square , or rectangular , or may be shaped to match the shape of the bundle of light fibres 18 . the taper 32 also provides a useful amount of homogenization of the light entering the larger face 34 of the taper , as shown in fig6 b . the light beam 31 entering the larger face 34 of the taper can have spatial irregularities 33 due to non - uniform directionality of the arc , or for other reasons . the light beam 35 leaving the taper 32 through the smaller face 36 has the homogeneous intensity profile 37 . because the taper 32 homogenizes light entering it , it can reduce ring artifacts and shading in the illumination provided by the light fibres 18 that would otherwise result from spatial irregularities in the light beam 31 . additionally , homogenizing the light beam prevents localized areas of high light intensity that can cause hot spots in the light fibres . the smaller face 36 of the taper 32 also defines an exit aperture similar to the aperture plate 26 . hence , the taper 32 can reduce the extent of the light beam to that of the bundle of light fibres 18 , and provide the benefits of aperturing described above . the light beam from the smaller face 36 has a uniform , high intensity and can either be directly coupled into the proximal end of the plastic light fibres 18 or can be refocused through relay optics ( not shown ) similar to the relay optics 30 ( fig5 ) onto the proximal end of the light fibres . the preferred embodiment uses a glass taper as the taper 32 . the larger face 34 preferably has a diameter of 5 mm , and the smaller face 36 preferably has a diameter of 2 . 5 mm . the numerical aperture at the larger face is nominally 0 . 66 . the glass taper 32 may be made by heating an optical glass rod to an elevated temperature , stretching the rod over at least part of the length of the rod , and polishing both ends of the rod to provide the faces 34 and 36 . with a glass taper 32 having a taper ratio ( i . e ., the ratio of the diameter of the larger face 34 to the diameter of the smaller face 36 ) of between 2 : 1 and 3 : 1 , a greater net light transmission to the light fibres 18 is measured using the taper than without the taper . this increased light transmission is obtained despite the insertion loss of the taper and its effective aperture . alternatives to using a glass taper as the taper 32 include a fibre - optic taper . a fibre - optic taper would preferably have a light fibre diameter at the larger face of about 100 ฮผm and an open area of the light fibres of at least 80 %. a fibre - optic taper produces less homogenization of the light beam than a glass taper , but is less likely to produce ring artifacts . for optimum homogenization , the fibre - optic taper should use optical fibres without an extramural absorber ( ema ). a further alternative to a glass taper as the taper 32 is a solid glass rod . a solid glass rod provides homogenization and aperturing , but not concentration and condensing . the solid rod could have a circular cross section , but could have other cross - sectional shapes , such as the shape of the bundle of light fibres . fig6 c shows the optical path of a practical embodiment of a light fibre illumination source according to the invention using the taper 32 . in this arrangement , the high - intensity light source 12 , dichroic filter 14 , non - visible radiation filter 24 , condenser lens 16 , and light fibre connector 20 are the same as those described above in connection with fig3 a . the glass taper 32 is mounted in the heat sink 38 with its larger face 34 receiving light from the condenser lens 16 , and its smaller face 36 aligned with the bundle of light fibres 18 . the taper 32 absorbs some light energy , which it turns into heat . thus , the taper 32 is mounted in the heatsink 38 which conducts this heat to a point remote from the light fibres 18 , where it dissipates this heat . this minimizes heat transfer to the light fibres , as described above . the heat sink 38 is thermally isolated from the light fibre connector 20 and the connector mounting 22 , similarly to the heat sink 28 described above . however , since the glass taper concentrates the light beam , instead of absorbing part of the light beam , there is less heat to dissipate from the taper 32 than from the aperture plate 26 shown in fig3 a . to minimize heat transfer between the taper 32 and the light fibres 18 , an air gap is provided between the smaller face 36 of the taper and the proximal end of the light fibres . the separation between the taper and the proximal end of the light fibres is chosen relative to the respective diameters of the smaller face of the taper and the bundle of light fibres so that the extent of the illumination spot formed on the bundle of light fibres is similar to the extent of the bundle . a thermally - isolated aperture plate , similar to the aperture plate 26 , can additionally be interposed between the smaller face 36 of the taper 32 and the proximal end of the light fibres 18 to define further the extent of the light beam falling on the proximal ends of the light fibres 18 . existing light fibre light sources can also be modified to illuminate plastic light fibres with a high intensity without the risk of damaging or destroying the light fibres . fig7 shows the existing light fibre light source 110 with the high - intensity lamp 112 , the dichroic filter 114 and the condenser lens 116 . the existing light fibre light source also includes the light fibre port 142 to which the light fibre bundle would normally be connected by means of a suitable light fibre connector ( not shown ). the existing light fibre light source is unsuitable for use with plastic light fibres because of excessive levels of non - visible radiation in the radiation beam , heating of the light fibre connector by the radiation beam , and radiation absorption by the adhesive retaining the light fibres in the light fibre connector , as described above . the plug - in converter 140 according to the invention plugs into the light fibre port 142 of the existing light fibre light source 110 to enable the existing light fibre light source to operate successfully with plastic light fibres . the plug - in converter provides non - visible radiation filtering and aperturing as in the embodiments of the invention described above . the plug - in converter is additionally be supplied with a light fibre bundle 118 and light fibre connector 120 in which the light fibre bundle is retained in the light fibre connector by a transparent adhesive , as described above . additionally , the light fibre connector may be customized to fit the outer profile of the bundle of light fibres to minimize the amount of adhesive required , as described above . the plug - in converter 140 includes a main body 144 having a shaped portion 146 that is shaped to plug into the light fibre port 142 . opposite the shaped portion 146 , and optically aligned with the shaped portion 146 , is the connector 148 that receives the light fibre connector 120 of the plastic light fibres 118 . the connector 148 is preferably mounted on a portion 149 of a thermally insulating material attached to the thermally - conducting main body 144 . the portion 149 minimizes heat conduction from the main body 144 to the connectors 148 and 120 . the taper 132 , which is preferably a glass taper , is mounted in the shaped portion 146 with its larger face 134 towards the light fibre light source 112 . the fibre - optic taper 132 is similar to the fibre - optic taper 32 described above . light issuing from the smaller end 136 of the fibre - optic taper 132 passes through the non - visible radiation filter 124 mounted in the main body 144 . the non - visible radiation filter 124 is preferably a piece of near infra - red absorbing glass , similar to the non - visible radiation filter 24 described above . alternatively , a more complex non - visible radiation absorbing / reflecting filter can be used for the non - visible radiation filter 124 , also as described above . because the preferred form of the non - visible radiation filter 124 absorbs a considerable amount of infra - red energy , it is mounted in the main body 144 with the face 150 of the filter in thermal contact with the face 152 of the main body 144 . a layer of silicone grease or other heatsink compound is interposed between the faces 150 and 152 to ensure good thermal contact between the faces . this enables heat to pass easily from the non - visible radiation filter 124 to the main body 144 , which then dissipates the heat . also mounted in the main body is the relay optic 130 , which forms a sharply - focussed image of the smaller face 136 of the fibre - optic taper 132 on the proximal end of the light fibres 118 . the size of the smaller face of the fibre - optic taper , the focal length of the relay optics , and the relative mounting positions of the fibre - optic taper , the relay optics and the proximal end of the light fibres are chosen so that the extent of the light beam falling on the proximal end of the light fibres is equal to the extent of the bundle of light fibres . this minimizes the amount of stray light filling on the light fibre connector 120 , and , hence , minimizes heating of the light fibre connector 120 and the light fibres 118 by absorbed stay light . plugging the converter 140 into the light fibre port 142 of the existing light fibre light source 110 , and plugging the light fibre connector 120 of the bundle of plastic light fibres 118 into the port 148 in the converter 140 enables the existing light fibre light source to operate with plastic light fibres without the risk of damaging or destroying them . alternatives to the converter 140 configured to plug directly into the existing light fibre light source 110 are the free - standing converters 160 and 190 shown in fig8 a and 8b , respectively . the free - standing converters 160 and 190 are connected to the existing light fibre light source 112 by a suitable light coupler 162 , which can be a bundle of flexible glass light fibres , or a liquid light guide . one end of the light coupler 162 is plugged into the light fibre port 142 on the existing light fibre light source 112 , the other end of the light coupler is connected to the light fibre port 164 in the free - standing converter . this arrangement makes it possible to make a single , free - standing adaptor that can be connected to different models of light source simply by providing an appropriate light coupler . the existing light fibre light source can then operate with plastic light fibres without the risk of damaging or destroying them . in the preferred embodiment , the light coupler 162 is a 3 mm liquid light guide sourced by oriel . alternatively , a 2 mm glass fibre bundle obtainable from several different sources can be used . the optical arrangement of the free - standing converters 160 and 180 is similar to that of the converter 140 already described , but differs in detail . the non - visible radiation filter of the free - standing converter 160 differs from that of the free standing converter 190 . referring first to fig8 a , the light from the light coupler 162 first enters the taper 166 . the taper 166 is similar to the taper 32 described above , so can be a non - tapered glass rod ( as shown ), a tapered glass rod , or a fibre - glass taper . the action of the taper 166 is the same as that of the taper 32 described above , so will not be described again here . the homogenized and apertured light from the taper 166 enters the relay optics comprising the lenses 168 and 170 . the dichroic filter 172 and the non - visible radiation filter 174 are disposed between the lenses of the relay optics to take advantage of the broadening of the beam caused by the lens 168 . the actions of the dichroic filter 172 and the non - visible radiation filter 174 are the same as those of the dichroic filter 14 and the non - visible radiation filter 24 described above , so will not be described again here . the dichroic filter 172 and the non - visible radiation filter 174 are in thermal contact with the body 176 of the free - standing adaptor 160 . the body 176 dissipates heat resulting from radiation energy absorbed by these filters at a point remote from the light fiber port 178 to prevent this heat being transferred to the light fibres 180 via the light fibre connector 182 . the light fibre port 178 is preferably thermally insulated from the heat - dissipating part of the body 176 . the lenses 168 and 170 of the relay optics form a sharply - focussed image of the exit pupil of the taper 162 on the ends of the light fibres 180 . this sharply - focussed image minimizes the amount of light spillage onto the light fibre connector 182 , and hence minimizes light absorption by the light fibre connector . the light fibre connector 182 is similar to the light fibre connector 20 described above , and is constructed to minimize the amount of adhesive bonding the light fibres to the connector . additionally , a non - absorbent adhesive is used , also as described above . hence the amount of light absorption is minimized , and the transfer to the light fibres of heat resulting from residual absorption is minimized . the optical arrangement of the flee - standing adaptor 190 shown in fig8 b is generally similar to that of the free - standing adaptor 160 , but the free - standing adaptor 190 uses as the dichroic filter and the non - visible radiation filter reflective dichroic filters disposed between the lenses 168 and 170 of the relay optics . components corresponding to components in the free - standing adaptor 160 are marked with the same reference numerals . referring to fig8 b , the light from the light coupler 162 first enters the taper 166 . the taper 166 is similar to the taper 32 described above , so can be a non - tapered glass rod ( as shown ), a tapered glass rod , or a fibre - glass taper . the action of the taper 166 is the same as that of the taper 32 described above , so will not be described again here . the homogenized and apertured light from the taper 166 enters the relay optics comprising the lenses 168 and 170 . the reflective dichroic filters 184 and 186 providing the dichroic filter and the non - visible radiation filter are disposed between the lenses of the relay optics to take advantage of the broadening of the beam caused by the lens 168 . the reflective dichroic filters reflect visible light and transmit infra - red radiation . the transmitted infra - red radiation is absorbed by the body 188 and is dissipated at points remote from the light fibre port 178 to minimize conduction of heat to the light fibres . the light fibre port 178 is preferably thermally insulated from the heat - dissipating part of the body 176 . the lenses 168 and 170 of the relay optics form a sharply - focussed image of the exit pupil of the taper 162 on the ends of the light fibres 180 . this sharply - focussed image minimizes the amount of light spillage onto the light fibre connector 182 , and hence minimizes light absorption by the light fibre connector . the light fibre connector 182 is similar to the light fibre connector 20 described above , and is constructed to minimize the amount of adhesive bonding the light fibres to the connector . additionally , a non - absorbent adhesive is used , as described above . hence the amount of light absorption is minimized , and the transfer to the light fibres of heat resulting from residual absorption is minimized . although this application describes illustrative embodiments of the invention in detail , it is to be understood that the invention is not limited to the precise embodiments described , and that various modifications may be practiced within the scope of the invention defined by the appended claims .
| 6 |
in this invention , problems are solved that arise when an electromagnetic inductive probe is applied to the measurement of electrostatic capacity . first , the parasitic coupling between primary coil 11 and secondary coil 13 ( as shown in fig1 ) is eliminated by means of an electrostatic shield . fig4 shows the basic structure of the probe pan of the invention . fig4 is a perspective view showing a cross section of the electromagnetic inductive probe , cut by a plane passing through the central axis of the toroidal core . the same reference numbers are used in fig4 for the elements with the same functions as in fig1 ( this is also the case for the following figures ). an impedance meter 1 is composed of a signal source 2 , a resistance 3 , a voltmeter 4 , and an ammeter 5 . resistance 3 is a current - limiting resistance of the signal source . electromagnetic inductive probe 8 includes a primary transformer , formed by a primary coil 11 wound on a toroidal core 10 , a secondary transformer , formed by a secondary coil 13 wound on a toroidal core 12 , a shield 14 , and an outer resin mold 9 . impedance meter 1 and electromagnetic inductive probe 8 are connected by cables 6 and 7 . in order to simplify the diagram , the coils are not drawn as though they are wound spirally . primary coil 11 and secondary coil 13 are separated from each other by shield 14 . shield 14 includes small gaps 15 between it and primary coil 11 and secondary coil 13 , so that shorting does not occur . the structure of fig4 enables parasitic electrostatic capacity to be eliminated . moreover , the stray magnetic flux is made small , compared to the parasitic electrostatic capacity . at high frequencies , the stray magnetic flux is removed by the shield . moreover , there arises a microphonic coupling due to magnetic strain oscillations of the core material . in order to prevent this , a suitable buffer material may be placed between the core and outer resin mold 9 . in measuring solutions on a beaker scale , where the solution is not grounded , there is no problem using probes as shown in fig4 . however , if the solution container is on a tank scale , and the solution is in a state in which it is close to being grounded , a new problem arises . that problem is the existence of an electrical pathway ( of the sort shown in fig5 ) which causes errors . in the probe structure using two coils shown in fig5 the shield structure between the primary and secondary transformers passes through the centers of the ring shapes of the cores of the transformers . it is not symmetrical with respect to a perpendicular plane along the central axis of the rings . therefore , the primary transformer raises the mean potential of the solution above zero . this is due to the fact that a common mode voltage component is produced with respect to the solution . this is because the potentials distributed at various places on the shield plates , as seen from the current supply point where the outer conductor of cable 6 is connected to the shield 14 , and the electrostatic capacity with the solution are not in balance with respect to the aforementioned plane of symmetry . when the solution is grounded , a current 23 flows to ground due to the aforementioned effect , and if the secondary transformer is asymmetrical on the left and right , a signal is detected which corresponds to the magnitude of this difference . in fig5 the secondary transformer , like the primary transformer , does not have a symmetrical shield structure . the resulting difference is observed as an offset electrostatic capacity 22 . current pathway 23 in fig5 shows the pathway of the imbalance in the asymmetrical current . it is probably possible to find a current feed position that would not cause this potential difference . however , this invention solves the problem by making the probe structure symmetrical . that is , the structure of the probe is made symmetrical with respect to a plane perpendicular to the central axis of the rings and passing through the center of the core ring of the secondary transformer . furthermore , for there to be a compensating effect , the symmetrical structure must include the core , the shield structure , and an aperture through which the wiring may be pulled . examples of this embodiment are shown in fig1 , and 3 . fig1 is a structure in which the primary transformer is split in two , and the secondary transformer is placed between the 2 parts . in order to produce symmetry with respect to the secondary transformer , the 2 coils of the primary transformer are connected in parallel . the shield gaps are also made symmetrical . the example of fig2 is a structure in which toroidal cores 10 and 12 have different diameters and are arranged concentrically . for the sake of symmetry , the lead wire from inner coil 13 is passed through a hole 16 in the radial direction , which passes through the center of the cross section of outer core 10 and leads outside the probe . the example of fig3 is a structure in which the cores are arranged concentrically , as in fig2 . in this example , the symmetrical structure is destroyed because the lead wires are taken out from the sides of the coils . the potential difference that results is equilibrated and measured by a balun 18 . the lead cables 6 and 7 of the primary and secondary transformers are passed through balun 18 from opposite directions and are connected to main meter 1 . the outer conductors of the 2 cables are connected to each other by a short - circuiting wire 17 , on the measuring device side of the balun . as can be seen from equivalent circuit 19 in fig3 a ( equivalent to balun 18 ), cables 6 and 7 are equivalent to transformers wound in opposite directions , and since the outer conductors of the cables have the same potential on the meter side , due to short - circuit wire 17 , equilibrium is obtained . in fig1 , and 3 , the same effect can be obtained by structures in which the primary and secondary transformers are exchanged in position . by the means described above , only the current that is induced by the primary transformer and flows through the solution can be detected by the secondary transformer . however , since the probe of this invention is used by extending it by means of cables 6 and 7 from meter 1 , and the probe itself has a residual error that is difficult to calculate , the measurement system as a whole must be calibrated . it is known that impedance meters are ordinarily calibrated through use of three known impedances . for such a calibration method , see japan public patent applications nos . 5 - 85545 and 5 - 352215 . it is conceivable that the three known impedances may be obtained by use of prepared solutions , but a simpler , more accurate and more stable calibration method is used by this invention . since measurement terminals in ordinary impedance meters are used in open , short , and load ( i . e ., a known resistance ) states , it is this concept that is applied to the probe . fig6 a - 6c show diagrams of the principle for applying three - point calibration to the electromagnetic inductive probe . for the &# 34 ; open &# 34 ; state , probe 8 is placed in air , for the &# 34 ; short &# 34 ; state , a conductor 31 with 1 winding is passed through probe 8 , and for the &# 34 ; load &# 34 ; state , part of the conductor with 1 winding of the short state is replaced with a known resistance 32 . furthermore , in the short state , a current limiting resistor 3 is connected in series with signal generator 2 shown in fig1 etc ., so that an over - current does not flow to signal generator 2 . fig7 shows the fundamental structure of an example of a calibration instrument devised to trace the calibration of the measurement system . in fig7 probe 8 is contained in the calibration instrument . fig7 is a diagram of a cross section through a plane that passes through the central axis of the core of probe 8 . the main body 41 of the instrument , made of a conductive material , surrounds the outer surface of probe 8 . a projection 42 on the inside of main instrument body 41 passes through the probe and is connected to internal conductor 43 of a coaxial connector . the outside of main instrument body 41 is connected to outer conductor 44 of the coaxial connector . an opening 45 is provided through which pass cables 6 and 7 . if probe 8 is enclosed in this structure and a resistor is connected to the coaxial connector , a load state results . if the coaxial connector is short - circuited by a short - circuiting plate , a short state results . in order to place the probe into this instrument and remove it , a suitable means for dividing and reuniting the main instrument body may be implemented at a suitable position . since an instrument incorporating this invention can be connected with a standard by means of the coaxial connector , traceability can be obtained . moreover , multipliers for converting from measured impedance values to conductivities and dielectric constants , i . e ., the conversion coefficients intrinsic to the probe dimensions , are constant multipliers that need only be obtained once ( in the developmental stage of the probe ). this is because , if the probe is molded , there are no great variations in its dimensions . moreover , differences in the dimensions of the probe primarily produce errors in the amplitudes of the measured values , but what is important for measuring minute electrostatic capacities with good accuracy , is the phase accuracy rather than the amplitude accuracy . the phase accuracy is determined by the resistance and inductance component of the load calibration ; and it is common knowledge that these can be made extremely stable . fig8 a and 8b show the basic principle of this embodiment and its equivalent circuit . impedance 51 that is the subject of measurement can be regarded as a load on closed circuit current 65 ( produced by electromagnetic induction in part of the solution ). direct - current resistances ( r11 and r12 ) and stray inductances ( l11 and l12 ) are present in the coils and measurement cables . if the exciting impedance of the cores , i . e ., the exciting resistances ( re1 and re2 ) and the exciting inductances ( le1 and le2 ) vary with temperature , etc ., after calibration , differential voltage errors will be produced on the primary side and differential current errors will be produced on the secondary side . fig9 shows a method for dealing with these effects . as shown in the figure , two primary and two secondary coils are provided . exciting coil 52 of the primary transformer is connected to signal source 2 through resistance 3 . coil 53 for detecting voltage is connected to voltmeter 4 . current detecting coil 54 of the secondary transformer is connected to one end of ammeter 5 and the ground terminal . the magnetic flux detecting coil 55 is connected to the input of differential amplifier 56 , and the output of differential amplifier 56 is connected to the other end of the ammeter 5 . by means of this structure , a voltage proportional to the net magnetic flux of core 10 is detected by voltmeter 4 . moreover , since feedback is applied so that the magnetic flux of core 12 of the secondary transformer becomes zero , all of the current flows to ammeter 5 . therefore , stability with respect to temperature changes , etc ., is achieved . this method can , of course , be applied to the examples shown in fig1 , and 3 . furthermore , resistance 3 , besides limiting the current in the short state of the calibration so that an over - current does not flow to signal generator 2 , also serves as a current limiter . when the measured impedance in the circuit of fig9 is small . this prevents the instrument from becoming unstable at such times . examples of this invention have been shown above , but it is not limited to the lay - outs , part forms , arrangements , etc ., of the examples , and , if desired , modifications of the structure may be performed , as long as the essential elements of this invention are not lost . moreover , this invention is not only effective in measuring liquids , but also in so - called &# 34 ; clamp &# 34 ;- type impedance meters for measuring circuits without cutting them . by means of this invention , it is possible to measure very small electrostatic capacities of colloidal solutions . the invention solves the problem of interface polarization , and allows the resistance component to be measured with high accuracy .
| 6 |
a set of fibers is aligned on a substrate by placing the fibers across an opening in the substrate and applying an airflow through the opening . a pressure differential created by the airflow causes the fibers to be pulled down onto the substrate . the forces associated with the airflow through the opening enables an operator to adjust the position of the fibers while the airflow holds the repositioned fibers in place . the airflow is continued until a bonding material and a holding cap is applied over the aligned fibers , at which point the airflow is turned off or reduced . referring to fig1 a and 2 , a substrate 100 a includes a set of closely - spaced grooves 130 formed next to an airflow opening 120 and a fan - out area 140 spaced away from opening 120 . an airflow fixture 200 includes an airflow opening 220 formed through the top surface of fixture 200 . airflow opening 220 aligns with airflow opening 120 when substrate 100 a is placed onto the top surface of fixture 200 . fixture 200 also includes a hollow airflow connector 210 attached to a side surface of fixture 200 and an airflow channel 212 , formed within fixture 200 and airflow opening 220 to airflow connector 210 . in use , an operator places substrate 100 a onto the top surface of fixture 200 and then places a set of etched fibers 110 across opening 120 and substrate 100 a . a vacuum source ( an โ airflow source โ- not shown ) is connected to airflow connector 210 to create a downward airflow 230 , through airflow opening 220 and opening 120 , and an outward airflow 215 from fixture 200 . downward airflow 230 creates a differential pressure that pulls fibers 110 down onto the top of substrate 100 a , i . e ., downward airflow 230 from the top of substrate 100 a causes fibers 110 to experience a higher pressure above opening 220 and 120 and a lower pressure below . if required , the final placement of fibers 110 into grooves 130 is performed manually , by an operator who manipulates fibers 110 with a small instrument , such as a small pick or brush ( not shown ) while downward airflow 230 is continued . each of the individual fibers in set 110 has smaller - diameter etched ends 112 and larger - diameter non - etched sections 114 . in use , the operator nudges or brushes the fibers on or near the substrate 100 a . the forces applied by the operator are sufficient to temporarily overcome the airflow forces produced by the airflow through opening 120 . by temporarily overcoming the airflow forces and nudging or brushing the fibers , the operator is able to reposition the etched ends 112 of individual fibers 110 into grooves 130 , while the continued downward airflow 230 causes a downward force to pull fibers 110 toward the substrate and into grooves 130 . sideward airflow forces 240 a and 240 b are also applied to the set of fibers 110 , as a result of the design of the airflow opening 120 and the nature of the flow of air around the opening . sideward airflows 240 a and 240 b cause inward forces to be applied to the fibers 110 , i . e ., causing the application of forces in the same horizontal plane as the top surface of substrate 100 a but perpendicular to the longitudinal axis of the fibers 110 causing the set of fibers 110 to be pushed toward each other . the sideward airflow forces are controlled by the strength ( amount ) of airflow applied to airflow connector 210 and by the length of channel 120 . the airflow source is left on to hold etched ends 112 of fibers 110 in grooves 130 while the operator positions non - etched sections 114 of fibers 110 into a more widely - spaced row in fan - out area 140 . the airflow is continued after the fibers 110 are positioned and the operator applies a bonding material ( not shown ), e . g epoxy or glue , to fibers 110 and substrate 110 a , and then positions a holding cap 150 over and onto the bonding material , at which point the airflow may be turned off or reduced . holding cap 150 may include a set of grooves formed in the surface contacting fibers 160 that match the alignment pattern of fibers 160 . referring to fig1 b , a second embodiment of a fiber alignment substrate 100 b includes all of features of substrate 100 a , and also includes a second set of grooves 160 b formed in the top surface of substrate 100 b in the fan - out area 140 for holding the non - etched sections 114 of etched fibers 110 in alignment . grooves 160 b are more widely - spaced than grooves 130 and are formed to an appropriate depth to hold non - etched sections 114 of fibers 110 . the placement of etched fibers 110 on substrate 100 b is similar to that described before in connection with substrate 100 a , i . e ., in use , substrate 100 b is placed on airflow fixture 200 , and a flow of air through opening 120 enables an operator to position the etched fiber ends 112 within grooves 130 and then position the non - etched sections 114 of fibers 110 within more widely - spaced grooves 160 b . in the embodiments discussed above the etched fibers 110 were placed on a substrate 100 a or 100 b in a โ fan - out โ pattern , i . e ., a closely - spaced pattern at the etched ends 112 and a more widely - spaced pattern at the non - etched sections 114 of fibers 110 . when placing fibers that have varying outer diameters , or , when placing fiber with varying separation distances across a single substrate , the use of grooves formed in the substrate surface with accurate center - to - center distances between them is necessary to ensure accurate center - to - center distances between the fibers . in contrast , when aligning fibers together that have approximately equal outer diameters , the center - to - center distance between the fibers may be established , in part , by the outer diameter of the fibers and without using grooves . referring to fig3 when aligning a set of fibers 310 that have approximately equal outer diameters , a fiber alignment substrate 300 includes a top surface that is flat ( i . e ., without grooves formed in the surface ). substrate 300 includes an airflow opening 320 , and , in use , substrate 300 is placed on airflow fixture 200 and a downward airflow 360 is passed through opening 320 , that enables an operator to align fibers 310 on substrate 300 . downward airflow 360 causes fibers 310 to be held down on the top surface of substrate 300 while the operator applies a bonding material ( not shown ) and then a holding cap 350 over and onto the bonding material . holding cap 350 may include a set of grooves formed in the surface contacting fibers 310 that match the alignment pattern of fibers 310 . in the embodiments discussed above , the shape of the airflow openings 120 and 320 in the top surface of substrate 100 a , 100 b and 300 , respectively , are rectangular relative to the top surface of each substrate , with the longest sides of openings 120 and 320 being roughly perpendicular to the longitudinal axis of the grooves and the fibers being placed . the length of the longer - sides of openings 120 and 320 is slightly longer than the combined width of the diameters of the set of fibers being placed when all of the fibers in the set are placed side - by - side . this longer - side length can be increased to increase the access to manipulate the fibers from the side of or below the set of fibers . as described before in connection with substrate 100 a and 100 b , the placement of etched fibers on a substrate may result in a โ fan - out โ pattern , i . e ., where the etched ends are placed in a more closely - spaced pattern and the non - etched sections are placed in a more widely spaced single row that is spaced away from the etched ends . referring to fig4 a and 4b , an alternative pattern is shown for positioning the larger - diameter section of a set of etched fibers 520 a - 520 n and 530 a - 530 m on a substrate 500 , i . e . placing the non - etched section of fibers 520 a - 520 n and 530 a - 530 m in multiple rows with a first row of fibers 520 a - 520 n placed into a set of grooves 510 a - 510 n formed on a substrate 500 and a second row of fibers 530 a - 530 m placed above the first row 520 a - 520 n . more specifically , the second row of fibers 530 a - 530 m is placed between the grooves formed between the pairs of fibers of the first row of fibers 520 a - 520 n . an airflow 540 is applied next to the fibers through an airflow slot 550 to create a pressure differential above and below fibers 520 a - 520 n and 530 a - 530 n during placement and to hold the fibers in place until bonded together and to substrate 500 . the placement pattern shown in fig4 a and 4b reduces the required width of the substrate 500 for a given number of fibers being placed . referring to fig5 a and 5b , another way of creating airflow openings through a grooved substrate is to drill or form holes 640 in the lower portion of a set of grooves 612 a - 612 f formed in a top surface of substrate 610 . an airflow from the top surface of substrate 610 and into holes 640 causes a pressure differential above and below the holes 640 which may be used to manipulate and hold fibers within the grooves 612 a - 612 f . however , aligning smaller - diameter etched fibers as closely as possible requires grooves that are more closely spaced and shallower than the grooves required when aligning full - diameter fibers . more specifically , in one application , the etched fibers ends may be on the order of 50 um in diameter and require a set of grooves each of which are approximately 50 um wide and 50 um in depth . to avoid removing too much material from these closely - spaced grooves when forming or drilling holes 640 , the maximum diameter of the hole is limited . therefore , the fabrication of the holes is difficult and requires a large number of holes to achieve the desired airflow through the grooves . an alternative way of creating airflow openings through a grooved substrate 610 is to create ( for example , by an etching process ) a recess 620 in the back of substrate 610 that intersects with the lower portion of grooves 612 a - 612 f , thereby creating openings 630 in the lower portion of grooves 612 a - 612 f . by forming recess 620 to a known depth into the back of substrate 610 , openings 630 are created that allow the desired airflow but without causing the removal of an excessive amount of material from grooves 612 a - 612 f . a problem with some bonding materials and methods is that voids may be created and may remain in the cured bonding material , e . g ., air bubbles . typically , following bonding and curing , the substrate and fiber ends are โ lapped back โ to a desired length and / or angle . the lap back procedure uses a grinding material to grind off and polish the fiber ends and the substrate , and , therefore it exposes voids in the bonding materials . lapping back a fiber that is near a void in the bonding material may cause the fiber to shift and / or be damaged . to address the problem of voids in the bonding material , in an embodiment , the airflow is left on during the application of the bonding material and the holding cap or holding substrate . the differential pressures created by the airflow cause the bonding material to be drawn into the grooves and along the fibers to even out the application and reduce the number of voids between the fibers , the holding cap or holding substrate . though we have described specific embodiments , we do not intend to imply there are not other ways to implement some of the features of those embodiments . for example , we mentioned epoxy or glue as the means by which various elements are attached to each other . however , any appropriate method which affixes one element to another could be used , such as fusing or soldering . if the bonding material requires thermal curing , the fiber alignment substrate and / or the airflow fixture may be placed in an oven to speed the curing . the holding cap may be larger or smaller than shown in the attached figures and may contact not only the aligned fibers held within grooves but may also contact the non - etched fiber sections placed in the fan - out areas . also , although a single rectangular slot placed directly behind grooves in the substrate was described , any number of through holes of various shapes , sizes and locations could also be used to hold the fibers against the substrate and to orient the fibers relative to one another . in addition , other hole shapes , sizes and locations may be used to aid in the application of bonding material . also , instead of having an operator manipulate the fibers to position them , an automated mechanical arm with a tool of the appropriate size could be used to manipulate the fibers , for example , from either the side of the fibers or through the airflow opening below the substrate , to raise , and position the fibers . the vacuum source described previously may be implemented as a vacuum pump or as a โ bernoulli effect โ vacuum generator , for example . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the following claims .
| 6 |
the subject matter of the present invention is described with specificity herein to meet statutory requirements . however , the description itself is not intended to limit the scope of this patent . rather , the inventors have contemplated that the claimed subject matter might also be embodied in other ways , to include different components , steps , or combinations of components or steps similar to the ones described in this document , in conjunction with other present or future technologies . gloves in accordance with the present invention provide padding to protect the hand of a wearer by laminating padding between an outer layer and an inner layer . the inner layer may be oriented between the padding and the hand of a wearer when the glove is worn , and the outer layer may be oriented external to the padding when the glove is worn . in accordance with the present invention , a glove may comprise one or more portions or regions for which padding is retained by laminating an outer layer to an inner layer . the padding may be segmented to permit enhanced flexibility and articulation . other glove portions , which may or may not provide padding for a wearer , may be joined to the laminated portion to form an entire glove to be worn by a user . portions of a glove may be joined together by stitching , gluing or other adhesives , lamination , or any other method . referring now to fig1 , a glove 100 in accordance with the present invention is illustrated . glove 100 may comprise a palm portion 110 that is a first laminated padded portion . palm portion 110 may comprise an outer layer of , for example , a rubber or tpu material laminated to an inner layer to secure between the outer layer and the inner layer a plurality of pads 120 . of course , laminated padded portion 110 of glove 100 may also comprise a plurality of finger extensions and thumb extensions , although a glove in accordance with the present invention may also be partially or entirely fingerless , or a glove in accordance with the present invention may incorporate separate finger and / or thumb portions that are not integral with a laminated padded palm portion . palm portion 110 may be joined to other components of glove 100 by a variety of attachment methodologies , such as seam 130 . other attachment methodologies may also be used , such as adhesives , lamination , etc . by affixing the various portions of a glove in accordance with the invention a cavity may be formed that permits the glove to be detachably retained on the hand of a wearer . glove 100 may include a wrist cuff 170 . wrist cuff 170 may provide an attachment tab 180 that utilizes hook and loop fasteners to secure the glove 100 securely to the hand of wearer 105 . of course , other fastener types may be utilized , such as snaps , buttons , and the like . further , wrist cuff 100 may simply be sufficiently elastic to open to slide over the hand of wearer 105 but still retain a snug fit to retain glove 100 on the hand of wearer 105 . as illustrated in fig1 , palm portion 110 and associated plurality of pads 120 lacks any seam to retain pads 120 within palm portion 110 . by limiting the use of seams to secure padding 120 , a glove in accordance with the present invention reduces the risk of failure by stitching to secure pads during wear and tear incurred naturally during use of glove 100 . further , the lack of stitching to secure pads 120 enable the construction of glove 100 to be simplified and standardized to provide uniform and consistent results . as shown in the example of fig1 , pads 120 may be referred to as heel pads , in that they are positioned so as to protect the heel of the hand of the wearer 105 when the glove 100 is worn . if heel pads 120 are used , their number , arrangement , size , and orientation may vary from that shown in the example of fig1 . referring now to fig2 , an illustration of a glove 100 in accordance with the present invention is illustrated from the back of the hand . fig2 illustrates glove 100 with a pressed and stitched padded back portion 140 comprising a plurality of pads 150 . in the example illustrated in fig2 , back portion 140 extends up each of the four fingers of glove 100 . as shown in fig2 , padding 150 may comprise multiple pads 150 situated along each finger and knuckle when glove 100 is worn to permit the wearer to flex and / or articulate each finger . multiple pads 150 may be formed by compressing a single piece of a compressible material , such as neoprene , to form individual pads separated by grooves 152 . one or more stitch 154 may secure padded back portion 140 to an interior layer of glove 100 . one or more stitch 154 may be used in conjunction with an adhesive to secure padded back portion 140 , although either a stitch or an adhesive may be used individually . if used , stitch 154 may extend through some , all , or none of grooves 152 and / or the perimeter of pads 150 . further , stitch 154 may comprise one or multiple independent stitches . in the example of fig2 , padding comprises three pads 150 situated along each finger , which may be referred to as finger pad ( s ). an additional pad 155 may be situated near the base of each finger to protect the knuckle , which may be referred to as knuckle pad . knuckle pads 155 may comprise a part of padded back portion 140 or may comprise one or more additional portions of glove 100 . knuckle pads 155 may be formed and / or secured to glove 100 similarly to finger pads 150 . in the example illustrated in fig2 , knuckle pads 155 may be contained within knuckle portion 157 . knuckle portion 157 may be situated underneath padded back portion 140 and / or other portions of glove 100 . the exterior of knuckle portion 157 may be any type of material , such as synthetic leather , nylon , etc . optionally , each finger pad 150 and / or knuckle pad 155 may have a size and / or shape suited to the portion of the finger and / or hand protected when glove 100 is worn . the size and / or shape , and even the location , of a pad such as pad 150 may vary based upon the size of the glove 100 , the type of athlete for which glove 100 is intended , the position played by the athlete for which glove 100 is intended , etc . some of the pads 150 and / or knuckle pads 155 illustrated in the example of fig2 may be omitted , while additional pads may be added , without departing from the scope of the present invention . fig2 further illustrates a padded thumb portion 160 . in the example shown in fig2 , padded thumb portion 160 may comprise two thumb pads 165 along the thumb of a wearer of glove 100 . padded thumb portion 160 may be fabricated using materials and / or techniques similar to those described above for back portion 140 . for example , a groove 102 may be pressed into a neoprene pod and a stitch 164 may be used to secure thumb portion 160 to glove 100 . an additional knuckle pad 166 may be located near base of the thumb . knuckle portion 160 , which may be fabricated using materials and / or techniques similar to those described for knuckle portion 157 . the plurality of pads 165 permits enhanced flexibility and articulation of the thumb of an athlete while wearing glove 100 . the number , size , shape , and / or location of pads 165 may vary to suit the likely needs of the intended wearer . non - laminated portion 190 may comprise any type of material , and may be crafted of an elastic material to facilitate flexibility and secure fit of glove 100 when worn by wearer 190 . a plurality of holes 192 may provide ventilation for glove 100 . portion 190 may comprise additional padding 195 that may be secured , for example , using an adhesive or by stitching padding to an inner layer of portion 190 . padding 195 may be formed from compressed neoprene or any other padding material . portion 190 may be secured to other portions of glove 100 using stitched seams 130 , although adhesives or other fastening types may be used . seams 130 may be located well away from pads , thereby reducing unnecessary wear and damage to seams 130 . in the view illustrated in fig2 , seam 130 has been positioned near the center of the back of the hand of wearer 105 , rather than near the knuckles of wearer 105 , thereby decreasing stress on seam 130 when glove 100 is flexed , but still protecting the knuckles and fingers with pads 150 . referring now to fig3 , a view of palm portion 110 and plurality of pads 120 are illustrated . plurality of pads 120 may comprise any number , size , shape , and configuration of padding . as described above , considerations such as hand size , sport , and position of the intended wearer of a glove in accordance with the present invention may render various numbers of pads to be used in varying sizes , shapes , properties , and / or arrangements . the exterior of palm portion 110 may comprise any type of material . a durable , pliable , material with grippability , such as rubber or tpu , may be used as exterior of palm portion 110 . line 4 - 4 in fig3 indicates a cross section of palm portion 110 further illustrated in fig4 . as shown in fig4 , beneath exterior layer 112 pads 120 may comprise a first padding material portion 122 , a second padding material portion 124 , and a third padding material portion 126 to provide cushioning and protection for the hand of the wearer of glove 100 . first padding material portion 122 , second padding material portion 124 , and third padding material portion 126 may comprise the same or different types of material . materials suitable for use as padding material in conjunction with gloves in accordance with the present invention comprise , for example , various types of foam , silicone , rubber , compressible fibers , and the like . padding material may , for example , be cut and / or compression molded to the size and / or shape desired for a particular pad location . exterior layer 112 may be molded to form depressions to receive pads 122 , 124 , and 126 . pads 122 , 124 , 126 may be situated between an outer layer 112 and an inner layer 114 . outer layer 112 may comprise the external material of glove 100 and may be formed of rubber or tpu . however , additional materials may be applied to outer layer 112 to provide a desired feel , water resistance , grip , durability , or other performance characteristic . inner layer 114 may contact the skin of the hand of wearer , but need not . if inner layer 114 contacts the skin of a wearer , a material such as lycra may be used . however , various liners or other materials may be interposed in inner layer 114 and the hand of a wearer when the glove is worn to provide desired comfort , feel , texture , moisture management , or other performance characteristics . adhesive layer 113 may secure pads 122 , 124 , 126 and outer layer 112 to inner layer 114 . any type of adhesive may be used for adhesive layer 113 . adhesive layer 113 may be a thermoplastic polymer that forms bonds with outer layer 112 , inner layer 114 , and / or pads 122 , 124 , 126 through the application of sufficient heat and pressure , thereby joining outer layer 112 , inner layer 114 , and pads 122 , 124 , 126 . alternatively , adhesive layer 113 may be a material that forms bonds through radio frequency or ultrasonic bonding processes , for example . with regard to the use of a thermoplastic polymer as adhesive layer 113 , the amount of heat and pressure applied to form bonds depends upon the specific material used , which may be , for example , polyurethane , polyamide , polyester , polyolefin , or vinyl . suitable thermoplastic polymers formed from these materials may be supplied by bemis associates , inc . of shirley , mass ., united states . in general , heat and pressure induces adhesive layer 113 to soften or melt so as to infiltrate the structure of outer layer 112 , inner layer 114 , and / or pads 122 , 124 , 126 . upon subsequent cooling , adhesive layer 113 becomes securely bonded to outer layer 112 , inner layer 114 , and / or pads 122 , 124 , 126 to form an integrated laminated padded portion , such as palm portion 110 . a laminated portion of glove in accordance with the present invention may be constructed in methods such as method 500 illustrated in fig5 . in step 510 , pads may be formed having the desired size , shape , and / or physical properties for a laminated padded portion of a glove . for example , individual pads may be cut or molded to a desired size and shape from a material possessing the desired compressibility . for example , step 510 may cut pads having a variety of sizes and shapes from a foam material . in step 520 , the inner layer for the laminated padded portion may be cut . inner layer may be cut from lycra , nylon , polyester , cotton , or any type of fabric . in step 530 , the outer layer for the laminated padded portion may be cut . outer layer may be cut from any type of fabric . coatings may be applied to the outer layer to provide desired properties , or outer layer may be cut from a material possessing desired properties itself , for example , rubber , tpu , and / or synthetic leather may be durable , flexible , and grippable . step 520 and step 530 may use die cutting or other techniques to cut the desired amount and shape of fabric , leather , or other type of material from a sheet . steps 510 , 520 , and 530 may be performed in any order , including simultaneously . in step 540 , the outer layer cut in step 530 may be shaped to receive the pads formed in step 510 . step 540 may comprise , for example , molding an outer layer formed of a rubber or a tpu material to form depressions into which pads may be inserted . the size and shape of such a depression formed in step 540 may correspond to the size and shape of pads formed in step 510 . further , step 540 may form depressions of multiple sizes and shapes to receive pads of multiple sizes and shapes . in step 550 the pads formed in step 510 may be inserted into the outer layer shaped in step 540 . for example , in step 550 pads may be inserted into depressions having a shape and size corresponding to the inserted pad . in step 560 an adhesive may be provided for use in assembling the laminated portion . any type or types of adhesive may be provided in step 560 . for example , a heat activated flexible tape adhesive such as is available from bemis ยฎ corporation may be cut to an appropriate size and shape . in step 570 the pads formed in step 510 and the outer layer cut in step 530 may be assembled to be retained to the inner layer cut in step 520 . step 570 may use double sided tape or any type of adhesive . in step 580 , the outer layer may be laminated to the inner layer , thereby retaining the pads between the inner layer and the outer layer to form a laminated padded portion . laminating in step 580 may comprise , for example , applying any heat and / or pressure needed to activate the adhesive provided in step 560 and assembled in step 570 . for example , a glove portion with a portion of heat activated flexible tape used as an adhesive may be heated to approximately 200 ยฐ f . to activate the beamis . in step 590 , the laminated padded portion may be affixed to one or more other glove portions , some or all of which may be laminated padded portions , to form a glove . step 590 may use stitching , adhesives , or any other technique . gloves in accordance with the present invention may provide laminated padded portions in locations other than the palm . further , multiple laminated padded portions may be provided in a single glove in accordance with the present invention . a glove in accordance with the present invention may combine one or more laminated padded portion with any number of additional portions of any type . for example , a glove in accordance with the present invention may combine multiple laminated padded portions with any combination of non - laminated padded portions , non - padded portions , ventilated portions , stretchable portions , etc . further any type of material may be used to fabricate the outer layer , inner layer , and pads of laminated portions of a glove in accordance of the present invention . embodiments of the present invention have been described with the intent to be illustrative rather than restrictive . alternative embodiments may be practiced that do not depart from the scope of the present invention . certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations and are contemplated within the scope of the claims . not all steps listed in the various figures need be practiced in methods in accordance with the present invention , nor need all steps be carried out in the specific order described .
| 0 |
referring to fig1 and fig2 a vehicle wheel 10 as is used for automotive vehicles includes an inflatable tire 12 which is mounted on a wheel rim 14 having an inner annular surface 16 and an outer annular surface 18 . an inflatable region 20 is disposed between the outer annular surface 18 of the wheel rim 14 and the inner surface of the inflatable tire 12 . the wheel 10 is mounted on an automotive vehicle , bringing the wheel rim 14 in proximity with vehicle components such as the brake rotor 22 and brake caliper support 24 . an electromagnetically activated air pump 30 embodying the present invention is integrated with the wheel rim 14 . the pump 30 extends from the inner annular surface 16 to the outer annular surface 18 . as described more fully below , the pump 30 interacts with an electromagnet 32 mounted on the brake caliper support 24 to force air from the atmosphere through the wheel rim 14 and into the inflatable tire 12 . referring to fig2 a cross - section of the vehicle wheel 10 mounted on a vehicle axle 40 is shown . the radially inner portion 42 of the pump 30 is exposed to atmosphere . the pump 30 passes through the wheel rim 14 and terminates with the radially outer portion 44 in fluid communication with the interior of inflatable tire 12 . an electromagnet 32 is mounted on a vehicular component within the perimeter defined by the inner annular surface 16 of the wheel rim 14 . although the electromagnet 32 as shown is mounted on the brake caliper support 24 , those skilled in the art will anticipate that the electromagnet 32 may be mounted on other proximate vehicular components . likewise , the pump 30 may be mounted elsewhere on the annular portion of the wheel rim 14 . in one possible alternative arrangement , the pump 30 is mounted parallel to the axis of the wheel 10 . in this arrangement , the centrifugal force created by tire rotation has a minimized effect on the performance of the pump 30 . as shown in fig3 the pump 30 includes an air inlet 50 . the air inlet 50 is disposed on the radially inner portion 42 of the pump body 52 . a plunger 54 having a magnet integrated therewith is disposed within the pump body 52 . the plunger 54 may be magnetic , or include a magnetic component fixedly attached thereto . the plunger 54 is shown in the open position , which allows air from the atmosphere to enter the pump body 52 through the air inlet 50 . a biasing element 56 retains the plunger 54 in the open position . as shown , the biasing element 56 is illustrated as a spring . in one possible alternative embodiment , the biasing element 56 may be a permanent magnet disposed within the pump body 52 which retains the magnetic plunger 54 in the open position . the air inlet 50 can be a one - way valve which allows air from the atmosphere through the air inlet 50 into the pump body 52 , but prevents air from within the pump body 52 from entering the atmosphere . referring to fig3 and fig4 the radially outer portion 44 communicates with the inflatable tire 12 . air within the pump body 52 is forced through the radially outer portion 44 as the magnetic plunger 54 moves into the closed position , as shown in fig4 . in the exemplary embodiment shown , the radially outer portion 44 includes a one - way valve 58 which allows air to enter the inflatable tire 12 but prevents air from entering the pump body 52 from the inflatable tire 12 . the shape of the plunger 54 is substantially equivalent to that of the pump body 52 so as to allow the plunger 54 to reciprocate within the pump body 52 . in one embodiment , the plunger 54 and the pump body 52 are cylindrical . the electromagnet 32 is fixedly located so that normal rotation of the wheel rim 14 will move the pumps 30 , and therefore the magnetic plunger 54 , within proximity of the electromagnet 32 . when the magnetic plunger 54 is within a predetermined range of the electromagnet 32 , if the electromagnet 32 is energized a force is exerted on the plunger 54 of sufficient strength to overcome the biasing element 56 , causing the plunger 54 to move to the closed position as shown in fig4 . when normal rotation , of the wheel rim 14 moves the plunger 54 out of proximity with the electromagnet 32 , the resulting absence of magnetic force upon the plunger 54 from the electromagnet 32 allows the biasing element 56 to return the plunger 54 to the open position as shown in fig3 . the electromagnet 32 includes an electric coil 60 . when the electric coil 60 is selectively energized , it provides the magnetic field of the electromagnet 32 . when the electric coil 60 is not energized , no magnetic field is produced , regardless of whether the plunger 54 and electromagnet 32 are in proximity . in an alternative embodiment , the electromagnet 32 is a permanent magnet which is enhanced by the electric coil 60 . when the electric coil 60 is energized , the strength of the resulting magnetic field is added to the strength of the permanent magnet . with this arrangement , the relative size of the electromagnet 32 and the electric coil 60 may be reduced while maintaining sufficient strength to overcome the biasing element 56 . correspondingly , the power delivered to the electric coil 60 may be reduced . when pressure in the inflatable tire 12 is low due to insufficient air such as detected by a tire pressure monitoring arrangement , the electric coil 60 receives an activation command form a vehicle controller ( not shown ). when the coil is activated , the electromagnet 32 and biasing element 56 exert off - step opposing forces upon the plunger 54 due to normal rotation of the wheel rim 14 . the subsequent reciprocating motion of the plunger 54 causes air to be drawn into the pump body 52 through the air inlet 50 and then pumped into the inflatable tire 12 . when pressure within the inflatable tire 12 returns to a sufficient level , the electric coil 60 is deactivated , and the plunger 54 returns to the open position . it is to be understood that the configuration of the pump 30 may be implemented in ways other than those illustrated . in one embodiment , the electromagnet 32 forces the plunger 54 into the open position , and the biasing element 56 returns the plunger 54 to the closed position . alternatively , the radially outer portion 44 of the pump 30 further comprises a valve which allows air to enter the pump body 52 from the inflatable tire 12 when pressure within the inflatable tire 12 is excessive . such a situation may arise due to ambient temperature changes . it is also to be understood that the activation of the electric coil 60 may be achieved using different methods . in one embodiment , the electric coil 60 is activated by a controller . alternatively , the electric coil 60 can be selectively activated by a vehicle operator from within the vehicle . additionally , the tire pressure at which the electric coil 60 is activated may be varied according to operator preference , tire specifications , and environmental conditions . in the case of a leak in the inflatable tire 12 , the electric coil 60 will experience near - continuous activation . in this circumstance , a feedback or other suitable detection arrangement capable of detecting such constant , or near constant , activation of the pump could be provided to notify the operator that such a leak is present . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .
| 1 |
the present invention is based on the discovery that lignin , a naturally occurring polymer , is particularly useful for storing electrical energy . as noted above , lignin has been used in batteries in the prior art , but only as fillers , expanders , passivating agents , anti - oxidants , etc . it turns out , however , that lignin can be charged by a charging current so as to store electrical energy which can be used to drive a load . lignin is the major non - cellulosic component of wood . in a broader sense , the term lignin is a generic term which includes other lignin - containing products such as various paper mill products and effluence , black liquor , commercial lignin and even ground - up newsprint . the term lignin as used herein is evident from this context . in general , the present invention operates most efficiently with the purest form of lignin available ; however , one of the advantages of the present invention resides in the fact that it is capable of utilizing almost any form of lignin . due to the broad range of chemical purities in the various aforementioned lignin products , the necessary modifying treatments and resultant electronic characteristics may vary . as expected , performance degrades as the lignin becomes more impure . in its isolated form , lignin includes many randomly bonded and cross - linked units , forming macro - molecules with a formula of the family och 3 c 6 o 2 ( ch ) n sh . lignins are not a chemical compound but a material which is statistically describable in terms of the concentration of functional groups and the kind and frequency of interunit linkages . the average lignin is known to contain aromatic rings with a side chain , one or two methoxyls , a phenolic hydroxyl or phenol ether . prominent configurations in the chemical structure are the quinoid charge transfer complexes . while quinoid materials have been previously explored for use as energy storage materials as described in the aforementioned mcginness patent , it is the source ( i . e . lignin ) and modifications of these materials as part of the present invention which makes them more viable as energy storage devices . the present invention is also based on the discovery of the aforesaid modifications to the polymer materials so as to make them more viable for the intended purpose . one of the principal agents in modifying the polymers according to the present invention is hydrazine . hydrazine has heretofore been widely used for such functions as fuel cell materials and immunology research to bond tyrosine residues to plastic for mechanical adherance . it has been found , however , that hydrazine will bond a variety of quinones to graphite with resulting increase in conductivity . specifically , hydrazine is employed with the oxidation - reduction polymer in accordance with the present invention for two distinct purposes : ( 1 ) the addition of electron - repelling groups to render the base polymer more anodic ; and ( 2 ) as a molecular solder connecting the polymer to an ohmic electrode . more specifically , it has been found that 2 , 4 - dinitrophenyl hydrazine can be mixed with an oxidation - reduction polymer such that the hydrazine functions as an anodic functional group when connected to the conjugated ( phenyl ) ring structure . the activity of the functional groups is enhanced by the double - bond structure in its vicinity . although , in accordance with the present invention , lignin can be employed in the non - barrier and barrier structural embodiments of the aforesaid mcginness patent , and although , in accordance with the present invention , oxidation - reduction polymers in general may be mixed with hydrazine in the non - barrier and barrier structural embodiments of the aforesaid mcginness patent , it has been found that the structure illustrated in the accompany drawing is particularly suitable for electrical energy storage devices . referring to that drawing , an electrical energy storage device 10 includes collector electrodes 11 and 13 which form ohmic interfaces 12 and 14 with respective electron acceptor 15 and electron donor 17 components , respectively . a barrier 19 is disposed between the electron acceptor 15 and the electron donor 17 and is impregnated with an electrolyte . barrier 19 serves to separate the active materials of components 15 and 17 into two compartments while acting as an ion conduit therebetween . an external circuit 20 operates to withdraw or introduce electrons into the active material in components 15 and 17 . specifically , series - connected ammeter 22 and resistor 23 are selectively connected across collector electrodes 11 and 13 by a switch 21 in one of its positions . a charging circuit , including a variable voltage source 24 ., is selectively connected across these electrodes in another position of switch 21 . as noted above , the present invention involves certain modifications which can render an organic semiconducting polymer containing quinoid subunits suitable as an electron donor or acceptor . moreover , as noted above , the present invention recognizes that there is a plentiful and natural source of such polymer , namely lignin . these materials can be made to function as one or both of the components 15 , 17 , depending upon the chemical and physical modifications employed . in addition , these materials can be made so as to acquire characteristics which compensate for some of their shortcomings . the electro - chemical properties of organic semiconducting materials lack adequate theoretical description . general interpretations and understandings arise from a combination of considerations based on solid state physics , chemistry and structure . therefore , the operational theory described hereinbelow is only theory and is intended to be illustrative of the present understanding of the invention operation . in addition , there are simply too many possible variations in the structure , detail and composition of the materials employed in the invention to provide an exact theory which covers all of the possibilities . the discussion which follows inherently includes the role played in the invention by oxygen ( present primarily in the form of lone pair states , such as in quinones ) nitrogen ( present primarily in hydrazine ) and sulfur ( present primarily in sulfimides , sulfonation and sulfhidrals ). moreover , it should be recognized that elements of higher order in the chemical periodic table may function similarly . the polymeric semiconductive materials which may be employed in energy storage devices in accordance with the present invention contain both modifications to the quinone structure and additional sub - units . when an electrical current is passed through the material , certain sites in the material can accept or donate electrons while simultaneously reacting with ions , depending upon the free energy states of the sites before and after the accepting - donating event . when the device is charged from the external circuit 20 , higher energy states are created which can later drive an internal ionic and external electric current when the device is later discharged through a load . in this regard , the standard battery terminology of cathode and anode are most applicable when considering events external to the energy source device . internal events can include charge gradients , counter ions , charge transfer complexes , etc ., which render some terminology unclear . in some contexts the terms anode and cathode are useful , such as the reference to potential voltage levels described below . pure quinones have an electrical potential of 0 . 7 volts with respect to hydrogen making them cathodic - electron acceptors with respect to the standard inorganic battery materials , such as zinc . hydroquinones are anodic toward hydrogen and donate electrons to strong electron acceptors . for a battery to be constructed entirely of quinone and hydroquinone units , the electrical potentials must be changed . the alterations possible are substituents and modifications to the rings and to the non - ring groups . the effect of these can be followed qualitatively as alterations in electron density in the vicinity of oxidizable or reduceable groups . the effect is greatest in alterations of the quinone ring . quinone is ordinarily cathodic and accepts electrons when it is reduced to hydroquinone . the effects of substituents on the ring are that electron - attracting groups decrease electron density in the vicinity of oxygen , rendering the compound a stronger oxidizing agent . electron - repelling groups have the opposite effect . hydroquinone is normally anodic and donates electrons when oxidized to quinone . the effect of ring substituents is that the anodic potential is raised if there is a higher electron density , for example , by adding electron - repelling groups , in the vicinity of an oxidizable group . alternatively , the ring substituents make the compound a stronger reducing agent by rendering the compound more weakly aromatic . finally , the voltage obtained with graphite as the ohmic contact is anomalously high and can exceed 2 . 5 v in contrast to metal ohmic contacts which provide potentials which correlate with the 0 . 7 volt contribution expected from quinones and yields 1 . 4 v with zinc . the general theory of operation within the oxidation - reduction polymer material used for electron acceptor 15 , electron donor 17 , or both , is described in detail in the aforementioned mcginness patent and is not repeated herein . the present invention is best illustrated by means of the following examples which show the preparation of oxidation - reduction polymers for use in electrical storage devices , including the device shown in the accompanying drawing , according to the present invention : an energy storage device was constructed using typical pulp mill black liquor ( lignin ) at 20 % hydration . black liquor paste was spread on a 32 mm graphite disc and was in turn covered with a thin paste of zinc chloride . the combined pastes were then covered with a 32 mm diameter zinc disc , forming a device in the form of a sandwich of graphite / black liquor / salt / zinc . the device was charged at 1 ampere for four ten - second cycles . the decay voltage was monitored and , after the fourth cycle , stabilized . the device was discharged and then charged at 200 ma for one minute . the resultant total efficiency ( available stored energy versus charging energy ) was 12 % and the energy density was 125 m joules / m 3 . the average potential was 1 . 8 volts . the short circuit current was 150ma . an energy storage device was constructed as in example i with the addition of a celgard microporous film ( celanese fibers marketing co .) serving as barrier 19 of the drawing . the liquor / zinc chloride mixture was spread on the zinc disc , covered with the celgard film ; liquor alone was spread on the other side of the film , and covered with a graphite disc . ( devices in which zinc chloride was used without liquor on the zinc disc component did not function as well as a mixture of zinc chloride with liquor .) this energy storage device had energy densities of over 100 m joules / m 3 , with increased total efficiency , typically above 30 %, and a significantly reduced voltage decay rate . an energy storage device was constructed by layering a 0 . 05 mm black liquor coat on a 32 mm graphite disc , placing a celgard film on top , and layering a 0 . 05 mm coat of hydra - zine - monohydrate treated liquor . a 32 mm graphite disc was placed on top of this as an ohmic contact . ( the liquor was treated with hydrazine by mixing 500 mg ( at a ph 10 . 6 ) of liquor with 750 mg of hydrazine and heating the resulting liquor at 60 ยฐ c . for ten minutes .) the charging process evaporated excess liquid ; further , the discharge characteristics showed that the liquor was modified such that it was capable of acting as an electron acceptor toward untreated liquor . the initial polarity of the energy storage device was negative with the liquor at ph 12 . 6 , acting cathodic with regard to the liquor with ph 10 . 5 . ( the addition of hydrazine monohydrate makes the liquor more basic .) the charging current reversed this polarity . however , the energy retention was relatively poor . twenty - four hours later , the sample was tested at the same dynamic impedance ( 125 ohms ) and was found to have increased its energy storage capacity from 2 mj / m 3 to 8 mj / m 3 . the average potential was 1 . 4 volts . furthermore , the discharge curve of voltage versus time was much flatter than is usually observed for quinone - containing polymers , including liquor and other lignins which have not been treated with hydrazine . an energy storage device was prepared as in example iii from one gram of black liquor treated by mixing with hydrazine monohydrate at a ph of 12 . 6 . the liquor was titrated to the desired ph by addition of ten normal naoh . two milliliters of hydrazine were then added . the material was incubated at 60 ยฐ c . for eighteen hours to remove excess water and allow the reaction mixture to reach equilibrium . in this example and in some following , the electronically active polymer was used in a variant form termed a composite material ( abbreviated cm ) which is a combination of polymer with an ohmic contact material , for instance , graphite powder . this composite structure increased surface area and stabilized the electronic properties , as well as improving mechanical behavior . the device was constructed from the combination of a graphite disc , the composite material , and separator in the order : graphite / cm / separator / cm / graphite . the effect of adding graphite was to raise the potential to over 2 volts , lower the internal impedance to 5 . 7 ohms / cm 2 , increase the energy density to over 25 mj / cm 3 , and slow internal discharge . this device ran a transistor radio at 10ma until the voltage dropped below the 2 v cutoff of the radio , at which time the device still contained over 80 % of its charge . short circuit current after charging was 185ma . an energy storage device was constructed using a commercial lignin known as indulin at ( polychemicals department , westvaco ) which is a kraft pine lignin polymer . the device consisted of an zinc electron donor ( 32 mm disc ), a zns04 saturated celgard film , and a 20 % hydration lignin paste 0 . 05 mm thick as the electron acceptor . tantalum discs , again 32 mm in diameter , formed the ohmic contacts . the device was charged and discharged ( three times ) until the voltage was stabilized and energy density raised , a procedure which has been found to be beneficial . the device then had an energy density of 150 mj / m 3 , and an average discharge voltage of 1 . 2 volts . lignin ( indulin at ) was packed in a tantalum foil envelope and heated to 1200 ยฐ c . for three hours . the resulting product was a partly graphitized mass with improved mechanical properties and higher electrical conductivity . when tested as in example v , it acted as an electron acceptor toward zinc and had an energy density of 200 mj / m 3 at an average voltage of 1 . 0 volts . lignin ( indulin at ) was saturated with ammonia and packed in a tantalum foil envelope and heated at 1200 ยฐ c . for four hours . the resultant product was found to function as an electron donor against the material in example vi . tested in the manner of example v , with an electrolyte of naoh , it produced an energy density of 80 mj / m 3 at an average voltage of 0 . 9 volts . an energy storage device was constructed using indulin at as the electron acceptor . the lignin was dissolved in methyl alcohol and a graphite felt was saturated with the solution using a vacuum funnel . the felt was then dried in a vacuum at 60 ยฐ c ., rehydrated , and tested against a zinc electron acceptor with a celgard film impregnated with zinc sulfate as an electrolyte . due to the large increase in surface area for electron transfer , there was a corresponding improvement in charging / discharging kinetics and energy density . the energy density was approximately 200 mj / m 3 , and the average voltage 1 . 2 volts . an energy storage device was constructed as in example vi , charged , and then cooled to 10 ยฐ c . the self - discharge rate decreased by 83 %. discharging the device through an external circuit at 10 ยฐ c . reduced the discharge rate by 32 %. this demonstrates that even though the low temperature charging / discharging characterisitics of lignin are superior to lead - acid systems , for example , there is a temperature dependence which can be used to lower the self - discharging life . a composite material ( cm1 ) was formed by mixing one gram of black liquor with 1 ml of hydrazine monophosphate and incubating the mixture for three minutes . graphite powder ( 500 mg ) was mixed into the black liquor and hydrazine mixture . a second composite material ( designated cm2 ) was formed by first mixing 1 mg of hydrazine monohydrate and 1 ml diethylamine . one gram of hydroquinone was then mixed into the solution and 300 mg of distilled water was added . the resultant chemical reaction raised the temperature from 25 ยฐ c . to 46 ยฐ c . several energy storage devices were constructed with graphite as the ohmic contact and celgard separators with the configuration : graphite / cm1 / separator / cm2 / graphite . the energy content was highest with the cm1 as the cathode and cm2 as the anode . one energy storage device was reverse charged ; that is , with cm1 the anode and cm2 the cathode . in both cases , the storage capacity continued to increase from twenty - four hours after initial charging . the device which was reverse charged was charged twenty - four hours later in the original charge configuration and found to store only approximately 24 % of original capacity . this indicates that initial charging current , therefore , polarizes the energy storage devices which incorporate hydrazine . in the previous descriptions , the results were obtained on developmental devices which used materials such as teflon , tantalum , sealing materials , and so forth . these were used for better control and ease of testing and fabrication ; for this reason they were not detailed , along with the test methods of data gathering and processing , as they are not pertinent to the operation of the devices . one of the advantages of the present invention over the prior art is that both the electron acceptor component 15 and the electron donor component 17 can be made from the same organic semiconducting material . this confers advantages in processing and in stability . cross - contamination is lessened when the anode and cathode are derived from the same material . a further advantage of the present invention is that a readily available material , namely lignin , may be employed as the basis for one series of materials . this material is a by - product of the paper making industry and is frequently thought of as a waste product . in addition , the non - toxicity of lignin , as evidenced by its use in animal feed , is another distinct advantage . the energy storage material which , in the preferred embodiment , is treated in the manner described , is not suitable for use as food ; however , it is clearly safe to handle . the energy storage materials are also chemically stable , lightweight and readily moldable to specific shapes . in addition to the examples described above , experiments were conducted with the device of the present invention by titrating black liquor lignin with hydrochloric acid in order to determine the role of sulfur groups in energy storage devices . a precipitant was formed , along with the release of sulfur gas , as a result of the titration . the resulting polymer was markably reduced in energy storage capacity . furthermore , it was noted that quinone polymers without sulfur or other anodic groups are also low in energy storage capacity . this phenomenon can be prevented by treatments which preserve the sulfur groups in the material . in such cases , titration with sulfuric acid allows protection if an acidic sample is required . finally , the graphite bonded by hydrazine allows the static dielectric constant to be reduced without appreciably lowering the impedence . previously the static dielectric constant was lowered to prevent internal decay . although internal decay could be drastically reduced , only a limited reduction could be achieved before the impedence became too high . it will be appreciated that the structure illustrated in the drawing represents a single cell of an energy storage device and that such cells may be connected in series , in parallel or in any other manner in which individual cells are connected in conventional battery devices . having described several embodiments of a new and improved electrical energy storage device and method , it is believed that other modifications , variations and changes will be suggested to those skilled in the art in light of the above disclosure . it is therefore to be understood that all such variations , modifications and changes are believed to fall within the scope of the invention as defined by the appended claims .
| 7 |
while this invention is susceptible of embodiment in many different forms , there is shown in the drawings and will herein be described in detail preferred embodiments of the invention with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the broad aspect of the invention to the embodiments illustrated . referring to fig1 - 6 , the stacking machine is situated beyond an upper conveyor 20 which has a downwardly - sloping rear portion 22 . articles are fed in the direction of the workflow on conveyor 20 , indicated by the arrow , and from portion 22 they are fed to gripping and stacking apparatus generally indicated by reference numeral 23 . this apparatus as illustrated , includes carrier means 25 pivoted on a horizontal pivot axis p parallel to the end of the conveyor 20 . the carrier means has gripping means 24 including upper and lower jaws 26 , 28 , shown in an intermediate open position when the carrier means 25 is in a raised article - receiving position , as shown in fig1 . the leading edge portion of the article is gripped by closing the jaws as the carrier means 25 is swung down about the pivot axis p to a lower release position where the article is placed on a stack on a lower discharge conveyor 30 . this sequence is shown in fig2 and 3 . the jaws 26 , 28 may be horizontally elongated jaw - forming bars where the lower jaw is pivotally supported on a horizontal pivot axis 32 with respect to the upper jaw and is closed by the application of air pressure to a one - way air cylinder assembly 36 . another air cylinder assembly ( not shown in fig1 - 6 ) which is arranged to move the carrier means 25 is attached to the carrier means . when the carrier means is raised to its receiving position , the lower jaw 28 is automatically moved to said intermediate open article - receiving position by the action of a mechanical linkage , to be described later , which cooperates with a fixed stop . thus , the jaws are automatically opened when they reach the receiving position ( fig6 ) and similarly they close to grip the article when air pressure is applied to the cylinder assembly , as will be explained later . as the carrier means is lowered , air streams are generated to push the portion of the article behind the leading edge portion thereof rearwardly in a manner to be explained so the article drops to the rear of the jaws upon a lower conveyor 30 . after each article has been placed on the conveyor 30 , or on top of the stack of articles thereon , the next operation is to open the jaws fully and then reset the mechanism to start a new operating cycle . jaw release is effected by removing the air pressure from cylinder assembly 36 . the lower jaw 28 then drops to a fully open position to allow the article to be left on the conveyor or stack thereon and the carrier means is returned to its upper article - receiving position . fig4 shows the lower jaw fully opened in the lowermost position of the carrier means , fig5 shows the carrier means being returned to its uppermost position , and fig6 shows the carrier means in the uppermost position where the jaws are open to accept the next article . fig7 shows details of the mechanism whereby the lower jaw is withdrawn so that in being raised to the receiving position it does not lift and disturb the top article on the stack . in the preferred design , the up and down movement and the lower jaw release movement are made by suitable air cylinders , valves and an appropriate control systems therefor . however , these operations can be made by other mechanical , hydraulic or electrical devices . as only a predetermined portion of the leading edge of the article is entered into the grip of the jaws , there remains a substantial part of unknown length of the article behind the jaws which must be moved rearward to drop upon the lower conveyor 30 . due to the flexibility of fabric articles , this portion will be in an unstable condition during the downward movement of the carrier means unless a rearward pushing force is then applied thereto . to this end , a stream of air is directed against the article preferably first in a mainly horizontal direction and later at a downwardly inclined direction . initially at least , this horizontal air stream could be obtained by directing a fixed overhead 45 ยฐ angle air stream downward upon a deflector plate on the carrier means above the jaws as described in the parent u . s . application ser . no . 845 , 123 which directs the air stream horizontally for only a portion of the downward movement of the carrier means . this arrangement places the stationary air stream so far from the article most of the time that very high air pressures are needed . the drawings illustrates an improvement wherein a horizontally elongated air jet tube 40 is mounted on the carrier means so that the tube pivots with the carrier means and always directs air at points always near the article in a changing direction initially horizontal but gradually dropping in angle as the carrier means pivots downwardly . fig8 and 9 of the drawings show a preferred embodiment of the stacking machine , constructed in accordance with the teachings of the present invention . the carrier means 25 consists of a main carrier frame 50 that has a pair of arms 52 ( only one being shown in fig9 ) pivotally supported on the frame about the pivot point p , the outer end of the arms have an upper jaw or gripping element 26 supported thereon , and the element 26 is preferably covered with a felt strip 54 . an upper plate 56 extends between the arms and the upper position for the arms is defined by a rubber stop 58 fixed to the frame 50 . the lower jaw or gripping element 28 is fixedly secured to a linkage 60 that is pivoted about a pivot pin 62 on the arms 52 . the fluid cylinder assembly 36 has one end pivotally supported on a cross brace 63 extending between the arms , while the opposite end is pivotally connected to the linkage 60 at 64 . the linkage 60 also has a further arm 66 fixed thereto , and the main frame has an abutment or stop 68 aligned with the end of the arm 66 . the movement of the jaw assembly or gripping means 24 will be described in detail hereinafter . the gripping means 24 is pivoted about pin p through a pneumatic cylinder assembly 70 that has one end pivoted on the frame and the opposite end pivoted on the arm adjacent the pivot point p . a counterbalancing means or spring 72 is also interposed between the frame 50 and the arms 52 to counterbalance the over - hung weight of jaw mechanism which thereby allows for lower operating forces for the air cylinder and also increases cycling speeds . the counterbalancing means 72 provides an upwardly - directed force to move the arms or gripping means 24 toward its uppermost position and thus lowers operating forces thereby producing a safety factor in the event that an operator should get a part of the body into the path of movement of the gripping means 24 . the air jet tube 40 , discussed above , is carried by the arms and is movable therewith and has openings for directing a stream of air towards the plate 56 so that the air flow will be parallel to the arms and above the jaws 26 and 28 . also , the mechanism or the gripping means incorporates an apron in the form of a plurality of cords 74 extending between the front end of the arms 52 and a vertical support 76 which will prevent the trailing portion of the article from falling into the air - blown zone and thereby considerably reducing the air pressure requirements . stated another way , the article support apron will prevent the article from obstructing the flow of the air across the plate 56 . the mechanism so far described operates as follows . the gripping means 24 is initially in the position shown in fig9 and no air is introduced into the cylinder assembly 36 so that the lower jaw or gripping element 28 is held in the position shown in the solid line of the drawing by the arm 66 engaging the stop 68 . this position may be referred to as the intermediate article - receiving position for the gripping means 24 . as an article a passes a sensing device , such as a photocell 78 , the cycling of the stacking device is commenced by circuitry to be described later , and after a predetermined time delay , pressurized fluid is supplied to the one - way cylinder assembly 36 and to the upper end of the cylinder assembly 70 . the cylinder assembly 36 thus moves the lower gripping jaw 28 to a clamping position to clamp the article between the jaws 26 and 28 , as shown in fig2 . as the downward movement of the gripping means 24 is continued , pressurized air is supplied to the tube 40 to produce air flow over the surface of the plate 56 , which in turn directs the tail portion of the article rearwardly or outwardly towards the stack . this movement continues until the end of the gripping means engages the upper article in the stack s , shown in phantom lines in fig9 . because of the relatively low air pressure and forces utilized in the cylinder assembly 70 , the movement of the gripping means will be interrupted by the stack of articles so that the lowermost release position is automatically adjusted to the top of the stack of articles . this eliminates the need for any complicated stack - lowering mechanisms , as is required when the gripping means is moved to a lowermost fixed position . the counterbalancing means also assists in reducing the force necessary to raise the carrier frame . when the article reaches the stack s , the flow of the air jet ensures that the article is straight and lays flat on the stack s . as shown in fig3 the air stream shown is directed across the upper surface of the article at a downwardly - inclined component of force . when the article has been received onto the stack , the pressure of the air on the cylinder assembly 36 is released , thereby allowing the lower gripping jaw to freely pivot counterclockwise as shown about its pivot axis 62 to a fully open position . in so doing , the pivoting action moves the gripping jaws in both a downward direction and a horizontal direction away from the deposited article so that when the carrier frame pivots upwards the lower jaw clears the article without upsetting it . at the same time , the pressurized air is introduced into the lower end of the cylinder assembly 70 to raise the arms 52 towards the uppermost position shown in fig9 . as such upward movement commences , the lower jaw 28 will be free to pivot and slide out from between the uppermost article and the adjacent article without disturbing the position of the article , as clearly illustrated in fig7 . the lowermost jaw 28 is then freely pivoted to the phantom line position , shown in fig9 which is the fully opened or release position for the lower jaw . as the jaw assembly approaches the uppermost article - receiving position , the free end of the arm 66 will engage the abutment or stop 68 and will cause the lower jaw to be pivoted to the intermediate article - receiving position , shown in the solid line in fig9 . thus , the system is ready for a second cycle of operation . several stacking deck arrangements are possible . in one form , the deck can be a simple stop / start conveyor 30 onto which the articles are stacked and when the bundle is complete , the conveyor is momentarily operated to discharge it from the system . in another preferred form , the deck is a simple hinge platform which can be tilted to a steep angle from where the bundle will slide downward onto a discharge conveyor . referring to fig1 , 11 , 12 , there is shown a multi - lane stacking mechanism with a discharge arrangement for discharging the stacks of articles beneath the machine in the opposite direction to the direction of workflow on the conveyor , or alternately bypassing the stacking machine to a second in - line conveyor . the direction of workflow is indicated by the arrow . the elements of the machine described with reference to fig1 - 9 are not shown , but an additional discharge conveyor 80 is shown . the discharge conveyor 30 on which the stack of article is received is driven intermittently by a motor 82 . when the stack has received a predetermined number of articles , motor 82 is energized and the stack is conveyed to a transfer deck 84 . from there , the articles are led away on a discharge conveyor 80 . fig1 and 11 are schematic views of the discharge arrangement of a four - lane machine , it being understood that there are four stacking and discharge conveyor stations exactly as described arranged closely side by side , as shown in fig1 and 11 and the upper conveyor 20 is a common belt conveyor encompassing all four stations . a separate sensing photocell 78 is mounted opposite each station . the close arrangement is made possible by the fact that the various pivot - forming bearings for the lower jaw 28 and the carrier arm 52 for each lane can be readily located within the ends of the horizontally elongated jaws 26 , 28 which are located contiguous to the jaws of the adjacent lane . the transfer decks for the four mechanisms are shown at 84a , 84b , 84c and 84d . each is tilted when full by a mechanism ( not shown ) to allow the stack to slide onto the discharge conveyor 80 . this conveys the stacks to a common collection point at 86 . the tilting mechanisms are interlocked so that tilting is inhibited if another stack is passing beneath a transfer deck . the control means may be arranged so that the adjacent pairs of transfer decks 84a - 84b and 84b - 84c may be operated together . in such case , a manual switch not shown , is moved to a position to connect in parallel the various solenoids of the pair of stations which are to act as one which operate the apparatus in a manner to be described . also , the switch will then disconnect one of the photocells of each pair of gauged stations so each pair is controlled by one photocell . the bypass operation is controlled by a series of guide fingers 100 ( fig1 ) which are movably mounted below the conveyor belts of the process conveyor 20 where they can be raised up and down in the gaps between these belts . when the bypass guide fingers 100 are raised by an air cylinder 102 , the articles will be directed from the process conveyor 20 onto the conveyor 110 . when the fingers are down , the articles will pass under the conveyor 110 to the stacking system . referring to fig1 , a where pneumatic - electric control circuit for each lane is provided using basic electromechanical components . when the leading edge of an article obscures the photosensor 78 , a switch 130 in a circuit is opened . this de - energizes the time delay relay 134 , which in turn energizes time delay relay 135 . then , after a preset adjustable time , time delay relay 135 operates energizing solenoid valves sv1 and sv2 and consequently air cylinders 36 and 70 . the time setting of relay 135 is adjusted to time the leading edge of the article into the jaws of the stacking mechanism , which then close and the arms are pivoted downward to place the article onto the stack . simultaneously , air is applied to the air jet tube 40 to direct the trailing portion of the article onto the stack . when the trailing edge of the article clears the photosensor 78 , the circuit energizes time delay relay 134 and after a preset delay , the relay operates . relay 134 resets the circuit , the jaws are opened and the mechanism is recycled to the receiving position ready for the next article ( fig9 ). two flow control valves 136 are positioned in the lines to cylinder 70 which control and stabilize operating speeds . when an article is stacked , a count signal is recorded by an electronic countdown device 139 . when a preselected number of articles have been stacked , the motor 82 , which drives the stacking - receiving conveyor 30 , is operated for a timed period of sufficient duration to convey the completed stack from the receiving area . to bypass the stacker , a switch 141 is operated . this energizes sv3 solenoid valve and air cylinder 102 , which raises the bypass fingers or diverting means . the described circuit is the basic requirement to operate a stacking mechanism . the preferred system will be microprocessor control , programmed to operate the stacker plus any other equipment in the complete process line . for ease of understanding , the control system has been described in a mechanical / electrical form using relays , microswitches and timers . however , the preferred control system will be fully electronic using a suitable programmed microprocessor system to perform all the necessary functions of counting , sequence and stack discharge and inhibit operations for all lanes . of course , various modifications come to mind without departing from the spirit of the invention . for example , the gripping means could be mounted on a suitable vertical linear track rather than the arcuate movement and the jaws could be moved by springs . also , the cylinder assembly 36 could be a two - way cylinder which would positively move the lower gripping element 28 between gripping and released positions . in this arrangement , the lower jaw 28 would be pivoted to the article - receiving position against the force of the air pressure and would automatically be moved to the gripping position by the air pressure when the arms begin the downward movement . also , the air tube could be fixed on the frame to first direct the air along the jaw plate and then at an angle on to the stack . while specific embodiments have been illustrated and described , numerous modifications come to mind without significantly departing from the spirit of the invention and the scope of protection is only limited by the scope of the accompanying claims .
| 1 |
the present invention will be described with reference to fig1 - 6 . the preferred embodiment of the present invention will be hereinafter described with reference to an implementation called the โ video encoding system โ. the video encoding system provides the preparation , delivery , pre - processing and presentation functionality described in the preceding sections . as discussed in the background section , the conventional approach for content delivery to mobile devices involves preparing content in accordance with the presentation capabilities of the targeted remote device ( s ), regardless of whether this is the most efficient approach to preparing content for a given delivery size or quality . the present invention overcomes this disadvantage by allowing the content to be prepared optimally even if the resulting form is initially unsuitable for presentation on the remote device . in accordance with the preferred embodiments , after the content is delivered to the remote device , the content may then be combined with other content already on the device , restructured or otherwise composited and then converted to a form that is suitable for effective presentation on the device . in accordance with the preferred embodiment , the pre - processing stage is preferably performed sometime prior to the presentation event such that it does not require use of the limited processing capabilities of the remote device during the presentation stage . in this manner , complex pre - processing may be performed on the delivered content that might take minutes or even hours on a low - powered processor producing simplified content in a form that can be presented effectively . fig1 is a schematic representation of the basic approach in accordance with the preferred embodiment . as shown in fig1 , stage 1 operates on a server 10 that is independent of the remote device 11 and performs the preparation of the original or source content 12 . in the video encoding system , the original content 12 ( i . e ., source content ) is initially provided in the form of high resolution video files such as tv quality advertising video clips ( e . g ., ntsc or atsc encoded video signals ). the original content is then converted into a form suitable for delivery to a remote device , typically a mobile phone . in the case of simple content conversion , the offline content conversion 13 takes the form of a video compression process using the best available compression algorithms for creating highly compact high quality video of suitable dimensions for playback on the remote device . in accordance with one embodiment , a high complexity h264 algorithm is used to convert broadcast quality digitally encoded betacam , pal and ntsc format digital video files into qcif ( 176 ร 144 pixels ) size or similar at 25 frames a second . the output dimensions and frame rates are chosen such that they are the maximum parameters for the range of remote devices to which the content is to be delivered . the means for effecting the conversion could be either a dedicated video converter or simply a programmed processor for effecting various different compression algorithms . once the original content is prepared , it is preferably appended , or โ tagged ,โ with information about the particular conversion process used so that the remote device receiving the converted content can determine how to interpret the delivered content for pre - processing . the converted content 14 is then delivered ( e . g ., broadcast , multicast , or unicast ) via any one or combination of a variety of transmission means 15 ( e . g . cellular wireless โ gprs โ, wired โ usb โ, or wireless โ bluetooth โ) to one or more remote devices . once the prepared content 14 is delivered to the remote device 11 , it is stored in a content archive ready for pre - processing . in accordance with the preferred embodiment , prior to presenting the received content on the device , a process is first run through an on - device content converter 16 ( which may be a dedicated processor or a programmed general processor ) to convert the desired archived content into a playable content 17 in a video format that can be played on the remote device . the chosen presentation format is typically a low complexity h264 format for higher end mobile phones and 3gpp format for middle range phones that are capable of playing video . due to the simplified nature of these formats , the output of the pre - processing stage typically results in video files that a substantially greater in size than that of the delivered content for the same quality video . in typical results , a 30 second video processed using the video encoding system can be prepared to a size as small as 150 kbytes using a variety of filtering and compression techniques . after delivery and pre - processing on the remote device the resulting video file in a form for effective presentation is typically around 1 . 5 mbytes , a tenfold increase in size . since transmission over cellular wireless networks using gprs is typically charged according to the bandwidth consumed , a tenfold reduction in delivery size equates directly to a tenfold reduction in transmission costs , making it cost effective for example to deliver video advertising to mobile phones . due to its simplified form , the converted larger video content now requires less decompression and decoding processing during playback , making it more presentable on a mobile device that may not otherwise have had sufficient processing power to simultaneously decompress and playback the original content . fig2 illustrates an alternative embodiment of the present invention whereby the original content 12 is segmented in a suitable fashion . specifically , each segment of the original content is separately prepared and delivered to the remote device either independently or in aggregated but still segmented form . once the entire segmented content has been received by the remote device along with instructions on how the content is to be composited and converted , the pre - processing stage can be programmed to select appropriate segments for a given presentation and output to a coherent single video file for later presentation . one advantage of this segmentation approach is that each segment could potentially be prepared / formatted using a different method , the particular method being selected in accordance with the nature of the segment . for example , a fast moving action segment might be encoded at a higher frame rate than slow moving or still image segments without noticeable loss of presentation quality . the pre - processing step of the system can then convert the various formatted segments ( e . g ., different frame rates ) to the highest possible frame rate available for effective presentation on the device . by providing the ability to format different segment with different methods of compression , this embodiment increases the content provider &# 39 ; s ability to maximize bandwidth efficiency and / or optimal content presentation . although conventional methods of content delivery , such as variable bit rate encoding , attempt to adapt to the complexity of the content in the video frame sequences being compressed , they are necessarily limited as to the extent of the adaptation possible . using the approach in the present invention , it is possible to use a different compression technique for each segment , for example simple computer graphics or cartoon animation might be compressed more appropriately using a different algorithm from that used for photographic video segments . this is analogous to the appropriate use of gif and jpeg formats for still images where the former is more appropriate for low colour palette graphical images and the latter more effective for photo - realistic images . a further advantage of this alternative embodiment of segmentation approach is that it allows a piece of content to be delivered to a remote device in a form that can be reconfigured for further presentations . for instance , in the case of a video advertisement clip that is to be played on more than one occasion ( e . g ., once a day for three days ), each segment may be modified in some way according to some criteria such as a predetermined configuration schedule , or even the individual preferences and profile of the remote device owner . in another example , the content provider ( or advertiser ) may deliver to remote devices a video clip such as a movie trailer advertisement with different opening sequence segments ( e . g ., โ coming soon to a theatre near you ,โ or โ in theatres tomorrow ); in such an example , when the video clip is played for the first time , when the movie is one week from being publicly released in the theatres , the opening sequence segment of โ coming soon to a theatre near you โ can be first presented before replaying the rest of the movie trailer . upon a subsequent presentation of the advertisement , say the day before the movie is to be publicly released , the opening segment of โ in theatres tomorrow โ can be used instead . this results in a powerful and flexible way to deliver content that might be displayed differently on each device without having to uniquely prepare the content for each device . if the content is viewed more than once in different forms , the reused segments are already on the remote device , further saving delivery transmission costs . fig3 is an illustration of one way in which a segmented content sequence 30 can be combined to produce a unique presentation . as shown in fig3 , reusable segments 31 a , 31 b , 31 c , and 31 d are selectively recombined in order to produce a second viewable video clip 32 . for instance , a video clip commercial , when presented for the first time , may be 30 seconds long . upon second presentation , the advertiser may wish to present a 15 second version of the original commercial so as to minimize the intrusion to the user of the mobile device while still accomplishing the objective of reminding the user of the advertised product or service . the ability to shuffle segments allows the content provider / advertiser more versatility to provide different advertisement presentation . fig4 illustrates is yet another alternative embodiment of the present invention . specifically , fig4 schematically illustrates an improved system from fig2 whereby the remote device 12 combines segments of delivered content 40 with segments of content 41 that is already archived on the remote device . in this manner , new and unique content can be pre - processed for presentation , by delivering only the marginal changes to content known to be already archived on the device . as before , the reuse of existing archived segments on the device results in a reduction of delivery transmission costs ( it is noted that , in fig4 only the remote device pre - processing stage is illustrated as the preparation stage is similar to what is shown in fig2 ). in accordance with another embodiment , the pre - processing phase of the system allows for content to be generated programmatically via a content generator 50 ( which may be , inter alia , a specific processor or a programmed general processor ) and combined with delivered and pre - stored segments as before . examples of such generated content may include graphical charts , image slide shows , video filtering of segments and computer generated vector and 3d animation . in each of these cases , the instructions for generating the content along with any necessary static images are preferably significantly smaller in delivery size than had they been delivered as high quality video segments . furthermore , computer generated graphics often require a high level of presentation detail to ensure that they can be presented effectively . for example , text generated on the device and subsequently encoded into a video for presentation is likely to be of higher quality than had they been subject to high compression during the preparation phase . in accordance with the yet another embodiment of the present invention , high quality textual annotation of a video sequence that may be uniquely provided for each unique mobile device receiving the video sequence . specifically , it may be desirable to display unique information associated with the device ( such as the name of the owner of the device , or some time dependent text within the video ). in another example , an advertisement for a movie that includes a trailer may be adapted for presentation to include the number of days remaining until the movie opens at the local cinema . each time the advertisement is presented it will appear to have been uniquely prepared for that moment . in this particular example , in contrast the segmentation example discussed above wherein different opening sequences are used , text annotations may instead be used to achieve the same objective . another advantage of using textual annotation is that it can be performed in the native speaking language of the owner of the remote device , allowing a single piece of content to be delivered to devices of different demographic communities , each customized on the device into their own language . fig5 and 6 further illustrate the process and benefits of the segmentation method illustrated in fig2 whereby an image is segmented by some means prior to preparation and with the appropriate maximum level of compression that delivers adequate high quality results is performed for each segment . specifically , as it is illustrated in fig5 , an entire original content is compressed at each of four compression levels labelled r 1 to r 4 ( 150 kb , 200 kb , 300 kb and 500 kb respectively ). the output content 60 may be comprised of segments selectively combined from the various compressed content . fig6 illustrates the resulting expected encoding size and showing that , in this particular instance , one can achieve a final compressed size of under 250 kbytes for a 32 second video clip , even though 40 % of the video is encoded at a higher rate . in the example described here , the segmentation is performed by a combination of automatic and manual means to ensure a sufficient high quality of the resulting presentation on the remote device . many alterations and modifications may be made by those having ordinary skill in the art without departing from the spirit and scope of the invention . therefore , it must be understood that the illustrated embodiment has been set forth only for the purposes of example and that it should not be taken as limiting the invention as defined by the following claims . the words used in this specification to describe the invention and its various embodiments are to be understood not only in the sense of their commonly defined meanings , but to include by special definition in this specification structure , material or acts beyond the scope of the commonly defined meanings . thus if an element can be understood in the context of this specification as including more than one meaning , then its use in a claim must be understood as being generic to all possible meanings supported by the specification and by the word itself . the definitions of the words or elements of the following claims are , therefore , defined in this specification to include not only the combination of elements which are literally set forth , but all equivalent structure , material or acts for performing substantially the same function in substantially the same way to obtain substantially the same result . in this sense it is therefore contemplated that an equivalent substitution of two or more elements may be made for any one of the elements in the claims below or that a single element may be substituted for two or more elements in a claim . insubstantial changes from the claimed subject matter as viewed by a person with ordinary skill in the art , now known or later devised , are expressly contemplated as being equivalently within the scope of the claims . therefore , obvious substitutions now or later known to one with ordinary skill in the art are defined to be within the scope of the defined elements . the claims are thus to be understood to include what is specifically illustrated and described above , what is conceptionally equivalent , what can be obviously substituted and also what essentially incorporates the essential idea of the invention .
| 7 |
the present invention generally comprises an infant bed that is designed for use in co - sleeping , in which the infant bed resides in the bed of a parent or other adult . with regard to fig1 and 2 , one embodiment of the infant bed includes a frame assembly 21 comprised of a rectangular base panel 22 and a head end wall 23 extending upwardly from the head edge of the panel 22 . a pair of side panels 24 and 26 extending upwardly from the opposed side edges of base panel 22 , and join the end wall 23 to form a coffer - like protected space 30 . the panels are provided with reinforcing ribs 27 and lightening holes 28 , as are well known in the prior art . further , the upper panel edges are provided with a tubular lip 29 extending along the upper distal edges of the panels 23 , 24 , and 26 . indeed , the reinforcing effect of end wall 23 joined to the side panels , together with the integral tubular lip , provides a structure that has significant resistance to deflection under vertical force . thus an infant supported within a bed defined by the frame structure 21 is afforded substantial protection from the accidental and incidental impingement by adult bodies that may occur in a co - sleeping situation . the frame structure 21 may be enclosed in a fabric cover 31 , as shown in fig4 . the fabric cover provides a soft surface treatment and may include a mattress pad , side pads , and other such features to enhance the comfort of the infant . such features are described in u . s . pat . no . 6 , 370 , 715 mentioned above and incorporated herein by reference . the head end wall , side panels , and base panel may be formed integrally by injection molding of polymer material , stamping of sheet metal or the like , or by assembly of the separate components using adhesive , ultrasonic welding , or the like . in the embodiment of fig1 and 2 , the frame structure 21 is depicted as integrally molded polymer material . a salient feature of the infant bed is the provision of a safety bar assembly 41 . in general , the safety bar assembly may comprise any arched or hoped structure that supports a hood - like structural arrangement , such as those common to baby carriages and the like , to divert objects that could impinge on the face or head of the infant within the infant bed . in the embodiment depicted in fig1 - 4 , the safety bar 41 is comprised of a tubular central portion 42 , and a pair of parallel legs 43 extending from opposed ends of the central portion 42 . a pair of mounting brackets 44 is provided , each secured to an outer surface of a respective side wall 24 and 26 . the distal end of each leg 43 is received in a respective one of the mounting brackets 44 . the mounting arrangement is configured so that the central portion 42 of the safety bar may be deployed across the area of the space 30 wherein the head of the infant will be resting . as explained below , the mounting system is designed to enable the safety bar to remain with the legs thereof in a generally vertical position to deflect pillows and other objects that might otherwise fall onto the face or head of the infant within the infant bed . in this regard it may be noted that the mounting brackets 44 are not centered along the length of the respective sidewall 24 or 26 . rather , the brackets 44 are disposed adjacent to the portion of volume 30 in which the infant &# 39 ; s head will be resting . this placement enables the safety bar 41 to be deployed to maximum effect when the legs 43 thereof are extending generally vertically upwardly from the mounting brackets 44 , so that the central portion 42 extends over the head of the infant for protection and the legs are oriented to resist any vertical loads from objects falling onto the safety bar . with regard to fig6 , the mounting bracket 44 comprises a lug protruding from the sidewall and having a slot 47 formed therein generally parallel to the sidewall . a keyway 46 extends generally vertically in the lug in communication with the slot 47 . each leg 43 includes a spade lug 48 at the distal end thereof , the spade being dimensioned to be received in the slot 47 . a key 49 protrudes from the lug 48 , and is formed in complementary fashion to keyway 46 , so that the spade lug and key may be inserted vertically into the slot and keyway . likewise , the spade lug and key may be withdrawn vertically from the slot and keyway . as shown in fig3 , within the bracket 44 there is an interior arcuate space 51 in which the key 49 may pivot after insertion through the keyway 46 . as a result , the legs of the safety bar may rotate within the mounting bracket 44 to permit the safety bar to rotate between the positions shown in fig1 and 2 . in addition , the mounting bracket is provided with a ball detent mechanism 52 which interacts with recesses 53 on the spade lug 48 ( fig6 ), so that the safety bar is maintained at at least one predetermined angular relationship , such as the vertical position of maximum protection . the safety bar may also be provided with a light 54 secured in the middle of the central portion 42 of the safety bar . the light may be actuated selectively so that the parent or other adult may be able to view the face of the infant at rest in the infant bed 21 . the light power supply ( battery or the like ) and switch may be installed within the tubular structure of the safety bar , using techniques well known in the prior art . the safety bar 41 may also be used to suspend a toy or other visually stimulating object within the view of the infant at rest in the bed of the invention . with regard to fig4 and 5 , a further embodiment 21 a of the frame structure includes a rectangular base panel 22 a and a separate head end wall 23 a extending upwardly from the head edge of the panel 22 . a pair of separate side panels 24 a and 26 a extending upwardly from the opposed side edges of base panel 22 a , and join the end wall 23 a to form a coffer - like protected space 30 a . the panels are provided with reinforcing ribs 27 a and lightening holes 28 a as described previously , as are well known in the prior art . further , the upper panel edges are provided with a tubular lip 29 a extending along the upper distal edges of the panels 23 a , 24 a , and 26 a . the safety bar 41 and the mounting brackets 44 are provided as described previously . in this embodiment , the frame components are not integrally formed ; rather , the fabric cover 31 encloses the frame components and secures then in an assembly that provides protection for the infant resting within the infant bed . the fabric cover 31 includes a portion that spans the distal ends of the side panels and the base panel , and so forms an end wall at the foot of the bed . this foot end wall completes the enclosure of the coffer - like space 30 a and secures the infant within the bed . furthermore , the tubular lip 29 a of the head end wall 23 a includes opposite end portions that curve approximately 90 ยฐ to align with the tubular lip portions of the adjacent side panels 24 a and 26 a . indeed , as shown in fig7 , the adjacent tubular lip portions of the side panels and head end wall are disposed to interlock when the panels are assembled , thereby to secure the components and augment the vertical load - bearing strength of the frame assembly . the fabric cover 31 may be joined together with straps ( including velcro or snap fasteners ) or zippers or the like , as shown in fig4 , so that the frame components are joined to act cooperatively in a structure that is very resistant to vertical loads or lateral loads that might otherwise be imparted by the adults sleeping adjacent to the infant bed of the invention . the fabric cover may be opened and separated from the frame components for laundering , or for transporting the infant bed in a knock - down disposition . with regard to fig8 and 9 , a further embodiment of the invention provides a frame structure 21 b that includes a rectangular base panel 22 b and a separate head end wall 23 b extending upwardly from the head edge of the panel 22 b . a pair of separate side panels 24 b and 26 b extending upwardly from the opposed side edges of base panel 22 b , and join the end wall 23 b to form a coffer - like protected space 30 b . the panels are provided with reinforcing ribs 27 b and lightening holes 28 b as described previously , as are well known in the prior art . further , the upper panel edges are provided with a tubular lip 29 b extending along the upper distal edges of the panels 23 b , 24 b , and 26 b . the safety bar 41 and the mounting brackets 44 are provided as described previously . in this embodiment , the frame components are not completely integrally formed ; rather , the side panels 24 b and 26 b are foreshortened , and separate side panel extensions 24 b โฒ and 26 b โฒ are provided . the side panel extensions are joined to the remaining integral frame structure by any of the methods and structures shown herein . for example , as described before , a fabric cover 31 may be fashioned to enclose the frame components and secure then in an assembly that provides protection and comfort for the infant resting within the infant bed . the integrally formed head end wall , base panel , and foreshortened side panels 24 b and 26 b combine to form a strong structure that is highly resistant to lateral compression and vertical loads , and will protect the infant very well . note also that the mounting brackets 44 extend from the side panels 24 b and 26 b , and the safety bar 41 is secured thereto to further protect the infant . the separate panel extensions 24 b โฒ and 26 b โฒ permit some yielding of the sides of the infant bed in the area of the legs and feet of the infant , a location that poses far less threat of injury to the infant . referring to fig1 and 11 , a further embodiment of the invention provides a frame structure 21 b that is very similar to the embodiment of fig8 and 9 , and is accorded the same reference numerals for the same components . in this embodiment , the side panel extensions 24 b โฒ and 26 b โฒ are secured with hinges 61 to the distal side edges of the base panel 22 b . in particular , each side panel extension is provided at its lower edge with at least one hinge component consisting of a separable male hinge half , and each distal edge of the base panel 22 b is provided with at least one hinge component consisting of the separable complementary female hinge component , so that the hinge components may be joined as the confronting edges of the side panel extensions and the base panel are translated together ( fig1 ). the hinged connections enable the side panel extensions to be deflected somewhat by the imposition of lateral force or vertical loads , but the structural effect of the fabric cover secures the side panel extensions in place without collapsing or otherwise threatening the well - being of the infant in repose in the bed . once again the portion of the fabric cover 31 that spans the distal ends of the side panel extensions and base panel defines a foot end wall that secures the infant within the confines of the infant bed . a further embodiment of this concept is depicted in fig1 , including a frame structure 21 b that is very similar to the embodiment of fig8 - 11 , and is once again accorded the same reference numerals for the same components . in this embodiment the side panels 24 b and 26 b are foreshortened , and the side panel extensions 24 b โฒ and 26 b โฒ are designed to slidably extend from their respective side panels . the tubular lips at the upper edges of each side panel and side panel extension are formed to be slidably telescoped together ( fig1 ), whereby the extension may be slidably moved toward the distal end of the base panel . in addition , the lower edge of each side panel extension is provided with at least one edge clamp fitting 71 ( fig1 ) that is adapted to resiliently clamp onto any portion of the side edge of base panel 22 b . thus each side panel extension may be disposed at any position along the respective side edge of the base panel . thus , for example , when the infant is newborn and rather small , the side panel extensions are disposed proximally , which reinforces the upper area where the infant is located . as the child grows , and more space is required , the side panel extensions may be moved distally , increasing the effective length of the sides and increasing the volume of the protected space 30 b . eventually , the side panel extensions may be fully extended , as shown in fig1 to maximize the capacity of the infant bed . a further embodiment 21 c of the infant bed , shown in fig1 , is notable for the base panel 22 c sloping upwardly between side panels 24 c and 26 c , with head end wall 23 c joining the ends of the side panels and base panel . the slope of the base panel maintains the head of the sleeping infant in an elevated condition , which may be desired to facilitate unimpeded breathing by the infant . the side panels are foreshortened as in previous embodiments , and the side panel extensions are eliminated . the lower edges of the side panels and end wall are disposed in a common nominal plane to engage a supporting flat surface in a stable manner . the safety bar 41 and mounting brackets 44 are provided substantially as described previously to protect the head area of the infant . it should be emphasized that all of the embodiments of frame structures shown herein may be used advantageously with a fabric cover assembly that also supports other features such as pads , mattress , foot end wall , and the like . thus the present invention provides an infant bed that is designed to enhance the safety and protection of the infant , so that it may be used in a co - sleeping arrangement . the strong frame structure , the safety bar , and the fabric cover combine to produce a superior infant bed construction . the foregoing description of the preferred embodiments of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and many modifications and variations are possible in light of the above teaching without deviating from the spirit and the scope of the invention . the embodiment described is selected to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as suited to the particular purpose contemplated . it is intended that the scope of the invention be defined by the claims appended hereto .
| 0 |
with reference to the drawings , the reference numeral 10 refers generally to a pouch which consists of a first panel 12 and a second panel 14 arranged in a face - to - face relationship and bonded to one another at an interface thereof along seal lines 16a , 16b and 16c . the seal lines 16a , 16b and 16c represents the bonded areas of the two panels and are hereinafter collectively identified by the reference numeral 16 . the unbonded area located within the bonded areas 16 serves to form an article receiving pouch 18 . it will be understood that the pouch may be in a form of a plastic bag or any other article receiving container and , as will be described hereinafter , the sealing method of the present invention may be used to secure webs at localized areas for the production of a wide range of items not necessarily in the form of pouches or containers . with reference to fig2 of the drawings , it will be seen that a first web 22 and a second web 24 are guided into a face - to - face overlying relationship with respect to one another between a pair of rollers 26 and 28 . the webs 22 and 24 may be made from a material which is bondable when subjected to electron radiation or from material which is non - bondable when subjected to electron radiation . in either case , a coating is applied to at least one surface of one web so that the bonding characteristics of the coated area of the web are opposite to those of the non - coated area . the coating may serve to make the coated area bondable or it may serve as a screen or resist coating to make an otherwise bondable material non - bondable . examples of a suitable non - bondable web are paper , aluminum foil and cellophane . examples of a suitable bondable material available in web form are polyethylene and polypropylene which are capable of forming a fusion bond but which are more efficiently bondable using e . b . curable adhesive . typical e . b . bondable pouch and bag flexible packaging single ply web materials are : ______________________________________web density thicknessmaterials llbs / cu . inch inches______________________________________paper 0 . 031 0 . 001 - 0 . 004cellulose film 0 . 051 & lt ; 0 . 001 - 0 . 002polyethylene ( pe ) 0 . 033 & lt ; 0 . 001 - 0 . 004polypropylene ( pp ) 0 . 032 & lt ; 0 . 001 - 0 . 002polyester ( pet ) 0 . 050 & lt ; 0 . 001 - 0 . 002polyamide ( nylon , pa ) 0 . 041 & lt ; 0 . 001 - 0 . 004polyvinyldiene chloride ( pvdc ) 0 . 036 & lt ; 0 . 001 - 0 . 003aluminum foil ( al ) 0 . 097 & lt ; 0 . 001 - 0 . 002______________________________________ some of the above webs to form a secure bond with the e . b . adhesive , e . g . polyethylene , require a corona discharge surface treatment which can be done in line up stream of the e . b . adhesive applicator units . single webs are also used in multiply form as laminated , coextruded or coated webs . a typical coated web is , pvdc / paper . typical multiply webs , to a maximum 0 . 008 &# 34 ; thickness are : pe / paper , pe / cellulose film , pe / pp , al / paper , pe / pa , paper / pe / al , pe / pet , pa / al / pe , paper / pe / al / pe , pet / al / pp , pet / pvdc / pp . such webs , single ply or multiply , can be electron radiation pattern bonded in eb 100 % reactive and curable adhesive with adhesive laydown weights of 2 to 3 lbs . per 3000 square foot ream and an electron beam radiation dose of 2 to 3 megarads , which penetrates the top web and depth of adhesive to instantly cure the e . b . adhesive patterns which bond the pouch or bag walls together in their predetermined seal patterns . electron penetration is a function of the &# 34 ; electrocurtain &# 34 ;โข controlled electron acceleration voltage , 300 kv max , and the density of materials . dose is a function of the &# 34 ; electrocurtain &# 34 ;โข controlled current output in milliamperes per inch of web width and the web speed . e . b . curable adhesives and coatings , suitable for forming a bond are available from a number of suppliers such as sun chemical co ., polymer industries , rad - cure corporation , dow corning corporation and celanese chemical company . relatively recent developments have produced 100 % reactive adhesives and coatings of various monomers and oligomers designed for viscosities ( below 200 centipoise ) suitable for rotogravure application and polymerization or curing by electron beam , radiation . a variety of suitable e . b . curable adhesives are known to those skilled in the art . coating materials suitable for e . b . radiation screening purposes are metallic or high denisty coatings having substantial resistance to e . b . transmission , and may be applied by rotogravure process to provide variations in pouch and bag making fusion seals . with reference to fig2 of the drawings , three alternative methods of coating are illustrated at areas a , b and c , respectively . in area a the coating 30 is a coating of bondable material ; in area b the coating 32 is a coating of non - bondable material , and in area c the coating 32 is again a coating of non - bondable material . the coating in area a and area b are applied by either of the rotogravure printing cylinders 34 and 35 ( fig4 ) and the coating in area c is applied by a rotogravure printing cylinder 36 ( fig4 ). the coating applied in area a is applied to a first surface 38 of the first web 22 which is located at the interface between webs 22 and 24 when the webs are brought together between rollers 26 and 28 . the coating at area b is applied to a lower surface 39 of web 24 which is again located at the interface of web 22 and 24 when the webs are brought together . the coating 32 applied in area c is applied to an upper surface 40 of web 24 . when bondable coating is applied as indicated in area a , it is applied to an interface surface in a pattern corresponding to the seal line 16a , 16b and 16c . this pattern is applied by the rotogravure printing device with a plurality of printed areas arranged side by side and closely following one another on the surface 38 . the web 22 with the pattern of area a applied thereto at longitudinal intervals along the length thereof is located in a face - to - face relationship with the web 24 between the rollers 26 and 28 . it will be noted that it is only necessary to apply a pattern as e . b . curable material to one of the webs so that there is no difficulty in aligning the webs 22 and 24 . the webs then pass through a radiation curing device 42 which activates the bondable coating 30 to form a bond at the coated interface . the web is then slit longitudinally along slit lines 44 and cut off along transverse lines 46 to sever the individual pouches 10 from the continous web . when the webs are made from bondable material and the coating is a screening material as illustrated in section b , the coating is again applied by the rotogravure cylinders 34 or 36 and the webs 22 and 24 are located in a face - to - face relationship between rollers 26 and 28 and the composite web is driven through the radiation curtain of the electron beam emitting device 42 . in this instance , the coating 32 screens the areas of the interface to which it is applied so that fusion bonding can only occur at the unscreened portions of the interface . a screen coating may be applied by the rotogravure 36 to the upper surface of the upper web 24 in order to prevent bonding of otherwise bondable webs as previously described . when the rotogravure cylinder 36 ( fig4 ) is used , it is not necessary to use the rotogravure cylinder 34 and it is not necessary to apply any coating to the interface . this method results in a pouch or bag with no coating or adhesive on the pouch or bag interior surfaces which coatings or adhesives or their components can contact or migrate into the subsequent pouch or bag contents when the contents are degradeable by the coating or adhesive or components thereof . it will , of course , be understood that when the rotogravure cylinder 34 is used to apply a coating to the interface , it is not necessary to apply a coating to the upper face of web 24 . when the coating is applied to the upper face of the web 24 , as shown at c in fig2 it may be applied after the webs 22 and 24 are located in a face - to - face relationship . it will , however , be understood that the coating may be also applied before the webs are located in a face - to - face relationship . the coating serves to screen or mask the otherwise bondable areas of the webs at the sealing interface as the web moves through the radiation curtain so that bonding occurs only at the unscreened interface and the pouch is made with no coating or adhesive on either of the pouch interior surfaces adjacent to the contents of the pouch . again , the web may be slit and cut - off as previously described . several forms of a suitable apparatus for high speed pouch and bag making are illustrated in fig4 of the drawings . a simple pouch machine is illustrated in area d of fig4 and a multi - colour printing machine is illustrated at area e in line with the high speed pouch and bag making machine . with reference to fig4 the reference numeral 50 refers generally to a high speed pouch and bag making machine according to one embodiment of the present invention and the reference numeral 52 refers generally to a multi - colour printing machine . the high speed pouch and bag making machine includes a first unwinding reel 54 and a second unwinding reel 56 . the web 22 is unwound from a roll of material supported on the first unwinding reel 54 and the web 24 is unwound from the roll of web material supported on the second unwinding reel 56 . a pair of pull rollers 58 pull the web 22 off reel 54 and a pair of pull rollers 60 pull the web 22 off reel 54 and a pair of pull rollers 60 pull the web 24 off reel 56 . a rotogravure cylinder 34 of a rotogravure printing device 62 applies an adhesive of the type previously described , as being applied to area a of the web 22 ( fig2 ). the webs 22 and 24 are brought together at rollers 26 and 28 with the adhesive applied to the interface . the webs 22 and 24 pass through an electron beam radiation device 42 in which a bond is formed at the interface as previously described . the bonded webs are then longitudinally slit by slitting cutters 64 and transversely cut off by rotary knife 66 . the individual products are then stacked by means of a stacker mechanism generally identified by the reference numeral 68 . as previously indicated , the high speed of operation of the &# 34 ; electrocurtain &# 34 ; electron beam radiation device is compatible with the speed of operation of a multi - colour printing press . consequently , a multi - colour printing press may be arranged in line with the high speed pouch and bag machine previously described , in which case the web 24 is unwound from a reel 70 through any required number of printing press colour units 72 before being directed to rotogravure cylinder 35 or 36 ( fig4 ) depending upon whether the coating is to be an e . b . curable adhesive or a resist coating . when the process of the present invention is to be combined with a multi - colour printing operation , it is desirable to apply the e . b . curable adhesive or the resist coating to the same web to which the printing is applied so that accurate registration of the printed material and the coating may be achieved with ease . in fig4 of the drawings , two rotogravure printing units 35 and 36 are provided for use in applying the coating of the present invention . when the coating is to be applied to a surface , of a printed web , which will ultimately be located at the interface , it is applied by the rotogravure cylinder 35 . when the coating is to be applied to a surface of a printed web , which will ultimately form an upper surface of the webs when they are brought together , it is applied by the rotogravure cylinder 36 . the rotogravure printing unti 35 complete with a dryer may be used to apply a resist coating or an eb curable adhesive , the dryer being necessary only for the resist coating . the rotogravure printing unit 36 complete with a dryer is required only when a resist coating is required on an outside face of a printed or plain ( unprinted ) pouch or bag . should the resist coating interfere with the printing then the standard reverse mode of the printing press colour units is employed via web path 72r and the resist coating applied to web 22 from unwind 56 via web path 22b and the resist coating on web 22 is adjacent to the incident eb radiation when webs 22 and 24 are extended from rollers 26 and 28 . when the rotogravure cylinder 35 is used to apply a coating to a face which will ultimately be located at the interface , unwind 56 supplies web 22 which is extended into contact with the coated side of web 24 via web path 22a prior to the coated side of web 24 contacting web rolls and to ensure that the coated face is located at the interface when the webs 22 and 24 are directed to the rollers 26 and 28 . as will be described hereinafter with reference to fig6 to 11 the pouch may be made from a single web of plastic material which is folded upon itself . in the embodiment illustrated in fig4 the method is achieved by passing the web through a suitable web folding device 25 and then directing the web to the radiation curing device 42 . the folding device may be any suitable folding former capable of making the folds required in fig6 to 11 or the like . from the foregoing it will be apparent that the present invention provides a simple and efficient method of high speed pouch and bag making which is readily applicable to the manufacture of products made from roll stock and secured along spaced seam lines . the method and apparatus is capable of operating at high speeds comparable to those of colour printing press units so that the apparatus may be located in line with a multi - colour printing press . a rotogravure printing device is particularly suitable for use in applying the coating to the interface . as is common practice with a rotogravure printing device , the lay down weight of the coating may be determined by the controlled micron engraving depth of the printing roller and as applied to the coating of a bondable material in the present invention , the lay down weight may be such that the bond which is achieved is permanent or peelable . in addition , local areas of the lay down pattern can be of a different lay down weight to that of other areas so that the bond may be permanent in such areas and peelable in other areas , a peelable bond being provided in areas where easy opening of a package may be required with a permanent bond being provided in other areas where a peelable bond must be avoided . as diagrammatically illustrated in fig5 of the drawings , the composite web which is directed through the e . b . radiation device 42 may consist of layers 80 , 82 , 84 and 86 having interfaces 88 , 90 and 92 . e . b . radiation curable coatings 88a , 90a and 92a may be applied to the interfaces 88 , 90 and 92 respectively , so that the coated portions of the various interfaces are simultaneously bonded on passage through the e . b radiation device , while the uncoated portions remain unbonded thus , it will be seen that the present invention provides a method whereby selective interface sealing of a multiple stack of interfaces may be achieved . it will be noted in some instances , the coated areas of one layer overlap the coated areas of another layer , this , however , does not prevent the bonding of the interfaces at both levels . a practical example of selective interface coating of a multi - layer web is described hereinafter as applied to the high speed manufacture of a square bottom bag . with reference to fig6 of the drawings , the reference numeral 100 refers generally to a web of material suitable for use in the manufacture of bags such as coffee bags , air sickness bags and the like . the web may be a web of paper or plastic material or the like . the web is directed through a rotogravure printing device 102 and a coating of e . b . curable adhesive is applied by rotogravure cylinder 104 . for the purposes of describing the pattern in which the e . b . curable coating is applied , the gusset fold lines along which the web 100 is subsequently folded are illustrated in broken lines . the gusset fold lines include central gusset fold lines 106 bounded on either side by outer gusset fold lines 108 . the e . b . curable coating is applied to a marginal edge portion 110 which extends continuously along one free edge of the web 100 as will be described hereinafter the coating which is applied to the marginal edge portion 110 is subsequently used to provide a longitudinal seal when the web is folded upon itself to form a tubular sleeve . the bottom wall portion of each bag which is to be formed from the web is a portion located between the broken lines 112 and 114 which extend transversely of the web 100 . the rotogravure cylinder 104 applies an e . b curable adhesive to the portion 116 . it will be noted that the e . b . curable portion includes a narrow band extending across the width of the bottom wall former portion in the area of the lower edge 112 and triangular shaped portions 118 projecting upwardly therefrom to the intersection of the gusset fold lines 108 and the bottom fold line 114 . it will be noted that an uncoated triangular shaped portion 120 projects downwardly between the triangular portions 118 . fig7 of the drawings shows the web of fig6 in a partially folded configuration . it will be noted that the central gusset fold line 106 is disposed inwardly from the gusset fold lines 108 . the manner in which the multiple interfaces are formed will be apparent with the reference to fig7 of the drawings which also illustrates the location of the various coated portions at preliminary folding . the folding of the web is completed in the relationship indicated in fig7 until the oppositely disposed faces are in intimate contact with one another whereupon the web is directed through an e . b . radiation device as illustrated in fig8 of the drawings . the e . b . radiation device causes curing of the e . b . curable material as the web passes therethrough so that a permanent bond is formed at each of the e . b . curable coated interfaces while the uncoated interfaces remain unbonded . after e . b . radiation the individual bags are cut from the continuous web by severing along the line spaced below the level of the transverse coating 112 so that the bag is preferably cut along an unsealed area so that in forming the transverse cut , the open end of the bag is formed . referring back to fig7 of the drawings , it will be noted that the uncoated triangular areas 120 are located between the coated areas 118 . as previously indicated with reference to fig5 of the drawings , e . b . radiation of this structure will provide a bond at the coated areas while leaving the uncoated areas unbonded . the unbonded triangular portions 120 are important when it comes to the erection of the bag to form a square bottom . the unbonded portions 120 in combination with the bonded portions 118 cause the bottom wall forming portions of the bag to articulate along the boundary lines 124 and transverse hinge line 114 to form a square bottom bag . fig9 a shows an interim stage in the erection of a bag in which it will be seen that the out gusset fold lines 108 extend across the bottom of the bag and the coated portions 118 on either side thereof are bonded together to form a double thickness . the uncoated triangular area 120 being free from attachment with respect to the remainder of the bottom wall so as to permit articulation of the various panels to the required square bottom configuration . various other printing devices may be used for applying the required coating to the web . for example , the coating may be applied by flexographic or letter press printing systems with various degrees of efficiency . as previously indicated while the present invention is particularly suitable for use in the high speed manufacture of pouches or bags or the like , the method and apparatus may be used for the manufacture of any number of pattern bonded structures . for example , in fig3 of the drawings , a tinted coating is applied in the form of a pattern 90 to one transparent web so that after radiation bonding the coated area is bonded while the adjacent areas of the web are unbonded . as a result the bonded areas become clearly visible . the pattern 90 may be in the form of a date , code , trade mark or advertising material . when a pouch or the like is to be manufactured as described in fig1 and 2 , the pattern 90 may be in the form of a continuous script extending around the area which will form the seal lines 16a , 16b and 16c of the pouch of fig1 . thus it will be seen that in the forming of a seal line , the pattern established by the pattern bonding may itself be used to convey a message relating to the package or its contents . fig7 a illustrates the manner in which a satchel type squared bottom bag can be made by the application of an e . b . bondable coating to selected portions thereof . in this embodiment a web is folded along longitudinal extending fold lines 113 and 115 in order to form an inwardly directed gusset . by the application of a bondable coating in the manner previously described an e . b . bondable coating is applied to the areas 117 and to the triangular shaped area 119 and circular areas 123 at corner 121 . it will be noted that in the corner 121 , the bondable coating is applied to each of circular areas 123 while in the coated area 119 the bondable coating is applied to the triangular corner section with circular areas 121a being free of bondable coating . it will be understood that a pattern of e . b . bondable material will be applied to each corner forming portion of the web . thus , when the web is folded to locate the inner faces in a face - to - face relationship and the web is passed through the e . b . radiation device , a bond is formed about the periphery of the bag forming portion of the web and thereafter the web is served along the line 125 to separate one bag from the web . it will be noted that the uncoated areas 121a will be located directly opposite the coated areas 123 when the web is folded to a lay - flat configuration prior to e . b . radiation . similarly it will be noted that the uncoated area at corner 121 will be located directly opposite the coated area 119 . thus , the radiation is able to pass substantially unrestricted through the uncoated areas to the underlying coated areas so that a bond of substantially the same strength may be formed at the coated areas of each interface without requiring any substantially greater power than that required to form the required bond at one interface . in this embodiment , the uncoated areas serve to permit the substantially free passage of the e . b . radiation therethrough . thus , it will be seen that the method of pattern bonding may be such as to provide a discontinuous coating at one interface so that the radiation may pass therethrough to form a bond at an underlying coated interface . fig1 , 10a and 10b , illustrate a further pattern suitable for use in the manufacture of a satchel type square bottom bag . in this embodiment , the bondable coating is applied in the manner previously described to a web 200 along transversely extending longitudinally spaced areas 202 . each area 202 consists of a longitudianl seam forming portion 204 and a pair of generally diamond shaped corner portions 206 . the diamond shaped portions 206 are centered on fold lines 213 and meet one another at the gusset fold line 215 . as shown in fig1 , the web 200 is initially folded along the gusset fold line 215 and as shown in fig1 a the web is subsequently folded along the fold lines 213 to locate the gusset fold line 215 inwardly thereof . the web is irradiated when in the folded position shown in fig1 b to bond the bondable areas and the web is cut along the transverse cut line 216 which extends centrally of the width of the coated areas 202 . the bag formed by this method is illustrated in fig1 of the drawings . a pouch , such as a retort pouch , may be made by the method of the present invention in which one or more of the webs is formed from a laminate consisting of polyester , aluminum foil , and polypropylene ( pet / al / pp ) or pet / pvdc / pp . with specific reference to fig1 - 16 , two alternate embodiments of the present invention are described in greater detail . with reference to fig1 , a modern six color central impression flexographic printing press 300 is shown as being in line with the electron radiation pouch and bag making machine 301 in an arrangement such that the printing press may operate either in line with the radiation pouch and bag making machine or in its normal roll to roll mode . also , by providing a roll unwind unit the pouch and bag making machine can operate separately from the printing press . however , the in line arrangement disclosed is ideal for the manufacturing of flat printed pouches and flat printed bags with the front panel printing in register to the back panel printing and to the cut off line of the pouch or bag top opening . the method and apparatus disclosed in fig1 is designed to operate on a continuous single web from the flexographic printing press with the flow of the single web material being shown in fig1 . as disclosed in fig1 , a single web 302 is printed while continously flowing through the in line arrangement of the printing press and the bag or pouch forming and curing machine . once a web flowing through an adhesive applying bag making machine exceeds approximately 36 &# 34 ; in web width , it becomes difficult to fold the web in half without smearing adhesive patterns and it also becomes difficult to accurately control the lateral position of the running fold line depending on the web machinability , stiff multiple laminations varying to flimsy 0 . 001 &# 34 ; polyfilm . to overcome these problems of applied fluid e . b . adhesive patterns and subsquent wide web folding , without smearing the applied adhesive patterns , the web folding per se has been eliminated in the embodiment shown in fig1 - 14 . in the apparatus shown in fig1 , the single web material 302 is conducted from a supply roll 303 to the printing press 300 wherein a single or multiples of colors and indicia may be printed on the upper surface of the material . the ink applied to the material is thereafter dried by passing through drying chamber 304 after which the material is pulled through a pair of pull rolls 305 . as will be seen from fig1 , the material arriving at the pull rolls 305 is a single width of web material which has printing applied across the entire upper face thereof as is necessary . after the material leaves the pull rolls 305 , it passes through a slitter assembly 306 wherein the web is slit or cut into equal width longitudinal sections or first and second webs 302 &# 39 ; and 302 &# 34 ;. the web 302 &# 34 ; which is to form the back panel of a bag or pouch is conveyed through a web turn over , alignment and collating device 308 and print register compensator device 307 where the web is collated under the other web 302 &# 39 ; which will form the front panel of the bag or pouch . the front panel web 302 &# 39 ; passes through a rotogravure adhesive applicator 309 wherein a 100 % e . b . reactive and curable adhesive is applied to the lower surface of the web . the adhesive pattern applied to the lower surface of the upper web 302 &# 39 ; is applied so as to be in register to the printing on the upper surface of the web while the outer surface of the lower web 302 &# 34 ; is being brought into register with the upper web printing by the compensator device 307 . after the 100 % e . b . adhesive has been applied to the upper web , the upper and lower webs are brought together through a pair of combining rollers 310 so that the pattern of adhesive is sandwiched between the upper and lower webs . the two webs which are combined are thereafter passed through an electron radiation device 311 , such as the &# 34 ; electrocurtain &# 34 ; wherein the adhesive pattern previously described , is subjected to instantaneous curing by the free radical initiating electron radiation emitted from the device . once the adhesive pattern between the webs has been cured , the combined webs are ready to be slit into separate streams of pouches prior to cut off of single pouches or perforated laterally and wound into rolls of pouches which are connected by preforated ( tear off ) connections between the opening of one pouch or bag and the sealed lower edge of the adjacent pouch or bag by by - passing the cutting and stacking assembly 312 to enter a roll rewind unit . as shown in fig1 , the radiation pouch and bag machine 301 is working with web widths which are nominally only one half of the widths of the web passing through the printing press . therefore , an &# 34 ; electrocurtain &# 34 ; for creating a 48 &# 34 ; long radiation zone within the radiation curing unit 311 need only be 48 &# 34 ; long in order to accomodate a printed web of up to 96 &# 34 ; wide to produce multi - streams of pouches or bags that are printed on both sides . by way of example , two streams of department store flat printed bags , size 18 &# 34 ; wide by 30 &# 34 ; deep , are produced from a single 72 &# 34 ; wide web of 0 . 001 &# 34 ; gage polypropylene or high density polyethylene printed at web speeds of up to and exceeding 600 &# 39 ; per minute for an output of 480 bags per minute in a one pass operation . for another example , four streams of similar department store bags but in dimension 9 &# 34 ; by 18 &# 34 ;, produced from the same 72 &# 34 ; web material under the same conditions will result in an output of 1600 bags per minute in a one pass operation . the bags may be delivered in rolls by the use of a transverse web perforated in lieu of the cut off knife and a roll rewind unit at the cutting and stacking station 312 . with reference to fig1 a and 14 - 16 of the drawings , an apparatus for forming printed square bottom bags 350 in which the bags include side gussets 351 each having a center fold fin seam 352 turned inside the bag and a bottom fin seam 352 &# 39 ; extending transverse to and between the sides of the bags . fig1 illustrates such a gusset fin seam square bottom bag with a straight cut top opening 353 whereas fig1 illustrates a gusset fin seam square bottom bag 354 having two carrying handles 355 integrally formed with a top opening . the bag disclosed in fig1 when made with a 0 . 00075 &# 34 ; gage polyethylene makes a typical &# 34 ; t - shirt &# 34 ; grocery bag . fig1 illustrates the web development from a flat single web into the side gusset center fin seam square bottom bag disclosed in fig1 and 16 . the apparatus shown in fig1 a is generally similar to the apparatus shown in fig1 with the exception that in order to form the side gussets in the square bottom bags , the web path is modified so as to include an e . b . adhesive applicator which applies the e . b . adhesive to the bottom inside gusset fold by providing four triangular seal patterns across the full web width and in register to the printing on the opposite side of the web . in this embodiment , the single web material 302 which has been printed in the press 300 is fed from the pull rolls 305 to a full web width e . b . adhesive applicator 320 wherein triangular seal patterns are printed on the bottom surface of the web material as is shown in dotted line at 321 in fig1 . thereafter , the single web material is introduced into a web slitter 322 which severs the web longitudinally into first and second web sections 302 &# 39 ; and 302 &# 34 ;. the severed web sections are thereafter passed through a gusset fold over device 323 wherein the opposite edges of each of the first and second web sections which form the top and bottom panels of a bag to be formed are folded as is illustrated in fig1 and 14a . after the first and second web sections have been folded along their edges so as to enclose the e . b . adhesive triangular gusset seal patterns under the half gusset fold , the first web section 302 &# 39 ; forming the front panel of the bag or pouch to be assembled enters into the e . b . adhesive applicator 309 which is similar to that disclosed in fig1 wherein the e . b . adhesive is applied to the under surface of the web section so that the e . b . adhesive is applied to the two longitudinal side gusset fin seal areas of the bag and along the bottom of the bag , 356 in fig1 , transverse to the seal patterns along the longitudinal sides . the back panel formed by the second web section 302 &# 34 ; passes from the separating roller 324 into the web turnover and lateral web alignment or web collating device 308 wherein the second web is turned over and moved laterally and brought into underlying relationship with the first web section as is illustrated in fig1 . the underlying web thereafter passes through a print register compensating device 307 from which the back or underlying web stream exits in proper underlying relationship with the printing in register to the printing on the upper web prior to the webs being combined by combining rollers 310 . after the webs have been brought into register and combined with one another so that the e . b . curable adhesive is now interfaced between the upper and lower web sections , the combined web is passed through the electron radiation chamber 311 wherein the e . b . adhesive seal patterns are cured at 3 strata levels ( these being the upper and lower bottom inside gusset seals , the longitudinal gusset fin seals and the top inside gusset seals ). the radiation multi - layered pattern bonded web then enters the rotary cut off unit 312 which severs the bags into individual square bottom bags at a cut off line disposed outwardly from the bag bottom tranverse seal line and thereafter delivers the open mouth square bottom bags in their folded flat attitude to the stacking and delivery conveyor . the width of the adhesive seal patterns applied in the embodiments of the invention shown in fig1 and 12a are generally similar to those discussed above with respect to the other embodiments of the invention with the maximum being approximately one quarter of an inch in width along any given side or bottom seal line . with the embodiment of fig1 , the bag bottom transverse seal is made at least double the normal one quarter inch width to provide a top bag seal and a bottom bag seal by making individual bag cut off lines across the transverse center line of the wide seal . in this manner , square bottom bags are created which are sealed across the top and bottom . thereafter , in order to create the &# 34 ; t - shirt &# 34 ; square bottom bag 354 shown in fig1 , in a separate off line operation , the top sealed end of the bag is cut with a deep rectangular center section being removed in order to provide the two integral bag side extensions which are each approximately 2 &# 34 ; wide and extend upwardly about 6 &# 34 ; from the center cut bag opening . these extensions form the two carrying handles 355 of the bag as shown in fig1 . utilizing the processes disclosed with respect to fig1 and 12a , it is noted that a single width of thin heat sealable films may be used wherein the films are initially printed along their entire width and thereafter the web or films severed and re - oriented so that the printed half sections or webs of the film are in opposing relationship with a 100 % e . b . adhesive pattern being applied between the two webs after which the webs are instantaneously bonded by passing through an electron radiation unit . speeds at which the bags of the present embodiment of the invention may be made are well in excess of those of conventional pouch and bag making machines with web speeds of up to 600 &# 39 ; per minute being obtainable while forming a plurality of bags or pouches from a single web of material . various modifications of the present invention will be apparent to those skilled in the art . for example , it will be apparent that the method of the present invention permits the production of a pouch from webs which are in the form of laminates in which one or more of the webs consists of a laminate of a heat sealable plastic material and an aluminum foil or a heat sealable plastic material and paper or the like . it will also be apparent that the method of the present invention permits a seal to be formed between the bondable webs at temperatures below the heat sealing temperature of the thermoplastic film used to form one or other of the webs . the method of the present invention also permits the production of a pouch in which the seal areas which are coated with bondable material constitute up to 50 % of the total pouch face area . preferably , each web from which the pouch is made has a thickness which does not exceed 0 . 008 &# 34 ;.
| 1 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . fig1 and 2 were explained at length in the introduction , so no further description will be provided at this point . a first embodiment variant of the proposals is explained in more detail with reference to fig3 . fig3 shows an image b made up of 352 ร 288 pixels . pixels are organized therein into image blocks bb , for example at a size of 4 ร 4 pixels . each of the pixels has an image value in each case representing a chrominance value and / or a luminance value , for example in the form of an 8 - bit resolution . each square within the image block bb represents a pixel , such as for example a first pixel , bp 1 and an associated first image value w 1 . for this discussion it is assumed that the image value has a position within the pixel designated by the square , for example a point at which diagonals of the square intersect . fig3 further shows a hatched area containing reconstructed pixels br 1 , br 2 and the associated second pixel values w 21 , w 22 . the reconstructed pixels were coded at an early point in time and are available in their decoded , i . e . reconstructed form , for the purpose of forming the prediction value . in a first step at least two trajectories t 0 , t 1 , t 2 , t 3 , t 4 are formed . in the first exemplary embodiment said trajectories are drawn as quadrants and so do not represent a straight line . an image value along the respective trajectory corresponds to a respective third image value w 31 , w 32 . in the present exemplary embodiment the respective trajectory starts in the second image value which corresponds exactly to the third image value of the respective trajectory . in a second step two auxiliary trajectories ht 1 , ht 2 are determined from the set of available trajectories t 0 , t 1 , t 2 , t 3 , t 4 in such a way that a respective distance a 1 , a 2 between the auxiliary trajectory ht 1 , ht 2 that is to be determined and the position p 1 of the first image value w 1 is minimal , i . e . constitutes a shortest distance in each case . in the present exemplary embodiment the trajectories t 1 and t 2 are the nearest neighbors to the first pixel , such that ht 1 = t 1 and ht 2 = t 2 . fig3 shows the respective distance a 2 of the trajectory t 2 from the position t 1 and a 1 of the trajectory t 1 between trajectory t 1 and position p 1 . since this is the shortest distance , the distance of the respective trajectory forms a 90 ยฐ angle to the position p 1 . in a following step the prediction value prw is formed by weighted averaging of the third image values w 31 , w 32 of the two auxiliary trajectories ht 1 = t 1 , ht 2 = t 2 taking into account the associated distances a 1 , a 2 , as follows : an extension of the proposals is described with the aid of fig4 . fig4 shows a detail from fig3 with the auxiliary trajectories ht 1 and ht 2 , as well as the first image value w 1 and the position p 1 . first the prediction value is formed , as explained with reference to fig3 . the prediction value prw corresponds to a weighted averaging of the third image values w 31 , w 32 of the trajectories t 1 , t 2 . in a further step a new trajectory t 5 , referred to in the following as t 5 , is now generated between the existing trajectories t 1 and t 2 . the new trajectory t 5 runs at least through the first image value w 1 at the position p 1 . furthermore the new trajectory t 5 can run between the auxiliary trajectories ht 1 , ht 2 in such a way that at an arbitrary point on the new trajectories a ratio of the shortest distances between the arbitrary point and the two auxiliary trajectories is identical to a ratio of the distances a 1 , a 2 in the first image value . a third image value w 35 of the new trajectory t 5 is equal to the prediction value prw for the first image value . in an alternative embodiment variant hereto a reconstructed image value wr can also be determined for the third image value w 35 of the new trajectory t 5 . for that purpose a differential value can first be formed from the first image value w 1 and the prediction value prw to yield in the following step the differential value is coded in quantized form , for example by a huffmann coding scheme , decoded and inversely quantized . a plurality of differential values can optionally be transformed in addition prior to the quantization and back - transformed after the inverse quantization . finally a reconstructed differential value res โฒ( bp 1 ) results which is different from the differential value res ( bp 1 ). the reconstructed image value wr is then formed into this reconstructed image value is used as the third image value w 35 of the new trajectory t 5 in subsequent formations of a further prediction value , e . g . for bpx , see position c 3 . another exemplary embodiment is explained with reference to fig5 . in this case five trajectories t 0 , t 1 , t 2 , t 3 , t 4 are shown , each of the trajectories having a nonlinear shape . the trajectories start in each case in one of the second image values w 22 and therefore have the second image value w 22 as third image value w 32 . in this example the first pixel bp 1 is located on position c 3 . in fig5 the trajectories were constructed in such a way that they lie precisely on a position of the respective image value . in this case only one auxiliary trajectory ht 2 is determined , for which the distance a 2 is zero . it is of course possible for hybrid shapes to occur in which one or more of the positions do not come to lie on a trajectory or auxiliary trajectory . in the present case the trajectory t 2 is chosen as the auxiliary trajectory ht 2 , because the distance a 2 between the auxiliary trajectory ht 2 and the position of the first image value is zero . thus , the prediction value prw is equal to the third image value w 32 of the trajectory t 2 , said third image value w 32 being equal to the second image value w 22 of the reconstructed pixel br 2 . in a third exemplary embodiment a combination of conventional prediction using straight lines and trajectories that are not straight is explained . in the previous examples predefined prediction patterns were presented in some cases with the aid of the trajectories . in the following example an adaptive intra prediction is described . in this case a prediction is performed one step at a time , wherein after a pass through a prediction a prediction direction for a following prediction can be adaptively adjusted . contrary to the previous representation in fig3 to 5 , a trajectory is now formed by a plurality of arrows which represent a continuous connection . in a first step a first row of first image values ( see associated pixels at the positions b 1 , b 2 , b 3 , b 4 in the coordinate system ) is predicted on the basis of the second image values w 21 , w 22 , w 23 , w 24 of the reconstructed pixels pr 1 , pr 2 , pr 3 , pr 4 lying directly above . in a second step a second row of first image values ( see first pixels at positions c 1 , c 2 , c 3 , c 4 in the coordinate system ) is predicted on the basis of a diagonal prediction direction leading from top left to bottom right . this corresponds for example to the prediction direction 4 from fig1 . this prediction direction is implemented in the second step also for the first image values having first pixels at the positions d 1 and e 1 . in a third and fourth step a downward - directed prediction takes place , marked by the numbers 3 and 4 in fig6 . the trajectory t 1 leads from a 1 , b 1 , c 2 , d 2 to e 2 . the trajectories t 2 and t 3 are formed in an analogous manner thereto . as already mentioned in the introduction with reference to fig2 , a second image value of the reconstructed pixel is used for the prediction in fig6 , for example the second image value w 21 of the reconstructed pixel br 1 in order to generate a prediction value for a first image value at position e 2 . thus , only reconstructed pixels according to the hatched pixels in fig6 are used in this case . analogously to the preceding exemplary embodiments , after the prediction value for the first image value has been determined an associated reconstructed image value wr can be determined and used for the following prediction step . for example , a prediction value is determined for the first image value at the position b 1 . after generation of the associated differential value of the coding and decoding a second image value is generated for the reconstructed pixel at position b 1 . this second image value is then used for determining a prediction value for the first image value at the position c 2 , instead of the second image value of the reconstructed pixel from the position a 1 . this procedure can also be applied analogously for other first pixels requiring to be coded along the respective trajectory . this approach can also find application for other embodiment variants . the embodiment variants described can be implemented and executed with the aid of specific devices , see fig7 . the devices vor have units e 1 , e 2 , e 3 , e 4 , ew which realize and perform individual steps of the embodiment variants . in this case the units can be realized and embodied in software , in hardware and / or in a combination of software and hardware . in such an arrangement the units can run on a processor , in which case individual steps of the method can be stored in a memory and loaded into the processor . the image values , such as the first , second and third image values , and other information relating to the image , as well as further operations for coding and decoding image values can also be stored in the memory . the invention has been described in detail with particular reference to preferred embodiments thereof and examples , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention covered by the claims which may include the phrase โ at least one of a , b and c โ as an alternative expression that means one or more of a , b and c may be used , contrary to the holding in superguide v . directv , 69 uspq2d 1865 ( fed . cir . 2004 ).
| 7 |
fig1 a through fig1 d are cross - sectional views of a device to explain manufacturing methods of a flash eeprom cell according to the invention . in fig1 a , a first tunnel oxide ( 2 ) and a first polysilicon film are sequentially formed on a silicon substrate ( 1 ). the first polysilicon is patterned to define the width and one side of a first floating gate , thereby forming a first polysilicon pattern ( 3 ). a dielectric film spacer ( 4 ) is formed at an etched wall of the firt polysilicon pattern ( 3 ). the first polysilicon pattern ( 3 ) is formed in an active region ( a ) as shown in fig1 . referring to fig1 b , a second tunnel oxide ( 5 ) and a second polysilicon are sequentially formed on the resulting structure after forming the dielectric film spacer ( 4 ), and the second polysilicon is then patterned to define the width and one side of a second floating gate , thereby forming a second polysilicon pattern ( 6 ). and also fig1 b is a cross - sectional view taken along line 2 -- 2 of fig2 . as shown in fig2 the second polysilicon pattern ( 6 ) is formed on the remaining area of the active region ( a ) excepting the region in which the first polysilicon pattern ( 3 ) is formed , wherein one side defined by the second polysilicon pattern ( 6 ) is overlapped with one side defined by the first polysilicon pattern . the first and second polysilicon patterns ( 3 and 6 ) extend to a field region ( b ) to cover the active region ( a ) fully . a dielectric film ( 7 ) and a third polysilicon film are sequentially deposited as shown in fig1 c . in fig1 d , a control gate ( 8a ) is formed by etching the third polysilicon film ( 8 ) using a mask for the control gate ( not shown ). at the same time , the dielectric film ( 7 ), the second polysilicon pattern ( 6 ), the second tunnel oxide ( 5 ), the first polysilicon pattern ( 3 ), and the first tunnel oxide ( 2 ) are sequentially etched by a self - aligning etching method using the mask for the control gate . and then a source and a drain ( 10 and 9 ) are formed in the silicon substrate ( 1 ) by an ion implant process . as illustrated above , by the self - aligning etching method using the mask for the control gate , the other side of the first and the second polysilicon patterns ( 3 and 6 ) are defined to become a first and a second floating gate ( 3a and 6a ) that are adjacent parallelly to the active region ( a ). the advantages of the invention are as follows . as the saturation current of a metal oxide semiconductor ( mos ) transistor is varied with the channel length of it , when effective channel length is altered , the saturation current varies accordingly so that different saturation current levels mighe be used for different logic levles . the present invention is capable of three different output levels . for example , if three ( 3 ) cells are required to get eight ( 8 ) kinds of different outputs in a conventional design , only two ( 2 ) cells are needed to get nine ( 9 ) different outputs according to this invention so that the integration of a device can be greatly increased . reference is now made to fig3 a through fig3 c which show the operation of a flash eeprom cell manufactured as shown above to make use of this technical principle . to program the cell , that is , to store charges in the floating gate , a ground potential is applied to a source ( 10 ) and a drain ( 9 ) and a high voltage of about + 12 voltage is set to a control gate ( 8a ). then a first and a second floating gate ( 3a and 6a ) are simultaneously programmed . in an erasing operation , when the source ( 10 ) and the drain ( 9 ) are set to 5 v and the control gate ( 8a ) is set to - 12 volt , charges stored at the first and the second floating gate ( 3a and 6a ) are extracted by tunneling , as shown in fig3 c . to program only one floating gate of the first or the second floating gate ( 3a and 6a ) in similar way , after programming the first and the second floating gate ( 3a and 6a ) in the same way shown in fig3 a , setting the source ( 10 ), the drain ( 9 ), and the control gate ( 8a ) to 0 v , 5 v and - 12 v respectively make the first floating gate ( 3a ) erased as shown fig3 b . inversely , it &# 39 ; s possible to erase the second floating gate ( 6a ). the conditions in which programmed data are read are classified into three types as shown above , ( 1 ) in case both of two floating gates are programmed , ( 2 ) when a floating gate is programmed while the other floating gate is erased , ( 3 ) when both of two floating gates are erased . of above three types , the read operation of the second type ( e . g ., the condition in which said first floating gate ( 3a ) is erased is assumed ) will be explained as follows . if vtp ( threshold voltage for the first type ) is applied to the control gate ( 8a ), a channel under the first floating gate ( 3a ) is sufficiently inversed to form a virtual drain . in this case , the virtual drain produces the same effect that the channel length is reduced as much as the length of the first floating gate , so that more saturation current flows compared with that of the first type . therefore using this principle of the present invention , a flash eeprom cell in which three different outputs may be acquired using above three types can be accomplished . as described above in detail , when the present invention is applied , different saturation current levels can be acquired with the variation of the channel length , and it can produces three different output levels so that there are dominant effects on increasing the integration of a device with no added cost . the foregoing description , although described in its preferred embodiment with a certain degree of particularity , is only illustrative of the principle of the present invention . it is to be understood that the present invention is not to be limited to the preferred embodiments disclosed and illustrated herein . accordingly , all expedient variations that may be made within the scope and spirit of the present invention are to be encompassed as further embodiments of the present invention .
| 6 |
system components with like reference numerals perform the same functions in each of the embodiments of a content aware storage system described below . fig1 a shows one implementation of the hd serial bus camera . the output from imager ( cmos or ccd ) 200 is digitized and provided to a cpu / gpu ( graphic processing unit ) device 360 where the parallel processes used to produce graphics imagery by the gpu are used instead to perform arithmetic calculations . video data is transmitted over superspeed usb or usb3 . 0 port 201 to the cpu bus such as pcie bus and is provided to gpu code that handles video analytics and h . 264 encoding . additionally , one or more gpus 312 and 330 can communicate with the cpu 360 over a bus such as pcie bus to offload processing work from the cpu 360 . the imager 200 , the memory 350 , and a display 340 can communicate over the bus as well . the gpus , working in concert with the system &# 39 ; s cpus accelerate enabled applications beyond traditional graphics and video processing . this enables balanced platforms to run computationally - intensive tasks more efficiently , providing a better application experience to the end user , all at a virtually free cost since the gpu is already in the computer and no additional hardware is required . fig1 b shows another exemplary high definition serial bus camera . the output from imager ( cmos or ccd ) 200 is digitized and the information is transmitted over superspeed serial bus or usb3 . 0 port 201 to the cpu bus such as pcie bus and is provided to an fpga or asic device that has two portions : video analytics dsp 310 and h . 264 encoder 320 . the encoder 320 and a cpu 330 can share memory 350 . the data can be transmitted over ethernet and power can be supplied by the display 340 . the system is cost effective and provides high performance . the fpga version provides field upgradability . in one embodiment , the cpu 330 , dsp 310 and encoder 320 are in one single asic . in another embodiment , the cpu 330 is a separate ic , while the dsp 310 and encoder 320 are in an fpga . any combinations of asic and fpga can be done as well . the system of fig1 a or 1 b provides high performance and field upgradability . in one embodiment , the cpu and gpus are in one single ic device with a heterogeneous multicore microprocessor architecture , combining a general purpose processing core ( s ) and basic graphics core ( s ) into one processor package , with different clocks for the graphics core and the central processing core . in this embodiment , amd &# 39 ; s fusion series processor includes on - chip graphics core that can be changed without re - design of the whole core . in this embodiment , hardware decoders of mpeg2 , vc - 1 and h . 264 video streams are included , while h . 264 encoding is done on the gpus with supported software . in another embodiment , the cpu 360 is a separate ic , while the gpus are in a separate ic . any combinations of cpu , gpu and fpga can be done as well . the implementation of fig1 a uses gpus such as those in video cards from nvidia or ati . the gpus are designed to perform fast execution of integer and floating - point arithmetic . this capability enables the video adapter to quickly compute color , shading , texture , and other aspects of a changing image and render these in real time to the screen โ thereby creating lifelike multimedia experiences . on many pcs , especially business pcs , much of this capability remains unused because business graphics only rarely need these full - bore advanced video capabilities , which means that the gpu and related hardware are available to be harnessed for non - video computation such as stream computing . stream computing ( or stream processing ) refers to a class of compute problems , applications or tasks that can be broken down into parallel , identical operations and run simultaneously on a single processor device . these parallel data streams entering the processor device , computations taking place and the output from the device define stream computing . stream computing takes advantage of a simd methodology ( single instruction , multiple data ) whereas a cpu is a modified sisd methodology ( single instruction , single data ); modifications taking various parallelism techniques into account . the benefit of stream computing stems from the highly parallel architecture of the gpu whereby tens to hundreds of parallel operations are performed with each clock cycle whereas the cpu can work only a small handful of parallel operations per clock cycle . fig2 a shows an exemplary block diagram of a hd usb cam . the usb board provides centralized communication between the image sensor and the host pc . the system receives firmware programming from a serial eeprom that configures the board into a synchronous slave fifo mode . the sensor data fills up an internal fifo with data when the elimination of handshake is taking place . the firmware automatically sends data through the usb 2 . 0 interface whenever the fifo becomes full and the frame_valid is polled to determine when a frame is complete . when the frame_valid drops , the host computer is signaled through the usb interface with a frame end packet . the firmware also supplies the necessary code to implement usb vendor commands that allow the host computer to query and modify the system configuration data . commands are used to communicate with the image sensor through the serial host interface protocol built into the sensor head interface . this embodiment works with aptina / micron &# 39 ; s mt9p031 , a 1 / 2 . 5 - inch cmos digital image sensor with an active - pixel array of 2592h ร 1944v . it incorporates sophisticated camera functions such as windowing , binning , column and row skip mode , and snapshot mode . it is programmable through a simple two - wire serial interface . the board of fig2 a can communicate over usb 3 . 0 protocol ( superspeed usb ). the theoretical throughput improvement offered by usb 3 . 0 is a 10 ร jump over usb 2 . 0 hardware : usb 2 . 0 peaks at a theoretical 480 mbps , while usb 3 . 0 can theoretically handle up to 5 gbps . this is done using transmission over differential transceivers and shielded differential pair cables , the details of which can be found at http :// www . usb . org / developers / ssusb /. two differential pairs are used ( dual / simplex ), and the differential transmission is similar to those used in sata and pcie differential transmission techniques . fig2 b shows an exemplary usb 3 . 0 superspeed controller . this embodiment supports 8 / 16 / 32 bit usb 3 . 0 pipe interface for discrete or integrated usb 3 . 0 phy and 125 / 250 / 500 mhz phy clock for 32 / 16 / 8 bit pipe interfaces . the phy interface supports data scrambling to reduce emi emissions . the controller has a link linker that communicates with a protocol layer . the protocol layer can communicate with a buffer manager , which in turn communicates with a dma engine . fig2 c shows an exemplary usb3 . 0 phy . the phy is compliant with universal serial bus 3 . 0 electrical interface specification . a digital wrapper implements intel pipe specification for usb simplifying integration . automatic digital calibration of key analog circuits is done to ensure reliability . digitally - programmable receive equalization is included to mitigate the harmful effects of isi . a fractional synthesis supports spread - spectrum clocking required by usb 3 . 0 . all usb 3 . 0 power saving modes ( u0 , u1 , u2 , and u3 ) are supported for ultra - low power operation . the cameras in fig1 a - 1b and 6 - 7 can communicate over pcie bus , or can communicate over usb 3 . 0 protocol ( superspeed usb ). the device can theoretically handle up to 5 gbps . this is done using transmission over differential transceivers and shielded differential pair cables , the details of which can be found at http :// www . usb . org / developers / ssusb /. two differential pairs are used ( dual / simplex ), and the differential transmission is similar to those used in sata and pcie differential transmission techniques . fig3 a - 3c shows an exemplary connector used to connect the camera to the processor bus in fig1 a - 1b . fig3 a shows a perspective view of the plug or connector , while fig3 b shows the metal shell and fig3 c shows the connector pins . in one embodiment , the pin assignment is as follows : fig4 a and 4b are similar to fig1 a and 1b , but in place of the usb3 . 0 connector , these embodiments have ultra - wideband ( uwb ) transceiver 203 that communicate with corresponding uwb transceivers on a remote imager 200 . in one embodiment , the transceiver 203 is a uwb chip set from tzero technologies . tzero uses the wimedia flavor of uwb that &# 39 ; s based on an ofdm channel . the consumer can more conveniently locate the cameran and pc with a wireless link . the tzero - based system includes multiple camera hdmi inputs and legacy component hd inputs . thus , the embodiment also functions as an hdmi switch connecting multiple hd sources over the single wireless link . fig5 shows details of an exemplary gpu from amd / ati . fig6 shows one embodiment of gpu based camera 700 . in fig6 , a multi - core processor 708 includes cpus 702 and 706 with shared memory 704 . the processor 708 communicates over a pcie bus 710 with one or more graphics chips 720 which includes a plurality of gpus 722 communicating with shared memory 724 . a camera 740 a also communicates over the pcie bus 710 . fig7 shows another gpu camera embodiment of fig6 . in this embodiment , each of three cameras 740 b , 740 c and 740 d is connected to a gpu device and the gpu device 720 in turn performs video analytics and / or encoder operations on the video captured by the camera . the system of fig7 scalably handles a number of cameras in parallel , while keeping overhead costs low . fig8 shows an exemplary stream computing programming model where programmable stream cores execute application specific programs called stream kernels such as video processing kernels . the stream cores operate with a virtualized simd programming model operating on streams of data . in stream computing , arrays of input video data are mapped onto a number of simd engines which execute kernels to generate video outputs that are written to external memory or to the cloud . each instance of a kernel is called a thread . a specified region of the output buffer to which threads are mapped is the domain of execution . the stream processor schedules the array of threads onto a group of processors until all threads have been processed . subsequent kernels can be executed until the application completes . fig9 shows exemplary stream processor which includes groups of simd engines . each simd engine contains numerous thread processors , which are responsible for executing kernels , each operating on an independent data stream . thread processors in turn contain numerous stream cores , which are programmable computation units that can perform integer , single or double precision floating point and transcendental operations . all thread processors within an simd engine execute the same instruction , and different simd engines can execute different instructions . in one embodiment , the gpus are used to expedite the motion estimation function , which is the most computationally intensive section of h . 264 operations by performing motion estimation in parallel . the term โ parallel โ to refer to processes that generally run concurrently in a coordinated fashion , but does not require a strict step by step , or clock by clock parallelism . the gpu executes parallel instructions that form a video analytic engine . the video analytics engine analyzes the video data produced by imager 200 to detect whether a predefined event or object of interest is being captured by imager which captures high definition video . video analytics engine generates metadata that describe the content of video data . the metadata produced by video analytics engine may be a textual and semantic description of the content of the video . video analytics engines of different cameras may have different analytic capabilities . multiple events of interest may be defined , and more than one event of interest may occur at a particular time . also , the nonoccurrence of one event leaves open the possibility of the occurrence of a second event . the metadata may be supplied to data storage system or the amazon s3 web storage . the metadata representing an arbitrary frame n can be associated with video data representing frame n . thus , the metadata may be searchable to allow a user to efficiently search and semantically browse large video archives . an event of interest that video analytics engine detects may be as simple as motion in the field of view . video analytics engine may also implement blob detection ( e . g . detecting a group of moving pixels as a potential moving object , without identifying what type of object it is ), lighting change adjustment , and geometric calibration based on object size in the field of view to distinguish objects based on types . for example , video analytics engine may be able to classify an object as a human being , a vehicle , or another type of object and be able to recognize an object when the object appears in any portion within the field of view of camera . furthermore , video analytics engine may be able to recognize certain identifiable features of an object such as , for example , human faces and vehicle license plates . video analytics engine may be able to recognize when imager 200 is capturing a new object and assign a unique object id to the new object . video analytics engine may be able to recognize the speed and trajectory at which an object moves . video analytics engine may be able to recognize events such as perimeter intrusion , object movement in a particular direction , objects approaching one another , a number of objects located in a specified area , objects left behind , and object removal . video analytics engine can also recognize specific locations , or coordinates , within the field of view where an event or object of interest is being captured , or a combination of objects and events , as defined by a rule . when video analytics engine detects an event or object of interest within the video data , video analytics engine generates metadata that correspond to the event or object of interest and supplies the metadata to an action engine , which can be rules based in one embodiment . for example , the rules can send an alert ( e . g ., instructions to generate one or both of a visual display and an audible sound ) to central monitoring station or remote user , store video data in amazon s3 for x period of time , among others . for example , a user may define the following rule : when a human being enters a defined perimeter , store high resolution video data representing the intrusion , alert central monitoring station of the intrusion , generate a short video clip of the intrusion and send the video clip to central monitoring station , and store in the web storage s3 the video data representing the intrusion . or , a user may define the following rule : when no event or object of interest is being captured , store low resolution video data and send no video data to central monitoring station . because video analytics engine can detect various objects and events , a wide variety of rules may be defined by a user and each rule can have different storage quality settings . also , because multiple events of interest may occur simultaneously , a rule may correspond to a combination of events . the gpus can also perform video compression . the video compression engine can be a scalable video codec to generate multiple quality levels using h . 264 svc . in operation , imager 200 captures a field of view and generates video data . frames of the video data are time - stamped so that metadata generated by video analytics engine may be synchronized with video data generated by imager . video analytics engine analyzes the video data generated by imager 200 and generates metadata based upon the content of the video data . the video compression engine also receives the video data generated by imager 200 and generates scalable video data that can be subsequently be saved at differing resolution . the metadata is communicated to the server to determine whether a rule has been violated ( i . e ., whether an event or object of interest detected by video analytics engine requires action ). referring now to exemplary h . 264 encoder cores , the initial step is the generation of a prediction . the baseline h . 264 encoder uses two kinds of prediction : intra prediction ( generated from pixels already encoded in the current frame ) and inter prediction ( generated from pixels encoded in the previous frames ). a residual is then calculated by performing the difference between the current block and the prediction . the prediction selected is the one that minimizes the energy of the residual in an optimization process that is quite computationally intensive . a linear transform is then applied to the residual . two linear transforms are used : hadamard and a transform derived from the discrete cosine transform ( dct ). the coefficients resulting from the transformations are then quantized , and subsequently encoded into network abstraction layer ( nal ) units . these nals include context information โ such as the type of prediction โ that is required to reconstruct the pixel data . the nal units represent the output of the baseline h . 264 encoding process . meanwhile , inverse quantization and transform are applied to the quantized coefficients . the result is added to the prediction , and a macroblock is reconstructed . an optional deblocking filter is applied to the reconstructed macroblocks to reduce compression artifacts in the output . the reconstructed macroblock is stored for use in future intra prediction and inter prediction . intra prediction is generated from unfiltered reconstructed macroblocks , while inter prediction is generated from reconstructed macroblocks that are filtered or unfiltered . intra prediction is formed from pixels that were previously encoded . two kinds of intra predictions are used : intra16 ร 16 and intra4 ร 4 . in intra16 ร 16 , all the pixels already encoded at the boundary with the current block can be used to generate a prediction . these are shown shaded in the figure below . the core can generate the four modes of the intra16 ร 16 prediction . in intra4 ร 4 , 16 4 ร 4 blocks of prediction are generated from the pixels at the boundaries of each 4 ร 4 prediction block and boundary pixels are used in intra16 ร 16 and intra4 ร 4 intra prediction modes . the inter prediction is generated from motion estimation . at the heart of video compression , motion estimation is used to exploit the temporal redundancy present in natural video sequences . motion estimation is performed by searching for a 16 ร 16 area of pixels in a previously encoded frame so that the energy of the residual ( difference ) between the current block and the selected area is minimized . the core can search an area 32 ร 32 pixels wide , down to ยผ pixel of resolution (โ 16 . 00 , + 15 . 75 in both x and y direction ). pixels at ยผ resolution are generated with a complex interpolation filter described in the itu - t h . 264 specification . the hadamard transform and an integer transform derived from the dct and their descriptions can be found in the itu - t h . 264 standard , the content of which is incorporated by reference . both transforms ( and their inverse functions ) can be performed by using only additions , subtractions and shift operations . both quantization and its inverse are also relatively simple and are implemented with multiplication and shifts . h . 264 encoding can be essentially divided into two independent processes : motion estimation and compensation , and variable length encoding . the motion estimation submodule of the core consists of two stages : integer pixel motion estimation followed by a refining step that searches for matches down to ยผ pixel resolution . the integer search unit utilizes a 4 step search and sums of absolute difference ( sad ) process to estimate the motion vector . similar to the case of motion estimation , sads are used to search for the intra prediction mode that best matches the current block of pixels . the resultant bitstream is assembled into nal units and output in byte stream format as specified in annex b of the itu - t h . 264 specification . each nal unit contains context information about the type of prediction , motion vectors , quantisation parameter delta , and the context adaptive variable length coded ( cavlc ) luma and chroma coefficients . most of the encoded bits in each macroblock are devoted to the cavlc coefficients . cavlc coding operates on 4 ร 4 blocks and scans the coefficients in zig - zag order . each 4 ร 4 block comprises the following elements : the number of non - zero coefficients number of trailing ones ( up to 3 ) sign of each trailing one ( up to 3 ) the level code of each non - zero coefficient the zero run code preceding each non - zero coefficient for high definition video , the core requires an external memory , whose interface can be easily interfaced to the amba ahb with a minimal amount of extra logic . the interface is also designed to be tolerant of latencies and delays typical of a shared bus . the external memory is likely to be , in many cases , a type of sdram rather than sram . one of the characteristics of sdram is for the memory to behave essentially like a sram provided that accesses are confined within a page . only when crossing a page boundary will the penalty of extra cycles be incurred due to a precharge . therefore the core sorts all its memory accesses in a way that minimizes page boundary crossings , achieving performance closer to one that would be obtained if it was connected to sram . the memory controller can postpone precharging as long as accesses are confined to the same page . additionally , the external memory interface can be clocked at a different frequency from the main core . other features include block skipping for lower bit count and multiple slice encoding for error resilience . a deblocking filter is also used in order to improve image quality at low bit rates . the gpu can also implement a cellular neural network ( cnn ) suitable for image processing . cellular arrays are usually defined on a spatially discrete square ( rectangular ) grid ; however , hexagonal and triangular arrangements can also be considered . these grids are the only regular contiguous tessellations of the plain based on congruent polygons alone . other grid - types can also be created based on non - regular congruent polygons or from a regular vertex grid through discrete geometrical transformations : rotations and translations . a number of these grids can be mapped on a typical eight - neighbor rectangular structure with periodic space - variant connections . the cnn has a mixer which contains cell values for the next updates , a memory unit that contains a belt of the cell array , a template memory , and an arithmetic unit . the processors can be connected on a grid . depending on the template size , each mixer unit stores the surrounding cells of the currently processed one , while the memory units store a one or two row - high belt from the given layer . using this structure the i / o requirements of the processor are reduced to p load and p store operations per cell update . the optimized template memory contains only the parameters which are necessary to perform the computations , while the modified arithmetic units make efficient computation of the different type multilayer dynamics possible . in one embodiment , a video frame is broken down into macroblocks ( each macroblock typically covers 16 ร 16 pixels ), each macroblock &# 39 ; s movement from a previous frame ( reference frame ) is tracked and represented as a vector , called motion vector . storing this vector and residual information instead of the complete pixel information greatly reduces the amount of data used to store the video . the pyramid ( or hierarchical ) motion vector prediction performs motion estimation on a significant downsampled version of the image . the vectors found in this iteration are used as estimates for the motion vector predictions in motion estimation of a slightly less - downsampled image . this process is repeated until the motion estimation is performed on the full - resolution image . one implementation started at a level of sixteen times downsampling and doubled the resolution to eight times . it continued doubling until the motion estimation is done for the full resolution image . one kernel is executed per level of hierarchy . after the kernel was done executing the motion vectors found are left on the device for the next kernel call to minimize the number of host - device memory transfers needed . in another implementation , the gpus operates in parallel on โ slices โ of video data for h . 264 encoding , each containing a set of blocks that can be decoded without any other neighboring block information ( from outside the slice ). at each slice , the predictors are reset , trading off compression efficiency for error resilience . thus , one slice can be used per line of blocks . if an error is introduced in any given block , the system can recover on the next line of blocks . the video frames are first placed in to the memory from a capture device such as a camera . the gpu then executes various pixel processes of an encoder resulting in coefficients . these processes include intra and inter prediction , mode selection , motion estimation , motion compensation , dct and idct , quantization and inverse quantization . the resulting coefficients and metadata is then processed by gpu . the gpu then takes the coefficient and meta data and encodes using a variable length coding process ( vlc ) resulting in a video stream . if there are multiple slices in the picture , the gpu can process each slice in parallel resulting in higher overall performance . each slice in a video stream can be decoded independently of other slices . slices also contain blocks that are dependent on other blocks in the slice and are best decoded sequentially ; therefore , in a preferred embodiment , each slice is decoded using a sequential processor in the gpu , but more than one slice can be decoded in parallel using a group of sequential processors in the gpu . each sequential processor decodes an assigned slice , and outputs the independent coefficients and metadata into another array for subsequent use . if there are not enough sequential processors for all slices of a frame , slices may be assigned , for example in a round - robin fashion , until all slices are decoded . variable sized slices are packed in a buffer that contains the encoded bits from the video stream with all slices packed together . the data is pre - processed by finding the point in the buffer where each slice begins and the pointers for each slice are stored in an index array which is read by each processor in the gpu to find the location of the slice that each processor is responsible for decoding . once the set of macroblocks in each gpu processor array has been vlc decoded to coefficients and meta data , the resulting ( rle compressed ) coefficients and metadata for each block in a slice is stored in an array . another index table is used to indicate where each macroblock is located in the coefficient buffer . each processor in the gpu array then reads the address offset for the macroblock data for its decoding assignment . once all the slices have been decoded , the decompressed slice data is sent for h . 264 nac assembly and decoding of the next frame of slices can be started on the gpu array . since each macroblock is independent of other macroblocks , the gpu &# 39 ; s parallel processors can be applied to decompressing all of the blocks in parallel . the system allows h . 264 to be encoded / decoded without noticeably slowing the user &# 39 ; s other tasks . since users prefer to be able to use their computers while conferencing , the system avoids consuming all of the cpu in the encode / decode task in such a way that the user can &# 39 ; t do anything else on his or her computer besides encoding . fig1 shows an exemplary process to optimize the speed of encode and cpu utilization . the metrics of success for gpu encoding can be measured on a plurality of axes : resolution , quality of encode , speed of encode , cpu utilization , and power . the code run by the gpu is modifiable to optimize on a given axis . pseudo code of this optimization is as follows : obtain user preference for gpu encoder software on minimum resolution , quality of encode , speed of encode , cpu utilization , and power ( 810 ) start video capture and start gpu avc encoding on cpu and gpu ( 812 ) detect power setting ( 814 ) loop sample cpu utilization ( 816 ) if on a desktop set for high performance or laptop that is plugged in to ac ( 818 ) if cpu utilization excluding video encoding tasks is below a predetermined threshold set by the max cpu utilization preference , encode at highest quality and speed while conforming to other user preference settings ( 820 ) if cpu utilization excluding video encoding tasks is above the predetermined threshold , progressively decrease quality and / or speed of gpu encoding until user preference settings are met ( 822 ) if cpu utilization excluding video encoding tasks is still above the predetermined threshold after decreasing quality / encoding speed , progressively decrease resolution until cpu utilization preference is met ( 824 ) if cpu utilization excluding video encoding tasks is still above the predetermined threshold after decreasing quality / encoding speed / resolution , progressively decrease frame rate until cpu utilization preference is met ( 826 ) if cpu utilization excluding video encoding tasks is still above the predetermined threshold after decreasing quality / encoding speed / resolution / frame rate , switch to voice conferencing mode ( 830 ) else if on a desktop that is set for low power or laptop that is not plugged in to ac ( 850 ) set preferences to medium resolution , medium quality encoding and other parameters optimized for battery life ( 868 ) if cpu utilization excluding video encoding tasks is below a predetermined threshold set by the utilization preference , encode at the set quality and speed settings while conforming to other user preference settings ( 870 ) if cpu utilization excluding video encoding tasks is above the predetermined threshold , progressively decrease quality and / or speed of gpu encoding until user preference settings are met ( 872 ) if cpu utilization excluding video encoding tasks is still above the predetermined threshold after decreasing quality / encoding speed , progressively decrease resolution until cpu utilization preference is met ( 874 ) if cpu utilization excluding video encoding tasks is still above the predetermined threshold after decreasing quality / encoding speed / resolution , progressively decrease frame rate until cpu utilization preference is met ( 876 ) a cpu can &# 39 ; t encode faster if it is maxed out . once processor utilization exceeds a predetermined level , the system inserts sleep states in the gpu based encoder to achieve real time high quality encoding but at a desired cpu utilization . one embodiment also performs scalable video coding using the gpu . other embodiments can perform various high level operations as described below . face detection can be performed on board the camera for autofocus of the camera . additionally , the face detection can be used to identify regions in the video that should be encoded at high resolution for certain applications . a parallelized implementation of convolutional neural networks ( cnns ) is done with parallelizing the detection process using the gpu . the convolutional network , consists of a set of layers each of which contains one or more planes . approximately centered and normalized images enter at the input layer . each unit in a plane receives input from a small neighborhood in the planes of the previous layer . the idea of connecting units to local receptive fields dates back to the 1960s with the perceptron and hubel and wiesel &# 39 ; s discovery of locally sensitive , orientation - selective neurons in the cat &# 39 ; s visual system . the general strategy of a convolutional network is to extract simple features at a higher resolution , and then convert them into more complex features at a coarser resolution . the simplest was to generate coarser resolution is to sub - sample a layer by a factor of 2 . this , in turn , is a clue to the convolutions kernel &# 39 ; s size . the weights forming the receptive field for a plane are forced to be equal at all points in the plane . each plane can be considered as a feature map which has a fixed feature detector that is convolved with a local window which is scanned over the planes in the previous layer . multiple planes are usually used in each layer so that multiple features can be detected . these layers are called convolutional layers . the gpu supports a fast , automatic system for face recognition which is a combination of a local image sample representation , a self - organizing map network , and a convolutional network for face recognition . for the images in the training set , a fixed size window is stepped over the entire image and local image samples are extracted at each step . at each step the window is moved by 4 pixels . next , a self - organizing map ( e . g . with three dimensions and five nodes per dimension ) is trained on the vectors from the previous stage . the som quantizes the 25 - dimensional input vectors into 125 topologically ordered values . the three dimensions of the som can be thought of as three features . the som can be replaced with the karhunen - loeve transform . the kl transform projects the vectors in the 25 - dimensional space into a 3 - dimensional space . next , the same window as in the first step is stepped over all of the images in the training and test sets . the local image samples are passed through the som at each step , thereby creating new training and test sets in the output space created by the self - organizing map . ( each input image is now represented by 3 maps , each of which corresponds to a dimension in the som . the size of these maps is equal to the size of the input image divided by the step size . a convolutional neural network , or alternatively a multilayer perceptron neural network , is trained on the newly created training set . the self - organizing map provides a quantization of the image samples into a topological space where inputs that are nearby in the original space are also nearby in the output space , which results in invariance to minor changes in the image samples , and the convolutional neural network provides for partial invariance to translation , rotation , scale , and deformation . substitution of the karhunen - lo &# 39 ; eve transform for the self organizing map produced similar but slightly worse results . the method is capable of rapid classification , requires only fast , approximate normalization and preprocessing , and consistently exhibits better classification performance than the eigenfaces approach on the database considered as the number of images per person in the training database is varied from 1 to 5 . as discussed above , a parallelized implementation of convolutional neural networks ( cnns ) is done with parallelizing the detection process using the gpu . this can be used for autofocus of the camera . once the face is detected , the gpus can also be used to detect gestures as commands . motion features are first computed on the input image sequence ( stationary camera assumed ). the face detector is then employed to obtain a user - centric representation , and again a classifier to discriminate between gestures is learned using a variant of adaboost . a real - time version of this classifier is deployed using the gpu . to calculate the motion features , the optical flow for each frame is determined . the optical flow vector field f is then split into horizontal and vertical components of the flow , fx and fy , each of which is then half - wave rectified into four non - negative channels fx +, fx โ, fy +, fy โ. a channel corresponding to motion magnitude f0 is obtained by computing the l2 norm of the four basic channels . these five non - negative channels are then normalized to facilitate gesture recognition in soft - real time where frame rates can be variable , and to account for different speed of motion by different users . given a vector v that represents the optical flow for a given pixel , the system computes v = v /(โฅ v โฅ+ e ), where e is used to squash optical flow vectors with very small magnitude introduced by noise . next , each of the five channels is box - filtered to reduce sensitivity to small translations by the user performing the gesture . this final set of five channels : ^ fx +, ^ fx โ, ^ fy +, ^ fy โ, ^ f0 will be used as the motion features for each frame . a gesture is represented as a collection of movements required to complete a single phase of the gesture , rather than just capture a subset of the gesture phase . hence , the system aggregates the motion features over a temporal history of the last k frames , for some k which is large enough to capture all frames from a gesture phase . face detection is used to create a normalized , user centric view of the user . the image is scaled based on the radius of the detected face , and is then cropped and centered based on the position of the face . the frame is cropped and resized to a 50 ร 50 pixel region centered around the user . all five motion feature channels described above are flattened into a single vector which will be used to determine the gesture being performed . a multi - class boosting process adaboost is used such as the one at http :// multiboost . sourceforge . net . adaboost takes the motion features as input . the supervised training is based on a set of labeled gestures . a set of weak learners is generated based on thresholding value from a particular component of the motion feature vector . the output of the final strong learner on motion feature v for class label is determined using weights chosen by adaboost . in one embodiment , the video feature tracking and matching described above is used to compress conferencing sessions . typically , in videoconferencing , the background remains the same , but the facial expression can change . the operation is as follows : 1 ) send the first few minutes of video using conventional or compressed video and simultaneously determine predetermine facial and body features ; 2 ) after the start up period , for each frame determine whether the current frame only has facial / body changes and if so look for an updated position of the features and transmit a vector indicating facial and body feature changes to the remote computer the remote computer converts the vector of changed facial features to an image of the user &# 39 ; s face and body position 3 ) otherwise , there are significant changes to the frame and so loop back to ( 1 ) to do a fresh compression cycle . the process achieves a very high compression ratio since only a vector of feature position changes are sent as a vector and the vector is converted back into frame image by the remote computer . moreover , if significant scene changes occur ( such as new participants entering the conference , or participant picks up a book and show book to the camera ), then the system reverts back to h . 264 compression of full image . referring back to the telepresence video conferencing system of fig1 , the gpus can perform panaroma stitching so that 3 inexpensive cameras can be used to provide a 180 degree immersive view . the gpu operations are done pipeline fashion as follows : radial distortion correction . next , the gpus perform keypoint detection & amp ; extraction ( shi - tomasi / sift ). keypoint matching is done , and the gpus recover homography ( ransac ). next , the gpus create a laplacian pyramid . a projective transform is done , and a multi - band blend is the last stage of the pipeline . fig1 shows an exemplary telepresence conferencing system using one or more of the hd usb cameras . the system has a wide field display 150 that provides viewers with an immersive 180 degree view of participants on the other side of the call . a wide view camera 160 captures a 180 degree view of participants and transmits such video to the other side of the conference call . the wide view camera 160 can be one camera fitted with wide angle lens and suitable distortion removing image processor , or can be three separate camera each capturing left , center and right views , respectively . the system can have optional lights 162 to provide lighting to provide high quality images of the physical participants . in one embodiment , the system has desks with a series of surfaces 152 that form an oval physical table space while the display 150 shows the virtual participants . in another embodiment , the system has desks with a series of surfaces 152 that form a semicircular physical table space while the display 150 shows the virtual participants and a matching virtual table space that mirrors the semicircular physical table . the surface 152 includes computers 154 , 158 and 164 such as laptop computers . the table also includes an lcd control panel 156 that allows users to control and operate the conferencing system . in one embodiment , the conferencing system includes a 3d scanner 166 . the scanner allows the participants to share 3d shape information with others . the 3d scanner 166 transmits 3d shape data that can be displayed on the display 150 and manipulated using suitable 3d imaging or cad programs . the purpose of a 3d scanner is usually to create a point cloud of geometric samples on the surface of the subject . these points can then be used to extrapolate the shape of the subject ( a process called reconstruction ). if color information is collected at each point , then the colors on the surface of the subject can also be determined . like cameras , they have a cone - like field of view , and like cameras , they can only collect information about surfaces that are not obscured . while a camera collects color information about surfaces within its field of view , 3d scanners collect distance information about surfaces within its field of view . the โ picture โ produced by a 3d scanner describes the distance to a surface at each point in the picture . together with distance , which corresponds to the r component , these spherical coordinates fully describe the three dimensional position of each point in the picture , in a local coordinate system relative to the scanner . also , more details on the 3d scanner are discussed next . the system can work with a variety of 3d scanners to communicate shape information with remote conferencing participants . the two types of 3d scanners are contact and non - contact . non - contact 3d scanners can be further divided into two main categories , active scanners and passive scanners . there are a variety of technologies that fall under each of these categories . contact 3d scanners probe the subject through physical touch . a cmm ( coordinate measuring machine ) is an example of a contact 3d scanner . it is used mostly in manufacturing and can be very precise . the disadvantage of cmms though , is that it requires contact with the object being scanned . thus , the act of scanning the object might modify or damage it . this fact is very significant when scanning delicate or valuable objects such as historical artifacts . the other disadvantage of cmms is that they are relatively slow compared to the other scanning methods . physically moving the arm that the probe is mounted on can be very slow and the fastest cmms can only operate on a few hundred hertz . in contrast , an optical system like a laser scanner can operate from 10 to 500 khz . non - contact scanners can be active scanners that emit radiation or light and detect its reflection in order to probe an object or environment . possible types of emissions used include light , ultrasound or x - ray . a time - of - flight lidar scanner may be used to scan buildings , rock formations , etc ., to produce a 3d model . the lidar can aim its laser beam in a wide range : its head rotates horizontally , a mirror flips vertically . the laser beam is used to measure the distance to the first object on its path . the time - of - flight 3d laser scanner is an active scanner that uses laser light to probe the subject . at the heart of this type of scanner is a time - of - flight laser rangefinder . the laser rangefinder finds the distance of a surface by timing the round - trip time of a pulse of light . a laser is used to emit a pulse of light and the amount of time before the reflected light is seen by a detector is timed . since the speed of light c is a known , the round - trip time determines the travel distance of the light , which is twice the distance between the scanner and the surface . the laser rangefinder only detects the distance of one point in its direction of view . thus , the scanner scans its entire field of view one point at a time by changing the range finder &# 39 ; s direction of view to scan different points . the view direction of the laser rangefinder can be changed either by rotating the range finder itself , or by using a system of rotating mirrors . the latter method is commonly used because mirrors are much lighter and can thus be rotated much faster and with greater accuracy . typical time - of - flight 3d laser scanners can measure the distance of 10 , 000 ห 100 , 000 points every second . a triangulation 3d laser scanner is also an active scanner that uses laser light to probe the environment . with respect to time - of - flight 3d laser scanner the triangulation laser shines a laser on the subject and exploits a camera to look for the location of the laser dot . depending on how far away the laser strikes a surface , the laser dot appears at different places in the camera &# 39 ; s field of view . this technique is called triangulation because the laser dot , the camera and the laser emitter form a triangle . the length of one side of the triangle , the distance between the camera and the laser emitter is known . the angle of the laser emitter corner is also known . the angle of the camera corner can be determined by looking at the location of the laser dot in the camera &# 39 ; s field of view . these three pieces of information fully determine the shape and size of the triangle and gives the location of the laser dot corner of the triangle . in most cases a laser stripe , instead of a single laser dot , is swept across the object to speed up the acquisition process . in a conoscopic system , a laser beam is projected onto the surface and then the immediate reflection along the same ray - path are put through a conoscopic crystal and projected onto a ccd . the result is a diffraction pattern , that can be frequency analyzed to determine the distance to the measured surface . the main advantage with conoscopic holography is that only a single ray - path is needed for measuring , thus giving an opportunity to measure for instance the depth of a finely drilled hole . structured - light 3d scanners project a pattern of light on the subject and look at the deformation of the pattern on the subject . the pattern may be one dimensional or two dimensional . an example of a one dimensional pattern is a line . the line is projected onto the subject using either an lcd projector or a sweeping laser . a camera , offset slightly from the pattern projector , looks at the shape of the line and uses a technique similar to triangulation to calculate the distance of every point on the line . in the case of a single - line pattern , the line is swept across the field of view to gather distance information one strip at a time . modulated light 3d scanners shine a continually changing light at the subject . usually the light source simply cycles its amplitude in a sinusoidal pattern . a camera detects the reflected light and the amount the pattern is shifted by determines the distance the light traveled . modulated light also allows the scanner to ignore light from sources other than a laser , so there is no interference . photometric systems usually use a single camera , but take multiple images under varying lighting conditions . these techniques attempt to invert the image formation model in order to recover the surface orientation at each pixel . this sort of 3d scanning is based on the principles of photogrammetry . it is also somewhat similar in methodology to panoramic photography , except that the photos are taken of one object on a three - dimensional space in order to replicate it instead of taking a series of photos from one point in a three - dimensional space in order to replicate the surrounding environment . alternatively , computed tomography , microtomography , magnetic resonance imaging ( mri ) techniques can be used in the 3d scanner . in addition , a rapid prototyping machine can be installed to render the 3d data into a physical model for the participants to touch and feel . rapid prototyping is the automatic construction of physical objects using additive manufacturing technology . the first techniques for rapid prototyping became available in the late 1980s and were used to produce models and prototype parts . today , they are used for a much wider range of applications and are even used to manufacture production - quality parts in relatively small numbers . the use of additive manufacturing technology for rapid prototyping takes virtual designs from computer aided design ( cad ) or animation modeling software , transforms them into thin , virtual , horizontal cross - sections and then creates successive layers until the model is complete . it is a wysiwyg process where the virtual model and the physical model are almost identical . with additive manufacturing , the machine reads in data from a cad drawing and lays down successive layers of liquid , powder , or sheet material , and in this way builds up the model from a series of cross sections . these layers , which correspond to the virtual cross section from the cad model , are joined together or fused automatically to create the final shape . the primary advantage to additive fabrication is its ability to create almost any shape or geometric feature . prototyping technologies base materials selective laser sintering ( sls ) thermoplastics , metals powders fused deposition modeling ( fdm ) thermoplastics , eutectic metals . stereolithography ( sla ) photopolymer laminated object manufacturing paper ( lom ) electron beam melting ( ebm ) titanium alloys 3d printing ( 3dp ) various materials preferably the video data can be operated in parallel using clusters of cloud based processors . video analysis applications from anywhere in the world can , after authentication and security clearance , access and analyze video data that represents video streams in parallel , and annotate portions of the video data ( e . g ., frames and groups of frames ), based on the analyses performed , with information that describes the portion of the video data . from an event stored in the database , the associated frames and / or groups of frames can be replayed for further human - based or application - based analyses . applications plugged into the pipeline , via application program interfaces ( apis ), can perform complex analyses and update the search engine in parallel . the camera , through the network , can store data on a storage cloud such as amazon &# 39 ; s s3 cloud service . the network also includes an elastic compute cloud ( ec2 ) that enables the camera system process the video data and the system can increase or decrease video processing capacity within minutes , not hours or days . the system can commission one , hundreds or even thousands of server instances simultaneously to perform deep searching of images to locate a particular individual captured by the cameras , for example . the system can select a configuration of memory , cpu , instance storage , and the boot partition size that is optimal for its choice of operating system and application . the compute cloud offers a highly reliable environment where replacement processor instances can be rapidly and predictably commissioned . the amazon embodiment runs within amazon &# 39 ; s proven network infrastructure and datacenters and amazon ec2 &# 39 ; s service level agreement commitment is 99 . 95 % availability for each amazon ec2 region . moreover , on - demand instances let security camera users or operators pay for compute capacity by the hour with no long - term commitments . this frees the system operator from the costs and complexities of planning , purchasing , and maintaining hardware and transforms what are commonly large fixed costs into much smaller variable costs . on - demand instances also remove the need to buy โ safety net โ capacity to handle periodic traffic spikes . other features such as auto scaling allow the camera system 100 to automatically scale its amazon ec2 capacity up or down according to predefined conditions . with auto scaling , the system can ensure that the number of amazon ec2 instances needed scales up seamlessly during demand spikes to maintain storage size or video analytic performance , and scales down automatically during demand lulls to minimize costs . auto scaling is particularly well suited for security monitoring applications that experience hourly , daily , or weekly variability in usage . the ec2 also provides elastic load balancing , which automatically distributes incoming application traffic across multiple amazon ec2 instances . it enables the system to achieve even greater fault tolerance in video processing , seamlessly providing the amount of load balancing capacity needed in response to incoming camera video traffic . elastic load balancing detects unhealthy instances within a pool and automatically reroutes traffic to healthy instances until the unhealthy instances have been restored . using the plurality of pcs on the ec2 cloud , each processing application can run in parallel to enhance searching and indexing of videos . although parallel video searching is described above , alternatively , the cloud based processors can be configured as a sequential processing systems where video analysis applications can access and analyze video data that represents video streams flowing through the pipeline , and annotate portions of the video data ( e . g ., frames and groups of frames ), based on the analyses performed , with information that describes the portion of the video data . these annotations flow through the pipeline , possibly along with corresponding frames or groups of frames , to subsequent stages of processing , at which increasingly complex analyses can be performed . analyses performed at the various stages of the pipeline can take advantage of the analyses performed at prior stages of the pipeline through use of the information embodied in the annotations . at each stage of the pipeline , portions of the video streams determined to be of no interest to subsequent stages are removed from the video data , which reduces the processing requirements of the subsequent stages . from an event stored in the database , the associated frames and / or groups of frames can be replayed for further human - based or application - based analyses . generally , as the videos flow down the pipeline , ( 1 ) portions of the videos or frames that are considered uninteresting to all the applications at a given stage are removed , thereby reducing the amount of data that flows further down the pipeline ; ( 2 ) portions of the videos or frames that are considered interesting to an application at a given stage are analyzed , with a goal of identifying features , activities , objects , etc . of interest ; and ( 3 ) analyzed portions of the videos or frames are annotated by the applications with information that describes what the applications identified as interesting in that portion of the video . in one embodiment , the pipeline comprises four different successive stages of processing : ( 1 ) quick frame processing ; ( 2 ) deep frame processing ; ( 3 ) cluster processing ; and ( 4 ) database processing . due to the nature of the pipeline , applications plugged into the pipeline , via application program interfaces ( apis ) associated with each respective stage , can perform increasingly more complex analyses at each successive stage of processing .
| 7 |
turning now to fig1 , computer network 100 is shown . source station s 102 transmits data packets to destination stations d 1 104 , d 2 106 , d 3 108 , d 4 110 , d 5 114 , and d 6 112 by means of a multicast session . destination stations d 1 . . . d 6 are the multicast group of destination station . router r 1 120 is the ingress ( or encapsulation ) router , and routers r 3 132 , r 6 137 , r 7 138 , r 8 140 and r 9 142 are the egress ( or destination ) routers . the delivery tree to reach all the destinations ( d 1 to d 6 ) is indicated by the arrows . when r 1 120 receives a packet from source s 102 addressed to the multicast group from source station s , it encapsulates the multicast packet in a unicast packet addressed to the first hop router r 2 and includes in the packet a header which describes the required delivery tree . note that the delivery tree need only include the routers that are either branch points ( r 2 , r 5 , r 8 ) in the tree , or delivery points ( r 3 , r 6 , r 7 , r 9 ). an intervening router , such as router r 4 above , need not be included in the specification of the delivery tree . on receiving such a unicast packet , a router inspects the header to determine the next hop routers and duplicates the packet , adjusting the unicast destination address of each packet to be the next hop ip address . forwarding of packets from router to router proceeds as follows . r 1 120 forwards to r 2 130 r 2 130 forwards to r 3 132 , r 5 136 , and r 8 140 r 5 136 forwards to r 6 137 and r 7 138 r 8 140 forwards to r 9 142 routers actively involved in the small group multicast ( sgm ) delivery tree such as routers r 1 , r 2 , r 3 , r 5 , r 6 , r 7 , r 8 , r 9 must be sgm capable . by being sgm capable is meant that the routers run software which recognizes sgm packets and take appropriate action based upon parsing the sgm header . router r 2 130 need not forward to r 4 134 , as the packets forward to r 5 136 will be transparently routed by router r 4 134 . on reaching a destination router , the packet is decapsulated and the original multicast packet is forwarded to the final multicast destination ( s ) station ( s ) using normal multicast methods . the details of the packet encoding and forwarding are described with reference to fig2 , where data packet header 200 is shown . only the encapsulating router , r 1 120 , is required to maintain state concerning the delivery tree . the remaining intervening routers merely forward based on the information in the header 200 . the information to build the delivery tree is acquired by the encapsulating router , by each destination router sending a โ trace โ packet , as discussed with reference to fig9 , towards the source . as the trace packet traverses the network it records the address of each sgm capable router traversed . so in the above example , ri would receive the trace packets from destination stations d 1 , d 2 , d 3 , d 4 , d 5 , and d 6 showing delivery tree paths as follows : ( d 1 ) having delivery tree path r 3 , r 2 , r 1 ( d 2 , d 3 ) having delivery tree path r 6 , r 5 , r 4 , r 2 , r 1 ( d 4 ) having delivery tree path r 7 , r 5 , r 4 , r 2 , r 1 ( d 5 ) having delivery tree path r 8 , r 2 , r 1 ( d 6 ) having delivery tree path r 9 , r 8 , r 2 , r 1 by combining the information carried by the trace packets , the delivery tree may be built for inclusion in multicast data packets . the delivery tree may eliminate any redundant , non - branching nodes , such as router r 4 above , even if r 4 is sgm capable . in order to send the trace packets , the destination routers must know the source ( s ) of the group . techniques for destination routers to learn the source of a desirable multicast group are discussed hereinbelow . destination routers handle recovery from failures by re - sending trace packets when no traffic for the group has arrived after some period . in the absence of genuine traffic the encapsulating router sends periodic heartbeat traffic to inhibit the trace packets from still connected nodes . details of these mechanisms are described hereinbelow . turning now to fig2 a , fields of multicast data packet 250 are shown . multicast packets are encapsulated in a standard unicast packet having layer 2 fields 252 and layer 3 fields 254 as follows : protocol 260 = sgm ( a new protocol type value assigned to small group multicast ) following the layer 3 fields 254 is the sgm header fields 200 . turning now to fig2 b , sgm header 200 fields are shown . tos refers to the type of service , or precedence , which is written into a header of a data an ip data packet . this parameter is used , in some instances , to establish a quality of service provided by a network device . this field is copied from the ordinary multicast packet into the sgm packet . the data portion of the unicast packet contains a small group multicast ( sgm ) header shown in fig2 , and as described below , followed by the original multicast packet in data field 264 . sgm type 202 โ type of sgm packet ( 1 byte ). the sgm type allows for different sgm packets ( e . g . prune , trace - ack ). an sgm data packet is assigned type = 128 . the high order bit is set to indicate that the packet contains an sgm route and should be processed using sgm forwarding . length 204 , or no . of nodes .โ the number of addresses in the address list ( 1 byte ). the offset to the start of the address list ( a ) is therefore ceiling (( 6 + n )/ 4 ) 32 bit words and hence the total length of the sgm header ( i . e . the offset to the start of the encapsulated multicast data packet ) is ( a + n ). using one byte allows 255 nodes . offset 206 โ the numerical offset of the receiving node &# 39 ; s entry in the tree list ( 1 byte ). this is initialized to 0 for delivery to the first hop router , since the first hop router &# 39 ; s address does not appear in the list . alternatively , the offset byte could be omitted and the header simply searched for the receiving node &# 39 ; s ip address . doing so would reduce the header size by one byte and remove the need to update the header when forwarding the packet , however omitting the offset byte would make the forwarding decision less efficient . ttl 208 โ normally indeterminate , but used when forwarding over a layer 2 multicast capable subnetwork . checksum field 209 . the sgm checksum field covers the original multicast source and destination addresses as well as the preceding sgm header fields . tree lists 210 a , 210 b , 210 c ,โ the list describing the delivery tree ( n bytes , where n is the number of entries in the tree list ). padding โ padding is represented by fields pad 1 212 , pad 2 214 , pad 3 216 , in order to start the address list on 4 - byte boundary . address list 220 โ the list of ip addresses for the delivery tree ( 4n bytes ) there is an address list for each receiving station . address lists 220 represent a list for each receiving station , for example address list 1 , address list 2 , address list 3 , etc . the sgm header is followed by the original multicast data packet 222 . an alternative would be to interleave the tree entries and ip addresses ( so that the corresponding ip address is adjacent to its tree entry ). while this might appear more natural , and may give some slight benefit in localising memory references once a node has been located , the lack of 4 - byte alignment of the ip addresses , coupled with poor localisation of memory references while searching the tree ( the ip address is only referenced once the next hop node has been found ), combine to make this a less efficient structure . turning now to fig3 , route table 300 for the parent encoding method is shown . the tree list may be encoded in one of two forms , โ parent encoding โ or โ depth encoding โ. parent encoding is adopted as the preferred embodiment , and depth encoding is described as an alternative embodiment hereinbelow . in parent encoding form , each entry in the list describes the entry number of that entry &# 39 ; s parent . thus the example tree above would be represented as an entry of zero indicates that this node &# 39 ; s parent is the root of the tree . parent encoding is interpreted as shown in fig3 . the entries are enumerated in column 302 . the router being addressed is listed in column 304 . the parent of the router listed in column 304 is listed in column 306 . the address of the parent is listed in column 308 . as an example , entry 5 310 is for router r 6 132 , the parent of router r 6 132 is router r 5 136 , as is shown in column 308 for entry 310 into table 300 . in operation , it is not necessary to include information about r 1 in the tree , since r 1 is the encapsulation node . similarly it is not necessary to include information about r 2 in the tree , since the packet is unicast addressed to that node . hence the information actually included in the packet would be just . this actual addressing is interpreted as shown in fig4 at table 400 . the addresses of the routers ( i . e . the address list in the packet ) are listed in column 402 , and the entries are enumerated in column 404 . the entry number corresponding to the parent of each listed router ( i . e . the parent list in the packet ) is shown in column 406 . the address of the parent is shown in column 408 . the address of the parent is obtained by taking the entry number of the parent ( listed in column 406 ) and finding the entry in column 404 with that entry number . the entry address in column 402 corresponding to that entry number is then the address of the parent . as an example , the entry marked 410 is the entry number 4 as shown in column 404 , and corresponds to the router with the entry address r 7 as shown in column 404 . the entry number of the parent of r 7 is 2 as shown in column 406 . the entry address shown in column 402 for entry 2 in column 404 is r 5 . hence , the address of the parent of r 7 shown in column 408 is r 5 . turning now to fig5 , a route table 500 is shown for the depth encoding technique . as shown in fig5 , table 500 , the nodes are listed in preorder ( i . e . each node is listed before its children ) and each list entry contains the depth of that node in the tree . thus using the original example , this would be encoded as this depth encoding method is interpreted as shown in fig5 . the address of the entry being considered is shown in column 502 . the depth of the entry is given in column 504 . the entries are enumerated in column 506 . as in parent encoding , it is not necessary to encode r 1 and r 2 , so the actual tree is : on receipt of an sgm encapsulated packet , an sgm capable router performs the following actions . 1 . checks whether it is a delivery point for this multicast group , by examining the multicast destination address in the encapsulated multicast packet , and if so takes a decapsulated copy of the multicast packet , updates the ttl of that packet to be the ttl in the received sgm packet โ 1 , and forwards the packet via normal multicast . the multicast destination address can be found easily by indexing ( length from sgm header ) from the header , then using normal ip packet parsing to find the destination address . alternatives would be to include the multicast address in the sgm header , or to include explicit โ delivery node โ information in the encoded tree . neither of these alternatives is as attractive as simply using normal ip packet parsing of the sgm data packet to find the destination address . 2 . determines the next hop forwarding destination if any , and forward a copy of the entire encapsulated packet to each of those destinations with the following changes interpreting the tree list depends on the choice of tree list format , and indeed , the choice of tree list format depends primarily on which of these is most efficient . the children of node n are found by scanning the list looking for the value n . so in the example at the first hop node the offset has the value 0 , so we look for that in the list and find entries 1 ( corresponding to r 3 ), 2 ( corresponding to r 5 ) and 5 ( corresponding to r 8 ). at r 3 the offset has the value 1 , and since there are no entries with the value 1 , we do not forward any further . at r 5 the offset has the value 2 , and we find entries 3 ( corresponding to node r 6 ) and 4 ( corresponding to node r 7 ). at r 6 the offset has the value 3 , and there are no entries with value 3 . at r 7 the offset has the value 4 , and there are no entries with value 4 . at r 8 the offset has the value 5 , and we find entry 6 ( corresponding to node r 9 ). note that while the parent tree does not require any particular ordering , we can improve the algorithm slightly by requiring that it be in preorder form . in that case the search for the offset value can start at entry offset + 1 instead of having to scan the entire list . the depth tree is guaranteed to be in preorder form . hence , we can find the children of node n by scanning the list starting at n + 1 looking for entries with depth exactly one more than the depth of n ( dn ). entries with depth & gt ; dn + 1 are ignored , and the search terminates on finding an entry with depth & lt ; dn + 1 ( or at the end of the list ). at the first hop node the offset has a value of zero . we assume that the depth of the root is also zero , so we start at the first element and find the first two entries ( corresponding to r 3 and r 5 ) have a depth of 1 . we ignore the next two entries with depth 2 and find entry 5 ( corresponding to r 8 ), also with depth 1 . we ignore the final entry with depth 2 . at node r 3 the offset has value 1 , and the depth of entry 1 is 1 . so starting at entry 2 we look for entries with depth 2 . entry two has depth 1 so we terminate the search , with no forwarding . at node r 5 the offset has value 2 , and the depth of entry 2 is 1 . so starting at entry 3 we look for entries with depth 2 . we find entries 3 and 4 ( corresponding to r 6 and r 7 respectively ), but entry 5 has depth 1 so we terminate the search there . . . . and so on . in general ( but not in the worst case ) the depth tree will require fewer elements of the list to be examined , but it requires an additional test to detect early termination . the difference is marginal . the encapsulating node can easily generate either tree encoding for parent encoding or depth encoding , and the distribution tree lengths of the two encoding methods have identical length . given a set of โ trace โ lists such as those in the example above ( d 1 ) r 3 , r 2 , r 1 ( d 2 , d 3 ) r 6 , r 5 , r 4 , r 2 , r 1 ( d 4 ) r 7 , r 5 , r 4 , r 2 , r 1 ( d 5 ) r 8 , r 2 , r 1 ( d 6 ) r 9 , r 8 , r 2 , r 1 a parent tree can be constructed by processing each trace list in turn ( in the order in which they arrived โ see below ) and assigning sequential ids to each unique router address encountered . the parent of each node can then be entered by taking the id of the next router in the list . the address of the encapsulating router is not needed , so its id is entered as zero . because trace packets may be processed sequentially , a new receiver can be accommodated merely by โ adding โ its trace packet to the existing tree . to permit correct identification of non - branching and dead nodes ( see below ) it is necessary to record which nodes are terminators i . e . r 3 , r 6 , r 7 , r 8 & amp ; r 9 in the example . in particular for r 8 it is necessary to identify it as a terminator router delivering packets to d 5 to prevent router r 8 from being removed as a non - branching node , and hence failing to deliver packets to d 5 . the algorithm above will always build a tree incorporating the most recent route from the root to any particular node , overriding any previous routes . this seems to be reasonable behavior given that the most recently received trace packet probably reflects the most recent routing information . however , the most recently arrived trace packet may not reflect the most recent , and hence โ best โ routing information since the trace packets could arrive out of order , and the routing may have changed subsequent to the arrival of the last trace packet . when routes change , it is likely that some portion of the tree will no longer reach any destination . such โ dead โ portions must be pruned off to avoid unnecessary bandwidth wastage . there are two obvious ways to deal with this . 1 . detect that the parent of a node was already set and is being changed to a new value , then follow up the chain of old parents until a node is reached with more than one child ( found by scanning the list looking for nodes with parents pointing to this node ). 2 . alternatively , the dead branches can be left in place , then pruned by performing a depth first exploration for the entire tree from the root . the exploration looks for nodes that do not lead to a delivery point . partially looping trace packets ( as a result of dynamic routing changes ) will be dealt with naturally by the above algorithm . when the trace packet crosses its own path the loop will be removed from the tree just as if it had been a new route . clearly , persistently looping trace packets will not arrive at their destination and will be treated as dropped trace packets . it is possible that such a packet may overflow the trace list before the hop count is exhausted . when there is no room in a trace packet to add an sgm entry , the packet should be discarded . the tree built by the above algorithm may include non - branching nodes ( such as r 4 in the example ). these can be removed by performing a depth first exploration of the tree from the root and removing nodes that have exactly one child ( a node which is also a terminator is never removed ). note that node removal must be done after any dead branches have been pruned , since removal of dead branches may generate further single child nodes . it is possible to perform the dead branch removal and non - branching node removal during the same exploration . however , this may not be desirable since a new trace packet can be added to the tree after dead branch removal , but not after non - branching node removal ( since the new path may merge with the old at a node that was previously non - branching ). performing dead branch removal after each ( set of ) trace packet ( s ) may be desirable since it allows the memory used to store the dead nodes to be recovered . packet headers in preorder form ( either parent or depth ) are easily built from the complete parent tree by performing a depth first exploration and reassigning node ids . note that for these purposes the trees are built with the first hop router ( s ) as the root . if there are multiple first hop routers ( i . e . the encapsulating router is a branch point ), there will be multiple distinct trees . turning now to fig6 , fields of a pruning message 600 are shown . field 602 contains the sgm type . field 604 contains the number of group address carried in the packet . field 606 is reserved , i . e . not used . field 608 contains the source address . field 610 contains the first group address . field 612 contains the second group address , etc . field 614 contains the n &# 39 ; th group address . when a destination router detects that it has no more members of the group , it unicasts a โ prune - leave โ message directly to the current source sgm router ( the current_source_sgm_router ) and sets current_source_sgm_router to no_members . the value no_members is returned when there is no record for the group at the destination router , that is the members serviced by that destination router have gone away . that is , there is no need to retain โ negative โ state for the group after its members have gone away . in an alternative embodiment of the invention , a bit is used to distinguish between prune - leave , and prune - change flavours . a prune - change causes the additional action of inhibiting all downstream heartbeats for the source until a new trace has been received for that source . the prune message is carried in an ip packet with protocol type sgm , and has the following data format . sgm type 602 ( 1 byte )โ type of sgm packet = 2 ( prune - leave ) or 3 ( prune - change ) n groups 604 ( 1 byte )โ number of group addresses source address 608 โ multicast source ip address group addresses 610 , 612 , 614 , etc . . . . ( 4 * n groups bytes )โ list of group addresses to be pruned . the only information required in the prune message is the source group pair state , [ s , g ] state , and the address of the destination router . the latter is obtained from the source ip address of the ip packet . the encapsulating router can then mark the destination router as no longer being a terminator , and remove the dead branch by either of the techniques outlined above . note that it is not necessary to have access to the original trace packet in order to remove it . prunes , in an exemplary embodiment of the invention , are not acknowledged . if the prune message is lost , unwanted multicast data may still arrive at a destination router . the value of no_members in the current_source_sgm_router is deemed to match no source sgm router address , and hence leads to re - transmission of prune - leave messages , although at a rate which is limited . a destination router may die without being able to send a prune - leave message , or it may become partitioned from the rest of the network . in these circumstances , we want the destination router to be eventually removed from the delivery tree . removal of the destination router from the delivery tree is achieved by the source sgm router maintaining a timer ( n * t1 ) with each destination , and this timing interval , in an exemplary embodiment of the invention , is chosen to be on the order of a few minutes . this timer in the source sgm router is reset by the arrival of a trace packet from that destination router . on expiry of the timer , the destination router is removed as if a prune - leave message had been received . destination routers maintain a timer with the value โ t1 โ, and send a trace packet when it expires . in an alternative embodiment of the invention , the timers in the various destination routers are jittered in order to prevent them to come into synchronization . the holding time may be carried in a unicast trace with no difficulty . however , in an alternative embodiment of the invention , multicast trace packets may be used ( mtrace ) and it could be awkward to maintain an identification between a timer interval and the destination router which requested it . there are enough fields defined in the trace packet to carry timer information , however , the trace packet is no longer of identical form for each destination router , that is , it is not a universal trace packet . in an alternative embodiment of the invention , the source sgm router determines the value of the timer interval , and passes it in the trace - ack to each destination router . the set of all the unique sgm router addresses mentioned in trace packets it receives . addresses of nodes pruned because they are on dead branches may be safely forgotten , but addresses of non - branching nodes must be retained in case they are subsequently needed . for each group ( identified by [ s , g ] ), a node list of length n , ( where n is the number of unique addresses in the set of trace lists for that group ), consisting of offsets into the address list . in an alternative embodiment of the invention which scales to more than 65 k sgm capable routers for an encapsulating router , then a choice between keeping the 32 bit addresses and accessing them globally through unique offsets is resolved in favor of keeping the 32 bit addresses . note that there is no need to keep the trace lists themselves . an alternative strategy would be to keep just the sets of trace lists for each group , and rebuild the trees from scratch on each change to the set . this strategy may require more storage . sgm encapsulated packets are unicast between branch point sgm routers . changes in unicast topology between sgm routers that do not affect reachability will simply be accommodated by normal unicast routing . sgm encapsulated packets will still be delivered to the next sgm router . where the topology changes such that the existing delivery tree is no longer optimum ( but is still connected ), the old sub - optimal delivery tree will continue to be used until such time as it is re - evaluated as the result of receiving new trace packets . this may occur as a result of new receivers joining the group on destination routers that were not previously receiving the group , or as a result of delivery failure . hence , the maximum time for which a non - optimal delivery topology will persist is t1 , and it will usually be much less , especially in the part of the tree near the root , where multiple traces contribute towards the topology discovery . turning now to fig7 , the fields of heartbeat message 700 are shown . field 702 contains the sgm type . field 704 contains the length . field 706 contains the offset . field 708 contains the first tree list . field 710 contains the second tree list . additional tree lists are contained in fields which are not shown . field 712 , etc . contain the n &# 39 ; th tree list . field 714 , field 716 , etc . contain padding to make the following addresses lists come out on four byte boundaries . field 720 contains the first address list . field 722 contains the second address list . field 724 contains the n &# 39 ; th address list , etc . field 730 contains the multicast source address . field 732 contains the multicast group address . failure of an intermediate sgm router on the delivery tree will cause all destinations below it to stop receiving data . each destination router runs a timer , โ n * t2 โ, where t2 is the expected maximum interval between data packets , and n is the number of lost packets which can be tolerated before recovery is initiated . in an exemplary embodiment of the invention , the value of the time interval for the โ n * t2 โ timer may be set by the application , and the value of t2 carried in the trace packets . the timer โ n * t2 โ is reset by the receipt of data for the corresponding [ s , g ]. on expiry of the timer , a new trace packet is sent towards the source , which will discover a new delivery path ( should one exist ). since trace packet delivery is unreliable it is necessary to allow multiple trace packet attempts to be made until a trace - ack is received . however it may be that the source really is unreachable , and no acknowledgement will ever be received . it would be wasteful to continue trace attempts under those circumstances . a counter c is maintained per [ s , g ] and is incremented on each transmission of a trace packet by a destination router containing g towards s . receipt of a trace - ack referring to [ s , g ] resets the counter in the destination router . if the counter exceeds some limit l , no further trace attempts are made for [ s , g ] until the process is re - initiated by the application and somehow that fact is reported to the application . it is envisaged that t2 would be of the order of a second ( perhaps less ) to allow recovery of a voice over ip connection within a few seconds . however , sending trace packets at this frequency would be expensive . therefore , in the absence of any real data for [ s , g ] for a period t2 , the encapsulating router sends a dummy โ heart - beat โ sgm encapsulated packet carrying no data packet . these have sgm type 130 placed in field 702 , with a standard sgm tree header followed by [ s , g ], as shown in fig7 . receipt of such a packet by the destination router causes the timer to be reset in the same way as a normal data packet and hence inhibits the recovery attempt , but no output multicast packet is generated . if , in an alternative embodiment of the invention , it were required to operate with tight constraints on the recovery time ( of the order of a few seconds ), this operation could result in โ heart - beat โ traffic being sent every second or so during periods of silence . for extended periods of silence , this much heart - beat traffic amounts to a serious waste of resources , so it is desirable to introduce a back - off mechanism controlled by the encapsulating router . if the sgm header includes the value of t2 , the encapsulating router can put progressively longer values in the โ heart - beat โ packets after a period of silence , and hence progressively decrease their frequency . the downside of this would be that there could be a large delay in recovery for the first data packets sent after a prolonged period of silence . sgm router reachability failures are indistinguishable from router failures , and are dealt with by the same mechanism . failure of the destination router causes state for the [ s , g ] to be lost . if there is only one sgm router to which the multicast receiver can join , then recovery is impossible ( until the router in question is re - booted ). the branch of the tree leading to the unreachable destination will eventually be pruned by the expiry of the destination holding timer as described hereinabove . if there are multiple possible destination routers , then normal multicast operation will result in another router receiving the igmp joins , and beginning the trace registration process in its own right . however the source sgm router will treat this trace registration as a completely distinct delivery point , and will continue to attempt delivery to the old destination router until its holding timer expires as above . this delivery attempt will result in a period of unnecessary packet transmission , but this will usually be restricted to the last hop . router reachability failures are dealt with as for intermediate sgm router reachability failures as described above . if another route exists , recovery will be complete . if not , the destination will eventually be pruned by the expiration of the destination holding timer as described above . if the source sgm router fails , then all the tree state is lost . normal recovery mechanisms will result in destination nodes re - sending trace packets towards the source . if another route , that is another encapsulating router , to the source station s 102 exists , this recovery may result in the new router becoming the encapsulating router and building a new tree as usual . if the source sgm router doesn &# 39 ; t fail , but is partitioned from the rest of the network , a new source sgm router may be initiated while the old source sgm router eventually ( n * t1 ) prunes off its delivery tree as a result of the failure of periodic destination refresh . turning now to fig8 , fields of an acknowledgement message 800 transmitted by a source end station in response to receiving a trace message from a hopeful destination end station are shown . field 802 contains the sgm type . field 804 contains the length . field 806 contains the offset . field 808 contains the first tree list . field 810 contains the second tree list , . . . etc . field 812 contains the n &# 39 ; th tree list . field 814 and field 816 contain padding to make the address lists come out on four byte boundaries . field 820 contains the first address list . field 822 contains the second address list , . . . etc . field 824 contains the n &# 39 ; th address list . field 830 contains the multicast source address . field 832 contains the multicast group address . field 834 contains the sequence number . the information for building the delivery tree is obtained from trace packets sent from the destination nodes towards the source of the group . the exact form of the trace packet mechanism is described herein . in the first case we will assume that the source sgm router is the ( single ) router adjacent to the source . that is , the sgm router knows that it is the encapsulating source sgm router by its proximity to the source . later we will discuss how to extend this to permit the source to be separated from the encapsulating router ( s ) by a multicast cloud . a trace packet is sent from a destination when the first member of a group joins , and periodically as described above . there are two possible mechanisms , using unicast trace packets , which is described below , or alternatively using multicast trace ( mtrace ) which is also described below . in either the unicast trace or the mtrace , the trace packet builds a list of sgm capable routers traversed in order to reach the source sgm router . there needs to be a guarantee that an ip address which goes in the list is unique . having a sgm router identified by more than one ip address can cause problems with the distribution tree . a router , for example , may have more than one ip address , for example , a different ip address for different ports . each sgm router must be identified in the list with a unique ( single ) ip address . the source sgm router acknowledges receipt of a trace packet , by sending an sgm encapsulated packet to a sub - tree of the optimized multicast delivery tree , which contains only the relevant destination router . no additional optimization is performed on the tree , which may therefore contain multiple hops . thus the acknowledgement packet is delivered over the same path which will be used for the delivery of multicast traffic and โ shares fate โ with that traffic . note that the acknowledgement of the first trace packet for the group will be delivered directly to the destination router , since the multicast tree will consist entirely of that one hop . as more destination routers are added , the tree will approach the final multicast delivery tree . the sgm type 802 is 129 ( trace - ack โ the high order bit indicating that it contains an sgm route and should be forwarded using standard sgm forwarding ) and the โ encapsulated data โ consists only of [ s , g ] and the two byte sequence number of the trace packet being acked . in an alternative embodiment of the invention , the heartbeat packet could be used instead of the trace - ack packet . however , using the heartbeat packet is not as desirable as using a specific trace - ack packet . for example , we need explicit acknowledgement that the trace from a particular destination router has successfully reached the source sgm router . it is not sufficient just to know that data is flowing , we need to know that we have found the current โ best โ path for this destination . therefore the trace - ack must be specific to a particular trace packet . as another alternative , we could sgm multicast ( rather than sgm unicast ) the trace - ack packet , but the other recipients can gain nothing from receiving the packet other than confirmation of a working delivery path . that is , the multicast trace - ack packet could be used instead of the heartbeat โ sending a trace - ack would reset the t2 timer . this multicast of the trace - ack might actually be slightly preferable , since it would avoid the additional cost on the source sgm router of computing the sgm unicast paths , and the unnecessary delivery is almost free because it replaces the heartbeat . that of course is not true if there is some genuine multicast data . note also that we would have to include the address of the destination whose sequence number we were acking as part of the โ encapsulated data โ, which would detract from using a multicast trace - ack . on triggering a trace packet for a group , the destination router sets the value of current_source_sgm_router for that group to zero . the trace packet is re - sent every trace_repeat_interval seconds , incrementing the sequence number on each transmission until a trace ack with the current sequence number is received . the ip address of the source sgm router for that multicast source ( from the ip source address of the trace ack packet ) is then recorded in current_source_sgm_router . this is used to detect changes in the source sgm router . the trace_repeat_interval in seconds may be set equal to n * t2 . the trace_repeat_interval needs to be guaranteed to be greater than the normal round trip time for trace / trace - ack packets between the destination and the source . also a window on the acceptable sequence number range is an aid in distinguishing a trace packet and its trace - ack packet . when an sgm router determines that it is the source sgm router , it performs the actions associated with a member of that group sending an igmp register . that is , the router does a pim join , or whatever action is appropriate , to pull down , that is to receive , the multicast traffic for that [ s , g ]. pim is a standard multicast protocol ( as described in rfc 2362 ) called โ protocol independent multicast โ. other non sgm domain multicast protocols from which a sgm router can receive multicast packets comprise distance vector multicast routing protocol ( dvmrp ) rfc 1075 , multicast extension to ospf ( mospf ) rfc 1584 , core based tree ( cbt ) rfc 2189 , etc . for example , under pim protocol , a pim router sends a join packet towards the source ( or towards a rendezvous point under the pim protocol ). the point is that a source sgm router must do whatever is necessary , under the multicast protocol being used for a desired multicast group , to cause it to receive traffic for the multicast group . in this example , the sgm router sends a pim join message . however , if the non - sgm domain were running a different multicast protocol , then the sgm router must do whatever is appropriate for that multicast protocol in order to receive traffic from that multicast protocol . when the last destination for [ s , g ] is removed from a source sgm router ( either as a result of receiving an sgm prune , or as a result of the destination holding timer expiring ), the router performs the appropriate multicast leave operations and purges all state for [ s , g ]. turning now to fig9 , fields of unicast trace message 900 are shown . field 902 contains the number of group addresses . field 904 contains the offset . field 906 contains a sequence number . field 910 the first group address . field 912 contains the second group address , etc . field 914 contains the n &# 39 ; th group address . field 920 contains the first address list . field 922 contains the second address list , etc . field 924 contains the n &# 39 ; th address list . a unicast packet containing the router alert option ( ra option ) is addressed to the source address . a router alert option is an ip option defined in rfc 2113 . the router alert option , if the flag is set , tells a router that a packet is โ interesting โ, and to examine the packet more closely by parsing more fields . in the event that the router alert option is not set , the router simply routes in response to the layer 2 and layer 3 fields . a unicast packet having the router alert option set is forwarded normally by non - sgm capable routers ( but it will incur the penalty of ra processing to determine that it is not interesting ). sgm capable routers append their ip address to the list , update the offset and re - forward the packet towards the source address . the internet control message protocol ( icmp ) is used for many messaging tasks in computer communications over computer networks , including the internet , and is described , for example , by william stallings in his book data and computer communications , fifth edition , published by prentice hall , copyright date 1997 , all 10 disclosures of which are incorporated herein by reference , especially pages 546 - 549 . if the sgm system is not using icmp traces , additionally a checksum may be needed here . n groups 902 ( 1 byte )= number of group addresses offset 904 ( 1 byte )= offset ( in 4 byte units ) of next free position ( initialized to zero ) in an alternative embodiment of the invention , the offset byte can be omitted if the trace packet is allowed to grow at each step ( rather than reserving space a priori ). in that case the next trace element is simply added at the end of the packet , and the length is adjusted accordingly . sequence number 906 ( 2 bytes ) group address 910 , 912 , 914 ( n groups * 4 bytes )= list of group addresses to which this trace refers address list 920 , 922 , 924 ( max trace length * 4 bytes )= list of sgm router addresses ( initialized to zero ) up to now , it has been assumed that the source sgm router is adjacent to the source host and can identify itself as such . details of how an adjacent source is detected are described hereinbelow . the source sgm router : 1 . records the state information from the trace packets , and builds the delivery tree . 2 . sends a trace - ack to the originator of the trace packet . 3 . encapsulates subsequent multicast data packets for [ s , g ]. 4 . performs whatever actions are necessary to pull down , that is to receive , the multicast traffic for the group . an sgm router that is not the source sgm router retains no state from the trace packets it forwards . this requirement allows intermediate routers to handle millions of sgm sessions , as the routers retain no state for any of the sgm sessions . however , this requirement places considerable constraint on the design that all sources must be adjacent to an sgm capable router . in an alternative embodiment of the invention , the source may be separated from the โ first โ sgm capable router by a conventional multicast domain ( that is be separated by an ip cloud ) because : 1 . it may not be feasible to deploy sgm capable routers adjacent to every host . 2 . it may be required for administrative reasons to use conventional multicast for that portion of the delivery tree between the source end station and the source sgm router . turning now to fig1 , network 10 , 000 is shown with ip cloud 10 , 002 between source end station s 10 , 001 and the distribution tree of routers . router r 1 10 , 004 is the source sgm router . the remainder of fig1 substantially duplicates fig1 , and the discussion under fig1 relating to source router r 1 120 applies to router sgm 10 , 004 , since it is the encapsulating router illustrated in fig1 . a small modification to the format of the trace packet allows the source end station s 10 , 001 to be across an ip cloud from the encapsulating router 10 , 004 . the data portion of the โ trace โ packet is carried as the data portion of an icmp echo request packet with destination address the group source ip address , source address the destination router ip address ( initially ) and an ra option . the icmp echo request identifier is set to the protocol type assigned to sgm to provide some protection against aliasing with genuine โ ping โ traffic . an sgm router intercepting the packet updates the trace information with its own unique ip address ( including adjusting the offset pointer and the ip header total length field ) and also sets the source ip address of the icmp packet to be its own unique ip address . both the icmp and ip header checksums must be modified as appropriate . any source host receiving the packet acts on it as a normal echo request and returns it to the last sgm router ( i . e . the most recent value inserted as the icmp source ip address ) as an echo reply with the trace data intact . on receiving such a packet , the sgm router establishes itself as source sgm router , builds the initial part of the tree from the enclosed trace list , and sends a trace - ack to the initiator of the trace ( i . e . the first address in the trace list ). note that the icmp sequence number is distinct from the sequence number contained within the trace , where the sequence number contained in the trace is used to increase the confidence in a trace - ack . we can &# 39 ; t use trace sequence number , because the intermediate sgm routers ( which may turn out to be the source sgm router ) cannot retain knowledge of it . that is the sgm router could increment a single ( irrespective of source or group ) 16 - bit sequence number every second and insert that as the icmp sequence number of any sgm trace packets it modifies . by testing this sequence number , the sgm router could then only accept a returned packet that is within a few seconds of the current value . there &# 39 ; s an obscure case that needs discussion . since the returned echo response packet will , presumably , still have the ra option set , it will be examined by all routers between the source and the source sgm router . it is possible , perhaps as a result of dynamic topology changes , or asymmetric routing , that one or more of these routers may be sgm capable . we then have the strange situation that we have found an sgm router that appears to be โ closer โ to the source than the router we had previously identified as the source sgm router . however , this is โ closer โ in the source to destination sense . since multicast routing uses rpf , we prefer the original , which is closer in the destination to source sense . if it turns out that the dynamic routing changes converge such that the second router really is โ closer โ in the required direction , then the source sgm router change procedures described herein will ultimately resolve the situation . hence any echo responses seen by an sgm capable router which are not directly addressed to it can safely be ignored . when the source sgm router is not an immediate neighbor of the multicast source , routing changes may result in a different source sgm router being identified by subsequent trace packets . the new source sgm router will begin to encapsulate data packets down the delivery tree , but the original source sgm router will also continue to encapsulate packets down its delivery tree , until the destination router holding timer expires . thus multicast data will be duplicated for the period of the destination router holding timer . it is undesirable to make the period of the destination router holding timer too short , because it is necessary to send 2 or 3 trace packets during this timer period to keep the destination router holding timer refreshed , and trace packets are relatively expensive . the destination router holding timer is only required to allow failing destination routers to be eventually removed from the delivery tree . for this purpose a period of a few minutes is adequate . periodic trace packets are also required at about this frequency to detect topology changes that would give rise to more optimal delivery paths . detection and recovery from delivery failure is handled by a different mechanism , triggered by failure to receive data . in order to minimize the period of duplication , a destination router checks the source address ( i . e . the address of the encapsulating source sgm router ) of each sgm encapsulated packet received , including heartbeat packets . if it does not match the value of current_source_sgm_router corresponding to the ip source address of the encapsulated multicast packet ( or that of the heartbeat packet ), it indicates that duplicate data may be being received . the data ( if any ) is delivered in any case ( a short duration of duplication is preferable to the risk of dropping data erroneously ), but an sgm prune - change is triggered , to be unicast directly to the unrecognized source sgm router . these prunes are rate limited . a value of zero in current_source_sgm_router ( indicating that the current source sgm router is unknown because a trace is in progress , is deemed to match any source sgm router . no prunes are sent until the correct source sgm router has been identified , by receiving a trace - ack . a value of no_members in current_source_sgm_router ( indicating that the destination router no longer has members for the group ) is deemed to match no source sgm router . hence , rate limited prune - leaves are sent to the source address of the encapsulated packets in response to sgm encapsulated data for the group from any source sgm router . since the source sgm router is sending heartbeats towards the destinations to suppress traces even in the absence of multicast data , we will only ever see periodic traces while the delivery path between the source sgm router and the destinations remains intact . this is true even if there is a multicast delivery failure between the source and the source sgm router ( s ). if the traces from the destinations had not been suppressed , they might have been able to discover a new source sgm router , which had connectivity to the source . it is not possible to use a heartbeat from the source to the source sgm router ( s ) to detect failures in the multicast delivery to the source sgm router . to detect this type of failure with heartbeat packets would require co - operation from the source host , and the present system avoids involving the host computer . similar functionality can be achieved by the use of pings or mtrace as discussed hereinbelow . however , frequent pings from source sgm routers are a considerable overhead . it is instructive to consider whether the gains justify the expense . once a source sgm router has joined the conventional multicast delivery tree , it is the conventional multicast protocols which will ( attempt to ) maintain the delivery path from the source to the source sgm router ( s ). failures of intervening routers and links should ( if connectivity still exists at all ) not affect the reliable delivery of multicast data to the source sgm router ( s ). if multicast routing fails to deliver multicast data to a particular source sgm router , then it is possible that the sgm router has become partitioned from the conventional multicast network . if this is the only feasible source sgm router , then recovery is impossible . but it may be that some other potential source sgm router still has multicast connectivity . each destination router is sending periodic traces at the rate of once per โ t1 โ seconds . in the steady state these will all converge on the source sgm router in question . thus , there are โ m โ opportunities per t1 seconds for a periodic trace packet to discover an alternative source sgm router , where โ m โ is the number of destination routers associated with both the multicast source and the source sgm router in question . when such a trace packet discovers an alternative source sgm router , the mechanisms described herein will cause a prune - change message to be sent to the original source sgm router . on receipt of such a prune - change message , the source sgm router performs the normal prune - leave action of removing the associated destination router from the delivery tree . in addition , it ceases transmitting downstream heartbeat packets to all destination routers associated with the source . sending of heartbeat packets is not resumed until a period of ( n + 1 )* t2 seconds has elapsed and a new trace packet for the source has been received . in the absence of genuine multicast traffic , this will cause the remaining destination routers served by this source sgm router to begin non - periodic tracing , and hence rapidly discover the new source sgm router if appropriate . if , on the other hand , multicast data is still arriving at the source sgm router , then this confirms that the conventional multicast delivery tree is still intact , and there is no harm in the non - periodic trace messages continuing to be suppressed . the effect of these mechanisms is that such a failure in the multicast delivery to the source sgm router will be repaired for the first destination in an average time of about โ t1 / m โ seconds , and the remaining destinations should catch up in a further period of n * t2 seconds . in an exemplary embodiment of the invention where t1 = 60 seconds , t2 = 1 second , n = 3 and m = 3 , we could hope for complete recovery ( if at all possible ) in around 23 seconds . clearly this time is very dependant upon m . in a further exemplary embodiment of the invention , t1 is adjusted with m to give a constant average interval between expected arrival of traces for a particular source at a particular source sgm router . this adjustment of t1 and m could easily be achieved by returning the value of m in the trace - ack packets . this adjustment also has the ( small ) advantage that the trace load scales nicely with increased group size . note that scaling of the trace load with increased group size assumes that the packets are well distributed , while experience shows the converse to be more likely . therefore , in a further exemplary embodiment of the invention , it may be worth attempting to dynamically adjust the suggested t1 intervals to achieve an approximately even distribution in arrival times of trace packets . this dynamic adjustment , may however , create processing overheads which might rule out such dynamic adjustment . the previous sections have identified a number of timers . their use is summarized here for clarity . periodic timer t1 : this timer is used for periodic functions to discover more optimal topology . destination routers send periodic trace packets every t1 seconds , and failure to receive such a packet from a destination router for a period of n * 1 results in the state for the destination being pruned . a plausible value for t1 is 60 seconds . error recovery timer t2 : this timer is used for protocol functions associated with the recovery from errors such as failed routers and links . the source sgm router guarantees to send sgm encapsulated data ( genuine multicast traffic , heartbeats , or track - acks ) at least once per t2 interval . failure to receive such data for a period of n * t2 results in the destination router initiating a trace . in the absence of a trace - ack , such traces are repeated up to trace_failure_count times at an interval of trace_repeat_inverval . once the count has been exceeded , the destination router abandons further attempt to join that [ s , g ] ( until when ?). service interruption as a result of router or link failure will be at least n * t2 seconds , rising in increments of trace_repeat_interval seconds if trace packets are lost . a plausible value for t2 is 1 second . trace repeat interval : the interval between non - periodic trace attempts . in an exemplary embodiment of the invention this timing interval is assigned the value of โ n * t2 โ. turning now to fig1 , computer network 11 , 000 is shown with multicast capable subnetworks and also using pseudo nodes . routers are indicated as follows : router 1 11 , 001 , router 2 11 , 002 , router 3 11 , 003 , router 4 11 , 004 , router 5 11 , 005 , router 6 11 , 006 , router 7 11 , 007 , router 8 11 , 008 , router 9 11 , 009 , router 10 11 , 010 , router 11 11 , 011 , pseudo interface a 11020 , pseudo interface b 11022 , and pseudo interface c 11024 . the algorithms described so far will not take advantage of a subnetwork that has layer 2 multicast capability . a separate copy of the data packet will be unicast to each child router on the subnet . this compares poorly with true ( legacy ) ip multicast which will ( usually ) multicast a single copy of each data packet to all the downstream routers on the subnet . the following sections describe enhancements to permit a similar optimization for sgm . when transmitting a trace packet , the source ip address of the enclosing icmp packet is set , not to the sgm loopback address , but to the actual transmitting interface ip address . the sgm loopback address is still inserted in the trace list as before . note that this causes the trace reply ( icmp reply ) to be returned to the interface address of the source sgm router , and not its sgm loopback address . when receiving a trace packet over a layer 2 multicast capable lan ( only ), a check is made to determine whether the source ip address of the enclosing icmp packet is a direct neighbor over that interface . if so an additional pseudonode identifier is inserted into the trace list before also inserting the sgm loopback address as normal . the pseudonode identifier is assigned uniquely to the interface within the scope of that router , and has the top 3 bits ( i . e . class d ) set to allow it to be distinguished from a genuine node identifier ( since a class d address will never be used as the sgm loopback address ). a pseudonode indicates that a node is special , in that it has a multicast capable lan . the multicast lan must be identified , as a router may have multiple multicast lans connected to its many ports . it is necessary to identify the downstream children which may be reached over which lan . the pseudonode is used to identify those children which have a common parent lan . however , the real parent is the router itself . the pseudonode is used to stand , as a router , as the parent of the downstream tree structures . the pseudonode does not appear in the final delivery tree , but the pseudonode is necessary in order to build the correct tree . an alternative would be to have a bitmap at the start of the trace packet , and set the corresponding bit to indicate that the address in question was a pseudonode identifier . using a bitmap would allow the real interface address to be used as the identifier . the additional cost of using a pseudonode identifier is four ( 4 ) bytes per multicast capable subnetwork traversed by the trace packet . in the worst case this cost could double the number of entries . however a 1500 byte trace packet is capable of containing around 370 ip addresses which are shared between trace list entries and group membership identifiers . in an alternative embodiment of the invention , the number of groups per trace packet is limited to ensure that the trace list can grow to maximum length . that is , reserve 255 * 4 = 1020 bytes for a maximum length ( maximum hop count and every router an sgm router ). that limitation would allow around 114 groups in a 1500 byte trace packet . if there are more groups than that , the groups can be split between multiple trace packets . however , splitting the groups between multiple trace packets does not work for the worst case with pseudonodes ( or for that matter for maximum transmission units ( mtus ) less than 1024 , even without pseudonodes ). a mtu is the largest packet size which can be transmitted between source and destination without fragmentation . admittedly , the worst case , 255 hops all of which are sgm capable with multicast capable subnets , is somewhat unlikely . we could probe with a single multicast group , and get the trace ack to return the actual hops and hence allow subsequent traces to fill up the available space . however , that using multiple traces does not allow for topology changes dramatically increasing the hop count . when processing the trace packet the pseudonode identifier is removed ( i . e . it never appears in the tree address list placed in the sgm data packet header .). however its presence is noted . if the set of logical children of a particular pseudonode ( i . e . the children of the parent of the pseudonode whose traces include the pseudonode ) has two or more members , those children are retained even if they themselves have only one child . retaining the children ensures that the routers that receive the multicast sgm data packet will always appear in the address list even if they are not a branch point . this is necessary to enable them to identify their position in the delivery tree , since the multicast packet is of necessity the same for all recipients . in addition , in an exemplary embodiment of the invention , each pseudonode of a particular router is given a unique identifier in the range 1 - 15 . this assignment may or may not correspond to the original interface number , which may or may not be encoded in the pseudonode identifier carried in the trace packet . however , a router may well have more than 15 interfaces , and this assignment of a unique identifier restricts it to not have more than 15 interfaces over which any one data packet requires to be multicast . this identifier is encoded in the top 4 bits of the tree list entry for each child ( the bottom 4 bits being the offset of the parent ). in order to maximize the size of distribution tree which can be accommodated within the 4 bit parent offset restriction , we can observe that no leaf node ( i . e . one with no children , whether or not it is a delivery point ), by definition , is ever referenced as a parent . by arranging that all leaf nodes appear at the end of the trace list ( this can be done without breaking the pre - ordering requirement ), we can ensure that all of the 15 available parent offset identifications are assigned to nodes which are referenced as parents . in a further alternative embodiment of the invention , this limitation of the number of interfaces to 15 can be raised by using more bits in the identifier . we would expect the following trace packets towards router 1 in the exemplary network shown in fig1 . the routers and pseudo interfaces are referred to by their number and letter designations . 5 , 3 , a , 2 , 1 6 , 3 , a , 2 , 1 7 , 4 , a , 2 , 1 10 , c , 2 , 1 8 , b , 2 , 1 9 , b , 2 , 1 11 , 2 , 1 we keep 4 , even though it is not a branch point , because a has multiple children ( 3 and 4 ). the resulting trace list is ( using hex to make the top and bottom 4 bits clearer ) r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , r 10 , r 11 when searching for children , only the bottom 4 bits of the trace list entry are compared to the parents index . thus in the above example , r 2 will treat r 3 , r 4 , r 8 , r 9 , r 10 and r 11 all as its children . however , it performs the following additional tests on the set of children . 1 . if the top 4 bits are zero , a copy is unicast to the child as normal . thus r 10 and r 11 receive unicast copies . 2 . if the top 4 bits are non - zero , it performs a next hop lookup on the corresponding ip address , to determine the output interface , and multicasts , to all - sgm routers , a copy over that interface . it then marks all subsequent entries in the children set as having been processed . thus r 3 has an entry of 12 , hence it looks up r 3 , determines that interface a is the output interface , multicasts a copy over that interface and sets the remaining entries for 12 ( r 4 ) as processed . the next child of r 2 is then r 8 , and the process is repeated over interface b . on receipt of a multicast copy , an sgm router needs to find its own position in the address list . this could be achieved by always scanning the address list looking for one &# 39 ; s own address , but that involves n 4 byte compares . the number of compares can be restricted by the following algorithm . note that when sending the multicast copy , the pointer is always adjusted for the first of the children . if the entry corresponding to the pointer has the top 4 bits zero no address check is required and the algorithm works as before . if the top 4 bits are non zero , the address corresponding to the pointer is checked against the receiving router &# 39 ; s own address . if it matches , the current location is correct and forwarding can proceed as normal . if not , it searches along the tree list ( starting from the current location ) looking for the same value ( including the top 4 bits ) as the current entry . if it finds it , it again checks the corresponding address , and if it matches , the search terminates and the packet is forwarded as normal , otherwise the search continues . if the search fails to find an entry the packet is discarded , since this must have been a multicast packet received by virtue of a router which is not a member of the tree being on the same lan as members of the tree . to proceed with the example , when r 3 receives the multicast copy it finds the pointer at 3 , and the top 4 bits of the entry have the value 1 . it therefore checks its own address against 3 , finds a match and forwards normally . when r 4 receives the packet , it performs the same checks , but this time the address doesn &# 39 ; t match , so it searches for the next entry ( 4 ) with the value 12 . the address check of 4 now succeeds and forwarding proceeds normally . if there were another router ( r 12 say ) on lan a , which was not part of the delivery tree , it too would receive the multicast packet , but both checks would fail , and so it would be discarded . the number of checks which a router must perform can become large , for example , in a lan with n downstream members of the tree , not only do each of those routers have to perform up to n checks ( overall a total of n ( n + 1 )/ 2 checks per packet ), but every router on the lan which is not a member of the tree must also perform n ( failing ) checks . further optimizations may be possible , taking advantage of the fact that there may be multiple groups that share the same source or source sgm router ( s ). on balance , they may not be worth the extra complexity they introduce , but they are discussed below for completeness . a destination router may have multiple active groups that share the same multicast source ( and implicitly , the same source sgm router ). in this case a single trace may be sent for the entire set of groups , containing a list of the group addresses to which it refers . however , with mtrace traces there is no space in the trace packet for a list of groups , since the group is encoded in the single mtrace โ group address โ field . not only does sending a list of groups in one trace packet reduce the bandwidth requirements for trace packets , but it may also reduce the memory requirements in the source and destination sgm router ( s ). in this case of a list of groups in one trace packet the destination sgm router need maintain current_source_sgm_router only per source , and not per [ s , g ]. however , separate trace - acks will still be required , since the sgm delivery trees for the groups may be different , owing to their different membership . for similar reasons , it is not possible to use traffic or sgm heartbeats arriving at a destination router for one group to imply correct operation of any other group even though they share the same source and source sgm router . the algorithms described above require the multicast source to process at least one trace packet per periodic time โ t1 โ for every distinct destination router served by all groups to which it is transmitting . under normal conditions the traces will all converge at one ( or more ) source sgm router ( s ). the portion of the trace from the source sgm router to the multicast source and back is only necessary to detect the arrival of a new sgm capable router closer to the source ( once the initial detection of the source sgm router has been accomplished ). limiting the number of such packets can therefore reduce the load on the multicast source . when a router sees a trace packet travelling to the source s , and it already has encapsulation state for [ s , *] ( i . e . it is a source sgm router for [ s , *]) it can โ short circuit โ the delivery of such trace packets provided at least one such packet per โ t1 โ interval is allowed to pass unimpeded . such short - circuited packets must be processed as if they had been received as responses from the source . this reduces the load on the multicast source to one trace packet per t1 interval , but still maintains the possibility of discovery of a closer source sgm router within that interval . note that this optimization does not necessarily conflict with the mechanisms described for recovering from failures which require the detection of a new source sgm router . only those trace packets that actually pass through the current source sgm router are affected . where the path from the destination router to the potential source sgm router does not pass through the existing source sgm router there will still be m opportunities per t1 seconds . multiple groups with the same source sgm router , but different sources since the sources are different , it is necessary to use separate traces , as they may subsequently identify different source sgm routers for the groups . the same arguments as above preclude the use of common trace - acks or heartbeats unless the delivery trees of the groups are identical . turning now to fig1 , an alternative encapsulation of multicast data referred to as a minimal encapsulation multicast packet 12 , 000 is shown . field 12 , 002 contains the sgm type . field 12 , 004 contains the number of nodes in the distribution tree list . field 12 , 006 contains the offset . field 12 , 008 contains the time to live ( ttl ) value taken from the normal unicast ip header . field 12 , 010 contains a checksum . field 12 , 012 contains the prot value ( that is the contents of the protocol field of the ip header ). this field indicates the protocol carried by the original multicast data ( for example udp ). this prot field is needed because in the minimal encapsulation header the prot field in the outer ip header is replaced with a value indicating sgm . field 12 , 014 contains the first tree list . field 12 , 016 contains the second tree list , etc . field 12 , 018 contains the n &# 39 ; th tree list . field 12 , 020 , 12 , 022 contain padding . field 12 , 024 contains the first address list . field 12 , 026 contains the second address list , etc . field 12 , 028 contains the n &# 39 ; th address list . field 12 , 030 contains the original multicast source address . field 12 , 032 contains the original multicast destination address . field 12 , 034 is the first field of the original multicast data . in the existing encoding for an sgm data packet , several fields are duplicated between the original multicast header and the ip header of the sgm data packet . by using similar techniques to rfc 2004 โ minimal encapsulation within ip โ, this duplication can be avoided . the modified sgm data packet is as shown in fig1 . the original multicast source and destination addresses from the multicast packet ( together with the data of course ) are kept intact , but the preceding parts of the original header are stripped out . the original prot is stored in the sgm header field 12 , 012 ( the outer ip header prot , being set to sgm ). tos , ident , frags and ttl are copied into the outer ip header ( and copied back on decapsulation ). the sgm header ttl field 12 , 008 is still required for multicast capable lans as described herein . the sgm checksum field 12 , 010 covers the original multicast source and destination addresses as well as the other sgm header fields . however if all the sgm header fields were covered it would be necessary to incrementally adjust the checksum when the offset ( and ttl ) are changed . therefore , the sgm checksum is defined to start at the checksum field 12 , 010 . omitting the offset exposes the venerability to corruption of the offset but this can only cause the following errors : if it is corrupted to an earlier value , the packet may be returned to a previous point in the delivery tree , causing duplication along the branches not leading to the current router . the branch below the current router will receive a single copy of the packet . no data loss will occur , and a single instance of corruption will only cause a single instance of duplication , since the contents of the offset field will be reset . unlike corruption of an address list value to an address earlier in the list , which can cause repeated duplication ( until ttl runs out ) if we rely on searching the address list to find the current router . use of the offset field protects against repeated duplication . 1 . if it is corrupted to a later ( but still valid ) value , the intervening branches will suffer packet loss ( since the packet will appear to โ jump โ to the later point in the tree ). 2 . if it is corrupted to an invalid value , the branch below the current router will suffer packet loss . benefits : deleting the offset saves 11 bytes ( or thereabouts , because of alignment issues ) compared to the full encapsulation . for example , in what might be a common case of three delivery points from a common fan out ( i . e . 3 addresses in the address list ), the minimal encapsulation would cost a total of 32 bytes encapsulation overhead , compared to 44 bytes with full encapsulation headers . for a typical uncompressed voip packet , which is about 50 bytes , that &# 39 ; s a 64 % overhead compared to 88 %. this should be compared to the โ overhead โ of using separate multicast packets , which in the above case would be 200 %, since 3 unicast packets would be required . costs : this form of encapsulation is less efficient for encapsulation and decapsulation . it also precludes the possibility of using a separate tos value for the sgm encapsulation , since this must be copied from the original multicast packet . fragmentation is an issue with sgm , whatever encapsulation is used , since an sgm packet may be fragmented by intermediate non - sgm routers ( i . e . by performing normal ip fragmentation on the outer ip header ). since not all fragments will contain the sgm header , and hence cannot be sgm forwarded , it is necessary for sgm routers ( i . e . the destination of the outer ip header ) to perform re - assembly before sgm forwarding . the situation is complicated if the โ minimal encapsulation โ sgm header is used , since there is then only one set of fragmentation information . if the multicast packet were already fragmented before sgm encapsulation , it would invoke re - assembly at each sgm hop . presumably , since it required fragmentation in the first place , it would then need to be re - fragmented for transmission . given that ( potential ) re - assembly at every sgm router is highly undesirable , the best solution may be to set the โ don &# 39 ; t fragment โ bit in the outer ip header , and hence never do any re - assembly at an sgm router . ( this would be desirable even with a full header encapsulation ). in the case of โ minimal encapsulation โ it would be necessary to find a single bit somewhere in the sgm header to carry the original value of the df bit . df and mf are flags in the ip header . when df is set , it means do not fragment the packet . when the mf flag is set , it means that there are more fragments . however , if the original multicast packet had previously been fragmented this could result in a packet with df set and non - zero values for either or both of mf and fragment offsets . it is not clear whether this would be treated as an error by any ip implementation . if it would , then it would be necessary to store the whole 16 bits of the fragmentation fields in the sgm header , which makes the โ minimal โ somewhat less attractive . turning now to fig1 , a worst case routing multicast tree 13 , 000 is shown . source computer s 13 , 002 is the source of a multicast transmission . routers comprise : router r 1 13 , 004 ; router r 3 13 , 006 ; router r 5 13 , 008 ; router r 7 13 , 010 ; router r 9 13 , 012 ; router r 2 13 , 020 ; router r 4 13 , 022 ; router r 6 13 , 024 ; router r 8 13 , 026 , etc . multicast destination computer d 1 13 , 031 receives multicast packets from delivery node router r 4 13 , 022 . multicast destination computer d 2 13 , 036 receives multicast packets from delivery node router r 8 13 , 026 . multicast destination computer d 4 13 , 038 receives multicast packets from delivery node router r 9 13 , 012 . multicast destination computer d 5 13 , 030 receives multicast packets from delivery node router r 2 13 , 020 . multicast destination computer d 6 13 , 034 receives multicast packets from delivery node router r 4 13 , 024 . small group multicast is designed to operate with a โ small โ group . however , the limiting factor is not the size of the group ( i . e . number of group members ) per se , but rather the size of the encoded delivery tree . the size of the encoded delivery tree depends on the number of destination routers ( which may each serve multiple group members ) and also on the topology of the delivery tree . an example of a worst case delivery tree is shown in fig1 . n delivery nodes require an encoded tree of length 2n โ 1 . the best case ( ignoring the trivial case where the encapsulating router sends a packet directly to each delivery node , requiring a zero length encoded tree ) is where each node on the tree is itself a delivery node , which requires an encoded tree of length n . thus for any set of n delivery nodes , the encoded length may vary between n and 2n โ 1 depending on the topology . since the topology may change during the lifetime of the group , the encoded tree length may also change between these limits even if the number of delivery nodes remains constant . equally , the number of delivery nodes may change as nodes join and leave the group . a number of possible strategies for controlling the size of the encoded tree are discussed below . the absolute worst case is when each delivery node serves a single member as in fig1 where delivery node routers r 2 , r 4 , r 6 , r 8 , and r 9 each serve only one destination computer , or group member . the topology of fig1 is close to requiring worst case encoding . for example , if limiting the number of members to a maximum of 5 group members were permitted , the encoded tree would never exceed 9 addresses . this would be a simple strategy to explain to users , but is severely restrictive . it is also hard to police , since the actual number of group members is unknown to the sgm protocols . however , a protocol using source information supplied by members could possibly police a limitation on the number of members . since each destination router is required to perform a trace and receive a trace - ack when it โ joins โ the group , it is possible for the source sgm router to check the current number of destination routers , and reject the join attempt ( by sending a trace - nack ) for a new destination router . a โ hard โ worst case limit can be chosen which will guarantee an upper limit on the size of the delivery tree irrespective of any topology changes . where there are multiple source sgm routers , each sgm router will independently acquire a set of destination routers , and limit the size of only that subset . subsequent topology changes could then make one or more source sgm routers redundant which may in turn cause one or more of the remaining source sgm routers to exceed the limit . 1 . dynamically remove one or more destination routers โ not very friendly to existing users , but at least its simple ! we could just use the normal algorithm of rejecting those above the threshold . doing anything else , such as lifo , would be difficult . since the state for the โ old โ source sgm routers will be lost , if the new set of source sgm routers has no overlap with the old set , all the destinations will appear to be new . the first destinations to send traces will then be ( arbitrarily ) accepted and the remainder rejected . 2 . allow the encoded tree size ( and hence the packet size ) to exceed the desirable limit โ but since the number of source sgm routers is unbounded , so too is the size of the encoded tree . 3 . adjust the delivery tree to remove one or more intermediate nodes at the expense of making the delivery tree less efficient , since multiple copies of a packet would be sent over some links . in the extreme , data packets could be unicast to each delivery node , which would partially defeat the purpose of using multicast . a similar effect could be obtained by splitting the delivery tree into two ( or more ) parts , each of which is below the critical limit . some intelligence into exactly which nodes to eliminate could be introduced by having the sgm trace message include the current value the icmp message hop count for each entry ( from which we can deduce the number of unicast hops corresponding to each sgm hop .) this could be used as a weighting when evaluating the modified delivery tree . 4 . communicate the number of destination nodes associated with each source sgm router and enforce a limit for the entire set . this could perhaps be done by including the current count in the source sgm router to multicast source mtrace messages . however , this would not allow the election mechanism to be used to minimise the number of such mtrace packets . alternatively , the source sgm routers send the number only when it changes , and it gets acked in the โ designated โ source sgm router &# 39 ; s message . but there may be insufficient number of fields to encode all that in an ordinary mtrace packet . further , there are numerous timing issues , which could give rise to uncertainly about the correct total . even when there is only a single source sgm router , ( or where there exist multiple source sgm routers , but their sub - trees do not become merged ), a topology change can potentially result in a factor of 2 ( actually ( 2n โ 1 )/ n ) increase in the size of the encoded tree . this size increase can be contained by limiting the maximum number of destination routers assuming the worst case topology . alternatively , a more optimistic assumption about the topology can be used , and worst cases can be dealt with by using the techniques outlined above . the space required in the sgm header for the encoded tree is unpredictable , and may vary during the lifetime of a group ( as a result of topology changes , or joining and leaving of destinations ). if the header size is kept to the minimum capable of containing the current delivery tree , then the header size , and hence the available mtu , will also vary . conversely , if sufficient space in the header is always allocated to contain the worst case encoded tree , the mtu will remain constant , but there will be significant wasted bandwidth . the variation is approximately 5 ( n โ 1 ). so for n = 5 it is about 20 bytes , and for n = 10 about 45 bytes โ a significant fraction of the total packet size for small payloads . each node requires 4 bytes for the ip address and one byte for its tree entry , but the total length is rounded up to a 4 - byte boundary . the best compromise is to calculate mtu assuming worst case tree length , but adjust the header length to reflect the current encoded tree length requirements . this compromise would not work if a totally unbounded extension of the header size is adopted , as suggested above to deal with merging source sgm router trees . if a totally unbounded extension of the header size is adopted , a higher upper bound could be enforced to accommodate most situations , and use one of the other techniques if the length of the header attempted to exceed the higher upper bound . the sgm tree information is never required for the final hops ( that is , from the last fan out point to the delivery router โ except of course for the cases where the last fan out router is a delivery router ). by stripping final hop information out of the packet before the final forwarding , another 20 bytes could be saved ( for the 3 way example ) reducing the overhead to 24 % for those hops . ( the sgm type , prot , checksum and the sa and da . are still required , giving a 12 byte overhead = 12 bytes ). such a packet shrinking operation is likely to be rather costly , but could perhaps be justified by the fact that the last hop is likely to be at the edge of the network and hence have lower bandwidth capable links . another way of looking at this is to say that for any particular hop , sending a single sgm packet is roughly comparable to sending 2 unicast packets ( for 50 byte packets and small tree lists ). so it is only on the final hops ( where there would be no packet duplication even in the multiple unicast ) that sgm is at a serious disadvantage . on hops which would require 3 or more unicast packets sgm almost always wins . of course sgm can never do better than true multicast . while the ability to carry both topology information and group membership information in the trace mechanism seems attractive at first sight , it leads to some unfortunate complications ( such as limitations on the size of trace lists and numbers of groups reported ). an alternative strategy of separating this information is explored below . in an alternative embodiment of the invention , trace messages are per source only . trace messages contain no group membership information . also , a new group membership notification ( gmn ) message is introduced . the new group membership notification message comes in two flavors . a complete gmn which is simply a complete list of the current group membership at that egress point ( per source ), and an incremental which contains a list of groups to be added and a list of those to be removed either of which may be null ( analogous to a pim join / prune ). a gmn message is normally sent by an egress , or destination , router whenever a trace ack message is received , and the gmn message is unicast to the source router . the gnn is unicast directly to the current_source_sgm_router . if current_source_sgm_router is zero , the unicast transmission must wait until the source sgm router is known . the gnn is always sent as a โ single โ ip data message , fragmenting if necessary so that information about as many groups as desired is included . an incremental gmn is sent whenever the group membership changes . further , a complete gmn is sent whenever current_source_sgm_router changes from zero to some real value , that is whenever a successful trace - ack is received . gmns are not acknowledged , but if one is lost ( assuming it was an add gmn ) we will fail to get data / heartbeats for that group , and hence trigger ( in the first instance ) a new trace , which ( assuming it is successful ) will cause a complete gmn to be sent โ hopefully correcting the problem โ if not , the sequence repeats . if the lost gmn were a remove gmn , then we will continue to receive data / heartbeats , so this reception of heart - beats will re - trigger a gmn remove ( rate limited of course ). alternatively , we could just let the heartbeat transmission die as a result of no trace packet transmission by the destination router . the trace ack is no longer sgm unicast as in other alternative embodiments of the invention , it is just plain old unicast to the destination . every โ n * t2 โ time period each egress router , i . e . destination router , checks the groups which it receives , and which are associated with each source , and if there is at least one group which hasn &# 39 ; t received a data or heartbeat packet since the last check or if current_source_sgm_router is zero , then the egress router sends a trace for that source , setting current_source_sgm_router to zero . on receipt of a responsive trace ack ( with the right sequence number etc .) the destination , or egress , router sets current_source_sgm_router to the source of the ack as before , and then the destination router sends a complete gmn to current_source_sgm_router . this gmn overrides any group state about this egress router that the source sgm router previously possessed . prune messages ( leave and change ) now only refer to the egress router as a whole and contain no group information . arrival of a prune ( of whatever flavor ) at the source router removes the egress router and all its associated group information from the source sgm router . to simply remove a group , but continue to receive other groups the egress router sends a gmn message to the source router with the group in the prune list . in this alternative embodiment of the invention , instead of including the group list in the trace message ( and hence causing problems with size etc .) this alternative embodiment makes the group list a separate message sent in response to a trace - ack . with this alternative embodiment of the invention , new groups may be added without the need to send a trace message . so if a long โ t1 โ timer is used , and the topology is reasonably stable , short duration groups may be added and removed fairly cheaply . in an alternative embodiment of the invention , the multicast source end stations execute software which does all of the tasks attributed hereinabove to the source router , including encapsulating the multicast packet in a sgm packet format . correspondingly , the multicast destination end station executes software which does all of the tasks attributed hereinabove to the destination router , including de - encapsulation the sgm packet when it arrives at the destination end station . in this embodiment of the invention , the trace packets are transmitted by the multicast destination end station and are received and interpreted by the multicast source end station . the multicast source end station builds the multicast delivery tree from addresses of intermediate routers carried in the address lists of the different trace packets received by the multicast source end station from different multicast destination end stations . the multicast source end station places the multicast delivery tree in the header of a sgm packet with the ordinary multicast packet as data in the sgm packet , and then transmits the sgm packet to the first hop router on the multicast delivery tree route to the intended destination end stations for the multicast group . this embodiment of the invention requires modification of software in all multicast destination end stations , both those serving as source end stations and those serving as destination end stations . changing software on all potential destination end stations is a daunting task , and requires either modifying the operating system running on each potential destination end station , or executing special application software to accomplish the necessary tasks . turning now to fig1 , a block diagram of a typical network device 14 , 000 is shown . for example , network device 14 , 000 could be a router operating at layer 3 , a bridge operating at layer 2 , or a switch operating at any layer , including a layer 4 switch , etc . for convenience we refer to network device 14 , 00 as a router . central processor unit ( cpu ) 14 , 002 manages operation of the router . memory 14 , 004 holds data structures , data , and instructions useful to operation of router 14 , 000 . memory 14 , 004 may be any type of electronic memory , random access memory ( ram ), read only memory ( rom ), etc . input / output device 14 , 006 ( i / o device ) for example , may be a disk drive to facilitate operation of router 14 , 000 . i / o device 14 , 006 is optional , and many designs of routers do not use an i / o device 14 , 006 . i / o device 14 , 006 may be , for example , an internal hard disk drive or , for example , a floppy disk drive . or as a further example , i / o device 14 , 006 may represent both a floppy disk drive and an internal hard disk drive . media 14 , 007 may represent a removable disk for use in i / o unit 14 , 006 when it represents a floppy disk drive . media 14 , 007 may be , for example , a standard 1 . 4 megabyte 3ยฝ inch floppy disk , or for example , media 14 , 007 may represent any type of computer readable media . as a further example , i / o device 14 , 006 could also represent a tape input / output device , and media 14 , 007 would then represent a tape readable by the i / o device 14 , 006 . for example , the various tables used by router 14 , 000 may be stored on disk 14 , 006 . that is , the three tables : first , the locally reachable bridge table which the bridge ( or router ) uses to bridge using layer 2 frame information from one of its ports to another port , and which is used when an incoming packet has in its layer 2 destination address an address other than the layer 2 address of the router ; second , a remotely reachable table which a peer router uses to determine which peer router it should forward an incoming frame to as an extension of its bridging function , such as use of dlsw routing protocol for a frame having a layer 2 destination address different from the layer 2 address of the router ; and third , a routing table which the router uses for ordinary layer 3 routing functions and which is used when an incoming packet has in its layer 2 destination address the layer 2 address of the router , may all be stored on a disk in i / o device 14 , 006 . also layer 4 switching tables may be stored to disk in i / o device 14 , 006 . alternatively , the tables may be maintained in memory 14 , 004 in the event that no disk drive is used in the router . in any event , the tables will be in memory 14 , 004 for use by the various bridging and routing functions of router 14 , 000 . network circuit 14 , 008 contains the major bridging and routing circuits of router 14 , 000 . bus 14 , 010 connects the cpu 14 , 002 , memory 14 , 004 , disk ( if any ) 14 , 006 , and network circuits 14 , 008 together so that they can exchange information by use of typical bus protocols . network circuit 14 , 008 contains the circuits responsible for input from local area networks ( lans ), output to lans , circuits for bridging of data packets , and circuits for performing routing , and possibly memory circuits to facilitate fast switching , etc . switching is a general term used for fast transfer of packets from an input lan to an output lan . particularly , bridging of packets using only layer 2 constructs , is accomplished by network circuit 14 , 008 . each port 14 , 012 , 14 , 014 , 14 , 016 of router 14 , 000 connects to a different local area network ( lan ). layer 3 routing may be accomplished either by network circuit 14 , 008 , or by the use of software running in cpu 14 , 002 , or , for example , by a combination of network circuits 14 , 008 and software running in cpu 14 , 002 . for example , port 14 , 012 connects to a lan designated as lan 1 14 , 022 . port 14 , 014 connects to lan 2 14 , 024 . there may be a large number of ports , and the highest numbered port is represented as port n 14 , 016 , where lan n 14 , 026 is shown connected to port n 14 , 016 . the three dots 14 , 030 indicate that network circuits 14 , 008 may serve many router ports . each port is connected to its transmitter and receiver . as an example , one or more of the ports 14 , 012 , 14 , 016 , etc . may connect the router to a tcp / ip network cloud . transmitter and receiver circuit xmit / rcv 14 , 032 serves port 14 , 012 and lan 1 14 , 022 . xmit / rcv circuit 14 , 034 serves port 14 , 014 and lan 2 14 , 024 . there is a transmit and receive circuit for each lan , and so correspondingly xmit / rcv circuit 14 , 036 serves port n 14 , 016 and lan n 14 , 026 . the exemplary network device 14 , 000 shown schematically in fig1 is representative of only a very simple design of a network device . other switching arrangements are often used in modern routers , including crossbar switches , multiple crossbar switches , etc . however , the simple schematic block diagram of fig1 is meant to only represent the general operations of a network device , including a router . the layers of the internet protocol communications model are implemented in various convenient hardware elements as shown in the block diagram of a router of fig1 . the internet communications model is described by andrew tanenbaum in his book computer networks , third edition published by prentice hall publishing company copyright 1996 , all disclosures of which are incorporated herein by reference , especially at pages 35 - 38 . for example , depending upon the design of the router , layer 1 and layer 2 may be implemented in hardware in the circuits of network circuits 14 , 008 . alternatively , field parsing and recognition functions may be implemented in software which executes on cpu 14 , 002 in connection with memory 14 , 004 . higher layer functions such as layer 3 network , or layer 4 transport , may be implemented in software executing on cpu 14 , 002 . layer 4 reliable transport implemented in the transport layer is usually implemented in software executing in cpu 14 , 002 , although even layer 4 functions may be implemented in hardware by using an asic semiconductor chip . network device 14 , 000 may alternatively , be referred to as a bridge with a dlsw layer 3 port , or as an alternative network device 14 , 000 may be referred to as a router , or as a still further alternative router 14 , 000 may be referred to as a โ switch โ. the acronym โ dlsw โ stands for data link switch . the term โ switch โ often refers to internal operation of the hardware . a switch may operate in layer 2 , layer 3 , or in layer 4 . alternatively , in hardware having router or bridge functionality , the network device 14 , 000 may function internally as a hardware switch . operations requiring both bridge module and router module operation may function as a software switch , and may use function calls between the different modules . and the internal forwarding structure may be a switch , and both bridge and router modules execute in cpu 14 , 002 . a switched lan is described by andrew tanenbaum in his book computer networks , third edition , published by prentice hall , copyright date 1996 , all disclosures of which are incorporated herein by reference , particularly pages 285 - 287 . data structure 14 , 050 is , for example , stored in memory 14 , 040 . data structure 14 , 050 has field 14 , 052 containing tree list 1 210 a , tree list 2 210 b , tree list 3 210 c , etc . as shown in fig2 . these tree lists are written to the header of multicast data packet 200 as shown in fig2 . data structure 14 , 050 also has fields 14 , 054 containing address lists 210 a , 210 b , 210 c , etc . again , address lists 210 a , 210 b , 210 c , etc . are written into the header of multicast data packet 200 by cpu 14 , 002 before the multicast data packet is transmitted by network circuits 14 , 008 . it is to be understood that the above described embodiments are simply illustrative of the principles of the invention . various other modifications and changes may be made by those skilled in the art which embody the principles of the invention and fall within the spirit and scope thereof .
| 7 |
the systems and methods of the invention can effectively communicate with and manage devices in a local or widely distributed building automation system ( bas ), from a space or building level to an enterprise level , encompassing virtually any structure , cluster , campus , and area in between . a bas according to one embodiment of the present invention comprises a dynamically extensible and automatically configurable architecture anchored by an enterprise server engine ( ese ). the bas and ese comprise a versatile and robust control system that operably supports the management of hvac and other subsystems in a building from a central location . the bas can be an automatically and intelligently scalable object - oriented system in one embodiment , providing multi - site management capabilities in a local or widely distributed geographic area . the bas is preferably networked for user accessibility . the systems and methods are particularly suited for a dynamically extensible and automatically configurable bas and architecture , such as those disclosed in u . s . patent application ser . no . 11 / 208 , 773 , filed aug . 22 , 2005 , entitled โ dynamically extensible and automatically configurable building automation system and architecture โ; u . s . patent application ser . no . 11 / 316 , 687 , filed dec . 22 , 2005 , entitled โ building automation system facilitating user customization โ; u . s . patent application ser . no . 11 / 316 , 699 , filed dec . 22 , 2005 , entitled โ building automation system facilitating user customization โ; u . s . patent application ser . no . 11 / 316 , 702 , filed dec . 22 , 2005 , entitled โ building automation system facilitating user customization โ; u . s . patent application ser . no . 11 / 316 , 695 , filed dec . 22 , 2005 , entitled โ building automation system data management โ; u . s . patent application ser . no . 11 / 316 , 697 , filed dec . 22 , 2005 , entitled โ building automation system data management โ; u . s . patent application ser . no . 11 / 316 , 698 , filed dec . 22 , 2005 , entitled โ building automation system data management โ; u . s . patent application ser . no . 11 / 316 , 703 , filed dec . 22 , 2005 , entitled โ building automation system data management โ; and u . s . patent application ser . no . 11 / 316 , 410 , filed dec . 22 , 2005 , entitled โ dynamically extensible and automatically configurable building automation system and architecture ,โ all of which are assigned to the assignee of the claimed invention , and are herein incorporated by reference . the invention can be more readily understood by reference to fig1 - 5 and the following description . while the invention is not necessarily limited to the specifically depicted application ( s ), the invention will be better appreciated using a discussion of exemplary embodiments in specific contexts . fig1 depicts an exemplary embodiment of a process reconnect manager . the reconnect manager is responsible for managing the logical processing steps for re - establishing lost communication connections with individual devices . it can be automatically configured to periodically iterate through all of the end devices or spaces associated with a bas in order to obtain a device &# 39 ; s status . the refresh rate , or the amount of time between communication requests , increases over time to reduce the overhead on the network . if there is no available device information the reconnect manager can set the refresh rate to the minimum value , further reducing the communication load on the bas network . an example of the processing logic in a potential embodiment of a reconnect manager that takes active responsibility in establishing a communication connection with a device is shown in fig1 . in the example embodiment the reconnect manager only begins executing this algorithm upon detecting that a device has stopped communicating 100 , as indicated by the device being placed on an off - line devices list . the later discussion of fig4 illustrates a process of determining when communication with a device has stopped . if there is device collection data available the reconnect manager checks to see if the device associated with that data is on - line ( 101 ). if the device is on - line the process reconnect manager iterates ( 100 ) to the next device with collection data available . in the case where all the devices are on - line , the reconnect manager simply clears the list of any previously off - line devices . when the process reconnect manager detects a device that is off - line the process reconnect manager transmits a verify message to the device via a command link , typically a wired connection . the reconnect manager will then wait for a period of time determined by the amount of time the device has been off - line before attempting to retransmit a subsequent verify message . in the example embodiment shown in fig1 , if the off - line time is less than 10 minutes the refresh rate ( 106 ) is set to 15 seconds . this short interval is based on the relatively short time period that the device has been off - line . as the off - line time increases the refresh rate delay does so as well . these refresh rates and off - line periods can be initially configured during system installation or later modified by a user based on the needs of the bas . the decay algorithm in one potential embodiment can be a hard - coded value that cannot be tuned or changed by the user . if a device has been off - line for less than 10 minutes , the refresh rate ( 106 ) ( or the frequency of the reconnect attempts ) is 15 seconds . if a device has been off - line more than 10 minutes but less than 30 minutes , the refresh rate ( 107 ) is 30 seconds . if a device has been off - line more than 30 minutes but less than 60 minutes , the refresh rate ( 108 ) is 60 seconds . if a device has been off - line more than 1 month the system assumes that the device no longer exists in the system , or has irreversibly failed , and is removed from further processing attempts ( 109 ). if the reconnect manager is able to successfully transition a device from the off - line state into an on - line state then the refresh state is set to the minimum time period for the system ( 111 ). the reconnect manager then proceeds to the next panel in the iteration . once a device is brought back on - line the device is removed from the off - line devices list ( 112 ). fig2 depicts one embodiment of a communication - polling manager . the communication - polling manager iterates through all of the devices provided by a heartbeat manager ( 200 ) and retrieves the current state of each device ( 201 ) through the associated link between the enterprise server engine of the bas and the individual device or module associated with the device . preferably the heartbeat manager only provides the communication - polling manager with devices that are known to be off - line . unlike a simple polling mechanism where all devices are periodically queried , one advantage of this exemplary embodiment is to utilize the normal communications mechanisms for on - line devices and when an off - line condition occurs , the system will dynamically poll the off - line device using a mediated decay - algorithm to bring the device ( s ) back on - line . successful normal communications can also bring devices back on - line as discussed below regarding fig4 . this service allows bas administrators to establish a selective pinging process that checks on the communication state of devices while keeping network traffic to a minimum . if this process brings a device back on - line , or discovers that a device has gone off - line , it is registered with the reconnect manager . alarm conditions can be triggered for both communication loss ( 208 ) and communication restore ( 205 ) based on customer configuration preferences . the separation of the communication polling manager and the reconnect manager provides the system with separate mechanisms for monitoring on - line devices for on - line to off - line transitions , and attempts to bring off - line devices back on - line . messages , flags , signals or other indications can be passed between the communication polling manager and the reconnect manager in order to coordinate the status of the individual devices . if the device is in the on - line state the communication polling manager checks to see if a flag has been set to alarm the transition from an off - line state to the on - line state ( 207 ). if the flag is set then the alarm is raised for that transition ( 208 ). if there is no flag indicating that an alarm should be raised for the off - line to on - line transition , likely due to the fact that the device was already on - line of the user has chosen to suppress the alarm , then no alarm is raised . if the device is in the off - line state the communication polling manager checks to see if a flag has been set to alarm the transition from an on - line state to the off - line state ( 204 ). if the flag is set then the alarm is raised for that transition ( 205 ). if there is no flag indicating that an alarm should be raised for the on - line to off - line transition . fig3 is a flow diagram depicting an embodiment of a smart - communication request . a smart - communication request is one that checks the communication state of the device ( 300 ) before sending a request over the wire , or making a raw - communication ( 301 ). this can be done as a performance optimization due to communication time - outs which can cause delays in processing and degrade the performance of the system . it also can be utilized to limit communication attempts with devices that are off - line to attempts made by the reconnect manager . fig4 is a flow diagram depicting raw - communication requests and expands the raw - communication block ( 301 ) in fig3 . a raw - communication request is one that will be sent over the wire , which is the actual transmission of signals out on the communication link to the device , regardless of the current communication state of the device . if the device is on - line , the reconnect manager is notified that communications is restored if the device was previously off - line ( 402 and 403 ). conversely , if the device is off - line , the reconnect manager is notified that communication to the device has been lost if the device was previously on - line ( 405 and 406 ). typically the reconnect manager should use raw communication requests as opposed to smart - communication requests . fig1 through 4 together depict an embodiment of an active device manager that can be implemented as part of a communication management component in a bas . the normal communication requests can bring a device on - line , or off - line . the โ smart requests โ prevent a barrage of communication requests that can cause performance problems . the reconnect manager implements a mediated re - connection algorithm that has a decaying algorithm that reduces the re - connect attempts over time . this is in recognition that on - line devices have a tendency to stay on - line and recover quickly from a communication loss . and that off - line or disconnected devices have a tendency to stay off - line and not recover as quickly . finally , the connection manager allows a user or bas administrator to establish a customized dynamic polling mechanism for detecting and reporting on the communication state for devices in the network . this polling mechanism works in concert with the rest of the other processes and produces no extra overhead on the network or the end devices . referring to fig5 , a bas 10 embodiment can comprise an enterprise server engine ( ese ) 20 preferably located at a central location 12 , such as a headquarters or control station . ese 20 comprises a single local device in one embodiment . in another embodiment , ese 20 comprises a multiple server configuration operating in a local or distributed environment . โ central โ location 12 , as understood by those skilled in the art , is not necessarily a geographic center but rather a communicative or control - based location in one embodiment from which it is convenient or feasible to manage bas 10 . for example , a user may manage one or more bass at locations nationwide or within a region from a single headquarters location . ese 20 is preferably locally networked at location 12 and communicatively coupled to the internet and / or intranet 30 and therefore can provide access and management control from virtually any location via a computer system , internal or external to a user &# 39 ; s computer system . ese 20 and bas 10 need not be web - based or communicatively coupled to the internet as shown in fig5 , as other options known to those skilled in the art exist . the internet and / or intranet ethernet / ip 30 or another local area network ( lan ) or wide area network ( wan ) facilitate communications between ese 20 and other system components and devices . some or all communications and connections may be either wired or wireless within portions of bas 10 as needed or desired . each implementation of system 10 can vary substantially by size , composition of devices , and balance of present , legacy , and future generation devices . system 10 can also vary by vendor / manufacturer , type , physical layout of building and / or campus , user needs , and other characteristics . therefore , each implementation of system 10 and ese 20 in particular is done on a site - by - site basis . ese 20 can recognize , communicate with , and control a variety of system devices , including present generation and common manufacturer , legacy or previous generation , and competitor controllers and building automation panels . system 10 , via ese 20 , can also expand to integrate next - generation devices . as depicted in fig5 , for example , a present generation supervisory controller 41 , such as a building control unit manufactured by trane ยฎ, or a device 40 , can be directly communicatively coupled to the internet 30 and / or intranet 32 , while legacy unit ( s ) 42 can be directly communicatively coupled to the internet 30 and / or intranet 32 or coupled via a media converter 48 . media converter 48 is preferably a simple translator but may also comprise other more sophisticated devices as needed . media converter 48 is preferably not but may also be used with competitive product ( s ) 44 and / or future product ( s ) 46 in various embodiments . competitive products 44 are also preferably directly coupled to the internet 30 and / or intranet 32 . ese 20 is further able to support future product ( s ) 46 , such as updated versions of current controllers , newly developed products , and the like . ese 20 is also preferably able to coexist and cooperate with other similar but previous generation control and management systems . fig6 depicts a communication management component 56 that includes communication manager 600 , reconnect manager 602 , protocol stack 604 and protocol data unit ( pdu ) 606 . communication manager 600 is an object responsible for managing all the communication ports , threads , protocol stacks and other elements linking the ese 20 to individual devices or equipment . the communication manager 600 and reconnect manager 602 can be implemented as separate sub - components , as shown in fig6 , or in an alternate embodiment the reconnect manager 602 can be implemented as a element of the communication manager 600 . the foregoing descriptions present numerous specific details that provide a thorough understanding of various embodiments of the invention . it will be apparent to one skilled in the art that various embodiments , having been disclosed herein , may be practiced without some or all of these specific details . in other instances , known components have not been described in detail in order to avoid unnecessarily obscuring the present invention . it is to be understood that even though numerous characteristics and advantages of various embodiments are set forth in the foregoing description , together with details of the structure and function of various embodiments , this disclosure is illustrative only . other embodiments may be constructed that nevertheless employ the principles and spirit of the present invention . accordingly , this application is intended to cover any adaptations or variations of the invention . it is manifestly intended that this invention be limited only by the following claims and equivalents thereof . each of the additional figures and methods disclosed herein may be used separately , or in conjunction with other features and methods , to provide improved devices , systems and methods for making and using the same . therefore , combinations of features and methods disclosed herein may not be necessary to practice the invention in its broadest sense and are instead disclosed merely to particularly describe representative embodiments of the invention . for purposes of interpreting the claims for the present invention , it is expressly intended that the provisions of section 112 , sixth paragraph of 35 u . s . c . are not to be invoked with respect to a given claim unless the specific terms โ means for โ or โ step for โ are recited in that claim . all of the patents and patent applications disclosed herein , including those set forth in the background of the invention , are hereby incorporated by reference . any incorporation by reference of documents above is limited such that no subject matter is incorporated that is contrary to the explicit disclosure herein . any incorporation by reference of non - priority documents above is further limited such that no claims included in the documents are incorporated by reference herein and any definitions provided in the documents are not incorporated by reference herein unless expressly included herein .
| 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.