text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the present invention provides a novel bricklayer &# 39 ; s trowel capable of better regulation of the gap or cross joint between adjacent vertical faces of adjacent bricks in the same course of bricks . the result being that the resulting course of bricks will be of the desired length compared with use of conventional trowels . turning now to the figures hereof , the trowel 10 of fig1 and 2 comprises a flat quadrilateral blade 11 having four corners ( or “ shoulders ”) and a shaft , ferrule or tube 12 for receiving a handle 12 a . the blade 11 preferably has two corners or shoulders 13 , 14 adjacent to the end where handle 12 a is located . adjacent to one corner 13 , there is provided , or formed , a protrusion 15 which projects from the flat ( main or top ) surface of blade 11 . protrusion 15 is preferably in the vicinity of corner 13 ( e . g ., 5 to 12 mm from the corner , preferably 10 mm or thereabouts for a blade having an overall length of about 20 to 30 cm and a width of about 70 mm to about 110 mm ) and preferably on or near to the edge of blade 11 between handle 12 a and corner 13 . the protrusion 15 may be on a notional line ( not shown ) joining corners 13 and 14 . in some preferred embodiments , protrusion 15 is at a location on blade 11 that is slightly displaced from this notional line so as to be closer to handle 12 a . this displacement leaves the adjacent corner 13 substantially unaffected by the presence of protrusion 15 so that it can be employed for cutting bricks in the well - known manner . protrusion 15 may be an integral or unitary part of the blade or it may be a separate part which is secured to blade 11 by any suitable means . thus , protrusion 15 may be a dimple which is integral with blade 11 and formed by pressing or stamping . alternatively , protrusion 15 may be a separate member secured to the blade , e . g ., by spot welding . a suitable separate member ( not shown ) might be , e . g ., a piece of metal resembling the domed head of a dome - headed bolt . protrusion 15 is preferably of a substantially smoothly - curved dome - like form and may will preferably have a substantially circular base , as depicted in the figures hereof , since this will be easier to clean than a protrusion having sharp angles . a smoothly - curved domed protrusion can be made by stamping or pressing blade 11 . alternatively , the blade may be formed from suitable sheet metal having a ridged section at or adjacent to the edge of blade 11 which is subjected to a grinding process to form a desired protrusion 15 . another form ( not shown ) of the protrusion is cylindrical with a flat outer face . this latter form can be made by welding or spot - welding a cylindrical disc ( e . g ., a stud or boss ) to the face of the blade . although the present invention is not limited to exact dimensions of instant trowel there are preferred dimensions . for example , it is preferred that the total distance between the free end of the protrusion and the lower or bottom face ( as shown ) of blade 11 be equal to ( or approximately equal to ) the desired gap for mortar between adjacent vertical faces of adjacent bricks in the same course . in uk , this distance is typically 10 mm . in usa , this distance is ¼ inch ( 6 . 35 cm ). thus for uk use , blade 11 will preferably have a thickness of about 2 mm , protrusion 15 should preferably extend about 8 mm from the surface of the blade 11 from which it protrudes . however , blade 11 may have a thickness in the range of about 1 to 3 mm , and protrusion 15 would then extend a distance in the range of about 9 to 7 mm so that the total thickness of the blade and protrusion will preferably be about 10 mm if the desired gap between adjacent bricks in the same course is about 10 mm . in use , trowel 10 is employed to apply and spread mortar on bricks . when bricks are being laid , bricks are laid in a bed of mortar to form a horizontal course . as each additional brick is added to the course , mortar is applied by the trowel to the vertical face of the last - laid brick of the course . the corner region 13 of trowel 10 of the present invention is located in the vertical gap between adjacent bricks where it serves as a gauge or spacer , wherein one brick abuts a face of the trowel &# 39 ; s blade and the adjacent brick abuts the “ top ” or free , distal , end of protrusion remote from the main face of blade 11 . thus , the gap or space between adjacent bricks in a course is relatively accurately defined . when adjacent bricks in a course are thus disposed with a gap of the desired size between them , corner region 13 of the trowel is withdrawn from the gap and the gap is filled with mortar to complete the joint . the gaps between bricks in each course can therefore be of substantially uniform dimensions , substantially equal to the thickness of the blade plus the “ height ” of the protrusion . as a result , each course laid by the method described has substantially the desired length . it has not previously been possible to ensure readily that the gaps or cross - joints between bricks in a course were uniform by use of conventional trowels . the trowel of the present invention enables this difficulty to be surmounted . the trowel of fig1 hereof is shown with protrusion 15 near one corner or shoulder 13 of blade 11 . fig3 hereof shows a trowel of the present invention in which protrusion 15 is near the opposite corner or shoulder 14 . all the matters mentioned regarding protrusions 15 of fig1 hereof apply equally to the protrusions 15 of fig3 hereof . the side elevation of the trowel of fig3 is the same as shown in fig2 hereof . the trowel of fig3 hereof could be suited to a left - handed bricklayer , and the trowel of fig1 hereof could be suited to a right - handed bricklayer . fig4 hereof shows a trowel having two protrusions 15 , one near one corner 13 and the other near opposite corner 14 . the trowel of fig4 hereof could be suited to bricklayers who are either right handed or left handed . the side elevation of the trowel of fig4 hereof is the same as fig2 hereof . all the matters mentioned regarding the protrusions 15 of fig1 and 3 apply equally to the protrusions 15 of fig4 hereof . the trowels of fig3 , 4 and 5 are used to set the gap between adjacent bricks in a horizontal course in the same way as the trowel of fig1 hereof . at least one protrusion 15 , preferably all , are preferably located on blade 11 slightly offset from its respective corner ( s ) 13 or 14 in a direction towards handle 12 a , so that the corner ( s ) 13 , 14 can be used for cutting bricks in the well - known manner . the offset distance from the respective comer ( s ) will preferably be in the range of about 2 to about 20 mm , e . g . about 3 to about 15 mm , for example about 4 to about 12 mm , suitably about 5 to about 10 mm , so that the corner ( s ) 13 , 14 are available for cutting bricks despite the provision of the protrusion ( s ) 15 . features of one embodiment described herein may be employed in any feasible combination with features of another embodiment .
| 4 |
aspects of the present invention are preferably implemented with computer devices and computer networks that allow users to exchange trading information . an exemplary trading network environment for implementing trading systems and methods is shown in fig2 . an exchange computer system 100 receives orders and transmits market data related to orders and trades to users . exchange computer system 100 may be implemented with one or more mainframe , desktop or other computers . a user database 102 includes information identifying traders and other users of exchange computer system 100 . data may include user names and passwords . an account data module 104 may process account information that may be used during trades . a match engine module 106 is included to match bid and offer prices . match engine module 106 may be implemented with software that executes one or more algorithms for matching bids and offers . a trade database 108 may be included to store information identifying trades and descriptions of trades . in particular , a trade database may store information identifying the time that a trade took place and the contract price . an order book module 110 may be included to compute or otherwise determine current bid and offer prices . a market data module 112 may be included to collect market data and prepare the data for transmission to users . a risk management module 134 may be included to compute and determine a user &# 39 ; s risk utilization in relation to the user &# 39 ; s defined risk thresholds . an order processing module 136 may be included to decompose delta based and bulk order types for processing by order book module 110 and match engine module 106 .) the trading network environment shown in fig2 includes computer devices 114 , 116 , 118 , 120 and 122 . each computer device includes a central processor that controls the overall operation of the computer and a system bus that connects the central processor to one or more conventional components , such as a network card or modem . each computer device may also include a variety of interface units and drives for reading and writing data or files . depending on the type of computer device , a user can interact with the computer with a keyboard , pointing device , microphone , pen device or other input device . computer device 114 is shown directly connected to exchange computer system 100 . exchange computer system 100 and computer device 114 may be connected via a t1 line , a common local area network ( lan ) or other mechanism for connecting computer devices . computer device 114 is shown connected to a radio 132 . the user of radio 132 may be a trader or exchange employee . the radio user may transmit orders or other information to a user of computer device 114 . the user of computer device 114 may then transmit the trade or other information to exchange computer system 100 . computer devices 116 and 118 are coupled to a lan 124 . lan 124 may have one or more of the well - known lan topologies and may use a variety of different protocols , such as ethernet . computers 116 and 118 may communicate with each other and other computers and devices connected to lan 124 . computers and other devices may be connected to lan 124 via twisted pair wires , coaxial cable , fiber optics or other media . alternatively , a wireless personal digital assistant device ( pda ) 122 may communicate with lan 124 or the internet 126 via radio waves . pda 122 may also communicate with exchange computer system 100 via a conventional wireless hub 128 . as used herein , a pda includes mobile telephones and other wireless devices that communicate with a network via radio waves . fig2 also shows lan 124 connected to the internet 126 . lan 124 may include a router to connect lan 124 to the internet 126 . computer device 120 is shown connected directly to the internet 126 . the connection may be via a modem , dsl line , satellite dish or any other device for connecting a computer device to the internet . one or more market makers 130 may maintain a market by providing constant bid and offer prices for a derivative or security to exchange computer system 100 . exchange computer system 100 may also exchange information with other trade engines , such as trade engine 138 . one skilled in the art will appreciate that numerous additional computers and systems may be coupled to exchange computer system 100 . such computers and systems may include clearing , regulatory and fee systems . the operations of computer devices and systems shown in fig2 may be controlled by computer - executable instructions stored on computer - readable medium . for example , computer device 116 may include computer - executable instructions for receiving order information from a user and transmitting that order information to exchange computer system 100 . in another example , computer device 118 may include computer - executable instructions for receiving market data from exchange computer system 100 and displaying that information to a user . of course , numerous additional servers , computers , handheld devices , personal digital assistants , telephones and other devices may also be connected to exchange computer system 100 . moreover , one skilled in the art will appreciate that the topology shown in fig2 is merely an example and that the components shown in fig2 may be connected by numerous alternative topologies . fig3 shows a trader station user interface 300 in accordance with an embodiment of the invention . a new client window is divided into two portions . an order entry region 302 may be included as the top portion of user interface 300 and an informational region 304 may be included as the bottom portion of user interface 300 . order entry region 302 includes a price and quantity grid 306 . fig4 shows an exemplary price and quantity grid 400 . as shown in the embodiment of fig4 , price and quantity grid 400 may contain five columns and ten rows . a buy column 402 displays a user &# 39 ; s working buy order quantities . as used herein , a user may be a trader . a hit column 404 displays the market bid quantities . prices for individual rows are displayed in a price column 406 . a take column 408 displays market ask quantities . and , a sell column 410 displays a user &# 39 ; s working sell order quantities . individual entries may be color coded to assist users in quickly interpreting the displayed information . for example , entries in buy column 402 and hit column 404 may be in blue and entries in take column 408 and sell column 410 may be in red . price and quantity grid 400 includes more rows than are displayed in price and quantity grid 306 ( shown in fig3 ). section 412 includes the rows from price and quantity grid 400 that are included in price and quantity grid 306 . the information included in rows outside of section 412 , such as the information included in row 414 , may be stored in memory and retrieved when needed . a scroll bar 416 allows a user to select which group of rows to display in price and quantity grid 306 . order entry region 302 may also include a custom order entry region 308 . fig5 illustrates a custom order entry region in accordance with an embodiment of the invention . a contract field 502 identifies a particular contract the user wishes to buy or sell . a quantity field 504 identifies the number of contracts the user wishes to buy or sell . a user can adjust the quantity by selecting the increase or decrease scroll icons . alternatively , the user can edit the displayed text . scroll icons are particularly convenient for small handheld devices that may not include a keyboard or that include a keyboard with small keys . the user &# 39 ; s net position for the contract display in contract field 502 is displayed in net position field 506 . a lock icon 508 may be included to lock the state of price and quantity grid 306 . the operation of lock icon 508 is described in detail below . the price of the transaction is displayed in a price field 510 . in one embodiment of the invention , selecting contract field 502 causes price field 510 to display the most recent market price for that contract . the user can adjust the price by selecting the increase or decrease scroll icons . alternatively , the user can edit the displayed text . finally , the user may select either a buy icon 512 or a sell icon 514 to enter a buy or sell order . returning again to fig3 , a view icon 310 may be used to select the type of information to display in informational region 304 . in one embodiment of the invention , informational region 304 may contain several overlaid informational panels . selecting view icon 310 may cause a menu of informational panels to be displayed . alternatively , selecting view icon 310 may cause informational region 304 to toggle through the informational panels . informational panels may include a variety of different trading related information . informational panel 312 displays market activities of several contracts simultaneously . informational panel 314 may display some or all of a user &# 39 ; s working orders . in one embodiment of the invention , a user may cancel a working order by selecting the order in informational panel 314 . an informational panel may also serve as a message log . informational panel 316 , for example , includes trade related messages received from a trading match engine . clearing information may also be displayed in an informational panel . informational panel 318 displays a user &# 39 ; s current clearing information settings and allows the user to make modifications . one skilled in the art will appreciated that two or more of the disclosed informational panels may be combined and additional informational panels may be used without departing from the scope of the invention . aspects of the present invention support a variety of different orders , such as buy / sell limit day order and buy / sell fill and kill limit day order . orders may be for financial instruments such as options contracts , futures contracts , options on futures contracts , securities , etc . the information included in price and quantity grid 306 may change while the market moves . an element within the grid may represent one transaction at a first time and a second transaction a split second later . with prior user interfaces , the user risked sending an unwanted order or cancel request to a trade engine . with the present invention , lock icon 508 may be used to freeze the state of the user interface to prevent elements of price and quantity grid from changing while the user enters a trade . once clicked , price and quantity grid 306 will only be updated in the memory of the device , and there is no display update . as a result and as described in detail below , selecting an element within price and quantity grid 306 will send out an order or cancel request that the user intended . in one embodiment , soon after the request is sent , the lock will be released automatically . the lock can also be released by clicking lock icon 508 again without sending out any order request . in one alternative embodiment , lock icon 508 may be replaced with a button or other physical device that forms part of a computer device . of course there are numerous alternatives for releasing the lock , such as releasing after the order is entered , after a time defined by the user , etc . in another embodiment , only a portion of price and quantity grid 306 is locked , such as the portion that the user is using to enter an order or the price column . the user may be presented with options for selecting the criteria for locking and unlocking . for example , a lock icon may be placed next to each column and / or row to allow the user to select columns and rows to lock . fig6 illustrates an embodiment that includes an order entry section for buy and sell limit day orders . user interface 602 illustrates a state before the entry of an order . user interface 602 may be presented on the display of a computer device , such as a pda . in the example shown in fig6 , the user wishes to buy 100 esh3 contracts at 83550 . in order to ensure that user interface 602 does not change while the user is in the process of entering an order , the user may first select lock icon 604 . after lock icon 604 is selected , updated market information is stored locally , but not presented on the display . next , the user sets a quantity field 606 to 100 ( the number of contracts the user wishes to buy ). element 608 is then selected to enter the order . element 608 may be selected with a stylus , key pad , mouse or any other conventional mechanism for selecting elements of a graphical user interface . selecting any element in the left most column will send in a limit gtd buy order with the price specified in the center column and the quantity specified in quantity field 606 . similarly , selecting any element in the right most column will send in a limit gtd sell order with the price specified in the center column and the quantity specified in quantity filed 606 . after element 608 is selected , a buy order for 100 esh3 contracts at 83550 may be transmitted to a match engine . after the order is entered , the lock may be released automatically so that updated market information is displayed . user interface 610 illustrates a state that exists while an order is pending . the background color of element 612 may be changed to indicate that the order is pending . of course other visual aspects of element 612 and / or visual aspects of the surrounding elements may be changed to indicate that the order is pending . a message banner 614 may also include a message indicating that an order is pending . the background color of message banner 614 may be changed to indicate that an order is pending . in one embodiment of the invention , the background color of element 612 and message banner 614 is changed to green to indicate that an order is pending . next , it is determined whether or not the order was accepted . user interface 616 illustrates a state that exists when an order has been rejected . a dialog box 618 may be presented to indicate that the order was rejected and may also provide a reason for the rejection . a message banner 620 may also indicate that the order was rejected . in one embodiment , the background color of message banner 620 is changed to a color that is different from the background color of message banner 614 , such as yellow . region 622 may be selected to close message banner 620 . user interface 624 illustrates a state that exists when an order has been accepted . element 626 has been updated to show that the user has entered an order for 100 additional contracts . similarly , element 628 has been updated to reflect the order . the background color of element 626 may also be switched to the default color . a message banner 630 may indicate that the order was accepted . in one embodiment , the background color of message banner 630 is changed to a color that is different from the background colors of message banners 614 , and 620 , such as blue . region 632 may be selected to close message banner 630 . informational panels 634 , 636 and 638 are exemplary informational panels that may be displayed after an order is accepted . fig7 illustrates an embodiment of the invention that may be used for order entry for hit and take orders . user interface 702 illustrates a state before the entry of an order . column 704 is a hit column that includes market bid quantities and column 706 is a take column that includes market ask quantities . selecting any element in hit column 704 will send in a limit fill and kill buy ( hit ) order with the price specified in price column 708 and the quantity equal to all available market quantity . similarly , selecting any element in take column 706 will send in a limit fill and kill sell ( take ) order with the price specified in price column the center column and the quantity equal to all available market quantity . in the example shown , a user may send a fill and kill limit order for 270 esh3 contracts at 83525 by selecting element 710 . after element 710 is selected , the order may be sent to a match engine . user interface 712 illustrates a state while the order is pending . the background color of element 714 may be changed to indicate that the order is pending . of course other visual aspects of element 714 and / or visual aspects of the surrounding elements may be changed to indicate that the order is pending . a message banner 716 may also include a message indicating that an order is pending . the background color of message banner 716 may be changed to indicate that an order is pending . in one embodiment of the invention , the background color of element 714 and message banner 716 is changed to green to indicate that an order is pending . next , it is determined whether or not a match engine has eliminated the order . user interface 718 illustrates a state that exists when an order has been eliminated . the background color of element 720 returns to the same color as the background of element 710 . a message banner 722 may indicate that the order has been eliminated . the background color of message banner 722 may be changed to indicate that the order has been eliminated . in one embodiment the color is changed to yellow . a dialog box may also be displayed to indicate that the order has been eliminated and may also provide a reason for the elimination . user interface 724 illustrates a state when the order has been accepted . the values in elements 726 , 728 and 730 are reset to reflect the change in net positions and to indicate that the order has been accepted . a message banner 732 may be included to indicate that the order has been accepted . the color of message banner 732 may also be changed to a different color , such as blue . informational panel 734 is an exemplary informational panel that may be displayed after an order has been accepted . fig8 illustrates user interfaces that may be used to cancel working orders , in accordance with an embodiment of the invention . selecting a price element in price column 802 of user interface 804 will send a cancel request to a match engine to cancel all working orders at that price . user interface 806 illustrates a state that exists when the user selects element 808 . the background color or other visual characteristic of element 808 may be changed to indicate that a cancel order is pending . a message banner 810 may also include a message indicating that an order is pending . the background color of message banner 810 may be changed to indicate that an order is pending . in one embodiment of the invention , the background color of element 808 and message banner 810 is changed to green to indicate that an order is pending . it is next determined whether the order is accepted . user interface 812 illustrates a state that exists when an order has not been accepted . user interface 814 illustrates a state that exists when an order has been accepted . user interfaces 812 and 814 are similar to user interfaces 616 and 624 ( shown in fig6 ) respectively , and a description is not repeated here . informational panels 816 and 818 are exemplary informational panels that may be displayed after an order is accepted . in one embodiment of the invention , a single command may be used to cancel all of a user &# 39 ; s orders for a specific contract or all orders for all contracts . for example , selecting the column heading for column 802 may cancel all orders for the contracts identified in element 820 . a confirmation box option may be used to protect against unwanted trades . activating and deactivating the confirmation box may be accomplished by making an appropriate menu selection . once the confirmation box is turned on , every trade will be echoed in the confirmation box to ask for further approval . if the user approves the order , the order request may be sent to a match engine . if cancelled , nothing will be sent to the match engine . a user can limit his or her one - time trading quantity to a fixed maximum number . this will protect user from hitting or taking an unwanted large market quantity or an erroneous quantity specification . if the quantity in any order request exceeds this number , a message box will be popped up to warn user , and the request will not be sent to the host . the determination of whether a trading quantity exceeds a fixed maximum number may be made locally and / or at a match engine . fig9 illustrate alternative user interfaces 902 and 904 in accordance with an embodiment of the invention . user interfaces 902 and 904 preferably include only 3 columns . of course , the information included in the three columns may also be arranged in 3 rows . among other advantages , the use of only three rows or columns eliminates unused space and improves readability on a small display or section of a display . user interface 902 includes a first column 906 that may include ask prices and market bid quantities . a second column 908 may include the user &# 39 ; s working bid and ask quantities . a third column 910 may include bid prices and market ask quantities . in operation , selecting element 912 or 914 will transmit a sell order having the price indicated and the quantity listed in element 916 . selecting element 918 or 920 will transmit a sell order for the indicated quantity that will be matched at entry with existing buy limit orders and the best available buy price . selecting element 922 , 924 or 926 will transmit a buy order having the price indicated and the quantity listed in element 916 . selecting element 928 or 930 will transmit a buy order for the indicated quantity that will be matched at entry with existing sell limit orders and the best available price . user interface 902 may incorporate the color schemes and functionality of user interfaces described above . one skilled in the art will appreciate that numerous modifications to user interface 902 may be made while still utilizing 3 columns . user interface 904 , for example , replaces sell column 906 and buy column 910 of user interface 902 with a hit column 930 and a take column 932 . in one exemplary embodiment , a user may take the market for the indicated quantity by selecting element 934 or 936 . the user may hit the market for the indicated quantity by selecting element 938 or 940 . additional modifications may include allowing a user to transmit an order by selecting any element within a row . for example , with reference to user interface 904 , a user may transmit a take order for 100 contracts by selecting any element within row 942 . fig1 illustrates a mobile computer device 1000 that includes a graphical user interface that does not include a lock icon in accordance with another embodiment of the invention . mobile computer device 1000 may be configured to monitor changes in market depth and cancel orders in which the market price has changed within a short period of time before the user enters the order . in one embodiment of the invention , this price protection feature may be applied to only a portion of a price and quantity grid . for example , the price protection feature may be applied to only rows 1002 and 1004 . fig1 illustrates an algorithm that may be performed by mobile computer device 1000 to protect a user against unexpected changes in prices . first , in step 1102 mobile computer device 1000 receives dynamically updated market depth information for a financial instrument . next , mobile computer device 1000 receives an order for the financial instrument from a user in step 1104 . step 1104 may result from , for example , the user providing a selection command to the graphical user interface . in step 1106 it is determined whether the market price for the financial instrument has changed within a predetermined period of time before receiving the order from the user . for example , it may be determined whether the price has changed within a two second period of time that begins two seconds before receiving the order and ends at the point that the order was received . in an alternative embodiment , a default tick tolerance or user specified tick tolerance is used and step 1106 includes determining whether the market price has changed a predetermined amount . if the price has not changed within the predetermined time period , the order may be transmitted to a match engine in step 1108 . in alternative embodiments of the invention step 1108 may be replaced with one or more other steps that result in an order being conveyed from the mobile terminal to a destination that will ultimately result in the order being placed with an exchange . when the price has changed within the predetermined time period , in step 1110 it is determined whether the price change benefits the user . when the price change benefits the user , the order is transmitted to a match engine in step 1108 . when the price change does not benefit the user , the order is canceled in step 1112 . as used herein , an order is canceled when it is deleted or otherwise does leave mobile computer device 1000 so that the order may be executed at an exchange . in various embodiments of the invention , users are allowed to select the predetermined time period and / or tick tolerance . fig1 shows a mobile computer device having an exemplary graphical user interface that allows a user to specify the predetermined time period as well as the tick tolerance . in alternative embodiments of the invention a plurality of predetermined time periods and / or tick tolerance may be used . for example , a first time period may be assigned for orders exceeding a monetary or quantity threshold and a second time period may be assigned for orders that do not exceed the threshold . the predetermined time periods and / or tick tolerances may also be specific to individual or groups of financial instruments . various aspects if the invention may include additional mechanisms to prevent unwanted trades . for example , a confirmation box may be activated to present a dialog box to users and request final approval before transmitting a trade . a user can also limit his or her one - time trading quantity to a fixed maximum number . this will protect the user from hitting or taking an unwanted large market quantity or an erroneous quantity specification . if the quantity in any order request exceeds this number , a message box will be popped up to warn the user and the request will not be sent to the host . the determination of whether a trading quantity exceeds a fixed maximum number may be made locally and / or at a match engine . the present invention has been described herein with reference to specific exemplary embodiments thereof . it will be apparent to those skilled in the art that a person understanding this invention may conceive of changes or other embodiments or variations , which utilize the principles of this invention without departing from the broader spirit and scope of the invention as set forth in the appended claims . all are considered within the sphere , spirit , and scope of the invention .
| 6 |
turning first to fig1 - 5 , the illustrated spillproof squeeze bottle liquid dispenser assembly 10 comprises a generally cylindrical molded plastic squeeze bottle 12 having a resiliently flexible container wall 16 and is integrally formed at its upper end with an externally threaded outlet neck 14 . the assembled bottle 10 also includes a molded plastic spout member 18 having a generally cylindrical lower end portion 20 that is internally threaded for mounting on the external threads of the bottle neck 14 . the tip of a tapered portion 22 of the spout is normally closed by a complementary cap 24 which is , of course , removed when it is desired to dispense a liquid contained in the bottle . as is well known , inward manual deflection of the wall 16 creates or stores elastic strain energy in the wall which returns the wall outwardly to its illustrated unstressed normal shape after pressure is removed from the wall . air is drawn into the container through its outlet neck 14 during this outward return of the wall 16 to equalize the internal container pressure and external ambient pressure and thereby permit full return of the wall to its normal shape . without any further structure , the squeeze bottle dispenser thus far described is entirely conventional and subject to the deficiencies previously noted . according to the present invention , spilling hazards are eliminated by providing the dispenser with a unique and simple valved and vented septum which prevents outflow of liquid from the dispenser except when it is deliberately squeezed but without the septum &# 39 ; s appreciably inhibiting the dispensing rates or relaxation rates of the bottle . preferably , the septum takes the form of the particular septum 26 shown in fig2 but in all cases is made as a thin self - supporting membrane of a resiliently flexible material with a perimeter matching that of the outlet on which it is to be seated . thus , as is shown in fig1 the septum 26 is seated on the upper end of the outlet neck 14 and fluid - sealingly clamped in place spanning the outlet by means of the screw connection of the spout 18 with the bottle neck . in the illustrated case , the septum 26 is of circular plan - form and the membrane thickness of the resiliently flexible septum is nevertheless sufficient to be sufficiently self - supporting to span the opening and provide a solid barrier to the passage of the liquid except in response to the valve action . the preferred septum 26 has a pair of slits 28 intersecting at 29 at the geometric center of the septum disc and , thus , the longitudinal axis of the dispenser spout . the pair of slits 28 are angularly oriented relative to one another such that they include equal opposite angles in the range of about 35 ° to about 65 °, but preferably on the order of 55 ° defining an opposite pair of symmetrical valve flaps 30 . the intersecting slits 28 also define another opposite pair of equal angles of 125 °, each of these areas comprising secondary flaps 32 . at both ends of each slit 28 , the septum 26 is formed with circular hole perforations 34 intersected by the slit . these holes are preferably centered with respect to the slits 28 , although not necessarily so . in any case , the hole - slit intersection eliminates binding of the valve flaps 30 at their root edges during valve action . the valve flaps 30 and the secondary flaps 32 have isosceles triangular shapes . however , the valve flaps 30 are relatively long and have short hinges , as compared to the secondary valve elements 32 and are therefore more flexible -- that is , the apices of the valve flaps 30 are more readily deflectable than the apices of the secondary flaps 32 . it will be understood that the hinge areas of all these flap elements correspond to the base of the respective triangular areas . in the case of the septum 26 , by virtue of the presence of the holes 34 , the length of the hinge line , most notably of the short hinge lines of the valve flaps 30 , is reduced accordingly . the valve flaps 30 are thus made more flexible for turning about their hinge line areas by virtue of presence of the holes 34 . the septum 26 is shown essentially full scale and to scale in fig2 ( except for exaggeration of the size of holes 34 for clarity ), and represents a specimen of the invention which is particularly suitable for use with liquids such as household detergents . in particular , the septum 26 illustrated in fig2 has been employed in a one - inch diameter made out of polyethylene - milp - 22033 mic - spgc , of a thickness of 0 . 020 inches , with a flap 30 apex angle of 55 ° and a flap edge length on the order of 1 / 4 inch . it will be understood that the 90 ° butt cut slit edges of the flap fit closely within the complementary v - shaped opening of the septum from which the flap is severed . the holes 34 each have a diameter of 1 / 32 of an inch to be porous with respect to air but non - porous with respect to the contained liquid . the septum 26 afforded practically no resistance to the desired expulsion of detergent out of the dispenser bottle and very closely approximated the relaxation time which would be true of the same bottle without the septum . at the same time , in all attitudes of the bottle , i . e ., inverted or turned 90 °, as in fig3 and 4 , no leakage or spillage of detergent of the 3 / 4 full bottle occurred , even through the holes 34 . when the dispenser 10 is not in use , its container 12 occupies the normal shape illustrated in fig1 and the internal container pressure and the external ambient pressure are equal . under these conditions , all of the flaps of the septum 26 occupy their normal closed position within the plane of the body of the septum to block liquid outflow from the dispenser through its outlet 14 if the dispenser is tipped over or dropped or held in an inverted position . assume now that the dispenser is tilted or inverted and its container wall 16 squeezed in the usual way . resultant inward deflection of the container wall first exhausts internal air through the openings 34 until sufficient air has been displaced to bring the liquid into contact with the inner surface of the septum . thereafter , upon continued pressure being applied , the valve flaps 30 are deflected outwardly creating an opening through the septum 26 . the other secondary flaps 32 may also yield outwardly slightly but the primary valving action occurs as a result of the outward flexing of the primary valve flaps 30 . dispensing occurs with far less pressure since only the resistance of the short hinge , relatively long valve flaps 30 needs to be overcome rather than the total resistance of the four flaps 30 , 32 . when pressure on the container wall is released , outward elastic strain energy return of the wall 16 to its normal shape induces intake of ambient air through the holes 34 and into the container . concurrently , the valve flaps 30 return to closed position and , in some cases , may be flexed inwardly as a result of the intake of ambient air therethrough . however , the primary intake of air probably occurs due to the presence of the holes 34 and the container wall 16 very quickly returns to its unstressed relaxed tubular cylindrical configuration of fig1 upon equalization of the internal and external pressures . in any event , the holes 34 in the specific slit - hole combinations of the septum 26 result in a seven - fold improvement in the bottle relaxation time . an alternative form of septum 40 is shown in fig6 which is in all respects like the septum 26 except for the valve defining slit formation and the relationship of the holes to the slits . more specifically , an intersecting pair of slits 42 define an included angle on the order of 55 ° thus defining an isosceles triangularly shaped valve flap portion 44 and an opposite equal angle stub flap 46 . the valve flap 44 is defined in the central region of the septum 40 such that the central portion of the flap is in alignment with the longitudinal central axis of the bottle in which it is to be mounted . adjacent the hinge line area of the valve flap 44 but offset from adjacent ends of the pair of slits 42 are a pair of holes 48 which , as before , may be 1 / 32 of an inch in diameter . in the case of the septum 40 it will be observed that there is essentially but a single valve element , i . e ., the relatively most flexible triangular flap area 44 . while in this case the holes 48 are offset slightly relative to a straight hinge line extending between base ends of the slits 42 , i . e ., essentially the base of the isosceles triangle , the removal of the material of the holes 48 nevertheless increases the flexibility of the valve flap 44 so that once again the septum 40 defines an effective barrier against undesired leakage without unduly impeding either exhaustion or dispensing of liquid through the valve flap or quick relaxation of the squeeze bottle by virtue of the presence of the holes 48 . the stub flap 46 flexes slightly with the valve flap 44 to avoid catching of the valve tip in the apex of the valve opening . another embodiment of the invention is shown in fig7 . in this case , the septum 50 is provided with a pair of slits 52 intersecting at 53 at the geometric center of the circular planform septum , thus defining two primary valve flaps 54 that are opposite equal included angle areas of 55 °. in this case , there are also secondary triangular long hinge flap areas 56 of 125 ° which , again , are relatively stiff as compared to the primary valve flaps 54 . in this instance , each of these four triangular flap areas , at essentially the midpoint of its hinge line area , has a perforation 58 , in this instance , constituting holes 1 / 32 of an inch in diameter . the modified flap valve insert 60 of fig8 and 9 is also of one - piece construction . in this case there is a circular planform septum 62 defining the floor of a cup shaped cavity 64 formed at its upper end with an annular flange 66 which is clamped between the spout 18 and neck 14 of the bottle . as is shown in fig9 an intersecting pair of slits 68 include an angle of preferably 55 °, the isosceles triangle flap area constituting a primary valve flap 70 , oppositely to a stub flap area 72 . as in the case of the embodiment shown in fig6 the two opposite equal angle 125 ° areas are essentially stiff as compared to the flexibility of the primary valve flap 70 . in this case a pair of 3 / 64 inch holes 74 are provided in the stub flap area 72 at the ends of the slits . concentration of the liquid at the slit formation of the septum 62 provides maximum return of the liquid inwardly upon relaxation of the bottle .
| 8 |
please refer to fig1 , which illustrates a schematic diagram of connections between a ue and cells c 1 - cn in a wireless communication system . in fig1 , the cells c 1 - cn and the ue are communicated through links l 1 - lm each corresponding to a component carrier configured in the ue , and each supports a lte - advanced radio access technology ( rat ) or an e - utran ( evolved universal terrestrial radio access network ) rat supporting the function of multiple component carriers on one ue . for example , the ue is communicated with the cell c 1 through the link l 1 , communicated with the cell c 2 through the links l 2 - l 4 , and so on . the component carriers of the links can be the same component carrier frequency band if the component carriers are associated to different cells . for example , the component carrier of any of the links l 2 - l 4 can use the same frequency band as the component carrier of the link l 1 . please refer to fig2 , which illustrates a schematic diagram of an exemplary communication device 20 . the communication device 20 can be the ue shown in fig1 and includes a processor 200 such as a microprocessor or asic , a computer readable recording medium 210 , and a communication interfacing unit 220 . the computer readable recording medium 210 is any data storage device that stores storage data 212 , including program code 214 , thereafter read and processed by the processor 200 . examples of the computer readable recording medium 210 include a subscriber identity module ( sim ), read - only memory ( rom ), random - access memory ( ram ), cd - roms , magnetic tapes , hard disks , optical data storage devices , and carrier waves ( such as data transmission through the internet ). the communication interfacing unit 220 is preferably a radio transceiver and accordingly exchanges wireless signals with a network ( i . e . the cells c 1 - cn ) according to processing results of the processor 200 . the program code 214 includes program code of a medium access control ( mac ) layer which can manage timing alignment ( ta ) functionality for multiple component carriers . please refer to fig3 , which illustrates a flowchart of an exemplary process 30 . the process 30 is utilized in the ue for managing ta functionality with multiple component carriers in a wireless communication system . the process 30 can be compiled into the program code 214 and includes the following steps : step 302 : separately manage ta functionality of a plurality of component carriers . according to the process 30 , the ue manages ta functionality of each of the plurality of component carriers with independent ta configuration sets can be configured by timing advance command sent by the network . that is , when a timing advance command is received from a link belonging to a component carrier , the ue applies the ta functionality for the component carrier only . in one example , no limitation on carrier - to - cell allocation is introduced . the component carriers belonging to the same or different cells are depended on network resource allocation . take an example associated with fig1 . if a ue has a first link ( i . e . link l 1 ) belonging to a first component carrier and a second link ( i . e . link l 2 ) belonging to a second component carrier for uplink transmission , the ue applies the ta functionality for the first component carrier when a first timing advance command is received in the first component carrier , applies the ta functionality for the second component carrier when a second timing advance command is received in the second component carrier , and so on . for ta functionality operation , when the ta functionality is applied in a component carrier for updating a timing advance value corresponding to a cell , the ue starts or restarts a time alignment timer for the component carrier . for example , as abovementioned , when the ta functionality is applied in the first component carrier for updating a first timing advance value corresponding to a cell ( i . e . cell c 1 ), the ue starts or restarts a first time alignment timer for the first component carrier according to the first timing advance command . please note that , the abovementioned time alignment timer of the ue is utilized for indicating whether the ue is synchronized with the cell on uplink timing . when the time alignment timer is running , uplink timing is considered synchronized . if the time alignment timer expires , then this indicates that the ue no longer has uplink synchronization with the cell . therefore , when the first time alignment timer expires , the ue releases resources of channel quality indication ( cqi ) report , sounding reference signal ( srs ), scheduling request ( sr ), and physical uplink control channel ( pucch ) for the first component carrier . similarly , when the ta functionality is applied in the second component carrier , the ue starts or restarts a second time alignment timer for the second component carrier according to the second timing advance command , and releases resources of cqi report , srs , sr , and pucch for the second component carrier when the second time alignment timer expires . in the lte - advanced system , the released cqi - report , srs , sr , and pucch resources can be cqi - reportconfig , soundingrs - ul - config , schedulingrequestconfig and pucch - config configurations , respectively . in addition , for network configuration flexibility and reduction of a signaling quantity , a radio resource control ( rrc ) message can be used to indicate the usage of the following timing advance command ( s ). when a rrc message indicating one component carrier is received , the ue applies ta functionality for the indicated component carrier when a timing advance command is received in the indicated component carrier . alternatively , when the rrc message indicating more than one component carrier is received , the ue applies the ta functionality for each of the indicated component carriers when the timing advance command is received in any one of the indicated component carriers . take an example associated with fig1 . if the rrc message indicates component carriers corresponding to the links l 2 - l 4 , the ue applies the ta functionality for each of the ta configuration sets corresponding to the links l 2 - l 4 when the timing advance command is received in any one of the links l 2 - l 4 . please note that the abovementioned ta functionality applying is not against with the separate management concept of the process 30 . the ue still sets the ta functionality of the component carriers one by one although the configuration source , namely timing advance command , is come from one link . please refer to fig4 which is a schematic diagram of an exemplary communication device 40 . the communication device 40 is used for realizing the process 30 and includes ta executing units ta 1 - ta n and a management unit 401 . the ta executing units ta 1 - ta n are used for executing ta functionality ( e . g resource releasing or time advance applying ) of component carriers of the communication device 40 and each of the ta executing units ta 1 - ta n is responsible for one component carrier . the management unit 401 is used for separately managing the ta functionality of the component carriers . the management unit 401 includes a reception unit 402 for receiving a timing advance command , and a configuration applying unit 403 . in an example , when the reception unit 402 receives a timing advance command from one of the component carriers . the configuration applying unit 403 then applies the ta functionality for the component carriers received the timing advance command , and starts or restarts a time alignment timer for this component carrier according to the received timing advance command . in addition , the reception unit 402 is further used for receiving a rrc message for indicating at least one of the component carriers . the configuration applying unit 403 applies the ta functionality for the indicated component carriers when the timing advance command is received in one of the indicated component carriers , and starts or restarts a time alignment timer for all of the indicated component carriers . the related description can be realized by referring to the above , so a detailed description is omitted herein . on the other hand , for reducing a configuration signaling quantity or complexity of ta functionality operation , please refer to fig5 which is a flowchart of an exemplary process 50 . the process 50 is utilized in the ue for managing the ta functionality with multiple component carriers in a wireless communication system . the process 50 can be compiled into the program code 214 and includes the following steps : step 502 : jointly manage ta functionality of a plurality of component carriers belonging to a cell . according to the process 50 , the ue manages the ta functionality in the plurality of component carriers belonging to the same cell with a common timing advance command . that is , when a timing advance command is received in one of the component carriers belonging to a cell , the ue jointly applies the ta functionality for the component carriers belonging to the cell . take an example according to fig1 . when a timing advance command is received in any one of the links l 2 - l 4 belonging to the cell c 2 , the ue applies the ta functionality for the links l 2 - l 4 according to the timing advance command . in this situation , the network does not need to generate and send timing advance command duplications for the links l 2 - l 4 , and on the other hand , the ue does not need to handle the ta functionality for each component carrier belonging to the same cell . as a result , the signaling quantity is reduced and furthermore complexity problem of separately configuring each component carrier is avoided . for ta functionality operation , when the ta functionality is applied in the plurality of component carriers belonging to the same cell for updating a timing advance value corresponding to the cell , the ue starts or restarts a time alignment timer for those component carriers according to the timing advance command . therefore , when the time alignment timer expires , the ue releases resources of cqi report , sounding rs , scheduling request , and pucch for all component carriers belonging to the cell . as a result , according to the abovementioned example , the ue starts or restarts a time alignment timer for the links l 2 - l 4 , and releases resources of the links l 2 - l 4 when the time alignment timer expires . based on the process 50 , the ue applies the ta functionality and maintains one time alignment timer for certain component carriers belonging to the same cell through a single timing advance command , so as to reduce the number of times for the timing advance command reception and related signalling quantity . please refer to fig6 which is a schematic diagram of an exemplary communication device 60 . the communication device 60 can be used for realizing the process 40 , which includes a plurality of ta executing unit ta 1 - ta n for executing ta functionality of component carriers belonging to a cell , and a management unit 601 for jointly managing the ta functionality of the component carriers . the management unit 601 includes a reception unit 602 for receiving a timing advance command , and a configuration applying unit 603 . when the reception unit 602 receives a timing advance command in one of the component carriers belonging to a cell , the configuration applying unit 603 applies the ta functionality for at least a component carriers belonging to the cell . in addition , the configuration applying unit 603 starts or restarts a time alignment timer for the component carriers belonging to the cell according to the timing advance command . detailed description can be referred from above , so the detailed description is omitted herein . please note that the abovementioned steps of the processes 30 and 50 including suggested steps can be realized by means that could be hardware , firmware known as a combination of a hardware device and computer instructions and data that reside as read - only software on the hardware device , or an electronic system . examples of hardware can include analog , digital and mixed circuits known as microcircuit , microchip , or silicon chip . examples of the electronic system can include system on chip ( soc ), system in package ( sip ), computer on module ( com ), and the communication device 20 . in conclusion , the above - mentioned examples provide a separately managing way to manage the ta functionality for multiple component carriers to avoid an erroneous situation where one component carrier belonging to a cell is successful in uplink synchronization while other component carriers belonging to other cells are failed . furthermore , the other examples provide a jointly managing way for component carriers belonging to the same cell in order to reduce a signaling quantity or complexity of ta functionality operation . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims .
| 7 |
referring now to fig1 there is a graphic depiction of the output signals developed by the temperature sensing means of the invention . the invention is illustrated with reference to a specific embodiment having specific values of control set temperature points and conditioned command voltage signals . this is intended to illustrate the most preferred embodiment only and is not intended to be limiting of the invention . as apparent to those skilled in the art , the system described herein can be widely adopted to various control zones set point temperatures and control signal voltages . as illustrated in fig1 the control system has two set air temperature points . these are 68 ° and 78 ° f . which are illustrated by the points a and k , respectively . the set temperature point a can be used for the control of the heating and ventilation facilities of an air conditioning system , while set temperature point k can be employed for the control of air cooling facilities of such an air conditioning system . fig1 illustrates the thermostat circuit output voltages as a function of control zone temperatures and is typical of any or all of the controlled zone temperature sensing means employed in individual controlled zones of the system . the air conditioning system which can be operated in response to the voltage signals generated by the thermostat and circuit means of this invention can comprise a typical air conditioning system which includes air heating , air cooling and air circulation facilities to direct conditioned air to one or more zones of controlled air temperature and to return air therefrom for recirculation . the air conditioning system typically includes ventilation damper and exhaust damper facilities whereby the relative proportions of fresh and returned air circulated through the control zones can be adjusted in a controlled manner . referring to fig1 line 10 is seen to pass through the set temperature point a and illustrates the output signals developed by the thermostat and circuit means of the invention in response to variation in sensed zone temperatures . as the air temperature in the control zone decreases from the set temperature point , the output signal from the signal conditioning circuit progressively decreases in a linear fashion along line 10 . in a typical embodiment , the slope of line 10 corresponds to approximately a five volt change in error signal with each degree of change in the sensed zone temperature . the voltage signals obtained from the signal conditioning circuit can be employed for a plurality of control operation of the air conditioning system . thus , as the voltage signal decreases , the damper motor will gradually close the damper of the cooling air duct and open the damper in the heating supply duct to the control zone , until , at 11 volts and 67 . 8 ° f ., the damper to the cooling duct is fully closed and that to the heating zone is fully open . as the sensed temperature drops to point c at 66 . 8 ° f ., a voltage signal of about 6 volts is obtained which is sufficient to activate the first stage of heating means of the air conditioning system . should the sensed temperature continue to drop , a second stage of heating can be activated at point d , 66 . 5 ° f . at about 4 . 5 volts . the air conditioning system can employ a large number or plurality of heating stages and , when many stages are employed , they are preferably activated in a staged manner with each increment of approximately 2 . 5 volts decrease in conditioned command signal , corresponding to approximately 0 . 5 degree f . incremental decrease in the sensed temperature . as the temperature in the controlled zone responds to the input of heating , the temperature rises and approaches the set temperature point . as the temperature reaches point e , which can be at 67 . 3 ° f ., the voltage signal of about 8 . 5 volts can be applied to deactivate the second stage of heating . similarly , the first stage of heating can be deactivated when the conditioned error signal rises to about 10 volts , corresponding to 67 . 6 ° f . sensed temperature . when the sensed air temperature in the controlled zone passes point b on line 10 , a command signal of about 11 volts , corresponding to 67 . 8 ° f ., is effective to progressively open the damper of the cooling supply duct and close the damper of the heating supply duct to the control zone . the ventilation and exhaust dampers which control the introduction of outside air into the system and discharge the return air from the system remain at their minimal open position , e . g ., that permitting introduction of about 5 to 20 volume percent of fresh air based on total air circulated . in the event that the sensed temperature of the control zone should rise above point g , 68 . 2 ° f ., and an outut signal of 13 volts be thereby generated , this command signal is effective to generate a control signal that is applied to the ventilation motor controller to open the ventilation dampers in the fresh air inlet and exhaust damper in the return air duct and close the return air damper in the return air duct in a proportional manner , responding to the magnitude of the command signal . the ventilation motor controller of the air conditioning system also receives a control signal that is proportional to outside air temperature so that the ventilation and exhaust dampers will not open unless the outside air temperature is low enough to provide effective cooling , for example ; below the set temperature point of 68 ° f . if the temperature in the control zone continues to rise and , if the outside air temperature is below the set temperature point a , the ventilation damper will progressively open until , at point h , 69 ° f . and 17 volts , the ventilation air damper is fully opened and the return air damper is fully closed so that the air conditioning system is supplied with outside air only . the air temperature in the control zone is permitted to drift through a region from the temperature represented at point h , 69 ° f ., to point i , 79 . 5 ° f . on cooling curve 12 . the cooling curve 12 represents the command voltage signal generated by the second thermostat of the invention . the slope of line 12 is approximately 5 volts per degree of temperature change . if the sensed temperature in the control zone rises to 79 . 5 ° f ., the circuit means generates a command signal of 19 . 5 volts which is sufficient when applied to the controlled circuit of the air conditioning system to activate the first stage of air cooling facilities . this signal is also sufficient to actuate the ventilation damper motor controller , close the ventilation and exhaust dampers and open the return air damper so that the return air rather than the warm outside air is cooled . if the temperature continues to rise in the control zone , successive stages of mechanical cooling can be progressively activated with each 1 volt incremental increase in output signal , corresponding to an increase of about 0 . 2 f . of sensed temperature . this is illustrated at point j where an error signal of 20 . 5 volts is generated at 79 . 7 ° f . sensed temperature . as the temperature decreases in the controlled zone , the air cooling facilities can be progressively deactivated by generation of error signals of 15 . 5 volts at point l corresponding to 78 . 7 ° f . which deactivates the second stage of cooling and by generation of an error signal of 14 . 5 volts at 78 . 5 ° f ., point m , that deactivates the first stage of cooling facilities . each control zone in the building serviced by the air conditioning system is provided with a temperature sensing means 10 which has a plurality of circuit means , each at different set point temperatures , for generating a plurality of dc analog voltage signals therefrom . as shown in fig2 the temperature sensing means 10 includes a housing 12 within which are mounted the plurality of circuit means . housing 12 is provided with three terminal posts 14 , 16 , and 18 . a single , three - lead conductor 20 has one of its leads connected to each of the terminal posts which are identified as th , hc and tc on the housing . the circuit means within the housing comprises a first circuit having a lead 22 extending from the common terminal 18 thermistor 24 which is in series with the windings 26 of a potentiometer . thermistor 24 is a conventional thermistor having a negative temperature coefficient . the thermistor 24 is in parallel with a high value resistor 28 . the high resistance value of resistor 28 in parallel with the thermistor reduces the nonlinearity of the thermistor to provide a substantially linear response to temperature changes . the other circuit of the temperature sensing means 10 is substantially identical and has thermistor 30 in series with the windings 32 of a second potentiometer . the wiper contacts of the potentiometers are connected to their respective terminal posts in the housing 12 , i . e ., to terminal posts th and to terminal post tc . the wiper arms 34 and 36 of the potentiometers are mechanically linked to lever arms 38 and 40 , respectively . these lever arms are pivoted at the wiper arm pivot point of the potentiometers and are restrained in their pivotal movement by stops 42 and 44 which project from an interior wall of housing 12 . each of arms 38 and 40 have a short inboard projection 45 and 46 and the ends of these projections are separated by a gap through which the thermostat adjustment lever 48 extends . lever 48 is pivotally mounted in housing 12 by frictional pivot pin 50 and projects beside scale 52 which bears indicia which are calibrated in a temperature scale . the individual lever arms 38 and 40 are biased against their respective stops 42 and 44 by suitable spring means such as tension spring 54 . the pivot end of each of these arms is mechanically linked to its respective wiper arm 38 and 40 of the potentiometer by adjustment means such as screw 56 whereby the angular relationship between the lever arm and its associated potentiometer wiper arm can be fixedly adjusted . the temperature sensing means 10 is thereby provided with two independent circuit means with internal adjustment means for variation of the circuit resistance which is useful to calibrate the circuit to a preselected resistance for a particular set point temperature and for a limited degree of external adjustment by lever 48 to levels below or above the preselected set point temperatures with a band of 3 ° to about 15 °, preferably about 10 ° f ., between those set point temperatures . in the embodiment described herein , the circuit means connected between terminals hc and th generates a heating and ventilation control signal about a set temperature point of 68 ° f . with means permitting adjustability to a lower set temperature point , e . g ., to as low as 55 ° f . typically , a range could be from 55 ° to 70 ° f . similarly , the sensing means 10 contains a second circuit between terminals hc and tc which is calibrated about a second , higher set temperature point such as 78 ° f . with means permitting adjustability to a higher set temperature point , e . g ., to 85 ° f . typically , a range could be from 73 ° to 85 ° f . the fixed adjustability of these circuits by the internal variation between the angular orientation of arms 38 and 40 and their respective potentiometer wiper arms 34 and 36 provides a facile means for factory adjustment of the low and high set point temperatures . the terminals of zone temperature sensing means 10 are connected by multiple conductor 20 to the corresponding terminal posts identified as th , tc and hc on a connector panel 58 . connector panel 58 can have a plurality of other input terminals to receive leads 60 and 62 which extend to another thermistor 64 and its associated parallel resistor 66 . thermistor 64 can be located in the duct to the controlled zone , downstream of the dampers which communicate with hot and cold decks . preferably , this thermistor is in the roof top unit in the common duct connected to the feeder ducts and is responsive to the temperature of the conditioned air supplied to its controlled zone . the connector panel 58 is also supplied with a source of 24 volts d . c . regulated voltage supply through leads 68 and 70 which are connected , respectively , through the terminal posts identified as 24 v and cm on terminal connector panel 58 . a switch 72 is provided between terminal posts 24 v and ns on the connector panel . this switch means 72 can be a manually actuated or , preferably , a timer controlled switch to open the controlled zones &# 39 ; dampers to the hot deck . associated with this is relay means ( not shown ) to switch out the control system , close the fresh air and exhaust dampers , and to connect the heater controls of the air conditioning system to an independent control set at a low night time temperature . circuit means are provided for conditioning the signals generated by the zone temperature sensing means to produce d . c . analog signals therefrom having a magnitude proportional to the sensed temperature . the signal conditioning circuit means is shown as circuit 74 which , preferably , is a modular unit on a circuit board adapted for plug - in connection to the terminals on terminal connector panel 58 . signal conditioning circuit means 74 includes a regulated or constant current supply circuit 76 and a pair of operational amplifiers 78 and 80 for comparing the d . c . voltage signals from temperature sensing means 10 to a reference signal and generating output signals therefrom at terminals zih and zic which have a magnitude proportional to the sensed temperatures in unit 10 . the zone temperature sensing means 10 and the circuits contained therein are portions of a comparator circuit which provides input signals to amplifiers in the signal conditioning circuit contained in circuit 74 . the conditioning circuit means includes a current regulated supply circuit 76 having a plurality of transistors 82 and 84 and 86 which have their emitter and collector terminals connected in series with the sensor network of unit 10 and the reference resistor 88 and their bases biased with a constant voltage source which is the breakdown voltage of zener diode 90 , thereby insuring a relatively constant current supply through each of the legs . these legs are reference leg 92 , first input signal leg 94 and second input signal leg 96 . the first input signal leg 94 extends to the th terminal of the circuit board through the three lead conductor 20 ( fig2 ) to the th terminal of the zone temperature sensing means 10 . the leg extends through the heating and ventilation signal generating circuit of the sensing means 10 , including winding 26 of the variable potentiometer and thermistor 24 , returning to the hc and ds terminals of the circuit board panel 58 . the leg then extends through the duct temperature circuit means including thermistor 64 and returns to the other ds terminal of the connector panel . the leg also extends through the ds terminal to the common or ground terminal of the circuit means 74 . the reference signal leg 92 of the comparator circuit includes a resistance 88 of a fixed value to provide a voltage drop that will provide the desired reference voltage at point 98 . this reference voltage developed at point 98 is applied to the minus terminal of operational amplifier 78 and the plus terminal of operational amplifier 80 as the reference signal thereto . connector 100 is extended from the input positive terminal of amplifier 78 to connection with leg 94 at point 102 to provide an input signal to operational amplifier 78 . similarly , connector 104 extends to a connection with the leg 96 for application of an input signal to the negative terminal of amplifier 80 . the output signal from amplifiers 78 and 80 are applied through load resistors 106 and 108 to the base connections of transistors 110 and 112 . resistor 114 is located between the base of transistor 110 and the common terminal of the voltage supply . the current supply to the collector of transistor 110 is from the 24 v d c buss 116 through resistor 118 . the base of transistor 120 is connected to the collector terminal of transistor 110 so that the collector voltage of transistor 110 is applied to the base of transistor 120 . a transistor 122 of opposite polarity , pnp type , is located between the zh and common terminals with its base connected to the collector terminal of transistor 110 through resistor 124 thereby providing for an output signal between terminals zh and the common terminal over a wide range of voltages in response to the output of amplifier 78 . transistor 126 is provided with its collector connected to the base of transistor 120 and its emitter connected to the zh terminal . this transistor is biased to a saturated condition by the application of a small potential , e . g ., about two volts across the resistor 128 , in series with transistor 120 . the resistor 128 has a value such that a safe current through it , and transistor 120 , will produce 2 volts and saturate transistor 120 and thereby serve as a protective switch to avoid destruction of the transistor 120 in the event that the zh terminal is inadvertently grounded during installation of the circuit . operation amplifier 78 is provided with a feedback to the signal input connector 100 by resistor 130 which is in parallel with capacitor 132 . the value of resistor 130 is selected so as to achieve the desired gain in amplifier 78 while capacitor 132 serves to eliminate any voltage spikes from the feedback signal in accordance with customary techniques . the input signal from the tc terminal and the leg 96 of the comparator circuit which includes thermistor 30 and potentiometer 32 of temperature sensing unit 10 , which is the circuit means that is adjusted to the higher set point temperature , is applied to the negative input terminal of operational amplifier 80 . the output from this amplifier is passed through load resistor 108 to the base of transistor 112 . the emitter of transistor 112 is connected to the output terminal zc through current limiting circuit resistor 134 . feedback to amplifier 80 is through resistor 136 in parallel with capacitor 138 . when the temperature in the control zone departs from the set temperature point , the resistance value of thermistors 28 and 30 are changed from their initial values , decreasing with increasing temperatures . with an increase in sensed temperature , the value of thermistor 28 decreases and the current is maintained constant by regulator circuit means 76 , lowering the voltage at point 102 . this changes the input to amplifier 78 which supplies an amplified lower output to the base of transistor 110 that raises the voltage to the base of transistor 120 and supplies an amplified output signal to terminal zh above the 12 volt , nominal output condition . similarly a decrease in the sensed temperature results in an increase in resistance of thermistor 28 and a higher voltage at point 102 generating a higher output from amplifier 78 which , through transistor 110 and transistor 120 , results in a lower amplified output at terminal zh . the relative values of the components of the temperature sensing and signal conditioning circuits are chosen to provide a high sensitivity in the circuit . the thermistors 28 and 30 are preset to greater sensitivity to temperature changes than duct sensing thermistor 64 by proper selection of the parallel resistance values connected across these thermistors . typically , the thermistors 28 and 30 with proper parallel resistors connected across their terminals provide a negative temperature coefficient of about 50 - 150 ohms per degree fahrenheit while that of thermistor 64 is from about 1 to about 10 ohms per degree fahrenheit . the temperature sensing circuits produce output voltages which range from about 2 to about 22 volts d . c . when using a 24 volt d . c . supply . fig3 illustrates an alternative temperature sensing means , that can be employed in the invention . in this embodiment , separate control levers 140 and 142 are provided whereby the upper and lower set point temperatures , respectively , can be adjusted . as shown , the levers 140 and 142 are pivotal about pins 144 and 146 , respectively . the levers have a limited degree of pivotal adjustment between fixed abutments or stops 148 and 150 that are disposed to either side of the levers . the levers are interconnected to their respective potentiometer wiper arms 152 and 154 by suitable adjustment screw means whereby the angular relationship between the wiper arms and levers can be fixedly adjusted in a factory calibration . typically , the fixed adjustment of these mechanical parts would be set such that the lever 142 , which controls the cooling facilities of the air conditioning system , could not be moved below an upper set temperature point , e . g ., about 78 ° f ., while the lever 140 , which controls the heating and ventilation facilities of the air conditioning system , could not be moved above the lower set temperature point of about 68 ° f . the invention has been described with reference to temperature sensing means having separate circuits with independent temperature responsive elements , i . e ., thermistors 24 and 30 of fig2 and thermistors 92 and 98 of fig3 . a single temperature responsive element can be employed , if desired , for an economy in components . fig4 illustrates a temperature sensing device having a single thermistor . this device is similar in construction to those of fig2 and 3 , having a housing 160 that contains the plurality of temperature sensing circuit means . the housing has three terminal posts hc , th and tc which can be connected to a single three - lead conductor , as described in regard to fig2 . the first circuit in housing 160 comprises a lead 162 extending from the common terminal hc to thermistor 164 , which is in parallel to a high value resistor 166 , and a lead from thermistor 164 to the terminal of potentiometer 168 . terminal th is connected to the wiper arm terminal of potentiometer 168 . the second circuit means in housing 160 also includes lead 162 , thermistor 164 and resistor 166 . the terminal of thermistor 164 , however , is connected to the winding terminal of potentiometer 170 by lead 172 . the tc terminal of housing 160 is connected to the wiper terminal of potentiometer 170 . the thermistor 164 serves as the temperature sensor for both circuits . since the thermistor 164 thus receives current flow from both thermostat legs of the comparator circuit , its sensitivity is adjusted to approximately half the sensitivity of the thermistors used in the devices of fig2 and 3 , reflecting the increased current flow through this thermister . the wiper arms 174 and 176 are mechanically linked to levers 178 and 180 , respectively , by adjustment screw means whereby the angular relationship between the wiper arms and the levers can be fixedly adjusted in a factory calibration . these levers are pivoted at the wiper arm pivot of the potentiometers and are restrained in their pivotal movement by stops 182 and 184 which project from an interior wall of the housing . the levers can be adjusted in the manner previously described with regard to fig3 . the invention has been described with reference to a presently preferred embodiment thereof . obviously , the invention could be equally practiced in other embodiments , e . g ., pneumatic control systems of similar operation could be substituted for the preferred and illustrated electronic system . similarly , electronic components could be substituted , e . g ., different temperature responsive elements such as ptc sensors , for example , ptc thermistors ; thermocouples ; or potentiometers with bimetallic driven wiper arms could be substituted for the preferred and illustrated thermistors . it is , therefore , not intended that the invention be unduly limited by the description of the illustrated and presently preferred embodiments . instead , it is intended that the invention be defined by the means and their obvious equivalents set forth in the following claims .
| 6 |
the disclosed embodiments are applicable to systems such as cdma2000 , w - cdma , and edge , wherein data is transferred using an arq ( automatic request for retransmission ) mechanism , and wherein data packets are sometimes received in an order different from the order in which they were transmitted . in relation to the transmission and receipt of rlp frames , rlp3 currently communicates with a multiplex sublayer below it and a byte stream layer above it . the byte stream layer is commonly referred to as the point to point protocol ( ppp ) layer , because ppp is commonly the protocol used in the byte stream layer . however , as the byte stream layer need not be ppp ( the byte stream layer could be isdn , or one of a plurality of protocols ), it is herein referred to as the byte stream layer . the aforementioned communication flow is illustrated in fig2 , a block diagram showing the data path for cdma2000 . the disclosed embodiments utilize a new method for processing all incoming traffic . the purpose of this method is to reorder the received packets into the order that they were transmitted , and to deliver the packets to the byte stream layer in said order without generating unnecessary naks and data frame retransmissions for delayed rlp frames . the disclosed embodiments reorder received rlp frames by determining the order that physical layer rlp frames were transmitted by a peer , and by buffering each received rlp frame until all rlp frames transmitted prior to it have either been received , or been determined to be missing ( lost or corrupted over the air ). the method accomplishes rlp frame reordering and nak management by means of a memory buffering mechanism and counters and / or timers . fig1 a and fig1 b are timeline diagrams illustrating the time - relationship of data frames transmitted and received on a wireless data network similar to cdma2000 . fig1 a illustrates a 160 ms time interval of rlp data frames generated for an rlp3 data transmission system 5 consisting of a fundamental channel 10 and two supplemental channels 20 , 30 . a first supplemental channel 20 is configured to an 80 ms cdma frame duration , while a second supplemental channel 30 is configured to a 40 ms cdma frame duration . the illustration assumes that at the beginning of the 160 ms time interval , the rlp3 engine has v ( s ) set to 5 . as illustrated , fundamental channel 10 transmits 20 ms cdma frames containing rlp3 frames of sequence numbers 5 , 8 , 9 , 11 , 12 , 15 , 16 and 18 . a first supplemental channel 20 transmits 80 ms cdma frames containing rlp3 frames of sequence numbers 6 and 13 . a second supplemental channel 30 transmits 40 ms rlp frames containing rlp3 frames of sequence numbers 7 , 10 , 14 and 17 . as illustrated in fig1 a , the frames having sequence numbers 5 , 6 , and 7 begin transmission at time 0 . frame 5 , the cdma frame containing an rlp3 frame of sequence number 5 , finishes transmission on fundamental channel 10 at time 20 . frame 6 finishes transmission on first supplemental 20 at time 80 , and frame 7 finishes transmission second supplemental 30 at time 40 . the times at which frames 8 – 18 begin and end transmission are illustrated in a similar manner . fig1 b illustrates a 160 ms time interval of rlp data frames received for an rlp3 data reception system 45 consisting of fundamental channel 10 , first supplemental channel 20 , and second supplemental channel 30 . fig1 b illustrates the times at which the data frames transmitted in fig1 a are received by a peer cdma2000 communications device . the supplemental and fundamental channels are labeled 10 , 20 , and 30 in fig1 b to indicate that these are references to the same channels used by transmission system 5 in fig1 a . as illustrated , rlp3 data reception system 45 receives rlp3 frame immediately following their completed transmission by rlp3 data transmission system 5 . introduction of an arbitary propagation delay common to fundamental channel 10 , the first supplemental channel 20 , and the second supplemental channel 30 , does not alter the explanation and has been omitted for the sake of simplicity . frame 5 is received by rlp3 data reception system 45 on fundamental 10 at time 20 . frame 6 is received by rlp3 data reception system 45 on first supplemental 20 at time 80 . frame 7 is received by rlp3 data reception system on second supplemental 30 at time 40 . the times at which frames 8 – 16 are received are illustrated in a similar manner . by examination of both fig1 a and fig1 b it is evident that the frames are received by rlp3 data reception system 45 in a different order than they were transmitted in by rlp3 data transmission system 5 . fig2 is a functional block diagram of an exemplary embodiment of a cdma2000 data transmission system 250 embodied in communication devices base station 210 and mobile station 230 . for illustrative purposes , the cdma2000 data transmission system is described in terms of transmission of packet data on the forward link . however , the teachings are easily extended to apply to reverse link transmissions . in base station 210 , there exists a byte stream layer 212 that provides a stream of bytes to rlp3 layer 214 . rlp3 layer 214 buffers these bytes for later transmission . multiplex sublayer 216 requests rlp frames from rlp3 layer 214 . in response , rlp3 layer generates rlp frames in accordance with the rlp3 specification and provides them to multiplex sublayer 216 . the rlp3 specification does not specify that the rlp3 layer shall assign frame sequence numbers in accordance with the frame lengths requested by the multiplex sublayer . in the exemplary embodiment , multiplex sublayer 216 encapsulates these rlp frames in accordance with the cdma2000 specification . multiplex sublayer 216 then provides these encapsulated rlp frames to physical layer 218 for transmission over cdma2000 air link 220 in accordance with the cdma2000 specification . when providing frames to physical layer 218 , multiplex sublayer 216 indicates which frames are to be transmitted on which channels . physical layer 238 , of mobile station 230 , receives frames from cdma2000 air link 220 . at 20 ms intervals , physical layer 238 provides each received frame to multiplex sublayer 236 , and indicates to multiplex sublayer 236 the channel that each frame was received on . multiplex sublayer 236 unencapsulates the rlp frames in accordance with the cdma2000 specification and provides the rlp frames to rlp3 layer 234 . rlp3 layer 234 performs rlp frame processing on these frames in accordance with the rlp3 specification . in the event that any received frame has a sequence number equal to v ( n ) the payload of all received rlp frames having consecutive sequence numbers beginning with v ( n ) are provided to byte stream layer 232 by rlp3 layer 234 . in the event that a new hole is created , a ak is generated to signal that one or more data frames need to be retransmitted , while the unsequentially received frame is buffered . the above description describes an exemplary embodiment of cdma2000 data flow in the forward link direction . as is known by one skilled in the art , data flow occurs in the reverse link direction along a path in the opposite direction . fig3 through 7 illustrate embodiments presenting a novel method of detecting rlp3 frames that are merely delayed , and not lost or corrupted . the presented embodiments disclose a novel method of preventing unnecessary naks , and resulting rlp frame retransmissions , when delayed frames are detected . the disclosed embodiments buffer unsequentially received rlp frames and withhold the transmission of nak messages until delayed rlp frames have been missing longer than a tolerated time period , using timers and or counters . fig3 is a flow chart diagram illustrating one embodiment of delayed frame detection in rlp3 . in block 302 , at 20 ms intervals , rlp frames are received . in this embodiment , the expected sequence number , l_v ( r ), is not updated until delayed frames have been received . when a new rlp frame is received , its full internal sequence number , received seq number , is calculated using its 8 bit over the air seq bits and 4 seq_hi bits of the current l_v ( r ). every 20 ms frame time , age counters of any rlp frames previously buffered in a delayed frame queue are decremented in block 304 . in block 306 , the received seq number is compared to the current l_v ( r ). in order to delay updating l_v ( r ), all unsequentially received rlp frames are buffered in the delayed frame queue . without delayed frame detection for rlp3 , received rlp frames with a received seq number greater than the sequence number of the next expected frame , v ( r ), would generate an unnecessary nak for delayed frames . new rlp frames with a sequence number less than l_v ( r ) are discarded . if the received rlp frame has a received seq number greater than l_v ( r ), indicating an unsequentially received rlp frame , or a hole , the rlp frame is inserted into the delayed frame queue buffer in order of received seq number in block 308 . the delayed frame queue buffer is maintained every 20 ms frame time by an age counter , hereinafter referred to as maximum age . for example , a system may tolerate a frame delay of 1 frame . each rlp frame in the delayed frame queue buffer has a maximum age counter that is decremented every frame time until it reaches 0 . when the maximum age counter of an rlp frame reaches 0 , the rlp frame is processed as a new rlp frame . unsequentially received rlp frames are stored in the delayed frame queue buffer in the order of received seq numbers . when a received rlp frame is placed in the delayed frame queue due to the receipt of a received seq number that is greater than the sequence number expected , a hole has been created in place of the expected rlp frame . in block 310 , the age counter of the rlp frame placed in the delayed frame queue in block 308 is initialized to the frame delay tolerance of the system , i . e max age = frame delay tolerance of the system . control passes to block 318 . the size of the delayed frame queue depends on the frame delay tolerance of the system , or the number of frames of delay for which the receiver is compensating . when an rlp frame is added to the delayed frame queue , the frame is given a maximum age . the maximum age is decremented every 20 ms . a buffered rlp frame becomes zero aged when the maximum age counter for the frame has been decremented to zero . when the age of the unsequential rlp frame becomes zero aged , the rlp frame is then processed as a new rlp frame . at this point , a necessary nak ( or naks ) may be created for missing rlp frames , i . e . rlp frames that have been delayed longer than the delay tolerance of the system . if the received seq number of the zero aged rlp frame is greater than v ( r ), a nak is issued for missing rlp frame number v ( n ). in a system where the frame delay tolerance is more than one frame time , a nak may be issued for missing frames v ( n ) through v ( r ). in block , 318 , the delayed frame queue buffer is checked for rlp frames with maximum age counters that have reached zero during the current frame time . if in block 320 , there are no rlp frames in the delayed frame queue with age values of zero or with sequence numbers equal to the next expected rlp frame , the system is ready to receive the next new rlp frame in block 302 . if in block 320 , any rlp frame &# 39 ; s maximum age has reached zero , the received seq number of the zero aged rlp frame is compared to l_v ( r ) in block 322 . if in block 322 , the received seq number of the zero aged rlp frame is greater than v ( r ), indicating a hole , or a delayed rlp frame missing longer than the frame delay tolerance of the system , a nak is issued for the missing rlp frame or frames in block 324 and control passes to block 312 where the zero aged rlp frame is processed as a new rlp frame . if in block 322 , the received seq number of the zero aged rlp frame is not greater than v ( r ), or if in block 306 , the currently received rlp frame has a received seq number equal to l_v ( r ) indicating a sequentially received rlp frame , control passes to block 312 , where the rlp frame is processed as a new rlp frame regardless of whether the rlp frame was newly sequentially received or became zero aged while stored in the delayed frame queue buffer . in block 314 , l_v ( r ) is incremented in order to receive the next sequential rlp frame . if there are no holes , l_v ( n ) is also incremented . when there are no holes , l_v ( n ) is equal to l_v ( r ). when there are no holes , l_v ( n ) tracks l_v ( r ), as the next needed rlp frame will also be the next expected rlp frame . however , if a hole exists , l_v ( n ) is not incremented . when a hole is filled , l_v ( n ) either takes the value of the next hole , or the value of l_v ( r ) if there are no more holes . the rlp frame is passed to the next protocol layer in block 316 . when a currently received rlp frame has either been passed to the next protocol layer or buffered in the delayed frame queue , and there are no rlp frames in the delayed frame queue with age values of zero , the system is ready to receive the next new rlp frame in block 302 . to make delayed frame detection in rlp3 highly efficient , another embodiment avoids aging each unsequential rlp frame separately . instead , n sub - arrays are maintained in the delayed frame queue , which compensate for n − 1 number of frames of delay . if , for example , the receiver is compensating for a typical case of only one frame delay , all the frames received in a 20 ms interval , that would have caused l_v ( r ) to be incremented are placed in sub - array 0 in a sorted order . in the next 20 ms interval all of the frames received that would have caused l_v ( r ) to be incremented are placed in sub - array 1 in a sorted order . at the end of the 20 ms interval , all the preexisting rlp frames in sub - array 0 are processed as new rlp frames . at this time l_v ( r ) may be incremented and a nak ( s ) may be generated for missing rlp frame ( s ). fig4 a – 4e illustrate possible rlp frame reception and memory structure management scenarios of the rlp3 delayed frame detection embodiment diagramed in fig3 . the scenarios illustrate received rlp frames , the received seq number , rlp state variable values of v ( r ), v ( n ), and the contents of the delayed frame queue over a period of four frame times . in fig4 a , a first rlp frame 402 a is received with a received seq number 404 a of 1 . before the rlp frame is received , the expected sequence number , v ( r ) 406 a equals 1 . because the sequence number of the received rlp frame , seq 404 a equals the expected sequence number v ( r ) 406 a , the rlp frame is processed as a sequentially received new rlp frame and passed to the next protocol layer . v ( r ) 406 a is incremented to 2 . v ( n ) 408 a is also incremented to 2 , and the delayed frame queue 410 a is empty , as no unsequential rlp frames have yet been received ( there are no holes ). in fig4 b , a second rlp frame 402 b is received with a received seq number 404 b of 2 . before the rlp frame is received , the expected sequence number , v ( r ) 406 b equals 2 . because the sequence number of the received rlp frame , seq , 404 b equals the expected sequence number v ( r ) 406 b , the rlp frame is processed as a sequentially received new rlp frame and passed to the next protocol layer . v ( r ) 406 b is incremented to 3 . again , v ( n ) 408 b is also incremented to 3 , and the delayed frame queue 410 b is empty , as no unsequential rlp frames have yet been received ( there are no holes ). in fig4 c , a third rlp frame 402 c is received with a received seq number , seq 404 c of 4 . before the rlp frame is received , the expected sequence number , v ( r ) 406 a equals 3 . a hole has been created where rlp frame 3 was delayed . because the received seq number of the received rlp frame 404 c is greater than the expected sequence number v ( r ) 406 c , the rlp frame is placed in the delayed frame queue 410 c . for exemplary purposes , the system will have a frame delay tolerance of one frame time . thus , the maximum age of rlp frame 4 is initialized to 1 , the example frame delay tolerance of the system . v ( r ) 406 c and v ( n ) are not incremented , retaining their values of 3 . in fig4 d , a fourth rlp frame 402 d is received with a received seq number , seq 404 d of 3 . in other words , the delayed rlp frame 3 has arrived out of sequence , one frame time after rlp frame 4 was received , filling the hole for rlp frame 3 . the maximum age of rlp frame 4 in the delayed frame queue is decremented from 1 to zero . before the rlp frame is received , the expected sequence number , v ( r ) 406 d equals 3 . because the received seq number of the received rlp frame , seq 404 d , equals the expected sequence number v ( r ) 406 d , the rlp frame is processed as a sequentially received new rlp frame and passed to the next protocol layer . at this time , rlp frames 1 through 3 have been passed to the next protocol layer . v ( r ) 406 d is incremented to 4 . v ( n ) 408 d is also incremented to 4 , as there are no more holes . the delayed frame queue 410 d is checked and rlp frame 4 is found to have a zero age causing rlp frame 4 to be passed to be sequentially passed to the next protocol layer . v ( r ) and v ( n ) are incremented to 5 , the next sequential rlp frame , and the system is ready to receive the next new rlp frame . in fig4 e , a forth rlp frame 402 e is received with a received seq number , seq , 404 e of 5 , instead of received seq number 3 404 d , as in fig4 d . the hole for rlp frame 3 , filled in fig4 d , is not filled in fig4 e . instead , frame 5 is received , causing a nak to be transmitted for frame 3 . the maximum age of rlp frame 4 in the delayed frame queue is decremented from 1 to zero . before the rlp frame is received , the expected sequence number , v ( r ) 406 e equals 3 . because the sequence number of the received rlp frame , seq 404 e , is greater than the expected sequence number v ( r ) 406 e , the rlp frame 5 is placed in sequential order in the delayed frame queue 410 e and assigned a max age of 1 . the delayed frame queue 410 e is checked for zero aged rlp frames , where rlp frame 4 has reached zero age . the received seq number of the zero aged buffered rlp frame , 4 is greater than v ( n ), which is equal to 3 . a nak is sent for rlp frame 3 . rlp frame 4 is processed as a new rlp frame and passed to the upper protocol layers . rlp frame 5 remains in the delayed frame queue . v ( r ) 406 e is incremented to 4 , but since the hole for rlp frame 3 has not been filled , v ( n ) is not incremented , retaining its value of 3 . fig5 is a flow chart diagram illustrating another embodiment of delayed frame detection in rlp3 . in the embodiment illustrated in fig5 , updates of l_v ( r ) and l_v ( n ) are done normally , with no special processing for delayed frames . the illustrated embodiment increments the state variables and creates naks for holes as in versions of rlp without delayed frame processing . however , naks are not issued upon creation , but buffered and timed to prevent issuance of unnecessary naks . delayed rlp frames are processed as rlp frames that would generate a nak . when the received seq number of a received rlp frame is greater than expected , v ( r ) is incremented and a nak is generated , as without delayed frame processing . however , the naks are not immediately issued . instead , to prevent unnecessary naks for delayed rlp frames , the naks are stored in a nak queue . three timers are started such that if the missing rlp frame arrives ( the hole is filled ), any timers for the arrived frame are turned off and the naks for the arrived frame are purged from the queue . if timer 1 expires and the delayed rlp frame has still not arrived , one nak is issued . if timer 2 expires before the delayed rlp frame arrives , two naks , are issued , and if timer 3 expires before the delayed rlp frame arrives , three naks are issued . one skilled in the art would understand that the nak scheme described above for exemplary purposes can be specified and changed by use of variable rlp_blob as described in is - 707 . in block 502 , at 20 ms intervals , rlp frames are received . when a new rlp frame is received , the received seq number is calculated using its 8 bit over the air seq bits and 4 seq_hi bits of the current l_v ( r ). in block 504 , the received seq number is compared to l_v ( r ). if , in block 504 , the received seq number is equal to l_v ( r ), the expected rlp frame has been received in sequence . control passes to block 506 , where the sequentially received rlp frame is passed to the next protocol layer . v ( r ) and v ( n ) are incremented to receive the next sequential rlp frame . control returns to block 502 . if , in block 504 , the received seq number is greater than l_v ( r ), an rlp frame has been delayed , creating a hole . control passes the block 510 where the unsequential rlp frame is placed in a resequencing queue in order of received seq number . v ( r ) is incremented in block 512 . v ( n ) is not incremented because a hole has been created . in block 514 , naks are generated for the hole and placed in a nak queue . in block 516 , nak send timers are started for the nak messages . control returns to block 502 to receive the next rlp frame . if , in block 504 , the received seq number is less than l_v ( r ), a delayed rlp frame has been received . the delayed rlp frame , better late than never , is passed to the next protocol layer in block 518 . in block 518 , l_v ( r ) is incremented on reception of the delayed rlp frame . because the hole has been filled , the value of v ( n ) is made equal to v ( r ), or the next hole in block 520 . in block 522 , the resequencing queue is checked for rlp frames sequential to the filled hole . if sequential rlp frames are stored in the resequencing queue , they are passed to the next protocol layer in block 524 . the unnecessary naks associated with the filled hole are removed from the nak queue in block 526 . timers corresponding to the unnecessary naks are turned off in block 528 . control returns to block 502 to receive the next rlp frame . fig6 a – 6d illustrate possible rlp frame reception and memory structure management scenarios of the rlp3 delayed frame detection embodiment diagramed in fig5 . the scenarios illustrate received rlp frames , the received seq number , rlp state variable values of v ( r ), v ( n ), and the contents of the resequencing queue and nak queue over a period of four frame times . in fig6 a , a first rlp frame 602 a is received with a received seq number , seq 604 a of 1 . before the rlp frame is received , the expected sequence number , v ( r ) 606 a equals 1 . because the received seq number of the received rlp frame , seq 604 a equals the expected sequence number v ( r ) 606 a , the rlp frame is processed as a sequentially received new rlp frame and passed to the next protocol layer . v ( r ) 606 a is incremented to 2 . v ( n ) 608 a is also incremented to 2 . the resequencing queue 610 a and the nak queue 612 a are empty , as no unsequential rlp frames have yet been received ( there are no holes ). in fig6 b , a second rlp frame 602 b is received with a received seq number , seq 604 b of 2 . before the rlp frame is received , the expected sequence number , v ( r ) 606 b equals 2 . because the sequence number of the received rlp frame seq 604 b equals the expected sequence number v ( r ) 606 b , the rlp frame is processed as a sequentially received new rlp frame and passed to the next protocol layer . v ( r ) 606 b is incremented to 3 . again , v ( n ) 608 b is also incremented to 3 . the resequencing queue 610 b and the nak queue 612 b remain empty , as no unsequential rlp frames have yet been received ( there are no holes ). in fig6 c , a third rlp frame 602 c is received with a received seq number , seq , 604 c of 4 . before the rlp frame is received , the expected sequence number , v ( r ) 606 a equals 3 . a hole has been created where rlp frame 3 was delayed . because the sequence number of the received rlp frame 604 c is greater than the expected sequence number v ( r ) 606 c , the rlp frame is placed in the resequencing queue 610 c . v ( r ) 606 c is incremented to 4 as usual when an rlp frame is received . v ( n ) is not incremented because a hole has been created , retaining its value of 3 . one nak is generated and stored in the nak queue 612 c for a first peer notification if the hole is not filled by the time the first timer expires . two naks are generated and stored in the nak queue 612 c for a second peer notification if the hole is not filled by the time the second timer expires . two naks are generated for the second notification to increase the probability that the peer will receive the naks if it has failed to receive the first nak . three more naks are generated and stored in the nak queue 612 c for a third peer notification if the hole is not filled by the time the third timer expires . three naks are generated for the third notification to increase the probability that the peer will receive the naks if it has failed to receive the first nak as well as the second two naks . timers are started to issue the naks in the event that the delayed rlp frame is not received . the naks will only be issued if the delayed rlp frame is not received within the frame delay tolerance of the system . in fig6 d , a fourth rlp frame 602 d is received with a received seq number , seq , 604 d of 3 . in other words , the delayed rlp frame 3 has arrived out of sequence , one frame time after rlp frame 4 was received , filling the hole for rlp frame 3 . before the rlp frame is received , the expected sequence number , v ( r ) 606 d equals 4 . because the received seq number of the received rlp frame , seq 604 d , is less than the expected sequence number v ( r ) 606 d , the rlp frame is passed to the next protocol layer , and l_v ( r ) is incremented to 5 , due to the reception of a new rlp frame . at this time , rlp frames 1 through 3 have been passed to the upper protocol layer , and rlp frame 4 is in the resequencing queue . v ( n ) is set to value of 5 , equal to v ( r ) 606 d , as the hole created by delayed rlp frame 3 has been filled . the resequencing queue 610 d is checked and rlp frame 4 is sequentially passed to the next protocol layer , leaving the resequencing queue empty . the timers for the nak messages are turned off and the nak messages are purged from the nak q because the hole has been filled . the system is ready to receive the next new rlp frame . fig7 illustrates wireless communications apparatus for performing delayed frame detection in rlp3 . wireless communications apparatus for performing delayed frame detection in rlp3 comprises wireless devices that send or receive rlp3 frames , such as mobile telephones , base station transceiver subsystems , and wireless data terminals . wireless communications signals are received by wireless device 700 at antenna 712 . antenna 712 is a transducer that converts radio - frequency ( rf ) fields into alternating current ( ac ) or vice - versa . antenna 712 intercepts rf energy and delivers ac to electronic equipment . the received analog signal reaches antenna element 712 , is downconverted to a baseband analog signal , and is further converted to digital rlp frames by data demodulator element 702 . after demodulation , the data frames pass to control processor 704 . control processor 704 performs delayed frame detection . control processor 704 passes sequential rlp frames to higher protocol layers , and buffers unsequential rlp frames and nak messages for missing rlp frames . control processor 704 performs its operations using a set of instructions , contained in storage medium 705 . one skilled in the art would understand that storage medium 705 could be integral to control processor 704 . it is also understood by those of skill in the art that processors may encompass a digital signal processor ( dsp ), an application - specific integrated circuit ( asic ), discrete gate logic , firmware , or any conventional programmable software module and a microprocessor . the software module could reside in ram memory , flash memory , registers , or any other form of storage medium known in the art . alternatively , any conventional processor , controller , or state machine could be substituted for the microprocessor . the control processor 704 instructs the message generator 706 to generate nak messages for missing rlp frames . the messages are modulated by modulator 708 and transmitted to peer wireless communications devices from antenna 712 . the presently disclosed embodiments provide a method of delayed rlp frame detection , handing and sequencing for upper protocol layers . thus , a novel and improved method and apparatus for delayed frame detection in rlp3 has been described . those of skill in the art would understand that the data , instructions , commands , information , signals , bits , symbols , and chips that may be referenced throughout the above description are represented by voltages , currents , electromagnetic waves , magnetic fields or particles , optical fields or particles , or any combination thereof . those of skill would further appreciate that the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented as electronic hardware , computer software , or combinations of both . the various illustrative components , blocks , modules , circuits , and steps have been described generally in terms of their functionality . whether the functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . skilled artisans recognize the interchangeability of hardware and software under these circumstances , and how best to implement the described functionality for each particular application . as examples , the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented or performed with a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components such as , e . g ., registers and fifo , a processor executing a set of firmware instructions , any conventional programmable software module and a processor , or any combination thereof designed to perform the functions described herein . the processor may be a microprocessor , but in the alternative , the processor may be any conventional processor , controller , microcontroller , or state machine . the software module could reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , hard disk , a removable disk , a cd - rom , or any other form of storage medium known in the art . as illustrated in fig7 , an exemplary processor 704 is coupled to a storage medium 705 so as to read information from , and write information to , the storage medium 705 . in the alternative , the storage medium 705 may be integral to the processor 704 . the processor 704 and the storage medium 705 may reside in an asic ( not shown ). the asic may reside in a telephone ( not shown ). in the alternative , the processor 704 and the storage medium 705 may reside in a telephone . the processor 704 may be implemented as a combination of a dsp and a microprocessor , or as two microprocessors in conjunction with a dsp core , etc . the previous description of the preferred embodiments is provided to enable any person skilled in the art to make or use the disclosed embodiments . the various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without the use of the inventive faculty . thus , the disclosed embodiments are not intended to be limited to the embodiments shown herein but are to be accorded the widest scope consistent with the principles and novel features disclosed herein .
| 7 |
now referring to fig3 and 4 , an embodiment of a multi - tone display lcm is illustrated according to the present invention . in this embodiment , it should be noted that an analog display data or signal ( stepwise analog signal ) 2 having different voltage levels corresponding to the number n of tones to be displayed is input to the display device . for simplicity of explanation , it is assumed that n = 4 , the analog input signal is represented by the voltage levels corresponding to 4 ( four ) tones . the analog signal is sent from an image display output of e . g ., a personal computer . in fig3 is an a - d converter section ; 7 is a digital display data . the a - d converter section 6 converts the analog display data 2 as an input into the digital display data which is represented by 2 bits ; more specifically , four value voltage levels of the analog display data are converted into ( 0 , 0 ), ( 0 , 1 ), ( 1 , 0 ), and ( 1 , 1 ) from the lower levels . 8 is a multi - voltage - level output generating circuit for generating constant voltages at plural levels in accordance with tones to be displayed , e . g . voltages at four different levels since this embodiment is directed to 4 tone display . the signal at the voltage level corresponding to tone 0 is output to a signal line 9 . the signals at voltage levels corresponding to tone 1 , tone 2 and tone 3 are output to signal lines 10 , 11 , and 12 respectively . 15 is an x driving section which takes in 2 bit digital data 7 sequentially one line at a time in synchronism with the latch clock 3 , selects one of the four tone voltages output to the signal lines 9 , 10 , 11 and 12 in accordance with the decoded value of data for each dot and outputs it as panel data x 1 - x 640 . the remaining reference numbers denote like parts in fig1 . fig4 shows an example of the x driving section shown in fig3 . in fig4 is a latch selector and s 1 - s 640 are select signals . the latch selector 23 is cleared by latch clock 3 and sequentially boosts the select signals s 1 , s 2 , . . . s 640 “ high ” in synchronism with the succeeding clocks 3 . 24 is a latch circuit which serves to latch the digital display data 7 in blocks ( latch 1 - latch 640 ) in which the select signal is “ high ”. 25 to 28 are outputs from the respective blocks of the latch circuit 24 , i . e . 2 bit latch data 1 to 640 . 29 is a horizontal latch circuit which latches the latched data 1 to 640 in horizontal latches 1 to 640 in synchronism with the horizontal clock 4 . 30 to 33 are outputs from the respective blocks of the horizontal latch circuit 29 , i . e . 2 bit horizontal data 1 to 640 . 34 is a decoder which serves to decode the horizontal data 1 to 640 by the corresponding decoder blocks ( decoders 1 to 640 ). numerals 35 to 38 are outputs from the decoder blocks , i . e ., decoded values 1 to 640 . numeral 39 indicates a voltage selector which serves to select one of the tone voltages in accordance with the decoded values 1 - 640 . now referring to fig3 and 4 , the operation of the multi - tone display lcm 1 shown in fig3 will be explained . in fig3 , the analog display data 2 is converted into the 2 bit digital data 7 by the a - d converter section 6 ; the 2 bit digital display data 7 is input to the x driving section 15 . the x driving section 15 takes the display digital data 7 , in synchronism with the latch clock 3 ( fig2 ) in one latch block of the latch circuit 24 to which a “ high ” select signal is being input . the latch selector 23 shifts the “ high ” state of the select signal each time the latch clock 3 is input . the latch circuit 24 takes in the sequentially sent digital display data 7 in the latch blocks 1 , 2 . . . 640 . when the latch circuit 24 has taken in the digital display data 7 corresponding to one line , i . e ., up to latch block 640 , the horizontal clock ( fig2 ) is applied to the x driving section 15 to clear the latch selector 23 ; then the x driving section stands by for next take - in of the digital display data 7 . the data latched by the latch circuit 24 is sent to the horizontal latch circuit 29 which latches the data from the latch circuit 24 in synchronism with the horizontal clock 4 ( fig2 ). the horizontal data 30 to 33 which are outputs from the horizontal latch circuit 29 are sent to the decoder 34 and decoded by the decoder blocks 1 to 640 thereof ; the decoded values 35 to 38 are output from the decoder 34 . in the voltage selector 39 , the selector blocks 1 to 640 , in accordance with the decoded values , selects tone 0 voltage 9 if the decoded value is “ 0 ”, tone 1 voltage 10 if it is “ 1 ”, tone 2 voltage 11 if it is “ 2 ”, and tone 3 voltage 12 if it is “ 3 ”. the tone voltages output from the voltage selector blocks are sent to the liquid crystal panel 17 as panel data x 1 to x 640 . thus , the four value voltages output from the x driving section 15 are applied to the liquid crystal elements corresponding to the line selected by the y driving section 16 in response to the select voltage 13 sent from the voltage generating circuit 8 . in this way , the lcm 1 shown in fig3 can realize four tone display . although the four tone display has been adopted in this embodiment , 2 n tone display can be realized . more specifically , if the input analog display data is represented by 2 n ( n is an integer of 1 or more ) levels , it is converted into n bit digital data by the a - d converter section 6 , the data width in the internal circuits in the x driving circuit 15 is set at n bits , and 2 n kinds of tone voltage are supplied to the x driving section 15 to display 2 n tones . now referring to fig5 , one embodiment of the lcm for multi - color display will be explained . the multi - color display can be realized by arranging color filters of r ( red ), g ( green ) and b ( blue ) in the direction of dots on the liquid crystal panel 17 , providing a - d converter sections 43 , 44 and 45 for r 40 , g 41 and b 42 as input analog display data , and applying the outputs from the r , g and b a - d converter sections 43 , 44 and 45 to a color x driving section 46 . in this case , the color x driving section 46 has three columns of the arrangement shown in fig4 and thus the corresponding panel data are rx 1 - rx 640 , gx 1 - gx 640 and bx 1 - bx 640 . with reference to fig6 to 8 , another embodiment of the multi - tone lcm will be explained . in this embodiment , it should be noted that a parallel input of m ( m is a positive integer ) dots are applied to the x driving section , and it is assumed that m = 2 . in fig6 , like reference numerals denote like elements in fig3 . 47 is a serial - parallel converter section . 48 is a first dot digital data , and 49 is a second dot digital data . the serial - parallel converter section 47 converts 2 bit serial digital data 7 from the a - d converter section 6 into a parallel data consisting of the first dot digital data 48 and the second dot digital data 49 , each data consisting of 2 bits . 50 is a timing correction section . 51 is a parallel clock . 52 is a correction horizontal clock . 53 is a correction head line signal . in response to the latch clock 3 , the timing correction section 50 generates a parallel clock 51 in synchronism with the parallel data consisting of the first dot digital data 48 and the second dot digital data 49 . further , in order to correct the phase deviation of data due to the serial - parallel conversion of the display data , the timing correction section 50 corrects the horizontal clock 4 and the head line signal 5 using the latch clock 3 to provide a corrected horizontal clock 52 and a corrected head line signal 53 . 54 is a parallel x driving section which serves to sequentially take in the 2 bit parallel display data in synchronism with the parallel clock 51 . fig7 is a timing chart showing the operation of the serial - parallel conversion section 47 . fig8 is a block diagram of the parallel x driving section 54 . in fig8 is parallel latch select which is cleared by the corrected horizontal clock 52 and thereafter sequentially boosts select signals 81 , 82 , . . . 8320 to “ high ”. 56 is a parallel latch circuit ; the latch block thereof for which the select signal is “ high ” latches simultaneously the first dot digital data 48 and second dot digital data 49 at the timing of the parallel clock 51 . the other reference numerals in fig8 denote like elements in fig4 . the operation of the multi - tone lcm shown in fig6 will be explained . the analog display data 2 having four value voltage levels is the 2 bit digital display data 7 by the analog - digital converter section 6 . this digital display data 7 is converted into 2 bit parallel data , as shown in fig7 , to provide the first dot digital data 48 and second dot digital data 49 which are in synchronism with the parallel clock 51 . then , as shown in fig7 , owing to the serial - parallel conversion , the phase of the output data lags the input data by 2 ( two ) latch clocks 3 . in order to correct this lag , the timing correction section 50 also causes the horizontal clock 4 and the head line signal 5 to lag by 2 latch clocks 3 . the resulting corrected horizontal clock 52 and corrected head timing signal 53 are applied to the x driving section 54 and the y driving section 16 . as seen from fig8 , the x driving section 54 takes the first dot digital data 48 and the second dot digital data 49 , in synchronism with the parallel clock 51 , into its one block to which the “ high ” select signal is applied from the parallel latch select 55 . the parallel latch select 55 is cleared by the corrected horizontal clock 52 and thereafter sequentially boosts the select signals s 1 to s 320 to “ high ”. thus , the parallel latch circuit 52 also latches the data in the order of latch blocks 1 , 2 . . . 320 to finally latch the data corresponding to one line . the outputs from the blocks of the parallel latch circuit 56 are latched in the horizontal latch circuit 52 at the timings of the corrected horizontal clock 52 . the following operation is the same as that in fig4 . thus , parallel data x 1 to x 640 are provided as panel data . as understood from the above explanation , two dots can be used as an input to the x driving section 46 by providing the serial - parallel conversion section 47 , causing the internal port of the x driving section 46 to simultaneously latch two dots and providing the timing correction section for correcting the phase lag due to the serial - parallel conversion . this can enhance the operation speed of the circuits successive to the a - d converter section 6 . in another embodiment of the invention , the timing correction section 50 is not required when the input timing is determined in consideration of the phase delay in the serial - parallel conversion section 47 ( two latch clocks 3 ) so that the horizontal clock 4 and the head line signals can be directly used without correction . incidentally , although in this embodiment , the input to the x driving was 2 bits for each of 2 dots , the input of n bites ) ( n is an integer of 1 or more ) for each of m dots ( m is an integer of 2 or more ) can be realized in the same way . a second embodiment of the lcm for color display as shown in fig9 can be realized by providing r , g and b serial - parallel converter sections 57 , 58 and 59 , and providing a color parallel x driving section 60 with three columns of the arrangement of fig8 . further , although the explanation hitherto made was directed to a liquid crystal display device , the same idea can be also applied to the other display devices such as a plasma display , el display , etc . in accordance with the present invention , an lcm for multi - tone display or multi - color can be realized thereby to decrease the number of input lines to lcm . moreover , by using an analog input to decrease the number of data bits , noise to be generated can be reduced . further , by carrying the parallel operation of the x driving section , the operation speed can be enhanced . furthermore , since the voltages in accordance with n bit decoded values can be selected as outputs from the x driving section , tone voltage with less fluctuation can be provided .
| 6 |
referring to fig1 of the drawings , tenderizer / sterilizer 10 is geared toward processing meat 100 for the commercial meat packing industry . typically , meat 100 may be continuous batches , or commercial slabs that may weigh about 300 to 600 pounds . a smaller version of tenderizer / sterilizer 10 can be constructed based on the teachings detailed herein for home consumers to tenderize and / or sterilize smaller portions of meat 100 . therefore , numerous sizes and capacities of tenderizer / sterilizer 10 may be made in scaled versions depending upon the particular applications . factors that make meat tender are well known and fully qualified . the following factors are well known and accepted ways to make meat tenderer : ( a ) prevent shortening of the sarcomeres caused by cold temperatures . meat must be refrigerated to prevent spoiling . locker and hagyard &# 39 ; s article cited above , including fig2 showed that the sarcomeres shorten when refrigerated . they also showed new temperature affects the sarcomeres . ( 1 ) provide a thickness of subcutaneous fat equal to a thickness of about : 0 . 10 inches in lamb ; 0 . 25 inches in beef . this thickness slows down temperature drop in muscle since fat is an insulator . the thicker the fat the better since the fat slows down temperature changes that occur from live to dead and from dead to refrigerated . fatter makes the sarcomeres weaker and therefore , less prone to cold shortening ( 2 ) chill meat at high temperature before rigor mortis sets in ( to about 16 ° c . for 16 hours immediately after slaughter , see fig2 ). ( 3 ) apply electrical stimulation to meat at 550 volts , 2 to 6 amps , 15 times in one minute to cause a very rapid drop in muscle ph and much quicker onset of rigor mortis . ( 1 ) apply texas a & amp ; m tenderstretch ™ technique that has suspension by the obturator foramen . hindleg acts as a cantilever . ( 2 ) apply stouffer &# 39 ; s stretching devices to a & amp ; m &# 39 ; s tenderstretch ™ technique to include clamps and stretching rods . ( 3 ) apply the trademarked technique known as tendercut ™ wherein bones and connective tissues are cut around muscles to allow stretching of the tissue . ( a ) increase activity of endogenous enzymes that include : ( a ) calpains , which are stored in the cytosol near z - lines and require calcium to be activated , and / or ( b ) cathepsins , which are stored in lysosomes . calpains work on z - lines while cathepsins work on actin - myosin bonds . calpastatin regulates calpains ; the higher the calpastatin levels and activity , the less breakdown of myofibrils . ( 1 ) apply aging by storing in cooler for 1 to 6 weeks at 0 - 30 ° c . ( 2 ) apply high temperature , post - rigor chilling by storing at 200 ° c . for 24 hours , ( same effect as 20 ° c . for 14 days ). ( 3 ) apply high temperature , pre - rigor chilling by storing at 160 ° c . for 16 hours . ( 4 ) apply electrical stimulation of meat by rapid ph decline to rupture lysosome and release cathepsins . ( 5 ) infuse / inject calcium chloride into meat by pre - rigor infusion or post - rigor injection of a solution of calcium chloride into muscle to cause increased activity of calpains . ( 2 ) machines have multiple blades and / or needles to penetrate meat as it passes through on a conveyor . first machine was called a jaccard and the process “ jaccarding .” ( 3 ) scoring , dicing , cubing , grinding or chopping meat created mechanical severance . ( 4 ) placing meat in a sealed water - filled chamber and setting off an explosion in the process known under the trademarked process know as hydrodyne ™. ( c ) topically add exogenous enzymes which are biochemical catalysts . protease enzymes can break down collagen proteins that are found in skin , bone , and muscle ( 1 ) marinate with salt and vinegar in a 2 % solution of nacl plus acetic acid in water . ( 1 ) cook by moist - heat cookery for a long time with steam generation , e . g . by braising , stewing , or simmering . the following table shows the relationship between tenderness and meat cuts : shear force = pounds of force to shear one - half - inch cores , removed parallel to the muscle fibers , of cooked muscle from steaks and roasts . the following table shows the traits of tender and tough meat : 1 . breed type : bos indicus ( brahman , sahiwal , etc .) breeds tend to be tougher than bos taurus breeds ( angus , hereford , etc .). bos indicus has greater amounts of calpastatin , a protein that interferes with postmortem degradation of muscle . 2 . locomotive vs . support muscles : less connective tissue is observed in support muscles . 3 . quality grade effects : prime has more marbling than choice and choice has more than select . 4 . degree of doneness : as some meat is cooked to more advanced degrees of doneness , it will get tougher . marbling helps to ensure acceptable tenderness at higher levels of doneness . the problem of inconsistency in meat tenderness has been identified as a major concern of the meat industry . results of various studies have indicated that differences in the rate and extent of postmortem tenderization are the principal sources of variation in meat tenderness and , thus , are likely to be the source of inconsistency in meat tenderness at the consumer level . as a result , in accordance with this inventive concept it has been discovered that reliable and consistent tenderizing is needed . furthermore , the use of the meat sterilizing process of this invention could reduce the incidence of bacterial contamination . the following facts are clear for e . coli 0157 : h7 that is a virulent strain of the family of generic bacterial contamination : according to nov . 15 , 1998 statistics from the u . s . center for disease control : in 1993 , there were 16 outbreaks of e . coli 0157 : h7 , of which seven ( 44 percent ) were attributable to ground beef . in 1994 , there were 34 outbreaks of e . coli 0157 : h7 , of which 13 ( 38 percent ) were attributable to ground beef . in 1995 , there were 34 outbreaks of e . coli 0157 : h7 , of which 12 ( 35 percent ) were attributable to ground beef . in 1996 , there were 32 outbreaks of e . coli 0157 : h7 , of which four ( 12 . 5 percent ) were attributable to ground beef . in 1997 , there were 22 outbreaks of e . coli 0157 : h7 , of which two ( 9 percent ) were attributable to ground beef . in 1998 , preliminary data showed there were 33 outbreaks of e . coli 0157 : h7 of which seven ( 21 percent ) were attributable to ground beef . research at washington state university in 1993 showed that e . coli 0157 : h7 was present in 0 . 5 percent of fed beef cattle . additionally , special u . s . department of agriculture ( usda ) tests show that 0 . 2 percent of beef carcasses tested positive e . coli 0157 : h7 . the food safety and inspection service ( fsis ) division of the usda began random testing for e . coli 0157 : h7 in ground beef in october 1994 . as of dec . 18 , 1998 , more than 25 , 000 ground beef samples had been analyzed . e . coli 0157 : h7 was found in 0 . 10 percent of the samples . those most susceptible to severe illness as a result of e . coli 0157 : h7 are the elderly , young and those with compromised immune systems . typically , e . coli 0157 : h7 related illnesses occur because the 0157 : h7 serotype emits a toxin which can cause hemorrhagic colitis , a disease with symptoms of bloody diarrhea and severe abdominal pain . approximately ten percent of these cases in children lead to hemolytic uremic syndrome ( hus ), which is the leading cause of acute renal failure in children . hus may progress to thrombocytopenic purpura ( ttp ), a central nervous system disease , characterized by seizures and coma . patients with ttp often develop blood clots in the brain , usually resulting in death . the beef industry has invested more than $ 8 . 4 million since 1993 for applied research concerning food safety and e . coli 0157 : h7 . to achieve reductions in microbial contamination , the meat packing and processing industry have implemented several intervention strategies . among these are steam pasteurization , steam vacuuming and organic acid carcass rinsing , that are each designed to kill , reduce or remove bacteria . however , these methods are not effective , and other technologies , such as irradiation and ozonation , are in various stages of development . techniques currently in use to one degree or another to achieve reductions in microbial contamination include : rinsing the carcass with high temperature water . high temperature water is sprayed on the carcass at the final point in the slaughter process , which can reduce the remaining bacteria on the carcass . however , about 10 percent of beef plants do not use this process ; misting the carcass with organic acid . an acidic solution , such as vinegar and water , in the form of a fine mist , is sprayed on the carcass after the hide is removed . this prevents certain bacteria from attaching to the outside of the carcass . however , about 85 percent of beef plants do not use this process ; spraying the carcass with tri - sodium phosphate . tsp is an alkaline solution that can be sprayed on a carcass to prevent certain bacteria from attaching to the outside of the carcass . used in combination with organic acid mists , the two treatments could prevent a range of bacteria from adhering to carcasses ; pasteurizing the carcass with radiation . an intense pulse of energy is emitted either from a gamma radiation source like cobalt 60 or from an electrical source like an electron beam accelerator . the energy irradiates and penetrates the meat and destroys bacteria . the u . s . food and drug administration approved irradiation of red meats in december 1997 . usda must now issue a rule establishing proper application ( to kill bacteria ) and labeling requirements delineating all residual risks . the beef industry is awaiting usda action ; decomposing ozone in water contacting the carcass , or ozonation . ozonation uses water infused with ozone molecules to reduce / eliminate bacterial contamination . as the ozone molecule ( three oxygen atoms ) decomposes to basic oxygen ( two oxygen atoms ), the released atom either could destroy bacteria with which it comes into contact or may react with existing chemical compounds to create a more benign byproduct . application of ozonation for beef carcasses has not been fully developed , and its performance is unclear , but processes could include spraying or misting carcasses with ozonated water . the use of ozone treated chilled water for poultry decontamination is not practical in some facilities ; pasteurizing the carcass by steam , or steam pasteurization . carcasses pass through a steam cabinet which emits a short blast ( less than one second ) of superheated steam ( approximately 350 degrees fahrenheit ). the steam effectively pasteurizes the exterior of the carcass just before it enters the cooler . at the end of 1998 , nearly 50 percent of america &# 39 ; s beef was produced by packing plants that did not use steam pasteurization technology ; and vacuuming the carcass by steam to produce lower bacteria counts than what is possible with just a trimming knife . other steam and hot water vacuums can only remove visible dirt or debris from the carcass aseptically without killing any bacteria . although it is easy to implement this method , about 20 percent of beef plants do not use this technology . referring to fig1 tenderizer / sterilizer 10 has large container 20 filled with liquid 25 . conveyor system 30 is disposed in container 20 and immersed in liquid 25 . container 20 may have lid 21 to prevent any of liquid 25 from being projected , or splashed from a boundary layer on the surface of liquid 25 during processing . conveyor system 30 has rollers 31 supporting conveyer belt 32 that is displaced by drives 33 . drives 33 longitudinally and continuously move belt 32 and meat 100 through liquid 25 and past upper and lower arrays 40 and 50 of high power electro - mechanical transducers 45 and 55 that face and are located on opposite sides of belt 31 and immersed in liquid 25 . rollers 31 and belt 32 are made and function in much the same manner that is well known in the food processing industry , and drives 33 are controlled motor - driven assemblies that have been used this way for years . belt 32 may be an endless design that reaches across container 20 to pick up and deliver other slabs of meat 100 generally where drives 33 are located . at these locations more slabs of meat 100 can be placed for tenderizing and / or sterilizing or processed slabs can be removed for packaging , for example . conveyor belt 32 ( and rollers 31 ) within container 20 may be made from rubber or equivalent natural or manmade compounds that have essentially the same density as the water or oil that is chosen as liquid 25 , the fluidic medium for transfer of shock waves from arrays 40 and 50 . this feature is of particular significance since it allows shock waves to be discussed below to pass through without substantial interaction or impedance with conveyor belt 32 ( as well as rollers 31 ). this is done to increase the efficiency of tenderizer / sterilizer 10 by allowing the timing of generated shock waves to be a straightforward process without the need to employ cumbersome higher mathematics , wave shapers and other complicated structures for wave compensation . upper array 40 and lower array 50 of high power electro - mechanical transducers 45 and 55 are spaced the same distance above and below conveyer belt 32 . high power electro - mechanical transducers 45 and 55 may each have a piston - shape and are respectively arranged in one or more adjacent rows 40 a and 40 b , see also fig3 ( rows 50 a and 50 b of array 50 are not shown ). transducers 45 and 55 of arrays 40 and 50 are arranged to orient their flat , or planar projection surfaces 46 and 56 in substantially coplanar relationships . coplanar projection surfaces 46 are virtually parallel with coplanar projection surfaces 56 . one typical design for each electro - mechanical transducer 45 and 55 could be the high power piezoelectric underwater transducer disclosed in u . s . pat . no . 4 , 219 , 889 , although many other different transducer designs might be selected to create converging shock waves in accordance with this invention . planar surfaces 46 and 56 of transducers 45 and 55 face conveyer belt 32 and meat 100 and are controlled to respectively each project energy away as first shock waves 47 and 57 that are projected separately in a planar form from each transducer and coaxial with the axis of each transducer . the energy of separate and planar first shock waves 47 from transducers 45 of array 40 is projected toward transducers 55 of array 50 , and the energy of the separate and planar first shock waves 57 from transducers 55 of array 50 is projected toward transducers 45 of the array 40 . thus , arrays 40 and 50 project energy in the form of first shock waves 47 and 57 in an axially opposing relationship . separate and planar first shock waves 47 and 57 each coalesce collectively a short distance from surfaces 46 and 56 to respectively form first composite shock waves 41 and 51 that are substantially coplanar . the directions of travel of first composite shock waves 41 and 51 are axially opposed and converge on meat 100 on conveyer belt 32 . proper convergence of axially opposed first shock waves 47 and 57 and their collectively coalesced first composite shock waves 41 and 51 tenderizes and / or sterilizes meat 100 . this processing is assured by appropriate actuation by proper timing signals from logic control and timing circuit 60 that are connected to power supply 70 and / or arrays 40 and 50 . these timing signals are fed to power supply 70 which couples properly timed driving potentials to actuate , or drive transducers 45 and 55 of arrays 40 and 50 , respectively . the constituents of logic control and timing circuit 60 and power supply 70 for the control of high power electromechanical transducers are well known in the industry . for example , over the years , well - known arrangements of control logic , timing circuits , and power supplies with associated diodes and capacitor banks have been used to control the phase of projected energy in many different active arrays in sonar systems . components 60 and 70 , therefore , can be readily fabricated by one skilled in the art to actuate transducers to create the desired planar shock waves . water , oil , or similar fluidic medium 25 fills container 20 a sufficient depth to cover and immerse central conveyer 30 , arrays 40 and 50 , and one or more batches of meat 100 . successive batches of meat 100 to be tenderized / sterilized are sent down feeder conveyor 35 where they enter liquid 25 of tank 20 and travel to center conveyor 30 . meat 100 is placed on conveyer belt 32 of central conveyer 30 by feeder conveyer 35 , and meat 100 is carried at a preset rate to and through liquid 25 in region 15 between arrays 40 and 50 of axially opposing high power electromechanical transducers 45 and 55 . conveyer belt 32 continues to move meat 100 through region 15 while arrays 40 and 50 of axially opposing rows of high power electro - mechanical transducers 45 and 55 tenderize / sterilize meat 100 with projected converging shock waves of energy . after meat 100 has been suitably tenderized and / or sterilized , conveyer belt 32 moves meat 100 to a pick up conveyer 36 which takes it from liquid 25 to another processing area . this progression is continuous and , therefore , cost effective as compared to the higher cost stop - and - go procedures that are characteristic of current state of the art batch processing . in accordance with preestablished timing sequences of logic control and timing circuit 60 energy from the power supply 70 has already charged an internal bank of capacitors ( not shown ) that are linked to the rows of transducers 45 and 55 of arrays 40 and 50 . logic control and timing circuit 60 then initiates rows of transducers 45 and 55 of arrays 40 and 50 so as to virtually simultaneously actuate the high power electromechanical transducers 45 and 55 in each array to project shock waves of energy . in addition , actuation of transducers 45 and 55 in the adjacent rows of array 40 and array 50 may also need to be slightly phased with respect to one another to more completely converge energy of the rows of transducers onto meat 100 . this actuation is initiated in sequences to produce simultaneous or phased sequences of first composite planar shock waves 47 and 57 to tenderized / sterilized meat 100 thoroughly as belt 32 carries it through region 15 . successive ones of first planar shock waves 47 and 57 are transmitted to be separated by an interval of between 25 and 50 milliseconds for tenderizing and sterilizing meat 100 in water as liquid 25 . since each transducer 45 and 55 creates separate and planar first shock waves 47 or 57 within liquid 25 , these separate planar shock waves 47 or 57 simultaneously travel away from the rows of transducers 45 or 55 of array 40 or 50 that generated them . a very short distance from surfaces 46 and 56 of transducers 45 and 55 , these first shock waves 47 and 57 coalesce collectively to respectively form first composite shock waves 41 and 51 that may be substantially parallel to the upper and lower surfaces 100 a and 100 b of meat 100 , and as mentioned above , successive ones of composite shock waves 41 and 51 also are separated by an interval of between 25 and 50 milliseconds . each of planar shock waves 47 and 57 and composite shock waves 41 and 51 has a positive phase component that is attributable to the positive pressure spike generated during the initial part of each shock wave and a negative phase component that is attributable to the negative transition to vacuum immediately after the positive pressure spike . however , in addition to separate and planar first shock waves 47 and 57 , each transducer 45 and 55 of arrays 40 and 50 also produces an expanding bubble front . this bubble front expands behind each precursor shock wave ( first planar shock wave 47 and 57 ), very close to the transducer that produced it , until the internal pressure forces of the bubbles and hydrostatic forces of fluid 25 reach equilibrium . when equilibrium is reached , each bubble front rapidly collapses and creates a separate and planar second shock wave 48 or 58 from each transducer 45 or 55 . second shock waves 48 and 58 follow very closely behind first shock waves 47 and 57 , in the range of about 5 to 10 milliseconds behind the first shock waves . however , this timing is exemplary , and other timing schemes are possible . the timing of events is dependent on the energy density level deposited on the medium ( water or oil ); that is , a big shockwave takes longer to dissipate all its reverberation inside the chamber , affecting the ultimate trade - off among speed , distance , and power levels . the multitude of second shock waves 48 and 58 coalesce collectively to respectively form large and substantially coplanar second composite shock waves 42 and 52 . second composite shock waves 42 and 52 are respectively virtually parallel to the first composite shock waves 41 and 51 and follow very closely behind them , in the order of from about 5 to 10 milliseconds behind the first composite shock waves . the set of first and second composite shock waves 41 and 42 and the set of first and second composite shock waves 51 and 52 from the axially opposing array 40 and 50 collide in meat 100 . this collision of the sets of composite shock waves produces mach stem effects that create two large spikes of pressure ( or pressure spikes ) closely separated in time . the first of the two large pressure spikes is caused by the colliding first composite shock waves 41 and 51 which each have a positive phase component and a negative phase component , and the second of the two large pressure spikes is caused by the colliding second composite shock waves 42 and 52 . each of the two pressure spikes exerts its pressure uniformly and each extends in a separate plane that is perpendicular to the opposite directions of travel of shock wave sets 41 , 42 , and 51 , 52 and substantially parallel to the planes of outer surfaces 100 a and 100 b of meat 100 . when proper timing of transducers 45 and 55 of arrays 40 and 50 brings these two pressure spikes , or two - phase shearing planes , within meat 100 , this effect cuts the sinuous fiber within meat 100 and thus tenderizes it along these planes . furthermore , having the two pressure spikes , or two - phase shearing planes separated by an interval of time in the range of 5 to 10 milliseconds provides for efficient sterilization by creating successive destructive absolute pressure spikes and absolute pressure differentials within and around each of bacteria and / or other undesirable organisms in meat 10 . the destructive pressure spikes and differentials are created by the traveling positive phase components and the subsequent negative phase components of the first composite waves 41 and 51 and the positive phase component of the second composite waves 42 and 52 . the timing or phasing of the actuation of rows of transducers 45 and 55 of each array 40 and 50 is varied over several successive cycles such that sets of composite shock waves 41 and 42 and sets of composite shock waves 51 and 52 collide sequentially along different planes at different depths within meat 100 . these sequential collisions of shock waves effectively tenderize it throughout the entire thickness of meat 100 . between cycles of actuation a finite amount of time is allowed to lapse before the next actuation cycle to allow any secondary shock and pressure waves to reverberate and dissipate . an exemplary repetition rate having an interval of between 25 and 50 milliseconds between successive shock waves is given for a water medium 25 . oil or other liquids for medium 25 would call for different repetition rates and different energy levels to achieve efficient sterilization and the two - phase shearing planes . thus , it is seen that appropriate timing and phasing ( firing of transducers ) can be made to avoid any undesirable destructive or constructive shockwave interferences ( attributable to time delay and / or mistiming between pulses and the speed of transition of meat 100 through tenderizer / sterilizer 10 ) that would degrade performance , repeatability , and uniformity of the delivered energy or power density levels of tenderizer / sterilized 10 . tenderizer / sterilizer 10 continuously tenderizes and simultaneously sterilizes meat 100 uniformly and reliably throughout its entire volume without the need of a protective plastic container . the colliding composite shock waves in meat 100 may be appropriately controlled in power , duration , and rate of repetition by circuit 60 and supply 70 to effect tenderization and sterilization simultaneously or separately in projections of shock waves from arrays 40 and 50 . these controlled colliding composite shock waves work like two hammers hammering simultaneously from axially opposed sides . tenderizer / sterilizer 10 makes efficient use of electrically induced mechanical shock waves for tenderizing and simultaneously sterilizing meat . high power electromechanical transducers 45 and 55 project axially opposing shock waves and can be used , or pulsed repeatedly at high rates over long periods of time without having to be replaced and without the producing contaminants . this feature further assures that tenderizer / sterilizer 10 is ideal for assembly line processing of batches of meat 100 . tenderizer / sterilizer 10 does not use dangerous chemicals , explosives , or vaporizing electrodes and reduces the need to wrap meat that other processes need to avoid product contamination with byproducts of processing . tenderizer / sterilizer 10 can be tuned ( rate of fire , or pulsed actuation ) and timed ( firing time phasing ) to project different levels of energy to tenderize / sterilize meat 100 so as to be effective on a variety of meat types , precut or whole carcasses . tenderizer / sterilizer 10 allows control and variation of the degree of tenderization and sterilization , and its size can be scaled for use in both the heavy meat packing industry and for the home consumer . the processing of tenderizer / sterilizer 10 substantially reduces the time otherwise necessary for meat to be stored in refrigerated warehouses during aging . since tenderizer / sterilizer 10 eliminates the need for aging , shelf life on grocers &# 39 ; shelves can be increased , and taste of meat can be improved . since large warehouses to store meat during chemical or environmental aging are no longer needed , the cost to deliver quality meat products is reduced , while using healthier low fat meat cuts . tenderizer / sterilizer 10 uses axially opposing high power electro - mechanical transducer arrays 40 and 50 to generate tenderizing and sterilizing shock waves . shock waves produced by axially opposing high power electro - mechanical transducer arrays 40 and 50 create shock waves having longer pulse durations ( positive pressure phases ) than those attainable with explosive devices or electrode vaporization devices of the prior art . shock waves produced by axially opposing high power electro - mechanical transducer arrays 40 and 50 create shock waves having sufficient peak pressure and impulse which are the time - pressure integrals that may be affected by length and frequency of pulses that actuate the transducers . this feature produces tenderizing and sterilizing of meat 100 more efficiently with respect to energy expended as compared to explosive devices or electrode vaporization devices . explosive devices or electrode vaporization devices of the prior art produce sharp pressure pulse spikes , requiring over pressurization to effect work which could be done at lower pressures but with longer pulse durations by the invention . the prior art has recognized the fact that work can be done by sharp pressure spikes more efficiently while under water or similar dense fluid , and this was the technical basis for development and fielding a family of underwater explosives of which pbxn - 103 is probably the best known member . thermodynamically speaking , no work and no energy can be exchanged in no time , and accordingly , substantial energy must be expended by large detonations to create pressure spikes significant enough to produce useful results . this substantial energy expenditure makes these detonations inefficient with respect to energy used by tenderizer / sterilizer 10 of this invention . more powerful or less powerful axially opposing high power electro - mechanical transducers arrays 40 and 50 may be employed depending on the application . a limitation regarding size might be the level , or density of power fed to the axially opposing high power electromechanical transducer arrays 40 and 50 . the current moving capacity of modern conventional materials used in the high power electromechanical transducer industry might be exceeded so that alternative fluids might be used to perform this function . tenderizer / sterilized 10 might be modified to clean things that are difficult to clean by other conventional methods , or it may be modified for use in lithotripsy . furthermore , having this disclosure in mind , one skilled in the art to which this invention pertains will select and assemble suitable components for fabrication of different tenderizers / sterilizers 10 from among a wide variety of materials and components available in the art to satisfactorily tenderize and / or sterilize meat 100 as disclosed herein . therefore , the disclosed arrangement is not to be construed as limiting , but rather , is intended to be demonstrative of this inventive concept . it should be readily understood that many modifications and variations of the present invention are possible within the purview of the claimed invention . it is to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described .
| 0 |
the present invention now will be described more fully hereinafter in the following detailed description of the invention , in which some , but not all embodiments of the invention are described . indeed , this invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will satisfy applicable legal requirements . fig1 is a cross - sectional view schematically showing a membrane - electrode assembly ( mea ) produced using a polymer electrolyte membrane of the present invention . referring to fig1 , a membrane - electrode assembly 10 of the present invention comprises a polymer electrolyte membrane 100 , catalyst layers 110 and 110 ′ coated on both surfaces of the polymer electrolyte membrane 100 by deposition , and gas diffusion layers 120 and 120 ′ disposed on the outer surfaces of the respective catalyst layers . the catalyst layers 110 and 110 ′ can contain at least one catalyst selected from the group consisting of platinum , ruthenium , osmium , platinum - ruthenium alloys , platinum - osmium alloys , platinum - palladium alloys , and alloys of platinum with at least one transition metal selected from the group consisting of ga , ti , v , cr , mn , fe , co , ni , cu and zn . a mixture of the catalyst and carbon black can be used to form the catalyst layers . the gas diffusion layers ( gdls ) 120 and 120 ′ are disposed on the outer surfaces of the respective catalyst layers 110 and 110 ′. the gas diffusion layers 120 and 120 ′ serve to supply sufficient hydrogen and oxygen gases from the outside to the catalyst layers to assist in the formation of three - phase interfaces of the catalyst layers , the electrolyte membrane and the gas . the gas diffusion layers can be formed of carbon paper or carbon cloth . the membrane - electrode assembly 10 of the present invention may further comprise microporous layers ( mpls ) 121 and 121 ′ disposed between the catalyst layer 110 and the gas diffusion layer 120 and between the catalyst layer 110 ′ and the gas diffusion layer 120 ′, respectively . the microporous layers 121 and 121 ′ are formed to assist in the diffusion of hydrogen and oxygen gases . fig2 is an exploded perspective view schematically showing a fuel cell comprising the membrane - electrode assembly . referring to fig2 , the fuel cell 1 of the present invention comprises the membrane - electrode assembly 10 and bipolar plates 20 arranged on both sides of the membrane - electrode assembly . hereinafter , the constitutions and effects of the present invention will be explained in more detail with reference to the following specific examples and comparative examples . however , these examples serve to provide further appreciation of the invention but are not meant in any way to restrict the scope of the invention . 1 . examples illustrating effects of polymer electrolyte membranes according to the first embodiment of the present invention one mole of 6 , 4 ′- diamino - 2 - phenylbenzimidazole ( formula 12 ) as a diamine is dissolved in n - methyl - 2 - pyrrolidone ( nmp , junsei chemical ) in a four - neck flask equipped with an agitator , a thermostat , a nitrogen injection system and a condenser while passing nitrogen through the flask . to the solution is added 1 mole of pyromellitic dianhydride ( pmda , cat . no . b0040 , tokyo chemical industry ). the mixture is vigorously stirred . the solids content of the mixture is 15 wt %. the mixture is allowed to react for 24 hours while maintaining the temperature below 25 ° c . to prepare a polyamic acid solution ( paa - 1 ). a polyamic acid solution ( paa - 2 ) is prepared in the same manner as in example 1 , except that 0 . 5 moles of 4 , 4 ′- diaminodiphenylether as a diamine ( cat . no . 00088 , tokyo chemical industry ) and 0 . 5 moles of 6 , 4 ′- diamino - 2 - phenylbenzimidazole are used . a polyamic acid solution ( paa - 3 ) is prepared in the same manner as in example 1 , except that 0 . 3 moles of 4 , 4 - diaminodiphenylether , 0 . 7 moles of 6 , 4 ′- diamino - 2 - phenylbenzimidazole and 1 mole of pyromellitic dianhydride ( pmda ) are used . a polyamic acid solution ( paa - 4 ) is prepared in the same manner as in example 1 , except that 0 . 3 moles of 4 , 4 ′- diaminodiphenylether , 0 . 7 moles of 6 , 4 ′- diamino - 2 - phenylbenzimidazole and 1 mole of 1 , 4 , 5 , 8 - naphthalene tetracarboxylic dianhydride ( cat . no . no369 , tokyo chemical industry ) are used . a polyamic acid solution ( paa - 5 ) is prepared in the same manner as in example 1 , except that 1 mole of 6 , 4 ′- diamino - 2 - phenylbenzimidazole and 1 mole of 1 , 4 , 5 , 8 - naphthalene tetracarboxylic dianhydride are used . a polyamic acid solution ( paa - 6 ) is prepared in the same manner as in example 1 , except that 0 . 3 moles of 4 , 4 ′- diaminodiphenylether , 0 . 7 moles of 6 , 4 ′- diamino - 2 - phenylbenzimidazole and 1 mole of 3 , 3 ′, 4 , 4 ′- benzophenonetetracarboxylic dianhydride ( cat . no . no369 , tokyo chemical industry ) are used . a polyamic acid solution ( paa - 7 ) is prepared in the same manner as in example 1 , except that 1 mole of 6 , 4 ′- diamino - 2 - phenylbenzimidazole and 1 mole of 3 , 3 ′, 4 , 4 ′- benzophenonetetracarboxylic dianhydride are used . polyimide polymer films are produced using the respective polyamic acid solutions prepared in examples 1 to 7 . the characteristics of the polyimide polymer films and the impregnation properties of the polyimide polymer films with phosphoric acid are evaluated . the results are shown in table 1 . as can be seen from the data shown in table 1 , the polyimide polymer films have a high rate of impregnation with phosphoric acid . a fuel cell is fabricated using a polymer electrolyte membrane formed in example 3 . the i - v characteristics of the fuel cell are evaluated at 150 ° c . without humidification . the results are shown in fig3 . the results of fig3 demonstrate that the fuel cell , which is fabricated using a polymer electrolyte membrane formed in example 3 , shows voltage values as high as 600 mv in the current range of 0 to 0 . 3 a / cm 2 . 2 . examples illustrating effects of polymer electrolyte membranes according to the second embodiment of the present invention polyimide is prepared in the same manner as in example 1 , and then a solution of 15 wt % of socyanuric acid triglycidyl ester ( cat . no . 10428 , tokyo chemical industry ) in n - methyl - 2 - pyrrolidone ( nmp , junsei chemical ) is added thereto . at this time , the socyanuric acid triglycidyl ester is used in an amount of 20 wt %, based on the solids content of the polymer . the mixture is vigorously stirred using a mechanical agitator for 6 hours to prepare a homogeneous polymer solution . polyimide is prepared in the same manner as in example 1 , and then a solution of 15 wt % of socyanuric acid triglycidyl ester ( cat . no . 10428 , tokyo chemical industry ) in n - methyl - 2 - pyrrolidone ( nmp , junsei chemical ) is added thereto . at this time , the socyanuric acid triglycidyl ester is used in an amount of 5 wt %, based on the solids content of the polymer . the mixture is vigorously stirred using a mechanical agitator for 6 hours to prepare a homogeneous polymer solution . polyimide is prepared in the same manner as in example 1 , and then a solution of 15 wt % of a melamine monomer ( cat . no . t0337 , tokyo chemical industry ) in n - methyl - 2 - pyrrolidone ( nmp , junsei chemical ) is added thereto . at this time , the socyanuric acid triglycidyl ester is used in an amount of 10 wt %, based on the solids content of the polymer . the mixture is vigorously stirred using a mechanical agitator for 6 hours to prepare a homogeneous polymer solution . polyimide is prepared in the same manner as in example 1 , and a polyamic acid solution is prepared in the same manner as in example 1 , except that 0 . 95 moles of 6 , 4 ′- diamino - 2 - phenylbenzimidazole and 0 . 1 moles of 4 - ethylnylaniline ( cat . no . e0505 , tokyo chemical industry ) are used . polyimide is prepared in the same manner as in example 1 , and a polyamic acid solution is prepared in the same manner as in example 1 , except that 0 . 95 moles of pyromellitic dianhydride ( pmda , cat . no . b0040 , tokyo chemical industry ) and 0 . 1 moles of maleic anhydride ( cat . no . m0005 , tokyo chemical industry ) are used . crosslinked polyimide films are produced using the respective polyamic acid solutions prepared in examples 8 . the crosslinked polyimide films are tested for chemical resistance . the results are shown in table 2 . the chemical resistance test is conducted by fenton &# 39 ; s test . specifically , 20 ppm feso 4 is dissolved in a hydrogen peroxide solution to prepare a solution for fenton &# 39 ; s test . each of the polyimide films is added to the solution in a container . the solution in which the polyimide film is dipped is shaken using a shaker in a water bath at 80 ° c . for 6 hours . thereafter , the film is taken out of the solution , washed with water , dried in a vacuum oven at 60 ° c . for 3 hours , and weighed . as is evident from the results of table 2 , the film of example 1 containing no crosslinking agent is very brittle and shows a great loss in weight after the fenton &# 39 ; s test . that is , it is impossible to measure the weight retention rate of the film . in contrast , the films of examples 8 to 12 containing a crosslinking agent show a relatively high weight retention rate even after the fenton &# 39 ; s test . particularly , the weight retention rate of the film produced in example 8 is very high ( 94 %). a fuel cell is fabricated using the polymer electrolyte membrane formed in example 9 . the i - v characteristics of the fuel cell are evaluated at 150 ° c . without humidification . the results are shown in fig4 . the results of fig4 demonstrate that the fuel cell , which is fabricated using the polymer electrolyte membrane formed in example 9 , shows a voltage value as high as 670 mv at a current density of 0 . 3 a / cm 2 . a test fuel cell is fabricated using the polymer electrolyte membrane formed in example 9 . the test fuel cell is evaluated for long - term operation stability . the results are shown in fig5 . although not shown in fig5 , a fuel cell fabricated using the film produced in example 1 containing no crosslinking agent shows poor durability (& lt ; 300 hours ), whereas a fuel cell fabricated using the film produced in example 1 containing a crosslinking agent shows markedly improved durability (≧ 3 , 500 hours ) under long - term operation conditions at a current density of 0 . 2 a / cm 2 . many modifications and other embodiments of the invention will come to mind to one skilled in the art to which this invention pertains having the benefit of the teachings presented in the foregoing descriptions . therefore , it is to be understood that the invention is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being defined in the claims .
| 7 |
as shown in fig1 a exhaust valve 8 and a sealing gas supply valve 9 are connected to a receptacle 6 for airtight packaging . a substrate 2 of a semiconductor package having semiconductor devices 4 mounted thereon is placed on a stand contained in the receptacle 6 . on the other hand , a cap 1 of the semiconductor package is retained by a retainer 14 . thermal conductive connectors 3 , mounted inside the cap 1 , come in contact with backs of the semiconductor devices 4 and transfers heat generated by semiconductor devices to the cap 1 to dissipate the heat . however , the thermal conductive connectors are not essential to the semiconductor package . the retainer 14 extends to the outside of the receptacle 6 and is moved upward and downward by servomechanism 15 . in addition , a heater 16 for heating is disposed near seal portions of the substrate 2 and the cap 1 . in a fig1 a heater 16 &# 39 ; is disposed near the seal portion of the retainer 14 . the seal portions of the cap 1 and the substrate 2 are provided with presolders 12 and 13 for sealing . a programmable controller 18 controls the valves 8 and 9 , the servomechanism 15 and the heaters 16 and 16 &# 39 ;. fig2 is a time chart for illustrating the operation of the apparatus of fig1 and represents the temperature t of a seal region ( inclusive of the seal portions of the cap 1 and the substrate ) within the receptacle , gas pressure p within the receptacle , and gap g between the seal portions of the cap 1 and the substrate respectively as functions of time . with reference to fig1 the inside of the receptacle 6 is once evacuated to eliminate the air , and the temperature of the seal region is raised from the room temperature to approximately 150 ° c . to effect vacuum baking . by the vacuum baking , the gas absorbed by the seal portions is eliminated . after completion of the vacuum baking , the temperature t is raised to and kept at approximately 230 ° c . and the sealing gas such as he gas is supplied into the receptacle 1 through the valve 9 to bring the inside of the receptacle 1 to approximately three atmospheres and maintain that pressure . thereby , the presolders 12 and 13 provided at the seal portions of the cap 1 and the substrate 2 are melted . at time instant t 1 , the retainer 14 for retaining the cap 1 is lowered by the servomechanism 15 to joint the solders 12 and 13 . in order to eliminate bubbles contained in the melted solder , the cap 1 is lowered at such a speed that the solder will not be scattered . as shown in fig2 the gap g between the seal portions is preferably reduced to a value ( 0 . 2 mm , for example ) smaller than a predetermined gap ( 0 . 5 mm , for example ) and thereafter adjusted to have the predetermined gap . if the semiconductor package is increased in size , solder of the cap 1 is not in contact with that of the substrate over some part of the whole periphery due to warp of the substrate , resulting in a packaging failure . this can be prevented by once pulling down the cap 1 lower than the predetermined height as described above . further , the solder 17 takes the shape of hand - drum as shown in fig3 representing the completed package by once pulling down the cap 1 lower than the predetermined height . when the semiconductor device is mounted on the substrate by solder balls , it is said that solder shaped like a hand - drum provides a higher connection reliability . in the packaging according to the present invention as well , a similar effect can be anticipated by making solder shaped like a hand - drum . from time instant t 2 at which the gap between the cap 1 and the substrate has reached the predetermined value , the heater temperature is lowered to start the cooling process . since the temperature within the package generally drops faster than that within the receptacle 6 , the gas pressure p 1 within the package becomes lower than the gas pressure p 2 within the receptacle . therefore , it is necessary to maintain the relation p 1 = p 2 until the temperature which solder is solidified is reached , by controlling the valves to control the gas pressure of the receptacle 6 concurrently with the drop in temperature . if the gas pressure p 1 within the package becomes lower than the gas pressure outside the package , the melted solder flows into the space within the package , resulting in solder projection . in order to attain the relation p 1 = p 2 in the present apparatus , the gas pressure p 1 within the package is experimentally derived with respect to various cooling instants . the resultant characteristic curve representing the gas pressure p 1 within the package as a function of cooling time t is stored in the controller 18 . a curve p of fig2 after time instant t 2 is that characteristic curve . after cooling has been started , the controller 18 derives the gas pressure within the receptacle on the basis of the characteristic curve and controls the valve 8 . such control for attaining the relationship p 1 = p 2 is conducted until solder is solidified . in pb - sn eutectic solder , for example , control for attaining the relationship p 1 = p 2 is effected until the solid phase temperature of 183 ° c . is reached . fig4 shows experimental results concerning the number of repeated thermal strains causing a leak failure of he contained in a semiconductor package sealed by means of solder in accordance with the method of fig1 . the number is plotted as a function of the height of sealing solder . as the solder height is increased , the number of thermal strains until the he leak is caused is also increased , resulting in a longer life . by increasing the solder height , therefore , it is possible to absorb the difference in thermal expansion between the cap and the substrate . accordingly , is becomes possible to select a material such as copper or aluminum having a property such as high thermal conductivity desired as the property of the cap without being subject to restriction by the thermal expansion difference from the substrate made of alumina ceramic or mullite ceramic , for example . it is thus possible to realize high seal reliability and cooling capability . therefore , the controller 18 adjusts the solder height so as to produce flexibility enough to absorb the thermal expansion difference between the substrate and the cap . as described above , the present invention provides an accurate solder connection shape irrespective of the weight of the cap or wiring substrate . as a result , a highly reliable structure for airtightly packaging a semiconductor package can be obtained .
| 7 |
a dry etching apparatus according to preferred embodiments of the present invention will be described hereinbelow with reference to fig1 and 2 . fig1 a shows a reaction chamber 1 of one preferred embodiment of a dry etching apparatus of the present invention . the reaction chamber 1 can be maintained under a vacuum . a lower electrode 2 made of aluminum for holding a base material 4 , such as a semiconducting substrate made of gallium arsenide , silicone , or glass , is connected to a high frequency power source 7 . a high frequency power is supplied from the power source 7 to the lower electrode 2 . a thin insulating layer 3 is formed at the upper surface of the lower electrode 2 . an insulating spacer 5 upper electrode 6 confronting the lower electrode 2 is grounded and has a reaction gas entrance 6a . alternatively , a reaction gas entrance is shown by a chain line in fig1 . the lower electrode 2 has in the upper surface thereof recesses 10 including a circular recess 10a at its center and an annular recess 10b extending around the circular recess 10a as shown in fig1 a and 1b . at the recesses 10 , the base material 4 is not close to the upper surface of the lower electrode 2 . the 20 - 80 μm thick insulating layer 3 which is formed of hard anodized aluminum covers the entire upper surface of the lower electrode 2 . preferably , the thickness of the hard aluminum is not less than 100μ and the thickness of the aluminum of the electrode is not less than 0 . 3 mm . preferably , material having a thermal conductivity that increases when in a vacuum is used for the insulating layer 3 . the operation of the dry etching apparatus having the above - described structure will be discussed below . since recesses 10 are formed in the surface of the lower electrode 2 , the contact area between the insulating layer 3 and the base material is small . the relationship of the opening ratio of the recesses 10 , the temperature of the base material 4 and the residual electrostatic attraction force is shown in a graph of fig2 . as is clear from fig2 the residual attraction force is eliminated when the opening ratio is 20 %. although the temperature of the base material 4 is 10 ° c . higher when the opening ratio is 20 % as compared to when there are not recesses , the increased temperature is not practically a problem . if the temperature of the cooling water for cooling the lower electrode 2 is lowered by approximately 10 ° c ., the base material 4 can be at the same temperature as when the opening ratio is 0 %. in the embodiment described hereinabove , the lower electrode 2 has recesses 10 in the upper surface to thereby reduce the area of contact with the base material 4 . therefore , the residual attraction force is decreased , and the problems when the base material 4 is transferred can be solved . moreover , because the residual electrostatic attraction force may vary in dependence with kind of the base material 4 , the opening ratio of the recesses and the cooling temperature of the electrode may be selected suitably . preferably , the opening ratio of the recesses 10 is not less than 20 % with respect to a semiconducting substrate made of silicon . it is also preferred that the opening ratio of the recesses 10 not be less than 25 % with respect to a semiconducting substrate made of glass . in the foregoing embodiment , the lower electrode 2 has the recesses 10 in the upper surface thereof , and the insulating layer 3 is formed over the entire upper surface of the lower electrode 2 . however , it is possible to form the insulating layer 3 on only part of the upper surface of the lower electrode 2 without forming recesses in the electrode 2 itself as illustrated in fig3 . that is , the insulating layer 3 may be formed while the upper surface of the lower electrode 2 is masked or the insulating layer 3 may be partially etched and removed after it is formed over the entire surface of the lower electrode 2 . in this case , recesses 11 having a similar configuration to the recesses 10 are formed between the base material 4 and the lower electrode 2 where the insulating layer 3 is not present . the effect achieved in this case is the same as that in the first embodiment . in the embodiments , the configuration of the recesses 10 and 11 may be changed as desired , e . g . the recesses may extend radially or be in the form of concentric circles . according to one aspect of the present invention , the electrode for holding a base material has a recess and the surface of the electrode is covered with the insulating layer so that part of the structure does not contact the base material . alternatively , only part of the surface of the electrode is covered with the insulating layer so that the insulating layer alone contacts the base material . therefore , the area of contact with the base material is small , thus resulting in a weaker electrostatic attraction force . since the residual electrostatic attraction force is reduced while the temperature rise of the base material on the electrode is restricted , the base material can be readily transferred . although the present invention has been fully described in connection with the preferred embodiments thereof with reference to the accompanying drawings , it is to be noted that various changes and modifications will become apparent to those skilled in the art . such changes and modifications are to be understood as included within the scope of the present invention as defined by the appended claims unless they otherwise depart therefrom .
| 7 |
in the following description , terms such as &# 34 ; top &# 34 ;,&# 34 ; bottom &# 34 ;,&# 34 ; left &# 34 ;, and &# 34 ; right &# 34 ; are used for convenience and are not to be construed as limiting terms . to better illustrate the high optical efficiency achieved by optical couplers of the present invention , a less efficient coupler 10 is first described with respect to prior art fig1 . such figure shows a top view of a coupler 10 having an input arm 12 for receiving light from a light source ( not shown ), an output arm 14 for outputting light to a distribution harness ( not shown ), and a bend portion 16 for achieving a 90 - degree bend . side views of inlet region 12a of inlet arm 12 , and of outlet region 14a , are respectively shown in fig1 a and 1b . such surfaces are square and of equal size to each other as shown in fig1 a and 1b . if coupler 10 is hollow , phantom lines 13 and 15 in fig1 a and 1b , respectively , represent interiorly reflecting surfaces ; if , alternatively , coupler 10 is a transparent solid , surfaces 13 and 15 are not present . as shown in fig1 a and 1b , the square shape of inlet and outlet surfaces 12a and 14a ( and of the remainder of inlet and outlet arms 12 and 14 ) facilitates the mixing of light that is passed through coupler 10 , in the manner described , for instance , in the above - mentioned u . s . pat . no . 5 , 341 , 445 . increased light mixing results in increased uniformity of intensity and color of output light , and also less critical alignment of the light coupled into the coupler . in some applications , the length of coupler 10 needs to be some multiple of the cross - sectional dimension of the coupler ; for example , a 7 : 1 ratio is desirable where the coupler is used in a photographic slide projector or video projector ( not shown ). to minimize the size of the resulting slide or video projector , it is desirable to include a bend portion 16 so that coupler 10 can be compact . an exemplary bend of 90 degrees , for instance , is illustrated , although other bend angles can be used . in forming bend portion 16 , a 45 - degree , mirrored surface 16a is used to provide for reflection of light ray 20 , which is directed along the central longitudinal axis ( not shown ) of inlet arm 12 , and is reflected upwardly as shown at point 21 , along the central longitudinal axis ( not shown ) of outlet arm 14 . it is desired that further light ray 22 , which is angled with respect to the longitudinal axis of inlet arm 12 , pass into outlet arm 14 . ray 22 , however , after reflecting from mirrored surface 16a at point 23 ( angles 24a and 24b being equal ), reflects rearwardly in inlet arm 12 , i . e ., back towards inlet region 12a . the inability to pass ray 22 into outlet arm 14 lowers the optical efficiency of coupler 10 , reducing the intensity of light output from outlet arm 14 . in accordance with a first embodiment of the invention , fig2 shows a coupler 10 , which , like coupler 10 of fig1 has an input arm 12 for receiving light , an output arm 14 , and a bend portion 16 for achieving , e . g ., a 90 - degree bend . side views of inlet region 12a of inlet arm 12 , and of outlet region 14a , are respectively shown in fig2 a and 2b ; such side views are similar to the above - described side views of surfaces 12a and 14a of fig1 a and 1b . however , a dimension of inlet region 12a is reduced compared to the dimensions of outlet region 14a . that is , while corresponding input and output dimensions d2 and d4 are shown as equal , input dimension d1 is reduced from corresponding output dimension d3 . such change in dimension occurs on the sides of inlet arm 12 that are parallel to a plane ( not shown ) defined by the intersection of the respective central longitudinal axes ( not shown ) of inlet and outlet arms 12 and 14 . details of such reduction in dimension will be set forth below . in the embodiment shown in fig2 and 2b , outlet arm 14 has a square and uniform cross section along its longitudinal axis , whereby dimensions d3 and d4 in fig2 b are the same . such dimensions , however , may alternatively be different from each other , whereby the cross section of outlet arm 14 would be rectangular . further , inlet arm 12 is shown in fig2 and 2a as being rectangular and uniform in cross section along its length ; alternatively , it could be square . moreover , one or both of inlet and outlet arms 12 and 14 , rather than being uniform along their lengths , could be tapered in a manner known per se in the art to achieve an angle - to - area conversion of light . in such conversion , considering a single input or output arm , the angle is with respect to the longitudinal axis of the arm , and the area refers to the respective cross sectional areas of light at the inlet and outlet portions of the arm . where an especially large angle - to - area conversion is desired , the tapers may each define a compound parabolic reflector made in accordance with non - imaging optics , a technology known per se in the art . referring again to fig2 a phantom line 28 shows the portion of inlet arm 12 that is absent in relation to inlet arm 12 of fig1 . the extent of the absent portion , i . e ., the reduction to dimension d1 for inlet arm as shown in fig2 a , is determined by the goal of transmitting all light rays through coupler 10 , from inlet region 12a to outlet region 12a . thus , light ray 30 , which reaches 45 - degree , mirrored surface 16a at point 31 , reflects at point 32 within outlet arm 14 , to pass upwardly and be transmitted though outlet region 14a . with light ray 30 representing light deviating from the longitudinal axis ( not shown ) of inlet arm 12 at a maximum angle 34 , determining the reduced dimension d1 ( fig2 a ), compared to dimension d3 of outlet arm 14 ( fig2 b ), is a matter of geometry . for the example shown , with a 90 - degree bend in the coupler , d1 = d3 ( 1 + tangent of angle 34 ). fig3 is a detail view of bend portion 16 of a coupler 10 , and of adjacent portions of inlet and outlet arms 12 and 14 of the coupler . a so - called backup , or separate , mirror 40 is shown mounted on angled surface 16a of the bend , and is preferably used rather than a mirrored surface 16a as described with the above embodiments where coupler 16 is a solid , rather than hollow , in construction . this is because a thin air layer that will exist between surface 16a and the mirror will cause much of the light reaching angled surface 16a to totally internally reflect within bend portion 16 . as opposed to such lossless change of direction , about one - third of the light reaching surface 16a will be angled such that it passes outside of surface 16a to be reflected by the backup mirror , resulting in only one - third of the light having a mirror - absorbed light loss on the order of ten percent . fig4 shows a coupler 10 whose inlet region 12a is square , as shown in fig4 a , and whose outlet region 14a is rectangular , as shown in fig4 b . for use in projecting video images from a photographic slide or liquid - crystal display ( not shown ), the aspect ratio of output dimension d3 to d4 ( fig4 b ) is typically 1 . 3 : 1 . determining the dimension d1 of inlet arm 12 ( fig4 a ), compared to dimension d3 of outlet arm 14 ( fig4 b ), can be accomplished in the same manner as determining the corresponding dimensions with respect to the embodiment of fig2 a and 2b , as described above . fig5 a and 5b respectively show top and side plan views of an optical coupling system using the coupler of fig4 a and 4b . within an enclosure 42 , coupler 10 is arranged to receive light in inlet arm 12 from a source of light 44 , via a mirror 46 shown in fig5 b . after passing through coupler 10 to achieve a high degree of light mixing , light passes though an image - containing plate 46 before being directed , via a projection lens 48 , to display optics ( e . g ., a viewing screen ). in a limiting case , the image - containing plate is perfectly transparent , and the system is used for projecting a uniform area of light . fig6 shows an optical coupler 10 including a bend portion 16 with a 120 - degree bend , or angle 50 . as a general rule , bend surface 16a is oriented at an angle 52 of half angle 50 , or 60 degrees for the case shown . determining the relation between dimension d1 of inlet arm 12 , and d3 , of outlet arm 14 , is done in the same manner as mentioned above with respect to fig2 a and 2b . for the 120 - degree angle 50 shown , dimension d3 is approximately four times dimension d1 ; for larger angles 50 , dimension d3 will be scaled even more upwardly with respect to dimension d1 . fig7 shows a limiting case where dimension d3 of outlet arm 14 is the same as dimension d1 on inlet arm 12 , and light rays directed into inlet arm 12 are all passed into outlet arm 14 . in this limiting case , the angle 50 of bend is 60degrees . for angles in excess of 60 degrees , dimension d3 will exceed dimension d1 as in the previous examples of the invention . a further approach to forming a bend in an optical coupler is now described in connection with fig8 and succeeding figures . fig8 shows a prior art coupler 60 having input and output arms 62 and 64 , and a bend region 66 with a mirrored surface 66a . as shown in fig8 a and 8b , inlet arms 62 and 64 may have respective , square , equal - size ends 62a and 64a ( not shown in fig8 ). if coupler 60 is hollow , phantom lines 63 and 65 in fig8 a and 8b , respectively , represent interiorly reflecting surfaces ; if , alternatively , coupler 60 is solid , surfaces 63 and 65 are not present . as shown in fig8 a light ray 70 reflects from point 71 on mirrored surface 66a back into inlet arm 62 , representing lost light . similarly , light ray 72 passes straight through bend region 62 and exits output arm 64 at point 73 ; this is because the angle 74 it makes with respect to a central , longitudinal axis of outlet arm 64 is too high to allow the ray to totally internally reflect at point 73 back within outlet arm 64 . fig9 shows an inventive coupler 60 which avoids the lost light of the coupler of prior art fig8 described above . in fig9 bend portion 66 comprises a prism with all surfaces polished , whose surface 66a may be mirrored if desired , as discussed below . bend portion ( or prism ) 66 has an upwardly facing surface 66b , for receiving light from inlet arm 62 , and a rightward facing surface 66c , through which light is passed into outlet arm 64 . as shown in fig9 a and 9b , inlet arms 62 and 64 may have respective , rectangular equal - size ends 62a and 64a ( not shown in fig9 ), although the ends may be square . if coupler 60 is hollow , phantom lines 63 and 65 in fig9 a and 9b , respectively , represent interiorly reflecting surfaces ; if , alternatively , coupler 60 is solid , surfaces 63 and 65 are not present . referring again to fig9 a material 76 adjoins upwardly facing prism surface 66b and has an index of refraction differing from that of the prism . likewise , a material 78 adjoins rightward facing surface 66c and has an index of refraction differing from that of the prism . materials 76 and 78 may comprise air , water , or preferably a material with an index of refraction lower than that of air , such as magnesium fluoride bonded to the inlet and outlet arms with an optical glue having an index of refraction matched to magnesium fluoride . owing to the differing indexes of refraction of the prism and of materials 76 and 78 , light ray 70 received within prism 66 can be reflected at point 71a either by a mirrored surface 66a or , preferably , by total internal reflection within the prism . after totally internally reflecting again in the prism at point 71b , ray 70 will pass into outlet arm 64 assuming the angle it make with prism surface 66c is above the maximum allowable angle for total internal reflection . in a similar manner , light ray 72 received into prism 66 totally internally reflects at point 73a in the prism , to be reflected at point 73b by a mirrored surface 66a , or preferably totally internally reflected , into outlet arm 64 . prism 66 is preferably a triangular prism as shown in fig9 for example . to minimize loss of light in the reflections within the prism , all of its surfaces should be polished , and beveling of its corners is preferably avoided . input and output arms 62 and 64 to the prism may be square , as shown in fig8 a and 8b , respectively , or rectangular , as shown in fig9 a and 9b , respectively . optimally , the input and output arms are of the same size and configuration , but differing sizes and configurations can be used if the attendant light loss is not prohibitive . moreover , several input arms or several output arms can be used for a single prism , such as a bundle ( not shown ) of four output arms . further , a single input arm may supply light to multiple ( e . g . two ) prisms ( not shown ), preferably stacked one atop the other ; that is , referring to fig9 a further prism ( not shown ) may be stacked beneath ( or above ) prism 66 , with its output surface facing leftward and leading to a further output arm ( not shown ). fig1 schematically shows how light from a light source 80 is passed to display optics 84 , via coupler 60 and a light distribution harness 82 . details of suitable light distribution harnesses will be apparent to those of ordinary skill in the art from , e . g ., the above - cited u . s . pat . no . 5 , 341 , 445 . for instance , a light distribution harness may comprise a bundle ( not shown ) of optical light conductors . alternatively , for instance , it may comprise a photographic slide and a projection lens ( not shown ) for modulating and routing light to display optics such as a viewing screen ( not shown ). fig1 illustrates preferred features of a prism 66 . a mirrored , reflecting surface may be provided on the angled surface 66a of the prism . it preferably is a separate , so - called backup mirror 40 ( shown in phantom ) attached to the prism in a manner allowing an air interface between the mirror and the prism . this is for the reduced light loss explained above in connection with fig3 . surfaces 66b and 66c of the prism are preferably coated with a low index of refraction material 76 and 78 , such as magnesium fluoride , as mentioned above . a matching , low index of refraction optical glue can then be used to bond the ends of inlet arms 62 and 64 ( fig9 ), where solid , to material 76 and 78 . this reduces optical losses that occur when a light ray refracts from one material to another . thus , if materials 76 and 78 comprise air and the inlet and outlet arms are solid glass , an approximately 4 percent optical loss occurs in light refracting from the inlet arm to air 76 , a similar loss occurs in light refracting from air 76 to the glass prism , and two further corresponding losses in connection with the refractions into and out of material 78 . this yields a total light losses of about 16 percent . by using magnesium fluoride , as mentioned , the loss for each refraction is about 1 . 5 percent , reducing the total loss to about 6 percent . fig1 shows a variation of the invention , where a coupler 60 includes a tapered inlet arm portion 62 &# 39 ; and a non - tapered inlet arm portion 62 ; and preferably also includes a tapered outlet arm portion 64 &# 39 ; and a non - tapered inlet arm portion 64 . the tapers of inlet and outlet portions 62 &# 39 ; and 64 &# 39 ; achieve , in a manner known per se in the art , an angle - to - area conversion of light . in such conversion , considering a single input or output arm , the angle is with respect to the longitudinal axis of the arm , and the area refers to the respective cross sectional areas of light at the inlet and outlet portions of the tapered arm portion . where an especially large angle - to - area conversion is desired , the tapers may each define a compound parabolic reflector made in accordance with non - imaging optics , a technology known per se in the art . beneficially , in such embodiment , more light rays ( not shown ) become oriented so as to totally internally reflect within the prism on surface 66a , with essentially no light loss . if the light rays reflect off a mirrored surface 66a , on the other hand , a 5 to 10 percent light loss occurs . optimal alignment of a prism with respect to input and output arms is now considered with respect to fig1 through 15 . these figures respectively relate to the cases where the angle 89 of bend is orthogonal , acute and obtuse . referring to fig1 , a person looking into inlet arm 62 from the perspective or arrow 90 should see only the interior of inlet arm 62 and mirror 66a , assuming that interface 91 between arm and prism is transparent . similarly , a person looking into outlet arm 64 from the perspective or arrow 92 should see only the interior of outlet arm 62 and mirror 66a , assuming that interface 93 between arm and prism is transparent . the same procedure can be applied to the acute - angle 89 and obtuse - angle 89 cases of fig1 and 15 , respectively . while the invention has been described with respect to specific embodiments by way of example , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true scope and spirit of the invention .
| 6 |
applicants have recognized and appreciated that the factor - of - two improvement in axial resolution and the immunity to group velocity dispersion that q - oct affords are consequences of the how phase - sensitive noise is affected by propagation through linear media . because high - flux classical - state light beams can carry phase - sensitive noise , it is therefore possible to reap these q - oct advantages without recourse to a quantum - state ( e . g ., “ twin ” beam ) light source . accordingly , one embodiment of the present disclosure is directed to imparting phase - sensitive noise to a classical light source , and utilizing the phase - sensitive noise carried by a classical light source to facilitate improved axial resolution in an oct imaging technique . it should be appreciated , however , that in other embodiments as discussed further below , quantum light sources may be utilized to implement inventive methods and apparatus according to the present disclosure . fig3 generally illustrates an exemplary configuration for a phase - conjugate optical coherence tomography ( pc - oct ) apparatus 100 according to one inventive embodiment of the present disclosure . as in fig1 and 2 , the scanning process used to obtain transverse resolution of an imaged sample has been omitted in fig3 for simplicity , as the salient concepts of interest in the present disclosure primarily are germane to axial resolution . in the embodiment of fig3 , unlike the implementations respectively shown in fig1 and 2 , the light source 90 is a classical - state source that emits signal and reference beams 92 and 94 with a significant and broadband phase - sensitive signal - reference correlation ( cross - correlation ). hence , the signal and reference beams 92 and 94 are said to be in a “ joint classical state with a phase - sensitive correlation .” in one exemplary implementation , strong signal and reference beams that have a phase - sensitive cross - correlation can be produced by splitting a single laser beam in two , and then imposing appropriate amplitude and phase noises on these beams through electro - optic modulators . conventional optical telecommunication modulators , however , in some cases may not have sufficient bandwidth for high - resolution pc - oct . accordingly , in another exemplary implementation , the light source 90 exploits nonlinear optics . for example , a light source 90 based on spontaneous parametric downconversion ( spdc ) may have thz phase - matching bandwidths , and is accordingly suitable as a broadband light source for a pc - oct implementation . other possible light sources 90 include parametric amplification via four - wave mixing in optical fibers . in one aspect of an spdc light source 90 for the implementation of fig3 , unlike q - oct ( which relies on spdc for the “ twin beam ” source , i . e ., entangled biphotons ), an spdc light source for pc - oct can ( and should ) be driven at maximum pump strength . in particular , it may be appreciated that there is no need to limit the photon - pair generation rate of the light source 90 so that the twin beam biphoton states are time - resolved by the approximately mhz bandwidth single - photon detectors that are used in q - oct &# 39 ; s detection scheme ( coincidence counter in a hong - ou - mandel interferometer ). to achieve maximum pump strength drive , pulsed pumping techniques may be employed . similar techniques may be used with fiber - optic parametric amplifiers . in fig3 , the signal beam 92 is directed to a sample 56 to be imaged ( e . g ., a tissue sample ), and the reference beam 94 is directed to a variable delay . in fig3 , for simplicity , the sample is shown as being irradiated by the signal beam and transmitting a beam 93 after interaction with the sample ( the sample is being shown imaged in transmission ), but it should be appreciated that sample imaging in pc - oct may be performed either in transmission or reflection . after the signal beam has interacted with the sample to generate the beam 93 , this beam is then passed through a phase - conjugator 95 . the resulting phase - conjugated beam 97 is then directed to irradiate and interact again with the sample 56 to provide a beam 99 that has twice interacted with the sample . the reference beam 94 is passed through a variable delay 58 to generate a beam 91 , and the beam 91 is combined via a 50 / 50 beam splitter 60 with the beam 99 that has twice interacted with the sample for detection in a michelson interferometer arrangement 62 , which is followed by differential amplification by amplifier 66 with gain g , and post - detection image processing by processor 68 . in sum , in one exemplary implementation according to this embodiment , the signal beam is focused on and reflected from a sample , undergoes conjugate amplification , is refocused onto the same sample , and then interfered with the time - delayed reference beam . in one aspect of the embodiment of fig3 , a broadband , high - gain phase - conjugator 95 based on spdc may be implemented as an optical parametric amplifier ( opa ) used in phase - conjugation mode . for example , using a frequency - degenerate type - ii phase matched down - converter as the phase - conjugator , the signal beam , after a first interaction with the sample , is applied as the beam 93 to the phase - conjugator in one input polarization ( referred to as the “ signal ” polarization ) and a vacuum state field ( not shown in fig3 ) is applied to the phase - conjugator in the other polarization ( referred to as the “ idler ” polarization ). the idler output of the phase - conjugator then serves as the beam 97 , which has the characteristics needed for pc - oct , i . e ., it comprises a phase - conjugated version of the signal input plus the minimum quantum noise needed to preserve free - field commutator brackets , as discussed further below . in other exemplary implementations , similar phase - conjugate operation can also be obtained from frequency - degenerate four - wave mixing . in either of these schemes , pulsed operation may be employed to achieve a suitable gain - bandwidth product for high - performance pc - oct . in the embodiment of fig3 , because the phase conjugator 95 converts phase - sensitive correlation of the signal and reference beams to phase - insensitive correlation , the desired interference signature of the sample 56 becomes observable with the michelson interferometer arrangement 62 . however , because the signal - reference beam correlation is phase - sensitive , the configuration illustrated in the embodiment of fig3 achieves the axial resolution and dispersion immunity of q - oct . as discussed above in connection with fig2 , q - oct derives its signal and reference beams from spontaneous parametric down - conversion ( spdc ), whose outputs are in a zero - mean gaussian state , with a non - classical phase - sensitive cross - correlation function . in the low - flux limit , this non - classical gaussian state becomes a stream of individually detectable biphotons . classical - state light beams can also have phase - sensitive cross - correlations , but quantum or classical phase - sensitive cross - correlations do not yield second - order interference . this is why fourth - order interference is used in q - oct . however , in the pc - oct apparatus 100 of fig3 , the phase conjugator 95 converts a phase - sensitive cross - correlation into a phase - insensitive cross - correlation that can be seen in second - order interference . accordingly , it may be appreciated that it is the phase - sensitive cross - correlation of the signal and reference beams , rather than any non - classical behavior per se , that provides the axial resolution improvement and even - order dispersion cancellation . thus , in pc - oct , this cross - correlation need not be beyond the limits of classical physics , as is required for q - oct . however , as discussed further below , in other implementations a quantum light source may be utilized to generate signal and reference beams in a jointly quantum state with a phase - sensitive correlation , and a phase conjugator similarly may be employed to convert the phase - sensitive correlation to a phase - insensitive correlation . following below is a detailed analysis of the pc - oct apparatus 100 shown in fig3 . a more rigorous theoretical analysis is provided in u . s . provisional application ser . no . 60 / 807 , 616 , filed jul . 18 , 2006 , entitled “ phase - sensitive optical coherence tomography methods and apparatus ,” and u . s . provisional application ser . no . 60 / 863 , 529 , filed oct . 30 , 2006 , entitled “ phase - conjugate optical coherence tomography methods and apparatus ,” as well as the following publications : b . i . erkmen and j . h . shapiro , “ phase - conjugate optical coherence tomography ,” phys . rev . a 74 , 041601 ( 2006 ); b . i . erkmen and j . h . shapiro , “ optical coherence tomography with phase - sensitive light ,” proc . spie 6305 , 630510 ( 2006 ); and j . h . shapiro and b . i . erkmen , “ imaging with phase - sensitive light ,” in international conference on quantum information technical digest on cd - rom ( osa , washington , dc , 2007 ), ithd1 . each of the above - identified applications and publications hereby is incorporated herein by reference . in the apparatus 100 of fig3 , the signal and reference beams 92 and 94 are classical fields with a common center frequency ω 0 , and baseband complex envelopes , e s ( t ) and e r ( t ), with powers ω 0 | e k ( t )| 2 , for k = s , r . these complex fields are zero - mean , stationary , jointly gaussian random processes that are completely characterized by their phase - insensitive auto - correlations e * k ( t + τ ) e k ( t ) = f − 1 [ s ( ω )], for k = s , r , and their phase - sensitive cross - correlation e s ( t + τ ) e r ( t ) = f − 1 [ s ( ω )], where is the inverse fourier transform of s ( ω ), and s ( ω )= s (− ω )≧ 0 is the common spectrum of the signal and reference beams at detunings ± ω from ω 0 . these fields have the maximum phase - sensitive cross - correlation that is consistent with classical physics . the signal beam is focused on a transverse spot on the sample yielding a reflection with complex envelope e h ( t )= e s ( t ) å h ( t ), where å denotes convolution and h ( t )= f − 1 [ h ( ω )] with being the sample &# 39 ; s baseband impulse response . in eq . ( 2 ), r ( z , ω ) is the complex reflection coefficient at depth z and detuning ω , and φ ( z , ω ) is the phase acquired through propagation to depth z in the sample . after conjugate amplification , the complex envelope e c ( t )=[ e * h ( t )+ w ( t )] å v ( t ) is obtained , where w ( t ), a zero - mean , complex - valued , isotropic white gaussian noise with correlation function w *( t + τ ) w ( t ) = δ ( τ ), is the quantum noise injected by the conjugation process , and v ( t )= f − 1 [ v ( ω )] gives the conjugator &# 39 ; s baseband impulse response in terms of its frequency response . the output of the conjugator is refocused onto the sample resulting in the positive - frequency field e 1 ( t )=[ e c ( t ) å h ( t )] e − iω 0 t , which is interfered with e 2 ( t )= e r ( t − t ) e − iω 0 ( t − t ) in a michelson interferometer , as shown in fig3 . the photodetectors 64 a and 64 b in fig3 are assumed to have quantum efficiency η , no dark current , and thermal noise with a white current spectral density s i th . the average amplified difference current , which constitutes the pc - oct signature , is then where q is the electron charge and g a is the amplifier gain . in c - oct the signal and reference inputs have complex envelopes that are zero - mean , stationary , jointly gaussian random processes which are completely characterized by their phase - insensitive auto - and cross - correlations , e * j ( t + τ ) e k ( t ) = f − 1 [ s ( ω )], for j , k = s , r . as shown in fig1 , in c - oct the sample is illuminated with the signal beam and the reflected signal — still given by convolution of e s ( t ) with h ( t )— is interfered with the delayed reference beam in a michelson interferometer . thus , the average amplified difference current in c - oct is for q - oct , quantum fields must be used because non - classical light is involved . now the baseband signal and reference beams are photon - units field operators , ê s ( t ) and ê r ( t ), with the following non - zero commutators , [ ê j ( t ), ê k t ( u )]= δ jk δ ( t − u ), for j , k = s , r . in q - oct , the sample is illuminated with ê s ( t ) and then the field operator is applied for the reflected beam plus that for the reference beam to an hom interferometer , as shown in fig2 . the familiar biphoton hom dip can be obtained theoretically — in a manner that is the natural quantum generalization of the classical gaussian - state analysis employed herein — by taking the signal and reference beams to be in a zero - mean joint gaussian state that is completely characterized by the phase - insensitive ( normally - ordered ) auto - correlations ê k ( t + τ ) ê k ( t ) = f − 1 [ s ( ω )], for k = s , r , and the phase - sensitive cross - correlation ê s ( t + τ ) ê r ( t ) = f − 1 [√{ square root over ( s ( ω )( s ( ω )+ 1 ))}{ square root over ( s ( ω )( s ( ω )+ 1 ))}]. this joint signal - reference state has the maximum possible phase - sensitive cross - correlation permitted by quantum mechanics . in the usual biphoton limit wherein hom interferometry is performed , s ( ω )□ 1 prevails , and the average photon - coincidence counting signature can be shown to be v *(− ω ) s ( ω )≈ v * s ( ω )=( v * p s √{ square root over ( 2π / ω s 2 ))} e − ω 2 / 2ω s 2 with | r □| 1 . physically , this corresponds to having a conjugate amplifier whose bandwidth is much broader than that of the signal - reference source , and a sample that is a weakly - reflecting mirror at delay t 0 . eq . ( 3 ) then gives a pc - oct average amplified difference current that , as a function of the reference - arm delay t , is a sinusoidal fringe pattern of frequency ω 0 with a gaussian envelope proportional to e − 2ω s 1 ( t 0 − t / 2 ) 2 , as illustrated in fig4 a . the average amplified difference current in c - oct behaves similarly : from eq . ( 4 ), it may be observed that it too is a sinusoidal , frequency ω 0 fringe pattern in t , but its envelope is proportional to e − ω s 2 ( t 0 − t ) 2 / 2 , as shown in fig4 b . the signature of q - oct , found from eq . ( 5 ), is a dip in the average coincidence - count versus reference - arm delay that is proportional to e − 2ω s 2 ( t 0 − t ) 2 , as shown in fig4 c . defining the axial resolutions of these oct systems to be the full - width between the e − 2 attenuation points in their gaussian envelopes viewed as functions of t 0 shows that pc - oct and q - oct both achieve factor - of - two improvements over c - oct for the same source bandwidth . to probe the effect of dispersion on pc - oct , c - oct , and q - oct , the sample &# 39 ; s frequency response is modified to h ( ω )= re i [( ω 0 + ω ) t 0 + bω 2 / 2 ] , where b is a non - zero real constant representing second - order ( group - velocity ) dispersion . because the sample &# 39 ; s frequency response enters the pc - oct and q - oct signatures as h *(− ω ) h ( ω ), neither one is affected by this dispersion term in h ( ω ), i . e ., it cancels out . for c - oct , however , it may be observed that the gaussian envelope of the average amplified difference current is now proportional to e − ω s 2 ( t 0 − t ) 2 / 2 ( 1 + ω s 4 b 2 ) , i . e ., its axial resolution becomes badly degraded when q s 4 b 2 □ 1 . more generally , for h ( ω )= re i [( ω 0 + ω ) t 0 + β ( ω )] , pc - oct and q - oct are immune to dispersion created by the even - order terms in the taylor series expansion of β ( ω ). having shown that pc - oct retains the key advantages of q - oct , the snr behavior of pc - oct is examined . because q - oct relies on spdc to generate the entangled biphoton state , and geiger - mode avalanche photodiodes 84 a and 84 b ( see fig2 ) to perform photon - coincidence counting , its image acquisition is much slower than that of c - oct , which can use bright sources and linear - mode detectors . to assess the snr of pc - oct , a gaussian spectrum is used for s ( ω ) and the non - dispersing mirror for h ( ω ), but , in order to limit its quantum noise , the conjugator &# 39 ; s frequency response is taken to be v ( ω )= ve − ω 2 / 4ω v 2 . it is assumed that i d ( t ) is time averaged for t i seconds ( denoted i d ( t ) ) at the reference - arm delay that maximizes the interference signature , and the following parameter is defined : snr pc - oct = i d ( t ) / var [ i d ( t ) ]. when the w ( t ) contribution to the conjugator &# 39 ; s output dominates the e h ( t ) contribution , it is found that where ω th ═ s i th / q 2 η . from left to right the terms in the noise denominator are the thermal noise , the reference - arm shot noise , the conjugate - amplifier quantum noise , and the intrinsic noise of the signal × reference interference pattern itself . best performance is achieved when the conjugator gain | v | 2 is large enough to neglect the first two noise terms , and the input power p s is large enough that the intrinsic noise greatly exceeds the conjugator &# 39 ; s quantum noise . in this case , it is observed that snr c - oct = i d ( t ) / var [ i d ( t ) ] is defined for the fig1 configuration at the peak of the c - oct interference signature . when the reflected signal field is much weaker than the reference field , it is observed that snr c - oct = 4η t i | r | 2 p s , ( 8 ) which can be smaller than the ultimate snr pc - oct result . however , if pc - oct &# 39 ; s conjugator gain is too low to reach this ultimate performance , but its reference - arm shot noise dominates the other noise terms , it is observed that which is substantially lower than snr c - oct , because | rv | 2 □ 1 is implicit in the assumption that the reference shot noise is dominant as high detector quantum efficiency can be expected . thus , pc - oct has snr similar to that of c - oct , but only if high - gain phase conjugation is available . at this juncture it is worth emphasizing the fundamental physical point revealed by the preceding analysis . the use of entangled biphotons and fourth - order interference measurement in an hom interferometer enable q - oct &# 39 ; s two performance advantages over c - oct : a factor - of - two improvement in axial resolution and cancellation of even - order dispersion . classical phase - sensitive light also produces an hom dip with even - order dispersion cancellation , but this dip is essentially unobservable because it rides on a much stronger background term . thus , the non - classical character of the entangled biphoton is the source of q - oct &# 39 ; s benefits , from which it might be concluded that non - classical light is required for any oct configuration with these performance advantages over c - oct . such is not the case , however , because the pc - oct configuration described herein illustrates that it is really phase - sensitive cross - correlations that are at the root of axial resolution enhancement and even - order dispersion cancellation . phase - sensitive cross - correlations cannot be seen in the second - order interference measurements used in c - oct . pc - oct therefore phase conjugates one of the phase - sensitive cross - correlated beams , converting their phase - sensitive cross - correlation into a phase - insensitive cross - correlation that can be seen in second - order interference . the analysis herein of pc - oct assumed classical - state light , and because s ( 0 )□ 1 is required for high - snr pc - oct operation , little further can be expected in the way of performance improvement by using non - classical light in pc - oct . this can be seen by comparing the cross - spectra s ( ω ) and √{ square root over ( s ( ω )( s ( ω )+ 1 ))}{ square root over ( s ( ω )( s ( ω )+ 1 ))} when s ( ω )=( p s √{ square root over ( 2π / ω s 2 ))} e − ω 2 / 2ω s 2 , with p s √{ square root over ( 2π / ω s 2 )}□ 1 . the intimate physical relation between pc - oct and q - oct can be further elucidated by considering the way in which the sample &# 39 ; s frequency response enters their measurement averages . again it is assumed that v *(− ω ) s ( ω )≈ v * s ( ω ), so that both imagers yield signatures ∝ ∫ dωh *(− ω ) h ( ω ) s ( ω ). klyshko &# 39 ; s advanced - wave interpretation has been used to account for the h *(− ω ) h ( ω ) factor in the q - oct signature as the product of an actual sample illumination and a virtual sample illumination . in the pc - oct apparatus disclosed herein , this same h *(− ω ) h ( ω ) factor comes from the two sample illuminations , one before phase conjugation and one after . in both cases , it is the phase - sensitive cross - correlation that is responsible for this factor . q - oct uses non - classical light and fourth - order interference while pc - oct can use classical light and second - order interference to obtain the same . sample information . that pc - oct &# 39 ; s two sample illuminations provide an axial resolution advantage over c - oct leads naturally to considering whether c - oct would also benefit from two sample illuminations . to this end , consider the general arrangement of the pc - oct apparatus 100 shown in fig3 , with e s ( t ) and e r ( t ) instead arising from a c - oct light source 50 as shown in fig1 , and the phase - conjugate amplifier ( phase conjugator ) 95 replaced with a conventional phase - insensitive amplifier of field gain g ( ω )= ge − ω 2 / 4ω g 2 with | g |□ 1 . such a two - pass c - oct arrangement then yields an interference signature ∝ e − 2ω s 2 ( t 0 − t / 2 ) 2 for the weakly - reflecting mirror when the amplifier is sufficiently broadband , and an snr given by eq . ( 6 ) with v replaced by g and ω v replaced by ω g . thus , two - pass c - oct has the same axial resolution advantage and snr behavior as pc - oct . however , instead of providing even - order dispersion cancellation , two - pass c - oct doubles all the even - order dispersion coefficients . in summary , the foregoing analysis demonstrates that the pc - oct apparatus 100 shown in the embodiment of fig3 combines many of the best features of conventional oct and quantum oct . like c - oct , pc - oct relies on second - order interference in a michelson interferometer . thus it can use linear - mode avalanche photodiodes ( apds ), rather than the lower bandwidth and less efficient geiger - mode apds employed in q - oct . like q - oct , pc - oct enjoys a factor - of - two axial resolution advantage over c - oct , and automatic cancellation of even - order dispersion terms . the source of these advantages , for both q - oct and pc - oct , is the phase - sensitive cross - correlation between the signal and reference beams . in pc - oct , however , this cross - correlation need not be beyond the limits of classical physics , as is required for q - oct . finally , pc - oct may achieve an snr comparable to that of c - oct , thus realizing much faster image acquisition than is currently possible in q - oct . it should be appreciated that while an exemplary sample including a biological tissue is illustrated in fig3 , pc - oct techniques according to the present disclosure may be employed essentially in any imaging application requiring micron - scale imaging over relatively short working distances . other exemplary applications in addition to tissue imaging include , but are not limited to , nondestructive inspection for micro cracks in manufactured parts ( e . g ., on an assembly line ), nondestructive evaluation of highly scattering polymer - matrix composites to estimate residual porosity , fiber architecture and structural integrity , and nondestructive evaluation of paints and coatings . pc - oct also may be applied to long range (& gt ; 1 kilometer ) imaging scenarios in which its dual benefits of improved axial resolution and immunity to group velocity are advantageous . according to yet another embodiment , instead of employing classical - state signal and reference beams with a phase - sensitive correlation as discussed above in connection with fig3 , quantum - state signal and reference beams with a phase - sensitive correlation alternatively may be employed as a light source ( e . g ., as discussed above in connection with the q - oct technique illustrated in fig2 ). however , unlike the q - oct implementation , the signal beam of the jointly quantum - state beams in this alternative embodiment still is phase - conjugated ( i . e ., passed through a phase - conjugator ), thereby permitting the use of the simpler michelson interferometer for the detection scheme ( rather than the photon - coincidence counting hong - ou - mandel interferometer required in fig2 ). in this manner , source fluxes for the quantum - state source that are beyond the counting limit of available single - photon counters may be used ( e . g ., source fluxes in the milliwatt range ), as linear - mode avalanche photodiode detectors may be employed in the michelson interferometer detection arrangement . fig5 illustrates an exemplary configuration for a frequency domain pc - oct apparatus 500 , according to one inventive embodiment of the present disclosure . the block diagram shown in fig5 is substantially similar to that shown in fig3 for the time domain , except for the absence of the variable delay 58 ( t ) and the replacement of the detectors 64 a and 64 b in the michelson interferometer arrangement with two identical spectrometers 550 . in one aspect of this embodiment , the apparatus 500 estimates the second - order interference spectrum , which may be inverse discrete fourier transformed to obtain an interference fringe very similar to that obtained in the time - domain . in another aspect , the resolution of the spectrometers and the bandwidth of the source determine the measurement resolution of the apparatus . in yet another aspect , the apparatus 500 has no moving components , which in some instances may increase stability when imaging at khz rates . fig6 illustrates an analytical model of the spectrometers 550 of the frequency domain pc - oct apparatus shown in fig5 . as shown in fig6 , each spectrometer 550 is modeled as comprising m parallel detectors 566 , each detector preceded by a narrowband optical filter 554 tuned to different center frequencies , such that the m detectors collectively cover non - overlapping , adjacent frequency bands over the optical bandwidth of the spectrometer . in one aspect , the baseband equivalent center frequencies of the m detectors are designated as ω m ( i . e ., the carrier frequency of the incoming light , ω 0 , is subtracted out ) and the optical bandwidth of the m th detector is δw opt □ 1 . the outputs of a given spectrometer are the m current values obtained from the detectors . the currents from the two spectrometers are subtracted to obtain { right arrow over ( i )}( t )= i d ( m ) ( t )| m = 0 , . . . , m − 1 }, a m × 1 vector of difference currents . similar to time - domain pc - oct , each difference current is integrated over a period t i to obtain an estimate of the spectrum as follows : where m = 0 , . . . , m − 1 . the inverse discrete fourier transform ( dft ) of the estimate waveform is taken to obtain a signature that resembles the signature of time - domain oct system . note that this frequency - domain technique has some relevant distinctions from time - domain pc - oct techniques . first , in frequency - domain pc - oct , the acquisition of data occurs in parallel , rather than serial data acquisition in time - domain pc - oct . however , because the optical bandwidth of the light illuminating each detector is appreciably smaller in frequency - domain oct , the integration time must also be longer . because integration times are on the order of the inverse of the optical bandwidth of the illuminating field , the data acquisition times of time - domain and frequency - domain techniques are almost the same . however , frequency - domain techniques have the advantage of eliminating the time - varying delay in the reference branch , which improves stability of the interference by eliminating jitter from mechanical motion ( time - varying delay is often implemented with a moving mirror ). while several inventive embodiments have been described and illustrated herein , those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein , and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein . more generally , those skilled in the art will readily appreciate that all parameters , dimensions , materials , and configurations described herein are meant to be exemplary and that the actual parameters , dimensions , materials , and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , many equivalents to the specific inventive embodiments described herein . it is , therefore , to be understood that the foregoing embodiments are presented by way of example only and that , within the scope of the appended claims and equivalents thereto , inventive embodiments may be practiced otherwise than as specifically described and claimed . inventive embodiments of the present disclosure are directed to each individual feature , system , article , material , kit , and / or method described herein . in addition , any combination of two or more such features , systems , articles , materials , kits , and / or methods , if such features , systems , articles , materials , kits , and / or methods are not mutually inconsistent , is included within the inventive scope of the present disclosure . all definitions , as defined and used herein , should be understood to control over dictionary definitions , definitions in documents incorporated by reference , and / or ordinary meanings of the defined terms . the indefinite articles “ a ” and “ an ,” as used herein in the specification and in the claims , unless clearly indicated to the contrary , should be understood to mean “ at least one .” the phrase “ and / or ,” as used herein in the specification and in the claims , should be understood to mean “ either or both ” of the elements so conjoined , i . e ., elements that are conjunctively present in some cases and disjunctively present in other cases . multiple elements listed with “ and / or ” should be construed in the same fashion , i . e ., “ one or more ” of the elements so conjoined . other elements may optionally be present other than the elements specifically identified by the “ and / or ” clause , whether related or unrelated to those elements specifically identified . thus , as a non - limiting example , a reference to “ a and / or b ”, when used in conjunction with open - ended language such as “ comprising ” can refer , in one embodiment , to a only ( optionally including elements other than b ); in another embodiment , to b only ( optionally including elements other than a ); in yet another embodiment , to both a and b ( optionally including other elements ); etc . as used herein in the specification and in the claims , “ or ” should be understood to have the same meaning as “ and / or ” as defined above . for example , when separating items in a list , “ or ” or “ and / or ” shall be interpreted as being inclusive , i . e ., the inclusion of at least one , but also including more than one , of a number or list of elements , and , optionally , additional unlisted items . only terms clearly indicated to the contrary , such as “ only one of ” or “ exactly one of ,” or , when used in the claims , “ consisting of ,” will refer to the inclusion of exactly one element of a number or list of elements . in general , the term “ or ” as used herein shall only be interpreted as indicating exclusive alternatives ( i . e . “ one or the other but not both ”) when preceded by terms of exclusivity , such as “ either ,” “ one of ,” “ only one of ,” or “ exactly one of .” “ consisting essentially of ,” when used in the claims , shall have its ordinary meaning as used in the field of patent law . as used herein in the specification and in the claims , the phrase “ at least one ,” in reference to a list of one or more elements , should be understood to mean at least one element selected from any one or more of the elements in the list of elements , but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements . this definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “ at least one ” refers , whether related or unrelated to those elements specifically identified . thus , as a non - limiting example , “ at least one of a and b ” ( or , equivalently , “ at least one of a or b ,” or , equivalently “ at least one of a and / or b ”) can refer , in one embodiment , to at least one , optionally including more than one , a , with no b present ( and optionally including elements other than b ); in another embodiment , to at least one , optionally including more than one , b , with no a present ( and optionally including elements other than a ); in yet another embodiment , to at least one , optionally including more than one , a , and at least one , optionally including more than one , b ( and optionally including other elements ); etc . it should also be understood that , unless clearly indicated to the contrary , in any methods claimed herein that include more than one step or act , the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited . in the claims , as well as in the specification above , all transitional phrases such as “ comprising ,” “ including ,” “ carrying ,” “ having ,” “ containing ,” “ involving ,” “ holding ,” “ composed of ,” and the like are to be understood to be open - ended , i . e ., to mean including but not limited to . only the transitional phrases “ consisting of ” and “ consisting essentially of ” shall be closed or semi - closed transitional phrases , respectively , as set forth in the united states patent office manual of patent examining procedures , section 2111 . 03 .
| 6 |
a financial instrument in accordance with the principles of the present invention effectively and diplomatically overcomes significant and well - recognized disadvantages to the islamic consumer &# 39 ; s deposit of funds to islamic as well as conventional banking and financial institutions . when combined with tried - and - true capital market philosophies and a shari &# 39 ; ah compliant infrastructure designed to better manage consumer depository risk , a financial instrument in accordance with the principles of the present invention enables the issuance and mass marketing of a shari &# 39 ; ah ( islamic ) compliant passive consumer investment vehicle . this shari &# 39 ; ah ( islamic ) compliant passive vehicle can be acquired openly by islamic consumers as the basis to inspire islamic consumer deposits and investments via banking and financial institutions . a financial instrument in accordance with the principles of the present invention enables the creation of a consumer - related investment vehicle which , as supported by a series of coordinated financial mechanisms , complies with shari &# 39 ; ah financial guidelines . a financial instrument in accordance with the principles of the present invention enables the creation of an investment vehicle that functions as a means of facilitating or otherwise effectuating a passive or semi - passive investment by a consumer who observes islamic law in the establishment of its personal funds management strategies and the implementation of its investment practices . while a primary application of the present invention is to an individual who invests in compliance with shari &# 39 ; ah ( islamic ) financial guidelines , the use of the term consumer herein is not meant to limit the application of the present invention . the structuring of the shari &# 39 ; ah compliant financial instruments in accordance with the principles of the present invention is designed and fiscally supported in such a way as to qualify as investment - grade , ratable ( by standard & amp ; poor &# 39 ; s , 55 water street , new york , n . y . 10041 , moody &# 39 ; s investors service , inc ., 99 church street , new york , n . y . 10007 or some other comparable credit rating agency ) securities comparable with conventional , non - islamic retail banking and financial market products . thus , a financial instrument in accordance with the principles of the present invention establishes a standardized foundation upon which islamic consumers may rely to enable passive , direct and / or indirect investments in depository structures that are conducive to preserving original consumer depository or invested amounts while potentially producing a yield thereon without any concern for violating shari &# 39 ; ah ( islamic ) financial guidelines . moreover , a financial instrument in accordance with the principles of the present invention provides a basis for consumer investment and fund management flexibility which , to date , has not existed in shari &# 39 ; ah compliant retail banking or investment opportunities . specifically , by employing a financial instrument in accordance with the principles of the present invention , the consumer can preserve their original deposited amount , have the potential for the generation of some shari &# 39 ; ah compliant yield derived from the management of their deposits , remain passive as to the nature of the investment operations or activities , and have the opportunity to “ cash - out ” of the investment position via the re - sale or remarketing of the financial instrument through a secondary market function . a financial instrument in accordance with the principles of the present invention encompasses a variety of features that when brought together address and improve upon many of the issues raised in the previous section . among other things , a financial instrument in accordance with the principles of the present invention combines the definable and consistent nature of a traditional , rated investment - grade depository / cash - based or backed security such as those that conventional institutions have utilized as a consumer / retail banking product or service for decades within an investment structure which hinges upon certain religious edicts of islam that in themselves are difficult for non - islamic parties to understand and appreciate . in fact , one of these edicts appears to fly in the face of some of the conventional banking markets most common financial practices : the prohibition of collection or payment of interest ( or riba ) in exchange for deposited funds or the making of a loan or investment . a financial instrument in accordance with the principles of the present invention , however , evidence a number of benefits which make the financial products themselves unique in the retail banking and financial markets and serve to highlight the technical complexities of accomplishing the implementation of these features in what is considered a shari &# 39 ; ah ( islamic ) compliant manner by accredited islamic scholars . in addition to the foregoing , the following identifies the features and key benefits of the financial instrument in accordance with the principles of the present invention : the financial instruments of the present invention can be applied in the operation of consumer banking practices to promote and facilitate increased and better administered consumer and retail deposits from islamic consumers and customers in support of the creation of or investment in various shari &# 39 ; ah compliant projects , ventures , financial services areas or operations and / or investment finds ; the financial instruments of the present invention are uniformly formatted amongst themselves such that a standardized security or financial instrument is created which need not materially vary based upon the underlying use of proceeds derived from the sale or placement of the financial instrument to the islamic investor ; the financial instruments of the present invention are ratable by a credit rating agency , thus raising placement efficiencies and creating a foundation in the marketplace which is conducive to the valuation and remarketing of the financial instruments ( the conditions being right for the evolution of a standardized secondary market for the resale of the financial instruments ), thereby assuring some element of interim liquidity of the investment to the islamic consumer ; by way of certain repurchase covenants , the financial instruments of the present invention have a minimum anticipated value at the conclusion of the depository term which contributes to the ratable nature of the financial instruments and supports the likelihood of a consumer remarketing strategy by creating a “ financial floor ” to potential losses related to the deposit and any subsequent bank or financial institution implemented investment to which the proceeds of the financial instruments are applied ; by way of the creation of a networked or coordinated application of issuance and remarketing , the financial instruments of the present invention provides for centralization within a single networked shari &# 39 ; ah supervisory board as to matters of initial compliance and , subsequently , functional and operational compliance of the investments or management operations , thereby permitting greater ease and efficiency in managing issues pertaining to shari &# 39 ; ah compliance ; the financial instrument of the present invention allows for the investment of islamic consumer deposits within a professional shari &# 39 ; ah compliant investment management infrastructure to be implemented by a depository institution or its nominee under an umbrella of greater institutional accountability for investment outcome ; and the common thread of a common networked application of the financial technology involving a variety of issuers and guarantors enables the creation of a composite risk management or risk syndication mechanism related to each respective financial instrument issuance , thereby diversifying the investment risk among a variety of banks and financial institutions rather than lumbering that risk exclusively on the islamic consumer and its respective deposit values . the foregoing features demonstrate an advantage of a financial instrument in accordance with the principles of the present invention over the retail banking practices previously utilized within the islamic marketplace . the present invention both better enables and preserves islamic consumer deposits within an institutionally administered investment environment which has the potential for generating yield on behalf of the consumer / depositor . this mechanism provides the islamic consumer with many of the same benefits that are consistent with generally accepted consumer depository products presently available in the conventional banking market , but which are not permissible under shari &# 39 ; ah investment practices . the implementation of the present invention in both islamic retail banking and financial institutions and within the conventional markets that geographically service islamic consumers will produce a retail banking climate for the islamic consumer with more predictable risk management and base - line performance of amounts deposited , greater liquidity to shari &# 39 ; ah compliant deposits , more accountability for investment performance on behalf of the banking or depository institution , and more continuity and efficiency in shari &# 39 ; ah compliance considerations between the respective issuers of the financial instruments . in all of the above examples , the common denominator is one of standardization and consistency in a shari &# 39 ; ah ( islamic ) compliant consumer - based retail banking structure which fosters a regularization of the depository risk management features afforded to an islamic consumer such that investment opportunities and banking practices can reflect some of the better attributes of the conventional consumer banking market within a framework of shari &# 39 ; ah compliance . for the purposes of explanation and not to narrow the scope of the present invention , the following describes an example of a financial instrument in accordance with the principles of the present invention . referring first to fig1 a methodological schematic depicting a general overview of a consumer deposit / subscription through yield payments process in accordance with the principles of the present invention is seen . a banking or funds depository institution is created or otherwise nominated (“ issuer ”) who issues the financial instruments . in addition to issuing the financial instruments , the issuer makes the offering for the purpose of attracting islamic consumer investments in the form of deposits , and subsequently manages and implements the proceeds of the sale of the financial instruments in a manner consistent with the investment criteria established related to that certain offering profile ( the “ investments ”). the issuer creates a document that provides the potential consumer / customer with a required description of and disclosure related to the nature of the financial instrument being offered for sale (“ offering memorandum ”). the issuer provides ( 101 ) the offering memorandum and supporting documentation to a third party compliance and supervisory entity ( s ) which would consist of a shari &# 39 ; ah supervisory component , a financial technology administrative networking component , and a professional services ( legal counsel , auditor ) component ( or any combination thereof ) for review and compliance evaluation of the offering structure and assistance in coordination of networked guarantors , as the need may arise . the shari &# 39 ; ah supervisory board component ( the “ ssb ”) of the compliance / supervisory entity may consist minimally of two islamic scholars and an islamic banking expert , in order to meet the auditing requirements of the auditing and accounting office of islamic financial institutions ( the “ aaoifi ”). the ssb reviews the issuer &# 39 ; s proposed financial instrument issuance strategy and is responsible for monitoring the issuer &# 39 ; s operations and issuance of requisite certifications as to shari &# 39 ; ah ( islamic ) investment compliance throughout the life of the financial instruments . the financial technology administrative component functions as an administrative outreach of the administrator of the financial technology of the present invention and assists in the coordinated networking of the operation mechanisms required to aid in organizing inter - institutional repurchase guarantees amongst users of the financial technology . the legal and auditing components of the compliance and supervisory entity may be managed independent of the other components through the issuer &# 39 ; s own professional services relations . alternatively , the legal and auditing components may be aided via a centralized entity which is organized to aid the financial technology users in the consistent deployment of the financial technology . legal advisors opine as to matters concerning the operation of the portfolios and administration of the operations of the issuer in compliance with applicable jurisdictional requirements and requisite legal and tax opinions required to underlie the offering memorandum . an auditing component (“ auditor ”) affords the issuer with a comprehensive and shari &# 39 ; ah ( islamic ) compliant accounting body upon which the ssb and the consumer depositors / subscribers may place reliance . the auditor preferably should specialize in matters of islamic finance . as applicable , each of the aforementioned entities issues ( 102 ) its respective certifications and / or opinions in regard to the means by which financial instruments are made available for subscription to consumers via the issuer &# 39 ; s banking or depository institution (“ offering ”). a complete description of the financial instruments proposed for issuance , and such certification and opinions are thereafter incorporated into the final offering memorandum . the consumer investment units (“ consumer investment units ”) are the shari &# 39 ; ah ( islamic ) compliant financial instruments to be issued and sold in accordance with the principles of the present invention . additionally , the administrative component within the compliance / supervisory entity will notify candidate guarantors of the issuer &# 39 ; s scheduled offering such that a par value repurchase may be agreed by a third party guarantor on behalf of the issuer at a future date . more specifically , an underwriter / guarantor (“ underwriter / guarantor ”) is engaged for the issuance of a third party guarantee for the purposes of fiscally supporting the proposed repurchase of the consumer financial instruments at the close of the term of the financial instruments — that period between the date of subscription and the scheduled date of redemption of the consumer investment units (“ depository term ”). a banking institution (“ fiscal agent / trustee ”) acts as the administrator for the issuance of the consumer investment units . the fiscal agent / trustee can be a substantial banking or financial institution having a credit agency rating of sufficient quality to meet minimal rating criteria set forth by the nominated credit rating agency which rates the consumer investment units . the guarantee is preferably organized as a standby letter of credit which becomes available for draw by the fiscal agent / trustee in the event that the fiscal agent / trustee requires further financial support for its repurchase of the financial instruments at the depository term as agreed (“ repurchase guarantee ” or “ guarantee ”). the guarantee is issued as the basis of credit enhancement of the consumer investment units for the purposes of creating a “ value preserved ” security as interpreted by the credit rating agency . as a factor of shari &# 39 ; ah compliance , the guarantee is not technically a guarantee of fiscal performance of the consumer investment unit itself , but rather a guarantee of specific performance under a repurchase requirement ( the “ repurchase agreement ”) constituted by the fiscal agency agreement . the proposed guarantors of the issuer &# 39 ; s consumer investment unit offering notify the compliance / supervisory entity of their commitment to guarantee repurchase of the consumer investment units ( 103 ). the compliance / supervisory entity notifies issuer of commitments received to repurchase the consumer investment units , and issuer commences offering per a pre - approved schedule ( 104 ). the offering memorandum and all supporting documentation for the consumer investment units are made available ( 105 ) by the issuer to the proposed consumers / subscribers as customers of the issuer as a banking / depository institution . the issuer , in this case , acts as its own placement agent , although a third party placement agent could be designated by issuer . the issuer may make its offering available to its customers in a variety of ways , including but not limited to mailings , document review / inspection on premises , upon request or any other compliant manner . while the target market for the consumer investment units consists of islamic consumers that are seeking a secure depository environment for their funds (“ consumer / subscriber ”), the principles of the present invention are not so limited . the issuer may issue physical certificates for the consumer investment units . alternatively , the consumer investment units may be administered via a book - entry only system as an alternative delivery method to the issuance of physical certificates for each of the definitive consumer investment units purchased in accordance with the standard practices applied by the depository trust company , euroclear or other like entities or agencies . the consumer / subscriber agrees ( 106 ) to purchase the consumer investment units by deposit of its funds to the designated subscription depository account of the issuer pursuant to the issuer &# 39 ; s subscription agreement (“ subscription agreement ”). the issuer &# 39 ; s subscription agreement defines the terms and conditions of the subscription of and investment in the financial instrument . the issuer &# 39 ; s subscription agreement further details the terms and conditions of repurchase of the financial instruments by an acceptable third party banking institution , as the case may be , from the consumer / subscriber at an agreed value and at a future date not later than the term of the consumer investment units ( the “ underwriter / guarantor ”). the subscription depository account (“ holding / depository account ”) functions as a holding account for proceeds from a subscription (“ subscription proceeds ”) pending the scheduled receipt by the issuer &# 39 ; s nominated fiscal agent / trustee of a corresponding value of acceptably formatted letters of credit ( as the “ repurchase guarantee ”) in support of the fiscal agent / trustee &# 39 ; s par value repurchase of the consumer investment units thus sold . the holding / depository account is managed as a non - interest bearing account and the proceeds deposited thereto are not eligible for deployment by the issuer into any investment until such time as an applicable repurchase guarantee ( s ) is issued . notice of the subscription is delivered to the compliance / supervisory entity ( 107 ) and the compliance / supervisory entity notifies underwriter / guarantor of the required issuance of the scheduled repurchase guarantee ( 108 ). the guarantee will be instructed for delivery to a safekeeping account established at the fiscal agent / trustee &# 39 ; s institution for the purposes of accepting and holding the guarantee ( s ) on behalf of the consumer / subscribers (“ custodial account ”). the delivery of the guarantee to the custodial account directly supports the fiscal agent / trustee &# 39 ; s repurchase of the financial instruments at the conclusion of the depository term . the underwriter / guarantor will deliver ( 109 ) its repurchase guarantee ( s ) for face value equal to the par value of the outstanding or scheduled value of consumer investment units being covered by such guarantee to the fiscal agent / trustee that acts as the administrator for the repurchase of the financial instruments on behalf of the issuer &# 39 ; s customer / consumer / subscriber . the fiscal agent / trustee will notify issuer and compliance / supervisory entity of its custody of the guarantees ( 110 ) via issuance of its custodial receipt or such other comparable mechanism which identifies deposits of the requisite guarantees to the fiscal agent / trustee &# 39 ; s designated custodial account (“ custodial safekeeping receipt ”). the compliance / supervisory entity will reconfirm the fiscal agent / trustee &# 39 ; s custody of guarantee ( s ) in support of the consumer investment unit repurchase , thereby enabling the issuer to deploy a value of consumer investment unit proceeds equal to the face value of guarantees then held by fiscal agent / trustee ( 111 ). against the issuer &# 39 ; s receipt of reconfirmation from compliance / supervisory entity as to guarantee custody , funds are freely available for investment by the issuer . the issuer will begin deploying funds ( 112 ) into suitable investments in accordance with the described use of proceeds as set forth in the offering memorandum . as a means of administering investment deployment , the issuer may elect to transfer funds now freely available for deployment to a separate account (“ investment account ”), thereby segregating available funds to permit the timely and documented withdrawals of proceeds in support of the issuer &# 39 ; s commencement of its scheduled investments . by way of example and not limitation , such investments may include any ssb approved , shari &# 39 ; ah compliant investment operation or project , including but not limited to energy markets , equipment leasing , real estate , manufacturing , mortgages , and warehousing . over the course of the depository term , any earnings on the investments , respectively , will be paid in or otherwise collected ( 113 a ) by the issuer pursuant to the specific terms of investment applicable to a given investment in support of a calculation and declaration of yield on the consumer investment units . subject investments will report ( 113 b ) required financial and compliance data to the compliance / supervisory entity as agreed , inclusive of data evidencing shari &# 39 ; ah compliance . also , over the course of the depository term , reporting data may be provided to certain regulatory bodies or agencies ( 114 a ), inclusive of the compliance / supervisory entity &# 39 ; s ssb , in order to assure good standing of investments in relation to issuer &# 39 ; s compliant status ; any regulatory / ssb entity that is entitled to or required to receive such information as the basis to confirm regulatory compliance of investments to compliance / supervisory entity ( 114 b ); and compliance / supervisory entity provides ( 114 c ) investment reports and compliance certifications as to standing of investments to issuer . based upon the performance of the investment portfolio arising from the deployment of proceeds made available via the sale of the consumer investment units , the issuer periodically makes a declaration of composite yield ( 115 ), if any , for the investments and remit any such yield payment in favour of the consumer / subscriber on a pro rata basis , representative of the value of consumer investment units purchased . any such yield payment is remitted in favor of a non - interest bearing , depository account at the issuer &# 39 ; s institution designated for the receipt and acceptance of yield payments from specific investments (“ yield account ”). in order to cause the issuance of the guarantee , a balance between risk and guarantor benefit is struck . dependent upon the sophistication of the networked application of the present invention , a variety of approaches to induce guarantor participation may be undertaken . three possible example approaches to engaging suitable repurchase underwriter / guarantors are examined . first , in its simplest form , an underwriter / guarantor will evaluate the design of the investment eligibility criteria for the issuer &# 39 ; s investment portfolio to assess whether it is broad enough to foster certain investment flexibility on the part of the issuer , on the one hand ; while remaining specific enough , on the other hand , to permit the underwriter / guarantor to be comfortable that the aggregate value of the issuer &# 39 ; s cash reserves and the issuer &# 39 ; s subject investments &# 39 ; asset valuation will support a certain minimum investment portfolio valuation at the earliest possible date for draw on the guarantee . this is the future date certain set for repurchase of the consumer investment units by the fiscal agent / trustee at the conclusion of the depository term . ideally , the formulation of an acceptable credit structure is accomplished with a candidate underwriter / guarantor by way of the negotiation and definition of several mechanisms . initially , a specific investment eligibility criteria serves as the “ blanket ” investment policy of the issuer and credit policy of the underwriter / guarantor related to the compilation of the investment portfolio . solely for the purposes of example , specific formulas may be included in that eligibility criteria which identify minimum required asset ratios when compared to total investment in a subject project , specific minimum historical performance ratios for a given candidate investment or project , required percentage - based cash reserve requirements which may be deposited with and held by the underwriter / guarantor during the life of a subject investment , the creation of a sinking fund to directly offset and compensate the underwriter / guarantor for the maximum perceived potential loss of asset value during the life of a given investment , and / or the establishment of a minimum blended asset ratio to total funds invested . additionally , mechanisms include the establishment of an investment draw schedule during the depository term which may require certain minimum cash values be maintained on issuer &# 39 ; s accounts up to the date of scheduled consumer investment unit repurchase ; the allocation of a certain percentage of investment earnings , profits or yields arising from the investments during the depository term into a dedicated guarantee reserve account to be held by the underwriter / guarantor and drawable expressly by the fiscal agent / trustee in support of certain payments to be made by the fiscal agent / trustee under its repurchase agreement as supplemented and supported by the underwriter / guarantor &# 39 ; s guarantee ; and / or the granting of a certain security interest in unrelated or additional collateral deemed acceptable to the underwriter / guarantor . the basis of negotiating and securing the guarantee may include any one or more of the aforementioned mechanisms or such other mechanism as a specific underwriter / guarantor may warrant and a specific issuer may grant . in any event , in securing the guarantee , the conservative formulation of an investment criteria is established which sufficiently supports the valuation of the issuer &# 39 ; s total available assets at the depository term , inclusive of the investment portfolio itself , such that the underwriter / guarantor may issue its guarantee in support of the fiscal agent / trustee &# 39 ; s performance on its repurchase undertaking to the consumer / subscribers . the underwriter / guarantor is not being engaged for the purposes of guaranteeing specific performance of the consumer investment units , lest the guarantee be potentially deemed non - compliant with shari &# 39 ; ah principles . additionally , to be shari &# 39 ; ah compliant the guarantee arises from an examination of the means by which the underwriter / guarantor may be compensated for the issuance of its guarantee . an underwriter / guarantor is designated that may consist of a single banking or financial institution , one or more banking or financial institutions participating in a syndication , or a networked extension of an organized administration of the present invention by the compliance / supervisory entity within an established framework of shari &# 39 ; ah compliant performance guarantee mechanisms or policies . in any of the foregoing cases , when the underwriter / guarantor is an institution having an acceptable investment grade rating , the rating of the underwriter / guarantor will generally become the basis by which the creditworthiness of the consumer investment units is thus measured . in this example , the guarantee takes the form of a letter of credit , preferably a standby letter of credit , which becomes payable upon default under the provisions of consumer investment unit repurchase or the repurchase agreement with the fiscal agent / trustee . customarily , a banking institution will charge certain fees (“ issuance fees ”) related to the issuance of a letter of credit or similar undertaking . in order for the guarantee to be and remain shari &# 39 ; ah compliant , the underwriter / guarantor agrees to waive the collection of issuance fees related to the guarantee , effectively issuing the letter of credit without consideration . alternatively , the underwriter / guarantor instead could potentially benefit by discounting the face value of the guarantee upon issuance or by way of the exploitation of other potential revenue centers available to it related to the operations of the issuer . the foregoing generally identifies the specific performance obligation which is being supported by the guarantee and the considerations which must be weighed in order to satisfactorily cause the issuance of the guarantee . these principles may be readily applied to a varied selection of underwriters / guarantors in compliance with shari &# 39 ; ah principles . in one preferred embodiment , the underwriters / guarantors operate within the banking industry . at the issuer &# 39 ; s option , however , an underwriter / guarantor may be engaged which consists of a single international banking institution , one or more international banking institutions participating in a syndication or consortium , or any administrative combination of the above . however , in general , the use of a networked underwriting and guarantee mechanism as administered by a third party compliance / supervisory entity such that a group of banking institutions operate under a cooperation agreement is potentially the most efficient means of affecting the consistent and mutually , but indirectly beneficial , issuance of scheduled guarantees . under such an arrangement , organized groupings of financial institutions may from time to time act as both consumer investment unit issuers and underwriter / guarantors , respectively , such that each may benefit from the fiscal balance achieved amongst themselves . also , in this example , the risks associated with a given consumer investment unit issuance may be easily defrayed among a variety of underwriter / guarantors . all banking institutions participating in this networked organization have a certain minimum financial standing or rating such that a blended rating for the financial instruments which are ultimately supported by the guarantees to be issued by the network may be reasonably determined . alternatively , and somewhat less efficiently , the syndication process described above may be undertaken directly by the issuer . the issuer may create a banking consortium for the issuance of multiple letters of credit , constituting the guarantees , which aggregate sum of their respective face values will total the par value of all outstanding consumer investment units . preferably , in the event that the issuer organizes multiple guarantees which support performance under the repurchase agreement , all guarantees would preferably be issued concurrently such that the repurchase obligation of the consumer investment units is viewed collectively and consistently as to operations and default provisions in the event of a default . although potentially open to interpretation , the operation of all individual guarantees concurrently assures certain parity between or equality among the outstanding consumer investment units which is desirable . as a further alternative , the issuer could undertake to cause the engagement of one underwriter / guarantor in support of a specific consumer investment unit issuance . this alternative can potentially be successfully implemented by applying comparable underwriting , security or collateralization mechanisms to those profiled above and by negotiating an alternative means of inducing the participation of the underwriter / guarantor in a shari &# 39 ; ah compliant manner for the issuance of the required guarantee . referring now to fig2 a methodological schematic showing details of a depository / subscription process in accordance with the principles of the present invention is seen . based upon market demand from consumer / subscriber of the issuance , the issuer provides ( 201 ) the offering memorandum and supporting documentation , inclusive of designation of fiscal agent / trustee for the consumer investment unit series , to the compliance / supervisory entity for recording of the scheduled consumer investment unit series in support of the desired method of networked underwriter / guarantor repurchase guarantee facilitation , and notice of issuance to the designated shari &# 39 ; ah supervisory board , either as an independent entity or part of the compliance / supervisory entity . the compliance / supervisory entity provides notice ( 202 ) of issuance to candidate underwriters / guarantors for scheduling of the respective underlying guarantees in support of consumer investment unit repurchase at par upon consumer investment unit default or scheduled term of each applicable consumer investment unit . one or more underwriters / guarantors submit ( 203 ) notification to compliance / supervisory entity of their commitment to issue their respective guarantee in support of the scheduled consumer investment unit series to be issued by issuer . the compliance / supervisory entity notifies ( 204 ) issuer and designated fiscal agent / trustee for the consumer investment unit series of schedule of underlying guarantee issuance as agreed and committed by underwriters / guarantors . this enables issuance and delivery of consumer investment units per pre - approved schedule by issuer . upon request , offering memorandum , subscription agreement and all supporting documentation is tendered ( 205 ) by issuer to consumer / subscriber as the subscriber for all or any portion of the consumer investment unit allocation . following the completion of normal bank due diligence on consumer / subscriber , consumer / subscriber agrees ( 206 ) to purchase desired consumer investment units from issuer / depository institution . consumer / subscriber executes issuer &# 39 ; s subscription agreement , inclusive of corresponding funds origin warranties , and effects the deposit of purchase proceeds to the designated holding / depository account at the issuer / depository institution . the amount accepted for subscription will not exceed the maximum value of guarantees scheduled and agreed for issuance by underwriter / guarantor per prior agreement with issuer . subscription proceeds are maintained ( 207 ) in a non - depleting reserve account , pending issuance and delivery of the corresponding guarantee to the custodial account of the fiscal agent / trustee for the consumer investment unit series then being subscribed . notice of subscription and subscription amount held in reserve is provided ( 208 ) by issuer to compliance / supervisory entity . the compliance / supervisory entity advises ( 209 ) underwriter / guarantor of pending subscription which confirms issuer &# 39 ; s call for issuance of the scheduled guarantee ( s ). the underwriter / guarantor causes the issuance of its scheduled and agreed guarantee ( s ) ( 210 ) covering the par value of the outstanding consumer investment units being subscribed ( which is also equal to the value of the proceeds deposited to the holding / depository account of the issuer ) and delivers guarantee ( s ) to the custody of the fiscal agent / trustee . fiscal agent / trustee confirms ( 211 ) its custody of scheduled guarantee ( s ) in its designated custodial account to compliance / supervisory entity in support of the repurchase of the consumer investment units in the series . compliance / supervisory entity advises ( 212 ) issuer of fiscal agent &# 39 ; s / trustee &# 39 ; s custody of the guarantee ( s ) in support of the par value repurchase of the consumer investment units being subscribed , thereby enabling the issuer &# 39 ; s release , investment or deployment of a value of subscription proceeds from its holding / depository account equal to a maximum aggregate value of the guarantee ( s ) then in the custody of the fiscal agent / trustee . issuer transfers funds ( 213 ) to its designated investment account pending subsequent investment in qualified and permitted investments in accordance with the investment eligibility requirements set forth in the offering memorandum and supporting documentation , which investments constitute the investment portfolio . referring now to fig3 a methodological schematic showing payments , cash accounts , and a networked consumer investment unit repurchase in accordance with the principles of the present invention is seen . issuer provides ( 301 ) offering memorandum and supporting documentation , inclusive of designation of fiscal agent / trustee for the consumer investment unit series , to third party compliance / supervisory entity for recording of consumer investment unit series pertaining to underwriter / guarantor facilitation and notice to designated shari &# 39 ; ah supervisory board . compliance / supervisory provides notice of issuance ( 302 ) to candidate underwriters / guarantors for scheduling of the respective underlying guarantees in support of consumer investment unit repurchase by underwriter / guarantor at par upon consumer investment unit default or the scheduled term of the consumer investment units . in response to notice received , one or more underwriters / guarantors submit ( 303 ) notification to compliance / supervisory entity of commitment to issue their respective guarantee ( s ) in support of the scheduled consumer investment unit series to be issued by issuer . compliance / supervisory entity notifies ( 304 ) issuer and designated fiscal agent / trustee for the consumer investment unit series of schedule of underlying guarantees to be issued as agreed and committed by underwriters / guarantors , thereby permitting issuance of consumer investment units per approved schedule . upon request , offering memorandum , subscription agreement and all supporting documentation are made available ( 305 ) by issuer to consumer / subscriber as the subscriber in support of all or any portion of the consumer investment unit allocation then approved for issuance and repurchase . following normal bank due diligence on the proposed subscriber , consumer / subscriber agrees ( 306 ) to purchase all or a portion of the scheduled consumer investment units from issuer / depository institution per issuer &# 39 ; s subscription agreement which includes certain corresponding funds origin warranties by the subscriber . consumer / subscriber deposits purchase proceeds to the designated account at the issuer / depository institution up to the maximum aggregate value of guarantees scheduled for issuance by respective underwriter / guarantor ( s ). notice of subscription and subscription amount then deposited to the designated holding / depository account of the issuer is provided ( 307 ) to compliance / supervisory entity . compliance / supervisory entity advises ( 308 ) underwriter / guarantor of subscription which confirms issuer &# 39 ; s call for issuance of the scheduled guarantee ( s ). the underwriter / guarantor causes the issuance ( 309 ) of its scheduled and agreed guarantee ( s ) covering the par value of the outstanding consumer investment units and delivers guarantee ( s ) to the designated custodial account of the fiscal agent / trustee for the consumer investment unit series . fiscal agent / trustee confirms ( 310 ) its custody of scheduled guarantee ( s ) in support of consumer investment unit series to compliance / supervisory entity via issuance of custodial receipt or such other like or acceptable method . compliance / supervisory entity advises ( 311 ) issuer of fiscal agent / trustee &# 39 ; s custody of guarantee , thereby enabling the issuer &# 39 ; s release , investment or deployment of a value of subscription proceeds equal to a maximum aggregate value of the guarantee ( s ) then in the custody of the fiscal agent / trustee . issuer selects and affects ( 312 ) the scheduled investments in accordance with the investment eligibility requirements set forth in the offering memorandum and supporting documentation which investments then constitute the investment portfolio . over the course of the investment term , any earnings on the investments , respectively , will be paid in or otherwise collected by ( 313 a ) the issuer pursuant to the specific terms of investment applicable to a given investment in support of a calculation and declaration of yield on the consumer investment units . all companies , institutions or entities that have received investment proceeds and which constitute the investments in the investment portfolio will report required financial and compliance data ( 313 b ) to compliance / supervisory entity as agreed , inclusive of data evidencing shari &# 39 ; ah compliance . the issuer periodically makes a declaration of composite yield ( 314 ), if any , for the investments and remits any such yield payment in favour of the consumer / subscriber on a pro rata basis , representative of the value of consumer investment units purchased . per the agreed liquidation or investment termination provisions of the issuer &# 39 ; s investment agreements with the subject investments , issuer collects ( 315 ) certain amounts from investments intended to cover repurchase costs and expenses associated with the consumer investment units . issuer deposits ( 316 ) required repurchase amounts to fiscal agent / trustee &# 39 ; s designated payment account . this depository function , although not referenced in the present example , may also be implemented under a segregated payment account with the issuer under specific arrangement with the fiscal agent / trustee . fiscal agent / trustee distributes ( 317 ) payments from its designated payment account in amounts equal to the par value of the consumer investment units then held by the consumer / subscriber , respectively , thereby effecting a scheduled repurchase of the consumer investment unit series then being closed out at the conclusion of the depository term . in response to receipt of payment , consumer / subscriber surrenders ( 318 ) repurchased consumer investment units to fiscal agent / trustee , and fiscal agent / trustee disposes of repurchased units pursuant to its agreement with the issuer . notice is provided ( 319 ) to compliance / supervisory entity of the consumer investment unit series &# 39 ; compliant and scheduled repurchase and retirement . referring now to fig4 a methodological schematic showing repurchase via utilization of the guarantee in accordance with the principles of the present invention is seen . as necessary prior to the conclusion of the depository term of the consumer investment units , issuer tenders ( 401 ) its instructions for liquidation of a minimum of the original investment amount or such other amount as was agreed with each of its respective investments as such constitute the investment portfolio just prior to the conclusion of the depository term . in response , investments , respectively , remit ( 402 ) payments to issuer per their agreements with issuer on or about the conclusion of the depository term . for the purposes of this example , available proceeds collected are not sufficient to cover or otherwise fully offset the scheduled par value repurchase of the consumer investment units then outstanding in the series . issuer provides ( 403 a ) notice of the amount collected to fiscal agent / trustee and makes payment of available proceeds in support of consumer investment unit repurchase by the fiscal agent / trustee on or about the scheduled close of the depository term ; and fiscal agent / trustee credits ( 403 b ) the amount remitted by issuer to a designated payment account . fiscal agent / trustee advises ( 404 ) consumer / subscribers of fiscal agent / trustee &# 39 ; s intent to draw upon one or more of the guarantee ( s ) as the basis to support and satisfy its repurchase obligation for the consumer investment units then outstanding or otherwise not able to be repurchased with available proceeds in the payment account . fiscal agent / trustee , on behalf of the consumers / subscribers , presents ( 405 ) its demand for payment of an amount equal to the repurchase shortfall plus any permitted fees or expenses to the underwriter / guarantor pursuant to the terms and conditions of the guarantee ( s ) then being drawn . provided the demand for payment was presented compliantly , the underwriter / guarantor will remit ( 406 ) its payment to the designated payment account of the fiscal agent / trustee . upon the receipt of proceeds drawn under the guarantee ( s ), fiscal agent / trustee calls for presentation ( 407 ) of outstanding consumer investment units at the counters of the fiscal agent / trustee or its nominee for repurchase . although not described in the present example , the fiscal agent / trustee may elect to nominate the issuer for acceptance of all surrendered consumer investment units being repurchased . consumer / subscribers surrender ( 408 ) their consumer investment units pursuant to fiscal agent / trustee &# 39 ; s instruction . fiscal agent / trustee repurchases ( 409 ) the outstanding consumer investment units by payment from the designated payment account to the consumer / subscribers . fiscal agent / trustee will ( 410 ), if required , deliver the duly repurchased consumer investment units to the underwriter / guarantor or pursuant to instructions received . the underwriter / guarantor will take ( 411 ) whatever actions it deems necessary with reference to the issuer and the consumer investment units to recoup or otherwise offset payments made under its guarantee . fiscal agent / trustee will notify ( 412 ) the compliance / supervisory entity of any draws , payments or collections made under any guarantee ( s ) in relation to the consumer investment unit series . the compliance / supervisory entity will subsequently utilize this data with reference to future proposed or scheduled issuances of consumer investment units by the issuer . referring now to fig5 a methodological schematic showing shari &# 39 ; ah compliant mechanisms in accordance with the principles of the present invention is seen . issuer provides ( 501 ) offering memorandum and supporting documentation , inclusive of designation of fiscal agent / trustee for the consumer investment unit series , to third party compliance / supervisory entity for recording of consumer investment unit series pertaining to underwriter / guarantor facilitation and review by designated ssb . the ssb supervises , monitors and advises as to all matters of islamic compliance involving the issuer &# 39 ; s issuance and sale of the consumer investment units , on - going operations , and financial interests concerning the calculation and payment of yield , financial risk management , and the underwriting and repurchase of the consumer investment units at the conclusion of the depository term . prior to issuance of the consumer investment units by issuer , the ssb , either directly or via the compliance / supervisory entity will review all documentation and data provided by the issuer related to the offering and , providing all is compliant , will issue its certification of compliance with shari &# 39 ; ah investment and financial principles ( a fatwa ) which is incorporated into the offering memorandum and related documentation by the issuer . the ssb functions may be part of the compliance / supervisory functionality or may be handled via a third party dedicated ssb organizational entity . for the purposes of the present example , the organizational structure of the ssb related to the compliance / supervisory entity is recorded as an independent entity . compliance / supervisory provides ( 502 ) notice of issuance to candidate underwriters / guarantors for scheduling of the respective underlying guarantees in support of consumer investment unit repurchase by underwriter / guarantor at par upon consumer investment unit default or scheduled term . in response to notice , one or more underwriters / guarantors submit ( 503 ) notification to compliance / supervisory entity of commitment to issue their respective guarantee ( s ) in support of the repurchase of the scheduled consumer investment unit series to be issued by issuer . compliance / supervisory entity notifies ( 504 ) issuer and designated fiscal agent / trustee for the consumer investment unit series of the schedule of underlying guarantees as agreed and committed by underwriters / guarantors , thereby permitting issuance of consumer investment units per pre - approved schedule . upon request , offering memorandum , subscription agreement and all supporting documentation is made available ( 505 ) by issuer to consumer / subscriber for all or any portion of the consumer investment unit allocation and who are likely of islamic belief and practice . following normal bank due diligence by the issuer , consumer / subscriber agrees ( 506 ) to purchase all or a portion of the consumer investment units from issuer / depository institution per issuer &# 39 ; s subscription agreement and corresponding funds origin warranties . the consumer / subscriber deposits its purchase proceeds to the designated shari &# 39 ; ah compliant , non - interest bearing holding / depository account at the issuer / depository institution . notice of subscription and subscription amount as deposited to the issuer &# 39 ; s designated holding / depository account is provided ( 507 ) to compliance / supervisory entity . compliance / supervisory entity advises ( 508 ) underwriter / guarantor of subscription which confirms issuer &# 39 ; s call for issuance of the scheduled guarantees . the underwriter / guarantor will cause ( 509 ) the issuance of its scheduled and agreed guarantee ( s ) covering the par value repurchase of the outstanding consumer investment units and delivers guarantee ( s ) to the fiscal agent / trustee . the underwriter / guarantor does not charge an issuance fee for the guarantee . in order for the guarantee to be and remain shari &# 39 ; ah compliant , the underwriter / guarantor must agree to waive the collection of issuance fees related to the guarantee ; the underwriter / guarantor instead can potentially benefit by the provision of related service functions or by way of other potential revenue centers available to it related to the operations of the issuer . fiscal agent / trustee confirms ( 510 ) its custody of scheduled guarantee ( s ) in support of consumer investment unit series to compliance / supervisory entity . compliance / supervisory entity advises ( 511 ) issuer of fiscal agent / trustee &# 39 ; s custody of guarantee ( s ), thereby enabling the issuer &# 39 ; s release , investment or deployment of a value of subscription proceeds equal to a maximum value of the guarantee then in the custody of the fiscal agent / trustee . issuer selects and affects ( 512 ) the scheduled investments in accordance with the investment eligibility requirements set forth in the offering memorandum and supporting documentation which investments then constitute the investment portfolio . over the course of the investment term , any earnings on the investments will be paid in or otherwise collected by ( 513 a ) the issuer pursuant to the specific terms of investment applicable to a given investment in support of a calculation and declaration of yield on the consumer investment units . the businesses , operating companies or projects that constitute the investments will report ( 513 b ) required financial and compliance data to compliance / supervisory entity as agreed , inclusive of data evidencing shari &# 39 ; ah compliance . reporting data is provided ( 514 a ) to certain regulatory bodies or agencies , inclusive of compliance / supervisory entity &# 39 ; s ssb , in order to assure good standing of investments in relation to issuer &# 39 ; s shari &# 39 ; ah compliant status . the ssb entity confirms ( 514 b ) compliant status of investments to compliance / supervisory entity ; and compliance / supervisory entity provides ( 514 c ) investment reports and compliance certifications as to shari &# 39 ; ah compliant standing of investments to issuer . the issuer periodically makes a declaration of composite yield ( 515 ), if any , for the investments and remit any such yield payment in favour of the consumer / subscriber on a pro rata basis , representative of the value of consumer investment units purchased . there is no guarantee of a specific yield , earnings or interest payable to the subscriber / investor in relation to the consumer investment units or the investments . the issuer is also required to certify the on - going shari &# 39 ; ah compliant standing of its consumer investment units to consumer / subscribers in conjunction with shari &# 39 ; ah compliant distributions of yield . as such , during the depository term , the ssb will periodically audit and randomly inspect the operations of the investments to assure that no portion of the operations of the investments fail to comply with shari &# 39 ; ah investment guidelines and business principles . against a satisfactory audit and inspection of the documents delivered by the issuer , the ssb delivers a copy of their updated shari &# 39 ; ah certification related to the issuer activities such that copies may be made available to and for the records of the consumer / subscribers throughout the balance of the depository term . thus , a financial instrument in accordance with the principles of the present invention encompasses certain features which make it new and innovative in the islamic consumer banking market . a financial instrument in accordance with the principles of the present invention makes tangible the philosophical beliefs of islam within a framework which is conducive to traditional financial thought which is designed to aid a consumer in preserving their savings while potentially generating a minimal yield or earnings thereon . this marriage of ideologies is evident via the overlay of financial practices generally identified in fig5 which demonstrates shari &# 39 ; ah compliant mechanisms within the consumer banking market , such that an economic bridge is established for the benefit of the islamic consumer which for the first time aids them in conservatively managing their funds while still maintaining an opportunity to further enhance their collective value . while the invention has been described with specific embodiments , other alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , it will be intended to include all such alternatives , modifications and variations set forth within the spirit and scope of the appended claims . the following glossary of terms is set forth for convenience and should not be construed as limiting the scope of the present invention : auditing and accounting office of islamic financial institutions (“ aaoifi ”): responsible for , among other things , the monitoring and oversight of islamic banking and investment institutions . auditor : the firm to be appointed should specialize in matters of islamic finance . it should afford the issuer with a comprehensive and shari &# 39 ; ah compliant accounting body upon which the shari &# 39 ; ah supervisory board and the investors may place reliance . consumer investment unit : the shari &# 39 ; ah ( islamic ) compliant investment - grade security to be issued and sold resultant from the application of a financial instrument in accordance with the principles of the present invention . consumer / subscribers : those entities , parties or individuals who purchase the consumer investment units , consisting of islamic individuals and retail banking customers . custodial account : a safekeeping account established at the fiscal agent / trustee &# 39 ; s institution for the purposes of accepting and holding the repurchase guarantee ( s ) for the ultimate benefit of the subscribers / investors . custodial safekeeping receipt : the receipt issued by the fiscal agent / trustee which identifies deposits to the custodial account of the guarantee ( s ). depository term : the term of the consumer investment units , or that period between the date of subscription and the scheduled date of redemption of the consumer investment units . fiscal agent / trustee : a substantial international banking institution having a credit agency rating of sufficient quality to meet minimal rating criteria set forth by the nominated credit rating agency which rates the consumer investment units ; acts as the administrator for the issuance of the consumer investment units . guarantee : the letter of credit , preferably a standby letter of credit , which is issued by the underwriter / guarantor in support of the repurchase of the consumer investment units . holding / depository account : a non - interest bearing , depository account at the issuer &# 39 ; s institution designated for the receipt of proposed subscription proceeds prior to the scheduled purchase of the consumer investment units . investment : the project or company which is , was or became the intended application or use of the proceeds derived from the sale of the consumer investment units . investment account : a non - interest bearing , depository account designated for the deposit and disbursement of subscription proceeds in favor of a certain investment as identified , selected and scheduled by the issuer . issuance fee : the fee customarily charged by a banking institution or other such entity for the issuance of a letter of credit or other similar undertaking . issuer : the banking or financial institution which issues the consumer investment units , makes the offering for the purpose of attracting consumer deposits and subsequently manages and implements the proceeds of the sale of the consumer investment units in a manner consistent with the investment criteria established related to that certain offering for which the consumer investment units were issued . offering : the means by which the consumer investment units are made available for purchase to the consumer / retail marketplace by the issuer . offering memorandum : the document which provides the potential investor with a required description of and disclosure related to the nature of the consumer investment units being offered for sale . rating agency : moody &# 39 ; s investor services , standard & amp ; poors , or such other internationally recognized credit rating agency . repurchase agreement : the terms and conditions under which the repurchase of the consumer investment units from the subscriber / investors by the fiscal agent / trustee or , as the case may be , an alternative third party , is scheduled at an agreed value and on a future date certain . shari &# 39 ; ah supervisory board (“ ssb ”): an advisory board consisting of at least two islamic scholars and an expert in the field of endeavor of the issuer / investment ; alternatively , an ssb may consist of three islamic scholars and still meet the auditing requirements of the aaoifi . the ssb reviews the issuer &# 39 ; s proposed consumer investment unit issuance and underlying investment / business strategy and is responsible for the monitoring of the issuer &# 39 ; s operations and the issuance of requisite certifications as to shari &# 39 ; ah ( islamic ) investment compliance throughout the life of consumer investment unit series . subscription agreement : the agreement which defines the terms and conditions of the subscription of and investment in the consumer investment units . subscription proceeds : the funds which were derived from the sale of the consumer investment units . underwriter / guarantor : this entity may consist of several international banking institutions , or functionally comparable entities ; the underwriter / guarantor is engaged for the purposes of issuance of its guarantee in support of the repurchase of the consumer investment units at the close of the depository term . yield account : a non - interest bearing , depository account designated for the receipt and acceptance of yield payments .
| 6 |
as the filtering solution of the invention any concentrated solution containing a soluble erbium salt and methyl violet 2b may be employed . however , the solution preferably contains 20 to 40 percent by weight of the erbium salt and 0 . 0004 to 0 . 0008 percent by weight of the voilet 2b . it has been found that the most useful solutions occur in the range wherein the concentration of the erbium salt is from 25 to 30 by weight and the concentration of the methyl violet 2b is from 0 . 0005 to 0 . 0007 by weight . as a solvent , a combination of water and alcohol may be employed . examples of alcohols that may be employed are ethylene glycol , 1 , 2 - propylene glycol , 1 , 3 - propylene glycol , glycerol , ethanol , propanol , isopropanol , and methanol . preferably up to 80 % by weight of the solvent consists of the alcohol . in such a case the solution may also serve as an excellent coolant for the tube during operation while at the same time the solution is resistant to freezing during storage . most preferable the solvent consists of 50 % by weight of ethylene glycol and 50 % by weight of water . if the solution not only is to serve to suppress the undesired radiation but also as a coolant for the tube , it is preferred that the solution be carried on the external surface of the faceplate of the tube and be held in place by a glass plate or other transparent member sealed to the external surface of the faceplate . however , if no cooling effect is desired the solution need not be carried directly on the surface of the faceplate of the crt tube but may be contained in a separate container outside of the external surface of the faceplate as long as the container is in the path of the radiation emitting from the tube and is transparent to the radiation from the tube . any water soluble erbium salt may be employed , examples of which are erbium chloride , erbium iodide , erbium bromide and erbium nitrate . of these , the erbium nitrate salt is preferred . the silver - doped zinc sulfide phosphor ( p22 blue ) which is the blue radiating phosphor used most frequently in commercially available crt devices is described in &# 34 ; optical characteristics of cathode ray tube screens &# 34 ;, ( december , 1980 ) electronic industries association , washington , d . c . the phosphor material may be present in a cathode ray tube as a luminescent screen coated on the inner surface of the faceplate but may also be in form of a single self - supporting crystal only the surface of which is activated . for a more complete understanding of the invention , the invention will now be described in greater detail with reference to fig1 of the drawing which is a cross - sectional view of a preferred embodiment of the crt device of the invention . a solution of 12 g of er ( no 3 ) 3 . 5h 2 o + 0 . 2 mg methyl violet 2b in 21 ml of 50 % h 2 o : 50 % ethylene glycol was made up . an 0 . 5 cm thick layer of the resultant light filtering solution 1 was prepared and applied to the external surface 3 of the glass plate 5 of a cathode ray tube 7 supplied with envelope 9 and containing an electron gun 11 positioned to emit a beam of electrons impinging the surface of a blue fluorescent luminescent screen 13 formed of a silver - activated zinc sulfide phosphor ( p - 22 blue ) deposited on the internal surface 15 of the faceplate 5 . the solution layer 1 is held in place on the external surface 3 of the faceplate 5 by transparent cover plate 17 and seals 19 . the light output of this crt device upon excitation of the luminescent screen by an impinging electron beam was scanned with a monocrometer in the wavelength range of 400 to 600 nm to record the result as is shown in the unbroken line curve in the graph of fig2 of the drawing in which the wavelength in nm is plotted on the abscissa and the measured intensity in arbitrary units is plotted on the ordinate . in similar fashion the light output produced by the identical crt device except for the omission of the erbium salt and the methyl violet 2b from the cooling solution was scanned in the same wavelength range . the recorded result is shown in the broken line curve in the graph of fig2 of the drawing . as inspection of results shown in fig2 of the drawing shows that the use of the filtering solution containing the erbium salt and the methyl violet 2b results in a significant decrease in undesired radiation from the device particularly undesired radiation from 440 to 450 nm and 470 to 540 nm while leaving the level of the desired 460 nm radiation peak virtually unchanged . while the present invention has been described with reference to particular embodiments thereof , it will be understood that numerous modifications can be made by those familiar with the state of the art without actually departing from the scope of the invention .
| 7 |
referring now to the drawings and more particularly fig1 - 7 , a hatch latch with integral lock is shown generally at 10 suitably mounted in an opening 12 of a hatch cover 14 . the latch 10 includes a housing 16 which is snugly and sealingly received in the opening 12 and bedded therein by the usual bedding compound , so that water may not leak therepast . the opening 12 is counter - sunk at 18 so that a top flange 20 of the housing 16 can be received therein . a generally &# 34 ; c &# 34 ; shaped lift ring 22 , when in its &# 34 ; down &# 34 ; position , fits in a conformingly shaped groove 23 formed in the top of the housing 16 , so that , as seen in fig2 when the ring 22 is in the groove 23 , it is flush with the top of the housing 16 . a knob shown generally at 24 is formed on the top of a knob shaft 25 , which knob 24 has a pair of diametrically opposed openings therein , one of which is shown at 26 , which openings pivotally receive the opposed ends of the &# 34 ; c &# 34 ; shaped ring 22 , whereby the ring 22 can be pivotally upwardly into a graspable position and downwardly into a flush position relative to the housing 16 . when in its upward position , the ring can be pulled on to raise the hatch 14 relative to the deck 15 and also to rotate the knob 24 to &# 34 ; latch &# 34 ; or &# 34 ; unlatch &# 34 ; the hatch latch . the knob shaft 25 is rotatably mounted in an opening 27 formed in the housing 16 , and an &# 34 ; o - ring &# 34 ; 28 carried by the shaft 25 immediately below the knob 24 seals against the housing 16 so that no water can flow therepast . a cam shaft 30 is formed integrally with and extends downwardly from the knob shaft 25 so that its lower end 31 projects below the inside of the deck 15 . the cam shaft 30 is threaded for its full length and has a pair of diametrically opposed flat surfaces 32 and 33 formed thereon . referring now to fig2 and 3 for clarity , a washer 34 is mounted on the cam shaft 30 and abuts a shoulder 35 formed on the housing 16 around the opening 27 therein , and a lock nut 36 is threaded on the shaft 30 securely against the washer 34 to lock the knob shaft 25 securely in housing 16 against vertical movement while allowing the shaft 25 to freely rotate relative to the housing . on the lower end of the cam shaft 30 is mounted a lock bar 37 which has a opening adjacent one end thereof ( not shown ) receiving the shaft 30 while a pair of lock nuts 38 and 39 , disposed on opposed sides of the bar 37 secure the same against movement relative to the shaft 30 . preferably , the opening in the bar 37 has a pair of flats ( not shown ) thereon in the opening therein ( not shown ) which register with the flat surfaces 32 and 33 on the shaft 30 to prevent relative rotation . the locking bar 37 projects perpendicularly from the shaft 30 , so that in the secured position of the lift ring 22 , the distal end of the bar 37 is disposed below the deck 15 to prevent upward movement of the hatch cover 14 relative to the deck . upon raising the ring 22 , the ring can rotate the knob 24 one hundred and eighty degrees thereby completely moving the bar 37 from engagement with the deck 15 . in this position , the ring 22 can be used to raise the hatch cover 14 . since the knob 24 has been rotated one hundred and eighty degrees , the ring 22 can again be lowered and received in the groove 23 . a securing plate 40 has an opening 42 therein which receives the lower part of the housing 16 so that the plate 40 abuts a shoulder 41 on the housing and also abuts the underside of the hatch cover 14 to securely mount the housing 16 and the hatch cover 14 . a pair of screws 40a and 40b secure the plate 40 to the bottom of the housing 16 . locking means , shown generally at 43 , are provided to lock the knob 24 and the cam shaft 30 alternately in their &# 34 ; locked &# 34 ; position , with the lock bar 37 under the deck 15 as seen in fig2 or to lock the lock bar in a position one hundred and eighty degrees from such position in its &# 34 ; unlocked position &# 34 ;. the locking means 43 includes a key actuated tumbler 44 which is sealingly pressed into an opening 45 and retained therein by a snap ring 46 engaged in a groove in the tumbler 44 and a registering groove in the housing 16 . the tumbler 44 has a key slot 47 therein which , when the key is removed therefrom , has a spring loaded cover which seals the opening against water leaking therepast . such a tumbler can be obtained from the hurd lock corp . of 603 bohannon avenue , greenville , tenn . 37744 - 1450 under part number 2400030000 . the lower end of the tumbler has an eccentric pin 48 thereon which engages in a transverse slot 49 in a slide plate 50 . rotation of the tumbler 44 causes the eccentric pin 48 to move the slide plate 50 for and aft . an opening shown generally at 51 in the rear end of the slide plate 50 has an enlarged round end 52 which at the inner end thereof blends into a flat sided slot 53 . when the bar 37 is disposed below the deck 15 , or one hundred and eighty degrees therefrom , the flat surfaces 32 and 33 are aligned with the flat sides of the opening 53 and the slide plate 50 can be moved by the pin 48 so that the flat sides of opening 53 engage the flat surfaces 32 and 33 of cam shaft 30 to prevent rotation of the cam shaft 30 , whereby the bar 37 is locked into its &# 34 ; locked &# 34 ; or unlocked position . activation of the tumbler 44 to move the pin 48 and thereby the slide plate 50 so that the round end 52 of the opening 51 receives the cam shaft 30 , allows the knob 24 to rotate the cam shaft such that the bar 37 may be moved to any position around its circumventual plane of movement , but preferably to either its &# 34 ; locked &# 34 ; or &# 34 ; unlocked &# 34 ; position . once the bar 37 is in its locked or unlocked position , the ring 22 can be lowered into the groove 23 and the key ( not shown ) removed from the tumbler 44 . a cover plate 50a overlies the slide plate 50 and is secured to the housing 16 by mounting screws 50b , so that the cover plate holds the slide plate in place while allowing operative movement thereof . in the event that the ring 22 is lowered at such time that the knob 24 is positioned so that the bar 37 is not fully locked or unlocked , the ring 22 will not register with the groove 23 and will be held up by the surface of the housing 16 adjacent the groove 23 . to prevent inadvertent damage to the ring 22 at such time , reference is made to the embodiment of fig8 wherein resilient means 54 has been provided to inhibit shock loading or bending of the ring 22 . more particularly , a coiled compression spring 55 is received around the knob shaft 25a and it top end abuts against a shoulder 35a on the housing 16a , while a lock nut 36a engages a washer 34a which , in turn , engages the bottom end of the spring 55 . thus the knob 24a is resiliently held in place in the housing 16a by the resilient means 54 , and in the event of the ring 22 is inadvertently stepped on while the ring is not in the groove 23 , the resilient means 54 will allow the knob 24a to move axially and prevent the ring 22 from bending or breaking . when the ring 22 is not in the groove 23 , the top surface of the housing 16 adjacent the groove 23 will engage the ring 22 and act as a fulcrum in the event the ring is stepped on . thus if someone steps on the ring 22 when not in the groove 23 and thus in its intermediate position , the outer end of the ring would be moved downwardly and the inner end , connected to the knob 24a , would be lifted , which moves the knob shaft 24a upwardly and compresses the resilient means 54 and thereby prevents damage to the ring . means are provided to indicate the locked status of the hatch latch . referring to fig1 a bump 56 is positioned on the housing 16 adjacent the knob 24 , and a bump 57 is positioned on the knob 24 . when the bumps 56 and 57 are adjoining each other as shown , the bar 37 is in its unlocked position and when the bumps are displaced , the bar is unlocked .
| 8 |
the assembly shown in fig1 includes a stator core 2 which has a conventional structure composed of a plurality of steel laminations 4 arranged in a stack which extends along the core axis . each lamination is typically composed of a plurality of circular segments and the core is assembled so that the segments of one lamination are angularly offset from those of the adjacent lamination so that each segment of one lamination overlaps two segments of each adjacent lamination . the outer periphery of core 2 is provided with a plurality of dovetail grooves 6 , one of which is designated in fig2 each groove extending parallel to the core axis and containing a key bar 8 having a trapezoidal shape which mates with the associated dovetail groove 6 . normally , each lamination segment will be provided with at least two grooves 6 and two grooves of one segment will each be aligned with a respective groove in each of two adjacent segments of the adjacent lamination 4 . the portion of each key bar 8 which engages a groove 6 may be given cross - sectional dimensions slightly smaller than the corresponding dimensions of groove 6 to facilitate insertion of key bars 8 in grooves 6 . at each axial end of core 2 there are disposed an interior pressure plate , or finger plate , 10 and an exterior pressure plate , or end plate , 12 . all plates 10 and 12 and all laminations 4 can be provided with bolt passages for receiving a plurality of bolts 14 that extend throughout the axial length of core 2 and project from plates 12 . each end of each bolt 14 is provided with a nut which is tightened to apply the desired compression force to core 2 . compression bolts 16 may be inserted into threaded passages in each end of each key bar 8 , and a compression force may be produced by tightening a nut associated with each bolt 16 . in this case , the resulting compression force applied to core 2 is absorbed in the form of a tension force imposed on each key bar 8 . due to the presence of bolts 16 , through bolts 14 may be eliminated if end plates 12 are appropriately constructed in a manner known in the art . key bars 8 thus act to hold he components of core 2 in alignment , to secure core 2 to the surrounding frame , as will be described in greater detail below , and to act as axial tension members via which compressive loading is applied to core 2 . after core 2 has been assembled with key bars 8 , plates 10 and 12 and at least bolts 16 , a plurality of key blocks 20 are secured to each key bar 8 . each key block 20 is provided with a bottom groove 22 which receives the associated key bar 8 , and with a top groove 24 , which preferably has chamfered sides . each key block 20 is secured to an associated key bar 8 by means of bolts 26 whose heads are countersunk in recesses formed in the base of groove 24 so that the top of each bolt 26 extends no higher than the groove base . tightening of bolts 26 clamps key bars 8 against the sloping sides of grooves 6 and clamps key blocks 20 against the outer periphery of core 2 . because of the mating trapezoidal , or dovetail , shapes of grooves 6 and key bars 8 , the mechanical fastening of key blocks 20 to key bars 8 and the clamping of key blocks 20 against core 2 , key bars 8 can effectively absorb torque loads exerted on core 2 during machine operation and are positively held against rotation in grooves 6 under the influence of such torque loads . the assembled core is then installed in a frame composed of a cylindrical casing ( not shown ) provided with radially inwardly extending , annular plate members 30 . each plate member 30 is provided at its inner periphery with one or two annular , axially projecting flanges 32 and each flange is provided with an array of bolt holes extending around the flange periphery . a plurality of axially extending , circumferentially spaced spring bars 34 are secured to flanges 32 by means of threaded bolts 36 which pass through the bolt holes in flanges 32 and engage in threaded passages in spring bars 34 . each flange 32 is provided , at its inner surface , with machined flats 33 each contacting a respective spring bar 34 to assure accurate positioning of each spring bar 34 relative to flanges 32 . subsequent to bolting , each spring bar is preferably also welded to flanges 32 . the circumferential spacing between spring bars 34 corresponds to the circumferential spacing between key bars 8 . the assembled core is installed in the frame by sliding grooves 24 in key blocks 20 along spring bars 34 until bolt holes in spring bars 34 come into alignment with bolt holes in key blocks 20 , the latter bolts holes also being aligned with threaded passages in key bars 8 . then , bolts 40 are installed to secure spring bars 34 to key blocks 20 and key bars 8 , and assembly is completed . each key block 20 is positioned to be located midway between two successive plate members 30 so that , typically , there is one key block 20 located between each successive pair of plate members 30 and core 2 can experience a certain degree of tangential movement relative to the frame . spring bars 34 are constructed , according to principles known in the art , to have sufficiently low spring constants in both the radial and tangential directions , to effectively isolate the frame from core vibrations . spring bars 34 are additionally constructed to be capable of withstanding short - circuit torques , which are typically 8 to 10 times the normal rated torque of the generator at frequencies of twice the line frequency and higher harmonies . because of the presence of key blocks 20 , a radial gap exists between key bars 8 and spring bars 34 . this gap provides sufficient space for movement of plates 10 and 12 through the cylindrical region enclosed by spring bars 34 during core installation . moreover , because of the connecting function performed by key blocks 20 , spring bars 34 require less machining than in the previously proposed arrangement . referring to fig4 it will be seen that each key bar 8 is preferably provided at its outer surface with a recess for each associated key block 20 . this recess serves to accurately position the associated key block 20 . in addition , these recesses provide a radial engagement between each key block 20 and key bar 8 which enables key blocks 20 to better support core 2 after connecting core 2 to the frame , which normally takes place while the axis of core 2 has a vertical orientation . finally , the presence of each recess in the outer surface of each key bar 8 allows the portion of each key block 20 which extends between grooves 22 and 24 to be given a sufficient structural thickness without requiring an increase in the frame flange diameter . as further shown in fig4 the radial inner surface of each spring bar 34 is provided with a plateau , or land , 42 at the location of each key block 20 so that each spring bar 34 projects radially inwardly at each location where it is to be fastened to a key block 20 to a greater extent than at each location where spring bars 34 are secured to flanges 32 . therefore , during insertion of core member 2 into the machine frame , a larger radial gap will exist between the outer surfaces of key blocks 20 and spring bars 34 at the locations of plate members 30 . this facilitates insertion of core member 2 since each spring bar 34 is capable of being deflected radially outwardly at the location of each land 42 as each key block 20 moves therepast during core insertion . to allow for tolerance variations in the location of the bolt holes provided in spring bar 34 relative to the passages provided in key blocks 20 and key bars 8 , each spring bar 34 is provided , at the location where it is to be secured to each key block 20 and key bar 8 , with longitudinally elongated slots 44 , which may also be seen in fig5 . for supporting the heads of bolts 40 ( not shown in fig4 ), each spring bar 34 is provided , at the location of each associated key bar 20 , with a back - up plate 48 to support the compressive forces produced by bolts 40 . on each back - up plate 48 there is placed a locking plate 50 which is sufficiently thin to allow corners of plate 50 to be bent upwardly , after bolts 40 have been installed and tightened , in a manner to prevent loosening of bolts 40 . fig4 further shows key bar 8 provided with threaded passages 52 for threadedly engaging bolts 26 and 40 , while key block 20 is provided with countersunk passages 54 to receive the heads of bolts 26 . turning to fig5 which is a plan view of a portion of spring bar 34 , it will be seen that , in further accordance with the invention , spring bar 34 is provided with a narrowed region 58 between each location where spring bar 34 is secured to a respective key block 20 and each location where spring bar 34 is fastened to a respective flange 32 . this width of each region 58 determines the spring constant of spring bars 34 . this narrowed region further facilitates insertion of core 2 into the machine frame . preferably , for the same reason , the region of each spring bar 34 which is fastened to a flange 32 is somewhat narrower than each region thereof which is fastened to a key block 20 , in the circumferential direction of the machine . this provides an additional increase in the gap which will exist between each key block 20 and its associated spring bar 34 as the key block is being moved past the region of each flange 32 . during insertion of the completed core 2 into the machine frame , a certain clearance exists between the outer surfaces of key blocks 20 and the inner surfaces of spring bars 34 . after core 2 has reached the desired final position , the installation and tightening of bolts 40 will cause spring bars 34 to be deflected radially inwardly by a small amount to produce the desired secure engagement of core 2 to the machine frame . preferably , the clearance which exists during insertion of core 2 into the machine frame is selected so that the amount of radial deflection experienced by spring bars 34 during tightening of bolts 40 will correspond at least approximately to the radial expansion of core 2 as a result of heating during generator operation . thus , when the resulting generator is in operation , spring bars 34 can return to essentially a neutral , or undeformed , position . core 2 can be provided with stator windings either before or after insertion into the machine frame . a core assembly according to the present invention can be constructed in a separate stacking fixture provided with stacking keys that correspond in position to key bars 8 . preferably the stacking fixture is oriented so that the core is assembled with its longitudinal axis vertical . assembly is performed by the following sequence of operations . first , an exterior plate 12 and an interior plate 10 are placed on supports at the bottom of the fixture and stacking keys are disposed at locations corresponding to the intended locations of core grooves 6 . then the core laminations 4 are installed on the stacking keys . after all laminations have been installed , key bars 8 provided with bolts 16 can be installed by removing the stacking key from each groove 6 in turn and sliding a key bar 8 into that groove . then an interior plate 10 and an exterior plate 12 are place atop the assembled laminations and nuts are affixed to bolts 16 and tightened . finally , key blocks 20 are fastened to key bars 8 by means of bolts 26 . the resulting assembly can then be removed from the stacking fixture , ready to be installed in an associated frame . the details of a suitable stacking fixture according to the invention , which will be in the form of an upright cylinder provided with components which will engage in core grooves 6 , are illustrated in fig6 and 7 . fig6 is a cross - sectional view taken in a vertical plane and showing one component of such a stacking fixture . this component is in the form of an annular member 60 and the stacking fixture is made up of a plurality of members 60 stacked upon one another . each member 60 is composed of a lower ring 62 and an upper ring 64 , rings 62 and 64 being secured together by a plurality of vertical webs , or plates , 66 . the number of plates in each ring can be selected to provide the requisite load supporting capability . for positioning members 60 relative to one another , each upper ring 64 is provided with a suitable pin 68 which engages in a mating opening 70 in ring 62 of the overlying member 60 . a pin 68 and opening 70 are provided for circumferential alignment of members 60 . each ring 64 carries a plurality of brackets 72 , the number of brackets 72 on each ring 64 being equal to the number of grooves 6 in the outer circumference of core 2 . each bracket 72 is accurately positioned relative to its associated ring 64 by means of a positioning pin 74 and a bolt 76 . for engaging each groove 6 in the outer circumference of core 2 each vertically aligned group of brackets 72 supports a stacking key 78 by means of suitable bolts 80 . each stacking key 78 has a longitudinal extent corresponding to the axial dimension of core 2 . as shown in fig7 the side of each key 78 which will engage in a groove 6 tapers to an inner end which is narrower than the opening defined by the associated groove 6 at the periphery of core 2 . between bracket 72 and the tapered portion , key 78 has a constant width which corresponds to the width of the open end of groove 6 . this constant width portion of key 78 is dimensioned to extend at least a short distance into the associated groove 6 to facilitate positioning of the segments of each core lamination 4 . because of the configuration of each key 78 , installation of the core laminations is facilitated . specifically , each lamination need not be slid along the entire length of each key 78 but rather can be placed in approximately the desired position and then moved radially outwardly to bring each key 78 into engagement in a respective groove 6 . when the lamination segments are correctly positioned relative to stacking keys 78 , the base of each groove 6 will engage the inner end 82 of each key 78 . after core 2 has been completely assembled , each key 78 can easily be withdrawn from its respective slot 6 , by removing bolts 80 or 76 , after which a key bar 8 can be slid in turn into its associated groove 6 . after all key bars 8 have been inserted , plates 10 and 12 are placed atop the lamination stack , the nuts are tightened on bolts 16 and the completed core is ready to be lifted out of the stacking fixture and installed in the machine frame . while the description above refers to particular embodiments of the present invention , it will be understood that many modifications may be made without departing from the spirit thereof . the accompanying claims are intended to cover such modifications as would fall within the true scope and spirit of the present invention . the presently disclosed embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims , rather than the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .
| 7 |
referring now to the figures of the drawing in detail and first , particularly , to fig1 - 3 thereof , there is seen a radiation detector having a housing 1 , which is provided at the front side with a window 2 , in which optics 3 in the form of a fresnel lens are disposed . the optics 3 have an angle of coverage α 1 , which in this case is somewhat smaller than 180 °. the infrared radiation received in the region of the angle of coverage α 1 is focussed onto a sensor 4 by the optics 3 . in the present example , a frame 5 is stuck on top of the housing 1 , and could equally well be constructed to fit flush . as may be seen in particular from fig3 the frame 5 forms with the optics 3 a guide channel 7 , in which a masking element 6 can be inserted . in this process , the masking element 6 , which is preferably designed as strip - shaped film , is pushed into a sub - region 8 before the optics 3 , which are masked in an angular region α 3 . to the extent that the masking element 6 is opaque to infrared radiation , no radiation is fed to the sensor 4 in the region of the angle α 3 . if , however , the masking element 6 has only an attenuating effect , the infrared radiation received by the sensor 4 is reduced . the actual angle of coverage , with which the infrared detector receives the infrared radiation undiminished is thereby reduced to an angle of α 2 . according to the invention , the detector is provided on both sides with openings 9 , which lie in the end region of the optics 3 , and facilitate the insertion of the masking element 6 . in this way , it is possible to limit the horizontally extending angle of coverageαalternatively with a masking element 6 on one side , or with a masking element on each side . a second variant for the design of a guide channel 7 with the aid of a frame 5 is represented in fig5 to 8 . it may be seen in fig5 and 6 that the frame 5 is constructed flush at the housing 1 . in order to obtain the guide channel 7 which can be seen especially clearly in fig7 the frame 5 surrounding it is extended over the front side of the housing 1 into the region of its two side walls . with this solution , the part of the guide channel 7 extending into the region of the side walls can receive the masking element 6 in its entire length . it follows that in this embodiment the detector can be provided in principle with a masking element 6 , which is pushed into the region of the optics , however , only if required . for the purpose of easier manipulation when adjusting , the masking element 6 is provided at its end lying away from the window with a manipulator 11 , which can be gripped by the hand , or also a tool . as may be seen from fig7 and 8 , a stem , which protrudes from the plane of the masking element approximately at a right angle , serves as manipulator . in this connection , the manipulator 11 is narrower than the masking element 6 , so that a correspondingly narrow slot 10 suffices during displacement of the masking element to ensure the mobility of the stem 11 , or , on the other hand , to prevent the masking element 6 from falling out . note further that the manipulator 11 can also be arranged in the region of the window or at any other chosen point , provided only that its free mobility is ensured . a further alternative to the types of frame represented in the drawings is provided with a frame that can be fitted on top . no dedicated drawing has been produced for this purpose , because there is no change in the basic construction of the frame , or of the guide channel formed thereby , and the elements serving as channel formed thereby , and the elements serving to anchor the frame to the housing are generally known . such a separate frame can also be designed from flexible material , so that the frame can be pushed on to the housing by being stretched briefly . there is also no need to explain further that the frame must leave the parts of the housing freely , which because of their construction allow no masking . as fig4 shows , by appropriate design of the masking element 6 , the radiation detector can be even more universally adapted to its particular application . it can , for example , be desired that the masking element 6 could be entirely opaque for infrared radiation in the sub - region of the angle of coverage , or that it should , if necessary , only attenuate it . in order to obtain a definite attenuation , it can be necessary to work with films which absorb the infrared radiation very differently . in addition , it is by no means always necessary to have the same degree of absorption in the entire sub - region 8 . in order , therefore , to do justice to the possibly very different requirements , it would be necessary to have a broad range of differing masking elements 6 on hand , which would entail keeping a corresponding stock . however , according to the invention , this object can be relatively simply achieved in that only one film of relatively low absorption is held ready , and then the masking element 6 is obtained by laying one above the other several films having the desired infrared transparency . depending on the application , individual films 12 can be laid flush one above the other , or , as represented in fig4 be offset in steps relative to one another . in the last case , too , the strip - shaped films 12 can have the same length , and thereby be arbitrarily stepped . in order that the films 12 do not become mutually dislocated , it is possible to stick them on to a transparent carrier 13 . the carrier can be an infrared - transparent self - adhesive film , or also be provided as a special construction having a manipulator at its end . with a fresnel zone plate , wherein the individual steps of differing infrared transparency can be adapted to the width of the individual zones of the lens . the differing sensitivities in the border region of the optics can also be compensated hereby . the foregoing is a description corresponding in substance to german application p 37 44 182 . 5 , dated dec . 24 , 1987 , the international priority of which is being claimed for the instant application , and which is hereby made part of this application . any material discrepancies between the foregoing specification and the aforementioned corresponding german application are to be resolved in favor of the latter .
| 8 |
a description of structural embodiments and methods of the technology is provided . it is to be understood that there is no intention of limiting the invention to the specifically disclosed embodiments but that the invention may be practiced using other features , elements , methods and embodiments . like elements in various embodiments are commonly referred to with like reference numerals . fig1 shows an exploded perspective view of a mobile phone embodiment . the mobile phone 106 has a smart card socket 108 . the combined smart card / printed circuit board 104 is shaped to be placed physically into the smart card socket 108 . the combined smart card / printed circuit board 104 has electrical contact pads arranged to electrically couple with the electrical contact pads in the smart card socket 108 , when the combined smart card / printed circuit board 104 is placed physically into the smart card socket 108 . the battery 102 has a contactless communication antenna . the contactless communication antenna has electrical contact pads arranged to electrically couple with contactless communication electrical contact pads of the combined smart card / printed circuit board 104 , when the combined smart card / printed circuit board 104 is placed physically into the smart card socket 108 , and the battery 102 is placed in the mobile phone 106 . the housing of the mobile phone 106 includes a removable battery cover 100 . in an other embodiment , the contactless communication antenna is on the removable battery cover 100 . in such an embodiment , the contactless communication antenna has electrical contact pads arranged to electrically couple with contactless communication electrical contact pads of the combined smart card / printed circuit board 104 , when the combined smart card / printed circuit board 104 is placed physically into the smart card socket 108 , and the battery cover 100 is placed on the mobile phone 106 . fig2 and 3 show top and bottom views of a mobile phone smart card in some embodiments . the mobile phone smart card 210 has a set of electrical contact pads 212 to communicate data of the mobile phone smart card 210 . fig4 and 5 show top and bottom views of a printed circuit board embodiment . one side of a printed circuit board 420 has one set of electrical contact pads 422 arranged to connect with the smart card socket 108 of a mobile phone 106 . the opposite side of the printed circuit board 420 has two sets of electrical contact pads — the set of electrical contact pads 524 and 526 , and the set of electrical contact pads 528 . the set of electrical contact pads 528 is arranged to connect with a contactless communication antenna external to the printed circuit board 420 . the set of electrical contact pads 524 and 526 is arranged to connect with a mobile phone smart card 210 . the set of electrical contact pads 524 are “ pass through ” contact pads that carry the same signal as the respective one of the electrical contact pads 422 from one side to the other of the printed circuit board 420 . out of the set of electrical contact pads 524 and 526 , electrical contact pads 526 are electrically connected with the set of electrical contact pads 528 arranged to connect with a contactless communication antenna . out of the set of electrical contact pads 524 and 526 , electrical contact pads 524 are not electrically connected with the set of electrical contact pads 528 arranged to connect with a contactless communication antenna . in this embodiment , the mobile phone smart card includes contactless communication circuitry and therefore controls the contactless communication antenna . fig6 and 7 show top and bottom views , again , of a mobile phone smart card in some embodiments . the mobile phone smart card 210 has a set of electrical contact pads 212 to communicate data of the mobile phone smart card 210 . fig8 and 9 show top and bottom views of another printed circuit board embodiment . the printed circuit board 820 includes an integrated circuit 830 processing data of the smart card for wireless and contactless communication . one side of a printed circuit board 820 has one set of electrical contact pads 422 arranged to connect with the smart card socket 108 of a mobile phone 106 . the opposite side of the printed circuit board 820 has two sets of electrical contact pads — the set of electrical contact pads 942 and 944 , and the set of electrical contact pads 952 . the set of electrical contact pads 952 is arranged to connect with a contactless communication antenna external to the printed circuit board 820 . the set of electrical contact pads 942 and 944 is arranged to connect with a mobile phone smart card 210 . only some of the set of electrical contact pads 942 and 944 are “ pass through ” contact pads that carry the same signal as the respective one of the set of electrical contact pads 422 from one side to the other of the printed circuit board 820 , as can be seen by the limited number of traces 822 that connect to the set of electrical contact pads 422 and carry signals from one side to the other side of the printed circuit board 820 . the set of electrical contact pads 942 and 944 , are electrically connected to the integrated circuit 830 , as is evident from the traces 832 and the corresponding traces on the other side . out of the set of electrical contact pads 942 and 944 , electrical contact pads 944 are not directly electrically connected with the set of electrical contact pads 422 . the integrated circuit 830 controls : the electrical contact pads 944 arranged to connected to the mobile phone smart card 210 , and the set of electrical contact pads 952 arranged to connect with a contactless communication antenna . in other embodiments , the integrated circuit and the set of electrical contacts arranged to connect with an external contactless communication antenna switch sides . fig1 and 11 shows top and bottom views of a contactless communication antenna . the contactless communication antenna 1002 has electrical contact pads 1004 arranged to connect with a set of electrical contact pads on the printed circuit board arranged to connect with the contactless communication antenna ( e . g ., 528 in fig5 and 952 in fig9 ). the contactless communication antenna 1002 also has electrical traces 1005 and 1106 arranged according to the shape of the contactless communication antenna 1002 and the position of the electrical contact pads 1004 . fig1 and 13 shows top and bottom views of a contactless communication antenna . the contactless communication antenna 1202 has electrical contact pads 1204 arranged to connect with a set of electrical contact pads on the printed circuit board arranged to connect with the contactless communication antenna ( e . g ., 528 in fig5 and 952 in fig9 ). the contactless communication antenna 1202 also has electrical traces 1205 and 1306 arranged according to the shape of the contactless communication antenna 1202 and the position of the electrical contact pads 1204 . fig1 and 15 shows top and bottom views of a contactless communication antenna . the contactless communication antenna 1402 has electrical contact pads 1404 arranged to connect with a set of electrical contact pads on the printed circuit board arranged to connect with the contactless communication antenna ( e . g ., 528 in fig5 and 952 in fig9 ). the contactless communication antenna 1402 also has electrical traces 1405 and 1506 arranged according to the shape of the contactless communication antenna 1402 and the position of the electrical contact pads 1404 . fig1 and 17 shows top and bottom views of a battery with a contactless communication antenna . the batter 102 has a contactless communication antenna 1202 , with electrical contact pads of the contactless communication antenna 1202 folded to place the bulk of the contactless communication antenna and its contact pads on opposing sides of the battery 102 . fig1 shows example dimensions of the set of electrical contact pads on embodiments of the mobile phone smart card complying with iso 7816 . the distance between side walls of the chip card 20 or 100 from a left edge 112 and an upper edge 114 are also shown . a typical sim card slot is capable of holding a typical sim card , which has second size dimensions with a plug - in size of about 25 mm long and 15 mm wide , and less than 1 mm thick . a plug - in sim card size is for example less than 1 mm thick . example “ mini - sized ” sim cards have size dimensions of 15 mm long , 12 mm wide , and less than 1 mm thick . the sim card includes at least a subset of contact pads compliant with iso 7816 - 2 , which includes contact pads 1 - 8 ( c 1 - c 8 ), defined according to iso 7816 as follows . the contact pads c 1 , c 2 , c 3 , c 5 , c 6 , c 7 have been assigned as interface pins for use with the functions as described in table 1 . two of the contact pads , c 4 and c 8 , are listed as reserved for future use . in one embodiment , the contact pads c 4 and c 8 are used to drive a contactless communication antenna or communicate data for use with a contactless communication antenna . in another embodiment , extra contact pads are added to drive a contactless communication antenna or communicate data for use with a contactless communication antenna .
| 7 |
the method for fabricating the semiconductor device according to one embodiment of the present invention will be explained with reference to fig1 a to 12 . fig1 a to 5c are sectional views of a semiconductor device in the steps of the method for fabricating the same according to the present embodiment , which show the method . fig6 a and 6b are pictures of sectional configurations formed by etching the resist film with nh 3 gas . fig7 is a graph of the oxygen flow rate ratio dependency of the bowing amount in the etching with n 2 / o 2 gas . fig8 a and 8b are pictures of sectional configurations formed by etching the resist film with an oxygen gas or a mixed gas of oxygen and nitrogen . fig9 a and 9b are sectional configurations of the resist film etched under low chamber internal pressure and under high chamber internal pressure . fig1 a - 10c are sectional configurations formed by etching the resist film with n 2 / o 2 gas . fig1 is a graph of the oxygen flow rate ratio dependency of the bowing amount in the etching with n 2 / o 2 / c 4 f 6 gas . fig1 is a sectional configuration formed by etching the resist film with n 2 / o 2 / c 4 f 6 gas . before the present invention is specifically described , the method for fabricating the semiconductor device the present invention is applied to will be explained with reference to fig1 a to 5c . first , an sic film 14 a of , e . g ., a 50 nm - thick , an sioc film 14 b of , e . g ., a 250 nm - thick , an sic film 14 c of , e . g ., a 30 nm - thick , an sioc film 14 d of , e . g ., a 200 nm - thick , an sio film 14 e of , e . g ., a 100 nm - thick and an sin film 14 f of , e . g ., a 50 nm - thick are sequentially deposited by , e . g ., cvd method on an inter - layer insulating film 10 with an interconnection 12 of mainly copper buried in ( fig1 a ). an inter - layer insulating film 14 of these films is thus formed . the sic film 14 a , the sic film 14 c and the sin film 14 f are used respectively as a barrier layer , an intermediate stopper layer and a hard mask . the inter - layer insulating film 10 is formed on a semiconductor substrate with devices , such as transistors , etc ., formed on . next , on the inter - layer insulating film 14 , a resist film 16 a of an organic resist material of , e . g ., a 500 nm - thick , an sog film 16 b of , e . g ., a 100 nm - thick , a barc film 16 of , e . g ., a 82 nm - thick and a resist film 16 d of , e . g ., a 300 nm - thick are formed by , e . g ., spin coating method . a multilayer resist film 16 of these films is thus formed on the inter - layer insulating film 14 . the resist film 16 a is the resist film for etching the inter - layer insulating film 14 , the sog film 16 b is the hard mask for patterning the resist film 16 a , and the barc film 16 c is an organic anti - reflection film , and the resist film 16 d is , e . g ., a photosensitive arf photoresist . then , the resist film 16 d is patterned by photolithography to remove the resist film 16 d in the region for a via - hole to be formed in ( fig1 b ). then , with the resist film 16 d as the mask , the barc film 16 c and the sog film 16 b are anisotropically etched to transfer the pattern of the resist film 16 d onto the sog film 16 b ( fig1 c ). the barc film 16 c and the resist film 16 b are anisotropically etched , e . g ., by a reactive plasma etching system under a 50 mtorr chamber internal pressure , at a 300 w power , with cf 4 as the etching gas , at a 100 sccm cf 4 flow rate , and for a 60 second etching period of time . then , with the sog film 16 b as the mask , the resist film 16 a is dry etched to remove the resist film 16 a in the region for a via - hole to be formed in ( fig2 a ). the barc film 16 c and the resist film 16 d on the sog film 16 b are removed in this etching . the resist film 16 a is anisotropically etched , e . g ., by , a reactive plasma etching system under a 20 mtorr chamber internal pressure , at a 200 w power , with n 2 / h 2 as the etching gas , at a 200 / 200 sccm n 2 / h 2 flow rate , and for a 200 second etching period of time . then , with the resist film 16 a as the mask , the sin film 14 f , the sio film 14 e , the sioc film 14 d , the sic film 14 c and the sioc film 14 b are anisotropically etched to open the via - hole 18 down to the sic film 14 a ( fig2 b ). the sog film 16 b on the resist film 16 a is removed in this etching . the sin film 14 f , the sio film 14 e , the sioc film 14 d , the sic film 14 c and the sioc film 14 b are anisotropically etched , e . g ., by reactive plasma etching system , under a 35 mtorr chamber internal pressure , at a 1000 w power , with c 5 f 8 / ar / o 2 as the etching gas , a 10 / 500 / 12 sccm c 5 f 8 / ar / o 2 flow rate , and a 40 second etching period of time . then , the resist film 16 a is removed by ashing ( fig2 c ). the resist film 16 a is ashed by a plasma ashing system , e . g ., under a 10 mtorr chamber internal pressure , at a 300 w power , with o 2 as the ashing gas , at a 300 sccm o 2 flow rate , and a 48 second ashing period of time . next , a resist film 20 a of an organic resist material of , e . g ., a 500 nm - thick is formed by , e . g ., spin coating method . the resist film 20 a is formed , filling the via - hole 18 ( fig3 a ). preferably , the surface of the resist film 20 a is flat , because films to be formed on the resist film 20 a can be flat , which permits photolithography to be performed without considering the problem of the depth of focus . then , an sog film 20 b of , e . g ., a 100 nm - thick , a barc film 20 c of , e . g ., a 82 nm - thick and a resist film 20 d of , e . g ., a 300 nm - thick are formed on the resist film 20 a by , e . g ., spin coating method . on the sin film 14 f , a multilayer resist film 20 of thus formed the resist film 20 a , the sog film 20 b , the barc film 20 c and the resist film 20 d is formed . the resist film 20 a is the resist film to be used in etching the inter - layer insulating film 14 , the soc film 20 b is to be used as the hard mask for patterning the resist film 20 a , the barc film 20 is an anti - reflection film , and the resist film 20 d is , e . g ., a photosensitive arf photoresist . then , the resist film 20 d is patterned by photolithography to move the resist film 20 d in the region for an interconnection trench to be formed in ( fig3 b ). next , with the resist film 20 d as the mask , the barc film 20 and the sog film 20 b are anisotropically etched to transfer the pattern of the resist film 20 d onto the sog film 20 b ( fig4 a ). the barc film 20 c and the sog film 20 b are anisotropically etched , e . g ., by a reactive plasma etching system , under a 50 mtorr chamber internal pressure , at a 300 w power , with cf 4 as the etching gas , at a 100 sccm cf 4 flow rate , and a 60 second etching period of time . then , with the sog film 20 b as the mask , the resist film 20 a is dry etched to remove the resist film 20 a in the region for the interconnection trench to be formed in . at this time , the resist film 20 a is left in the via - hole 18 ( fig4 b ). the barc film 20 c and the resist film 20 d on the sog film 20 b are removed in this etching . the resist film 20 a is anisotropically etched by , e . g ., a reactive plasma etching system , e . g ., under a 35 mtorr chamber internal pressure , at a 100 w power , with n 2 / o 2 as the etching gas and at a 290 / 10 sccm n 2 / o 2 flow rate , or , e . g ., under a 40 mtorr chamber internal pressure , at a 150 w power , with n 2 / o 2 / c 4 f 6 as the etching gas and a 250 / 50 / 5 sccm n 2 / o 2 / c 4 f 6 flow rate . as will be described later , this etching step mainly characterizes the present invention . then , with the resist film 20 a as the mask , the sin film 14 f and the sio film 14 e are anisotropically etched to remove the sin film 14 and the sio film 14 e in the region for an interconnection trench to be formed in . the sin film 14 f is anisotropically etched , e . g ., by a reactive plasma etching system , under a 40 mtorr chamber internal pressure , at a 200 w power , with chf 3 / ar / o 2 as the etching gas , at a 20 / 200 / 10 sccm chf 3 / ar / o 2 flow rate . the sio film 14 e is anisotropically etched , e . g ., by a reactive plasma etching system under a 60 mtorr chamber internal pressure , at a 200 w power , with c 4 f 6 / ar / o 2 as the etching gas and at a 30 / 400 / 20 sccm c 4 f 6 / ar / o 2 flow rate . next , with the resist film 20 a as the mask and the sic film 14 c as the stopper , the sioc film 14 d is anisotropically etched to form the interconnection trench 22 in the sioc film 14 c . the sog film 20 b on the resist film 20 a is removed by this etching . the sioc film 14 d is anisotropically etched , e . g ., by a reactive plasma etching system under a 35 mtorr chamber internal pressure , at a 100 w power , with n 2 / o 2 as the etching gas , at a 290 / 10 sccm n 2 / o 2 flow rate and a 200 second etching period of time . then , the resist film 20 a is removed by ashing . the resist film 20 a is ashed by a plasma ashing system , e . g ., under a 10 mtorr chamber internal pressure , at a 300 w power , with o 2 as the ashing gas , at a 300 sccm o 2 flow rate and a 48 second ashing period of time . next , the sic film 14 a on the bottom of the via - hole 18 is anisotropically etched to open the via - hole 18 down to the interconnection 12 ( fig5 a ). the sic film 14 a is anisotropically etched , e . g ., by a reactive plasma etching system , under a 50 mtorr chamber internal pressure , at a 400 w power , with ch 2 f 2 / ar / o 2 as the etching gas and at a 20 / 200 / 25 sccm ch 2 f 2 / ar / o 2 flow rate . then , a barrier metal and a cu seed are deposited by sputtering , and then cu plating is performed . thus , the via - hole 18 and the interconnection trench 22 are filled with a barrier metal 24 and a cu film 26 ( fig5 b ). next , the cu film 26 and the barrier metal 24 are polished by cmp method to leave the cu film 26 and the barrier metal 24 selectively in the via - hole 18 and the interconnection trench 22 . thus , an interconnection 28 formed of the barrier metal 24 and the cu film 26 and connected to the interconnection 12 is formed in the via - hole 18 and the interconnection trench 22 ( fig5 c ). hereafter , as required , interconnection layers are repeatedly formed on the interconnection 28 to fabricate a semiconductor device having the multi - level interconnections . the present invention is characterized mainly in that in the above - described method for fabricating the semiconductor device , n 2 / o 2 gas or n 2 / o 2 / cf gas is used as the etching gas for etching the resist film 20 a in the step illustrated in fig4 b . conventionally , nh 3 and n 2 / h 2 have been predominantly used in etching organic resist films used as the mask for etching inter - layer insulating films . however , the earnest studies of the inventors of the present application have found that in the above - described method for fabricating the semiconductor device , etching the resist film 20 a with nh 3 or n 2 / h 2 in the step of fig4 b generates cracks down to the inter - layer insulating film 10 . fig6 a - 6c are pictures of sectional configurations formed by etching the resist film 20 a with nh 3 as the etching gas , which were taken by a scanning electron microscope . fig6 a is the sectional configuration immediately after the resist film 20 a has been etched . fig6 b is the sectional configuration immediately after the sin film 14 f and the sio film 14 e have been etched . fig6 c is the sectional configuration immediately after the interconnection trench 22 has been formed and before the ashing . as seen in fig6 a , immediately after the resist film 20 a has been etched , a crack ( circled in the drawing ) is observed between the resist film 20 a and the side wall of the via - hole 18 . the crack is increased after the sin film 14 f and the sio film 14 e have been etched ( see fig6 b ). then , after the interconnection trench 22 has been formed , the crack is further increased down to even the inter - layer insulating film 10 with the interconnection layer 12 buried in ( fig6 c ). there is the risk that such crack will much affect the reliability of the semiconductor device , and the generation of the crack must be prevented . the mechanism that the crack is generated between the resist film 20 a and the side wall of the via - hole 18 is not clear , but the etching gas of nh 3 and n 2 / h 2 will make some action to the interface between the resist film 20 a and the side wall of the via - hole 18 to thereby lower the adhesion therebetween . in such background , the inventors of the present application have made earnest studies of the etching conditions for the resist film 20 a to be the first to find that n 2 / o 2 or n 2 / o 2 / cf is used as the etching gas , and the chamber internal pressure and the etching gas flow rate are suitably controlled , whereby the generation of cracks between the resist film 20 a and the side wall of the via - hole 18 can be prevented , and the resist film 20 a can be etched in a good vertical processed configuration . the etching conditions the inventors of the present application have found will be detailed below . in the multilayer resist process , generally a lower resist film is processed by using oxygen gas only . in etching a lower resist film by using oxygen gas , the horizontal etching also tends to go on , and the resist film is processed in a bowing configuration . such bowing configuration does not matter when a pattern size of a semiconductor device is relatively large . however , in processing a fine pattern , such bowing configuration is a problem , such bowing configuration is an obstacle to accurate processing of the fine pattern . then , the inventors of the present application studied whether the etching with oxygen gas can be applied to the etching of the resist film 20 a in the above - described method for fabricating the semiconductor device and additionally means for preventing the bowing configuration . resultantly , n 2 / o 2 or n 2 / o 2 / cf gas was used as the etching gas , and the chamber internal pressure and the etching gas flow rate were suitably controlled , whereby the resist film 20 a could be etched into a good vertical processed configuration , and the generation of cracks between the resist film 20 a and the side wall of the via - hole 18 could be prevented . fig7 is a graph of the oxygen flow rate ratio dependency of the bowing amount of the etching with n 2 / o 2 gas . the bowing amounts are taken on the vertical axis , and the bowing amounts were determined by b - a in which a indicates an opening width of the mask , and b indicates a maximum width of an opening formed in the resist film 20 a by using the mask . flow rate ratios (%) of oxygen gas to a total gas flow rate are taken on the horizontal axis . the flow rate ratios of the oxygen gas were adjusted by diluting the oxygen gas with nitrogen gas . the other etching conditions were a 35 mtorr chamber internal pressure , a 100 w power and a 300 sccm total flow rate of n 2 and o 2 , which were fixed . as shown , the bowing amount is decreased by lowering the flow rate ratio of the oxygen gas . when the flow rate ratio of the oxygen gas is below 10 %, the bowing amount is drastically decreased to about 5 nm at 5 % and to about 2 nm at 1 - 3 %. a gas to be mixed with the oxygen gas is preferably nitrogen . mixing , e . g ., argon in place of nitrogen cannot suppress the bowing . although the mechanism for this is not clear , the nitrogen will be acting to protect the side wall of the processed part . fig8 a is a picture of the sectional configuration formed by etching the resist film 20 a with oxygen gas only , which was taken by a scanning electron microscope . the etching conditions were a 80 mtorr chamber internal pressure , a 100 w power and a 250 sccm o 2 flow rate . as shown , the resist film 20 a is bowed unsuitably for the downsizing . fig8 b is a picture of the sectional configuration formed by etching the resist film 20 a with a mixed gas of oxygen and nitrogen , which was taken by a scanning electron microscope . the etching conditions were a 35 mtorr chamber internal pressure , a 100 w power and a 290 / 10 sccm n 2 / o 2 flow rate ( oxygen flow rate ratio : 3 . 3 %). as shown , the resist film 20 a was processed vertically without bowing configuration . no crack is generated between the resist film 20 a and the via - hole 18 . the processed configuration of the resist film 20 a is changed depending on the chamber internal pressure . fig9 a is a picture of the sectional configuration formed by etching the resist film 20 a with a mixed gas of oxygen and nitrogen under low pressure , which was taken by a scanning electron microscope . the etching conditions other than a 15 mtorr chamber internal pressure were the same as the case of fig8 b . as shown , even with the etching gas with nitrogen added to , under a low chamber internal pressure of 15 mtorr , the so - called sub - trench configuration , which has a groove formed on the bottom peripheral part of a trench and a hole deeper than the bottom center thereof , is formed , which affects the later etching . fig9 b is a picture of the sectional configuration formed by etching the resist film 20 a under high pressure and with a mixed gas of oxygen and nitrogen , which was taken by a scanning electron microscope . the etching conditions other than a 150 mtorr chamber internal pressure were the same as the case of fig8 b . as shown , with the chamber internal pressure as high as 150 mtorr , the resist film 20 a is bowed unsuitably for the downsizing . when n 2 / o 2 is used as the etchant for the resist film 20 a , the flow rate ratio of the oxygen gas is less than 10 %, preferably not more than 5 %, more preferably 1 - 3 %. the upper limit value of the flow rate ratio of the oxygen gas can be suitably set in accordance with an allowable bowing amount . the etching rate is lowered by lowing the flow rate ratio of the oxygen gas , and the lower limit value of the flow rate ratio of the oxygen gas can be suitably set in accordance with a prescribed etching rate . it is preferable to set the chamber internal pressure at 25 - 50 mtorr , more preferably , at 30 - 40 mtorr . this is because under a pressure less than 25 mtorr , the etching rate of the resist film 20 a is extremely low , and often the sub - trench configuration shown in fig9 a is formed . on the other hand , under a pressure of above 50 mtorr , the effect of adding oxygen is enhanced , and the bowing configuration shown in fig9 b tends to be formed . fig1 a - 10c are pictures of sectional configurations formed by etching the resist film 20 a with n 2 / o 2 gas , which were taken by a scanning electron microscope . fig1 a is the sectional configuration immediately after the resist film 20 a has been etched . fig1 b is the sectional configuration immediately after the sin film 14 f and the sio film 14 e have been etched . fig1 c is the sectional configuration after the interconnection trench 22 has been formed , and ashing has been performed . as seen in fig1 a , immediately after the resist film 20 a has been etched , no crack is generated between the resist film 20 a and the side wall of the via - hole 18 . the processed configuration of the resist film 20 a is vertical . no crack is generated after the sin film 14 f and the sio film 14 e have been etched ( fig1 b ) and after the interconnection trench has been formed ( fig1 c ). as the etching gas for the resist film 20 a , n 2 / o 2 / cf gas other than n 2 / o 2 gas can be used . cf gas ( fluorocarbon gas ), which forms a protection film on the side wall of an etched part , is expected to prevent the bowing . the use of cf gas can enlarge the process window for etching the resist film 20 a . as the cf gas can be used c x f y or ch a f b used in the usual semiconductor process , more specifically , c 3 f 6 , c 4 f 8 , c 4 f 6 , c 5 f 8 , ch 2 f 2 , chf 3 , ch 3 f or others . fig1 is a graph of the oxygen flow rate ratio dependency of the bowing amount of the etching with n 2 / o 2 / c 4 f 6 gas . the bowing amounts are taken on the vertical axis , and the bowing amounts were determined by b - a in which a indicates an opening width of the mask , and b indicates a maximum width of an opening formed in the resist film 20 a by using the mask . flow rate ratios of oxygen gas (%) to a total gas flow rate are taken on the horizontal axis . the flow rate ratio of the oxygen gas is adjusted by the flow rate of the nitrogen gas . the specific etching conditions are a 35 mtorr chamber internal pressure , a 100 w power , a 60 sccm flow rate of c 4 f 6 as the cf gas , a 300 sccm total flow rate of the n 2 , o 2 and c 4 f 6 , which were fixed . as shown , the bowing amount is decreased by lowering the flow rate ratio of the oxygen gas . when the flow rate ratio of the oxygen is below 12 %, the bowing amount is drastically decreased to about 6 nm at 7 % and to about 1 nm at 3 - 5 %. fig1 is a picture of the sectional configuration of the resist film 20 a etched with n 2 / o 2 / c 4 f 6 , which was taken by a scanning electron microscope . the etching conditions were a 35 mtorr chamber internal pressure , a 100 w power and a 250 / 5 / 50 sccm of n 2 / o 2 / c 4 f 6 flow rate ( oxygen flow rate ratio : about 1 . 6 %). as shown , the processed configuration of the resist film 20 a is vertical , and no bowing configuration is generated . no crack is generated even between the resist film 20 a and the via - hole 18 . when n 2 / o 2 / cf is used as the etching gas for the resist film 20 a , the flow rate ratio of the oxygen gas is less than 12 %, preferably not more than 7 %, more preferably not more than 5 %. the upper limit value of the flow rate ratio of the oxygen gas is suitably set in accordance with an allowed bowing amount . the etching rate is lowered by lowering the flow rate ratio of the oxygen gas , and the lower limit value of the flow rate ratio of the oxygen gas can be suitably set in accordance with a required etching rate . it is preferable to set the flow rate ratio of the cf gas at 15 - 25 %. this is because when the flow rate ratio of the cf gas is less than 15 %, the effect of forming the protection film is insufficient , and when the flow rate ratio of the cf gas is more than 25 %, an organic resist film used as the mask ( sog film 20 b ) is etched . thus , when the resist film 20 a is etched with n 2 / o 2 as the etching gas , the flow rate ratio of the oxygen gas is set at less than 10 %, preferably not more than 5 %, more preferably 1 - 3 %. the chamber internal pressure is set at 25 - 50 mtorr , more preferably 30 - 40 mtorr . when n 2 / o 2 / cf is used as the etching gas , the flow rate ratio of the oxygen gas is set at less than 12 %, preferably not more than 7 %, more preferably not more than 5 %. the flow rate ratio of the cf gas is set at 15 - 25 %. thus , the generation of cracks between the resist film 20 a and the side wall of the via - hole 18 can be prevented , and the resist film 20 a can be etched in good vertical processed configuration . as described above , according to the present embodiment , in the dual damascene process of the preceding via mode using a multilayer resist , n 2 / o 2 gas or n 2 / o 2 / cf gas is used in etching a lower resist film for forming an interconnection trench , whereby the generation of cracks between the lower resist film buried in a via - hole and the inter - layer insulating film can be prevented . the processed configuration of the lower resist film can be made vertical . the present invention is not limited to the above - described embodiment and can cover other various modifications . for example , in the above - described embodiment , the present invention is applied to the steps of forming the interconnection trench in the dual damascene process of the preceding via mode using a multilayer resist , but may be applied to other steps . for example , the present invention may be applied to the step of forming the via - hole 18 shown in fig2 a . the etching method of the present invention is used to thereby vertically process the resist film 16 a suitably for forming fine patterns . in the above - described embodiment , the interconnection is buried in the inter - layer insulating film of sin / sio / sioc / sic / sioc / sic structure by the dual damascene , but the materials forming the inter - layer insulating film and the layer structure thereof are not limited to the above .
| 7 |
the following definitions are provided in order to aid those skilled in the art in understanding the detailed description of the present invention . the term “ alloantigens ” refers to antigens of an individual that are responsible for eliciting an alloimmune response . the phrase “ alloimmune response ” refers to an immune response , which occurs when antibodies from one individual react against antigens of a different individual of the same species . the phrase “ anti - idiotypic antibodies ” refers to antibodies which can bind endogenous or foreign idiotypic antibodies and which can be used to treat or prevent pathological conditions associated with an immune response to a foreign alloantigen . the phrase “ gov a / gov b biallelic system ” refers to a system of human platelet alloantigens in which an individual can be homozygous for either gov a or gov b allelic forms of cd 109 , or an individual can be gov a / gov b heterozygous for cd109 . “ nucleic acid ” includes dna and rna , whether single or double stranded . the term is also intended to include a strand that is a mixture of nucleic acids and nucleic acid analogs and / or nucleotide analogs , or that is made entirely of nucleic acid analogs and / or nucleotide analogs . “ nucleic acid analogue ” refers to modified nucleic acids or species unrelated to nucleic acids that are capable of providing selective binding to nucleic acids or other nucleic acid analogues . as used herein , the term “ nucleotide analogues ” includes nucleic acids where the internucleotide phosphodiester bond of dna or rna is modified to enhance biostability of the oligomer and “ tune ” the selectivity / specificity for target molecules ( ulhmann , et al ., 1990 , angew . chem . int . ed . eng ., 90 : 543 ; goodchild , 1990 , j . bioconjugate chem ., i : 165 ; englisch et al ., 1991 , angew , chem . int . ed . eng ., 30 : 613 ). such modifications may include and are not limited to phosphorothioates , phosphorodithioates , phosphotriesters , phosphoramidates or methylphosphonates . the 2 ′- o - methyl , allyl and 2 ′- deoxy - 2 ′- fluoro rna analogs , when incorporated into an oligomer show increased biostability and stabilization of the rna / dna duplex ( lesnik et al ., 1993 , biochemistry , 32 : 7832 ). as used herein , the term “ nucleic acid analogues ” also include alpha anomers ( α - dna ), l - dna ( mirror image dna ), 2 ′- 5 ′ linked rna , branched dna / rna or chimeras of natural dna or rna and the above - modified nucleic acids . for the purposes of the present invention , any nucleic acid containing a “ nucleotide analogue ” shall be considered as a nucleic acid analogue . backbone replaced nucleic acid analogues can also be adapted to for use as immobilised selective moieties of the present invention . for purposes of the present invention , the peptide nucleic acids ( pnas ) ( nielsen et al , 1993 , anti - cancer drug design , 8 : 53 ; engels et al ., 1992 , angew , chem . int . ed . eng ., 31 : 1008 ) and carbamate - bridged morpholino - type oligonucleotide analogs ( burger , d . r ., 1993 , j . clinical immunoassay , 16 : 224 ; uhlmann , et al ., 1993 , methods in molecular biology , 20 ,. “ protocols for oligonucleotides and analogs ,” ed . sudhir agarwal , humana press , nj , u . s . a ., pp . 335 - 389 ) are also embraced by the term “ nucleic acid analogues ”. both exhibit sequence - specific binding to dna with the resulting duplexes being more thermally stable than the natural dna / dna duplex . other backbone - replaced nucleic acids are well known to those skilled in the art and may also be used in the present invention ( see e . g ., uhlmann et al 1993 , methods in molecular biology , 20 , “ protocols for oligonucleotides and analogs ,” ed . sudhir agrawal , humana press , nj , u . s . a ., pp . 335 ). the standard , one - letter codes “ a ,” “ c ,” “ g ,” and “ t ” are used herein for the nucleotides adenylate , cytidylate , guanylate , and thymidylate , respectively . the skilled will understand that , in dnas , the nucleotides are 2 ′- deoxyribonucleotide - 5 ′- phosphates ( or , at the 5 ′- end , possibly triphosphates ) while , in rnas , the nucleotides are ribonucleotide - 5 ′- phosphates ( or , at the 5 ′- end , possibly triphosphates ) and uridylate ( u ) occurs in place of t . “ n ” means any one of the four nucleotides . on occasion herein , da , dc , dg and dt might be used for the respective 2 ′- deoxyribonucleotides . unless otherwise specified or required by the context , “ nucleic acid ” means dna or rna and “ nucleotide ” means ribonucleotide or 2 ′- deoxyribonucleotide . reference herein to a “ full - length ” cd109 molecule or protein means the 1445 - amino acid - long polypeptide , for which the amino acid sequence , deduced from a cdna sequence , is provided in seq id no : 1 and in seq id no : 3 and which is denoted as the full - length translated product ( i . e ., including the amino - terminal leader peptide , and excluding carboxyl - terminal processing associated with gpi anchor addition ). the gov a alloantigen bearing form of cd109 may be referred to herein as 703 tyr cd109 . the gov b alloantigen bearing form of cd109 may be referred to herein as 703 ser cd109 . it has been determined that a single nucleotide of the cd109 gene is responsible for the gov polymorphism in cd109 . extensive serological studies initially demonstrated that the polymorphism underlying the gov system resides solely on the cd109 molecule [ sutherland , d . r . ( 1991 ); smith et al . ( 1995 )]. further , extensive deglycosylation of cd109 does not affect the binding the anti - gov a and anti - gov b antibodies to molecules of the appropriate phenotype , or to cells bearing the appropriate cd109 variant , indicating that carbohydrate residues are not involved in the formation of gov antigenic epitopes . further work has indicated that the gov allele - specific antibody binding can however , be abrogated by denaturation of cd109 with the detergent sds [ smith et al . ( 1995 )]. taken together , these observations indicate that the gov alleles of cd109 are protein epitopes that are likely defined by the primary amino acid sequence of cd109 . following the isolation of a cd109 cdna the nature of the two gov alleles was characterised further using platelet rna - derived cdna in the polymerase chain reaction (“ pcr ”). platelet mrna transcripts were obtained from serologically defined gov a / a , gov a / b and gov b / b individuals . the rna was then converted to cdna , and the entire cd109 cdna coding region was then amplified as a series of overlapping pcr products . the gov a [ seq id no : 1 ] and gov b [ seq id no : 3 ] alleles differ by an a to c substitution at position 2108 of the coding region of the cd109 cdna . this single nucleotide polymorphism also results in a bstni restriction site in the gov b allele that is not present in its gov a counterpart . on the basis of this bstni site , gov a can by distinguished from gov b by restriction fragment length polymorphism ( rflp ) analysis . this single nucleotide polymorphism can also be detected by sscp analysis , and by allele - specific hybridization studies , including “ real - time ” pcr analyses . as a result of this a 2108 c single nucleotide polymorphism , the gov a allele [ seq id no : 2 ] of cd109 contains a tyr at position 703 of the full - length protein , while the gov b allele [ seq id no : 4 ] contains a ser in this position . the polymorphism does not alter the ability of gov a and gov b homozygous platelets to adhere to collagen types i , iii and v . additionally , the binding of anti - gov a and ant - gov b antibodies to platelets of the appropriate phenotype did not interfere with platelet adhesion to any of the above collagen types . thus , while the tyr 703 ser results in the formation of the gov alloantigen epitopes , it does not appear to impair platelet function . identification and characterisation of the gov alloantigen system permits pre - and post - natal diagnosis of the gov phenotype of an individual , providing a warning for the possibility of natp , ptp and ptpr . allelic gov typing of cd109 equates with the gov status of the cd109 protein of an individual . the gov system led to diagnostic and therapeutic strategies to avoid or control diseases that result from gov incompatibility . the present invention can be applied to these tasks and goals in a variety of ways , illustrative examples of which are discussed below . for example , an oligonucleotide probe can be synthesized , in accordance with the present invention , that will hybridize to a cdna segment , derived from cd109 mrna , that contains the nucleotide g at polymorphic nucleotide 2108 ( nucleotide = guanylate ). alternatively , an oligonucleotide probe can be synthesized that will hybridize with a cd109 cdna segment containing the base adenine at nucleotide 2108 . ( nucleotide = adenylate ). these allele - specific probes can be appropriately labelled and added to the generated cdna segments under annealing conditions , such that only one of the allele - specific probes hybridizes and can be detected , thereby identifying the specific gov a or gov b allele . in accordance with conventional procedures , the design of an oligonucleotide probe according to the present invention preferably involves adjusting probe length to accommodate hybridization conditions ( temperature , ionic strength , exposure time ) while assuring allele - specificity . a length of ten to thirty nucleotides is typical . diagnostic kits can also be used , in accordance with the present invention , for the determination and diagnosis of alloantigen phenotypes via the procedures described herein . such a kit can include , among others , antibodies or antibody fragments to an antigenic determinant expressed by either of the above - described gov a - and gov b - encoding sequences . these antibodies would react with the blood sample of an individual so as to indicate whether that individual has a gov a or gov b phenotype . alternatively , all the reagents required for the detection of nucleotide ( s ) that distinguish the gov alloantigens , by means described herein , can be provided in a single kit that uses isolated genomic dna , platelet ( or other cellular ) mrna or total rna , or corresponding cdna from an individual . a kit containing a labelled probe that distinguishes , for example , nucleotide 2108 of cd109 can be utilised for gov alloantigen genotyping and phenotyping . a further beneficial use of the nucleotide sequences that distinguish the gov a allele from the gov b allele is to obtain or synthesize the respective expression product , in the form of a peptide or polypeptide , encoded by these nucleotide sequences . these polypeptides can be used to generate antibodies for diagnostic and therapeutic uses , for example , with regard to pathological conditions such as ptp , ptpr or natp . these polypeptides can also be used diagnostically to detect the presence of gov a or gov b specific antibodies in patient plasma or serum , or used therapeutically ( see below ; assays may be adopted , for example , from u . s . pat . no . 5 , 851 , 788 ). a polypeptide within the present invention which can be used for the purpose of generating such antibodies preferably comprises an amino - acid sequence that corresponds to ( i . e ., is coincident with or functionally equivalent to ) a fragment of the cd109 molecule that includes amino acid 703 . when amino acid 703 is tyrosine , the polypeptide can be used , as described above , to produce antibodies that specifically bind the gov a form of cd109 ; in contrast , when it is serine , antibodies can be obtained that specifically recognise the gov b form . the class of polypeptides thus defined , in accordance with the present invention , is not intended to include the native cd109 molecule , but does encompass fragments of the molecule , as well as synthetic polypeptides meeting the aforementioned definition . although the length of a polypeptide within this class is not critical , the requirement for immunogenicity may require that the polypeptide be attached to an immunogenicity - imparting carrier . such carriers include a particulate carrier such as a liposome or a soluble macromolecule ( protein or polysaccharide ) with a molecular weight in the range of about 10 , 000 to 1 , 000 , 000 daltons additionally , it may be desirable to administer the polypeptide with an adjuvant , such as complete freund &# 39 ; s adjuvant for artificial polypeptides , as distinguished from cd109 fragments , maximum length is determined largely by the limits of techniques available for peptide synthesis , which are currently about fifty amino acids . thus , a synthetic polypeptide of the present invention is preferably between four to about fifty amino acids in length . in the context of the present invention , the term “ antibody ” encompasses monoclonal and polyclonal antibodies produced by any available means . such antibodies can belong to any antibody class ( igg , igm , iga , etc .) and may be chimeric . examples of the preparation and uses of polyclonal antibodies are disclosed in u . s . pat . nos . 5 , 512 , 282 , 4 , 828 , 985 , 5 , 225 , 331 and 5 , 124 , 147 which are incorporated by reference in their entirety the term “ antibody ” also encompasses antibody fragments , such as fab and f ( ab ′) 2 fragments , of anti - gov a or anti - gov b antibodies , conjugates of such fragments , and so - called “ antigen binding proteins ” ( single - chain antibodies ) which are based on anti - gov a or anti - gov b antibodies , in accordance , for example , with u . s . pat . no . 4 , 704 , 692 , the contents of which are hereby incorporated by reference . alternatively , monoclonal antibodies or fragments thereof within the present invention can be produced using conventional procedures via the expression of isolated dna that encodes variable regions of such a monoclonal antibody in host cells such as e . coli ( see , e . g ., ward et al ., nature , 341 : 544 - 546 ( 1989 )) or transfected murine myeloma cells ( see gillies et al ., biotechnol . 7 : 799 - 804 ( 1989 ); nakatani et al ., biotechnol . 7 : 805 - 810 ( 1989 )). for additional examples of methods of the preparation and uses of monoclonal antibodies , see u . s . pat . nos . 5 , 688 , 681 , 5 , 688 , 657 , 5 , 683 , 693 , 5 , 667 , 781 , 5 , 665 , 356 , 5 , 591 , 628 , 5 , 510 , 241 , 5 , 503 , 987 , 5 , 501 , 988 , 5 , 500 , 345 and 5 , 496 , 705 that are incorporated by reference in their entirety . while human alloantisera currently used for serological typing are specifically excluded from this definition , the use of cd109 or gov allele - specific peptides to detect anti - gov antibodies in human plasma or serum , or to determine the specificity of such alloantibodies , are specifically included . similarly , the use of such cd109 peptides or gov allele - specific peptides to purify cd109 antibodies , or allele - specific cd109 antibodies from human serum is specifically included . similarly , the use in vitro of such cd109 peptides or gov allele - specific peptides to deplete allele - specific antibody activity from human serum samples , or to block cd109 antibody binding , or allele - specific antibody binding , is specifically included . diagnostic applications of these antibodies are exemplified , according to the present invention , by the use of a kit containing an anti - gov a or an anti - gov b antibody , which undergoes a reaction with a sample of an individual &# 39 ; s blood to determine a gov a or gov b platelet phenotype . such a reaction involves the binding of anti - gov a antibody to gov a antigen or the binding of anti - gov b antibody to gov b antigen . the observation of antibody - antigen complex in a blood sample would indicate a positive result . a kit of this type could be used to diagnose , or to help prevent the occurrence of pathological conditions like ptp , ptpr , or natp . a polypeptide of the present invention that is recognised specifically by anti - gov a or ant - gov b antibodies can also be used therapeutically . thus , antibodies raised against such a polypeptide can be employed in the generation , via conventional methods , of anti - idiotypic antibodies , that is , antibodies that bind an anti - gov a or anti - gov b antibody . see , e . g ., u . s . pat . no . 4 , 699 , 880 , the contents of which are hereby incorporated by reference . such anti - idiotypic antibodies would bind endogenous or foreign anti - gov antibodies in the blood of an individual , which would treat or prevent pathological conditions associated with an immune response to a “ foreign ” gov alloantigen . alternatively , a polypeptide within the present invention can be administered to an individual , with a physiologically - compatible carrier , to achieve the same qualitative effect , namely , the selective reduction or elimination of circulating anti - gov antibodies from a patient suffering or at risk from an immune response , or the abrogation by competitive binding to administered peptide , of the binding of gov - specific antibodies to the platelets of such an individual the present invention is further described below by reference to the following , illustrative examples . platelet total rna was isolated from edta anticoagulated blood of gov aa and gov bb individuals in the manner described in lymann et al ., blood 75 : 2343 - 48 ( 1990 ). first , platelet mrna in 10 μl aliquots was heated to 70 ° c . for 10 minutes and quickly cooled on ice before reverse transcription . the first strand cdna was then synthesized using 10 μm oligo dt , 40 units rnasin ( promega ), 2 mm of each dntp ( dn triphosphate ) ( pharmacia ), 500 units of cloned mmlv reverse transcriptase and 5 × enzyme buffer ( gibco ) in a total volume of 50 μl . the cdna synthesis was carried out at 42 ° c . for 45 minutes and was stopped by chilling to 0 ° c . overlapping sets of oligonucleotide primers ( table 2 ) based on the sequence of cd109 were then used to amplify by pcr the entire coding region of platelet cd109 in 8 overlapping segments that spanned the entire cd109 open reading frame . table 2 lists the position of the 5 ′ end of each oligonucleotide with respect to the cd109 cdna sequence , which includes both 3 ′ and 5 ′ untranslated regions , is noted in parentheses . the cd109 orf encompasses nucleotides 1 - 4335 of the published cd109 cdna , and corresponds exactly to the cd109 cdna sequence presented in seq id no : 1 . the size of each pcr product , and the annealing temperature used for the corresponding primer pair , is listed . pcr reactions ( 50 : i ) containing 1 × pcr buffer ( gibco life technologies ), 1 . 5 mm mgcl 2 , 200 : m of each dntp , 1 : m of each primer , 1 . 25 units taq polymerase ( gibco life technologies ), and 3 : i cdna underwent 40 cycles of 94 ° c . ( 45 seconds ), primer - specific annealing temperature ( table 2 ; 45 seconds ), and 72 ° c . ( 45 - 60 seconds ), using a perkin elmer 2400 thermocycler . pcr products ( 30 : i ) were subsequently size - separated electrophoretically on a 1 . 2 % agarose / tae gel containing 1 : g / ml ethidium bromide . bands were subsequently excised and purified ( 50 : i ) using the qiaquick ( qiagen ) kit for direct sequencing and subcloning . sequencing reactions ( 3 - 5 : i purified product per reaction ) were carried out using the thermosequenase cy5 . 5 dye terminator sequencing kit ( amersham pharmacia biotech ) and the same primers that had been used for initial pcr amplification ( table 2 ), or selected internal cd109 - specific primers as appropriate , and were subsequently analysed using the open gene automated dna sequencing system ( visible genetics ). in parallel , pcr products were cloned into pmei - digested pmabi , a pbs sk (−) ( stratagene ) derivative containing a pmei restriction site within the polylinker . resultant plasmid clones were analysed by alkaline lysis / restriction digestion , and as appropriate ( and following an additional overnight 13 % peg / 1 . 6 m nacl precipitation ), by dna sequence analysis as above . by combining direct pcr sequencing and the analysis of subcloned fragments , it was ensured that the dna sequence of each pcr - derived cdna fragment was obtained independently at least twice , with each fragment being sequenced in both directions in its entirety . this analysis revealed that the cd109 cdna sequences of gov aa and gov bb individuals differed by a single nucleotide at position 2108 of the sequence shown in seq id no : 1 . gov a / a individuals have an a at position 2108 , whereas gov b / b individuals have a c at the same position . this change results in a tyr - ser amino acid polymorphism at residue 703 of the full - length cd109 polypeptide chain . this single nucleotide polymorphism also results in a bstni restriction site in the govb allele that is not present in the gov a allele . analysis of the other regions of the cd109 cdna in their entirety revealed no other nucleotide differences that segregated with gov phenotype ( i . e ., that could be used to distinguish the gov a allele from the gov b allele ). to facilitate subsequent genomic dna analyses of the gov a / b alleles , the intron / exon junctions of the exon bearing the putative gov - specific nucleotide substitution identified above , as well as the dna sequence of the flanking introns , were determined . cd109 cdna - specific oligonucleotides binding in the vicinity of this substitution were used for the direct sequencing of p4l10 , a pcypac — 1 - derived pac clone bearing the human cd109 locus using the open gene system ( visible genetics ) as above . the nucleotide sequence of the gov polymorphism - containing exon , as well as of the flanking introns , is presented in seq id no : 5 . the gov polymorphism lies at nucleotide position 954 in seq id no : 5 . subsequent work has mapped the intron - exon structure of the entire human cd109 locus , and has determined that the gov single nucleotide polymorphism of cd109 lies in exon 19 of the cd109 gene . the a - c gov cd109 polymorphism corresponds to the internal nucleotide of the first complete codon of exon 19 of the cd109 gene . as this exon comprises only 118 nucleotides , and the gov polymorphism lies almost at the extreme 5 ′ end of this exon , we determined the nucleotide sequence of both introns flanking this exon to facilitate subsequent genomic dna analyses of the gov a / b alleles . the dna sequence of cd109 exon 19 and its flanking introns ( cd109 introns 18 and 19 ) is presented as seq id no : 5 . to confirm that the a to c polymorphism at position 2108 of the cd109 open reading frame ( nucleotide 2108 , seq id no : 1 ; nucleotide 954 , seq id no : 5 ) segregates with the gov phenotype , rflp analysis was carried out on pcr amplified genomic cd109 dna using the bstni restriction endonuclease , which recognises the dna sequence 5 ′ c cagg 3 ′ found in the gov b cdna ( nucleotides position 2108 - 2112 in seq id no : 3 ; the corresponding gov a sequence , 5 ′ a cagg 3 ′, is nucleotides 2108 - 2112 in seq id no : 1 ). this enzyme does not cleave at 5 ′ acagg 3 ′ ( found in gov a ; nucleotides 2108 - 2112 in seq id no : 1 ). a 448 bp genomic fragment was pcr - amplified from gov aa , gov ab , and gov bb individuals using the pair of oligonucleotides seq id no : 9 and seq id no : 10 . these oligonucleotides flank exon 19 . the former binds within intron 18 ( nucleotides 875 - 892 seq id no : 5 ), while the latter binds within intron 19 to the sequence complementary to nucleotides 1305 - 1322 of seq id no : 5 ). the resultant 448 bp pcr product , when digested with bstni , yielded the restriction fragments predicted on the basis that the a to c polymorphism at position 2108 ( seq id no : 1 ) segregates with the gov phenotype . to further confirm that the a to c polymorphism at position 2108 of the cd109 open reading frame ( nucleotide 2108 , seq id no : 1 ; nucleotide 954 , seq id no : 5 ) segregates with the gov phenotype , we also performed an alternative analysis involving the selective hybridization of gov allele - specific dna probes to pcr amplified genomic cd109 dna . two primers flanking the polymorphic a - c site at position 2108 ( seq id no : 1 ; position 954 , seq id no : 5 ) were designed to amplify by pcr a 105 bp genomic dna fragment containing the polymorphic site from genomic dna isolated from gov aa , gov ab , and gov bb individuals . the first primer ( seq id no : 11 ) binds within intron 18 to nucleotides 902 - 928 of seq id no : 5 . the second primer ( seq id no : 12 ) binds within exon 19 to the sequence complementary to nucleotides 977 - 1106 of seq id no : 5 . two additional nucleotide probes were designed — one specific for the target sequence of the gov a allele of the cd109 gene , and the other for the gov b allele of the cd109 gene . the first probe ( seq id no : 13 ) overlaps the cd109 intron 18 / exon 19 junction , binds to the gov a allele at nucleotides 935 - 974 of seq id no : 5 , and was tagged with the fluorescent dye 6 - fam . the second probe ( seq id no : 14 ), also overlapping the cd109 intron 18 / exon 19 junction , binds to the gov b allele at the position corresponding to nucleotides 935 - 971 of seq id no : 5 , and was tagged with the fluorescent dye vic . genomic dna was isolated from gov phenotyped human peripheral blood leukocytes , and pcr / hybridization analysis was carried out using taqman real - time pcr technology ( perkin elmer ). genomic dna was amplified using primers seq id no : 11 and seq id no : 12 , with each reaction additionally containing 100 nm fam - labelled gov a probe and 200 nm vic - labelled gov b probe . allelic discrimination , based on allele - specific fluorescence , was then determined using a post - pcr plate reader ( perkin elmer ). in all cases , pcr / fluorescence - based gov genotyping correlated with the gov phenotype , indicating that the a to c polymorphism at position 2108 ( seq id no : 1 ) does indeed segregate with the gov phenotype . to further confirm that the a to c polymorphism at position 2108 of the cd109 open reading frame ( nucleotide 2108 , seq id no : 1 ; nucleotide 954 , seq id no : 5 ) segregates with the gov phenotype , we also performed an alternative analysis involving sscp analysis of pcr amplified genomic cd109 dna . two gov allele - specific antisense oligonucleotides — seq id no : 6 and seq id no : 7 — differing by a single 3 ′ nucleotide ( and binding to sequence complementary to nucleotides 954 - 976 of seq id no : 5 , and of the gov b counterpart of seq id no : 5 , respectively ), were combined with a common sense primer — seq id no : 8 binds within intron 18 and which corresponds to nucleotides 752 - 773 of seq id no : 5 , to amplify a 225 bp genomic dna fragment containing the gov polymorphic site from genomic dna isolated from gov aa , gov ab , and gov bb individuals . in all cases , complete concordance between pcr - ssp analysis and gov phenotyping was observed . seq id no : 1 consists of the entire 4335 nucleotide cd109 cdna open reading frame encoding the gov a allele . the gov a allele comprises an a at nucleotide position 2108 . seq id no : 2 consists of the entire 1445 aa protein sequence produced from cd109 gov a cdna . the gov a allele comprises a tyr at amino acid 703 . seq id no : 3 consists of the entire 4335 nucleotide cd109 cdna open reading frame encoding the gov b allele . the gov b allele comprises a c at nucleotide position 2108 . seq id no : 4 consists of the entire 1445 aa protein sequence produced from the cd109 gov b cdna . the gov b allele comprises a ser at amino acid 703 . seq id no : 5 consists of the cd109 genomic dna comprising cd109 exon 19 and the flanking introns , introns 18 and 19 . the 118 nucleotide exon 19 , comprising nucleotides 952 - 1069 of seq id no : 5 , corresponds to nucleotides 2106 - 2223 of seq id no : 1 . the a to c gov polymorphism of cd109 ( corresponding to nucleotide 2108 of seq id no : 1 ) therefore corresponds to nucleotide 954 of seq id no : 5 . in the gov a allele , nucleotide 954 is a , while in the gov b allele nucleotide 954 is c . thus , seq id no : 5 corresponds to the gov a allele of cd109 . within seq id no : 5 , nucleotides 1 - 951 correspond to cd109 intron 18 , while nucleotides 1070 - 2608 correspond to intron 19 . we note that nucleotides 2108 - 2112 of seq id no : 1 , and the corresponding nucleotides 954 - 958 of seq id no : 5 , which consist of the sequence 5 ′ acagg 3 ′ ( and which contains the gov a allele - specific polymorphic nucleotide at its 5 ′ end ), is not cleavable by the restriction endonuclease bstni . however , in the corresponding gov b allele , the corresponding sequence — 5 ′ ccagg 3 ′— is cleavable by bstni , and that the two gov alleles can be discriminated on this basis . we note also that a group of restriction endonucleases — bst2ui , bstni , bstoi , ecorii , maeiii , mspr91 , mvai , or scrfi ( or one of their isoschizomers )— is capable of differentiating between the gov a and gov b alleles on this basis . seq id no : 6 - seq id no : 14 comprise oligonucleotides for the pcr amplification of gov polymorphism containing cd109 sequence from rna , cdna derived from rna , or from genomic dna , and for the gov typing analyses of such amplified dna fragments . seq id no : 3 , an antisense oligonucleotide specific for the gov a allele , binds to exon 19 sequence complementary to nucleotides 954 - 976 of seq id no : 5 . seq id no : 6 and seq id no : 7 ( see below ) differ by a single allele - specific 3 ′ nucleotide seq id no : 7 , an antisense oligonucleotide specific for the gov b allele , binds to exon 19 sequence complementary to nucleotides 954 - 976 of the gov b counterpart of seq id no : 5 . seq id no : 6 ( see above ) and seq id no : 7 differ by a single allele - specific 3 ′ nucleotide . seq id no : 8 binds within intron 18 , and corresponds to nucleotides 752 - 773 of seq id no : 5 . seq id no : 10 binds within intron 19 to the sequence complementary to nucleotides 1305 - 1322 of seq id no : 5 . seq id no : 1 binds within intron 18 to nucleotides 902 - 928 of seq id no : 5 . seq id no : 12 , binds within exon 19 to the sequence complementary to nucleotides 977 - 1006 of seq id no : 5 . seq id no : 13 , specific for the gov a allele , overlaps the cd109 intron 18 / exon 19 junction , and binds to the gov a allele at nucleotides 935 - 974 of seq id no : 5 . seq id no : 14 , specific for the gov b allele , overlaps the cd109 intron 18 / exon 19 junction , and binds to the gov b allele at the position corresponding to nucleotides 935 - 971 of seq id no : 5 .
| 2 |
we begin with a review of the elements of an asymmetric flow fff channel . the a4f channel , illustrated in fig1 , is comprised of the following elements together with means to hold them together : 1 ) a bottom assembly structure 1 holding a liquid - permeable frit 2 surrounded by a sealing o - ring 3 , 2 ) a permeable membrane 4 that lies on the frit 2 , 3 ) a spacer 5 of thickness from about 75 μm to 800 μm into which has been cut a cavity 6 , and 4 ) a top assembly structure 7 generally holding a transparent plate 8 of material such as lexan ® or glass . the plate need not be transparent for some implementations . the resulting sandwich is held together with bolts 13 or other means . the generally coffin - shaped or tapered cavity 6 in the spacer 5 will serve as the channel in which separation will occur . the top assembly structure 7 usually contains three holes , called ports , that pass through the top plate 8 and are centered above the channel permitting the attachment of fittings thereto . these ports are : 1 ) a mobile phase inlet port 9 located near the beginning of the channel and through which is pumped the carrier liquid , the so - called mobile phase , 2 ) a sample port 10 , downstream of the inlet port , into which an aliquot of the sample to be separated is introduced to the channel and focused thereunder , and 3 ) an exit port 11 through which the fractionated aliquot leaves the channel near the end of the cavity . a single pump , as used in the a4f preferred embodiment , provides the mobile phase at the inlet port 9 . the mobile phase is the source of two distinct flows : i ) flow through the flit - supported membrane producing a cross flow transverse to the injected sample , and ii ) longitudinal flow parallel to the membrane and leaving the channel with the fractionated sample through the exit port 11 . because of the small diameter of the outlet tubing as well as back pressure caused by detectors downstream of the channel , the impedance to the sample - containing channel flow is generally much greater than the impedance produced by the frit - supported membrane and the cross flow therethrough . this cross flow is controlled by a needle valve or similar computer interfaced means housed in a remote control unit . the total flow that passes through the membrane 4 and , therefrom , through the supporting frit 2 , is controlled and regulated by means of a remote valve that controls the outflow through port fitting 12 . similar a4f devices to those manufactured by wyatt technology corporation , and as discussed explicitly in this specification , are manufactured by consenxus gmbh and postnova analytics inc . both of these achieve the same type of separation . thus if the mobile phase inlet flow at 9 is , say , 2 ml per minute and the flow through the outflow controlling needle valve programmed to provide 0 . 5 ml / min through 12 , the total outlet flow through 11 would be 1 . 5 ml / min . thus the single needle valve controller regulates the split of the mobile phase into two components : the total so - called cross flow through the membrane 4 and exiting through 12 and , the remaining outflow through 11 . recall that the outflow through 11 is subject to a large impedance / back pressure arising from its narrow outlet and the detectors downstream . the supporting frit is very porous and produces negligible impedance to flow through it . prior to separation , a sample aliquot is injected at the sample injection port 10 and a reversed flow , created by a partial split off from the normal mobile phase stream , is introduced through the exit port 11 . the two counter flows keep the injected sample aliquot in position under its injection port 10 , focusing it thereby within a small region transverse to the usual longitudinal channel flow . this “ stop - flow ” mode allows the aliquot to equilibrate . once equilibrated , the sample aliquot is released by restoring the channel flow . the thus - focused aliquot will fractionate as it is driven forward by the channel flow while a transverse component acts to drive it downward toward the frit - supported membrane , or the often used term “ accumulation wall .” instead of applying the stop flow technique with focusing to allow the sample aliquots to equilibrate , the conventional procedure for a4f , the earlier developed symmetric cross flow fff , sf1fff , provided for the sample to be injected directly into the mobile phase and retained at the inlet frit for a sufficient time to permit relaxation before release to the symmetric flow separation channel . once the particles have been separated by the a4f unit , they are generally examined by means of different classes of detection instruments responsive thereto . these may include light - scattering photometers , uv absorption meters , differential refractive index detectors , differential viscometers , and combinations thereof . such devices are used to characterize the separated particles / molecules in terms of their molar mass , intrinsic viscometry , size , etc . fig2 shows the 90 ° light scattering signal as a function of time from a bovine serum albumin , bsa , sample fractionated by an a4f device . note that the sample is comprised of 5 peaks , 14 , 15 , 16 , 17 and 18 in addition to other unresolved elements 19 . the resolved peaks include certain so - called oligomers that are small 2 -, 3 -, 4 -, and 5 - mer aggregates of the monomer , respectively . the major peak at 14 corresponds to the monomer fraction . pharmaceutical products , somewhat similar to this protein example , must be produced in such a manner that the amount of aggregated monomer is negligible . although such oligomers do not contribute generally to the biological &# 39 ; s therapeutic activity , their presence should be minimized . of even greater importance are much larger aggregates that may cause immunogenic responses in the patient . in this manner , the biological becomes dangerous to the patient and must be cleared of such possible contributions . an objective of this invention is to show how this might be achieved . note the width of the eluting peaks of fig2 . for example , note that the monomer peak 14 elutes over the range from about 16 min to 18 . 7 min , i . e . a total width of about 2 . 7 min . if the peak could now be narrowed to , say , a range corresponding to about 1 . 0 min without affecting the separation of this peak relative to adjacent oligomers peaks 15 , 16 , 17 and 18 in the process , the concentration within the reduced 0 . 5 ml band would have been increased approximately by the ratio 2 . 7 / 1 . 0 = 2 . 7 . it is an important objective of the present invention to achieve such increased concentrations when desirable . we shall refer to this process of increasing the peak concentrations by such narrowing as “ reconcentrating .” perhaps of even greater importance would be the separation of the larger aggregate elements beyond the last oligomeric state observed . indeed , the contributions that elute beyond 28 min should be examined in greater detail for their possible inclusion of larger aggregates that may be immunogenic . another objective of this invention is to separate and concentrate such contributions for later collection and analyses . in addition , if such immunogenic contributions are known to be present , the product cannot be sold and is generally destroyed . on the other hand , if these contaminants could be removed , the product might then be considered safe and could be marketed as such . an additional objective of this invention is to be able to restore such contaminated pharmaceutical products to pristine , safe , and marketable states . the channel flow of a conventional a4f unit decreases along the length of the channel . this is quite distinct from the sf1fff system wherein separate pumps provide constant cross and channel flows . thus for the a4f systems , the fractionating power may increase slightly down the length of the channel . however , in order to keep the ratio of channel flow to cross flow per unit area constant , the channel is usually tapered . fig3 illustrates such a channel 6 cut into a spacer 5 of length l , initial width 2w 0 , and final width 2w l . at any position x , the width of the channel is given by w ( x )= 2w 0 ( 1 − bx ), where thus , the channel flow rate at any position along such a tapered channel is f = f 0 − f ∫ 0 x w ( x ) dx , c cr is the total cross flow through the channel - defined membrane , f 0 is the input flow rate , and a is the area of the channel from 0 to l . by tapering the channel , the channel flow f in excess of the component that is locally diverted to cross flow is increased approximately in its rate per unit area in the ratio of w 0 / w ( x ), where the channel width at a distance x is 2w ( x ) since the channel flow to cross flow ratio for the a4f device varies throughout the length of the channel , any attempt to change this ratio at one region of the channel necessarily affects this ratio throughout the channel . indeed , characteristic of a4f operation has been the programming of these flows during the separation and elution of the sample . until the current invention , the possibility of more localized control had been neither possible nor considered . consider now the preferred implementation of the invention shown in fig4 wherein the frit is divided into n separate regions 20 , r 1 , i = 1 , . . . , n . for example , the first three compartments ( and their corresponding frit regions ) shown in fig4 might be replaced by a single larger compartment ( and a correspondingly larger frit region ). the successive compartments and frit regions may be combined as well . below each region 20 is a corresponding partitioned compartment 21 through whose base is an exit port fitting 12 . flow through each such exit port fitting 12 is controlled by a corresponding programmable needle valve means v i i = 1 , . . . , n , that regulates the flow through its supporting frit region . a plurality of programmable regulators , one for each compartment / region , are located in an external control unit . needle valves combined with flow meter regulation are often selected for this purpose . as the cross flow through each region may be individually programmed in time , the inventive system provides a broad range of capabilities . larger particles , once separated from their smaller companions , may be retained at a particular region while the smaller particles progress through the channel . another feature would relate to the invention &# 39 ; s ability to reconcentrate separated species that had become broadened and diluted . it is important recognize that the regions and their associated compartments may be of different sizes and , under some circumstances , might not be transverse to the direction of flow . fig5 shows an example of different compartment and frit configurations . referring again to fig4 wherein the preferred embodiment is illustrated by a channel comprised of 5 equally sized regions , each with its corresponding compartment below , means by which the embodiment may be restored to its conventional form is readily visualized . fig6 and 7 suggest how the base of each compartment could be modified to incorporate a drain hole 22 at its base ; each such drain emptying into a common compartment 24 below . by opening all such drains and closing each needle valve that controls out flow through the individual port fittings 12 , the common single compartment is provided with a single port fitting 12 whose out flow is controlled by a single regulator in the controller unit . the channel would thus be restored for conventional operation . providing mechanical means by which such drains could be opened simultaneously is illustrated schematically by the paddle structure 23 that may be slid out partially , opening thereby all drain holes 22 directing fluid to flow into the common compartment 24 and out through the associated out flow port fitting 12 . this concept may be further expanded to permit compartmental ganging to be applied to selected sets of compartments whose cross flows per unit area may be required to be the same . for those compartments , their regulators would be closed and their drainage valves opened by individual paddle features similar to the multi drain hole paddle structure 23 allowing drainage into the common compartment 24 controlled by its single port fitting 12 shown at the left of the structure in a plane at right angles to the individual compartment out flow fittings . the structure of fig6 is shown in further detail by means of the cross sectional cut through the compartmentalized structure indicated in fig7 a and 7 b . the out flow port fittings 12 of each compartment are shown in fig6 a . note that fig6 a is very similar to the base of the unit of fig4 but with the addition of a single out flow port fitting 12 serving the common compartment 24 . although restoration to conventional operation may be achieved by displacing the paddle element 23 and stopping all individual flows through their port fittings 12 , it would be far easier for most experimental requirements just to replace the compartmentalized structure with a conventional cross flow unit . the main and most important reason that one might want to be able to restore the channel by repositioning the drain hole blocking paddle 23 , illustrated in fig6 b and 6 c would be to examine in greater detail the performance of a specific channel . that channel &# 39 ; s physical structure , such as its dimensions and associated membrane variation , if any , may vary with usage . since flows through specific compartments at varying rates may have affected certain local regions of the membrane , restoration of the device to its conventional operating mode would permit rapid examination of membrane changes that might have occurred while it was so operated . although fig4 illustrates the invention by means of a five compartment configuration , it should be recognized , as discussed earlier , that similar systems may be developed using more or even fewer compartments of similar or different sizes . means to gang different groups of compartments are easily implemented . thus , in a 5 - compartment device , there could be two sets of ganged compartments each with its regulating needle valve . for example , the first three and the fifth compartments might be controlled by a single regulating valve following the closure of their outflow port fittings 12 and the opening of their corresponding drainage holes into a single volume , while the fourth compartment could be controlled by a single valve controlling its outflow . in order to illustrate further the universal application of the compartmentalization concept , reference is made to the hollow fiber fff , h4f , device . fig8 illustrates the structure and key elements of the porous hollow fiber fractionator . a rigid vessel 25 surrounds a porous cylindrical fiber 26 mounted therein between an inlet fitting 27 and exit port fitting 29 . the mobile phase is introduced through fitting 27 and samples are injected into the mobile phase through injection port fitting 28 . as the fiber is porous , its exudate flows into the vessel 25 and then out by means of regulation of such flow through exit port fitting 29 which is connected to the controller unit . the flow through the porous fiber channel 26 is comprised of two parts : transverse flow through the porous fiber and the longitudinal flow . thus the fiber plays the role of the membrane / frit structure of the a4f and sf1fff fractionators . fig9 illustrates how a porous hollow fiber fractionator , h4f , might be modified to permit compartmentalization similar to the a4f implementation . the internal structure of the modified rigid vessel 25 is divided into compartments 21 surrounding a porous fiber 26 threaded therethrough . the fiber may be cooled to shrink slightly before insertion producing a tight fit against the side walls of each compartment upon heating . additionally , the internal pressure caused by the longitudinally flowing fluid therein may be sufficient to seal each compartment . for other types of porous hollow fibers that cannot seal by deformation means , circular o - rings may be inserted into each . other implementations would include a compartmentalized vessel that is hinged into two axial components that are easily opened and provided with suitable seals and o - rings required for adequate sealing of each compartment . fig1 illustrates how the inventive technique might be used to examine the larger aggregates 19 of the sample shown in fig2 . assume that an objective of this separation is to isolate and concentrate these larger aggregates 19 present from the most prominent oligomeric states . assume also , that only 5 compartments are present . at t = t 1 , most of the oligomeric peaks of the fig2 sample have eluted and left the fractionator . the figure at this time shows the concentration of the remaining species as a function of channel position . note that the five compartment positions are indicated by the numbers at the bottom of the graph . when most of the sample has fractionated and left the channel , the cross flow in the last compartment is increased significantly , retaining thereby much of the fraction 19 at the last two compartments . other cross flows are maintained as they were throughout the separation , but the inlet mobile phase flow has been increased to accommodate the additional flows through the last two compartments . by t = t 2 , the remaining sample is beginning to slow down and collect between these latter two compartments and by t = t 3 , the cross flow through the fourth compartment has been stopped with the remaining sample being held at the last region shortly before it is released . in this manner , the unresolved aggregate fraction 19 has been further separated from the well defined and characterized oligomeric constituents . once released , the aggregate fraction may be subjected to further analyses and study . although the membrane used for separations within a compartmentalized fractionator has been assumed of uniform composition , as have the individual frit elements , these constituents may be constructed with materials of different composition . for example , the membrane 4 of the a4f fractionators and , its compartmentalized variants , may be constructed of segmented sections fused or otherwise connected between regions . one segment , for example could be non porous preventing thereby any cross flow affecting the sample passing therethrough . other membrane sections may be composed of sections with differing porosities . the supporting flits , as well , may be of differing compositions expanding or restricting thereby the flow therethrough . consider a frit section composed of a highly porous material permeable to a broad range of molecular / particle sizes that might pass therethrough unimpeded . with a corresponding membrane section that is highly porous , any sample passing thereover at a particular time may be driven almost entirely therethrough by applying a strong cross flow as it reaches that porous section . other cross flows at different compartments may be modified accordingly to establish means by which specific fractions of the separating sample may be collected and removed from therefrom . another interesting application of a simple compartmentalized fractionator would be one designed to collect specifically defined fractions of a sample undergoing separation . consider that only the final compartment be operated independently in this manner with its corresponding membrane section almost completely permeable to any sample fraction that might pass therethrough . for most of the separation , cross flow would be prevented from passing through this section . only when a specific fraction had reached it , would the cross flow be activated briefly and the fraction swept into its companion chamber . since such a fractionator chamber may be of extremely small volume , other easily developed means may be required to extract such collected samples without their appreciable dilution . the foregoing description , for purposes of explanation , used specific implementations to provide a thorough understanding of the invention . however , it will be apparent to one skilled in the art that specific details are not required in order to practice the invention . thus , the foregoing descriptions of specific embodiments of the invention are presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed ; obviously , many modifications and variations are possible based on the above teachings . the particular embodiments described were chosen in order to best explain the principles of the invention and some of its many practical applications in order to enable , thereby , others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is intended that the following claims and their equivalents define the scope of the invention .
| 6 |
the lower alkyl group as defined for the substituent in the above - mentioned formula ( i ) means a straight or branched - chain alkyl group containing 1 - 4 carbon atoms . methyl , ethyl or propyl is preferred . the lower alkoxy group means a straight or branched alkoxyl group containing 1 - 4 carbon atoms . methoxy , ethoxy or propoxy is preferred . the amide derivatives represented by the above - mentioned formula ( i ) are produced by reacting a reactive derivative of a carboxylic acid represented by the formula ( ii ) ## str2 ## wherein r 3 and n have the same meanings as defined above and r 4 and r 5 which may be the same or different and represent hydroxy - protective groups or lower alkyl groups with an amine derivative represented by the formula ( iii ) ## str3 ## wherein x has the same meaning as defined above , and if required , removing the hydroxy - protective groups . as the above - mentioned reactive derivative of the carboxylic acid ( ii ) is preferably employed a halide , for example , chloride or bromide , or an anhydride of said carboxylic acid . as the hydroxy - protective group is preferably employed an aliphatic or aromatic acyl group such as acetyl , propionyl , benzoyl or toluoyl ; or benzyl group . the above - mentioned reaction is carried out by a method known per se . for example , the reactive derivative of the carboxylic acid ( ii ) is dissolved in an appropriate organic solvent such as , for example , chloroform , the amine derivative ( iii ) is added to the solution , and the mixture is reacted at room temperature for several hours . after completion of the reaction , the desired product ( i ) is isolated from the reaction mixture by a conventional method and purified by such a means as column chromatography . when r 4 and / or r 5 in the above formula ( ii ) is a hydroxy - protective group , the protective group is removed by a conventional method . for example , when the protective group is an acyl group , deacylation is effected by the treatment with a mineral acid such as hydrochloric acid . when the protective group is benzyl group , the removal is effected by a catalytic reduction . the amide derivatives of the invention are useful as a lypoxygenase inhibitor and are administered for the therapy and prevention of diseases such as allergic asthma and allergic rhinitis . the dose is variable depending upon patient &# 39 ; s conditions , but is generally 10 - 2000 mg , and preferably 20 - 600 mg per day for an adult . it may be administered in one to three divided doses in a day as needed depending upon patient &# 39 ; s conditions . route of administration may be in any suitable form , and oral administration is particularly desirable . intravenous administration is also feasible . the compound of the invention may be administered either alone or in admixture , as one of the active ingredients , with pharmaceutical carriers or excipients , by employing conventional procedures , in a variety of forms such as tablets , sugar - coated tablets , powders , capsules , granules , suspension , emulsion and injectable solution . examples of the carriers or excipients are calcium carbonate , calcium phosphate , starch , glucose , lactose , dextrin , alginic acid , mannitol , talc , and magnesium stearate . examples and a test example are given to illustrate the invention in more details , but the invention is not limited thereto in any way . to a suspension of 200 mg ( 0 . 703 mmol ) of 3 -( 3 - methoxy - 4 - benzyloxyphenyl )- 2 - propenic acid in dry chloroform ( 6 ml ) was added 178 . 5 mg ( 1 . 406 mmol ) of oxalyl chloride in the atmosphere of argon at room temperature . the mixture was stirred for one hour , and the reaction mixture was concentrated under reduced pressure . to the residue thus obtained was added dry chloroform ( 4 ml ) followed by addition of a solution of 264 mg ( 0 . 703 mmol ) of brmohexine in dry chloroform ( 2 ml ), and the solution was stirred for 3 hours . to the reaction mixture was added saturated aqueous solution of sodium hydrogen carbonate followed by extraction with chloroform . the organic layer was concentrated under reduced pressure , and the residue thus obtained was subjected to column chromatography on silica gel . from the benzene - ethyl acetate ( 10 : 1 ) eluate was obtained 275 . 8 mg ( 0 . 429 mmol ) of n - cyclohexyl - n - methyl -( 2 -( 3 -( 3 - methoxy - 4 - benzyloxy - phenyl )- 2 - propenoylamino )- 3 , 5 - dibromobenzyl ) amine . to a solution of 275 mg ( 0 . 428 mmol ) of the amine compound in acetic acid ( 3 ml ) was added concentrated hydrochloric acid ( 1 . 5 ml ), and the mixture was stirred at 100 ° c . for 2 hours and then at room temperature for 14 hours . to the reaction mixture were added ice water and 1n sodium hydroxide to adjust the ph to 8 , followed by extraction with ethyl acetate . the organic layer was concentrated under reduced pressure , and the residue was subjected to column chromatography on silica gel . from the benzene - ethyl acetate ( 5 : 1 ) eluate was obtained 134 . 5 mg ( 0 . 243 mmol ) of n - cyclohexyl - n - methyl -( 2 -( 3 -( 3 - methoxy - 4 - hydroxyphenyl )- 2 - propenoylamino )- 3 , 5 - dibromobenzyl ) amine . spectrophotometric data of the product support structure of the formula ( iv ) shown below . ## str4 ## 1 h - nmr ( cdcl 3 ). tbd . ( ppm ): 0 . 93 - 2 . 40 ( 11h , m ), 2 . 11 ( 3h , s ), 3 . 54 ( 2h , bs ), 3 . 88 ( 3h , s ), 6 . 36 ( 1h , d , j = 15 . 5 hz ), 6 . 73 - 7 . 45 ( 5h , m ), 7 , 62 ( 1h , d , j = 15 . 5 hz ), 7 . 68 ( 1h , d , j = 2 . 0 hz ). ir ( kbr ) ν max cm - 1 : 3250 , 2930 , 2850 , 1680 , 1620 , 1595 . to a solution of 103 . 5 mg ( 0 . 47 mmol ) of 5 -( 3 - methoxy - 4 - hydroxyphenyl )- 2 , 4 - pentadienoic acid in dry tetrahydrofuran ( 3 ml ) was added 119 . 3 mg ( 0 . 94 mmol ) of oxalyl chloride in the atmosphere of argon at room temperature . the mixture was stirred for 1 . 5 hours , and the reaction mixture was concentrated under reduced pressure . to the residue thus obtained was added dry tetrahydrofuran ( 2 ml ) followed by addition of 135 mg ( 0 . 36 mmol ) of brmohexine in dry tetrahydrofuran ( 2 ml ) at room temperature . the mixture was stirred with heating under reflux for 2 hours and at room temperature for 14 hours . to the reaction mixture was added saturated aqueous solution of sodium carbonate followed by extraction with ethyl acetate . the organic layer was concentrated under reduced pressure , and the residue thus obtained was subjected to column chromatography on silica gel . from the benzene - ethyl acetate ( 10 : 1 ) eluate was obtained 140 . 8 mg ( 0 . 24 mmol ) of n - cyclohexyl - n - methyl -( 2 -( 5 -( 3 - methoxy - 4 - hydroxyphenyl ) 2 , 4 - pentadienoylamino )- 3 , 5 - dibromobenzyl ) amine . spectrophotomethic data of the product support structure of the formula ( v ) shown below . ## str5 ## 1 h - nmr ( cdcl 3 ) δ ( ppm ): 1 . 06 - 2 . 35 ( 11h , m ), 2 . 10 ( 3h , s ), 3 . 51 ( 2h , bs ), 3 , 88 ( 3h , s ), 6 . 00 ( 1h , d , j = 15 . 0 hz ), 6 . 50 - 7 . 75 ( 8h , m ), 7 . 66 ( 1h , d , j = 2 . 0 hz ). ir ( kbr ) ν max cm - 1 : 3210 , 2920 , 2840 , 1650 , 1605 , 1580 . mouse mastocytoma cells , strain p815 were diluted in a medium containing 90 % of the eagle basal medium ( manufactured by gibco laboratories ) to a cencentration of 5 × 10 4 cells / ml . the diluted liquor was subjected to shake culture in air at 37 ° c . for 48 hours . the culture liquor was cooled with ice and centrifuged to collect the cells . the cells were re - suspended in a phosphate buffer solution at ph 7 . 4 to a concentration of 2 × 10 7 cells / ml . the suspension was treated in an ultrasonic cell fragmenting machine and then centrifuged at 10 , 000 ppm for 10 min . the supernatant was used as the 5 - lypoxygenase enzyme solution . to a test tube in which 20 μl of radiolabelled arachidonic acid ( 10 μ curies / ml ), indomethacine ( 2 × 10 8 mol ) and an amide derivative of the invention to be tested were placed 0 . 45 ml of phosphate buffer solution , 0 . 45 ml of the above - prepared enzyme solution and 0 . 1 ml of 8 mm cacl 2 ( calcium chloride ) solution . the mixture was reacted at 37 ° c . for 5 min . after cooled with ice , 60 μl of 1n -- hcl ( hydrochloric acid ) was added , and the resulting mixture was extracted with 8 ml of ethyl acetate . the extract was concentrated , and the concentrate was spotted and developed on a silica gel thin layer plate ( merck 60f 254 ). determination of the inhibitory activity was made by collecting the portion corresponding to 5 - hbte ( 5 -( s )- hydroxy - 6 , 8 , 11 , 14 - eicosatetraenic acid ) and ltb 4 ( leucotriene b 4 ), which were 5 - lypoxygenase products as detected with a radio - thin layer scanner ( dunnschicht - scanner ii lb 2723 manufactured by berthold ), and measuring the radioactivity by means of a scintillation counter . reduction in the 5 - lypoxygenase inhibitory activity is demonstrated by decrease in amount of the 5 - lypoxygenase products . as shown in table 1 below , results of the test indicate high 5 - lypoxygenase inhibitory activities . amide derivatives of the invention not shown in table i also demonstrated 5 - lypoxygenase inhibitory activities . table i__________________________________________________________________________5 - lypoxygenase inhibitory activity 50 % inhibitory concentrationstructural formula example ic . sub . 50 ( mol ) __________________________________________________________________________ ## str6 ## 1 4 × 10 . sup .- 6 ## str7 ## 2 3 × 10 . sup .- 7__________________________________________________________________________ the 50 % inhibitory concentration as shown in table i means concentration of the amide derivative which is required for inhibiting the formation of the abovementioned 5 - lypoxygenase products , 5 - hete and ltb 4 by 50 % of that in the absence of the amide derivative . an acute toxicity test by oral administration was conducted using icr male mice ( 5 weeks old ). the ld 50 value was 300 mg / kg or higher with any of the compounds of the invention thereby confirming higher safety than the effective dose .
| 0 |
an embodiment of the image reception system according to this invention will hereinafter be described in detail with reference to fig1 to 8 . fig1 is a circuit block diagram showing an embodiment of the image reception system according to the present invention . in fig1 reference numeral 1 designates a transmitting side or front end which transmits on - screen display information together with a video program , numeral 2 is a tuner which is supplied with the output from the front end 1 , numeral 3 is a video detector including a video intermediate frequency amplifier which amplifies the output from the tuner 2 , numeral 4 is an in band data read - in circuit for reading therein in band data such as , reception block control data , scramble data , or the like , out of the output delivered from the amplifier 3 , and numeral 5 is a microcomputer for use in reception block control to which the output from the in band data read - in circuit 4 is supplied . reference numeral 6 designates a character generator and display controller for generating character signals and controlling the display on the basis of the command data from the microcomputer 5 , and 7 is a blanking or masking circuit for superimposing a masking signal on the video signal from the video detector 3 on the basis of the command data derived from the microcomputer 5 , to thereby blank the video signal . reference numeral 8 designates a mixing circuit for mixing the character information from the character generator and display controller 6 and the output from the masking circuit 7 , and 9 and fsk ( frequency shift keying ) receiver for receiving an out band data such as an emergency broadcast data and so on from the front end 1 . the output from the fsk receiver 9 is also supplied to the microcomputer 5 . reference numeral 10 designates a remote control pad for remote - controlling the microcomputer 5 . as , for example , shown in fig2 this remote control pad 10 is provided with a plurality of operation keys corresponding to various kinds of functions that the image reception system of the invention has . in fig2 reference numeral 10a designates a power on - off key , 10b to 10k comprise ten keys for the user to enter the channel number and to enter a desired block code ( four figures ), and 10l comprises a channel - enter key . after the ten keys 10b to 10k are depressed by the user in accordance with the channel number that the user wants to select , the channel enter key 10l is depressed . then the predetermined portion , for example , an upper right - hand portion on the screen of a display apparatus ( such as a television set , not shown ). reference numeral 10m designates a channel key by which the television channel now being viewed is displayed on the screen . reference numeral 10n designates a code enter key . after the keys corresponding to a reserved block code are depressed and selected from the keys 10b to 10k , the code enter key 10n depressed . in this embodiment , four designated figures are entered as the identification code . reference numeral 10o designates channel keys for making the channel selection go up and down , 10p designates sound volume keys for increasing and / or decreasing the sound volume ; 10q comprises a muting key for changing over the muting state of the sound , 10r comprises a cable switching key for changing over the catv cables , and 10s comprises a block set key . as will be described later , if this block set key 10s is depressed , after the code registration or code verification , the channel now being selected is blocked , or the reception thereof is blocked . reference numeral 10t designates a block clear key , and , if this block clear key 10t is depressed , after the code verification the corresponding channel is released from being blocked . reference numeral 10u designates a key for selecting normal television , and if this key 10u is depressed , the normal television picture can be viewed . reference numeral 10v designates a cada ( cable digital audio ) key and if this cada key 10v is depressed , an audio signal from the cada system can be received . reference numeral 10w designates a key for a television game , and if this key 10w is depressed , it becomes possible to play a television game . when various kinds of these keys are depressed , the various information from the remote control pad 10 are interpreted by the microcomputer 5 and in accordance with the information , the microcomputer 5 controls the respective circuits . in other words , the microcomputer 5 interprets not only the information from the transmitting side 1 but also the information from the remote control pad 10 to thereby carry out the control operation thereof . an output terminal 11 exits from the mixing circuit 8 . when the blanking or masking circuit 7 is controlled by the microcomputer 5 to superimpose the masking signal on the video signal derived from the video detector 3 , or blank the video signal , only the character information from the character generator and display controller 6 is delivered to the output terminal 11 . when a video signal on which a block control data is superposed is transmitted from the transmitting side 1 , this video signal is received by the tuner 2 and then converted to a video signal by the video detector 3 . the block control data in this video signal is read in and detected by the in band data read - in circuit 4 and then fed to the microcomputer 5 . on the basis of the data concerning the block control information supplied thereto , the microcomputer 5 controls the character generator and display controller 6 so as to produce the character information and also controls the masking circuit 7 to blank the video signal applied thereto . as a result , there is supplied to the mixing circuit 8 only the character information from the character generator and display controller 6 . this transmitted character information is displayed in the form as , for example , shown in fig3 on an image display apparatus ( not shown ) such as a crt cathode ray tube . at this time , the sound is automatically muted . during this display period , the user cannot see the television picture . however , as will be described later , if the user &# 39 ; s block code is entered by selecting appropriately from the ten keys and pressing the code enter key 10n , then if the input code and the previously registered code are coincident with each other , it becomes possible for the user to see the television picture . further , when the video signal on which the emergency broadcast data is superposed is transmitted from the transmitting side , such video signal is supplied through the tuner 2 and the video detector 3 to the masking circuit 7 as mentioned above , while the emergency broadcast data is received by the fsk receiver 9 and then fed to the microcomputer 5 as the out band data . similarly as described above , on the basis of the data supplied thereto , the microcomputer 5 controls the character generator and display controller 6 to produce the character information or data and further controls the masking circuit 7 to blank the video signal applied thereto . as a result , only the character data derived from the character generator and display controller 6 is supplied to the mixing circuit 8 so that this character data is displayed as &# 34 ; emergency &# 34 ; on the blanked screen at its predetermined position ., for example , at its central portion in a predetermined cycle , for example , in the cycle of 250 ms in a flushing manner by the image display apparatus ( not shown ). at this time , the sound is muted . in this case , it is possible that the video signal is not blanked but is delivered together with the character information . when a tier level information which allows the reception of the video signal in accordance with the user &# 39 ; s contract condition is superposed upon the video signal , on the basis of the tier level information passed through the tuner 2 and the video detector 3 , there is detected a tier level at each television program by the in band data read - in circuit 4 . on the other hand , a tier level at every home is detected by the fsk receiver 9 and the both detected outputs are supplied to the microcomputer 5 , in which they are compared with each other . at this time , if the program now being received belongs to the tier level , the video signal is delivered to the output terminal 11 . if the television program now being received does not belong to the tier level , the microcomputer 5 controls the masking circuit 7 to blank the video signal applied thereto and also controls the character generator and display controller 6 to produce the character data indicative of the non - tier level . as a result , only the character data from the character generator and display controller 6 is transmitted to the mixing circuit 8 so that this character data is displayed on the masked screen at its predetermined position , for example , the upper right - hand position as the display of channel and &# 34 ; not authorized &# 34 ; is displayed at the central portion of the screen by the image display apparatus ( not shown ). at this time , the sound is muted . when the above three kinds of information are transmitted from the transmitting side 1 , they are displayed dominantly from any other information . operation of the block display and the setting method by the remote control pad 10 will be described with reference to fig4 to 8 . a normal television picture is displayed as shown in fig4 and then a desired block code ( four figures ) that the user wants to register is entered by using the ten keys . for example , if the code is 1234 , the ten keys 10b , 10c , 10d , and 10e are depressed in sequence . in this case , in order to remove the disadvantage upon displaying the channel , the display is made on the upper right hand position of a screen 12a in the two figures . accordingly , the display is changed in the order of 01 → 12 → 23 → 34 . next , when the code enter key 10n is depressed within a predetermined time , for example , within about three seconds later , the display on the screen is changed as shown in a screen 12b . at this time , while the sound is not muted , the picture except the characters is masked . then , after a predetermined time , for example , about four seconds , the picture screen is returned to the ordinary picture screen . accordingly , in this case , the code is not registered . on the other hand , when the code enter key 10n is depressed within a predetermined time , for example , within about four seconds , the code is registered and the display is made as shown by a screen 12c . at this time , while the sound is not muted , the picture other than the characters , is masked . then , after a predetermined time , for example , about four second later , the picture screen is returned to the normal picture screen . in this case , if the code registration is carried out previously , the following code verification operation becomes necessary . at first , the normal picture is displayed as shown in fig5 and the user &# 39 ; s block code is entered by using the ten keys . then , the code is displayed on the upper right hand position of a screen 12d . next , when the code enter key 10n is depressed , it is judged whether the input code coincides with the registered code or not . if they are coincident , the character information &# 34 ; code ok &# 34 ; is displayed as shown by a screen 12e . under this state , also the picture other than the characters is displayed . if not , the program is returned to the step of normal picture . then , after a predetermined time , for example , after about four seconds , the characters are erased . in this case , the verification of the normal channel is used when the block channel registration and the code correction are carried out as will be described later . further , if a channel which is previously blocked is selected by using the ten keys 10b to 10k and the channel enter key 10l or the channel key 10o , such a screen 12f as shown in fig6 is displayed . under this state , the pictures except the characters are masked and the sound is muted too . next , if the user &# 39 ; s code is entered by selecting from the ten keys , the code number is entered and the display is changed as shown by a screen 12g . next , if the code enter key 10n is depressed , it is judged whether the input code is coincident with the registered code or not . if they are coincident with each other , the character data &# 34 ; code ok &# 34 ; is displayed as shown by a screen 12h . then , the masking of the picture screen and the muting of the sound are both released and after a predetermined time , for example , about four seconds later , the characters are erased . if not , the program is returned to the step at which the screen 12f is to be displayed . at first , the channel that the user wants to block is selected and then the code verification is carried out in accordance with the procedure of the above - described ( b ). next , when the block set key 10s is depressed , such a screen 12i as shown in fig7 is displayed . at this time , although the sound is not muted , the pictures , except the characters are masked . in this case , the channel , which is displayed on the upper right hand side of the screen , is blocked . then , after a predetermined time , for example , after about four seconds , the displayed picture screen is returned to the normal picture screen . accordingly , even when the channel is changed over next time or the power source is switched on , the registered channel has been still blocked . at first , the blocked channel is selected and the code verification is carried out in accordance with the procedure described in the above ( b ). next , when the block clear key 10t is depressed , such a picture screen 12j as shown in fig8 is displayed . at this time , although the sound is not muted , the picture except the characters is masked . then , after a predetermined time , for example , after about four seconds , the picture screen is returned to the normal picture screen and the registered block channel is canceled . at first , the code verification is carried out in accordance with the procedure ( b ) and then a new code is registered in accordance with the procedure ( a ). as described above , the block display and the setting thereof can be carried out by the remote control pad 10 . when the reception block data as shown in fig3 is transmitted from the transmitting side , if the user wishes to release this reception block control , it is sufficient for the user to carry out the operation in accordance with the procedure ( b ). thus the picture screen blocked by the transmitting side can be seen . as set forth above , according to this invention , since the on - screen display information from the transmitting side is received and then interpreted , the content of such information is displayed as characters on the screen of the crt and the on - screen display can be also controlled by the operation of the remote control pad at the receiving side , the reason the reception of the channel is blocked will be known instantaneously by just viewing the screen so that the user can enter a next operation step easily . further , control of the reception block set by the user and control of the reception block control set by the transmitting side can be easily accomplished by the remote control pad while observing the on - screen display information . further , the character pattern prepared by the receiving side can be displayed on the screen by an instruction from the transmitting side , and all the channels that can be received can be subjected to the reception block state . furthermore , in other cases than the reception block control , such as an emergency broadcast , it is also possible to use the on - screen display command by the transmitting side . in addition , since the processing is carried out fully in the electronic fashion , no matter what command the transmitting side transmits , the user can cope with such command by one remote control pad . the above description sets forth a single preferred embodiment of the invention but it will be apparent that many modifications and variations could be effected by one skilled in the art without departing from the spirit of scope of the novel concepts of the invention . accordingly , the scope of the present invention should be determined by the scope of the appended claims .
| 7 |
the method according to the invention for the determination of platelet function comprises several methodological steps . for the simulation of the physiological flow conditions prevailing in small arteries the blood that is initially located in a reservoir is passed though a capillary that preferably has a diameter of about 200 μm . the capillary leads into a measurement chamber that is separated into two compartments by a partition member . the partition member has an opening through which the blood is passed from the first into the second compartment . the method of the invention is characterized in that the partition member used comprises an activator of purinergic receptors and an activator of intracellular adenylate cyclases whereby the blood flowing through the opening of the partition member is brought into contact with these substances contained in or on the partition member . as a result of the platelet aggregation that is induced by the contact with the substances a thrombus forms at the opening of the partition member . the time that is necessary for the formation of the thrombus at the opening of the partition member up to closure of the opening is measured . preferably the closure time is measured in that an apparatus is used that comprises a pressure sensor which determines the blood flow through the aperture during the test . thus , after initial rapid aspiration of the dead volume of the test cartridge the initial flow rate is first determined . if the flow rate falls below 10 % of this initial flow rate for more than 3 seconds the measurement is ended and the time passed until then is recorded as the so - called closure time . this so - called closure time , which is i . a . dependent on the aggregation reaction of the stimulated platelets , is a measure of platelet function . preferably the closure time that was measured for a whole blood sample of a patient is compared with a closure time reference range for whole blood samples of healthy subjects . preferably the blood flow through the capillary and through the opening of the partition member is produced by creating a partial vacuum in the measurement chamber , that is by suction . in a particularly preferred embodiment the partial vacuum is produced by the combined action of a suitable test cartridge and an apparatus . an example of such a system is described , for example , in patent specification wo 97 / 034698 . the partition member used in the method according to the invention comprises an activator of purinergic receptors , preferably from the group adenosine - 5 ′- diphosphate ( adp ), 2 - methylthioadenosine - 5 ′- diphosphate ( 2 - mesadp ) and their derivatives . in a preferred embodiment a partition member is used that comprises an adp salt or a 2 - mesadp salt . in a preferred embodiment a partition member is used that comprises 1 to 100 μg , especially preferred 5 to 50 μg , particularly preferred 20 to 25 μg adp . the partition member used comprises further an activator of intracellular adenylate cyclases , preferably from the group prostaglandin e1 ( pge 1 ), forskolin and its water - soluble derivatives , prostaglandin 12 and its stable derivatives , iloprost and cicaprost . in a preferred embodiment a partition member is used that comprises 1 to 1000 ng , especially preferably 3 to 20 ng prostaglandin e1 . in another preferred embodiment a partition member is used that comprises 0 . 1 to 10 μg , especially preferred 0 . 5 to 5 μg forskolin . in an especially preferred embodiment of the method a partition member is used that comprises adp and prostaglandin e1 . in a further preferred embodiment of the method according to the invention a partition member is used that also comprises calcium ions , preferably in the form of calcium chloride dihydrate . in a preferred embodiment a partition member is used that comprises 50 to 200 μg , especially preferred 100 to 150 μg , most especially preferred 125 μg calcium ions in the form of calcium chloride dihydrate . it was found that in the presence of calcium ions the platelet aggregation inhibitory effect of acetylsalicylic acid ( asa ) is reduced so considerably that an accurate determination of the platelet aggregation inhibitory ( antithrombotic ) effect of other platelet aggregation inhibitors such as , for example , p2y ( 12 ) antagonists such as clopidogrel is also possible in such samples that comprise asa . a partition member that comprises calcium ions is thus especially then to be used in the method according to the invention when the whole blood sample to be investigated is anticoagulated with a calcium - binding anticoagulant . if the whole blood sample to be investigated is anticoagulated with a non - calcium - binding anticoagulant such as , for example , with a direct thrombin or factor xa inhibitor , the calcium ion concentration contained endogenously in the sample is sufficient to reduce an asa - induced platelet dysfunction . nevertheless , a partition member that comprises calcium ions can also be used in these cases . the method according to the invention is used most preferably for the determination of the antithrombotic ( platelet aggregation inhibitory ) effect of a p2y ( 12 ) antagonist , especially for the determination of a p2y ( 12 ) antagonist from the group clopidogrel , ticlopidine , prasugrel ( synonym : cs - 747 ) and other thienopyridines , ar - c67085mx ( 2 - propylthio - d - β , γ - dichloromethylene - adenosine - 5 ′- triphosphate ), cangrelor ( synonym : ar - c69931 mx , n6 -[ 2 - methylthio ) ethyl ]- 2 -( 3 , 3 , 3 - trifluoropropyl ) thio - 5 ′- adenylic acid ), c1330 - 7 ( n1 -( 6 - ethoxy - 1 , 3 - benzothiazol - 2 - yl - 2 -( 7 - ethoxy - 4 - hydroxy - 2 , 2 - dioxo - 2h - 2 - 6benzo [ 4 , 5 ][ 1 , 3 ] thiazole [ 2 , 3 - c ][ 1 , 2 . 4 ] thiadiazin - 3 - yl )- 2 - oxo - 1 - ethanesulfonamide ), azd 6140 ( nucleoside analogs ), mrs 2395 ( 2 , 2 - dimethyl - propionic acid 3 -( 2 - chloro - 6 - methylaminopurin - 9 - yl )- 2 -( 2 , 2 - dimethyl - propionyloxymethyl )- propyl ester ) and 2 - mesamp ( 2 - methylthioadenosine - 5 ′- monophospate ). surprisingly , it was also found that the method according to the invention can also be used for the determination of the antithrombotic ( platelet aggregation inhibitory ) effect of a p2y ( 1 ) antagonist . in particular , the method can be used for the determination of the antithrombotic effect of p2y ( 1 ) antagonists from the group mrs 2179 [ 2 ′- deoxy - n - 6 - methyladenosine - 3 ′, 5 ′- bisphosphate , diammonium salt ], mrs 2279 [( n )- methanocarba - n - 6 - methyl - 2 - chloro - 2 ′ deoxyadenosine - 3 ′, 5 ′- diphosphate ], mrs 2500 [ 2 - iodo - n - 6 - methyl -( n )- methanocarba - 2 ′- deoxyadenosine - 3 ‘ 5 ’- diphosphate ], a2p5p [ adenosine - 2 ′, 5 ′- diphosphate ], a3p5p [ adenosine - 3 ′, 5 ′- diphosphate ], a3p5ps [ adenosine - 3 ′- phosphate - 5 ′- phosphosulfate ]. a further object of the present invention concerns a device , as for example a test cartridge , which is suitable for the determination of platelet function in a whole blood sample wherein the device comprises different elements : a ) a reservoir for storing the sample ; b ) a capillary through which the blood is passed from the reservoir into a measurement chamber ; c ) a measurement chamber that is separated into two compartments by a partition member , wherein the first compartment receives the blood from the capillary ; d ) a partition member which divides the measurement chamber into two compartments and which has an opening through which the blood can flow from the first compartment into the second compartment . the device is characterized in that the partition member comprises an activator of purinergic receptors and an activator of intracellular adenylate cyclases . in one preferred embodiment the partition member also comprises calcium ions , preferably in the form of calcium chloride dihydrate . the partition member is a porous or nonporous support matrix for an activator of purinergic receptors and an activator of intracellular adenylate cyclases and optionally for calcium ions . preferably the partition member is constructed in the form of a membrane . the preferred material is liquid absorbing so that the aforementioned substances can be applied in solution . especially preferred materials are cellulose esters , ceramic , nylon , polypropylene , polyether sulfone , and polyvinylidene fluoride ( pvdf ). preferably the partition member wetted or soaked with the desired substances is dried . by contact of the blood with the partition member the substances are dissolved from the partition member and mix with the blood sample . the partition member preferably has a circular opening that is produced in the support matrix by punching . the diameter of the opening in the partition member is so dimensioned that a thrombus can form under the conditions of the respective method which closes the opening and can thus stop the blood flow . preferably the opening in the partition member has a diameter between approximately 100 μm and approximately 200 μm . particularly preferably the diameter of the opening in the partition member is about 100 μm . the device according to the invention is preferably so constructed that a partial vacuum that brings about a blood flow from the reservoir through the capillary into the measurement chamber and through the opening of the partition member is produced in the device with the help of an apparatus that is integrated with components of the device . the present invention further relates to the use of a device according to the invention in a method for the determination of platelet function . a preferred use of a device according to the invention relates to the use for the determination of the antithrombotic effect of a p2y ( 12 ) antagonist . another preferred use of a device according to the invention relates to the use for the determination of the antithrombotic effect of a p2y ( 1 ) antagonist . the following embodiment examples serve to illustrate the method according to the invention and are not to be understood as limiting . fig1 shows by way of example how a device for the determination of platelet function according to the invention can be constructed . shown is a test cartridge in accordance with wo 97 / 34698 in longitudinal section that is placed in a suitable apparatus for implementing the method according to the invention and into which extends a vacuum apparatus ( 15 ) that is responsible for the generation of the partial vacuum the vacuum apparatus ( 15 ) has a ring gasket ( 27 ) which is located as a seal on the circumferential edge ( 12 ) of the sample container ( 10 ). the test cartridge has a housing that forms a reservoir ( 61 ) and a test chamber ( 63 ). the test chamber ( 63 ) is constructed to accept a sample container ( 10 ) the cavity of which can also be referred to as measurement chamber . the sample container ( 10 ) supports a partition member ( 6 ) treated with reagents and with a central opening ( aperture ) and a capillary attachment ( 30 , 31 ) that connects the capillary ( 40 ) with the sample container ( 10 ). reservoir ( 61 ) and test chamber ( 63 ) are separated by a penetrable element ( 70 ). the figure shows a phase of the test cycle after the vacuum apparatus ( 15 ) is in contact with sample container ( 10 ) and has moved downwards so that the base of the sample container ( 10 ) is in contact with the support ( 71 ) and the capillary ( 40 ) has penetrated the penetrable element ( 70 ) and penetrated into the sample ( 11 ). the apparatus produces a partial vacuum in the sample container ( 10 ) by means of which the sample ( 11 ) is pulled through the capillary ( 40 ) into the first compartment ( 18 ) of the measurement chamber and then through the opening in the partition member ( 6 ). diagram for the illustration of closure times ( in seconds [ s ]) for normal untreated whole blood samples ( control ) and for whole blood samples that had been treated with the p2y ( 12 ) antagonist mrs 2395 and / or the cox - 1 inhibitor acetylsalicylic acid ( asa ) in vitro ( see example 2 ). whole blood samples from 11 healthy donors anticoagulated with sodium citrate were used . on the left of the diagram are shown the mean values and the standard deviations of the closure times determined with the adp / pge1 / calcium test cartridge according to the invention ( cut - off : 81 seconds ). on the right of the diagram are shown the mean values and the standard deviations of the closure times that were determined for comparison with conventional col / epi test cartridges ( cut - off : 158 seconds ). a comparison of the two types of test cartridge shows that with use of an adp / pge1 test cartridge according to the invention , closure times that lie significantly above the upper reference value ( cut - off ) were measured with samples that were treated with the p2y ( 12 ) antagonist mrs 2395 , whereas the same samples with the use of a col / epi test cartridge lie to a greater extent below the upper reference value ( cut - off ). that means that the method for determination of platelet function according to the invention allows a more sensitive determination of platelet dysfunction induced by a p2y ( 12 ) antagonist than the comparison method from the prior art . diagram for illustration of the closure times ( in seconds [ s ]) for normal untreated whole blood samples ( control ) and for whole blood samples treated in vitro with the p2y ( 12 ) antagonist mrs 2395 , the p2y ( 1 ) antagonist mrs 2179 or the cox - 1 inhibitor acetylsalicylic acid ( asa ) ( see example 4 ). whole blood samples from 10 healthy donors anticoagulated with ppack were used . in the diagram are shown the mean values and the standard deviations of the closure times that were determined with the adp / pge1 test cartridges according to the invention ( cut - off : 90 seconds ). the performance evaluation shows that with use of an adp / pge1 test cartridge according to the invention , closure times that lie significantly above the reference value ( cut - off ) were measured with samples that were treated with the p2y ( 12 ) antagonist mrs 2395 or the p2y ( 1 ) antagonist mrs 2179 , whereas the samples treated with cox - 1 inhibitor acetylsalicylic acid show no prolongation of closure times and thus lie below the cut - off . for the preparation of a partition member for a test cartridge according to the invention a polyether sulfone filter membrane ( supor ®) membrane , pall gmbh , dreieich , germany ) was cut into strips . 1 μl of a solution comprising 7 μg / μl adp ( adenosine - 5 ′- diphosphate potassium salt . 2h 2 o , sigma - aldrich chemie gmbh , steinheim , germany ) and 5 ng / μl pge1 ( prostaglandin e1 , sigma - aldrich chemie gmbh , steinheim , germany ) and 367 . 5 μg / μl cacl 2 . 2h 2 o ( equivalent to 100 μg / μl ca 2 + ions ) were pipetted punctiform onto the membrane and the membrane was dried . next a circular opening ( aperture ) with a diameter of 100 μm was punched out of the middle of the region of the membrane treated with the reagents . the membrane thus prepared was used as partition member in the measurement chamber of a pfa - 100 ® test cartridge ( dade behring marburg gmbh , marburg , germany ). use of an adp / pge1 / calcium test cartridge according to the invention for the determination of the antithrombotic effect of a p2y ( 12 ) antagonist in vitro venous blood was taken from 11 healthy donors and anticoagulated with sodium citrate ( 3 . 2 % buffered na citrate ). aliquots of the citrated whole blood sample were treated in vitro with the p2y ( 12 ) antagonist mrs 2395 ( sigma - aldrich chemie gmbh , steinheim , germany ). for this purpose an ethanolic mrs 2395 stock solution ( 15 mg / ml ) was mixed with the whole blood samples so that an end concentration of 100 μmol / l was obtained . further aliquots of the citrated whole blood samples were treated in vitro with the cox - 1 inhibitor acetylsalicylic acid ( abbr . : asa ; sigma - aldrich chemie gmbh , steinheim , germany ). for this purpose an aqueous asa stock solution ( 1 mg / ml ) was mixed with whole blood samples so that an end concentration of 30 μmol / l was obtained . further aliquots of the citrated whole blood samples were treated in vitro with mrs 2395 and with asa so that the previously stated end concentrations were achieved . after addition of the reagents the blood samples were incubated at room temperature for 5 minutes . 2b ) determination of the antithrombotic effect of mrs 2395 by adp induced light transmission aggregometry ( according to born ) in order to check whether the samples treated with mrs 2395 actually show a reduced platelet aggregation , platelet rich ( prp ) and platelet poor ( ppp ) plasma was prepared from aliquots of the untreated and mrs 2395 - treated whole blood samples described under example 2a ), and the samples were then treated with 2 μm adp . the ppp samples were used as blank controls . the photometric measurement of the aggregation reaction was carried out in the automated coagulation apparatus bct ® ( dade behring marburg gmbh , marburg , germany ) under continuous stirring ( 600 rpm ). the platelet aggregation of the samples treated with mrs 2395 was reduced by a mean of 27 % compared with the platelet aggregation of the untreated samples . 2c ) determination of the antithrombotic effect of mrs 2395 by the method according to the invention under flow conditions to determine the closure time as a measure of platelet function the whole blood samples described under example 2a ) were investigated with the aid of the adp / pge1 / calcium test cartridge according to the invention described in example 1 in a pfa - 100 ® apparatus ( platelet function analyzer - 100 , dade behring marburg gmbh , marburg , germany ). for this purpose 700 μl of a blood sample were placed in the reservoir of the temperature equilibrated test cartridge (+ 37 ° c .) and incubated at + 37 ° c . for 3 minutes . next a partial vacuum of − 40 mbar was generated by the apparatus by which means the blood was sucked through a capillary from the reservoir ( diameter 200 μm ) and finally through an opening ( aperture ) of the partition member in the measurement chamber . the time required up to the closure of the aperture by formation of a blood clot was determined as closure time . every sample investigated was determined in duplicate and the mean value of a duplicate determination was used as the measurement value . for comparison purposes the whole blood samples described under example 2a ) were investigated in parallel with a known col / epi pfa - 100 ® test cartridge ( 2 μg collagen and 10 μg epinephrine on the membrane ; 150 μm aperture diameter ; dade behring marburg gmbh , marburg , germany ) in the pfa - 100 ® apparatus . the results of the investigations are summarized in fig2 and the relevant figure description . in table 1 details are reported for how many of the respective 11 mrs 2395 - and / or acetylsalicylic acid - treated samples a closure time above the cut - off was measured with the aid of the adp / pge1 test cartridge according to the invention and with the conventional col / epi test cartridge . in 9 of the 11 samples treated with mrs 2395 an abnormally reduced platelet aggregation was measured with the aid of the method according to the invention , whereas only 4 of 11 samples were classified as abnormal with the aid of the conventional method . that means that the method according to the invention has an increased sensitivity for a platelet dysfunction induced by a p2y ( 12 ) antagonist . moreover , it is of advantage that in the presence of free calcium ions the method according to the invention has a very low sensitivity for acetylsalicylic acid . in only one of 11 acetylsalicylic acid - treated samples , an abnormally reduced platelet aggregation is measured with the aid of the method according to the invention , whereas , in contrast , with the conventional col / epi test cartridge 8 of the 11 samples treated with acetylsalicylic acid were determined as abnormal . samples that are treated with mrs 2395 and acetylsalicylic acid are classified 100 % as abnormal with the aid of the conventional method , whereas only 9 of the 11 samples ( as with sole addition of mrs 2395 ) are classified as abnormal with the method according to the invention . thus on the basis of its high sensitivity for platelet dysfunction induced by p2y ( 12 ) antagonists and its low sensitivity to platelet dysfunction induced by acetylsalicylic acid , the method according to the invention is suitable for differentiation of the two classes of antithrombotics . venous blood was taken from healthy donors and anticoagulated with sodium citrate ( 3 . 2 % buffered na citrate ). the closure time determination was carried out for each whole blood sample in the pfa - 100 ® apparatus . samples from 186 donors were determined in duplicate with a col / epi pfa - 100 ® test cartridge [ see example 2c )]. samples from 159 donors were determined in duplicate with an adp / pge1 / calcium test cartridge according to the invention [ see examples 1 and 2c )]. the reference ranges ( normal range ) for the col / epi closure time and the adp / pge1 closure time were established in that the measurement value ranges in which 90 % of the measurement values found for the healthy subjects lay were determined ( 90 % central interval of the normal distribution of all measurements ). this gave the following reference ranges for the closure times : the upper reference limit of the reference range was defined as cut - off , i . e . as threshold value , for a platelet dysfunction . if the closure time of a patient sample deviates from the reference range it can indicate a platelet dysfunction . this means col / epi closure times that are greater than 158 seconds and adp / pge1 closure times that are greater than 81 seconds indicate the presence of a platelet dysfunction within the sense of a reduced aggregation efficiency . use of an adp / pge1 test cartridge according to the invention for the determination of the antithrombotic effect of the p2y ( 12 ) antagonist clopidogrel ex vivo venous blood was taken from 13 patients suffering from peripheral arterial obstructive disease and who had been treated with a daily dose of 75 mg clopidogrel ( plavix ®, sanofi - aventis ) as sole antithrombotic for a period of at least 4 weeks and the blood was anticoagulated with sodium citrate ( 3 . 8 % buffered na citrate ). the samples were investigated with the aid of different methods to determine platelet function . 1 . according to the invention under flow conditions and use of an adp / pge1 / calcium pfa - 100 ® test cartridge ( see examples 1 and 2c ), cut - off : & gt ; 81 seconds ; 2 . under flow conditions and use of a pfa - 100 ® test cartridge that differed from the test cartridge according to the invention in accordance with example 1 in that it comprised no pge1 , cut - off : & gt ; 78 seconds ; 3 . with adp - induced light transmission aggregometry ( according to born ) with addition of 2 μm adp ( see example 2b ), cut - off : & lt ; 40 % light transmission at end of test ; 4 . with adp - induced light transmission aggregometry ( according to born ) with the addition of 5 μm adp ( see example 2b ), cut - off : & lt ; 40 % light transmission at end of test . this method is recommended by sanofi - aventis , the manufacturer of the clopidogrel preparation plavix ®, for the determination of the antithrombotic effect of the medicament . the cut - offs for the individual test procedures were determined by preliminary investigations with whole blood and plasma samples of normal donors . table 2 presents in detail with which of the four methods in which of the 13 patient samples an antithrombotic effect of clopidogrel could be detected . “+” means an antithrombotic effect could be detected . “−” means no antithrombotic effect could be detected . “ 0 ” means that the duplicate determination gave contradictory results , i . e . one value above and one value below the cut - off . with the aid of the method of the invention the antithrombotic effect of clopidogrel intake could be detected in 10 of the 13 patients ( 77 %). the duplicate determination gave contradictory results with one patient ( patient no . 2 ), whilst with 2 patients ( patient no . 1 and 6 ) no reduced platelet aggregation could be detected . however , in these two patients an effect of dosage of clopidogrel could not be detected in any of the methods used . the method according to the invention is more sensitive towards the platelet dysfunction induced by clopidogrel than the standard method of adp - induced light transmission aggregometry according to born and more sensitive than the method with which a test cartridge is used that comprises adp but no pge1 . use of an adp / pge1 test cartridge according to the invention for the determination of the antithrombotic effect of a p2y ( 12 ) and a p2y ( 1 ) antagonist in vitro venous blood was taken from 10 healthy donors and anticoagulated with 75 μm ppack . aliquots of the whole blood samples were treated in vitro with the p2y ( 12 ) antagonist mrs 2395 ( sigma - aldrich chemie gmbh , steinheim , germany ). for this purpose an ethanolic mrs 2395 stock solution ( 15 mg / ml ) was mixed with the whole blood samples so that an end concentration of 150 μmol / l was obtained . further aliquots of the whole blood samples were treated in vitro with the cox - 1 inhibitor acetylsalicylic acid ( abbr . asa ; sigma - aldrich chemie gmbh , steinheim , germany ). for this purpose an aqueous asa stock solution ( 1 mg / ml ) was mixed with the whole blood samples so that an end concentration of 30 μmol / l was obtained . further aliquots of the whole blood samples were treated in vitro with the p2y ( 1 ) antagonist mrs 2179 ( sigma - aldrich chemie gmbh , steinheim , germany ). for this purpose an aqueous mrs 2179 stock solution ( 1 mg / ml ) was mixed with the whole blood samples so that an end concentration of 75 mol / l was obtained . after addition of the reagents the blood samples were incubated at room temperature for 5 minutes . 4b ) determination of the antithrombotic effect of mrs 2395 and mrs 2179 with the aid of the method according to the invention under flow conditions for the determination of the closure time as a measure of the platelet function the whole blood samples described under example 4a ) were investigated with the aid of a adp / pge1 test cartridge according to the invention in a pfa - 100 ® apparatus ( platelet function analyzer - 100 , dade behring marburg gmbh , marburg , germany ). the adp / pge1 test cartridge according to the invention used was prepared essentially as described in example 1 but without the partition member having been treated with cacl 2 . 2h 2 o . the test cartridge thus comprised 7 μg adp and 5 ng pge1 but no calcium ions . 700 μl of a blood sample was added to the reservoir of the temperature equilibrated test cartridge (+ 37 ° c .) and incubated at + 37 ° c . in the apparatus for 3 minutes . next a partial vacuum of − 40 mbar was applied by the apparatus when the blood was sucked through a capillary ( diameter 200 μm ) from the reservoir and finally through an opening ( aperture ) of the partition member in the measurement chamber . the time that was required up to the closure of the aperture by formation of a blood clot was determined as closure time . every sample investigated was determined in duplicate and the mean value of a duplicate determination was used as the measurement value . the results of the investigations are summarized in fig3 and the relevant figure description . in table 3 details are given for how many of the respective 10 mrs 2395 -, mrs 2179 - or acetylsalicylic acid - treated samples a closure time above the cut - off was measured with the aid of the adp / pge1 test cartridge according to the invention . in 9 of the 10 samples treated with mrs 2395 and in 10 of the 10 samples treated with mrs 2179 an abnormally reduced platelet aggregation was measured with the aid of the method of the invention , whereas none of the samples treated with acetylsalicylic acid was classified as abnormal . this means that the method according to the invention has a high sensitivity for a platelet dysfunction induced both by a p2y ( 12 ) antagonist and by a p2y ( 1 ) antagonist . moreover , it is of advantage that the method according to the invention has a very low sensitivity for acetylsalicylic acid in the presence of free calcium ions . thus on the basis of its high sensitivity for platelet dysfunction induced by adp receptor antagonists and its low sensitivity towards platelet dysfunction induced by acetylsalicylic acid the method according to the invention is suitable for differentiation of the two classes of antithrombotics . owing to the use of ppack as anticoagulant the cut - off determined with citrated whole blood in the above - described examples cannot be used . therefore , the reference range for the adp / pge1 closure time from the 10 samples of the healthy donors treated with ppack was calculated by the determination of the 90 % central interval of the normal distribution of the mean values of the duplicate determinations . this gave the following reference ranges for the closure times : the upper limit of the 90 % central interval was defined as cut - off , i . e . as threshold value for a platelet dysfunction .
| 6 |
modern ics comprise a multiplicity of components or modules of different complexity and different construction . in this case , in order to obtain higher system integration , analog and digital modules are also realized on one and the same ic . by way of example , an ic may comprise one or more a / d converters , d / a converters , logic units , memory areas and also a microprocessor or a microcontroller as different modules . in the field of mobile radio applications , analog radiofrequency components ( e . g . mixing stages ) are realized together with digital baseband assemblies ( e . g . digital filters ) on an ic . a further example of ic - integrated modules is task - specific hardware data paths which execute specific predetermined computation tasks in sequential logic . a module in the sense of the invention is thus an essentially autonomous functional unit or assembly in an ic which cooperates with other components or further switchable modules of the ic , the module generally participating in specific shared resources such as , for example , the power supply or clock generation of the ic . fig1 shows , in a simplified illustration , the construction of such an ic 1 in the form of a block diagram . the ic 1 comprises a central processing unit ( cpu ) 2 and a plurality of further modules 2 . 1 , 2 . 2 and 2 . 3 . the modules 2 . 1 to 2 . 3 perform different , task - specific functions of the ic 1 and may be realized for example in the form of the abovementioned functional units . the ic 1 furthermore comprises a clock generating circuit 3 , which is constructed from a clock generator 3 . 1 and a clock divider 3 . 2 in the example illustrated here . the clock generator 3 . 1 is operated by an external oscillating crystal 7 . it generates a fixed clock frequency which is fed to the clock divider 3 . 2 via a line 8 . a control circuit 4 is connected both to the clock divider 3 . 2 and to the central processing unit 2 via bi - directional data connections 5 and 6 . the clock divider 3 . 2 generates the clock signals for the central processing unit 2 and the diverse modules 2 . 1 , 2 . 2 and 2 . 3 . the clock lines via which the clock signals are passed to the units and modules mentioned are designated by the reference symbol 9 ( for the cpu 2 ), 9 . 1 ( for the module 2 . 1 ), 9 . 2 ( for the module 2 . 2 ) and 9 . 3 ( for the module 2 . 3 ) in fig1 . by way of example , the module 2 . 2 is intended to be switched to an operating state with a low power consumption on account of low capacity utilization . the possibility of effecting lower clocking of the module 2 . 2 is recognized in the central processing unit 2 and corresponding information is sent to the control circuit 4 via the data connection 6 . the operating states and clock frequencies of the central processing unit 2 and of all the modules 2 . 1 , 2 . 2 and 2 . 3 may be known to the control circuit 4 , which may simultaneously be a state monitoring device , or are communicated to said control circuit via the data connections 6 and 5 , respectively . with such system information optionally being taken into account , the control circuit 4 instructs the programmable frequency divider 3 . 2 to reduce the clock frequency for the module 2 . 2 to a desired target value . this target value may either be determined in variable fashion by the central processing unit 2 or be fixedly predetermined . a special case exists when the module 2 . 2 is intended to be disconnected . in this case , the target value is 0 hz . however , the frequency divider 3 . 2 does not perform an abrupt change of the clock frequency for the module 2 . 2 to the target value , but rather carries out a slow transition in the frequency from its original value to the target value . this may be effected either in a plurality of discrete steps or in continuous fashion . on account of the fact that a specific , predetermined time duration for the transition is not undershot , the occurrence of transients can be avoided or limited as desired . the transition time duration may either be a system - wide fixed time duration for all the modules 2 . 1 , 2 . 2 and 2 . 3 or the time duration may be determined individually for each module 2 . 1 , 2 . 2 , 2 . 3 . furthermore , the time duration can be set by the control circuit 4 taking account of the type of state change ( e . g . switching - on or disconnection ) and / or the load change associated with the changeover and , if appropriate , taking account of further system parameters which are dependent on the state of other modules 2 . 1 , 2 . 2 , 2 . 3 . fig2 diagrammatically shows a second exemplary embodiment of the invention . the same or functionally comparable parts are identified by the same reference symbols as in fig1 . the essential difference between the first exemplary embodiment illustrated in fig1 and the second exemplary embodiment illustrated in fig2 is that , in the second exemplary embodiment the transition of a module 2 . 1 , 2 . 2 or 2 . 3 from a first operating state to a second operating state is effected by a change in the supply voltage of the corresponding module . in this respect , the reference symbol 3 . 1 ′ designates a circuit for generating a supply voltage and the reference symbol 3 . 2 ′ designates a circuit for controlling and altering the supply voltage obtained from the circuit 3 . 1 ′ via the line 8 . the reference symbol 10 designates an external power source , for example a battery , and the reference symbol 3 . 2 ″ designates a circuit for generating the supply voltages for the central processing unit 2 and the modules 2 . 1 , 2 . 2 and 2 . 3 . the supply voltage lines via which the supply voltages are passed to the modules mentioned are designated by the reference symbols 9 ′ ( for the cpu 2 ), 9 . 1 ′ ( for the module 2 . 1 ), 9 . 2 ′ ( for the module 2 . 2 ) and 9 . 3 ′ ( for the module 2 . 3 ) in fig2 . the functioning of the components of the ic 1 ′ is analogous to the functioning of the components of the ic 1 . the analogy consists in the fact that operating voltages or operating voltage changes and associated switching processes are now considered instead of clock frequencies or clock frequency changes . in order to avoid repetition , reference is made to the description concerning the first exemplary embodiment in the sense of this analogy . a further exemplary embodiment of the invention is likewise explained with reference to fig2 . the module 2 . 2 to be switched is supplemented by a dummy load , which is intended to be represented here by the reference symbol 2 . 3 . unlike in the first or second exemplary embodiment of the invention , the switching process with regard to the module 2 . 2 can now be carried out abruptly . at the same time , the dummy load 2 . 3 is likewise supplementarily connected abruptly . the dummy load 2 . 3 is dimensioned such that it precisely compensates for the load change effected by the switching of the module 2 . 2 . since , as a consequence , no or only a very small overall load change is associated with the switching process , the occurrence of transients is effectively suppressed . the dummy load 2 . 3 may be of adjustable magnitude , as a result of which two different things are achieved : firstly , it can be used during switching processes for different load changes or modules . secondly , it can be slowly choked after supplementary connection , as a result of which the overall load — and thus the current consumption — is reduced again in a desired manner . in a further exemplary embodiment , not specifically illustrated , the module to be switched is constructively subdivided into a plurality of submodules which are individually switchable . the switching of the module is carried out in the form of sequential switching of the individual submodules , so that the module , e . g . during disconnection , is ramped down section by section ( i . e . submodule by submodule ). it is pointed out that all the exemplary embodiments can be combined . in other words , it is conceivable for the ic to comprise both functional elements which are put into different states by means of a protracted switching process for the operating voltage and to comprise modules in which operating state changes are brought about by a protracted frequency change . furthermore , it is possible to provide abrupt switching processes with supplementary connection or disconnection of the dummy load of suitable magnitude or sequential disconnection of a module subdivided into submodules . with regard to an individual module , too , it is possible , in principle , for a plurality of the possibilities mentioned to be realized . in this case , an integrated circuit according to the invention comprises e . g . both frequency and voltage control devices which may be embodied in accordance with the circuits 3 and 3 ′ and are provided with corresponding peripherals 7 , 10 . furthermore , the dummy load 2 . 3 is required if the intention is to realize changeovers with the participation of a dummy load 2 . 3 .
| 7 |
additional advantages of the present invention will become readily apparent to those skilled in this art from the following detailed description , wherein preferred embodiments of the invention are shown and described in the disclosure , simply by way of illustration of the best mode contemplated for carrying out the invention . as will be realized , the invention is capable of other and different embodiments , and its several details are capable of modifications in various obvious respects , all without departing from the invention . accordingly , the drawings and description are to be regarded as illustrative in nature , and not as restrictive . an invention of processing steps is disclosed which significantly reduce the resistivity and increase thermal stability of annealed refractory metal silicide films . the processing steps reduce agglomeration at the interface of the refractory metal silicide film and an underlying layer of polysilicon or silicon . the processing steps are useful as part of a general method for fabrication of mosfet structures , a preferred embodiment of which is disclosed below . in the following description , numerous details are set forth , such as specific materials , process parameters , etc ., in order to provide a thorough understanding of the present invention . it will be obvious to one skilled in the art , however , that these specific details need not be employed precisely as described to practice the present invention . in other instances , well - known processing steps are not described in detail so as not to detract from the various details of the embodiments of the invention . in an embodiment of the present invention , referring to fig1 a thermally grown field oxide film 11 is formed on a p - type or n - type silicon substrate 10 with exposed active areas corresponding to the geometries of the mosfet structures that are to be fabricated . after cleaning , an insulating film 12 , typically sio 2 , is grown on the entire exposed surface of the substrate . a polysilicon layer 13 is then deposited over the insulating film , preferably using lpcvd . other methods for depositing polysilicon layer include pecvd ( pressure enhanced chemical vapor deposition ), apcvd ( atmospheric pressure chemical vapor deposition ), and sputtering . polysilicon layer 13 is formed according to one of the foregoing processes at a temperature in a range from about 50 ° c . to about 900 ° c . referring to fig2 a first diffusion barrier matrix 17 is then implanted within polysilicon layer 13 with nitrogen . first diffusion barrier matrix 17 is implanted at a predetermined depth range corresponding to where the interface will be situated between polysilicon layer 13 and a layer of titanium silicide to be formed after a subsequent annealing step . in the preferred embodiment , first diffusion barrier matrix 17 is a 2 × 10 13 cm - 2 14 n + implant dose at an energy of about 22 kev , although other dopants such as phosphorus , or metals such as molybdenum , tungsten , or cobalt could also be used . other dopant concentrations could also be used but a low dose close to the value stated herein is preferable . first diffusion barrier matrix 17 is used to limit the diffusion of silicon along columnar grain boundaries which form in the polysilicon layer during annealing . ion implantation is conducted by providing an ion source from which the implanted ions are generated . the ion source may be , for example , phosphorus , nitrogen , or other suitable materials contemplated by the invention . the wafer is then patterned and insulating film 12 and polysilicon layer 13 are etched to form a polysilicon gate structure consisting of a gate oxide layer 12 and a polysilicon gate layer 13 . insulating side wall spacers 15 are then formed by conventional processing . a second matrix 18 is then implanted in the surface . second matrix 18 may comprise , for example , nitrogen ions . alternatively , other materials , such as phosphorus ions , molybdenum ions , tungsten ions , or cobalt ions may be used in second matrix 18 . the primary function of this step is to control salicidation and for silicide surface smoothing on the surface . the first and second implanted matrixes assist a smooth silicide / polysilicon interface and a smooth silicide surface , respectively . a metallization layer 19 of ti material is next deposited on polysilicon layer 13 using a standard pvd process . the pvd process is conducted in a temperature range of between 100 ° c . and 300 ° c . alternatively , metallization layer 19 may also be a refractory metal material that is next deposited on polysilicon gate layer 13 preferably using a standard pvd process . refractory metal materials according to the present invention include at least titanium , tungsten , cobalt , and molybdenum and combinations thereof . the structure is then subjected to a salicidation anneal . a first salicidation anneal is performed in nitrogen at 750 ° c . for 20 seconds . a conventional blanket etch is then performed to remove all unreacted titanium metal from the top layer that did not form polycide or salicide structures . a second salicidation anneal is then performed in nitrogen at 825 ° c . for 10 seconds to fully convert all of the remaining silicide structures to the c54 phase . alternatively , the anneals may be conducted according to other process parameters . for example , an anneal may include rapid thermal processing at about 1 , 000 ° c . for about 20 seconds . the overall finished mosfet gate structure appears as shown in fig3 . metallization layer 19 of fig2 has combined with polysilicon gate layer 13 to form a polycide gate layer 21 , on top of unreacted silicon . the gate structure includes active regions that form source and drain regions . results of the foregoing steps reveal a smooth film surface and a smooth interface as demonstrated by resistivity tests . in a preferred embodiment of the present invention , field oxide film 11 has a thickness in a range from about 1 , 000 å to about 3 , 000 å , insulating film 12 has a thickness in a range from about 50 å to about 150 å , polysilicon layer 13 has a thickness in a range from about 1 , 000 å to about 2 , 000 å , and refractory metal silicide layer 21 has a thickness in a range from about 500 å to about 2 , 000 å . in a preferred embodiment , first diffusion barrier matrix 17 is implanted in polysilicon layer 13 at a predetermined depth in a range from about 200 å to about 1 , 000 å . the following examples are provided for illustration purposes and are not intended to be restrictive of the scope and spirit of the present invention . table a illustrates a series of tests in which one or more ion dopant implantations were made previous to forming into a structure of a layer of tisi 2 above and on a layer of polysilicon , the layer of polysilicon being above and on a gate oxide that is in turn above and on a p - type silicon substrate . in the test nos . 1 - 3 , second and first implant matrices were implanted , respectively , into the polysilicon layer at the surface and the eventual tisi 2 - polysilicon interface . table a illustrates that tests nos . 1 - 3 demonstrate a controlled low - level resistivity . a series of comparative examples ( tests nos . c1 - c7 ) illustrate that single implant at the surface of the polysilicon , while controlling salicidations of tisi 2 , do not achieve the desired low resistivity . table a______________________________________ rs after rtp anneal , test tis . sub . ix depth , 1st 2nd ohms / squareno . angstroms implant implant 0 1 2 3______________________________________1 700 n . sup . 4 , 9 n . sup . 6 , 9 2 . 41 2 . 93 3 . 90 5 . 492 650 n . sup . 4 , 9 n . sup . 6 , 9 1 . 90 2 . 22 3 . 18 4 . 963 700 n . sup . 4 , 9 p . sup . 1 , 9 2 . 36 2 . 83 3 . 68 5 . 15c1 700 w . sup . 2 , 7 2 . 34 4 . 89 7 . 29 10 . 39c2 700 co . sup . 6 , 7 2 . 55 4 . 06 5 . 72 8 . 06c3 700 co . sup . 6 , 8 2 . 32 4 . 17 6 . 16 8 . 91c4 430 w . sup . 2 , 7 3 . 90 10 . 48 18 . 54 37 . 67c5 430 w . sup . 2 , 10 3 . 88 8 . 80 14 . 24 23 . 17c6 430 mo . sup . 3 , 7 3 . 75 9 . 69 16 . 73 34 . 28c7 420 co . sup . 5 , 7 4 . 13 10 . 03 15 . 73 27 . 17______________________________________ . sup . 1 60 kev , . sup . 2 50 kev , . sup . 3 45kev , . sup . 4 22kev , . sup . 5 15kev , . sup . 6 12kev , . sup . 7 1e14 / cm . sup . 2 , . sup . 8 5e12 / cm . sup . 2 , . sup . 90 2e13 / cm . sup . 2 , . sup . 10 2e12 / cm . sup . 2 the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrated and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope .
| 7 |
referring now specifically to the drawings , in which identical or similar parts are designated by the same reference numerals throughout , and first referring to fig1 and 2 , the rack assembly 10 of the present invention includes a plurality of rack elements 12 - 14 . while only three rack elements are shown , this is only for illustrative purposes and any number can be used as will become evident from the description that follows . each of the rack elements is in the nature of a module which may be attached or connected to an adjacent module . the rack assembly 10 can thereby be sold in the disassembled condition thereof in kits of , for example , 10 or 20 rack elements . the facility with which the rack elements may be assembled permits such rack assemblies to be conveniently assembled in relatively short periods of time . each of the rack elements 12 - 14 is generally in the nature of a rectangular housing having a rear wall 16 , a bottom wall 18 ( best shown in fig6 ), and a pair of side or lateral walls 20 . the front - most rack element 14 has slightly modified side or lateral walls 20 &# 39 ; as will be more fully described hereafter . when two or more rack elements are stacked together as shown in fig1 and 2 , the rear wall of a frontwardly disposed rack element also serves as a front wall of the adjacent rearwardly disposed rack element to form a pocket 22 , best shown in fig6 . clearly , the dimensions of the pockets or bins 22 may be varied by a selection of dimensions for the rear walls 16 , the bottom walls 18 and the side or lateral walls 20 . the rack assembly 10 shown and described herein as the presently preferred embodiment has bins or pockets 22 having the depth of the bins substantially smaller than the heights or the transverse widths thereof . such a rack assembly is particularly suitable for storing and displaying sheet music . however , as above suggested , changing the dimensions of the rear walls , bottom walls or lateral walls can modify the dimensions of the bins to accommodate any other product commonly displayed in this form . thus , the rack assembly 10 , possibly with minor changes in dimensions , can be utilized to store and display greeting cards , newsstand - type magazines , blank forms , or the like . the rack assembly 10 is characterized in that the individual rack elements may be molded , such as from a plastic material . for example , the rack elements may be molded from styrene or other comparable plastics . it is desirable in selecting a material for the rack element that it be sufficiently stiff or rigid so that no additional reinforcing means need be provided even when the rack assembly includes upwardly of 20 rack elements . however , it is desirable that the material used for the rack elements have at least some resiliency , for reasons to be described below . the rack assembly of the present invention is particularly characterized in that each of the rack elements is formed with two separate locking mechanisms , one of which cooperates with the rear walls 16 and the bottom walls 18 while the second locking mechanism corporates with the side walls 20 . by integrally molding the locking mechanisms into the rack elements , a particularly simple and economical construction is obtained which permits easy and rapid assembly of the rack elements to each other while securely connecting these adjacent rack elements to each other . the first locking mechanism to be described is generally designated by the reference numeral 24 in fig2 and 6 - 8 . the first locking means or mechanisms 24 includes a first locking portion of the rear walls 16 . the locking portion 26 is in the nature of an offset wall portion or a female connecting member 28 spaced from the plane of the rear wall 16 to form a slot 30 in the nature of a socket . as best shown in fig6 the upper edge of the offset wall portion 28 is provided with a bevel 32 , whose function will become apparent hereafter . there may be additionally provided a supporting rib 34 which extends across the widths of each rear wall 16 , is parallel to the bottom wall 18 , and is generally coextensive with the upper edge of the offset wall portions 28 . the function of the supporting rib 34 will similarly be more fully discussed below . the second locking portion , which is in the nature of a male connecting member , is generally designated by the reference numeral 36 . as best shown in fig6 and 8 , the locking portion 36 depends or projects downwardly from the frontal region of the bottom wall 18 . the second locking portion 36 generally includes a skirt 38 which extends across the entire width of the rear wall 16 , as well as at least one tab or tongue 40 which is dimensioned to be received within the socket 30 of the female connecting member 26 . the slot 30 is generally a rectangular slot and the tongue 40 has a generally rectangular cross - sectional configuration dimensioned to be received within the slot 30 with little clearance therebetween , as best shown in fig6 . advantageously , the tongue 40 is provided at the lower end thereof with a wedge - shaped projection 42 which has a surface inclined rearwardly and upwardly from the lower edge of the tongue as shown , and an upper surface 44 generally disposed in a horizontal plane normal to the plane of the tongue or tab 40 . as suggested above , the offset wall portion 28 is made of a resilient material and the projection 42 engages the offset wall portion 28 when the tongue is initially advanced through the slot 30 to resiliently deflect the wall portion 28 to enlarge the slot 30 and facilitate insertion of the tongue 40 therein . in this manner , the projection 42 snaps into a position disposed below the offset wall portion 28 subsequent to full insertion of the tongue 40 through the slot 30 to lock the same within the slot as a result of the abutment of the locking surface 44 with the lower edge of the offset wall portion 28 . when the tongue 40 is fully received within the slot 30 in the engaged condition of the male and female connecting members 26 and 36 , the lower edge 45 of the skirt 38 abuts against or rests against the supporting rib 34 . by supporting the next adjacent or rearwardly disposed rack element across the entire width thereof , the weights of the racks , as well as of the materials contained therein , are more evenly distributed across the entire widths of the rack elements instead of being concentrated only at the locations of the first locking mechanism 24 . such a construction therefore protects the offset wall portions 28 from experiencing deformations or stresses which may damage the same . as best shown in fig2 and 6 , the sockets 30 are disposed on the rear walls 16 at a height above the bottom walls 18 to correspond to the desired vertical displacement between adjacent racks . clearly , the closer the offset wall portions 28 are to the bottom wall 18 , the less the vertical displacement between adjacent racks while greater separation results in greater displacement . in the case of sheet music , wherein the title of the work appears proximate the upper edge thereof , it is only necessary to displace adjacent racks between approximately 2 and 3 inches . where more exposure of the items is desired , clearly , greater vertical displacement between adjacent racks may be desirable . additionally , as mentioned above , the rear wall 16 of a frontwardly disposed rack element in effect forms the front wall for a rearwardly disposed rack element . the extent to which an item within the pockets or bins 22 are exposed is , therefore , also a function of the heights of the rear walls 16 . while the rear walls in the presently preferred embodiment have the same heights as the side walls , this is not essential and the rear walls 16 can clearly be made shorter to expose more of the items being displayed or higher than the side walls 20 to expose less of items . while only one set of female and male members 26 , 36 has been described in connection with fig6 - 8 , it is clear that one or more sets of such connecting members may be provided to secure two adjacent rack elements . in the presently preferred embodiment , as suggested in fig1 each rack element is provided with two female connecting members on the rear wall thereof , each of which is aligned and project downwardly from a common supporting rib 44 . similarly , each rack element is provided with two spaced tongues 40 , each of which depends from a common lower edge 45 of a skirt 38 . the offset wall portions 28 as well as the tongues 40 are positioned on the rack elements so that they are aligned with an associated mating member when the rack elements are aligned to bring the side walls of the two adjacent rack elements into common planes . at such time when alignment is achieved , the adjacent rack elements are moved vertically relative to each other to force the tongues 40 through the slots 30 and thereby move from an unengaged to an engaged condition . as should be evident , any number of male and female connecting members 36 , 26 respectively may be used , so long as locking engagement is effected in all of them substantially at the same time since further relative movements of the adjacent or connected rack elements is prevented subsequent to engagement of any of the mating pairs . the rack elements are further joined to each other by means of a second locking mechanism generally designated by the reference numeral 45 which is substantially formed in the planes of the side walls 20 . the locking mechanisms 45 serve to connect the rack elements to each other as well as drawing adjacent rack elements together to dispose the same in close abutting relationship . this will be more fully discussed below . the first and second locking mechanisms 24 , 45 are arranged to lock successively rearwardly disposed rack elements respectively successively upwardly to provide an upwardly and rearwardly stepped or terraced modular rack assembly 10 . the second locking mechanism 45 each includes at least one planar female opening 46 in the side walls 20 of each of the rack elements , and at least one planar male member 48 which projects forwardly from the side walls of the rack elements in the direction of the adjacent frontwardly disposed rack elements . the male planar members 48 are configurated and dimensioned to be receivable with associated female openings 46 in the planes of the side walls 20 , as to be more fully described hereafter . each female opening 46 has a generally inverted l - shape which has a horizontal leg portion 46a thereof extending to the rear edge of a side wall 20 to provide access into the opening 46 from the direction of a rear wall 16 . the opening 46 also has a vertical leg portion 46b which generally extends downwardly from the horizontal leg portion 46a and inwardly spaced from the rear wall 16 to form an upwardly projecting side wall extension 46c . in effect , each opening 46 is in the nature of an upper planar opening which is wider and opens to the rear of the rack element , and a lower planar opening , which has a height corresponding to that of the side wall extension 46c . each planar male connecting member 48 similarly has an inverted l - shape to correspond to the shape of the l - shaped opening 46 and projects forwardly from a side wall 20 to be receivable within an associated opening 48 of a forwardly disposed adjacent rack element . by projecting forwardly of the side walls 20 and subsequently projecting downwardly , the male members 48 each have a horizontal leg portion 48a and a vertical leg portion 48b . the vertical leg portion 48b is spaced from the side wall 20 , and forms therewith a downwardly directed slot 48c . as best shown in fig2 engagement of the planar female opening 46 and the planar male member 48 results when the planar male member 48 is lowered within the planar female opening 46 to bring the side wall extension 46c within the associated downwardly directed slot 48c to thereby effect locking . in effect , the side wall extensions 46c abut against the horizontal leg portions 48a of the planar male member 48 in the locked condition of the planar connector 45 . the heights of the horizontal leg portions or upper opening portions 46a of the female openings 46 are greater than the heights of the male members 48 . in this manner , the male members 48 may be initially received through the upper opening portions 46a at a first relative position of two associated adjacent rack elements in an unengaged condition thereof . after the planar male members 48 have been received into the upper opening portion 46a and positioned furwardly of the side wall extensions 46c , the rearwardly disposed rack element may be lowered relative to the frontwardly disposed rack element to bring the side wall extensions 46c within the spaces defined by the downwardly directed slots 48c . simultaneously therewith , of course , the vertical leg portions 48b of the planar male members 48 are moved from the upper opening region 46a into the lower opening region 46b of the planar female openings 46 . as best shown in fig2 the vertical leg portions or lower opening portions of the planar openings 46 are wider than the corresponding vertical leg portions 48b of the planar male members 48 . advantageously , there is provided a downwardly and forwardly inclined edge or surface within each lower opening portion 46b to draw two adjacent rack elements together as the relative positions thereof change from the unengaged to the engaged conditions to lock the same in close abutting relation in the fully engaged conditions thereof . in the presently preferred embodiment , the forwardly disposed edges of the side wall extensions 46c as well as the rearward edge of the vertical leg portion 48b of the planar male member 48 are each inclined at a relatively small angle such as approximately 5 °. such a small incline affects the desired locking engagement as the adjacent rack elements are increasingly moved to the full engaged positions as shown in fig2 . as with the first locking mechanism 24 described above , one or more locking mechanisms 45 may be utilized . for example , it is possible to provide only one planar female opening 46 and a planar male member 48 in two co - planar side walls 20 of two adjacent rack elements . in the presently preferred embodiment , two locking mechanisms 45 are provided on each set of side walls 20 . as shown , the locking mechanisms 45 are displaced in a vertical direction , the relative positions of the planar female openings 46 and the planar male members 48 being again selected to provide the desired vertical displacement between adjacent rack elements . as best shown in fig3 and 4 , there is further provided a guide tab or key 56 projecting from the front edge of each side wall 20 into the downwardly directed slot 48c which is dimensioned to be received within a guideway or keyway 58 formed in the side wall extension 46c . the key 56 and the keyway 58 ensure the proper alignment of the planar male member 48 within the planar female opening 46 to dispose these mating parts within the planes of the side walls 20 . such a construction initially guides the rack elements relative to each other to assure reliable interconnection of the rack elements to each other by means of the locking mechanisms 45 . referring to fig1 and 6 , it will be noted that the front - most rack element 14 differs slightly from the rearwardly disposed rack elements 12 and 13 in that the rack element 14 is not provided with forwardly projecting planar male members 48 . in the presently preferred embodiment , a cover plate 50 is provided which is connected to the front - most rack element 14 to form a bin or pocket with the side walls 20 &# 39 ; and the rear wall 16 of the rack element 14 . the height of the cover plate 50 is not critical although it is shown to have a height of approximately one - half that of the rear walls 16 to expose to a greater extent the items within the front - most bin . clearly , the front cover plate 50 may have a greater height if desired to only expose a comparable portion of the items therein as are exposed in the rearwardly disposed bins or pockets . the cover plate 50 is provided at the lower edge thereof and projecting from the rearward surface thereof with a female connecting member 26 similar to those used on the rear walls 16 of the rack elements . accordingly , the lower edge of the cover plate 50 may be connected or engaged with the tongues 40 downwardly projecting from the front - most rack element 14 as shown in fig2 and 6 . the cover plate 50 has a pair of rearwardly projecting alignment walls 52 which are parallel to each other and spaced inwardly of the side walls 20 &# 39 ; of the front - most rack element 14 . the alignment walls 52 are provided at the upper ends thereof with wedge - shaped projections 54 extending outwardly to be snappingly engaged within a planar female opening 46 of the front - most rack element 14 . accordingly , it will be noted in fig2 that the planar female opening 46 in the front - most rack element 14 receives both a planar male members 48 of the next successive rack element 14 , as well as the wedge - shaped projections 54 of the cover plate 50 . while the provisions of a cover plate 50 results in a finished and aesthetically pleasing appearance , the present invention also contemplates the use of only rack elements having frontwardly projecting planar male members 48 , such as rack elements 12 and 13 . in that case , the first bin 22 is formed behind the rear wall of the front - most rack element . however , the presently preferred embodiment contemplates the use of the modified front - most rack element 14 without the frontwardly projecting planar male members 48 and the use of a front cover plate 50 in association with such a front - most rack element . the rear walls 16 are advantageously provided with an array of openings 60 during the molding process . this serves both to save material as well as result in a more light - weight construction . what has been described above is a simple and economical rack assembly whose rack elements may be molded from any suitable plastic material and which have two separate and independent locking mechanisms , one of which is associated with the rear walls and bottom walls of the rack elements while the other locking mechanism is co - planar with the side walls thereof . the locking mechanisms are advantageously integrally formed with the rack elements so that additional hardware is not required for the assembly of the rack elements which are in the form of modules which may be interconnected to form a terraced rack display of any desired size . it is to be understood that the foregoing description of the embodiment illustrated herein is exemplary rather than limiting in nature and various modifications to the embodiment as shown herein may be made without departing from the spirit and scope of the invention .
| 0 |
a more complete understanding of the present invention may be gleaned with reference to the illustrations , wherein each of the drawings depict a matrix 10 provided for routing paper or other continuous web material under tension between two processing devices . an array of processing devices are arranged in fig1 - 6 with the matrix 10 centrally located between them . a paperweb 12 is fed into the matrix 10 in the direction of the arrows from a printer or other processing device . the paperweb 12 is oriented such that a first side 14 faces up as it enters the matrix 10 , and an obverse side 16 faces down . for clarity , the first side 14 is depicted as having printed matter on it , and the obverse side 16 remains blank in each of the fig1 - 6 . the matrix comprises four upright supports 18 spanned by an upper diagonal turnbar 20 , a lower diagonal turnbar 22 lying in a plane horizontally lower than that of the upper diagonal turnbar 20 , and other turnbars to be later described . all turnbars of the preferred embodiment lie substantially in a horizontal plane , though such geometry is merely for convenience and simplicity . each turnbar may be fixed or may rotate about its longitudinal axis , the preferred embodiment incorporating fixed turnbars of relatively small diameter as are commonly used in the paper processing art , generally less than 1 . 5 ″ in diameter . the threading of the web 12 through the matrix 10 as shown in fig1 is taken first . in order to route the paperweb 12 from the printer shown to the rewind machine labeled post , the paperweb 12 is merely passed about the upper diagonal turnbar 20 as is common practice . this of course inverts or flips the web so that its obverse side 16 faces up as the web departs the matrix 10 , and the web is re - directed 90 ° from its original direction . when the opposite orientation for the web is desired , that is , when it is preferred that the web enter the rewind machine with its first side 14 facing up just as it left the printer , the web need merely be re - routed through the matrix 10 as shown in fig2 . the web 12 is passed about the lower diagonal turnbar 22 , then about a left side turnbar 24 that redirects the web 12 toward the rewind machine . the web 12 undergoes a flip at each of the turnbars 22 and 24 , resulting in the first side 14 facing up as the web 12 exits the matrix 10 . the left side turnbar 24 spans two adjacent upright supports 18 of the matrix 10 , and is mounted in a horizontal plane between that of the two diagonal turnbars 20 and 22 . for routing the paperweb to turn 90 ° to the left ( respecting its entry into the matrix ) rather than to the right as in the previous discussion , the web is routed in a mirror fashion depicted in fig3 and 4 . to orient the web 12 so that its obverse side 16 faces up upon the web &# 39 ; s exit from the matrix 10 , the web 12 is routed about the lower diagonal turnbar 22 as in fig3 where the web travels from the printer to a cutter . the web may alternatively be oriented so that the first side faces up upon entry into the cutter , shown in fig4 . there , the web is routed around the upper diagonal turnbar and subsequently about a right side turnbar 26 that is similar to the left side turnbar 24 but on an opposing side of the matrix 10 . finally , the web may be oriented with either the first side 14 or the obverse side 16 facing up when the web passes through the matrix 10 without a net 90 ° turn , such as when routed from the printer to the folder of fig5 and 6 . when orienting the web so that the obverse side faces up , the web can be threaded as in fig5 . the web first passes about the upper diagonal turnbar 20 , then the right side turnbar 26 , and finally about the lower diagonal turnbar 22 . though the web 12 is flipped three times and redirected 90 ° twice and 180 ° once while within the matrix 10 , its net change is to pass ‘ straight ’ through the matrix and be flipped once , or inverted . the same result may be obtained with a mirror threading as that shown in fig5 . in this mirror arrangement that is equivalent , the web 12 passes first about the lower diagonal turnbar 22 , then about the left side turnbar 24 , and finally about the upper diagonal turnbar 20 . of course , the web may pass through the matrix 10 without encountering any turnbars and pass out unflipped along its original direction , as in fig6 . it is elementary that the direction of web travel may be reversed from that depicted in fig2 and 4 with the same result . in each such reversal , the web would move from the post or cutter devices depicted in fig2 and 4 , which may be any processing device , to first encounter the left side turnbar 24 or right side turnbar 26 . the web subsequently passes about one of the diagonal turnbars 20 or 22 to exit the matrix toward the device labeled printer in fig2 and 4 . that is , rather than pass about the side turnbar after the diagonal turnbar , the web may equivalently be passed about the side turnbar prior to the diagonal turnbar . such an embodiment and re - ordering of method steps is within certain explicit claims below , and is hereby stipulated as an equivalent to those claims directed particularly toward the preferred embodiment as illustrated . it will be appreciated that the web 12 may be threaded in numerous ways to achieve any of the net results depicted in fig1 - 6 . the depictions herein are the simplest routing for a given desired net change in web direction and orientation . merely complicating the threading without changing the fundamental operation of the matrix on a web is hereby considered an equivalent . more turnbars may be added along the sides adjacent to the left 24 and right 26 side turnbars so that the matrix is symmetric as viewed from above . the advantage there is that any of the purposes shown in fig1 - 6 may be achieved regardless of which particular matrix side faces the upstream device . throughout this disclosure and the ensuing claims , the term ‘ substantially ’ as referring to an angle or a horizontal , vertical or parallel alignment is hereby limited to be within 7 . 5 ° of the stipulated angle or direction . for example , substantially 90 ° includes all angles between 82 . 5 ° and 97 . 5 °, inclusive . similarly , an angle substantially bisecting 90 ° includes all angles between 37 . 5 ° and 52 . 5 °, and an angle substantially bisecting a substantially 90 ° angle includes all angles between 33 . 75 ° and 56 . 25 °. when the web is described or claimed as passing about a turnbar , the term ‘ about ’ excludes passing over or under but not being redirected by the turnbar . to pass ‘ about ’ a turnbar is herein restricted to exclude those instances wherein the web circumscribes less than 90 degrees around the surface of the turnbar . for example , the web in fig2 passes about the lower diagonal turnbar and the left side turnbar because it circumscribes approximately 180 degrees along the surface of each turnbar . these two turnbars act to purposefully change the direction of the web . that same web in fig2 does not pass ‘ about ’ the upper diagonal turnbar . even if the web touches the upper diagonal turnbar , it circumscribes less than 90 degrees and this latter turnbar has no purposeful effect on the direction of web travel . while the preferred embodiment has been shown and described , additional modifications will be apparent to skilled mechanics without departing from the spirit and scope of the present invention . the embodiments described above are hereby stipulated as illustrative rather than exhaustive .
| 1 |
with continuing attention to the drawings wherein applied reference numerals indicate parts similarly hereinafter identified , the reference numeral 1 indicates generally a building structure of dome or hemispherical shape . the building structure is comprised of upright pentagonally shaped perimeter components indicated generally at 2 and hexagonally shaped building components indicated generally at 3 . with particular attention to the pentagonal components 2 , the same includes side members 4 , 5 , 6 , 7 and 8 . internal members at 9 , 10 , 11 , 12 and 13 divide each pentagon into five isosceles triangles . said side members are uniformly curved and formed on a radius from a center indicated at x located below a circular foundation with a footing at f . the curved pentagon members are joined at their inner ends by connector means 14 as best shown in fig4 and which is formed with channels 15 within which the component members are inset with their ends abutting the channel end walls at 15a . additional connector means joins each internal member with a pair of side members and with later described hexagonal component members . the connector means 14 additionally defines a central bore 14a which is threaded for the reception of a headed fastener 17 also used in conjunction with later described building forms . a skirt portion 19 of the connector means serves to space later described forms from the pentagonal component . the hexagonal , concavo - convex building component at 3 , best shown in fig6 includes radiating elongate curved members at 20 , 21 , 22 , 23 , 24 and 25 which are secured at their proximate ends to connector means indicated at 26 . connector means 26 is similar to connector means 14 with the exception that it defines six channels at 27 for the reception and securement of six elongate members . channel end walls are at 27a . the term hexagonal with reference to component 3 is not used in the true geometric sense as the side members for the hexagonal members are in actuality the side members of adjacent pentagons . the connector means 26 is of circular configuration has an annular skirt 28 extending about its periphery which skirt serves as a spacer to position later described form members . the connector means is apertured at 26a to receive a headed fastener 17 . as viewed in fig1 and 3 the lowermost pair of connector means of each pentagonal component 2 are secured to steel reinforcing projecting upwardly from concrete footing f . one suitable reinforcing steel arrangement utilizes angularly bent rebar segments 29 having an upright portion extending above the footing surface . curved lengths of rebar 30 interconnect with upright portions of angle shaped rebar . the aforementioned lowermost pairs of connector means 14 of each pentagonal component are secured as by welding to the curved lengths of rebar 30 . a centrally disposed column c within the structure has a buried lower end segment and serves to directly support , during erection and later , if desired , a uppermost pentagonal component indicated generally at 31 . said uppermost central pentagonal component differs from the earlier described pentagonal components in that its internal members at 32 , 33 , 34 , 35 and 36 terminate inwardly in securement with a first or central disk 37 which is positionable and fixable near the upper end of column c and held in place thereon as by a column inserted rod 37a . top pentagonal component 31 has side members at 39 , 40 , 41 , 42 and 43 with the internal and side members being joined by connector means 14 as described earlier . a second disk at 38 is fixed on column c and may be used to support the inner ends of floor joists of a building structure second floor while the outer ends of the radiating floor joists at j are carried by hangers suitably attached to dome structure . tie rod components at 44 tie the lateral extremities of adjacent pentagonal components and serve to space and brace said components during building erection . additional tie rod components are at 44a . in fig3 and 6 , a form is indicated generally at 45 which is of compound curvature so as to be concentric with both the triangular portions of the pentagonal and the hexagonal building components . the form is of rigid , reinforced fiberglass construction having curved side rails as at 46 internally braced as at 47 . the form is an equilateral triangle and defines a first set of openings 48 , 49 and 50 one each at each apex for the inserted reception of the fasteners 17 associated with each of the earlier described connector means . accordingly , form 45 may be temporarily fastened interiorly to any hexagonal building component in the manner shown in fig6 . the skirt portion 28 of the connector means 26 assures inward spacing of the forms outermost surface from the hexagonal component to provide an area for the reception of cementious material such as concrete in a triangular area of the building component . the form has a second set of openings comprised of previously mentioned openings 48 and 49 and a new opening 51 therein which permit temporary installation of the form on the pentagonal building components which are subdivided into isosceles triangles . said second set of openings includes the two earlier mentioned apical located openings 48 and 49 and the additional or new opening at 51 . the fasteners 17 , when inserted through the second set of openings , serve to secure the form to triangular areas of the pentagonal areas of the building component as shown in fig3 . form 45 is reinforced at each corner opening by bent flat iron members having a flat iron bridge member welded therein . the openings in the form are oversized to permit compensation for connector spacing variances . for the sake of avoiding overstressing of the building components , the installation of form members 45 and the application of cementious material is done incrementally at spaced apart locations about the dome structure . the layer of cementious material is reinforced internally by welded wire fabric 52 held in place and offset by wire spacers as at 54 . the method of construction includes the steps of installing , in a removable manner , column c at the foundation center with the column provided with disk 37 located at the column upper end with the uppermost pentagonal component 31 carried by said disk . the pentagonal components 2 are installed in place , about outer margin of the footing and supported by the rebar at 29 and 30 with the components spaced apart and braced by tie rods 44a and 44 . the hexagonal components 3 are then attached , as by welding , to the connector means 14 on the pentagonal components 2 and 31 . a second disk 38 may be located at column c as a support for the inner ends of floor joists for a second floor or , if the building is to be used for commercial purposes , the column c may support the inner end of a hoist carrying beam . the steel and wire fabric reinforced shell is of requisite strength to provide a suitable attachment joint for beam or joist hangers . in some uses , column c will be removed from the finished structure . entry to the structure may be via a barrel vaulted entry ( not shown ) preferably constructed from a lattice work of rebar and welded wire fabric reinforced concrete when the structure is for other than residential purposes . for residential uses , the entry may be of considerably less size . vaulted entries will join the structure intermediate pentagonal building components 2 . while i have shown but one embodiment of the invention , it will be apparent to those skilled in the art that the invention may be embodied still otherwise without departing from the spirit and scope of the invention .
| 8 |
fig1 shows an example of a constant temperature liquid circulating apparatus which can be equipped with the predictive maintenance system according to the present invention . the constant temperature liquid circulating apparatus ( commonly referred to as a “ chiller ” unit ) is essentially an apparatus for circulating and continuously supplying a constant temperature cooling liquid medium ( typically brine ) with respect to a constant temperature member ( load ) in various kinds of mechanical or electrical devices , and primarily comprises a cooling liquid circulating circuit 40 in which the cooling liquid that is returned back from the load is cooled in a heat exchanger 25 , the circulating circuit then passing through a tank 41 having a heater 50 in which the chilled cooling liquid is adjusted to a fixed temperature by application of heat and discharged therefrom . various types of equipment operated in conjunction with the constant temperature liquid circulating apparatus may also be included . for example , an activation switch , a temperature setting device for setting the temperature of the cooling liquid , an input / output display device including an operational display for displaying a present operating state , a sequencer for providing sequential operation or various controls , and various other electrical devices may also be provided . fig1 shows an embodiment of the present invention in which the cooling liquid temperature control apparatus comprises a refrigeration circuit 20 and a cooling liquid circulating circuit 40 respectively . the above - noted refrigeration circuit 20 is equipped with a compressor 21 , a condenser 22 , and a temperature - type expansion valve 24 disposed in series along a refrigerant medium circuit 23 including a heat exchanger 25 . a hot gas bypass conduit 27 is provided into which a hot gas that is compressed by the compressor 21 can flow , bypassing the condenser 22 and expansion valve 24 when the compressor 21 is operating under certain load conditions or upon startup , as is well understood in the art . the degree of opening of the aforementioned temperature - type expansion valve 24 is controlled by a temperature sensing bulb 29 . driving of the compressor 21 is controlled by a high / low pressure switch 30 , and the flow amount of hot gas flowing through the flow path 27 is controlled by a capacity adjusting valve 28 , respectively . an oil separator 33 comprising a suction tank is also provided in a known manner . the aforementioned cooling liquid circulating circuit 40 is equipped with a main flow path 44 in which a tank 41 , a pump 42 and a load ( not shown ) are connected successively in series , and an auxiliary coolant flow path 45 which branches off from a return line from the load for recirculating the cooling liquid through the heat exchanger 25 and back to the tank 41 . a three - way proportional valve 46 and a heat exchange member 47 which undergoes heat exchange with the refrigerant of the refrigeration circuit 20 in the heat exchanger 25 are disposed in series in the auxiliary coolant flow path 45 . a level regulating valve 43 is also provided which controls the supply of cooling liquid to the load while keeping the level of cooling liquid in the tank 41 substantially constant . the condenser 22 is illustrated in fig1 as a fan cooled condenser unit , although it will be appreciated that the condenser 22 could also be cooled using cooling water supplied from an external cooling tower ( not shown ). the three - way proportional valve 46 operates such that the amount of chilled cooling liquid which is introduced into the tank 41 , after being chilled by circulating through the heat exchanger 25 in the auxiliary coolant flow path 45 , can be varied proportionally to a temperature amount detected by the temperature sensor 52 . the side of the three - way proportional valve 46 through which chilled cooling liquid is introduced can be operated over a range from being completely closed ( 0 %), wherein freshly chilled cooling liquid is not introduced into the tank 41 , to being completely open ( 100 %), wherein substantially all of the cooling liquid returned from the load is circulated through the heat exchanger 25 and chilled therein before returning to the tank 41 . typically , under normal operating conditions , the average degree of opening of the three - way proportional valve 46 is about 60 %. the tank 41 has a heater 50 for applying heat to the cooling liquid , wherein a degree of opening of the three - way proportional valve 46 , and supply and cutoff of electricity to the heater 50 , are controlled by a temperature controller 53 operated by a signal from a temperature sensor 52 that detects the temperature of the cooling liquid supplied to the tank 41 . in the case that the temperature of the cooling liquid supplied to the tank 41 becomes higher than a preset temperature , as set in the temperature controller 53 , the three - way proportional valve 46 is opened for supplying chilled cooling liquid to a greater degree along with suspending the supply of electricity to the heater 50 , whereby the cooling liquid is cooled . in the case that the supplied cooling liquid becomes lower than the preset temperature , the degree of opening of the three - way proportional valve 46 is lessened so that the amount of chilled cooling liquid introduced into the tank is decreased , along with supplying electricity to the heater 50 , whereby the cooling liquid is heated . when the cooling liquid is determined to reside at the preset temperature , the degree of opening of three - way proportional valve 46 is not changed and the heater 50 is deactivated , so that rise or fall of the cooling liquid temperature is halted . in the refrigeration circuit 20 , operation of the compressor 21 is regulated by a high / low pressure switch 30 . hot gas flows through the hot gas bypass conduit 27 for preventing freezing of the cooling liquid at a low temperature side of the heat exchanger 25 and is adjusted by a capacity adjusting valve 28 . further , control of an evaporation temperature of the heat exchanger 25 is performed by controlling a degree of opening of the temperature - type expansion valve 24 in accordance with a temperature sensing bulb 29 . on the other hand , cooling liquid which flows through a main flow passage 44 of the cooling liquid circulating circuit 40 receives heat or releases heat at the load ( not shown ) and recirculates to the tank 41 , whereby the variable temperature of the cooling liquid supplied to the tank 41 is detected by the temperature sensor 52 . in the aforementioned temperature controller 53 , as the temperature of cooling liquid supplied to the tank 41 and detected by the temperature sensor 52 progressively rises inside of a preset temperature range set by the temperature controller 53 , the degree of opening of the three - way proportional valve 46 for supplying chilled cooling liquid to the tank 41 is increased proportionally to the temperature rise . thus , after the cooling liquid flowing through the auxiliary coolant flow path 45 is cooled in the heat exchange portion 47 of the heat exchanger 25 , the chilled cooling liquid is circulated back to the tank 41 , whereby the temperature of the cooling liquid inside the tank 41 falls in temperature to remain inside the preset temperature range . conversely , as the temperature of the supplied cooling liquid decreases within the preset temperature range , the degree of opening of the three - way proportional valve 46 is decreased , while in addition , electricity is supplied to the heater 50 , whereby the temperature of the cooling liquid inside the tank 41 rises to remain within the preset temperature range . when it is already at the preset temperature , the degree of opening of the three - way proportional valve 46 is not changed and supply of electricity to the heater 50 is halted , so that the rise or fall of temperature of the cooling liquid is stabilized . in the aforementioned constant temperature liquid circulating circuit , for predicting a need for maintenance ahead of an event , at respective parts throughout the apparatus , sensors are disposed for continuously monitoring various condition amounts . as such sensors , there can be disposed at necessary points in the constant temperature liquid circulating apparatus the following types of sensors : temperature sensors for detecting the temperature of respective parts of the refrigeration circuit and the circulating circuit ; current sensors for detecting the current values of driving motors for the compressor 21 and pump 42 and of other electrically actuated parts ; pressure sensors for detecting pressures of the refrigerant and the cooling liquid in respective locations of refrigerant and cooling liquid flow passages of the refrigeration circuit and the circulating circuit ; flow amount sensors for detecting flow amounts of the cooling liquid in the coolant flow path of the circulating circuit , as wells as various sensors for detecting changes in effective condition amounts for predicting other irregular conditions of the constant temperature liquid circulating apparatus . further , as the above sensors , other sensing means may also be used such as the following : calculators for calculating operation cycles of mechanical operating parts including the electromagnetic valves used in the refrigeration circuit and the circulating circuit ; an accumulating device for determining additive values of electric supply times to the heater 50 ; and an accumulating device of the usage time intervals for detecting that the useful life of various expendable parts has been reached . the condition amounts of the apparatus internal parts that are obtained as outputs of the sensors which are arranged in the constant temperature liquid circulating apparatus are transmitted to a warning means 55 which is disposed at any optional location . in fig1 for example , the warning means 55 is shown as being associated with the temperature controller and receives signals therefrom , which may include , in particular , a signal indicating a degree of valve opening of the three - way proportional valve 46 , as shall be discussed in more detail later . the warning means 55 also receives signals from other sensors throughout the apparatus . specifically , the warning means 55 is formed by an arithmetic control unit which infers the parts for which maintenance is required , and maintenance time intervals therefor , based on condition amounts obtained from the various sensors or from variations of the condition amounts , and issues a needed warning before a breakdown or irregular condition is reached . as a result , it is necessary to store beforehand in the warning means 55 proper value ranges concerning the respective data detected by the temperature sensors , current sensors , pressure sensor and flow sensors , or upper and lower value limits at which irregular operation becomes likely , or otherwise to store standards for judging irregular conditions . the operational limiting cycles of mechanical operating parts , limiting values for electrical supply times of the heater , or usage time intervals of expendable parts , or the like , are also handled similarly . in the predictive maintenance system having the above - described structure , as a result of sensors which detect various condition amounts including temperatures at each of the internal parts of the constant temperature liquid circulating apparatus , electric current values of electromagnetic actuators , pressures of the refrigerant and cooling liquids and flow rates of the cooling liquid , or the like , or from sensors that detect the number of times of operation of mechanical operating parts including valves , and cumulative amounts of electric supply times to the heater or the like , various condition amounts are monitored . based on the sensor outputs therefrom , locations at which maintenance is needed and maintenance time intervals are inferred in the warning means 55 . so called after - event responses which take place only after a breakdown or serious irregular condition of the constant temperature liquid circulating apparatus are not taken , but rather warnings are issued before such breakdowns or irregular conditions actually occur , wherein the need for maintenance from an operator or service personnel is urged . at that time , of course , the detected data from the devices can be directly recorded on a recording medium such as a floppy disk . such a warning is not only provided on the operating display unit of the constant temperature liquid circulating apparatus , but a display by means of a lamp , warning sound , characters or the like can be provided on the operational display of a master device or in a control room , and further , by means of telephone lines , or via a distributed wire or wireless network , intranet or internet , may be transmitted to a maintenance facility for establishing the warning at a remote site . of particular importance to the present invention is to detect the degree of opening of the three - way proportional valve 46 which is disposed in the cooling liquid circulating path and which serves to control the flow amount of chilled cooling liquid output from the heat exchanger 25 to the tank 41 . as shall be described below , an overall rising trend in degree of opening of the three - way proportional valve 46 can serve to indicate a decrease in cooling capacity of the cooling liquid circulating circuit . the degree of opening of the three - way proportional valve 46 , and in particular a rising trend in an average degree of opening thereof , serves as a valuable indicator of cooling capacity in accordance with the teachings of the invention , which shall be described below in connection with fig2 and 3 . fig2 shows operational results and effects of the temperature control apparatus of the above - described embodiment . when the cooling liquid inside of tank 41 rises ( i . e . progressively increases ), the degree of opening of the three - way proportional valve 46 on the side for supplying chilled cooling liquid increases in proportion to the detected cooling liquid temperature , thereby cooling the cooling liquid . conversely , the degree of opening of the three - way proportional valve 46 decreases as the detected cooling liquid temperature is lowered below the preset temperature , for reducing the supply of chilled cooling liquid and allowing the temperature of the cooling liquid in the tank 41 to increase . more specifically , the wavy line in the upper half of fig2 is intended to illustrate controlled cooling liquid temperature in a generalized case in which the temperature of the cooling liquid is relatively stable and fluctuating in a sinusoidal pattern at or around the preset temperature . under normal operation , the average degree of opening of the three - way proportional valve 46 for supplying chilled cooling liquid into the tank 41 is about 60 %. as the cooling liquid temperature increases , the degree of opening of the three - way proportional valve 46 also increases ( indicated by rising portions of the wavy line ), while conversely , as the cooling liquid temperature decreases , the degree of opening of the three - way proportional valve 46 decreases ( indicated by falling portions of the wavy line ). it should be understood , however , that different and less regular fluctuations in temperature of the cooling liquid are not only possible but likely , in which case the pattern of opening and closing of the three - way proportional valve would not be sinusoidal . further , as shown in fig2 if the temperature of the cooling liquid decreases to be about 0 . 4 ° c . below the preset temperature , electricity is supplied to the heater 50 to supply supplemental heating to the cooling liquid to elevate its temperature to the range in which the three - way proportional valve is operating on its own . when the cooling liquid temperature reaches about 0 . 35 ° c . below the preset temperature , the supply of electricity is halted , although the temperature of the cooling liquid will continue to rise for a time after the heater is cut off . it should further be noted that when the heater is operating the three - way proportional valve can be completely closed to enable the cooling liquid temperature to recover to the preset temperature more quickly . as a result , the temperature of cooling liquid inside the tank 41 can be controlled with high precision within a narrow range of about ± 0 . 1 ° c . around the preset temperature . by contrast , when the cooling capacity of the constant temperature liquid circulating apparatus begins to show signs of decreasing , the three - way proportional valve 46 reacts in such a manner that the average degree of opening of the three - way proportional valve 46 needed to maintain the same temperature of the cooling liquid supplied to the tank 41 tends to increase , as shown in fig3 . this happens because , as the cooling capacity of the refrigeration circuit decreases ( which may be due to a refrigerant leak or other causes requiring investigation to determine ), the temperature controller 53 senses an increase in temperature at the temperature sensor 52 and in response thereto sends a signal for opening the three - way proportional valve 46 to a greater degree . although the opening of the three - way proportional valve 46 continues to fluctuate as described above , the average opening degree of the three - way proportional valve 46 exhibits an increasing trend above the normal 60 % operation as shown in fig3 wherein such a trend can be an indicator that the cooling capacity is decreasing . more specifically , as shown in fig3 according to the present invention a signal which indicates an opening degree of the three - way proportional valve 46 is registered , in the warning means 55 , and from such a signal the actual degree of opening of the valve 46 is determined , and the cooling capacity of the apparatus is judged from the opening degree of the three - way proportional valve 46 . specifically , if the opening degree increases further than the expected opening degree needed for maintaining the same cooling of the liquid supplied to the tank 41 , then a judgement is made that the cooling capacity of a apparatus has decreased . the temperature controller 53 is typically operated such that when a 1v to 10v dc signal , over a range of 4 ma to 20 ma , is supplied to the three - way proportional valve 46 , the valve is operated to open from between 0 % and 100 %, as shown on the lefthand side of fig3 . when such a signal indicative of the valve opening is registered , with respect to the same cooling capacity , so long as the opening degree of the valve is about 60 % ( i . e ., within the range of the two - dot - dashed lines on the right side of fig3 ), then the cooling capacity of the apparatus is judged to be acceptable . however , if in order to achieve the same cooling , the degree of opening of the three - way proportional valve rises above a preset limit ( for example 75 % or above , shown by region a ), then it can be predicted that the cooling capacity of the apparatus is declining , which indicates a need for investigation and repair . moreover , as understood by comparing fig2 and 3 , it is not possible to determine a diminishing in cooling capacity of the chiller unit simply by observing the temperature fluctuation of the cooling liquid alone , as shown by the wavy line in fig2 . this is because as the cooling capacity decreases , the degree of opening of the proportional valve is increased to compensate and maintain the temperature of the cooling liquid at or around the preset temperature . stated otherwise , even as the cooling capacity of the chiller unit decreases , the temperature fluctuation will remain substantially as shown in fig2 . in such a case , although the wavy line in fig2 does not change , the trend line in degree of opening of the three - way proportional valve changes significantly , as shown in fig3 . in order to more accurately assess the cause of a particular irregular operation of the constant temperature liquid circulating apparatus , various warnings are issued and a procedure is undertaken by the warning means 55 as shown in fig4 . more particularly , fig4 is a flowchart of a case in which a warning condition is judged , in accordance with a warning procedure in response to changes in the average opening degree of the three - way proportional valve 46 . referring to fig4 in step s 1 it is first determined whether the three - way proportional valve 46 shows a trend of having an average degree of opening of above , for example , 75 % and rising . if the answer is no , the warning means 55 determines that , insofar as the three - way proportional valve 46 is concerned , the system is operating normally , although the system may proceed to implement other data checks in step s 7 pertaining to other sensors installed throughout the apparatus . on the other hand , if the answer is yes in step s 1 , the routine proceeds to investigate the cause of the irregularity and to issue appropriate predictive warnings . for example , in step s 2 , the system checks whether or not the cooling water or cooling air from a fan supplied to the condenser unit 22 is unusually high . if the answer to this query is yes , a warning is issued in step s 8 to an operator or to a remote maintenance facility to investigate the status of the cooling water ( e . g ., the condition of the cooling tower ) or the ambient air temperature ( e . g ., whether the cooling fan is operating properly ). on the other hand , if the answer is no , the system proceeds to the next step . in step s 3 , the system investigates whether the amount of cooling water supplied to the condenser 22 has decreased . if the answer is yes , a warning is issued in step s 8 and appropriate measures may be taken to increase the supply of cooling water from the cooling tower . similarly , in the case that the condenser 22 is cooled using a fan unit , as a remedial measure , the power to the fan could be increased . if the answer in step s 3 is still no , the system checks whether on not the load on the system ( i . e ., the load to which the cooling liquid is circulated ) has increased , and if so a warning is issued in step s 9 to investigate whether some reason exists to explain such an increase in load . if the load has been changed due to explainable changes in the environment in which the constant temperature liquid circulating apparatus is used , normal adjustments to the apparatus may simply be needed in order to maintain the desired constant temperature . on the other hand , if the answers through step s 2 to step s 4 are all no , the system determines that a relatively simple explanation for the rising trend in opening of the three - way proportional valve 46 does not exist , and it is judged that a more serious problem exists . in this case , a request is made in step s 5 to shut down the machinery for repairs , and in step s 6 a request is issued to service personnel or to a service facility , for effecting repairs to the apparatus , or replacement , as soon as possible . it should be noted , however , that in accordance with operation of the warning means 55 , assuming that any of the answers in steps s 2 through s 4 is yes , predictive warnings , that is , warnings which pre - estimate the cause of an improper operation before a serious malfunction or breakdown occurs , are issued , so that measures can be taken to prolong the service life and proper functioning of the apparatus without requiring a complete shutdown . some examples of other irregular conditions of the constant temperature liquid circulating apparatus which can be predicted from the outputs or variations in output of the aforementioned various sensors are as follows : 1 ) temperature data changes of refrigerant or condenser cooling water for predicting variations in cooling capacity , 2 ) changes in electrical current values of component motors for predicting motor life , 3 ) arrival at a limit value for the number of on / off times of electromagnetic valves for predicting life expectancy of electromagnetic valves , 4 ) when the supply of electricity to heaters reaches a limiting value for predicting heater life , and 5 ) lowering of refrigerant pressure for predicting the generation of a gas leak . in this manner , with the above - described predictive maintenance system , locations requiring maintenance , and maintenance time intervals therefor , are inferred before occurrence of a fault condition , and a report is issued to operators or service personnel beforehand , so that the fault or irregular operation does not occur . therefore , the inventive system is different from so called after - event systems , in which an investigation of cause , exchange of parts and the like are made only after an irregular condition of the constant temperature liquid circulation apparatus occurs , so that the constant temperature liquid circulating apparatus and / or control devices attached thereto need not be completely stopped . rather , the irregular condition can be predicted and parts can be repaired , and further , since the parts themselves which have the possibility for fault can be known as a result of reporting based on the output of operated sensors , the time needed for maintenance is also shortened and losses due to stoppage of the apparatus can be dramatically decreased . effect of the invention . as described above , according to the predictive maintenance system of the present invention , in the above - described constant temperature liquid circulating apparatus , locations requiring maintenance and maintenance time intervals are inferred before the occurrence of a fault condition , so that the downtime of the apparatus can be reduced to a minimum . furthermore , because a three - way proportional valve is used in place of an electromagnetic valve , a rise in the opening degree of the three - way proportional valve is used as an indicator of a reduction in cooling capacity , and thus indicates a need for maintenance . at the same time , there is no possibility of a “ water hammer ” effect , even when used with large capacity chiller apparatuses , and thus the present invention is applicable throughout a wide range of industrial environments .
| 5 |
in one particular exemplary embodiment of the invention , a in the following description , directional terms such as “ above ”, “ below ”, “ upper ”, “ lower ”, “ uphole ”, “ downhole ”, etc . are used for convenience in referring to the accompanying drawings . one of ordinary skill in the art will recognize that such directional language refers to locations in downhole tubing either closer or farther from the wellhead and that various embodiments of the present invention may be utilized in various orientations , such as inclined , deviated , horizontal , vertical , and the like . referring to fig1 - 6 , the present invention relates to a tubular airlock assembly and method for facilitating deployment of a tubing string 10 into a wellbore 12 . the tubular airlock assembly of the present invention preferably includes a rupture assembly 100 disposed in the tubing 10 , that along with a sealing assembly 22 , maintains an airlock or buoyancy chamber 20 in the tubing 10 to assist in positioning the tubing 10 in the wellbore 12 , particularly in a horizontal section 14 of the wellbore 12 . once the tubing 10 is fully deployed to its desired vertical depth and / or horizontal position in the wellbore 12 , the sealing assembly 22 is designed to easily rupture into very small fragments through application of hydraulic pressure allowing the buoyance chamber 20 to be filled with fluid from above . once fluid fills the buoyancy chamber 20 , the rupture assembly 100 is designed to easily rupture into very small fragments through the application of hydraulic pressure so that the fragments of the sealing assembly 22 and rupture assembly 100 may be circulated out of the well . the sealing assembly 22 and rupture assembly 100 in a preferred embodiment , once ruptured , do not reduce the inner diameter id 1 ( fig2 ) of the tubing 10 . as seen in fig1 , the rupture assembly 100 of the present invention is preferably disposed at the toe or bottom of the tubing 10 to form a temporary isolation barrier to seal off the fluid from the wellbore 12 as the tubing 10 is being run therein , thereby maintaining and protecting the integrity of a buoyant chamber 20 in the tubing 10 . the buoyant chamber 20 may be filled with air , or any fluid that provide buoyancy , to provide float to the tubing 10 . the buoyant chamber 20 is formed between the rupture assembly 100 , which is the lower boundary of the chamber , and a sealing assembly 22 located at or near the heel or upper part of the tubing 10 , which is the upper boundary of the chamber . air in the buoyant chamber 20 is trapped between the rupture assembly 100 of the present invention and the sealing assembly 22 . the buoyant chamber 20 in the tubing 10 may be created as a result of sealing of the lower or toe end 24 of the tubing 10 with the rupture assembly 100 of the present invention and sealing of the upper or heel end 26 of tubing 10 with the sealing assembly 22 . the distance between the rupture assembly 100 and sealing assembly 22 is selected to control the force tending to run the tubing into the hole and to maximize the vertical weight of the tubing . the buoyant chamber 20 is air - filled to provide increased buoyancy , which assists in running the tubing 10 to the desired depth . that eliminates the need to fill the tubing 10 with fluid prior to running the tubing 10 in the wellbore 12 , and there is no need to substitute the air in the tubing once installed in the well . the buoyant chamber 20 alternatively may be filled with other gases , such as nitrogen , carbon dioxide and the like . light liquids may also be used . generally , the buoyant chamber 20 is preferably filled with a fluid that has a lower specific gravity than the well fluid in the wellbore in which the tubing 10 is run . the choice of which gas or liquid to use may depend on factors , such as the well conditions and the amount of buoyancy desired . rupture assembly 100 generally includes first and second rupture members 102 and 104 , a disengagable securing mechanism 106 , an impact member 108 , and a plurality of sealing o - rings 112 , as best seen in fig3 and 5 . each of the rupture members 102 and 104 is preferably a hemispherical dome that is formed of a material having a burst or rupture pressure ( i . e . the pressure at which hydraulic pressure alone can break the rupture member ) greater than the hydraulic pressure in the tubing when the tubing is being run in the wellbore , so as to avoid premature breakage of the rupture members 102 and 104 , thereby maintaining the seal for buoyant chamber 20 . in a preferred embodiment , the dome shape of the second rupture member 104 can withstand 3500 psi or more without bursting . once the tubing 10 is properly deployed , the rupture members 102 and 104 are fractured in very small fragments to remove the assembly and clear the fluid passageway of the tubing 10 . the rupture assembly 100 is sealed between an upper tubular member 116 that is coupled to a lower tubular member 118 through which a fluid passageway is defined . upper tubular member 116 may be coupled with lower tubular member 118 in such a way that the outer wall of lower tubular member 118 overlaps at least a portion of the outer wall of upper tubular member 116 . in the illustrated embodiment , the upper tubular member 116 and lower tubular member 118 are threadably coupled together at that overlap . various other interconnecting means that would be known to a person skilled in the art are possible . a fluid seal between upper tubular member 116 and the lower tubular member 118 may be provided by one or more seals , such as o - ring seal 120 . the tubular members 116 and 118 provide a radially expanded area in the tubing 10 designed to accommodate the rupture assembly 100 , so as to maintain the same inner diameter of the tubing . in particular , an internal recessed area 122 is defined in the inner surface of the lower tubular member 118 that is sized to receive the components of the rupture assembly , as seen in fig2 . the internal recessed area 122 is preferably sized such that the inner diameter id 1 ( fig1 ) of the tubing 10 is substantially the same as the inner diameter id 2 ( fig4 ) of the rupture assembly 100 . the inner diameter may be 4 . 5 inches , for example . the recessed area 122 is flanked by an annular frusto - concial surface 124 of the upper tubular member 116 leading into the recessed area 122 and an annular frusto - conical surface 126 of the lower tubular member 118 behind the recessed area 122 . the rupture members 102 and 104 are preferably concentrically disposed in the tubular members 116 and 118 generally traverse to the longitudinal axis of the upper and lower tubular members 116 and 118 with the first rupture member 102 facing uphole and the second rupture member 104 facing downhole . the first rupture member 102 includes a portion 132 that is a hollow , hemispherical dome , with a concave surface 134 that faces downhole and a convex surface 136 that is oriented in the uphole direction . hemispherical portion 132 is continuous with a cylindrical portion 138 which terminates in a circumferential edge 140 that abuts the disengagable securing member 106 . likewise , the second rupture member 104 includes a portion 142 that is a hollow , hemispherical dome , with a concave surface 144 that faces uphole and a convex surface 146 that is oriented in the downhole direction . hemispherical portion 142 is continuous with a cylindrical portion 148 which terminates in a circumferential edge 150 that abuts the impact member 108 . in a preferred embodiment , the disengageable securing member 106 is a shear ring . the shear ring 106 may be sandwiched between the inner wall of lower tubular member 118 and the cylindrical portion 138 of first rupture member 102 . an exemplary shear ring is described in u . s . patent application publication no . 2014 / 0216756 , incorporated herein by reference . the shear ring 106 provides for seating the first rupture member 102 in lower tubular member 118 , and acts as a disengageable constraint while also facilitating the rupture of the rupture member 102 , and generally being shearable in response to hydraulic pressure ( e . g . being shearable or otherwise releasing the rupture member 102 in response to the application of a threshold hydraulic pressure that is less that the rupture burst pressure of the rupture member 102 ). the first rupture member 102 of the rupture assembly 100 is preferably designed so that up to 1800 psi of pressure may be applied before the securing member 106 releases or shears . the shear ring 106 has tabs 152 or other projections that can be sheared in response to hydraulic pressure , as seen in fig3 - 5 . the tabs 152 are adapted to be eliminable from the tubing 10 . the plurality of tabs 152 are preferably spaced around the circumference of a rim of the shear ring 106 . although shear ring 106 serves as the disengageable constraint or securing mechanism for the first rupture member 102 in the illustrated embodiment , other securing mechanisms to hold the rupture member 102 in sealing engagement within the tubing 10 may be possible , provided that rupture member 102 is free to move suddenly downward or across in the direction of the second rupture member 104 , when freed or released from the constraints of the securing shear ring 106 . the first rupture member 102 may be sealed to shear ring 106 by means of one or more sealing o - rings 112 . each o - ring 112 may be disposed in a groove or void , circumferentially extending around the cylindrical portion 138 of the shear ring 106 . various back - up ring members may be present . the o - rings ensure a fluid tight seal as between the shear ring 106 , the rupture member 102 , and the upper and lower tubulars 116 and 118 . the sealing engagement of the first rupture member 102 within shear ring 106 and the sealing engagement of shear ring 106 against the lower tubular member 118 together with the o - ring seals create a fluid - tight seal between the upper tubing and the tubing downhole of rupture assembly 100 . tabs 152 of the shear ring 106 may be bendable or shearable upon application of force ( e . g . hydraulic force ). for example , tabs 152 may shear at 1000 to 2000 psi . this threshold pressure at which the securing mechanism 106 shears , releasing the first rupture member 102 , is less than the rupture burst pressure of the rupture member 102 ( i . e . the pressure at which the rupture member 102 would break in response to hydraulic pressure alone ). shear ring 106 may be made of any material that allows the tabs 152 to be suitably sheared off , such as metal ( like brass , aluminum , and various metal alloys ) or ceramics . the tabs 152 are also small enough that when sheared , they do not affect wellbore equipment or function . once all of the tabs 152 are sheared , the first rupture member 102 may be freed or released from the constraints of shear ring 106 . the rupture member 102 then moves suddenly towards the impact member 108 in response to hydraulic fluid pressure already being applied to convex surface 136 of the first rupture member 102 such that it is pushed through the circumferential aperture of shear ring 106 . once disengaged or otherwise released from shear ring 106 , the rupture member 102 will hit the impact member 108 and break into very small fragments as a result . the impact device 108 is configured to provide at least one impact surface against which the first rupture member 102 breaks once the shear ring 106 releases the rupture member 102 . any surface of the impact device 108 may be the impact surface of the present invention , provided that the impingement of the first rupture member 102 with that surface causes the rupture member 102 to fracture . in a preferred embodiment , the impact device 108 is a carrier ring that includes one or more inwardly extending impact projections 160 . the projections 160 may be annularly arranged and spaced from one another . each projection 160 includes a first side surface 162 that faces toward the first rupture member 102 , an opposite second side surface 164 faces toward the second rupture member 104 , and an end face 166 extending between the side surfaces 162 and 164 . the second side surfaces 164 may act as an abutment against the circumferential edge 150 of the second rupture member 104 . the inner diameter id 2 formed by the end faces 166 of the projections 160 is preferably substantially the same as the inner diameter id 1 of tubing 10 . that is , the structure of impact carrier ring 108 and the projections 160 facilitate the restoration of the tubing inner diameter because no or few portions of the impact carrier ring 108 and projections 160 extend into the inner diameter of the tubing 10 . the second rupture member 104 may be sealed to impact device 108 by means of a seal , such as the o - rings 112 disposed in one or more grooves circumferentially extending around a cylindrical portion 148 of the impact carrier ring 108 . various back - up ring members may be present . the o - rings ensure a fluid tight seal as between the impact carrier ring 106 , the rupture member 104 , and the upper and lower tubulars 116 and 118 . the sealing engagement of the second rupture member 104 within impact carrier ring 108 and the sealing engagement of impact carrier ring 108 against the lower tubular member 118 together with the o - ring seals create a fluid - tight seal between the upper tubing and the tubing downhole of rupture assembly 100 . any one of the first side surfaces 162 of the impact projections 160 may act as the impact surface of the present invention against which the first rupture member 102 is forced and breaks . when hydraulic pressure is applied to the rupture assembly 100 within the tubing 10 , there is a combination of hydraulic pressure acting on the first rupture member 102 , as well as compressive forces forcing the rupture member 102 into the impact device 108 ( onto the one or more impact surfaces 162 ). the combination of the hydraulic force and the impact force against the impact surfaces 162 allow for shattering of the rupture disc 102 . the sudden release of energy from the impact of the first rupture disc 102 with the impact projections 160 in combination with the debris of the first disc 102 travelling past the projections 160 , impacts the convex surface 146 of the second disc 104 and breaks the second disc 104 into very small fragments as well . the second rupture disc 104 may also impact any inner surface of the lower tubular member 118 , such as frusto - conical surface 126 , to further assist in fracture of the second rupture member 104 . the shattering of the rupture discs 102 and 104 results in opening of the passageway of the lower tubular member 118 , such that the tubing &# 39 ; s inner diameter in that region of the lower tubular member 118 may be restored to substantially the same inner diameter as the rest of the tubing 10 ( i . e . the tubing above and below the tubular or region in which the rupture assembly 100 was installed ). the first and second rupture members 102 and 104 are preferably made of a frangible material that shatters into very small fragments . each very small fragment may not exceed more than 1 inch in any dimension , and preferably no more than ⅜ inch in any dimension . an exemplary material for the rupture members 102 and 104 is high heat strengthened glass . the high heat strengthened glass preferably has a nominal thickness of 0 . 100 inch to 0 . 500 inch , a refractive index of 1 . 489 , a density of 2 . 33 g / cc , a linear thermal expansion of 43 e - 7 / c , a strain temperature of 482 ° c ., a transition temperature of 512 ° c ., an annealing temperature of 526 ° c ., and a deformation temperature of 660 ° c . high heat strengthened glass is also preferably used for the sealing assembly 22 . other possible materials include carbides , ceramic , metals , plastics , porcelain , alloys , composite materials , and the like . these materials are frangible and rupture in response to the pressure differential when high pressure is applied . hemispherical domes for the rupture members 102 and 104 are preferred because of their ability to withstand pressure from their convex sides 136 and 146 . the convex side 146 of the second rupture member 104 in particular must have sufficient rupture strength to prevent premature fracture when the tubing 10 is run into the wellbore 12 . in a preferred embodiment , the convex side 146 of the second rupture member 104 can withstand up to 3500 psi . due to the nature of the dome shape of the second rupture member 104 , the concave side 144 of the rupture disc 104 is much weaker than its convex side 146 . as a result , the second rupture member 104 easily fractures due to impact with the ruptured pieces of the first rupture member 102 . thus , the structure and material of the rupture assembly 100 provides a way for a sealed tubing 10 to become unsealed while requiring less hydraulic pressure than prior art rupture disc approaches and without increasing the inner diameter of the tubing 10 . there is no need to send weights , sharp objects or other devices ( e . g . drop bars or sinker bars ) down the tubing 10 to break the rupture assembly 100 of the present invention like in some prior art techniques . in the present arrangement , the rupture assembly 100 is arranged so that the rupture discs 102 and 104 fracture into sufficiently small fragments those fragments can be easily removed by fluid circulation , without damaging the tubing 10 . in addition , full tubing inner diameter id 1 is restored after the rupture members 102 and 104 are broken , so that there is no need to drill out any part of the assembly 100 . once the rupture discs 102 and 104 have ruptured , normal operations may be performed . the rupture assembly 100 is straight - forward to install , avoids the cost and complexity of many known tubing flotation methods and devices , and decreases completion time . in a preferred embodiment , the sealing assembly 22 is a rupture disc assembly , as seen in fig6 and described in commonly owned u . s . patent application publication no . 2014 / 0216756 , the entire contents of which are hereby incorporated by reference . the sealing assembly 22 may be any conventional sealing mechanism for tubing and casing strings . the rupture disc assembly may consist of an upper tubular member 16 coupled to a lower tubular member 18 , and a rupture disc 30 sealingly engaged between upper tubular member 16 and lower tubular member 18 . the rupture disc 30 is preferably made of high heat strengthened glass , similar to rupture discs 102 and 104 . upper tubular member 16 may be coupled with lower tubular member in a manner similar to tubular members 116 and 118 . lower tubular member 18 may include a radially expanded region 25 with a tapered internal surface 58 , which may be a frusto - conical surface ( e . g . lead - in chamfer ). the radially expanded region 25 is continuous with a constricted opening ( represented by dash line 27 ). various surfaces on lower tubular member 18 , most notably surface 58 , can form impact surfaces for shattering the rupture disc 30 . upper tubular member 16 also has a radially expanded portion 29 to help accommodate disc 30 . rupture disc 30 may be concentrically disposed traverse to the longitudinal axis of the upper and lower tubular members 16 and 18 . in the illustrated embodiment , a portion 32 of rupture disc 30 is a hollow , hemispherical dome , with a concave surface 38 that faces downhole and a convex surface 36 that is oriented in the uphole direction . hemispherical portion 32 is continuous with cylindrical portion 34 which terminates in a circumferential edge 39 having a diameter that is similar to the inner diameter of the radially expanded region 25 of lower tubular member 18 at shoulder 26 . rupture disc 30 is constrained from upward movement by tapered surface 60 on upper tubular member 16 . shear ring 44 is an example of a securing mechanism for disc 30 , the securing mechanism generally serving the purpose of holding the rupture disc 30 in the lower tubular member 18 helping to seal the rupture disc 30 in the tubing string 10 , facilitating the rupture of the disc 30 , and generally being shearable in response to hydraulic pressure ( i . e . being shearable or otherwise releasing the rupture disc 30 in response to the application of a threshold hydraulic pressure that is less that the rupture burst pressure of the disc 30 ). as seen in fig6 , the shear ring 44 may be sandwiched between the inner wall of lower tubular member 18 and the walls of cylindrical portion 34 of rupture disc 30 . similar to shear ring 106 , shear ring 44 provides for seating rupture disc 30 in lower tubular member 18 , and acts as a disengageable constraint . a circular rim 40 of the shear ring 44 acts as seating for the circumferential edge 39 of rupture disc 30 . shear ring 44 preferably has tabs 46 or other projections extending inwardly from rim 40 that can be sheared in response to hydraulic pressure like tabs 152 . the tabs 46 may be spaced around the circumference of the rim 40 . shear ring 44 may be held between shoulder 26 of lower tubular member 18 and end 28 of upper tubular member 16 and may be sealed to lower tubular member 18 by an o - ring 50 . rupture disc 30 may be sealed to shear ring 44 by an o - ring 52 . o - ring 52 may be disposed in a groove or void , circumferentially extending around the cylindrical portion 34 of disc 30 . the o - rings ensure a fluid tight seal as between the shear ring 44 , the rupture disc 30 , and the upper and lower tubulars 16 and 18 . the threshold pressure at which the securing mechanism 44 shears , releasing the rupture disc 30 , is less than the rupture burst pressure of the disc 30 ( i . e . the pressure at which the disc would break in response to hydraulic pressure alone ). tabs 46 support and / or seat rupture disc 30 . once all of the tabs 46 are sheared , rupture disc 30 may be freed or released from the constraints of shear ring 44 . rupture disc 30 then moves suddenly downward in response to hydraulic fluid pressure already being applied to convex surface 36 of rupture disc 30 , being pushed through the circumferential aperture 39 of shear ring 44 . once disengaged or otherwise released from shear ring 44 , rupture disc 30 will impinge upon some portion of lower tubular member 18 ( e . g . tapered surface 58 , herein referred to as an example of an impact surface ) and break into very small fragments as a result , preferably fragments that are less than ⅜ of an inch in any dimension . thus , surface 58 serves as an impact surface . surface 58 , because it is angled , provides a wall against which the rupture disc is forced , and thus causes the disc to rupture . any portion of the lower tubular 18 may constitute an impact surface , provided that the impingement of disc 30 with the surface causes the disc to rupture . the sealing assembly 22 and rupture assembly 100 are preferably used in a method of installing the tubing 10 in the wellbore 12 . running a tubing 10 in deviated wells and in long horizontal wells , in particular , can result in significantly increased drag forces . the tubing may become stuck before reaching the desired location . this is especially true when the weight of the tubing in the wellbore produces more drag forces than the weight tending to slide the tubing down the hole . if too much force is applied to push the tubing into the well , damage to the tubing can result . the rupture assembly 100 of the present invention helps to address some of these problems . to install the tubing 10 in the wellbore 12 , the tubing 10 is initially assembled at the surface including the incorporation of the sealing assembly 22 and the rupture assembly 100 , trapping air therebetween in the buoyant chamber 20 . the buoyant chamber 20 provides float to counteract any friction drag between the tubing walls with the walls of the wellbore 12 . as the tubing 10 is run into the wellbore 12 , the convex surface 146 of the second rupture member 104 resists fracture and remains intact against the hydrostatic pressure from the wellbore fluid . that is the hydrostatic pressure during run - in must be less than the rupture burst pressure of the second rupture disc 104 , to prevent premature rupture of the rupture disc 104 . generally , the rupture disc 104 may have a pressure rating of at least 3500 psi , for example . once the tubing has run and landed , the sealing assembly 22 and the rupture assembly 100 can be easily removed from the system and circulating equipment may be installed . the removal involves first bursting the sealing assembly 22 near the top of the tubing 10 by puncturing the same or applying sufficient fluid pressure . after the sealing assembly 22 is burst , and fluid fills the buoyancy chamber 20 , sufficient fluid pressure is applied again to subsequently burst the rupture assembly 100 . alternatively , the sealing assembly 22 and the rupture assembly 100 can be burst at the same time using the same fluid pressure application . the fluid pressure ( e . g ., from the surface ) is applied through the tubing 10 and exerts enough force on the first rupture member 102 and the shear ring 106 , particularly tabs 160 , to release the first rupture member 102 . the first rupture member 102 of the rupture assembly 100 is preferably designed so that up to 1800 psi of pressure may be applied before the securing ring 106 releases or shears . that initiates the sequence of rupturing the first and second rupture members 102 and 104 and clearing the tubing fluid passageway , as described above . once the rupture assembly 100 has been ruptured , the inside diameter of the tubing 10 in the region of the rupture assembly 100 is substantially the same as that in the remainder of the tubing ( i . e . the inner diameter id 1 is restored following rupture of the rupture assembly 100 ). that is accomplished in the present invention by installing the rupture assembly 100 in the radially expanded area of the tubular members 116 and 118 along with sizing the tabs 152 ( e . g . to form a 4 . 48 inch inner diameter ) of the shear ring 106 and the projections 160 ( e . g . to form a 4 . 15 inner diameter ) of the impact carrier ring 108 to have an inner diameter that is substantially the same or greater than the inner diameter of the tubing . the ability to restore full tubing inner diameter is useful in achieving maximum flow rate quickly . it also allows downhole tools and the like to be deployed without restriction into the tubing 10 . also , further work can be done without the need to remove any parts from the tubing 10 . the foregoing presents particular embodiments of a system embodying the principles of the invention . those skilled in the art will be able to devise alternatives and variations which , even if not explicitly disclosed herein , embody those principles and are thus within the scope of the invention . although particular embodiments of the present invention have been shown and described , they are not intended to limit what this patent covers . one skilled in the art will understand that various changes and modifications may be made without departing from the scope of the present invention as literally and equivalently covered by the following claims .
| 4 |
fig1 shows a schematic illustration of the physiological and physical model of a spectacle lens in a predetermined wearing position along with an exemplary ray course , on which an individual spectacle lens calculation or optimization according to a preferred embodiment of the invention is based . here , preferably only one single ray ( the main ray 10 ) is calculated per visual point of the spectacle lens , but further also the derivatives of the vertex depths of the wavefront according to the transversal coordinates ( perpendicular to the main ray ). these derivatives are taken into consideration up to the desired orders , wherein the second derivatives describe the local curvature properties of the wavefront and the higher derivatives are related to the higher - order aberrations . in the tracing of light through the spectacle lens , the local derivatives of the wavefronts are ultimately determined at a suitable position in the ray course in order to compare them with the required values of the refraction of the spectacles wearer there . in a preferred embodiment , this position is for example the vertex sphere or the entrance pupil of the eye 12 . to this end , it is assumed that a spherical wavefront originates at an object point and propagates to the first spectacle lens surface 14 . there , it is refracted and subsequently it propagates ( st 2 ) up to the second spectacle lens surface 16 , where it is refracted again . if further surfaces to be considered exist , the alternation of propagation and refraction is continued until the last boundary surface has been passed , and the last propagation ( st 4 ) then takes place from this last boundary surface to the vertex sphere ( or the entrance pupil of the eye ). in the following , the propagation of the wavefront according to a preferred embodiment of the present invention will be described in more detail . these statements can e . g . be applied to the propagation of the wavefront between the two spectacle lens surfaces and / or to the propagation of the wavefront from the rear spectacle lens surface to the vertex sphere . as illustrated in fig2 , preferably a cartesian coordinate system ( with an x axis , a y axis , and a z axis ) is defined , the origin of which being at the intersection point of the main ray 10 with the original wavefront 18 for a predetermined main ray 10 . the z axis preferably points in the direction of the main ray 10 . the directions of the x axis and the y axis are preferably selected to be perpendicular to the z axis and perpendicular to each other such that the coordinate system is right - handed . if the original wavefront is assumed to be a wavefront at a refractive surface , i . e . a surface of the spectacle lens , the x axis and / or the y axis is preferably selected to be parallel to the surface or surface tangent in the penetration point of the main ray . in another preferred embodiment , the x axis and the y axis are selected to be parallel to the main curvatures of the original wavefront 18 . w ( x , y ) = ∑ k = 0 ∞ ∑ m = 0 k a m , k - m m ! ( k - m ) ! x m y k - m ( 2 ) thus , the connection between the coefficients a k x , k y and the local aberrations e k x , k y can be described by : e k x , k y = na k x , k y e 2 , 0 = s xx na in , 2 , 0 e 1 , 1 = s xy = na 1 , 1 e 0 , 2 = s yy = na 0 , 2 e 3 , 0 = na 3 , 0 for aberrations up to the second order , the propagation of a spherical wavefront with the vergence s o = n / s o of the original wavefront in a surrounding around a main ray can preferably be expressed in a known manner by the propagation equation s p = 1 1 - d n s o s o ( 4 ) where s p = n / s p designates the vergence of the propagated wavefront . as illustrated in fig3 , s o and s p designate the vertex distance of the original wavefront 18 and the propagated wavefront 20 , respectively , ( distance along the main ray 10 from the wavefront to the image point 22 ). n designates the refractive index and d the propagation distance . by an extension to three dimensions , the spherocylindrical form of the wavefront can be represented as follows . first of all , the curvatures 1 / s o and 1 / s p are identified with the second derivatives of the vertex depths of the original wavefront 18 and the propagated wavefront 20 , respectively . in the three - dimensional representation , the two derivatives w o ( 2 , 0 ) =∂ 2 w o /∂ x 2 , w o ( 1 , 1 ) =∂ 2 w o /∂ x ∂ y , w o ( 0 , 2 ) =∂ 2 w o /∂ y 2 the original wavefront 18 and correspondingly for the propagated wavefront 20 are respectively summarized in form of a vergence matrix : s o = ( s oxx s oxy s oxy s oyy ) = n ( w o ( 2 , 0 ) w o ( 1 , 1 ) w o ( 1 , 1 ) w o ( 0 , 2 ) ) , s p = ( s pxx s pxy s pxy s pyy ) = n ( w p ( 2 , 0 ) w p ( 1 , 1 ) w p ( 1 , 1 ) w p ( 0 , 2 ) ) ( 5 ) s oxx = ( sph + cyl 2 ) - cyl 2 cos 2 α s oyy = ( sph + cyl 2 ) + cyl 2 cos 2 α ( 6 ) ( and analogously for the propagated wavefront ) the components of the respective vergence matrix are connected with the known parameters of spherical power sph , the magnitude cyl of cylindrical power , and the cylinder axis a of the cylindrical power . by means of the representation in form of the vergence matrix , by analogy with equation ( 4 ), the propagation of an astigmatic wavefront can be represented via the generalized propagation equation s p = 1 1 - d n s o s o ( 7 ) s o = ( s oxx s oxy s oyy ) = n ( w o ( 2 , 0 ) w o ( 1 , 1 ) w o ( 0 , 2 ) ) , s p = ( s pxx s pxy s pyy ) = n ( w p ( 2 , 0 ) w p ( 1 , 1 ) w p ( 0 , 2 ) ) ( 8 ) are introduced as power vectors in the three - dimensional vector space for the original wavefront 18 and the propagated wavefront 20 . now , for consideration of higher - order aberrations in the propagation of the wavefront , corresponding vectors e k of the dimension k + 1 are introduced : for further consideration , at first only a two - dimensional representation will be described for reasons of simplification . here , some point on the original wavefront ( r = o ) or the propagated wavefront ( r = p ) is described by the coefficients a o , k of the original wavefront 18 correspond to the derivatives of the wavefront with y = 0 : in two dimensions , the vergence matrix s o in equation ( 5 ) is reduced to a scalar e o , k = nw o ( k ) = na o , k . for second or third - order aberrations , e . g . s o = e o , 2 = nw o ( 2 ) = na o , 2 , e o , 3 = nw o ( k ) = na o , 3 , etc . result . the same applies to the propagated wavefront 20 . here , it is to be noted that any wavefront at the intersection point with the main ray 10 is not inclined with respect to the z axis . since the z axis points along the direction of the main ray 10 , it is perpendicular to the original and propagated wavefronts in the intersection points of the main ray 10 with the wavefronts 18 , 20 . moreover , since the origin of the coordinate system is at the original wavefront 18 , it holds for the coefficients that : a o , 0 = 0 , a o , 1 = 0 , a p , 0 = d , and a p , 1 = 0 in two dimensions , the normal vector n w ( y ) for a wavefront w ( y ) results from n w ( y )=(− w ( 1 ) ( y ), 1 ) t /√{ square root over ( 1 + w ( 1 ) ( y ) 2 )}, where w ( 1 ) =∂ w /∂ y . for reasons of a simplified notation , first of all v ≡ w ( 1 ) and the following function is introduced : as derivatives n ( i ) ( 0 )≡∂ i /∂ v i n ( v )| v = 0 of this function there result : the normal vector , which is perpendicular to both the original wavefront 18 and the propagated wavefront 20 , can be designated uniformly with n w . thus , for the first derivative of the normal vector there is determined : with the local aberrations of the original wavefront 18 , the corresponding coefficients a k and , equivalent thereto , the derivatives of the wavefront are directly defined as well . subsequently , the propagated wavefront 20 is determined therefrom particularly by determining its derivatives or coefficients a k for all orders 2 ≦ k ≦ k 0 up to the desired value k 0 , and thus the values of the local aberrations of the propagated wavefront 20 are determined . as a starting point , the following situation with respect to fig4 will be considered in an illustrative way . while the main ray 10 and the coordinate system are fixed , a neighboring ray 24 scans the original wavefront 18 ({ w o }) and strikes it in a section y o ≠ 0 . from there , it propagates further to the propagated wavefront 20 ({ w p }). as illustrated in fig4 , y o designates the projection of the intersection point of the neighboring ray 24 with the original wavefront { w o } to the y axis , while analogously the projection of the intersection point with the propagated wavefront { w p } to the y axis is designated with y p . the vector w o = w o ( y o ) ( cf . equation ( 10 )) points to the intersection point of the neighboring ray 24 with the original wavefront 18 , and the optical path difference ( opd ) with respect to the propagated wavefront 20 is designated with τ . accordingly , the vector from the original wavefront 18 to the propagated surface 20 is represented by τ / n n w . thus , it results for the vector to the corresponding point of the propagated wavefront : w p = w o + τ / n n w . as a basic equation there is introduced : now , from this equation , the desired relations are derived order by order . here , y p is preferably used as a free variable , on which y o depends in turn . for solving the equation , first of all the vector can be introduced . based on this , the following function is introduced for the further consideration : f ( p , y p ) = ( y o + τ n n w , y ( w o ( 1 ) ( y o ) ) - y p w o ( y o ) + τ n n w , z ( w o ( 1 ) ( y o ) ) - w p ) ( 18 ) where ( p 1 , p 2 )=( y o , w p ) are the components of p . now , if p = p ( y p ), the equation ( 16 ) can be represented in a compact form by : the derivatives of this function according to y p are preferably expressed by the following system of differential equations : ∑ j = 1 2 ∂ f i ∂ p j p j ( 1 ) ( y p ) + ∂ f i ∂ y p = 0 , where the matrix with the elements a ij :=∂ ƒ i /∂ p j is referred to as a jacobi matrix a . the jacobi matrix a thus reads the terms appearing in this equation are to be understood as w o ( 1 ) ≡ w o ( 1 ) ( y o ) w o ( 2 ) ≡ w o ( 2 ) ( y o ), n w , y ≡ n w , y ( w o ( 1 ) ( y o )), n w , y ( 1 ) ≡ n w , y ( 1 ) ( w o ( 1 ) ( y o )), etc ., where y o , w p are in turn themselves functions of y p . the derivative vector ∂ ƒ i /∂ y p can be summarized as p ( 1 ) ( y p )= a ( p ( y p )) − 1 b ( 24 ) based on this , the equation system for higher - order aberrations is preferably solved recursively as follows : p ( 1 ) ( 0 ) = a - 1 b p ( 2 ) ( 0 ) = ( a - 1 ) ( 1 ) b p ( k ) ( 0 ) = ( a - 1 ) ( k - 1 ) b , ( 25 ) in an alternative approach , it is suggested performing the recursion on the basis of equation ( 23 ) instead of equation ( 24 ). the first ( k − 1 ) derivatives of equation ( 23 ) yield : ap ( 1 ) ( 0 ) = b ( a ) a ( 1 ) p ( 1 ) ( 0 ) + ap ( 2 ) ( 0 ) = 0 ( b ) a ( 2 ) p ( 1 ) ( 0 ) + 2 a ( 1 ) p ( 2 ) ( 0 ) + ap ( 3 ) ( 0 ) = 0 ( c ) … ∑ j = 1 k ( k - 1 j - 1 ) a ( k - j ) p ( j ) ( 0 ) = 0 , k ≥ 2 ( d ) a ( 1 ) = ⅆ ⅆ y p a ( p ( y p ) ) y p = 0 , … , a ( k - j ) = ⅆ k - j ⅆ y p k - j a ( p ( y p ) ) y p = 0 ( 26 ) designate the total derivatives of the function . formally , these equations are solved by : in order to obtain a ( 0 ) − 1 , preferably equation ( 21 ) is evaluated for p = 0 and equation ( 14 ) is applied . this yields : a ( 0 ) = ( 1 + τ n w o ( 2 ) 0 0 - 1 ) ⇒ a ( 0 ) - 1 = ( 1 1 - τ n w o ( 2 ) 0 0 - 1 ) ( 28 ) y o ( 1 ) ( 0 ) = 1 1 - τ n w o ( 2 ) and w p ( 1 ) ( 0 ) = 0 . a ( 1 ) = ⅆ ⅆ y p a ( p ( y p ) ) ❘ y p = 0 , etc . are preferably determined from equation ( 21 ) and preferably equation ( 14 ) is applied again . thus , it results in the second order : w p ( 2 ) = 1 1 - τ n w o ( 2 ) w o ( 2 ) ( 30 ) which basically corresponds to the above - described propagation equation . the higher orders can analogously be expressed by : equation ( 31 ) correspondingly applies to the derivatives and the coefficients a o , k and a p , k due to equations ( 10 ) to ( 12 ). now , if one replaces d = τ / n and β = 1 1 - d n s o , in a generalized way , where in r k all wavefront derivatives e o , j of the lower orders ( j & lt ; k ) are expressed in form of local aberrations . even if a three - dimensional representation is more complex , it can basically be established by analogy with the two - dimensional representation . therefore , for the fully three - dimensional representation , only a few essential additional considerations will be described in the following . where w o ( x , y ) is determined according to equation ( 2 ), and the relationship between the coefficients and the derivatives is determined according to equation ( 3 ). the connection between the coefficients and the local aberrations results from a multiplication of the coefficient by the refractive index . preferably , by analogy with equation ( 13 ), formal vectors are introduced : n ( u , v ) := 1 1 + u 2 + v 2 ( - u - v 1 ) ( 35 ) so that the normal vectors with respect to a surface w ( x , y ):=( x , y , w ( x , y )) t are determined by : in the intersection point , it thus results n w ( 0 , 0 )=( 0 , 0 , 1 ) t , and the derivatives according to equation ( 14 ) are preferably determined from equation ( 35 ). as the basis for the consideration of a connection between the original and propagated wavefronts , preferably substantially equation ( 16 ) is used , with the difference that now x and y components are considered at the same time . as a vector of unknown functions , there is preferably determined : p ( x p , y p ) = ( x o ( x p , y p ) y o ( x p , y p ) w p ( x p , y p ) ) ( 36 ) and by analogy with equation ( 16 ), there is preferably used for the three - dimensional consideration : an importance difference compared to the two - dimensional consideration is that in the three - dimensional case two arguments exist , with respect to which the derivatives are taken into account . thus , already in the first order , two equations are considered : a ( p ( x p , y p )) p ( 0 , 1 ) ( x p , y p )= b y ( 38 ) the jacobi matrix a ( p ( x 2 , y 2 )) with the elements a ij :=∂ ƒ i /∂ p j is the same for both equations and analogous to equation ( 21 ), but now in the size 3 × 3 . the direct solutions by analogy with equation ( 25 ) are now determined by by analogy with equations ( 28 ) and ( 29 ), it results for the three - dimensional consideration : a ( 0 ) = ( 1 - τ n w o ( 2 , 0 ) - τ n w o ( 1 , 1 ) 0 - τ n w o ( 1 , 1 ) 1 - τ n w o ( 0 , 2 ) 0 0 0 - 1 ) ⇒ a ( 0 ) - 1 = ( γ ( 1 - τ n w o ( 0 , 2 ) τ n w o ( 1 , 1 ) τ n w o ( 1 , 1 ) 1 - τ n w o ( 2 , 0 ) ) 0 0 0 0 - 1 ) γ = - 1 det ( a ( 0 ) ) = 1 1 - τ n w o ( 2 , 0 ) - ( τ n w o ( 1 , 1 ) ) 2 - τ n w o ( 0 , 2 ) + ( τ n ) 2 w o ( 2 , 0 ) w o ( 0 , 2 ) ) ( 42 ) after further application of equations ( 39 ) and ( 41 ), it results in the second order w p ( 2 , 0 ) = γ ( τ / n ( w o ( 1 , 1 ) ) 2 +( 1 − τ / n w o ( 0 , 2 ) ) w o ( 2 , 0 ) ) w p ( 0 , 2 ) = γ ( τ / n ( w o ( 1 , 1 ) ) 2 +( 1 − τ / n w o ( 2 , 0 ) ) w o ( 0 , 2 ) ) ( 44 ) in a preferred embodiment , the coordinate axes for determination of the propagation are selected or determined such that the x axis and the y axis coincide with the directions of the main curvatures of the original wavefront . it thereby holds that w o ( 1 , 1 ) = 0 , and the equations ( 44 ) are simplified as in a corresponding way , the equations in the third order are preferably expressed as follows : d = τ n and γ = 1 1 - d n s oxx - ( d n s oxy ) 2 - d n s oyy + ( d n ) 2 s oxx s oyy ) , the propagation of the wavefront in the second order in the form of the local aberrations can be expressed as follows : β x = 1 1 - d n s xx and β y = 1 1 - d n s yy , the propagation of the wavefront in the third order can be described by : in a preferred embodiment , the coordinate axes for determination of the propagation are selected or determined such that the x axis and the y axis coincide with the directions of the main curvatures of the original wavefront . thereby , the equations ( 47 ) and ( 48 ) are simplified as the propagation of fourth - order aberrations can be determined in a comparatively simply way by : e pk = b k ( e ok + r k ) ( 52 ) with b k = ( β x k … … 0 ⋮ β x k - 1 β y 1 ⋮ ⋱ ⋮ β x 1 β y k - 1 ⋮ 0 … β y k ) ( 53 ) where r k represents a vector in which by analogy with r k in equation ( 33 ) all remainder terms r k x , k y are included . s p = t ( 2 ) ( { circumflex over ( r )} ) t ( 2 ) ({ circumflex over ( β )}){ tilde over ({ circumflex over ( s )})} p s ( { circumflex over ( r )} ) e p3 = t ( 3 ) ( { circumflex over ( r )} ) t ( 3 ) ({ circumflex over ( β )}){ tilde over ({ circumflex over ( e )})} p3 s ( { circumflex over ( r )} ) e p4 = t ( 4 ) ( { circumflex over ( r )} ) t ( 4 ) ({ circumflex over ( β )}){ tilde over ({ circumflex over ( e )})} p4 s ( { circumflex over ( r )} ) where s p , e p3 , e p4 , . . . apply in every coordinate system and where β ^ = ( β ^ xx 0 0 β ^ yy ) with β ^ xx = ( 1 - τ n w ^ ( 2 , 0 ) ) - 1 β ^ yy = ( 1 - τ n w ^ ( 0 , 2 ) ) - 1 ( w ^ ( 2 , 0 ) w ^ ( 1 , 1 ) w ^ ( 0 , 2 ) ) = 1 2 ( w ( 2 , 0 ) + w ( 0 , 2 ) ) ( 1 0 1 ) + 1 2 ( w ( 2 , 0 ) - w ( 0 , 2 ) ) 1 + ( 2 w ( 1 , 1 ) w ( 2 , 0 ) - w ( 0 , 2 ) ) 2 ( 1 0 - 1 ) is an auxiliary matrix , which can be referred to back to the matrix β = ( β xx β xy β xy β yy ) = ( 1 - τ n ( w o ( 2 , 0 ) w o ( 1 , 1 ) w o ( 1 , 1 ) w o ( 0 , 2 ) ) ) - 1 by β ^ = r ^ β r ^ - 1 where r ^ = ( cos φ - sin φ sin φ cos φ ) is a rotation matrix , which transforms from the special system in which the x axis and the y axis coincide with the directions of the main curvatures of the original wavefront into the general system . here , s ( r ^ ) : = ( r ^ 0 0 1 ) is used , and , further , t ( 1 ) , t ( 2 ) , t ( 3 ) , t ( 4 ) in equation ( 54 ) are matrix - like functions which assign the matrices t ( 1 ) ( x ) = ( a c b d ) t ( 2 ) ( x ) = ( a 2 2 ac c 2 ab ad + bc cd b 2 2 bd d 2 ) t ( 3 ) ( x ) = ( a 3 3 a 2 c 3 ac 2 c 3 a 2 b a ( ad + 2 bc ) c ( 2 ad + bc ) c 2 d ab 2 b ( 2 ad + bc ) d ( ad + 2 bc ) cd 2 b 3 3 b 2 d 3 bd 2 d 3 ) t ( 4 ) ( x ) = ( a 4 4 a 3 c 6 a 2 c 2 4 ac 3 c 4 a 3 b a 2 ( 3 bc + ad ) 3 ac ( bc + ad ) c 2 ( bc + 3 ad ) c 3 d a 2 b 2 2 ab ( bc + ad ) b 2 c 2 + 4 abcd + a 2 d 2 2 cd ( bc + ad ) c 2 d 2 ab 3 b 2 ( bc + 3 ad ) 3 bd ( bc + ad ) d 2 ( 3 bc + ad ) cd 3 b 4 4 b 3 d 6 b 2 d 2 4 bd 3 d 4 ) for even higher orders , the matrices t ( n ) can be defined with n & gt ; 4 . finally , as expressions for solutions on which the solutions for the propagated wavefronts can be formed by the transformation in equation ( 54 ), there are predetermined for the order n = 2 s ~ ^ p = ( w ~ ^ p ( 2 , 0 ) w ~ ^ p ( 1 , 1 ) w ~ ^ p ( 0 , 2 ) ) = ( β ^ 11 - 1 w ^ o ( 2 , 0 ) 0 β ^ 22 - 1 w ^ o ( 0 , 2 ) ) = ( w ^ ( 2 , 0 ) 0 w ^ o ( 0 , 2 ) ) - τ n ( w ^ o ( 2 , 0 ) 2 0 w ^ o ( 0 , 2 ) 2 ) , e ~ ^ p 3 = ( w ~ ^ p ( 3 , 0 ) w ~ ^ p ( 2 , 1 ) w ~ ^ p ( 1 , 2 ) w ~ ^ p ( 0 , 3 ) ) = ( w ^ o ( 3 , 0 ) w ^ o ( 2 , 1 ) w ^ o ( 1 , 2 ) w ^ o ( 0 , 3 ) ) in the following , it will be shown how the aberrations of a spectacle lens are considered in the optimization thereof in a preferable way by the wavefronts being described in different coordinate systems that are rotated relative to each other . as described with respect to fig1 and fig2 , the coordinate systems are preferably defined by the intersection points of the main ray 10 with the refractive surface 14 , 16 , by the refractive surface , and by the direction of the main ray 10 . in order to describe an incoming wavefront , the refractive surface itself , and the outgoing wavefront for the process of refraction on the refractive surface , preferably three different local cartesian coordinate systems ( x , y , z ), ( x , y , z ), and ( x ′, y ′, z ′) are used . the origin of all these coordinate systems preferably coincides with the intersection point of the main ray 10 with the refractive surface . while the systems have the normal direction to the plane of refraction ( i . e . the plane in which the incoming and the outgoing main ray are located ) as the common axis x = x ′= x , the z axis points along the incoming main ray , the z ′ axis along the outgoing main ray , and the z axis along the normal of the refractive surface . the orientations of the axis , axis , and axis are preferably selected such that each system is right - handed ( cf . fig5 ) at the transition between the coordinate systems , all vector quantities v depend on each other via the following relations where r designates the rotations about the common x axis and is defined by the three - dimensional rotation matrix in case of a rotation of the coordinate system by the angle α about the z axis , the coordinate transformation is described by x ~ = x cos α - y sin α y ~ = x sin α + y cos α or ( x ~ y ~ ) = r ( α ) ( x y ) ( 57 ) thus , the wavefront { tilde over ( w )} in the rotated coordinate system { tilde over ( x )}, { tilde over ( y )} is described by { tilde over ( w )} ( { tilde over ( x )},{ tilde over ( y )} )= w ( x ( { tilde over ( x )},{ tilde over ( y )} ), y ( { tilde over ( x )},{ tilde over ( y )} )) ( 59 ) if one derives the wavefront { tilde over ( w )} according to { tilde over ( x )},{ tilde over ( y )}, one obtains the new coefficients ã m , k − m relative to the coefficients a m , k − m . if the coordinate system is rotated by the angle α , the new aberrations { tilde over ( s )} of second order ( in the rotated coordinate system ({ tilde over ( x )},{ tilde over ( y )})) are calculated via for higher orders of the aberrations , the dependency of the new coefficients a m , k − m on the old coefficients a m , k − m is preferably expressed by the resulting rotation matrix has the block structure , which shows that the coefficients a m , k − m of the order k only depend on coefficients a m , k − m of the same order k . the rotation matrix for the first 15 coefficients ( n = 15 ) up to the order ( k = 4 ) thus reads the matrix elements of the block structures r k ( α ) of the first order ( k = 1 ) yield the known rotation matrix r 2 ( α ) = ( cos 2 α - 2 cos α sin α sin 2 α cos α sin α cos 2 α - sin 2 α - cos α sin α sin 2 α 2 cos α sin α cos 2 α ) ( 67 ) r 3 ( α ) = ( cos 3 α - 3 cos 2 α sin α 3 cos α sin 2 α sin 3 α cos 2 α sin α cos 3 α - 2 cos αsin 2 α sin 3 α - 2 cos 2 α sin α cos α sin 2 α cos α sin 2 α - ( sin 3 α - 2 cos 2 α sin α ) cos 3 α - 2 cos αsin 2 α cos 2 α sin α sin 3 α 3 cos α sin 2 α 3 cos 2 α sin α cos 3 α ) ( 68 ) the equations ( 66 ) to ( 69 ) show that the block matrix elements e i , j ( α ) of the respective rotation matrix r k ( α ) have the symmetry e i , j ( α )= e k + 2 − i , k + 2 − j (− α ). with c = cos α , s = sin α , the block matrices can be simplified to read in a preferred embodiment , the aberrations are described in the form of zernike polynomials . in this case , the rotation is performed in the space of the zernike polynomials . the wavefront is preferably spanned by the zernike polynomials in polar coordinates : the zernike coefficients corresponding to a wavefront w ( x , y ) are preferably determined via the integral c k m = 1 π r 0 2 ∫ ∫ pupil z k m ( x r 0 , y r 0 ) w ( x , y ) ⅆ x ⅆ y ( 73 ) where r :=√{ square root over ( x 2 + y 2 )}, x = ρ cos φ , y = ρ sin φ , and r 0 the pupil size . in the preferred representation by means of zernike polynomials in polar coordinates , the rotation for the zernike coefficients is very simple . the vector of zernike coefficients is transformed by the rotation in a block matrix representation , the rotation matrix is directly based on the elementary rotation matrix of equation ( 57 ). for n = 15 , the rotation matrix has the form : for illustration purposes , every block belonging to the same radial order is framed . if the wavefront is represented via a series as in equations ( 70 ) and ( 71 ), a series representation , i . e . a linear combination of the coefficients a m , k − m results for the integral of equation ( 72 ) as well . if the coefficients c k m or a m , k − m are summed as vectors up to a specific order k , a transition matrix t ( n ) between the zernike subspace and the taylor series subspace of the order k can be indicated by ( c 0 , 0 c 1 , 1 c 1 , - 1 c 2 , 0 c 2 , 2 c 2 , - 2 c 3 , 1 c 3 , - 1 c 3 , 3 ⋮ ) = t ( n ) ( e e x e y e xx e xy e yy e xxx e xxy ⋮ e yy … y ) = n t ( n ) ( a 00 a 01 a 10 a 02 a 11 a 20 a 03 a 12 a 21 ⋮ ) ( 76 ) d ( 9 ) = ( 1 … … 0 0 r 0 ⋮ ⋮ r 0 r 0 2 r 0 2 r 0 2 r 0 3 ⋮ r 0 3 ⋮ 0 … … 0 r 0 3 ) ( 77 ) designates a matrix that indicates the correct power of the pupil radius . the basic transformation matrix z ( n ) is determined by zernike expansion of the power series . preferably , the following representation is provided for the transformation matrix for n = 15 : in this equation as well , the blocks belonging to the same radial order are framed for purposes of illustration . it can be seen that non - disappearing elements also exist outside the diagonal blocks . however , they do not influence the rotation matrix r pot ( n , α ). in order to determine the rotation matrix r pot ( n , α ), r zernike ( n , α ) is transformed to the coefficient system of the power series development with equation ( 76 ): r pot ( n , α )= t − 1 ( n ) r zernike ( n , α ) t ( n ) ( 78 ) r pot ( 15 ) = ( 1 0 … 0 0 r 1 ( α ) ⋮ r 2 ( α ) ⋮ r 3 ( α ) 0 0 … 0 r 4 ( α ) ) ( 79 ) wherein the block matrices are identical with those of equation ( 70 ). fig6 illustrates an exemplary method for individually optimizing a spectacle lens taking higher - order aberrations ( hoa ) of both the eye and the spectacle lens into consideration . in a step st 12 , not only the local aberrations of 2 nd order ( s ′ xx , s ′ xy , s ′ yy ) but also the aberrations of a higher order ( k ′ xxx , k ′ xxy , k ′ xyy etc .) at the vertex sphere are calculated on the basis of wavefront tracing ( st 10 ). from these , from the local aberrations , the values for sphere , cylinder , and cylinder axis ( sph , zyl , a ) of the spectacle lens are calculated with the help of zernike polynomials and / or other suitable metrics , preferably taking the pupil diameter or pupil radius into consideration . preferably , in a step s 14 , first of all zernike coefficients ( c 2 0 , c 2 2 , c 2 − 2 , . . . ) are determined . since now also the higher - order local aberrations are known , it is possible to calculate the ideal sph , zyl , a values of the spectacle lens for a finite pupil opening , which preferably correspond to the above - described transformed values . both the connection between the local aberrations ( s ′ xx , s ′ xy , s ′ yy , k ′ xxx , k ′ xxy , k ′ xyy , . . . ) and the zernike coefficients ( c 2 0 , c 2 2 , c 2 − 2 , . . . ), as it is particularly referred to in step st 14 , and the connection between the zernike coefficients ( c 2 0 , c 2 2 , c 2 − 2 , . . . ) and the values for sphere ( sph ), cylinder ( zyl bzw . cyl ), and cylinder axis ( a or α ) are provided as functional connections c 2 0 , c 2 2 , c 2 − 2 , . . . )= f ( r , ′ xx , s ′ xy , s ′ yy , k ′ xxx , k ′ xxy , k ′ xyy , . . . ) and sph , zyl , a = f ( r , c 2 0 , c 2 2 , c 2 − 2 , . . . ) in a step st 18 , particularly taking the pupil radius r into consideration . now , it is preferred that the pupil size r be specified to be variable for every visual point . it is particularly preferred that the pupil size be specified as a function of the object distance , which in turn represents a function of the visual point . this can be based e . g . on the near reflex , so that with near objects the assumed pupil diameter decreases . preferably , in the refraction determination ( st 20 ), not only the values for sphere , cylinder , and cylinder axis , particularly for distance and near vision , are determined subjectively , but additionally the higher - order aberrations ( c 2 0 , c 2 2 , c 2 − 2 , . . . ) are determined with an aberrometer . in a step st 22 , the subjective and objective refraction data are combined particularly considering object distance , direction of sight , and pupil diameter . thus , it is possible to calculate ideal ( transformed ) prescription values ( sph , zyl , a ) particularly for different pupil diameters depending on the visual point with suitable metrics . it is particularly preferred that the ideal prescriptions be calculated once and then be deposited as a function of the object distance . moreover , it is preferred that e . g . with the aberrometer also the individual pupil diameter be determined under photopic ( small pupil ) and mesopic ( large pupil ) conditions . otherwise , standard values from literature have to be used . subsequently , the spherocylindrical values of the spectacle lens ( sl ) can be combined with those of the eye ( st 24 ) in a known way ( combination sl / eye k : k ( ref , ast )= sl ( sph , zyl , axis )− eye ( sph , zyl , axis ). the target function ( st 26 ), in which particularly the target values s ( ref , ast ) provided in a step st 28 are taken into account , preferably remains unchanged . the differences between the combination values k and the target values s determined in step st 24 are particularly taken into account therein : k ( ref , ast )− s ( ref , ast ).
| 6 |
the compounds of the invention are prepared by the coupling of 2 - nitroaniline diazonium salt with 2 , 7 - dihydroxynaphthalene , and proceeds as follows : ## str5 ## in general , the compounds of the invention are prepared by first performing a standard diazotization , and the 2 - nitroaniline diazonium salt is used immediately in a coupling step with 2 , 7 - dihydroxynaphthalene . next , the azo compound is reductively cyclized with zinc . the material is then acylated with methacryloyl chloride . the current invention will be further illustrated by the examples , which are provided for purposes of illustration only and are not intended to limit of the current invention . 2 - nitroaniline ( 0 . 25 mol , 34 . 5 g ) was warmed with concentrated hcl ( 95 ml ) to form a hydrochloride salt and the solution was cooled to 0 ° c . and diazotized with a cold solution of sodium nitrite ( 75 . 5 g , 0 . 25 mol ) in water ( 50 ml ). the diazonium salt solution added in small portions with vigorous stirring to a solution of 2 , 7 - dihydroxynaphthalene ( 0 . 2 mol , 32 g ) in ethanol ( 200 ml ) and water ( 200 ml ) at 5 ° c . and the reaction mixture was stirred for 3 hours at this temperature . the cooling bath was removed and the solution was stirred for 1 additional hour . the red - brown azo dye was then filtered and washed thoroughly with water . the azo dye was suspended in 2n naoh ( 300 ml ) and the reductive cyclization carried out by the addition of zinc dust ( 60 g ) over a period of 30 minutes followed by the dropwise addition of a naoh solution ( 50 %). after stirring for 48 hours , the mixture was decanted from the zinc residue and acidified to a ph of 3 to give a crude precipitated product . the product was then carbon decolorized in methanol and recrystallized from a methanol / water mixture to give 30 g ( 54 % yield ) of a light brown solid that looked pure by tlc analysis , and was 2 ( 2 , 7 - dihydroxynaphthyl ) 2h - benzotriazole ( bdhn ). the procedure of example 1 was followed using 4 - methoxy - 2 - nitroaniline ( 0 . 25 mol , 42 g ) in place of 2 - nitroaniline to produce 2 ( 2 , 7 - dihydroxynaphthyl ) 5 - methoxy - 2h - benzotriazole ( mbdhn ). the procedure of example 1 was followed using 4 - chloro - 2 - nitroaniline ( 0 . 25 mol , 43 . 3 g ) in place of 2 - nitroaniline to produce 2 ( 2 , 7 - dihydroxynaphthyl ) 5 - chloro - 2h - benzotriazole ( cbdhn ). to a solution of bdhn or 2 ( 2 , 7 - dihydroxynaphthyl ) 2h - benzotriazole ( 5 . 0 g 18 m mol ) and naoh ( 0 . 8 g , 20 m mol ) in water ( 100 ml ) a solution of methacryloyl chloride ( 20 m mol , 4 ml ) in chloroform ( 50 ml ) was added dropwise with vigorous stirring . the mixture was stirred for 1 additional hour . the organic layer was separated and washed thoroughly with water before evaporation to yield a crude product that was recrystallized from carbon tetrachloride to give a yellow solid ( 2 . 5 g , 40 % yield ) of 2 ( 2 - hydroxy - 7 - methacryloxynaphthyl ) 2h - benzotriazole -- m . p . 167 °- 168 ° c . the reaction may be represented as follows : ## str6 ## the above reaction of the sodium salt of the free hydroxyl of bdhn with methacryloyl chloride in a water / chloroform schotten - baumann reaction gives the polymerizable uv stabilizer bdhnm ( 55 %). after isolating this light yellow solid by precipitation from chloroform and washing it with cold carbon tetrachloride , the uv spectrum of bdhnm in chloroform at 2 × 10 - 4 mol / l showed a λ maximum at 352 nm ( ε = 1 . 3 × 10 - 4 l / mol cm ) with a sharp cut - off at 400 nm in transmission mode at a concentration of 2 × 10 - 3 mol / l see fig1 where ( a ) is 2 × 10 - 5 , ( b ) is 2 × 10 - 4 , and ( c ) is 2 × 10 - 3 mol / l . the procedure of example 4 was followed using mbdhn ( 18 m mol , 5 . 5 g ) in place of bdhn to produce a light yellow solid of 2 ( 2 - hydroxy - 7 - methacryloxynaphthyl ) 5 - methoxy - 2h - benzotriazole ( mbdhnm ). the procedure of example 4 was followed using cbdhn ( 18 mmol , 5 . 6 g ) in place of bdhn to produce a light yellow solid of 2 ( 2 - hydroxy - 7 - methacryloxynaphthyl ) 5 - chloro - 2h - benzotriazole ( cbdhnm ). 2 ( 2 - hydroxy - 7 - methacryloxynaphthyl ) 2h - benzotriazole was copolymerized with methylmethacrylate ( mma ) using 2 , 2 &# 39 ;- azobisisobutyronitrile ( aibn ) as an initiator as follows : a 100 ml pear - shaped flask equipped with a magnetic stirrer and side - arm with stopcock was charged with bdhnm ( 0 . 1 ) and recrystallized aibn ( 50 mg ). the flask was capped with a rubber septum and purged with nitrogen . toluene ( 10 ml ) and dimethyl acetate ( 5 ml ) was added to dissolve the solid completely and methylmethacrylate ( 10 . 5 ml , 9 . 9 g ) was added using a syringe . after three freeze - thaw cycles at 0 . 05 mmhg pressure to degas the homogeneous polymerization mixture , the flask was placed in an oil bath at 60 °- 65 ° c . under positive pressure of dry nitrogen . the solution was then stirred for 48 hours at an average temperature of 65 ° to 68 ° c . the polymer solution was then dissolved in chloroform ( 100 ml ) and added dropwise to a rapidly stirred beaker of methanol ( 600 ml ) to precipitate a white , fluffy polymer . the sample was then dried overnight in a vacuum oven . bdhnm was copolymerized with 2 - hydroxyethylmethacrylate ( hema ) and ethyleneglycol dimethacrylate ( egdma ) using 2 , 2 &# 39 ;- azobisisobutyronitrile ( aibn ) as an initiator as follows : a 15 ml polymerization tube was capped with a rubber septum and evacuated . a homogenous mixture of bdhnm ( 0 . 1 g ), hema ( 9 . 9 g ), egdma ( 0 . 025 g ) and recrystallized aibn ( 50 mg ), was added to the tube using a syringe . after three freeze - thaw cycles at 0 . 05 mmhg pressure to degas the polymerization mixture , the tube was placed in a constant temperature bath of 50 ° c . for 3 days , followed by an oven - curing cycle at 110 ° c . for 1 day . the product was then cooled to room temperature over a 12 - hour period . soxhlet extraction with water for 5 days failed to extract bdhnm , thus demonstrating the chemically bonded incorporation of the uv - absorbing group in the polymer matrix . a uv transmittance curve for the polymer of this example is plotted in fig3 using a 2 mm thick , unpolished disc cut from the polymer rod produced . the procedure of example 8 was followed using bdhnm ( 0 . 1 g ), mma ( 9 . 9 g ) and aibn ( 50 mg ). a uv transmittance curve for the polymer of this example in fig4 using a 2 mm thick , unpolished disc cut from the polymer rod produced . the procedure of example 8 was followed using mbdhnm ( 0 . 1 g ) in place of bdhnm to produce an uv - absorbing xerogel . while the preferred examples show the preparation of bdhn , bdhnm , and copolymerization of these materials with 2 - hyroxyethyl methacrylate and methyl methacrylate , it is to be understood that the type of comonomer is not critical , and it can be any monomer having a polymerizable unsaturated group such as styrene , acrylonitrile , methacrylic esters , acrylic esters , butadiene , isoprene , vinyl chloride , chloroprene , or other vinyl monomers . it is also possible to use polyvinyl compounds such as a divinyl monomer and vinylidene monomers and other compounds having α , β - unsaturated group . also , the usual grafting polymerization on the polymer in bulk or solution can provide the polymeric ultraviolet absorbers of the invention . it is also possible to incorporate these polymerizable uv absorbers in silicone polymers via an addition reaction to -- sih functionalities . the bdhn and bdhnm monomers can be used as reactive absorbers in a cured polymerizable composition ; i . e ., as the reactive component for curable polymerizable resin compositions such as unsaturated polyester resin compositions . the curable polymerizable resin composition is then polymerized , then bdhn and bdhnm monomers are also copolymerized with the polymerizable component to obtain a cured product having absorbency . when the bdhn and bdhnm monomers are used as the copolymerizable component of a polymer , the stability of the polymer to uv rays can be improved with only a relatively low concentration of the bdhn and bdhnm monomers . for example , the copolymer having uv absorbency can be obtained by incorporating only about 0 . 01 weight percent of the bdhn and bdhnm units or the ratio of the bdhn and bdhnm monomers in the copolymerization can be more than 1 weight percent ; however , the maximum ratio is not critical . nevertheless , when economical factors are considered , the limit of the ratio of the bdhn and bdhnm monomers to the total monomer mixture is about 20 weight percent . for applications in lens materials , the weight percent of polymerizable stabilizer ( bdhnm ) may range from as little as 0 . 1 % for screening up to 380 nm and up to 5 % for complete absorbance up to 430 nm .
| 2 |
the invention especially relates to compounds of the general formula i in which any alkyl part of any of the groups r 1 to r 3 , which may be straight chained or branched , contains up to 12 carbon atoms , preferably up to 10 carbon atoms , more preferably up to 9 carbon atoms , any alkenyl or alkynyl part of any of the substituents r 1 to r 3 contains up to 12 carbon atoms , preferably up to 10 carbon atoms , more preferably up to 9 carbon atoms , any cycloalkyl part of any of the substituents r 1 to r 3 contains from 3 to 10 carbon atoms , preferably from 3 to 8 carbon atoms , more preferably from 3 to 6 carbon atoms , any saturated or unsaturated chain , especially carbon chain , contains from 3 to 10 chain members , preferably from 4 to 6 carbon atoms , and any aryl part of any of the substituents r 1 to r 3 contains 6 , 10 or 14 carbon atoms , preferably 6 or 10 carbon atoms , and in which each optionally substituted group independently is substituted by one or more halogen atoms or nitro , cyano , alkyl , preferably c 1 - 6 alkyl , cycloalkyl , preferably c3 - 6 cycloalkyl , cycloalkenyl , preferably c 3 - 6 cycloalkenyl , haloalkyl , preferably c 1 - 6 haloalkyl , halocycloalkyl , preferably c3 - 6 halocycloalkyl , alkoxy , preferably c 1 - 6 alkoxy , haloalkoxy , preferably c 1 - 6 haloalkoxy , phenyl , halo - or dihalo - phenyl or pyridyl groups . any alkyl , alkenyl or alkynyl group may be linear or branched . a 4 - to 6 - membered heterocyclic group may be any heterocyclic group with 4 to 6 ring atoms , interrupted by one or more heteroatoms selected from sulfur , nitrogen , and oxygen , preferably oxygen . a halogen atom suitably denotes a fluorine , chlorine or bromine atom . the invention especially relates to compounds of the general formula i in which r 1 represents a c 1 - 10 alkyl , c 3 - 6 cycloalkyl , c 3 - 8 cycloalkyl - c 1 - 6 alkyl , c 1 - 6 alkoxy , c 1 - 10 alkoxy - c 1 - 6 alkyl or phenyl group . preferably r 1 represents a c 1 - 8 , suitably c 1 - 6 , alkyl group , especially a branched alkyl group , more especially secondary and tertiary alkyl groups as secondary butyl , tertiary butyl and tertiary amyl groups . more preferably , r 1 represents a t - butyl or t - amyl group . the invention further especially relates to compounds of the general formula i in which r 2 and r 3 each independently represent a hydrogen atom , a c 1 - 12 alkyl , especially c 3 - 10 alkyl , c 2 - 6 alkenyl , c 2 - 6 alkynyl , c 3 - 8 cycloalkyl - c 1 - 6 alkyl , c 3 - 8 cycloalkyl , phenyl , phenyl - c 1 - 6 alkyl , especially benzyl , halophenyl - c 1 - 6 alkyl or pyridyl - c 1 - 6 alkyl group , or r 2 and r 3 together represent a saturated carbon chain containing three to eight carbon atoms while optionally one or more additional oxygen atoms may be present in the chain and which chain may optionally be aryl - or cycloalkyl - fused . preferably r 2 and r 3 each independently represent a hydrogen atom , a c 2 - 12 alkyl , c 2 - 5 alkenyl , c 5 - 7 cyclo - c 1 - 2 alkyl , c 5 - 7 cycloalkyl or phenyl - c 1 - 2 alkyl group , or r 2 and r 3 together represent a saturated chain containing four or five carbon atoms while optionally additional oxygen atoms may be present and which chain optionally may be aryl - or cycloalkyl - fused , especially cyclopentyl , cyclohexyl or cycloheptyl fused , each of the above groups optionally substituted by one or more halogen atoms , especially chlorine and / or fluorine atoms , or c 1 - 4 alkyl , c 1 - 4 haloalkyl , c 4 - 6 cycloalkenyl or c 1 - 4 alkoxy groups . the invention also especially relates to compounds of the general formula i in which r 2 represents a hydrogen atom or a methyl group , preferably a hydrogen atom . the invention especially relates to compounds of the general formula i in which n represents 0 , 1 or 2 , particularly 0 . a particular preferred sub - group of compounds of the general formula i is that in which r 1 represents a butyl , pentyl or phenyl group , especially a t - butyl or t - amyl group . another particular sub - group is that in which r 2 and r 3 each independently represent a hydrogen atom or a linear or branched c 1 - 12 alkyl group , especially a c 1 - 10 alkyl group , an allyl , c 3 - 7 cycloalkyl optionally fused with a cyclohexyl group , benzyl or phenyl group , or r 2 and r 3 together represent a saturated c 4 - 7 carbon chain , especially a c 4 - 6 carbon chain , which optionally may contain an additional oxygen atom and which optionally may be fused with a cyclohexyl ring , each of the above groups optionally substituted by a fluorine , chlorine or bromine atom or one or two methyl groups , a t - butyl , cyclohexyl , cyclohexenyl , phenyl or pyridyl group . the present invention further provides a process for the preparation of compounds of the general formula i as defined hereinbefore or acid - addition salts thereof , which process comprises reaction of a compound of the general formulae iia or iib ## str3 ## wherein n is 0 , 1 or 2 and r 1 is defined hereinbefore , with a compound of the general formula iii ## str4 ## in which r 2 and r 3 are as defined hereinbefore , under reducing conditions . suitable reducing conditions for the reductive amination are well known in the literature . see for instance j . march , advanced organic chemistry , j . wiley & amp ; sons , new york , 1985 . suitable reducing agents are formic acid ( leuckart - wallach reduction ), complex metal hydrides such as cyanoborohydride or hydrogen gas together with a hydrogenation catalyst , e . g . raney nickel . the starting compounds of formulae iia and iib are novel . therefore , the invention relates also to the novel starting compounds of formulae iia and iib . the compounds of formula iia can be prepared according to reaction scheme 1 , in which the following expressions have been used : step 1 : &# 34 ; strong base &# 34 ; represents a metal organic compound , preferably a metal dialkylamide or an alkali metal alkane , in particular lithium diisopropylamide ; &# 34 ; allylhalide &# 34 ; represents allylchloride , allylbromide or allyliodide . step 2 : &# 34 ; peroxoacid &# 34 ; represents suitably an organic peroxoacid , preferably an optionally substituted perbenzoic acid , in particular m - chloroperbenzoic acid . step 3 : &# 34 ; reduction &# 34 ; represents a reduction process carried out with a complex metal hydride , preferably a complex aluminum hydride or borohydride , in particular lithium aluminum hydride . step 4 : &# 34 ; oxidation &# 34 ; represents a oxidation process carried out in the presence of agents being capable of oxidizing primary alcohols to aldehydes , in particular with dimethyl sulfoxide in the presence of oxalyl chloride and a base . step 5 : &# 34 ; aldol condensation &# 34 ; represents a condensation process , preferably carried out in the presence of a base such as a metal dialkylamide or a metal hydroxide or a metal alkoxide . step 6 : &# 34 ; hydrogenation &# 34 ; represents a hydrogenation process carried out in the presence of a heterogeneous catalyst , in particular in the presence of raney nickel and / or palladium . ## str5 ## wherein r represents a c 1 - 10 alkyl , c 3 - 6 cycloalkyl , c 3 - 8 cycloalkyl - c 1 - 6 alkyl , c 1 - 10 alkoxy - c 1 - 6 alkyl , phenyl or benzyl group . the compounds of formula iib can be obtained from formula iia according to reaction scheme 2 , in which the following expressions have been used : &# 34 ; oxidation &# 34 ;: as described for step 4 of scheme 1 ; ## str6 ## wherein n is 1 or 2 ; r &# 34 ; represents a c 1 - 10 alkyl , c 3 - 6 cycloalkyl , c 3 - 8 cycloalkyl - c 1 - 6 alkyl , c 1 - 10 alkoxy - c 1 - 6 alkyl or phenyl group ; x denotes halogen , preferably cl , br or i . the compounds ( iic ) wherein n is 2 may be further reacted to convert the aldehyde moiety to an imino group followed by reduction to form the compounds of formula i wherein n is 3 . starting compounds of the general formula iii are well known in the literature , and many of them are commercially available . the reductive amination process of the present invention is suitably carried out in the presence of an organic solvent , for example an ether , an alcohol or a carboxylic acid such as acetic acid . the process is suitably carried out at a temperature in the range of 0 ° to 150 ° c ., especially between 40 ° and 120 ° c ., in the case of formic acid as reducing agent or at temperatures between 0 ° and 50 ° c . in the case of complex borohydrides as reducing agents . in an alternative process for the preparation of the compounds of the present invention the starting compound of formula iia is first converted into the corresponding aminospiro ( 4 , 5 ) decane compound , for instance by reaction with hydroxylamine followed by reduction of the obtained oxime . the 3 - amino compound is thereafter alkylated , especially with a ketone or aldehyde under suitable reducing conditions or with an alkylating agent . the reaction of the ketone starting material and hydroxylamine is well known in the literature . the reaction may be carried out in an organic solvent / water mixture at temperature between 20 ° and 100 ° c . the reduction of the oxime compounds is also well known in the literature . the reduction can be carried out with complex metal hydrides , for instance lithium aluminium hydride , in an organic solvent , e . g . tetrahydrofuran , at temperatures between 40 ° and 80 ° c . the alkylation of amines using ketones or aldehydes is well known in the literature , and is described hereinbefore . the alkylation using alkylating agents is also well known in the literature . alkylating agents , for instance ( substituted ) alkyl halides may be used in suitable , inert organic solvents at temperatures between 40 ° and 100 ° c . the present invention also provides a process for the preparation of compounds of the general formula i as defined hereinbefore , or acid addition salts thereof , and in which n is 1 , which process comprises reduction of a compound of the general formula iia as defined hereinbefore to an alcohol , activation of the alcohol , followed by reaction with hydrogen cyanide , a salt thereof or with trialkylsilyl cyanide in the presence of a lewis acid , followed by reduction of the obtained cyanide group and alkylation of the amine obtained , especially with a ketone or aldehyde under suitable reducing conditions or an alkylating reagent . the reduction of the carbonyl group of the starting compound of formula iia can be carried out according to methods well known in the literature , for example by reduction with a complex metal hydride such as sodium borohydride . the activation of the alcohol can also be carried out according to methods well known in the literature , for instance by reaction with alkyl - or arylsulfonylchloride . the substition of the activated hydroxy group is suitably carried out in a polar organic solvent , for instance an alcohol , an ether or a ketone using hydrogen cyanide or a salt thereof . the substitution with a trialkylsilyl cyanide , as for example with trimethylsilyl cyanide , is carried out in an aprotic solvent , for instance in an ether or a halogenalkane , such as dichloromethane , in the presence of a lewis acid . the reduction of the cyano group is also well known in the literature , and can be performed as described hereinbefore . the alkylation of the 3 - aminomethyl group may be carried out as described hereinbefore . the present invention also provides a process for the preparation of a compound of the general formula i as defined hereinbefore , or acid addition salts thereof , and in which n represents 2 , which process comprises reaction of a compound of the general formula iia as defined hereinbefore , with cyanoacetic acid ( knoevenagel - doebner reaction ) followed by reduction of the compound obtained into an amine , and alkylation of the amine , especially with a ketone or aldehyde under suitable reducing conditions or an alkylating agent . the reaction of the ketone starting material and cyanoacetic acid is suitably carried out in a polar organic solvent such as pyridine . the reduction of the cyano group and the alkylation of the 3 - aminoethyl group may be carried out as described hereinbefore . suitably all reactions are carried out using substantially equimolar amounts of the reactants . however , it can be expedient to use one reactant in excess . it will be appreciated that in addition to the above described reaction steps additional chemical modifications can be made to the compounds and intermediates , e . g . introduction or amendment of certain substituents , additional alkylation reactions etc . the invention also provides fungicidal compositions comprising at least one of the compounds according to general formula i or an acid addition salt thereof , as well as methods of combating fungi at a locus comprising treatment of the locus with a compound of formula i or an acid addition salt thereof as defined hereinbefore , or with a composition as defined in this specification . the locus to be treated especially comprises plants subject to or subjected to fungal attack , seeds of such plants or the medium in which the plants are growing or are to be grown . the fungicidal composition comprises a carrier and , as active ingredient , a compound of the general formula i or an acid addition salt thereof . a method of making such a composition is also provided , which comprises bringing a compound of the general formula i as defined above or an acid addition salt thereof into association with at least one carrier . such a composition may contain a single compound or a mixture of several compounds of the present invention . it is also envisaged that different isomers or mixtures of isomers may have different levels or spectra of activity and thus compositions may comprise individual isomers or mixtures of isomers . the invention further relates to the use as a fungicide of a compound of formula i as defined hereinbefore or a composition as defined hereinbefore . a composition according to the invention preferably contains from 0 . 5 to 95 % by weight of active ingredient . a carrier in a composition according to the invention is any material with which the active ingredient is formulated to facilitate application to the locus to be treated , which may for example be a plant , seed or soil , or to facilitate storage , transport or handling . a carrier may be a solid or a liquid , including a material which is normally gaseous but which has been compressed to form a liquid , and any of the carriers normally used in formulating fungicidal compositions may be used . suitable solid carriers include natural and synthetic clays and silicates , for example natural silicas such as diatomaceous earths ; magnesium silicates , for example talcs ; magnesium aluminium silicates , for example attapulgites and vermiculites ; aluminium silicates , for example kaolinites , montmorillonites and micas ; calcium carbonate ; calcium sulphate ; ammonium sulphate ; synthetic hydrated silicon oxides and synthetic calcium or aluminium silicates ; elements , for example carbon and sulphur ; natural and synthetic resins , for example coumarone resins , polyvinyl chloride , and styrene polymers and copolymers ; solid polychlorophenols ; bitumen ; waxes , for example beeswax , paraffin wax , and chlorinated mineral waxes ; and solid fertilisers , for example superphosphates . suitable liquid carriers include water ; alcohols , for example isopropanol and glycols ; ketones , for example acetone , methyl ethyl ketone , methyl isobutyl ketone and cyclohexanone ; ethers ; aromatic or araliphatic hydrocarbons , for example benzene , toluene and xylene ; petroleum fractions , for example , kerosine and light mineral oils ; chlorinated hydrocarbons , for example carbon tetrachloride , perchloroethylene and trichloroethane . mixtures of different liquids are often suitable . fungicidal compositions are often formulated and transported in a concentrated form which is subsequently diluted by the user before application . the presence of small amounts of a carrier which is a surface - active agent facilitates this process of dilution . thus preferably at least one carrier in a composition according to the invention is a surface - active agent . for example the composition may contain at least two carriers , at least one of which is a surface - active agent . a surface - active agent may be an emulsifying agent , a dispersing agent or a wetting agent ; it may be nonionic or ionic . examples of suitable surface - active agents include the sodium or calcium salts of polyacrylic acids and lignin sulphonic acids ; the condensation products of fatty acids or aliphatic amines or amides containing at least 12 carbon atoms in the molecule with ethylene oxide and / or propylene oxide ; fatty acid esters of glycerol , sorbitol , sucrose or pentaerythritol ; condensates of these with ethylene oxide and / or propylene oxide ; condensation products of fatty alcohol or alkyl phenols , for example p - octylphenol or p - octylcresol , with ethylene oxide and / or propylene oxide ; sulphates or sulphonates of these condensation products ; alkali or alkaline earth metal salts , preferably sodium salts , of sulphuric or sulphonic acid esters containing at least 10 carbon atoms in the molecule , for example sodium lauryl sulphate , sodium secondary alkyl sulphates , sodium salts of sulphonated castor oil , and sodium alkylaryl sulphonates such as dodecylbenzene sulphonate ; and polymers of ethylene oxide and copolymers of ethylene oxide and propylene oxide . the compositions of the invention may for example be formulated as wettable powders , dusts , granules , solutions , emulsifiable concentrates , emulsions , suspension concentrates and aerosols . wettable powders usually contain 25 , 50 or 75 % w of active ingredient and usually contain in addition to solid inert carrier , 3 - 10 % w of a dispersing agent and , where necessary , 0 - 10 % w of stabiliser ( s ) and / or other additives such as penetrants or stickers . dusts are usually formulated as a dust concentrate having a similar composition to that of a wettable powder but without a dispersant , and may be diluted in the field with further solid carrier to give a composition usually containing 1 / 2 - 10 % w of active ingredient . granules are usually prepared to have a size between 10 and 100 bs mesh ( 1 . 676 - 0 . 152 mm ), and may be manufactured by agglomeration or impregnation techniques . generally , granules will contain 1 / 2 - 75 % w active ingredient and 0 - 10 % w of additives such as stabilisers , surfactants , slow release modifiers and binding agents . the so - called &# 34 ; dry flowable powders &# 34 ; consist of relatively small granules having a relatively high concentration of active ingredient . emulsifiable concentrates usually contain , in addition to a solvent and , when necessary , co - solvent , 1 - 50 % w / v active ingredient , 2 - 20 % w / v emulsifiers and 0 - 20 % w / v of other additives such as stabilisers , penetrants and corrosion inhibitors . suspension concentrates are usually compounded so as to obtain a stable , non - sedimenting flowable product and usually contain 10 - 75 % w active ingredient , 0 . 5 - 15 % w of dispersing agents , 0 . 1 - 10 % w of suspending agents such as protective colloids and thixotropic agents , 0 - 10 % w of other additives such as defoamers , corrosion inhibitors , stabilisers , penetrants and stickers , and water or an organic liquid in which the active ingredient is substantially insoluble ; certain organic solids or inorganic salts may be present dissolved in the formulation to assist in preventing sedimentation or as anti - freeze agents for water . aqueous dispersions and emulsions , for example compositions obtained by diluting a wettable powder or a concentrate according to the invention with water , also lie within the scope of the invention . the said emulsions may be of the water - in - oil or of the oil - in - water type , and may have a thick ` mayonnaise ` like consistency . the composition of the invention may also contain other ingredients , for example other compounds possessing herbicidal , insecticidal or fungicidal properties . of particular interest in enhancing the duration of the protective activity of the compounds of this invention is the use of a carrier which will provide a slow release of the fungicidal compounds into the environment of the plant which is to be protected . such slow - release formulations could , for example , be inserted in the soil adjacent to the roots of a plant , or could include an adhesive component enabling them to be applied directly to the stem of a vine plant . the present invention still further provides the use as a fungicide of a compound of the general formula i as defined above or a composition as defined above . the present invention is of wide applicability in the protection of crop plants against fungal attack . typical crops which may be protected include cereals , especially wheat and barley , rice , vines , vegetales , especially sugarbeet , potatoes , tomatoes , top fruit , especially apples , and cucumber . the duration of protection is normally dependent on the individual compound selected , and also a variety of external factors , such as climate , whose impact is normally mitigated by the use of a suitable formulation . the compounds of the present invention are especially suitable to combat erysiphe graminis in cereals . to a cold (- 20 ° c .) solution of lithium diisopropylamide ( 0 . 2 mol ) in tetrahydrofuran ( 300 ml ) is added ethyl 4 - t - butylcyclohexylcarboxylate ( 42 . 5 g , 0 . 2 mol ) in tetrahydrofuran ( 100 ml ). the reaction mixture is stirred for 1h at - 20 ° c . and is then cooled to - 70 ° c . allylbromide ( 24 . 5 g , 0 . 2 mol ) is added and the reaction mixture is allowed to warm up to room temperature over night . the reaction mixture is then quenched with saturated aqueous ammonium chloride solution ( 200 ml ) and most of the organic solvent is distilled off under reduced pressure . from the remainder the product is extracted with toluene ( 500 ml ). the organic layer is separated , dried with magnesium sulphate and concentrated in vacuo to yield an oil ( 51 g ). distillation in vacuo ( b . p . 75 °- 82 ° c ./ 0 . 03 mbar ) furnishes the pure product as a colourless oil ( 46 g ). to a solution of 3 - chloroperbenzoic acid ( 25 g , 0 . 080 mol ) in dichloromethane ( 200 ml ) is added ethyl 1 - allyl - 4 - t - butylcyclohexylcarboxylate ( 17 g , 0 . 067 mol ) in dichloromethane ( 200 ml ). the reaction mixture is stirred at room temperature over night . precipitated 3 - chlorobenzoic acid is filtered off and the filtrate is washed twice with saturated aqueous sodium bicarbonate and 5 % aqueous sodium bisulfite . drying and evaporation of the solvent yields the product as a colourless oil ( 17 g ). to lithium aluminumhydride ( 5 . 0 g , 0 . 132 mol ) in tetrahydrofuran ( 100 ml ) is added 1 -( 2 , 3 - epoxyprop - 1 - yl )- 4 - t - butylcyclohexylcarboxylate ( 17 g , 0 . 063 mol ) as a solution in tetrahydrofuran ( 100 ml ) at room temperature . the mixture is stirred over night and excess lah is hydrolysed by careful addition of saturated aqueous sodium sulfate . precipitated inorganics are filtered and the filtrate is dried with magnesium sulfate . evaporation of the solvent furnishes 14 g of crude product which is recrystalized from light petroleum to yield the pure product ( 8 g ) as colourless crystals which melt at 93 ° c . to a solution of oxalylchloride ( 21 . 0 g , 0 . 165 mol ) in dichloromethane ( 50 ml ) is added dimethylsulfoxide ( 21 ml ) in dichloromethane ( 50 ml ) at - 70 ° c . the reaction mixture is stirred for 5 min . and 1 - hydroxy - methyl - 1 -( 2 - hydroxyprop - 1 - yl )- 4 - t - butylcyclohexane ( 17 . 0 g , 0 . 075 mol ) is added . the reaction mixture is stirred for 30 min . at - 70 ° c . triethylamine ( 100 ml ) is then added and the reaction mixture is allowed to warm to room temperature . the reaction mixture is washed with water and brine . the organic layer is dried with magnesium sulfate and evaporated in vacuo to yield 15 g of a crystalline solid which melts at 68 °- 72 ° c . it is used in the next step without further purification . to a solution of 1 -( propan - 2 - one - 1 - yl )- 4 - t - butylcyclohexane carboxaldehyde ( 14 g , 0 . 0625 mol ) in tetrahydrofuran ( 200 ml ) cooled to - 70 ° c . is added a 2m solution of lithium diisopropylamide ( 35 ml ) in tetrahydrofuran . the mixture is stirred at - 70 ° c . for 1h and is then allowed to warm to - 20 ° c . aqueous saturated ammonium chloride ( 100 ml ) is then added and the phases are separated . the organic layer is dried with magnesium sulfate and evaporated in vacuo . the crude product is dissolved in toluene ( 200 ml ) to which p - toluenesulfonic acid ( 0 . 3 g ) is added . the solution is heated to reflux for 30 min . after cooling the acid is removed by washing with 5 % aqueous sodium carbonate . drying and evaporating the solvent yields 11 g of a thick oil which is purified by flash chromatography ( silica , light petroleum / ethylacetate 10 : 1 ). 8 - t - butyl - spiro 4 , 5 ! dec - 3 - en - 2 - one ( 7 . 5 g , mol ) in ethanol ( 100 ml ) is hydrogenated on a mixture of raney nickel and palladium on charcoal ( 50 ° c ./ 60 psi ) until hydrogen uptake ceases . the catalyst is filtered off and the solvent evaporated in vacuo . the crude product is purified by flash chromatography ( silica , toluene / acetone 10 : 1 ). m . p . 78 °- 82 ° c . the title compounds are prepared by dissolving the ( substituted ) spiro ( 4 , 5 ) decane - 2 - one ( 4 mmol ), an amine of formula hnr 2 r 3 ( 4 . 2 mmol ) and zinc chloride 0 . 4 g ( 3 mmol ) in 20 ml dry methanol . sodium cyanoborohydride ( 0 . 31 g , 5 mmol ) is then added and the mixture is stirred over night at room temperature . the solvent is then distilled off in vacuo and the residue is taken up in ethylacetate ( 20 ml ), washed with 1n sodium hydroxide ( 20 ml ) and water ( 20 ml ). the organic layer is dried with magnesium sulphate , filtered and evaporated in vacuo to yield the crude product which might be further purified by chromatography on silica using mixtures with varying amounts of toulene / ethylacetate / triethylamine as the eluent . the compounds according to the invention have been prepared via the above described method as detailed below in table ia : table ia__________________________________________________________________________formula i ( n = 0 ) exampler . sub . 1 r . sub . 2 r . sub . 3 acid__________________________________________________________________________1 t - butyl -- ch . sub . 2 ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 ch . sub . 2 -- -- 2 t - butyl h 3 - heptyl -- 3 t - butyl h cyclohexyl -- 4 t - butyl cis --- ch . sub . 2 ch ( ch . sub . 3 ) och ( ch . sub . 3 ) ch . sub . 2 -- -- 5 t - butyl -- ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 -- 6 t - butyl h 3 - methylcyclohexyl -- 7 t - butyl h 4 - methylcyclohexyl -- 8 t - butyl h i - butyl -- 9 t - butyl methyl cyclohexyl -- 10 t - butyl h cyclopentyl -- 11 t - butyl h cycloheptyl -- 12 t - butyl h 4 - chlorobenzyl -- 13 t - butyl --( ch . sub . 2 ). sub . 2 -- o --( ch . sub . 2 ). sub . 2 -- -- 14 t - butyl n - butyl n - butyl -- 15 t - butyl methyl phenyl -- 16 t - butyl h phenyl -- 17 t - amyl h cyclohexyl -- 18 t - butyl -- ch . sub . 2 ch ( ch . sub . 3 )( ch . sub . 2 ). sub . 3 -- -- 19 t - amyl --( ch . sub . 2 ). sub . 2 ch ( ch . sub . 3 )( ch . sub . 2 ). sub . 2 -- -- 20 t - amyl methyl cyclohexyl -- 21 t - butyl --( ch . sub . 2 ). sub . 6 -- -- 22 t - butyl -- h methyl -- 23 t - butyl -- h ethyl -- 24 t - butyl -- h n - propyl -- 25 t - butyl -- h i - propyl -- 26 t - butyl -- h n - butyl -- 27 t - butyl -- h t - butyl -- 28 t - amyl -- h methyl -- 29 t - amyl -- h ethyl -- 30 t - amyl -- h n - propyl -- 31 t - amyl -- h n - butyl -- 32 t - amyl -- h i - butyl -- 33 t - amyl -- h t - butyl -- 34 t - amyl -- h phenyl -- 35 t - amyl --( ch . sub . 2 ). sub . 5 -- -- 36 t - amyl -- ch . sub . 2 ch ( ch . sub . 3 )-- o -- ch ( ch . sub . 3 ) ch . sub . 2 -- -- 37 t - butyl -- h -- h -- 38 t - amyl -- h -- h -- 39 n - butyl -- h phenyl -- 40 n - butyl -- h cyclohexyl -- 41 n - butyl -- h methyl -- 42 n - butyl -- h ethyl -- 43 n - butyl -- h n - propyl -- 44 n - butyl -- h i - propyl -- 45 n - butyl -- h n - butyl -- 46 n - butyl -- h i - butyl -- 47 n - butyl -- h t - butyl -- 48 n - butyl n - butyl phenyl -- 49 t - amyl -- h cyclohexyl -- 50 t - amyl methyl phenyl -- 51 t - amyl methyl methyl -- 52 t - amyl methyl ethyl -- 53 t - amyl methyl n - propyl -- 54 phenyl -- h methyl -- 55 phenylbutylphenyl -- 56 phenyl -- h cyclohexyl -- 57 phenyl -- ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 -- 58 phenyl -- ch . sub . 2 ch ( ch . sub . 3 )-- o -- ch ( ch . sub . 3 ) ch . sub . 2 -- -- 59 -- h methyl methyl -- 60 t - amyl methyl n - hexyl -- 61 phenyl methyl n - hexyl -- 62 cyclohexyl -- h n - butyl -- 63 cyclohexyl -- h i - propyl -- 64 cyclohexyl -- h n - pentyl -- 65 cyclohexyl -- h t - amyl -- 66 cyclohexyl -- h s - butyl -- 67 t - butyl methyl ethyl -- 68 t - butyl ethyl ethyl -- 69 t - butyl n - hexyl n - hexyl -- 70 t - butyl -- h n - pentyl -- 71 t - butyl -- h allyl -- 72 t - butyl ethyl n - pentyl -- 73 t - butyl n - n - pentyl -- propyl74 t - butyl n - butyl n - pentyl -- 75 t - butyl s - butyl n - pentyl -- 76 t - butyl i - n - pentyl -- propyl77 t - butyl cyclohexyl n - pentyl -- 78 t - butyl methyl n - pentyl -- 79 t - butyl allyl cyclohexyl -- 80 t - butyl methyl cyclohexyl -- 81 t - butyl -- h t - butyl -- 82 t - butyl -- h cyclohexylmethyl -- 83 t - butyl -- h 1 - ethylpropyl -- 84 t - butyl -- h 2 - methylcyclohexyl -- 85 t - butyl -- h 2 - norbornyl -- 86 t - butyl -- h 2 - adamantyl -- 87 t - butyl -- h 3 - methylcyclohexyl -- 88 t - butyl -- h 4 - methylcyclohexyl -- 89 t - butyl -- h 4 - ethylcyclohexyl -- 90 t - butyl -- h 2 - ethylcyclohexyl -- 91 t - butyl methyl cyclohexylmethyl -- 92 t - butyl ethyl cyclohexylmethyl -- 93 t - butyl propyl cyclohexylmethyl -- 94 t - butyl methyl 1 - ethylpropyl -- 95 t - butyl ethyl 1 - ethylpropyl -- 96 t - butyl n - 1 - ethylpropyl -- propyl97 t - butyl i - i - propyl -- propyl98 t - butyl -- h cyclohexylmethyl -- 99 t - butyl -- h 1 - propylbutyl -- 100 t - butyl -- h 2 - cyclohexylethyl -- 101 t - butyl -- h 2 - heptyl -- 102 t - butyl -- h 3 - heptyl -- 103 t - butyl allyl allyl -- 104 t - butyl -- h n - heptyl -- 105 t - butyl -- h 2 - octyl -- 106 t - butyl -- h 1 , 1 , 3 - trimethylbutyl -- 107 t - butyl -- h 1 , 5 - dimethylhexyl -- 108 t - butyl -- h 2 - cyclohex - 1 - enyl - -- ethyl109 t - butyl -- h 4 - t - butyl - cyclohexyl -- 110 t - butyl -- h 1 , 3 - dimethylbutyl -- 111 t - butyl -- h 2 - t - butylethyl -- 112 t - butyl -- h 1 , 3 - dimethylpentyl -- 113 cyclohexyl - -- ch . sub . 2 ch . sub . 2 ch (-- ch . sub . 2 --). sub . 4 chch . sub . 2 -- methyl114 t - butyl -- ch . sub . 2 ch . sub . 2 ( 1 , 2 - benzylene ) ch . sub . 2 -- -- 115 cyclohexyl - -- h n - octyl -- methyl116 t - butyl -- ch . sub . 2 ch . sub . 2 ch . sub . 2 ch (-- ch . sub . 2 --). sub . 4 ---- 117 t - butyl methyl 2 - cyclohexylethyl -- 118 t - butyl ethyl 2 - cyclohexylethyl -- 119 t - butyl n - 2 - cyclohexylethyl -- propyl120 t - butyl -- h 4 - methylcyclohexyl - -- methyl121 t - butyl methyl 2 - methylpropyl -- 122 t - butyl i - 2 - cyclohexylethyl -- propyl123 t - butyl n - 2 - methylpropyl -- propyl124 t - butyl -- h c ( ch . sub . 3 )═ chcoch . sub . 2 ch ( ch . sub . 3 ). sub . 2 -- 125 t - butyl -- ch . sub . 3 -- ch . sub . 2 --( 1 - methyl - -- cyclohexyl ) 126 t - butyl -- c . sub . 2 h . sub . 5 -- ch . sub . 2 --( 1 - methyl - -- cyclohexyl ) 127 t - butyl -- c . sub . 3 h . sub . 7 -- ch . sub . 2 --( 1 - methyl - -- cyclohexyl ) 128 t - butyl -- ch . sub . 32 - norbornyl -- 129 t - butyl -- c . sub . 2 h . sub . 52 - norbornyl -- 130 t - butyl -- c . sub . 3 h . sub . 72 - norbornyl -- 131 t - butyl -- ch . sub . 3 -- ch . sub . 2 -- c ( ch . sub . 3 ). sub . 3 -- 132 t - butyl -- c . sub . 2 h . sub . 5 -- ch . sub . 2 -- c ( ch . sub . 3 ). sub . 3 -- 133 t - butyl -- c . sub . 3 h . sub . 7 -- ch . sub . 2 -- c ( ch . sub . 3 ). sub . 3 -- 134 t - butyl -- h -- ch . sub . 2 -- c ( ch . sub . 3 ). sub . 3 -- 135 1 , 1 , 3 , 3 - --( ch . sub . 2 ). sub . 2 ch ( ch . sub . 3 )( ch . sub . 2 ). sub . 2 -- -- tetramethyl - butyl136 1 , 1 , 3 , 3 - -- ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 -- tetramethyl - butyl137 1 , 1 , 3 , 3 - -- h -- ch . sub . 2 -- ch ( ch . sub . 3 ). sub . 2 -- tetramethyl - butyl138 t - butyl -- h2 - decalylhcl139 1 - methyl - 1 -- h -- ch . sub . 2 -- ch ( ch . sub . 3 ). sub . 2 -- cyclohexyl - ethyl140 1 - methyl - -- ch . sub . 3n - c . sub . 6 h . sub . 13 -- 1 - cyclohexyl - ethyl141 1 - methyl - --( ch . sub . 2 ). sub . 2 ch ( ch . sub . 3 )( ch . sub . 2 ). sub . 2 -- -- 1 - cyclohexyl - ethyl142 1 - methyl - -- h -- c . sub . 6 h . sub . 11 -- 1 - cyclohexyl - ethyl143 t - butyl -- ch . sub . 2 -- ch ( ch . sub . 3 ). sub . 2 -- ch . sub . 2 -- ch ( ch . sub . 3 ). sub . 2 -- 144 t - butyl -- h --( ch . sub . 2 ). sub . 2 och . sub . 3 -- 145 t - c . sub . 4 h . sub . 9 -- h -- ch . sub . 2 --( 2 - thf ) -- 146 t - butyl -- h -- ch . sub . 2 ch ( och . sub . 3 ). sub . 2 -- 147 t - butyl --( ch . sub . 2 ). sub . 2 och . sub . 3 --( ch . sub . 2 ). sub . 2 och . sub . 3 -- 148 t - butyl -- ch . sub . 3 -- ch . sub . 2 ch ( och . sub . 3 ). sub . 2 -- 149 t - butyl -- ch . sub . 3 -- ch . sub . 2 - 2 -( 1 , 3 - -- dioxolanyl ) 150 t - butyl -- ch . sub . 3 --( ch . sub . 2 ). sub . 2 och . sub . 3 -- 151 t - butyl -- ch . sub . 3 -- ch . sub . 2 --( 2 - thf ) -- 152 t - butyl -- c . sub . 2 h . sub . 5 -- ch . sub . 2 --( 2 - thf ) -- 153 t - butyl -- h -- ch . sub . 2 ch ( oc . sub . 2 h . sub . 5 ). sub . 2 -- 154 t - butyl -- c . sub . 2 h . sub . 5 -- ch . sub . 2 ch ( och . sub . 3 ). sub . 2 -- 155 t - butyl -- ch . sub . 3 -- ch . sub . 2 ch ( oc . sub . 2 h . sub . 5 ). sub . 2 -- 156 t - butyl -- c . sub . 2 h . sub . 5 -- ch . sub . 2 ch ( oc . sub . 2 h . sub . 5 ). sub . 2 -- 157 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - hcl cyclohexyl ) 158 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - hbr cyclohexyl ) 159 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - h . sub . 3 bo . sub . 3 cyclohexyl ) 160 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - 1 / 2 hooc -- cooh cyclohexyl ) 161 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - ch . sub . 3 cooh cyclohexyl ) 162 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - cf . sub . 3 cooh cyclohexyl ) 163 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - c . sub . 3 h . sub . 7 cooh cyclohexyl ) 164 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - c . sub . 5 h . sub . 11 cooh cyclohexyl ) 165 t - butyl -- h ch . sub . 2 --( 1 - methyl - c . sub . 11 h . sub . 23 cooh cyclohexyl ) 166 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - c . sub . 15 h . sub . 31 cooh cyclohexyl ) 167 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - c . sub . 6 h . sub . 5 b ( oh ). sub . 2 cyclohexyl ) 168 t - butyl -- h -- ch . sub . 2 --( 1 - methyl - saccharin cyclohexyl ) 169 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 hcl170 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 hbr171 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 h . sub . 3 bo . sub . 3172 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 1 / 2 hooc -- cooh173 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 ch . sub . 3 cooh174 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 cf . sub . 3 cooh175 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 c . sub . 3 h . sub . 7 cooh176 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 c . sub . 5 h . sub . 11 cooh177 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 c . sub . 11 h . sub . 23 cooh178 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 c . sub . 15 h . sub . 31 cooh179 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 c . sub . 6 h . sub . 5 b ( oh ). sub . 2180 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 saccharin__________________________________________________________________________ the compounds of formula i , wherein n represents 1 , 2 or 3 , are obtained from the corresponding compounds of formula iib , wherein n is 0 , 1 or 2 , respectively , using procedures analogous to example 1 ( vii ). the resulting compounds are given below in tables ib to id : table ib______________________________________formula i ( n = 1 ) example r . sub . 1 r . sub . 2 r . sub . 3 acid______________________________________181 t - butyl -- h -- h -- 182 t - butyl -- h -- c . sub . 6 h . sub . 11 -- 183 t - butyl -- hn - c . sub . 8 h . sub . 17 -- 184 t - butyl -- hn - c . sub . 6 h . sub . 13 -- 185 t - butyl -- h -- c . sub . 6 h . sub . 11 hcl186 t - butyl -- ch . sub . 2 -- ch ( ch . sub . 3 ). sub . 2 -- ch . sub . 2 -- ch ( ch . sub . 3 ). sub . 2 -- 187 t - butyl -- ch . sub . 3 -- c . sub . 6 h . sub . 11 -- 188 t - butyl -- c . sub . 2 h . sub . 5 -- c . sub . 6 h . sub . 11 -- ______________________________________ table ic______________________________________formula i ( n = 2 ) example r . sub . 1 r . sub . 2 r . sub . 3 acid______________________________________189 t - butyl -- h -- c . sub . 6 h . sub . 11 -- 190 t - butyl -- h -- h hcl191 t - butyl -- ch . sub . 3 -- ch . sub . 3 -- 192 t - butyl -- h ( 3 - methyl )- -- cyclohexyl193 t - butyl -- h -- ch ( c . sub . 3 h . sub . 7 ) c . sub . 3 h . sub . 7 hcl194 t - butyl -- h -- ch ( ch . sub . 3 ) c . sub . 5 h . sub . 11 -- 195 t - butyl -- h -- c . sub . 7 h . sub . 13 -- 196 t - butyl -- c . sub . 4 h . sub . 9n - c . sub . 4 h . sub . 9 -- 197 t - butyl -- h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 -- 198 t - butyl -- h2 - decalyl -- 199 t - butyl -- ch . sub . 3 -- c . sub . 6 h . sub . 11 -- 200 t - butyl -- c . sub . 2 h . sub . 5 -- c . sub . 6 h . sub . 11 -- 201 t - butyl -- ch . sub . 3 -- ch ( ch . sub . 3 ) c . sub . 5 h . sub . 11 -- 202 t - butyl -- c . sub . 2 h . sub . 5 -- ch ( ch . sub . 3 ) c . sub . 5 h . sub . 11 -- 203 t - butyl --( ch . sub . 2 ). sub . 5 -- -- 204 t - butyl --( ch . sub . 2 ). sub . 2 -- o --( ch . sub . 2 ). sub . 2 -- -- 205 t - butyl -- h ( 4 - t - -- butyl )- cyclohexyl206 t - butyl -- h ( 4 - methyl )- -- cyclohexyl207 t - butyl -- h ( 2 - methyl )- -- cyclohexyl208 t - butyl -- h -- c . sub . 5 h . sub . 9 -- 209 t - butyl -- h --( ch . sub . 2 )- 2 - thf -- 210 t - butyl -- ch . sub . 3 -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 -- 211 t - butyl -- c . sub . 2 h . sub . 5 -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 -- 212 t - butyl -- c . sub . 3 h . sub . 7 -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 -- ______________________________________ table id______________________________________formula i ( n = 3 ) example r . sub . 1 r . sub . 2 r . sub . 3 acid______________________________________213 t - butyl h h -- 214 t - butyl h -- ch ( ch . sub . 3 ) c . sub . 5 h . sub . 11 -- 215 t - butyl h -- ch ( c . sub . 2 h . sub . 5 ) c . sub . 4 h . sub . 9 -- 216 t - butyl h -- ch ( c . sub . 3 h . sub . 7 ) c . sub . 3 h . sub . 7 -- 217 t - butyl h -- c . sub . 6 h . sub . 11 -- 218 t - butyl h -- c . sub . 7 h . sub . 13 -- 219 t - butyl --( ch . sub . 2 ). sub . 2 -- o --( ch . sub . 2 ). sub . 2 -- -- 220 t - butyl --( ch . sub . 2 ). sub . 5 -- -- 221 t - butyl --( ch . sub . 2 ). sub . 2 ch ( ch . sub . 3 )( ch . sub . 2 ). sub . 2 -- -- 222 t - butyl -- ch . sub . 2 ch ( ch . sub . 3 ) ch . sub . 2 ch ( ch . sub . 3 )-- -- 223 t - butyl -- ch . sub . 2 ch ( ch . sub . 3 )-- o -- ch ( ch . sub . 3 ) ch . sub . 2 -- -- ______________________________________ thf means tetrahydrofurfuryl , acid means that the compound is an ammonium salt of the denoted acid . all other alkyl groups are straight chains unless otherwise designated as branched chains . c 6 h 5 means phenyl , c 7 h 13 means cycloheptyl , c 6 h 11 means cyclohexyl , c 5 h 9 means cyclopentyl and c 3 h 5 means cyclopropyl . physical data for the above compounds are set out in tables ii , iii and iv . table ii______________________________________melting pointexample no . melting point ° c . ! ______________________________________1 1283 67 - 694 70 - 725 5012 53 - 57______________________________________ table iv______________________________________molecular weight ( determined by mass spectrometry ) exampleno . calculated found______________________________________6 305 3057 305 3058 265 2659 305 30510 277 27711 305 305______________________________________ test compounds are dissolved in acetone and diluted with deionized water ( 95 parts water to 5 parts acetone ) containing 0 . 05 % tween 20 ®, a polyoxyethylene sorbitan monolaurate surfactant manufactured by atlas chemical industries , to give a concentration of 200 ppm . the plants are sprayed with the test solutions , dried and inoculated with fungi later the same day . when disease symptom development is optimal , the plants are rated for disease control according to the rating scale shown below . each test contains inoculated treated plants , inoculated untreated plants and a inoculated plants treated with reference fungicides . the data obtained are shown in table v . ______________________________________rating scalerating range % control______________________________________0 01 1 - 142 15 - 293 30 - 444 45 - 595 60 - 746 75 - 897 90 - 958 96 - 999 100t no evaluation possible______________________________________targetssymbol disease pathogen______________________________________as apple scab venturia inaequalisgdm grape downy mildew plasmopara viticolapb pepper botrytis botrytis cinerearb rice blast pyricularia grisea f . sp . oryzaesbc sugar beet cercospora cercospora beticolateb tomato early blight alternaria solaniwpm wheat powdery mildew erysiphe graminis f . sp . triticiwsn wheat septoria nodorum septoria nodorum blotch______________________________________ table v______________________________________example as gdm pb rb sbc teb wpm wsn______________________________________1 6 9 8 0 6 0 7 72 8 8 9 0 4 0 8 03 8 5 9 0 6 8 8 84 0 0 9 0 7 0 9 75 6 5 9 0 7 0 8 46 5 4 7 4 7 3 7 67 4 3 7 0 8 4 7 78 8 0 6 0 6 0 5 49 8 2 8 0 4 0 7 610 8 5 6 0 6 2 6 711 7 6 8 0 5 5 6 612 7 0 7 0 0 0 5 0______________________________________ test compounds are dissolved in acetone then diluted with deionize water ( 9 parts water : 1 part acetone ), and dispersed into cell well plates containing a suspension of ground fungal mycelium in a nutrient broth resulting in a final concentration of 25 ppm of the test compound . assay plates are incubated for 3 - 7 days at 22 ° c . growth inhibition is measured visually and is rated using the following scale : ______________________________________ rating % inhibition______________________________________ 0 0 1 1 - 29 3 30 - 59 5 60 - 89 7 90 - 99 9 100______________________________________ untreated controls , solvent blanks and reference fungicide are included in each test . ______________________________________symbol pathogen______________________________________fus oxc fusarium oxysporium f . sp . cucumerinumpsdc he pseudocercosporella herpotrichoidesptyh ul pythium ultimumrhiz so rhizoctonia solani______________________________________ fus psdc pyth rhizexample oxc he ul so______________________________________1 0 7 7 92 0 9 9 73 0 0 1 04 0 0 0 05 0 0 0 06 0 7 7 97 0 7 7 98 0 7 7 99 0 7 7 910 0 9 9 911 0 9 0 912 0 9 0 9______________________________________
| 0 |
for the purpose of promoting an understanding of the principles of the present invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will , nevertheless , be understood that no limitation of the scope of the invention is thereby intended ; any alterations and further modifications of the described or illustrated embodiments , and any further applications of the principles of the invention as illustrated therein are contemplated as would normally occur to one skilled in the art to which the invention relates . generally , the present invention in its preferred embodiment operates in the context of a network as shown in fig1 . system 100 includes a vulnerability and remediation database 110 connected by internet 120 to subnet 130 . in this exemplary embodiment , firewall 131 serves as the gateway between internet 120 and the rest of subnet 130 . router 133 directs connections between computers 137 and each other and other devices on internet 120 . server 135 collects certain information and provides certain data services that will be discussed in further detail herein . in particular , security server 135 includes processor 142 , and memory 144 encoded with programming instructions executable by processor 142 to perform several important security - related functions . for example , security server 135 collects data from devices 131 , 133 , 137 , and 139 , including the software installed on those devices , their configuration and policy settings , and patches that have been installed . security server 135 also obtains from vulnerability and remediation database 110 a regularly updated list of security vulnerabilities in software for a wide variety of operating systems , and even in the operating systems themselves . security server 135 also downloads a regularly updated list of remediation techniques that can be applied to protect a device from damage due to those vulnerabilities . in a preferred embodiment , each vulnerability in remediation database 110 is identified by a vulnerability identifier , and the vulnerability identifier can be used to retrieve remediation information from database 110 ( and from database 146 , discussed below in relation to fig2 ). in this preferred embodiment , computers 137 and 139 each comprise a processor 152 , 162 , memory 154 , 164 , and storage 156 , 166 . computer 137 executes a client - side program ( stored in storage 156 , loaded into memory 154 , and executed by processor 152 ) that maintains an up - to - date collection of information regarding the operating system , service pack ( if applicable ), software , and patches installed on computer 137 , and the policies and configuration data ( including configuration files , and elements that may be contained in files , such as *. ini and *. conf files and registry information , for example ), and communicates that information on a substantially real - time basis to security server 135 . in an alternative embodiment , the collection of information is not retained on computer 137 , but is only communicated once to security server 135 , then is updated in real time as changes to that collection occur . computer 139 stores , loads , and executes a similar software program that communicates configuration information pertaining to computer 139 to security server 135 , also substantially in real time . changes to the configuration registry in computer 139 are monitored , and selected changes are communicated to security server 135 so that relevant information is always available . security server 135 may connect directly to and request software installation status and configuration information from firewall 131 and router 133 , for embodiments wherein firewall 131 and router 133 do not have a software program executing on them to communicate this information directly . this collection of information is made available at security server 135 , and combined with the vulnerability and remediation data from source 110 . the advanced functionality of system 100 is thereby enabled as discussed further herein . turning to fig2 , one sees additional details and components of the devices in subnet 130 . computers 137 and 139 are traditional client or server machines , each having a processor 152 , 162 , memory 154 , 164 , and storage 156 , 166 . firewall 131 and router 133 also have processors 172 , 182 and storage 174 , 184 , respectively , as is known in the art . in this embodiment , devices 137 and 139 each execute a client - side program that continuously monitors the software installation and configuration status for that device . changes to that status are communicated in substantially real time to security server 135 , which continuously maintains the information in database 146 . security server 135 connects directly to firewall 131 and router 133 to obtain software installation and configuration status for those devices in the absence of a client - side program running thereon . processors 142 , 152 , 162 may each be comprised of one or more components configured as a single unit . alternatively , when of a multi - component form , processor 142 , 152 , 162 may each have one or more components located remotely relative to the others . one or more components of processor 142 , 152 , 162 may be of the electronic variety defining digital circuitry , analog circuitry , or both . in one embodiment , processor 142 , 152 , 162 are of a conventional , integrated circuit microprocessor arrangement , such as one or more pentium 4 or xeon processors from intel corporation of 2200 mission college boulevard , santa clara , calif ., 95052 , usa , or athlon xp processors from advanced micro devices , one amd place , sunnyvale , calif ., 94088 , usa . memories 144 , 154 , 164 may include one or more types of solid - state electronic memory , magnetic memory , or optical memory , just to name a few . by way of non - limiting example , memory 40 b may include solid - state electronic random access memory ( ram ), sequentially accessible memory ( sam ) ( such as the first - in , first - out ( fifo ) variety or the last - in first - out ( lifo ) variety ), programmable read only memory ( prom ), electrically programmable read only memory ( eprom ), or electrically erasable programmable read only memory ( eeprom ); an optical disc memory ( such as a dvd or cd rom ); a magnetically encoded hard drive , floppy disk , tape , or cartridge media ; or a combination of any of these memory types . also , memories 144 , 154 , 164 may be volatile , nonvolatile , or a hybrid combination of volatile and nonvolatile varieties . in this exemplary embodiment , storage 146 , 156 , 166 comprises one or more of the memory types just given for memories 144 , 154 , 164 , preferably selected from the non - volatile types . this collection of information is used by system 100 in a wide variety of ways . with reference to fig3 , assume for example that a connection request 211 arrives at firewall 131 requesting that data be transferred to computer 137 . the payload of request 211 is , in this example , a probe request for a worm that takes advantage of a particular security vulnerability in a certain computer operating system . based on characteristics of the connection request 211 , firewall 131 sends a query 213 to security server 135 . query 213 includes information that security server 135 uses to determine ( 1 ) the intended destination of connection request 211 , and ( 2 ) some characterization of the payload of connection request 211 , such as a vulnerability identifier . security server 135 uses this information to determine whether connection request 211 is attempting to take advantage of a particular known vulnerability of destination machine 137 , and uses information from database 146 ( see fig2 ) to determine whether the destination computer 137 has the vulnerable software installed , and whether the vulnerability has been patched on computer 137 , or whether computer 137 has been configured so as to be invulnerable to a particular attack . security server 135 sends result signal 217 back to firewall 131 with an indication of whether the connection request should be granted or rejected . if it is to be granted , firewall 131 passes the request to router 133 as request 219 , and router 133 relays the request as request 221 to computer 137 , as is understood in the art . if , on the other hand , signal 217 indicates that connection request 211 is to be rejected , firewall 133 drops or rejects the connection request 211 as is understood in the art . analogous operation can protect computers within subnet 130 from compromised devices within subnet 130 as well . for example , fig4 illustrates subnet 130 with computer 137 compromised . under the control of a virus or worm , for example , computer 137 sends connection attempt 231 to router 133 in an attempt to probe or take advantage of a potential vulnerability in computer 139 . on receiving connection request 231 , router 133 sends relevant information about request 231 in a query 233 to security server 135 . similarly to the operation discussed above in relation to fig3 , security server 135 determines whether connection request 231 poses any threat , and in particular any threat to software on computer 139 . if so , security server 135 determines whether the vulnerability has been patched , and if not , it determines whether computer 139 has been otherwise configured to avoid damage due to that vulnerability . security server 135 replies with signal 235 to query 233 with that answer . router 133 uses response 235 to determine whether to allow the connection attempt . in some embodiments , upon a determination by security server 135 that a connection attempt or other attack has occurred against a computer that is vulnerable ( based on its current software , patch , policy , and configuration status ), security server 135 selects one or more remediation techniques from database 146 that remediate the particular vulnerability . based on a prioritization previously selected by an administrator or the system designer , the remediation technique ( s ) are applied ( 1 ) to the machine that was attacked , ( 2 ) to all devices subject to the same vulnerability ( based on their real - time software , patch , policy , and configuration status ), or ( 3 ) to all devices to which the selected remediation can be applied . in various embodiments , remediation techniques include the closing of open ports on the device ; installation of a patch that is known to correct the vulnerability ; changing the device &# 39 ; s configuration ; stopping , disabling , or removing services ; setting or modifying policies ; and the like . furthermore , in various embodiments , events and actions are logged ( preferably in a non - volatile medium ) for later analysis and review by system administrators . in these embodiments , the log also stores information describing whether the target device was vulnerable to the attack . a real - time status database according to the present invention has many other applications as well . in some embodiments , the database 146 is made available to an administrative console running on security server 135 or other administrative terminal . when a vulnerability is newly discovered in software that exists in subnet 130 , administrators can immediately see whether any devices in subnet 130 are vulnerable to it , and if so , which ones . if a means of remediation of the vulnerability is known , the remediation can be selectively applied to only those devices subject to the vulnerability . in some embodiments , the database 146 is integrated into another device , such as firewall 131 or router 133 , or an individual device on the network . while some of these embodiments might avoid some failures due to network instability , they substantially increase the complexity of the device itself . for this reason , as well as the complexity of maintaining security database functions when integrated with other functions , the network - attached device embodiment described above in relation to fig1 - 4 is preferred . in a preferred embodiment , a software development kit ( sdk ) allows programmers to develop security applications that access the data collected in database 146 . the applications developed with the sdk access information using a defined application programming interface ( api ) to retrieve vulnerability , remediation , and device status information available to the system . the applications then make security - related determinations and are enabled to take certain actions based on the available data . in these exemplary systems , “ configuration information ” for each device may take the form of initialization files ( often named *. ini or *. conf ), configuration registry ( such as the windows registry on microsoft windows operating systems ), or configuration data held in volatile or non - volatile memory . such configuration information often determines what and how data is accepted from other devices , sent to other devices , processed , stored , or otherwise handled , and in many cases determines what routines and sub - routines are executed in a particular application or operating system . all publications , prior applications , and other documents cited herein are hereby incorporated by reference in their entirety as if each had been individually incorporated by reference and fully set forth . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiments have been shown and described and that all changes and modifications that would occur to one skilled in the relevant art are desired to be protected .
| 7 |
the disclosure , including the accompanying drawings , is illustrated by way of example and not by way of limitation . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references mean at least one . referring to fig1 , an exemplary embodiment of a sign language recognition system 1 includes a camera 10 , a storage unit 12 , a processing unit 15 , a first output unit 16 , and a second output unit 18 . in the embodiment , the first output unit 16 is a screen , and the second output unit 18 is a speaker or an earphone . hereinafter the term signer is used for the person who uses sign language to communicate . the camera 10 captures images of the gestures of a signer . the processing unit 15 and the storage unit 12 processes the images 30 captured by the camera 10 , for obtaining what the signer means . the first output unit 16 displays what the signer is signing . the second output unit 18 verbalizes what the signer is signing . the storage unit 12 includes a sign language system setting module 122 , a sign language identification module 123 , a recognition module 125 , a voice conversion module 126 , and a gesture storing module 128 . the sign language system setting module 122 , the sign language identification module 123 , the recognition module 125 , and the voice conversion module 126 may include one or more computerized instructions executed by the processor 15 . the gesture storing module 128 stores different types of gestures and meanings for each gesture as shown in fig2 . each type of gestures includes a plurality of gestures . in the embodiment , the gesture storing module 128 stores two types of gestures . a first type of gestures corresponds to china sign language . a second type of gestures corresponds to american sign language . in other embodiments , the gesture storing module 128 may store more than two types of gestures or just one type of gestures . the sign language system setting module 122 is for setting a work mode of the sign language recognition system 1 . work mode hereinafter is referring to which language of sign that the signer is using . it can be understood that in the embodiment , the work modes of the sign language recognition system 1 includes a first mode corresponding to the first type of gesture , and a second mode corresponding to the second type of gesture . in the embodiment , receivers can use two buttons to manually set the work mode of the sign language recognition system 1 . the sign language system identification module 123 is for automatically setting the work mode of the sign language recognition system 1 when the receivers do not manually set the work mode of the sign language recognition system 1 . to automatically set the work mode of the sign language recognition system 1 by the sign language identification module 123 will be described as follows . the sign language identification module 123 compares the gesture of the signer captured by the camera 10 with the plurality of types of gestures , to determine which type the gestures captured belongs to . if the gesture of the signer captured by the camera 10 belongs to the first type of gesture , the sign language identification module 123 sets the work mode of the sign language recognition system 1 as the first work mode . moreover , if a gesture of the signer captured by the camera 10 belongs to both the first and second types of gesture , the sign language identification module 123 may compare the next gesture of the signer captured by the camera 10 with the plurality of types of gestures , until it is determined which only one type the gesture belongs to . the recognition module 125 compares the images of the gestures captured by the camera 10 with the plurality of gestures , corresponding to the work mode of the sign language recognition system 1 , to find out what the meanings of the gestures that are captured by the camera 10 are . the screen 16 displays the meanings obtained by the recognition module 125 . the voice conversion module 126 converts the gestures captured by the camera 10 into audible sounds . the speaker 18 plays the meanings of the gestures captured by the camera 10 . as shown in fig3 , the sign language recognition system 1 may be embedded within a mobile telephone . the camera 10 mounts on a surface of the body of the mobile telephone . furthermore , the sign language recognition system 1 may take the form of glasses worn by the receiver as shown in fig4 . the camera 10 mounts on a bridge of the glasses . referring to fig5 , an exemplary embodiment of a sign language recognition method is as follows . in step s 1 , the receiver determines whether the receiver needs to manually set the work mode of the sign language recognition system 1 . if the receiver needs to manually set the work mode of the sign language recognition system 1 , the process flows to step s 2 . if the receiver does not need to manually set the work mode of the sign language recognition system 1 , the process flows to step s 3 . in step s 2 , the receiver manually sets the work mode of the sign language recognition system 1 , then the process flows to step s 3 . in step s 3 , the camera 10 captures an image of a gesture of the signer . in step s 4 , the recognition module 125 determines whether the work mode is set . if the work mode is not set , the process flows to step s 5 . if the work mode is set , the process flows to step s 6 . in step s 5 , the sign language identification module 123 compares the gesture of the signer captured by the camera 10 with the plurality of types of gestures , to determine which type the gesture of the signer belongs to , and sets the work mode accordingly . for example , if the gesture of the signer captured by the camera 10 belongs to the first type of gestures , the sign language identification module 123 sets the work mode of the sign language recognition system 1 as the first work mode . moreover , if a gesture of the signer captured by the camera 10 belongs to both the first and second types of gestures , the sign language identification module 123 may compare the next gesture of the signer captured by the camera 10 with the plurality of types of gestures , until a determination is made which type the gesture belongs to . in step s 6 , the recognition module 125 compares the image of the gesture captured by the camera 10 with the plurality of gestures , corresponding to the work mode of the sign language recognition system 1 , to find out what meanings are associated with the gestures captured by the camera 10 . in step s 7 , the screen 16 displays the meanings obtained by the recognition module 125 . the voice conversion module 126 converts the meanings of the gesture captured by the camera 10 into audible sounds , and the speaker 18 plays the sounds of the gesture captured by the camera 10 . the foregoing description of the embodiments of the disclosure has been presented only for the purposes of illustration and description and is not intended to be exhaustive or to limit the disclosure to the precise forms disclosed . many modifications and variations are possible in light of the above everything . the embodiments were chosen and described in order to explain the principles of the disclosure and their practical application so as to enable others of ordinary skill in the art to utilize the disclosure and various embodiments and with various modifications as are suited to the particular use contemplated . alternative embodiments will become apparent to those of ordinary skills in the art to which the present disclosure pertains without departing from its spirit and scope . accordingly , the scope of the present disclosure is defined by the appended claims rather than the foregoing description and the exemplary embodiments described therein .
| 6 |
in the following description , numerous specific details are set forth to provide a thorough understanding of the methods and mechanisms presented herein . however , one having ordinary skill in the art should recognize that the various embodiments may be practiced without these specific details . in some instances , well - known structures , components , signals , computer program instructions , and techniques have not been shown in detail to avoid obscuring the approaches described herein . it will be appreciated that for simplicity and clarity of illustration , elements shown in the figures have not necessarily been drawn to scale . for example , the dimensions of some of the elements may be exaggerated relative to other elements . while the techniques described herein are susceptible to various modifications and alternative forms , specific embodiments thereof are shown by way of example in the drawings and will herein be described in detail . it should be understood , however , that the drawings and detailed description thereto are not intended to limit the techniques to the particular form disclosed , but on the contrary , the intention is to cover all modifications , equivalents and alternatives falling within the spirit and scope of the present embodiments as defined by the appended claims . the headings used herein are for organizational purposes only and are not meant to be used to limit the scope of the description . as used throughout this application , the word “ may ” is used in a permissive sense ( i . e ., meaning having the potential to ), rather than the mandatory sense ( i . e ., meaning must ). further , the use of the word “ may ” generally indicates that the feature discussed may or may not be present in various embodiments . similarly , the words “ include ”, “ including ”, and “ includes ” mean including , but not limited to . this specification includes references to “ one embodiment ” or “ an embodiment .” the appearances of the phrases “ in one embodiment ” or “ in an embodiment ” do not necessarily refer to the same embodiment , although embodiments that include any combination of the features are generally contemplated , unless expressly disclaimed herein . particular features , structures , or characteristics may be combined in any suitable manner consistent with this disclosure . terminology . the following paragraphs provide definitions and / or context for terms found in this disclosure ( including the appended claims ): “ comprising .” this term is open - ended . as used in the appended claims , this term does not foreclose additional structure or steps . consider a claim that recites : “ a system comprising a display control unit . . . ” such a claim does not foreclose the system from including additional components ( e . g ., a processor , a memory controller ). “ configured to .” various units , circuits , or other components may be described or claimed as “ configured to ” perform a task or tasks . in such contexts , “ configured to ” is used to connote structure by indicating that the units / circuits / components include structure ( e . g ., circuitry ) that performs the task or tasks during operation . as such , the unit / circuit / component can be said to be configured to perform the task even when the specified unit / circuit / component is not currently operational ( e . g ., is not on ). the units / circuits / components used with the “ configured to ” language include hardware — for example , circuits , memory storing program instructions executable to implement the operation , etc . reciting that a unit / circuit / component is “ configured to ” perform one or more tasks is expressly intended not to invoke 35 u . s . c . § 112 ( f ) for that unit / circuit / component . additionally , “ configured to ” can include generic structure ( e . g ., generic circuitry ) that is manipulated by software and / or firmware ( e . g ., an fpga or a general - purpose processor executing software ) to operate in a manner that is capable of performing the task ( s ) at issue . “ configured to ” may also include adapting a manufacturing process ( e . g ., a semiconductor fabrication facility ) to fabricate devices ( e . g ., integrated circuits ) that are adapted to implement or perform one or more tasks . “ based on .” as used herein , this term is used to describe one or more factors that affect a determination . this term does not foreclose additional factors that may affect a determination . that is , a determination may be solely based on those factors or based , at least in part , on those factors . consider the phrase “ determine a based on b .” while b may be a factor that affects the determination of a , such a phrase does not foreclose the determination of a from also being based on c . in other instances , a may be determined based solely on b . in practical sourcing situations , buyers are typically faced with a significant number of business rules . in addition to this , the bidders often have other considerations such as capacity limitations , synergies , etc . in a sourcing system supporting these types of rules , there are often a rather large number of rules used in analyzing different scenarios for awarding the business . sometimes rules may be contradictory . when the number of rules is large and / or there are many items , bids , bidders , etc ., it can be very cumbersome to resolve such contradictions , and some tool for infeasibility resolution is highly desired . there at least two aspects of infeasibility resolution : 1 . obtain a feasible solution by relaxing some of the rules , preferably with small efforts from the buyer . for ease of discussion , we will discuss “ a buyer ”/“ the buyer ” as an entity which defines rules , resolves infeasibility , etc . however , it is to be understood that in practice there may be one or more buyers , one or more groups of buyers , one or more buying organizations , etc . this “ buyer ” may also be referred to as a manager , user , or otherwise . the specific term used should not be seen as limiting the invention . for example , sometimes in the literature the party controlling a bidding process is also called bid taker . the solutions described herein can also be used outside of e - sourcing and buying , in which cases , the term “ buyer ” can be replaced by a more appropriate term , such as manager . examples are resource planning , scheduling , exchanges , selling , etc . in addition , in various embodiments bids may correspond to goods , services , other tangibles and / or intangibles , or any combination of the foregoing . numerous such alternatives are possible and are contemplated . it is noted that while the following discussion is centered on e - sourcing , the methods and mechanisms described herein may be used in areas outside of e - sourcing . for example , the systems and methods may be used for planning , supply chain optimization , and other optimization areas . furthermore , the entity setting the rule need not represent a buyer , it may just as well be a bidder , analyst or otherwise . as described herein , a “ reference allocation ”, or “ reference point ”, represents a potential allocation or solution . for example , such an allocation or solution may be the result of solving a scenario or it may be a predefined allocation . alternatively , it may simply be a description of an allocation , such as “ allocate the lowest bid for each item ”. it is noted that a reference allocation does not need to represent a feasible solution to any specific scenario . a reference allocation may be used in many different ways . for example : 1 . if all rules violated by the reference allocation are identified , and all identified rules are relaxed , a feasible problem is generated . 2 . information about violated rules can be useful for a buyer in evaluating why he is unable to obtain an expected allocation , or to guide the buyer in setting priorities for one or more rules . fig1 a illustrates one embodiment of a method for determining an allocation . in the example shown , a model is received that is based on bids and rules ( block 100 ). for example , suppliers may provide bids on one or more items that wish to supply with the bids representing the price at which they will supply ( sell ) the items . rules regarding allocations ( i . e ., the awarding of contracts to suppliers based on their bids ) are also received . such rules may specify requirements on how the allocation is to be made . using the received bids and rules , an optimization model is received ( or otherwise generated ). generally speaking , the model may comprise a system of equations as described herein that includes constraints based on at least the received rules . having received the model , a determination is made as to whether a solution exists ( i . e ., is the model feasible ) ( block 102 ). if the model is feasible , then an allocation may be generated based on a solution of the model ( block 114 ). however , if the model is infeasible , then a reference allocation is selected by the user or system ( block 104 ). in various embodiments , the reference allocation is an initial allocation made without regard to the allocation rules that have been received . in this sense , the reference allocation may be viewed as a default allocation . for example , such a reference allocation may be a zero allocation in which no awards are made . alternatively , a reference allocation may simply award the lowest bid for each item . other reference allocations may be based on previously determined allocation and / or solution to a model . these and other reference allocation will be discussed further below . having made the reference allocation , a determination is then made as to whether any of the received allocation rules , have been violated . generally speaking , each rule is examined and compared to the reference allocation to determine if the rule is violated ( block 106 ). in this manner , each of the rules that are violated are identified ( block 100 ). having identified all rules that are violated by the reference allocation , all of the identified rules ( in some embodiments ) are relaxed ( block 112 ). in some embodiments , relaxing a rule may include complete removal of the rule . in other embodiments , relaxing of a rule may include reducing constraints imposed by the rule . for the purposes of discussion here , removal of the rule will be described . the comparison of rules against the reference allocation and the relaxation of the rules can be done at different levels , for example on a data structure directly representing the rule ( s ) or on an equation in an optimization model dependent on how data is received and processed in various embodiments . as used herein , the expression “ relaxing a rule ” and similar expressions may refer to a direct modification of rules , modification of a representation of rules ( e . g ., in equations used to represent such rules ), modification of data structures used to represent rules , and so on . once the identified rules that violate the reference allocation have been removed , the optimization model is then modified so that is reflects removal of these rules ( block 114 ). given the modified model , a new allocation is generated that is compatible with the modified model and a solution has now been obtained ( block 116 ). fig1 b , illustrates various method to identify and relax a sub - set of rules , based on one or more reference allocations . in the example shown , a reference allocation is used to obtain different results : ( i ) information about relaxed rules , ( ii ) a modified model , or ( iii ) a solution to the modified model . in block 120 , an optimization model including associated bids and rules is received . generally speaking , as described herein , the optimization model may include a system of equations based on bids and rules . however , the discussion may simply describe the optimization and including or comprising bids and / or rules . the received rules are then compared to one or more reference allocation ( block 122 ), and a determination is made as to whether any of the rules are violated by the one or more reference allocations ( decision block 124 ). if no rules are violated , then some other action may be taken ( block 126 ). however , if a rule violation is detected , then one or more actions ( denoted a ) may occur . in one embodiment , information about at least one rule that is violated by the reference allocation may be output ( block 130 ). another possibility is to relax at least one rule that is violated by the reference allocation ( block 140 ), and a modified model based on the relaxed rule generated and / or output ( block 142 ). yet another possibility is to relax at least one rule that is violated by the reference allocation ( block 150 ), and output a result of solving the model using the relaxed rule ( block 152 ). the comparison of rules against the reference allocation and the relaxation of the rules can be done at different levels , for example on a data structure directly representing the rule or on an equation in an optimization model dependent on how data is received and processed in various embodiments . elastic programming is a method for handling infeasibility in mathematical programming in which constraints may be broken with a penalty and the solver may then include these violation penalties in the objective . using such a method , each constraint can be violated and is penalized as a function of the magnitude of the deviation . in other words , a constraint may not need to be completely omitted . rather a constraint may be violated to different degrees at a cost . for example , assume the following linear problem : minimize : 2x + y subject to : x ≧ 1 ( 1 ) y ≧ 2 ( 2 ) x + y ≦ 1 . 5 ( 3 ) where : x ε [ 0 , 1 ] y ε [ 0 , 2 ] minimize 2x + y + 100e 1 + 100e 2 subject to x + e 1 ≧ 1 ( 1 ) y + e 2 ≧ 2 ( 2 ) x + y ≦ 1 . 5 ( 3 ) where : x , e 1 ε [ 0 , 1 ] y , e 2 ε [ 0 , 2 ] the solution to the elastic version is x = 0 and y = 1 . 5 , with e 1 = 1 and e 2 = 0 . 5 giving a total violation cost at 150 . elastic programming is a means to relax a rule in various embodiments — when the scenario is modelled using mathematical programming and elastic programming is applied to one or more rules representing the rule . as described herein , we provide a modified form of elastic programming for this purpose , we introduce the term ep *. applying ep * is defined as one or more of the following : ( i ) applying elastic programming to relax one or more constraints in a mathematical programming problem representing some part of a scenario . ( ii ) omitting the representation of some part of a scenario or rule in the mathematical programming model . ( iii ) changing the scope or limit of a rule . omitting ( parts of ) the rule in the mathematical program can essentially be thought of as corresponding to using elastic programming with a rule violation penalty of zero , but technically , just omitting the rule may be more practical . for simplicity and readability , the description of ep * is based on the case where a penalty ( if used ) is proportional to the deviation from the rule , and where rules can be omitted . other variants are possible and are contemplated , such as using a penalty if the rule is broken and then adding no further penalty based on degree of deviation , using combinations of different such penalties , or use penalties based on combinations of deviations of different rules . the variants described here are exemplary only and should not be seen as limiting . in ep *, a rule violation penalty can be a fixed number , user - defined , derived by the system , or otherwise . one alternative would be to use a user - defined value whenever defined , and a system default value otherwise . the variant above that obtains a feasible problem by applying ep * to all rules that are violated by the reference point problem is denoted autorelaxbyalloc . the mathematical programming problem resulting from autorelaxbyalloc is feasible as there is at least one feasible solution : the solution corresponding to the reference allocation . autorelaxbyalloc is now described in a small example . in fig2 , an infeasible two - dimensional problem with four constraints ( c 1 - c 4 ) is shown . we also show two reference points , p 1 and p 2 , which may correspond to reference allocations for a corresponding scenario . as can be seen , p 2 is not feasible due to constraint c 3 , and p 1 is not feasible due to either of constraints c 2 and c 3 . next , in fig3 , autorelaxbyalloc with reference point p 2 has been applied . in order to make p 2 feasible , ep * has been applied on c 3 ( here the constraint c 3 has been relaxed , and removed from the figure ). p 2 is now a feasible solution , and there is a region around p 2 which is also feasible . for the case that the rule violation penalty applied by ep * on c 3 is high enough , the solver will return the solution being the top corner of the triangle forming the feasible region around p 2 , as this may be deemed to violate c 3 the least . in fig4 , the reference point p 1 is used . for this case , ep * is applied and both c 2 and c 3 are relaxed , and there is a larger feasible region . the autorelaxbyalloc method can hence be used to conveniently obtain a feasible solution with minimum input from the buyer , or allowing the buyer to set penalties at a detailed level if so desired . in various embodiments , autorelaxbyalloc can be invoked on request , for example when the buyer has been informed that his original scenario was infeasible , performed automatically by the system as soon as a solve attempt concludes that the problem is infeasible , or be triggered by some other event . once the allocation is obtained , it can be reported by the system in various ways . this can include all types of reports on the allocations and payments as well as reports on deviations from limits of the relaxed rules . based on the above discussion , below is a sample description of a bidding and allocation process . it is noted that the presented example is relatively simple for purposes of discussion . those skilled in the art will appreciate that in various situations there may be many more bidders , items and rules than discussed below . in this example there are two bidders that are bidding to serve as supplier for five items . the illustrated bid prices ( 100 - 104 and 90 - 94 ) in this table are arbitrary and are provided simply for purposes of discussion . each bidder has provided bids for supplying the items as follows : in table 4 above , incumbent supplier and new supplier have each provided bids for the sale of each of five items , item 1 - item 5 . in this example , we assume that the objective of the optimization is to minimize cost , though other objectives are possible and are contemplated . in this example , the cost of an item is defined as either ( i ) the payment to the allocated bid as stated in the bid , or ( ii ) 10 , 000 per non - allocated item if an item is not allocated . for example , if item 1 is not allocated in a given allocation , then a cost of 10 , 000 is applied . if items 1 and 2 were not allocated , then a cost of 2 = 10 , 000 = 20 , 000 would be applied , and so on . as with the above bids , the penalty mentioned here ( 10 , 000 ) is simply provided for purposes of discussion . in this embodiment , there is no penalty associated with violation of an omitted rule ( discussed in greater detail below ). rather , omitted rules are ignored and treated as though they do not exist . however , as will be further described below , penalties associated with rules that are made elastic may also be included in the cost and in some embodiments such costs could be associated with omitted rules as well if desired with no other rules present , the minimum cost occurs if the bids from new supplier ( the lowest bidder on all items ) are allocated on all five items , resulting in a total cost of 90 + 91 + 92 + 93 + 94 = 460 . next , assume that a buyer has defined a scenario s , including the rules of table 2 , to be used in the allocation calculation . hence scenario s contains : on review of the above rules it can be seen that scenario s is not feasible . for example , r1 and r3 cannot both be satisfied as r1 requires allocation of at least 4 units and r3 requires allocation of at most 2 units . in some embodiments , detection of such an infeasibility may include responding in one or more of a variety of ways — such as by producing a report when an attempt to calculate allocations is made . we will now describe six different embodiments for resolving the infeasibility of scenario s . the described embodiments are based on three different reference allocations and two relaxation methods , resulting in six combinations . it is noted that many possible reference allocations and relaxation methods are possible based on a variety of business considerations . these and other reference allocations and methods are possible and are contemplated . it is also noted that techniques to resolve infeasibility may be done after infeasibility has been detected , or such techniques may be applied without testing or knowledge of whether or not the allocation calculation is infeasible . resolution of an infeasibility can be triggered manually or automatically . these , and other variants are possible and contemplated . as will be seen , the described methods and mechanisms may provide a highly efficient approach for determining a lowest cost allocation within the context of given conditions . first , we describe three different reference allocations ( as shown in table 5 ) for use in resolving infeasibilities . in the table below , a “ 1 ” indicates that the supplier has been allocated the corresponding item ( s ) and a “ 0 ” indicates that the supplier has not been allocated the corresponding item . it is noted that other types of allocations such as split allocations , over - allocations , partial allocations , etc ., are also possible and contemplated , but are not described in this example for ease of discussion . in addition , while three different reference allocations and two different relaxation methods are discussed , a given process may only use one type of reference allocation and relaxation method . however , embodiments are possible where multiple approaches may be used either in parallel or according to some sequence . as seen from the above in table 5 , reference allocation a is allocating nothing to each supplier , reference allocation b is allocating each item to the lowest bid ( i . e ., new supplier in this example ), and reference allocation c is allocating each item to incumbent supplier . in the embodiments of this example , the reference allocations are defined without regard to any specific allocation rules defined by the buyer . in various embodiments , such reference allocations may be pre - defined in the sourcing platform . in other words , it may be predetermined that a given reference allocation to be used is to “ allocate nothing ”, “ allocate lowest bid ”, “ allocate incumbent supplier ”, or otherwise . in other embodiments , a reference allocation to be used may be based on some rules or conditions , and / or may be the result of earlier allocation calculation ( s ). as noted above , in addition to three reference allocations , two relaxation methods may be used ,: ( i ) omit all violated rules , and ( ii ) apply elastic programming to ( representations of ) violated rules with a penalty for violation of the rule . as an example , a penalty of 100 , 000 per unit for violation of a rule may be applied . so , for example , if a rule requiring allocation of at least 4 units is violated and the allocation is of 2 units , then the rule is violated by a measure of 2 units which incurs a penalty of 2 × 100 , 000 = 200 , 000 . similarly , if an allocation of 7 units were made , then the rule would be violated by a measure of 3 units which would incur a penalty of 3 × 100 , 000 = 300 , 000 . the penalty of 100 , 000 is an example only . different penalties may be used in different embodiments . penalties may also vary between different rules to reflect some type of priorities . given the above descriptions of the reference allocations and relaxation methods , we now describe the resulting six combinations as shown in table 6 . in embodiments 1 and 2 , we use reference allocation a . by comparing the above rules to reference allocation a , we can see that rules r1 and r2 are violated . r1 is violated as it requires the allocation of at least 4 units , but reference allocation a allocates 0 units . r2 is violated as it requires allocation of at least 3 units to incumbents and reference allocation a allocates 0 to incumbents . rule r3 is not violated as it requires allocation of at most 2 units and reference allocation a allocates 0 units . in embodiments 3 and 4 , we use reference allocation b . by comparing the above rules to reference allocation b , we can see that rules r2 and r3 are violated . r2 is violated as it requires allocation of at least 3 units to incumbents and reference allocation b allocates 0 units to incumbents . r3 is violated as it requires allocation of at most 2 units and reference allocation b allocates 5 units . rule r1 is not violated as it requires allocation of at least 4 units and reference allocation b allocates 5 units . in embodiments 5 and 6 , we use reference allocation c . by comparing the above rules to reference allocation c , we can see that r3 is violated as it requires allocation of at most 2 units and reference allocation c allocates 5 units . r1 is not violated as it requires allocation of at least 4 units and reference allocation c allocates 5 units . r2 is not violated as it requires allocation of at least 3 units to incumbent supplier and reference allocation c allocates 5 units to incumbent supplier . table 7 below summarizes the comparisons between the above described rules and reference allocations . in each of the six embodiments , having identified which rules are violated by a given allocation , the violated rules are relaxed . as described above in table 6 , the relaxation methods used by the example embodiments are to either to omit violating rules (“ omit ”) or make them elastic with a penalty (“ elastic ”). in various embodiments when using an elastic relaxation method , allocations may seek to minimize the penalty associated with violation of elastic rules when possible . as a result of the relaxation , we may say that we have a relaxed version , scenario relaxed (“ sr ”), of scenario s . following relaxation , a new allocation calculation is made based on sr . the result is shown in table 8 where “ incumbent supplier ” is abbreviated as “ inc ”, and “ new supplier ” is abbreviated “ new ”. in embodiment 1 , the violated rules r1 and r2 are omitted . r3 ( allocate at most 2 units ) remains and limits the total allocation to 2 items , leaving 3 items unallocated at a cost 3 × 100 , 000 = 30 , 000 ( penalty for non - allocation of items ). as noted above , the objective in these discussed scenarios is to minimize cost . therefore , 2 items ( item 1 and item 2 ) are allocated to the lowest bid ( i . e ., new supplier ), resulting in a total cost of 90 + 91 + 3 × 10 000 = 30 , 181 . accordingly , by using the reference allocation discussed above , rules that prevent a feasible solution are readily identified and removed , and a feasible solution is determined in an efficient manner given the conditions of the scenario and embodiment , the resulting total cost of the solution is guaranteed to be a lowest cost solution which may be deemed optimal in the given context . as will be seen in the following , the other embodiments likewise provide a very efficient approach to determining a solution to what was originally determined to be infeasible . in embodiment 2 , the violated rules r1 and r2 are made elastic with a penalty of , for example , 100 , 000 . r3 remains and serves to limit the total allocation to 2 items which will leave 3 items unallocated at cost 3 × 10 , 000 = 30 , 000 . regardless of which of the 2 items we allocate , allocation of 2 items will result in r1 ( allocate at least 4 units ) being violated by 2 units at a cost of 2 × 100 , 000 = 200 , 000 . therefore , r1 will have no impact on which items are allocated . however , to minimize the impact of violating the elastic version of rule r2 ( allocate at least 3 units to incumbent ), the 2 units to be allocated will be allocated to incumbent supplier . therefore , r2 will still be violated by 1 unit at a cost / penalty of 100 , 000 . to minimize cost ( according to the present scenario and embodiment ), items 4 and 5 , having the lowest bids , are allocated to the incumbent supplier at a total cost of 101 + 100 + 3 × 10 , 000 + 2 × 100 , 000 + 100 , 000 = 330 , 201 . in embodiment 3 , rule r1 remains unchanged and rules r2 and r3 are omitted . the solver can hence allocate all items at lowest cost . as a result , all items are allocated to new supplier at cost 90 + 91 + 92 + 93 + 94 = 460 . in embodiment 4 , rule r1 remains and rules r2 and r3 are made elastic with a penalty of 100 , 000 . with reasoning analogous to the above it can be seen that the lowest cost solution is to allocate item 1 to new supplier , and items 3 , 4 and 5 to incumbent supplier . the cost includes a penalty of 0 for r2 , 200 , 000 for r3 , and 10 , 000 for one unallocated item . therefore , the total cost is 90 + 102 + 101 + 100 + 10 , 000 + 200 , 000 = 210 , 393 . in embodiment 5 , rules r1 and r2 remain and rule r3 is omitted . the resulting allocation is item 1 and 2 to new supplier , and items 3 , 4 , and 5 to incumbent supplier , resulting in a total cost of 90 + 91 + 102 + 101 + 100 = 484 . finally , in embodiment 6 , rules r1 and r2 remain and rule r3 is made elastic with a penalty of 100 , 000 . this results in the same allocation and cost as for embodiment 4 . as seen above , the role of the reference allocation in these example embodiments is to determine what rules to relax . once that has been done , the reference allocation may have no further role in these embodiments . in addition to the above , the methods and mechanisms described herein can also be used iteratively . assume for example we refer to the set of rules for scenario s1 as r s1 and an allocation to scenario s1 as a s1 . 1 ) the buyer sets up a scenario , termed “ base ”, in which r base expresses one or more rules of the current tender . examples of such rules can be balance rules between different parts of a supply chain : for example in order to enable the allocation of a certain production bid , matching allocations of required raw material bids must also be allocated . 2 ) scenario base turns out to be infeasible . the buyer then uses the above described method using zero allocations ( allocate nothing ) as a reference allocation ( s ). the resulting allocation , a base , is concluded acceptable , even though it may be that case that , for example , a minor set of the desired sourced items cannot be bought as part of the current tender . 3 ) the buyer sets up a second scenario , termed “ asis ”. this scenario uses all rules of the rule set r base which are not violated by the new reference allocation a base . this set of rules is named r ′ base . the buyer then adds one or more rules that indicate incumbent suppliers should maintain their incumbent allocations as specified by a base . 4 ) the second scenario , asis , turns out to be infeasible . the buyer then uses one of the methods and / or mechanisms described herein to solve the scenario with a base as a reference allocation . as a consequence , all rules requiring that incumbents should keep their shares which are in conflict with a base are relaxed . a new allocation is then made , a asis . on running different reports on a asis the buyer may detect that all expected asis allocations may not be fulfilled because all the incumbents had not rebid on all of their current contracts . the buyer might then want to contact selected incumbents and encourage them to rebid and then rerun the asis scenario . it may also / alternatively be the case that asis reveals problems in the set - up of base and that r base rules need corrections and the process should restart at step 1 . once a asis is determined to be acceptable , the buyer continues to step 5 . 5 ) the buyer sets up a third scenario , termed “ preferred ”, which uses the rules of r ′ base plus one or more other rules ( e . g ., preferred business rules ). assume also that scenario preferred is infeasible . the buyer then uses the methods and / or mechanisms described herein with a asis as a reference allocation . note that the buyer in this example made a choice to start from r ′ base rather than r asis . this means that the particular rules of keeping incumbent allocations introduced in the asis scenario are not enforced , but that a asis is a feasible solution and that the rules introduced for scenario preferred are only relaxed when conflicting with a asis . the rules r ′ base are enforced and met in an allocation , a preferred , but the rules r asis need not be . it is also conceivable to automate the semi - manual process above . that is , define all set of rules , r base , r asis , and r preferred prior to beginning that above process , and define what reference allocations to use when , etc . as described above , the approach based on one or more reference allocations can provide information about which rules were violated , and to what degree , in order to obtain a feasible solution . though it can be very useful to obtain such a “ best effort ” feasible solution , this is sometimes not very informative for the user . in tenders with great complexity , the fact that a certain rule had to be violated can come as a surprise , and in order to understand why it was violated , more information ( e . g . what other rules a specific rule is contradicting ) would be very useful . in various embodiments , a sourcing system can be configured to automatically take infeasibility resolution actions if a user attempts to solve a scenario which turns out to be infeasible . such an action could , for example , be to relax rules using a reference allocation as discussed above . it could also be to inform the user about sources of infeasibility . the latter can for example be in the form of a report formatted in a suitable way for direct display on a screen or for download . in one embodiment , the method for providing information about the source ( s ) of infeasibility can be based on expressing high level rules as a mathematical programming problem using , for example , mixed integer programming ( e . g . as described in andersson , arne , mattias tenhunen , and fredrik ygge . “ integer programming for combinatorial auction winner determination .” multiagent systems , 2000 . proceedings . fourth international conference on . ieee , 2004 , and then maintain a mapping between ( i ) high - level rules and ( ii ) constraints in the mathematical programming problem . such a mapping could look like that shown in table 9 below : next , one or more irreducible infeasible sets ( iis ) of constraints , sometimes called irreducible inconsistent subsystem , are identified . the identification of iis for a mixed integer programming problem can be done with any of a variety of available mixed integer programming solvers , or by some special purpose algorithm . generally speaking , in the process above when one or more irreducible infeasible sets have been identified , the result is output by being saved to a machine readable media in a proper format or shown on a display of a computing device . one embodiment of such a method is depicted in fig5 . fig5 illustrates a method 500 that includes receiving bids and rules ( block 502 ), and a model builder electronically constructing a model including constraints based on the rules , and a mapping between the rules and constraints ( block 504 ). one or more irreducible sets of constraints are then identified ( block 506 ), and information about the identified irreducible infeasible sets is generated , stored , and / or output , etc . ( block 508 ). for the case of a complex rule , it may be translated to many constraints mapping to the same rule ( cf . rules 3 in table 3 ). for the case of a simple rule , it may be translated directly as a bound on a variable . hence , variable bounds can map to one or more rules . in various embodiments , all rules may not need to be modeled in the mathematical programming problem , but they may be maintained separately for efficiency . call this set of separately maintained rules , s r . one example of a rule in s r could be a “ reject bids ” rule , which may cause one or more bids not to appear at all in the mathematical programming problem . information about s r can be added once the mathematical programming solver has returned one or more iis . this can be done optimally ( for example by performing an analysis of rules in s r ) or in some approximate way ( for example by indicating where there are bids affected by rules in s r ). some rules may have a repetition . an example of such a rule could be “ allocate at most 3 winners per country ”. in this case , the mapping will also preferably contain enough information to derive which part of the repetition ( such as country ) a constraint maps to in order to provide a more accurate reporting , further illustrated below . once the iis have been identified , different types of output ( s ) and reports can be produced . these may be in many forms — from a simple message directly on a display , to an extensive , formatted , report . it can also be visible in an interface for viewing and / or editing rules , so that , for example , rules that are part of one or more infeasible set ( s ) are highlighted . furthermore , possible changes of the limits of one or more rules being part of an infeasible set of rules may be suggested or automatically performed based on an analysis of the problem at hand . it some cases it may be advantageous to report several iis in order to enable the buyer to resolve multiple sources of infeasibility at the same time . in practice , a reported infeasibility may reveal errors in project set - up , data problems , or other errors or problems which should be corrected . one example of an iis report in a spreadsheet - like format is shown in fig6 . in addition to what is shown in the sample report , the report can contain other information , such as the number of bids that occur in all of the conflicting rules . fig6 illustrates one embodiment of an infeasibility analysis report 600 in a table / spreadsheet format . in the sample report shown , rules r1 and r2 are identified as contradictory ( 602 ), rule r17 is identified as being a rule that cannot be fulfilled ( 604 ), and rules r3 , r12 , and r13 are also identified as contradictory ( 606 ). the method of identifying sources of infeasibility can be combined with the above discussed methods in different ways . for example , an identification of sources of infeasibility can allow the buyer to set specific rule violation penalties on some of them . turning now to fig7 , one embodiment of a system that may include the methods and mechanisms described herein is shown . a system of the type described here can typically support hundreds of users simultaneously , which may have many different roles and may be working in different projects . as shown in fig7 , the sourcing system 700 is connected to the internet via a connection including a firewall 702 . web pages for bidders , buyers , and other users can be produced in a web - server 706 . a backend server 708 can receive data and signals from the web - server 706 and store data to a database . in this example , a server cluster 712 ( e . g ., sql based or otherwise ) including storage area network 714 is shown that may store a database . in addition , the backend server 708 may be configured to perform different forms of processing and may also be configured to initiate jobs on other computers . for example , additional ( worker ) servers 710 may be utilized for processing tasks and / or storing data . still further , cloud based servers 704 may be utilized for processing tasks and / or storing data . further , the backend server may also be configured to manage scheduling of different tasks , such as closing the system for bidding in a specific project . the worker servers 710 can perform computationally intensive tasks , such as solving optimization problems or performing different forms of infeasibility analysis , or any other desired tasks . the system can be dynamic and add hardware dynamically at runtime . this can be in the form of rented computers from a cloud server provider . the server cluster ( or other forms of database hardware ) generally manages the longer term storage of data . in the example shown , one or more elements within block 720 may referred to as a processing system . in some embodiments , the backend server 708 generally performs processing tasks . in other embodiments , worker servers 710 may be used for performing one or more tasks . still further , in some embodiments , cloud based servers 704 may be used for performing processing tasks . depending on the configuration , bidders may be allowed to place bids through a web - interface 800 such as that shown in fig8 , or via uploads of bid forms in one or more designated formats . submitted bids can be received via the web - server , processed and verified in the backend server , and stored by the database hardware . the buyer may be allowed to express different desired properties of the allocation of business . a sample set of rules expressing such desired properties is shown in fig9 . such rules can be edited directly on a web - page , submitted via upload of documents or using any other suitable method . submitted rules can be received via the web - server , processed and verified by the backend server , and stored by the database hardware . fig1 illustrates one embodiment of a list of scenarios . the buyer can be allowed to compare the consequences of applying different set of rules , by applying them differently in different scenarios . such scenarios can be edited directly on a web - page , submitted via upload of documents or using any other suitable method . submitted scenarios can be received via the web - server , processed and verified by the backend server , and stored by the database software . fig1 shows such a possible list of scenarios . exact rule settings not shown , but the names of the scenarios give some guidance in the example . for example , scenario 1 is a cherry pick scenario ( a commonly used term denoting awarded the lowest possible bid for every item without any rules or other limitations ). then scenario 2 is limiting the allocation to two winners . as a consequence of this , the payment raises from 2 , 017 , 246 usd to 2 , 035 , 246 usd . similarly the other scenarios show trade - offs between desirable properties and cost . scenario ( index ) 5 of fig1 is infeasible , i . e . contains contradicting rules and hence does not have a solution . if , for example , a buyer initiates the solving of a scenario by pushing a button on a web - page , the information can be received by the web - server and processed by the backend server . the backend server may then update the status of the solve job via the database hardware . it can also schedule the solving to be performed by a worker server . the worker server can receive a job description , read required data from the database , solve the scenario , output the result to the database hardware , and update the job status when appropriate . fig1 shows a sample web - page displaying some details of scenario 5 . status is displayed as infeasible . the user is offered some help for infeasibility resolution . in this example , an infeasibility analysis report is available . this can be implemented to be done automatically by the system when the scenario was concluded infeasible , or to be done manually on request by the user . the content of this report can be of the type displayed in fig6 . in fig1 there is also provided the possibility of solving the scenario using a reference allocation . from a hardware processing perspective , the relaxation of rules and solving the relaxed model can be similar to the processing of a standard solve of a scenario . in fig1 , the scenarios of fig1 are shown again , but now scenario 5 has been solved using a relaxation based on a reference allocation “ zero ”. to analyze the outcome in more details , an e - sourcing system can allow for the production of different reports . if , for example , a buyer initiates report generation of a scenario by pushing a button on a web - page , the information can be received by the web - server and processed by the backend server . the backend server can then update the status of the job via the database hardware . it can also schedule the solving to be performed by a worker server . the worker server can receive a job description , read required data from the database , solve the scenario , output the result to the database hardware , and update the job status when appropriate . one such report is shown in fig1 . in this example , two columns per scenario are displayed : the allocated share of the volume in %, and the payment in usd . from the report , it can for example be seen that for scenario 2 , the rule of max 2 winners is fulfilled . for scenario 5 it can be noted that all rules could not be fulfilled ( as expected since the scenario contains contradicting rules and is infeasible ). if we assume that reference allocation zero means no allocation , using this reference implies relaxing the rules “ min 75 % to bidder 1 ”, and “ min 5 % to each of bidder 6 & amp ; 7 ”. in this particular example , the solver found a solution by violating one constraint in the rule “ min 5 % to each of bidder 6 & amp ; 7 ”, namely the constraint on min 5 % to bidder 6 . it is noted that the above - described embodiments may comprise software . in such an embodiment , the program instructions that implement the methods and / or mechanisms may be conveyed or stored on a computer readable medium , or on multiple computer readable media . numerous types of media which are configured to store program instructions are available and include hard disks , floppy disks , cd - rom , dvd , flash memory , programmable roms ( prom ), random access memory ( ram ), and various other forms of volatile or non - volatile storage . in various embodiments , as described one or more portions of the methods and mechanisms described herein may form part of a cloud - computing environment . in such embodiments , resources may be provided over the internet as services according to one or more various models . such models may include infrastructure as a service ( iaas ), platform as a service ( paas ), and software as a service ( saas ). in iaas , computer infrastructure is delivered as a service . in such a case , the computing equipment is generally owned and operated by the service provider . in the paas model , software tools and underlying equipment used by developers to develop software solutions may be provided as a service and hosted by the service provider . saas typically includes a service provider licensing software as a service on demand . the service provider may host the software , or may deploy the software to a customer for a given period of time . numerous combinations of the above models are possible and are contemplated . although the embodiments above have been described in considerable detail , numerous variations and modifications will become apparent to those skilled in the art once the above disclosure is fully appreciated . it is intended that the following claims be interpreted to embrace all such variations and modifications .
| 6 |
it should be understood that the improved impact tool of the present invention can be fabricated in any of a variety of sizes , depending upon the needs of the user . thus , its size may range from a small model which may be handheld , to a large , heavy - duty model which must be carried and positioned by a piece of construction machinery such as a backhoe or a power shovel due to the weight of the impact tool and the magnitude of the forces involved . but it should be noted that the improved impact tool of the present invention is particularly adapted to be embodied in the latter sort of impact tool where the large forces and heavy weight of the moil make particularly valuable the various features of the present invention which are set out in detail herein . it is also to be understood that the improved impact tool of the present invention is by no means novel in all of its parts , with the improvements of the present invention lying solely in the construction and arrangement of both the moil and the lower portions of the impact tool . as can be appreciated , these improvements can be incorporated in any of a wide variety of impact tools of the class which utilize an elongated casing within which a pneumatically , hydrualically or electrically actuated hammer or piston repeatedly strikes the top of the moil . thus , the details of construction of these portions of the impact tool are here only briefly alluded to , and , by way of non - limiting example , applicant hereby expressly incorporates the details of construction for these portions of the above class of impact tools are set forth in my aforesaid u . s . pat . no . 3 , 739 , 863 , or u . s . pat . no . 3 , 661 , 216 , granted may 9 , 1972 to yamanaka or u . s . pat . no . 3 , 003 , 773 , granted oct . 10 , 1961 to feuhrer . referring now to fig1 the improved impact tool of the present invention , generally designated at 10 is shown , by way of non - limiting example , mounted to the end of a backhoe or power shovel boom , generally designated at 12 by means of mounting brackets 14 and a plurality of bolts 16 . the impact tool comprises upper and lower casing halves 18 , 20 within which a pneumatically , hydraulically or electrically driven hammer or piston , not shown , repeatedly strikes the top of the moil 22 during use , causing the moil to reciprocate violently . it is to be understood that the boom 12 , mounting brackets 14 and bolts 16 form no part of the present invention , and are shown only by way of illustration . in addition , the improved impact tool of the present invention could be sized and adapted to be mounted in many other ways , or even to be hand held . referring now to fig2 and 6 , which show the lower portion of the improved impact tool of the present invention , we see the lower casing 20 within which a pneumatically , hydraulically or electrically actuated hammer or piston 24 of conventional construction repeatedly strikes the top 26 of the moil during use . concentric within the casing is a hammer bushing 28 which encircles the hammer 24 and centers it over the moil 22 . the hammer bushing includes an inwardly projecting hammer bushing shoulder 30 which is of smaller diameter than the hammer and which engages the chamber 32 on the lower end of the hammer , as best seen in fig3 to limit the range of downward travel of the hammer . as best seen in fig2 the hammer bushing shoulder 30 also acts as a stop to limit the upward travel of the moil when the upper shoulder 34 on the octagonal upper portion 36 of the moil 22 strikes it from below . cooperating structures , including tapers 38 , 40 prevent the hammer bushing from relative movement with respect to the casings 18 , 20 . beneath the hammer bushing 28 and concentrically encircling the octagonal upper portion 36 of the moil is an upper moil bushing 42 defining a cylindrical cavity 44 which receives said octagonal upper portion of the moil , centers the moil beneath the hammer , and retains the moil against sidewise displacement . of course , the cavity 44 could be octagonal to match the upper portion of the moil . the upper moil bushing 42 rests on an inwardly projecting rim 46 of the casing which both restrains the upper moil bushing from downward travel . the rim 46 also receives loads transmitted to it by the upper moil bushing 42 from the hammer bushing 28 when the hammer bushing is struck by the hammer . it is understood that the material selected to be used in fabricating the upper and lower casings 18 , 20 , the hammer bushing 28 , the hammer 24 , the upper moil bushing 42 and the moil 22 are those conventionally used by those skilled in the art in constructing impact tools . a significant part of applicant &# 39 ; s present invention lies in the construction of his novel moil 22 , which is best seen in fig4 . the lower portion 48 of the moil is of conventional construction , being of cylindrical cross - section and terminating in a pointed work tip 50 . of course , as is often the case , the moil may terminate in an enlarged or angularly disposed work tip of any of a variety of constructions , such as that shown in the aforesaid u . s . pat . no . 1 , 470 , 622 granted to jimmerson . it should be noted that the octagonal cross section of the upper portion 46 of the moil serves no useful purpose per se , but is merely a result of the manufacture of the octagonal lower portion 52 of the moil , whose purpose will be explained subsequently in greater detail . since one of the purposes of the upper portion 46 of the moil is to contact the upper moil bushing 42 to prevent tipping of the moil , it is apparent that the upper portion of the moil could be of cylindrical cross section to match the cylindrical cavity in the upper moil bushing which receives it . of course , the diameter of such a cylindrical upper portion of the moil , not illustrated , must be sized such that it will pass , during removal or installation of the moil , through the octagonal cavity 54 of the nose bushing 56 , which receives the octagonal lower portion 52 of the moil . between the octagonal upper and lower portions 36 , 52 of the moil lies an annular recess 58 which forms a necked portion of the moil and which forms a lower shoulder 60 on the octagonal upper portion 36 of the moil . the functioning of the moil in association with other parts of the improved impact tool of the present invention will be explained subsequently in greater detail . referring now to fig2 and 6 , it is seen that the improved impact tool of the present invention includes a hollow nose cap 62 generally in the shape of a frustum . the tapered configuration of the nose cap is preferred to enable the impact tool to be used in tight situations where a nontapered nose cap might block access of the impact tool to the work piece , but it is within the scope of the present invention that a nontapered nose cap be used . the nose cap includes a pair of mounting ears 64 which are secured to the internal surface 66 of the nose cap , as by welding . the lower portion of the lower casing 20 of the impact tool includes a pair of mounting slots 68 which receive the upper ends of their respective mounting ears . associated with each mounting slot are a pair of mounting recesses 70 machined in the lower casing which receive the mounting pins 72 and the mounting pins associated mounting clips 74 . the mounting clips are located in grooves 76 located at one end of the mounting pins . each mounting ear 64 and one end of each mounting recess 70 includes a mounting pin aperture 78 which receives therethrough a transverse mounting pin 72 to hold the mounting ears and the outer casing of the impact tool in an assembled relation . as best seen in fig1 the purpose of the mounting recesses 70 are to provide mounting locations for the mounting pins and clips which are recessed below the external surface of the outer casing in order to minimize the possibility of damage to the mounting pins and clips , and to reduce the overall diameter of the impact tool for lower cost and to enable the impact tool to operate in tight places . similarly , it is seen that the external surface of the mounting ears 64 are also substantially flush with the lower casing for like reasons . of course , more than two mounting ears and associated mounting structures could be provided . the nose cap 62 , mounting ears 64 and mounting pins 72 are made of strong , tough material such as high strength sae 8620 steel which has been heat treated for surface hardness and internal toughness . mounting pins and clips are preferred over nut and bolt arrangements such as disclosed in u . s . pat . no . 1 , 481 , 641 , granted jan . 22 , 1924 to jimmerson because they cost less , enable quick assembly or disassembly of the impact tool , and have a high resistance to damage during use from flying debris and the like since they lack threads . the mounting pins and clips , being recess mounted instead of externally mounted as in jimmerson , are better protected from the possibility of damage and better enable applicant to reduce the overall diameter of his impact tool . applicant &# 39 ; s transverse mounting pins are preferred over longitudinal mounting nuts and bolts such as disclosed in u . s . pat . no . 1 , 470 , 622 , granted oct . 16 , 1923 to jimmerson because the longitudinal mounting bolts of jimmerson may be inherently more subject to failure because of the fact that they are subject to tensile forces rather than shear forces to which the transverse mounting pins of applicant are subjected . the generally cylindrical nose bushing 56 includes an octagonal bore 54 which receives therethrough a portion of the octagonal lower portion 52 of the moil with a relatively snug slip fit . lubricant is provided between both the upper moil bushing 42 and the octagonal upper portion 36 of the moil , and the octagonal bore 54 of the nose bushing and the octagonal lower portion of the moil . the upper portion of the nose bushing includes a cylindrical keeper ring recess 80 in which is mounted a split keeper ring 82 having an inwardly projecting impact shoulder 84 . as seen in fig2 when the cushioned moil stop is in an assembled relation , the impact shoulder on the split keeper ring projects inwardly into the annular recess 58 on the moil . the keepr ring is fabricated from low carbon steel such as sae 1018 and is somewhat ductile to conform to the shape of the lower shoulder 60 on the octagonal upper portion of the moil . as best seen in fig2 the cylindrical lower portion 86 of the nose bushing is prevented from sidewise displacement by its relatively snug slip fit with the circular aperture 88 in the nose cap through which is passes , and from which is projects at least slightly at all times . the cylindrical upper portion 90 of the nose bushing is received in a nose bushing recess 92 in the lower casing of the impact tool which serves to restrain the upper portion nose bushing from sidewise displacement during use . as is seen in fig3 even during maximum downward displacement of the nose bushing , the upper portion 90 of the nose bushing is at all times securely restrained by the nose bushing recess 92 . of course , by securely restraining both the upper and lower portions of the nose bushing from sidewise displacement , applicant achieves the objectives of increased resistance to vibration and wear , while also preventing any sidewise displacement of the moil itself during use . the nose bushing also includes an outwardly extending nose bushing flange 94 which terminates substantially flush with the lower casing . the nose bushing flange includes a pair of mounting ear slots 96 through which the mounting ears 64 extend . the flange on the nose bushing gradually tapers in thickness having a maximum thickness closest to the moil and gradually tapering to a minimum thickness at its periphery . such a construction maximizes the strength of the nose bushing flange over that which it would have if it were of constant thickness , and significantly increases its strength for weight characteristic over the conventional , uniform thickness nose bushing flange which is found in many prior art devices . referring again to fig2 and 6 , it is seen that a moil cushion 98 in the form of a body of resilient material is located between the lower surface 100 of the nose bushing flange and the internal surface 66 of the nose cap . by way of nonlimiting example , applicant &# 39 ; s moil cushion is fabricated from neoprene rubber having a durometer rating of 50 and a 2500 lb tensile strength , although as can be appreciated , a wide range of rubbers or other resilient materials could be used . a bonded connection is formed between the internal surface 66 of the nose cap , the moil cushion 98 and the lower surface 100 nose bushing flange by conventional vulcanizing techniques . in short , the nose bushing and the nose cap are held in the desired relation in a mold and mastic neoprene rubber is inserted to fill the space between the nose bushing flange and the internal surface of the nose cap . then the mold is inserted into a conventional vulcanizing press where heat and pressure finish the vulcanizing process to form the moil cushion and adhere it to both the flange on the nose bushing and the inner surface of the nose cap . adhesion of the rubber to the external surface 102 of the lower portion of the nose bushing is prevented , in the conventional fashion , by spraying that portion of the nose bushing with a silicone spray prior to appying the neoprene rubber to the mold . it is preferred that the moil cushion be bonded , as by vulcanizing , to both the nose bushing flange and to the internal surface of the nose cap in order to prevent any creep or displacement of the moil cushion during use despite the severe vibrational forces encountered . although the moil cushion contacts a portion of the external surface 102 of the lower portion of the nose bushing , it is not bonded thereto in order to enhance the ability of said external surface to slide with respect to the moil cushion . although a lubricant between the moil cushion and said external surface of the lower portion of the nose bushing is not required , a lubricant can be applied in this region to reduce friction therebetween . it is noted that because of the relatively snug slip fit between said external surface 102 and the aperture 88 in the nose cap , there is no possibility that the moil cushion will intrude therebetween during use of the impact tool . as best seen in fig2 the outer periphery of the moil cushion is substantially flush with the lower casing of the impact tool . it should be noted however that the maximum diameter of both the flange on the nose bushing and the moil cushion can be smaller than the maximum diameter of the lower casing , without departing from the scope of the present invention . similarly , the maximum diameters of the moil cushion and the nose bushing flange do not have to be the same . it is noted that the periphery of the moil cushion is unbounded by both the flange 94 and the nose cap in order to provide unrestricted space into which the moil cushion can flow when compressed . if desired , a shield , not illustrated , would be secured to the nose cap and the lower casing , as by screws , to cover the outer peripheries of both the nose bushing flange and the moil cushion in order to prevent foreign matter from damaging the same , and to prevent intrusion of foreign matter into the impact tool in this region . but again , in any embodiment in which the periphery of the moil cushion is bounded or enclosed , adequate space must always be provided into which the moil cushion can flow freely radially outwardly when compressed . at this point it may be convenient to note that , although it is not preferred , it would be possible to eliminate the split keeper ring 82 by utilizing in the present invention a split nose bushing , not illustrated . in such case , of course , the upper portion of the nose bushing would have to include an inwardly projecting shoulder which would extend into the annular recess in the moil when the impact tool was in an assembled relation . additionally , the nose bushing flange could not be bonded to the moil cushion . such a construction utilizing a split nose bushing is not preferred because of the increased cost in fabricating a split nose bushing , because a split nose bushing is considered to be structurally weaker and less vibration resistant , and because when the moil cushion is unbonded to the nose bushing flange , it may be subject to an increased tendency to creep or be displaced during use . in order to assemble the improved impact tool of the present invention , the top 26 of the moil is first inserted through the octagonal bore 54 in the nose bushing until the lower shoulder 60 on the octagonal upper portion 36 of the moil extends above the top of the nose bushing a sufficient distance such that the split keeper ring 82 can be inserted into the keeper ring recess 80 in the top of the nose bushing . naturally , the longitudinal length of the recessed portion 58 of the moil is sized to permit this assembly operation . since the impact shoulder 84 of the keeper ring extends inwardly into the annular recess on the moil , as seen in fig3 it prevents the moil from dropping out of the impact tool . next , the top of the moil is inserted into the lower casing 20 of the impact tool while the mounting ears 64 are inserted into their respective mounting slots 68 on the lower casing . to secure the mounting ears to the lower casing , the mounting pins 72 are inserted through the mounting pin apertures 78 in both the outer casing and the mounting ears , and are secured with the mounting clips 74 . although the moil shown in the figures terminates in a work tip 50 of reduced diameter , it is frequently the case that the moil may include an angularly disposed work tip 50 or a work tip having a diameter greater than the balance of the moil , such as a wide chisel - like work tip . if such is the case , it becomes apparent that is is desirable that it be possible to index the moil with respect to the lower casing of the impact tool , in order to properly orient the work tip with respect to the impact machine . of course , it is preferred that moils with such work tips have the capability of being indexed at several positions with respect to the impact tool in order to provide an orientation for the work tip that is most suitable for the particular task encountered . indexing of the moil of the present invention is provided by the octagonal lower portion 52 of the moil and the matching octagonal bore 54 in the nose bushing . rotation of the moil is prevented by the nose bushing , whose mounting ear slots 96 engage the mounting ears 64 on the nose cap to prevent any rotation of the nose bushing and the moil it encircles . it is apparent that since the lower portion 52 of the moil and the bore 54 in the nose bushing are octagonal , the moil can be oriented in four positions with respect to the impact tool . of course , it is within the scope of the present invention that these elements need not be of octagonal configuration , but could instead be of other configuration depending upon the number of indexing positions needed . if only one indexing position is needed , these elements need not have a polygonal configuration , but could instead be circular with one flat side , for example . in order to index the moil of the present invention , all that is needed is to remove the mounting clips 74 from the mounting pins 72 , withdraw the mounting pins from the mounting pin apertures 78 and drop the moil , nose bushing , split keeper ring , moil cushion and nose cap a short distance from the lower casing . then the split keeper ring is removed , which permits the moil to be dropped out of the nose bushing . next , the moil is rotated to the desired indexing position , reinserted into the nose bushing and the impact tool is re - assembled as has been previously described . an important feature of the present invention is that the octagonal nose bushing bore 54 also provides large areas of support for the octagonal lower portion 52 of the moil which it carries , instead of the single line of support which is provided in devices utilizing a nose bushing with a cylindrical bore and a moil with a corresponding cylindrical portion . this important feature greatly increases the life of both the nose bushing and the moil . now that a detailed description of the construction and assembly of the improved impact tool of the present invention has been given , applicant turns now to a consideration of its operation . during normal operation of the impact tool , it is understood that the work tip 50 of the moil is applied to a work piece with some condiserable pressure due to the weight of the impact tool along with any downward force applied by the backhoe or other device which is carrying the impact tool . this force will cause the moil to move upwardly within the impact tool to the position shown in fig2 where the upper shoulder 34 on the octagonal upper portion of the moil is in contact with the shoulder 30 on the hammer bushing and is prevented from further upward travel . then the hammer 24 in the impact tool is forceably propelled downwardly by hydraulic , pneumatic or electric actuating means , until it strikes the top 26 of the moil . the force of the hammer is transmitted by the moil to the work piece , and in the process the moil may travel downwardly a short distance . however , as long as the work tip of the moil is supported by the work piece , the lower shoulder 60 on octagonal upper portion of the moil does not strike the impact shoulder 84 on the split keeper ring . after the force of the blow of the hammer on the moil has been dissipated , the down pressure of the impact tool and the rebound of the moil from the work piece help to return the moil to its initial position or adjacent thereto . then , the cycle is repeated in rapid succession until the work piece is broken up to the desired extent . during this cycle it will be appreciated that the moil will oscillate longitudinally in such a manner that the impact shoulder 84 on the keeper ring is not struck due to the sizing of the annular recess 58 and the position of the split keeper ring . however , in the previously described cycle , should the work piece break or move away from the moil , or should the impact tool be inadvertently actuated when the moil is not in contact with a work piece , after the hammer strikes the top of the moil the moil will continue its downward stroke until the lower shoulder 60 on octagonal upper portion of the moil contacts the impact shoulder 84 on the split keeper ring , forcing it downwardly , as seen in fig3 . as this occurs , the energy in the moving moil is transferred from the moil to the nose bushing by means of the split keeper ring . as the nose bushing is forced downwardly by the moil it compresses the moil cushion forcing it to flow freely radially outwardly and thereby dissipating the energy of the moil without damage to the impact tool . as seen in fig3 at the maximum downward travel of the moil , the octagonal upper portion 36 of the moil always remains in contact with the upper moil bushing 42 , thereby always providing proper support for the upper portion of the moil . after the energy of the moil has been dissipated , the natural resilience of the moil cushion 98 returns the nose bushing to its initial position wherein the top surface of the flange is in contact with the lower casing . when the moil is reapplied to a work piece , the moil is forced upwardly until the upper shoulder 34 on the octagonal upper portion of the moil is in contact with the shoulder 30 on the hammer bushing , at which time the impact tool may be reactivated . thus we have seen that the present invention utilizes a unique one - piece , triple function nose bushing which not only indexes and properly supports the moil but also helps to transfer energy from the moil to the moil cushion when the moil moves past a predetermined position . from the foregoing , various further applications , modifications and adaptations of the apparatus disclosed by the foregoing preferred embodiments of the present invention will be apparent to those skilled in the art to which the present invention is addressed , within the scope of the following claims .
| 1 |
thus , it is the nature of the polymeric material forming the matrix of the microspheres which constitutes the originality of the present invention . this polymeric material is essentially formed of a homopolymer constituted of recurring units of general formula ( i ). such polymers possess the remarkable property of being biocompatible and bioerodable , i . e . they can degrade chemically or biochemically by cleavage of the lateral substituents . the speed of erosion of the microspheres in accordance with the invention being dependent upon the molecular weight of the support material , the speed can therefore by modulated simply by using a support material having a molecular weight adapted to the speed of erosion desired . the microspheres according to the present invention thus possess a progressive and modulated bioerosion which enable , for example , the transport of a biologically active substance , dispersed in the support material , up to the location in the organism where its action will be the most efficient . the bioerosion of the microspheres also prevents their accumulation in the organism ; their use is therefore no more limited . according to a particular characteristic , the homopolymer mentioned above is constituted of recurring units of the general formula ( i ) in which : r 1 represents an alkyl group having 1 to 6 carbon atoms ; r 2 represents an alkyl group having 1 to 6 carbon atoms ; and and preferably in which r 1 and r 2 represent a ch 2 — ch 3 group . these different types of polymers of the poly ( methylidene - malonate ) family are particularly suitable for the encapsulation of hydrophilic substances , notably substances of biological origin , and optionally biologically active substances . & lt ;& lt ; biologically active molecule )) is understood as meaning , in a non - limiting manner , any molecule having a prophylactic or curative biological action , in vitro or in vivo , notably an anti - infectious agent , in particular an antiseptic , antibiotic , antiviral , antiparasitic or antimitotic agent , notably an anticancer agent . antibiotic or antiseptic agents which can be used can be rifampicin and colistine for example . didanosine , ribavirine , zidovudine , acyclovir , ganciclovir , foscarnet , vidarabine and zalcitabine can be cited in a non - limiting manner as examples of antiviral agents . cis - plastin and taxol can , for example , by used as anticaner agents . according to a currently preferred embodiment of the invention , the support material of the microspheres contains : from 90 % to 99 . 5 % by weight of a homopolymer as defined above ; and from 0 . 5 % to 10 % by weight of a copolymer comprising at least one sequence having a hydrophilic character and at least one sequence having a hydrophobic character , said sequence having hydrophobic character preferably comprising at least one recurring unit of the general formula ( i ). advantageously , the sequence having hydrophilic character of the copolymer mentioned above is selected from a poly ( oxyethylene ), a poly ( vinyl alcohol ), a poly ( vinylpyrrolidone ), a poly ( n - 2 - hydroxypropyl methacrylamide ), a poly ( hydroxyethyl methacrylate ), a hydrophilic poly ( amino acid ) such as a polylysine , a polysaccharide , and will preferably be a poly ( oxyethylene ). the copolymer can have a block structure , preferably a di - block structure or tri - block structure , or a grafted structure . the addition of such copolymers into the support material enables obtaining a homogeneous dispersion of the substance to be encapsulated inside each of the microspheres . the addition also enables modulating the hydrophilic / hydrophobic ratio of the surface of the microspheres , and this enables preventing or limiting strong and often denaturing interactions with the substance to be encapsulated . further , these copolymers , the chemical nature of the hydrophobic sequence of which is identical to that of the homopolymer which essentially constitutes the microspheres , are particularly advantageous for the implementation of the currently preferred method of preparing the microspheres , as will be explained in more detail by the following . in general , the microspheres in accordance with the present invention can be obtained by carrying out a method comprising : preparing a multiple emulsion having three phases , the intermediate phase of which is constituted of a solution of polymer ( s ) constituting the support material in a volatile organic solvent , and evaporating said organic solvent , under conditions which enable causing the precipitation of the polymer around the droplets constituting the internal phase . this multiple emulsion can be obtained in a classical manner by dispersing a first emulsion of the water - in - oil type in a second aqueous phase containing a stabilising agent . this multiple emulsion can also be obtained by an “ inverse ” method which consists in pouring an aqueous solution into a first emulsion of the water - in - oil type . in an entirely unexpected way , this “ inverse ” method enabled obtaining results which are entirely remarkable , sometimes even better than those obtained by the classical technique mentioned above . thus , according to a second aspect , the present invention relates to a method of obtaining microspheres as described above , comprising : a ) preparing a first solution of the polymer ( s ) mentioned above constituting the support material in a volatile organic solvent optionally containing a surfactant agent , b ) preparing a second solution non - miscible with the solution obtained in a ), optionally containing said substance to be dispersed and optionally a surfactant agent , c ) preparing a first emulsion by dispersing the second solution in the first solution , the continuous phase being constituted by the solution of polymer ( s ), either by dispersing , with agitation , the first emulsion obtained in c ) in a dispersing medium non - miscible with said first emulsion , said dispersing medium optionally containing a stabilising agent ; or by pouring with agitation ; into said first emulsion , a solution constituted of a medium non - miscible with said first emulsion , said medium optionally containing a stabilising agent , according to a particular characteristic of the invention , the method mentioned above further comprises : the first step of the method of preparing the microspheres in accordance with the invention therefore comprises the preparation of an emulsion of the water - in - oil type preferably in the presence of a suitable surfactant agent , the oily or organic phase containing the polymer ( s ) intended to constitute the support material of said microspheres . firstly , a solution of the polymer ( s ) constituting the support material is prepared with the aid of a suitable volatile organic solvent optionally in the presence of a surfactant agent . advantageously , preformed polymers will be used in this step insofar as the homopolymers which essentially constitute the support material of the microspheres can be obtained under the conditions which enable a good characterisation in terms of molar mass and of mass dispersity . the homopolymers which are constituted of recurring units of the general formula ( i ) can be prepared from monomers , for example by following the method described in the ep 283346 patent which corresponds to u . s . pat . no . 4 , 931 , 584 and u . s . pat . no . 5 , 142 , 098 patents which are incorporated herein by reference , said monomers being generally degassed under vacuum of a paddle pump to constant weight in order to remove the polymerisation inhibitor ( so 2 ). these homopolymers will however be advantageously prepared anionically in an aprotic medium , for example by dispersion of the monomer in acetone , followed by the addition of sodium hydroxide under agitation , followed then by evaporating the acetone and drying the polymer thus obtained . other aprotic organic solvents such as acetonitrile , dioxan and tetrahydrofuran can be used instead of acetone . the molecular mass of the homopolymer obtainable by carrying out this method can be perfectly mastered by a judicial choice of the conditions of implementation , and in particular of the concentration of the monomer in the organic phase , of the ph and of the molarity of the polymerisation initiator ( sodium hydroxide ). in general , homopolymers having an average molar mass of 1 , 000 to 100 , 000 , and preferably of 5 , 000 to 80 , 000 , will be used within the context of the present invention . the volatile organic solvent which can be used for the preparation of the first solution containing the polymer ( s ) constituting the support material will generally be selected such that its boiling point be lower than that of water . it will therefore be possible for this solvent to be removed easily during the final evaporation step by enabling the precipitation of the polymer . ethyl acetate constitutes a volatile organic solvent which is particularly suitable to this end . the surfactants which can be used for stabilising the first emulsion can be of various natures and will be added to the organic phase containing the polymer ( s ) ( first solution ) and / or to the aqueous phase ( second solution ) which constitutes the dispersed phase . it can be for example a poloxamer such as the product marketed under the designation pluronic ® f68 , or even a poly ( vinyl alcohol ) such as the product marketed under the designation mowiol ® 40 - 88 , or even a polysorbate , or a surfactant copolymer the hydrophobic sequence of which has a chemical nature which is identical to that of the homopolymer constituted of recurring units of the general formula ( i ). it has been demonstrated that such surfactant copolymers and in particular poly ( methylidene malonate ) and polyoxyethylene copolymers are particularly advantageous insofar as they enable obtaining a very stable first emulsion on the one hand , and obtaining a good anchoring of the surfactant in the matrix after evaporation of the solvent on the other . the surfactant copolymers mentioned above can be prepared by classical polymerisation techniques well known to the person skilled in the art . amongst these techniques , anionic polymerisation , radical polymerisation , or even the technique of coupling of the copolymer precursor sequences , will preferably be used , these sequences having been adequately functionalised beforehand at the end of the chain . the anionic polymerisation comprises the sequential addition of the monomers and enables obtaining copolymers of a perfectly defined structure , the amounts of initiators and monomers engaged enables controlling the degree of polymerisation of each one of the sequences . either by anionic polymerisation of a first monomer and reaction on the growing chain of a second monomer ; or by activation of a precursor polymer which will serve as initiator of the polymerisation of a second monomer . the initiator agents which can be used within the context of these anionic polymerisations will generally be : on the one hand , organometallic derivatives , such as butyllithium and particularly diphenylhexyllithium ; on the other , alkoxides and in particular macromolecular alkoxides such as a poe alkoxide which can be generated by activating a hydroxyl function with the aid of cumylpotassium , diphenyl methylpotassium , naphthalenepotassium . the anionic polymerisation will generally be carried out in a solvent which is compatible with the various sequences of the copolymer . in the case in which the sequence having hydrophilic character is constituted of a poly ( oxyethylene ) and the sequence having hydrophobic character is constituted of a poly ( methylidene malonate ), the block copolymers will be prepared preferably by successive anionic polymerisation of ethylene oxide and then of methylidene malonate or by activation of a commercial monohydroxylated polyoxyethylenated precursor and subsequent anionic polymerisation of the poly ( methylidene malonate ) sequence . in general , tetrahydrofuran will preferably be used as polymerisation solvent , this product enabling working in a homogeneous medium and influencing the polymerisation kinetics favourably . the monomers used for preparing the hydrophilic sequences will generally be commercial products . the coupling technique is also more particularly suitable for preparing block copolymers . this reaction is generally carried out from pre - synthesised and functionalised homopolymers , in the presence of a coupling agent and optionally in the presence of an activating agent , in a suitable solvent . an α - carboxy group - functionalised poly ( oxyethylene ) homopolymer and an α - hydroxy group - functionalised poly ( methylidene malonate ) homopolymer will advantageously be used in the case of the preparation of the preferred copolymers according to the invention , the hydrophilic sequence of which is constituted of a poly ( oxyethylene ) and the hydrophobic sequence of which is constituted of a poly ( methylidene malonate ). the α - carboxy group - functionalised poly ( oxyethylene ) homopolymer can be obtained for example by transforming a commercial α - hydroxy group - functionalised poly ( oxyethylene ) with succinic anhydride . the α - hydroxy group - functionalised poly ( methylidene malonate ) homopolymer can be obtained directly by anionic synthesis in aqueous medium or by anionic synthesis in a solvent using an aqueous sodium hydroxide solution as polymerisation initiator . dicyclohexylcarbodiimide ( dcci ) will advantageously be used as coupling agent which is particularly adapted to this polymerisation . the coupling reaction can optionally be activated by basic catalysis , and will generally take place in a solvent which is compatible with the homopolymers , such as dichloromethane in particular in the particular case of the preferred copolymers of the invention . the radical polymerisation is more particularly suitable for preparing grafted copolymers . this polymerisation is generally carried out from a macromonomer , i . e . an oligomer which bears , on one of its ends , an ethylenic group which is radical polymerisable and which is able to react with a monomer to form a copolymer having a grafted structure . this polymerisation will generally be carried out in the presence of an initiator in a suitable solvent . it will be possible for various functionalised macromonomers to be used in the case of the preparation of the preferred copolymers , the hydrophilic sequence of which is constituted of a poly ( oxyethylene ). it will be more particularly preferred to use a methacryloyl group - functionalised poly ( oxyethylene ) macromonomer . such a product can be commercial ( aldrich ) and will be constituted for example by a poly ( oxyethylene ) chain of molar mass between 308 and 440 g / mol , or will be prepared from a commercial poly ( ethylene glycol ) monomethyl ether by coupling with methacrylic acid in dichloromethane to form a methoxy terminal function . such a macromonomer may even be prepared by activation of a poly ( oxyethylene ) and subsequent reaction with methacryloyl chloride . it is also be possible for the copolymers having grafted structures to be prepared by transesterification of a poly ( oxyethylene ) monomethylether with the lateral ester chains of a pre - synthesised poly ( methylidene malonate ). this transesterification will generally be carried out with alcohol in the presence of a catalyst at high temperature . copolymers the total molar mass of the sequences of which having hydrophobic character is between 1 , 000 and 80 , 000 g / mol , and preferably between 1 , 000 and 50 , 000 g / mol are particularly suitable within the context of the present invention . generally , it will be possible for the first emulsion serving for the preparation of the microspheres according to the invention to be obtained by means of a shearing homogeniser of the ultraturrax type ( 13 , 500 rpm - 5 minutes ) for example . the substance to be encapsulated is generally added to the dispersed aqueous phase of the first emulsion . the second step of the method of preparing the microspheres in accordance with the invention comprises preparing a second emulsion : either by dispersing , with agitation , the first emulsion obtained in the first step in a dispersing medium non - miscible with said first emulsion , said dispersing medium optionally containing a stabilising agent ; or by pouring with agitation into said first emulsion , a solution constituted of a medium non - miscible with said first emulsion , said medium optionally containing a stabilising agent . generally , the dispersing medium non - miscible with the first emulsion is an aqueous phase in which the first emulsion is introduced , preferably dropwise , and the emulsion is also prepared for example with the aid of a homogeniser of the ultraturrax type ( 8 , 000 rpm ; 5 minutes ). poly ( vinyl alcohol ) constitutes a stabilising agent which is particularly suitable for the preparation of the second emulsion . optionally , this second step can be followed by a supplementary step of displacement of the organic solvent . the third essential step of the method of preparing the microspheres in accordance with the invention consists in evaporating the volatile organic solvent having served for the preparation of the solution of the polymer ( s ). in the particular case in which this solvent is ethyl acetate , this evaporation is carried out for a period of time of about 12 hours at ambient temperature , under magnetic agitation ( 1 , 400 rpm ). the person skilled in the art will select in an appropriate manner the various conditions of implementation of these three first essential steps of the method in accordance with the present invention as a function of the physico - chemical and morphological characteristics of the microspheres sought after . generally , these microspheres will have an average diameter of between 1 μm and 100 μm , preferably of between 5 μm and 50 μm for their application as vectors in the pharmaceutical field . generally , the microspheres obtained at the end of the third step will be isolated by centrifugation , washed , and optionally lyophilised . according to a third aspect , the present invention also relates to pharmaceutical compositions containing the microspheres which have just been described . these compositions will generally be suitable for an administration via the oral route and will be presented for example in the form of tablets , gelatine capsules , powders or granules . the present invention will now be illustrated by the following non - limiting examples : the size of the microspheres was measured by the technique of the coulter counter and the morphological examination carried out by sweeping electronic microscopy , either on the crude prepared microspheres , or after cryofracture ; the molecular mass of the polymers was determined by gel permeation chromatography ( gpc ). 100 mg of methylidene malonate 2 . 1 . 2 are dissolved in 10 ml of acetone with magnetic agitation . 100 microlitres of 0 . 1 n sodium hydroxide are added progressively with magnetic agitation . the polymerisation is maintained for 5 minutes and then 100 microlitres of 0 . 1 n hcl are added always with magnetic agitation . the acetone is all removed under vacuum . the polymer obtained is then washed with the aid of about 100 ml of distilled water and then dried under vacuum . the molecular mass of this polymer is 30 , 000 . 280 mg of poly ( methylidene malonate ) are dissolved in 10 ml of ethyl acetate . 1 ml of aqueous phase containing 60 mg of ovalbumin is emulsified in the organic phase with agitation with the aid of an ultraturrax at a speed of 13 , 500 rpm for 5 minutes . this emulsion is then added to 100 ml of a 2 % aqueous solution of poly ( vinyl alcohol ), the agitation being made with the aid of an ultraturrax at a speed of 8 , 000 rpm for 5 minutes . the evaporation of the ethyl acetate is carried out at ambient temperature overnight , with mechanical agitation ( turning blade ) at a speed of 1 , 400 rpm . the microspheres are collected after centrifugation at 4 , 000 rpm for 10 minutes and then washed 6 times with distilled water and each time they are subjected to a new centrifugation . after the last centrifugation , the microspheres are placed back in suspension in a volume of 3 ml of distilled water and are then lyophilised . the microspheres thus obtained have an average diameter of 6 microns and 14 . 2 % of the ovalbumin used in the preparation is encapsulated in the pmm 2 . 1 . 2 microspheres , and this corresponds to an encapsulation of 2 . 5 % ( w / w ). this preparation is administered via the oral route to c3h mice at the dose of 100 micrograms of encapsulated ovalbumin ( per mouse per day ) over 5 consecutive days . the last oral administration took place 7 days before the sensitisation of the animals to ovalbumin which is carried out by subcutaneous injection of free ovalbumin ( 100 micrograms per mouse ) on days do and d14 . 90 % of the mice survive the second injection while less than 30 % of the mice administered with the microspheres without ovalbumin or with the same dose of non - encapsulated ovalbumin survive . carried out according to example 1 but pluronic f 68 is added into the aqueous phase containing the ovalbumin at a concentration of 2 %. carried out according to example 1 but 20 mg of poe - pmm copolymer are added into the aqueous phase containing the polymer . in this example , a poe - pmm 2 . 1 . 2 block copolymer was used . this copolymer was obtained by successive polymerisation of the two monomers by starting with the preparation of the poe block , in carrying out the following experimental protocol . the reactor ( 250 ml ) in which the polymerisation is carried out is connected to a vacuum line enabling working under high vacuum and ridding of protic impurities . the solvent ( thf , 150 ml ) purified of all traces of moisture is cryodistilled into the reactor at − 70 ° c . the initiator ( potassium tert - butoxide ( 0 . 1n / thf ); 10 ml ) is then added with the aid of a syringe via a septum . the polymerisation is carried out at ambient temperature for 48 hours . after this time , a sample enables verifying , by gel permeation chromatography , the molar mass ( 4 , 000 g / mol ) and the polymolecularity index ( 1 . 13 ) of the first sequence . the mm 2 . 1 . 2 ( 0 . 5 ml ), freshly degassed under vacuum to remove the so 2 used as polymerisation inhibitor , is then added rapidly and at once at ambient temperature . after 5 hours , the copolymer is deactivated by the addition of methanol and is precipitated in diethyl ether . 5 units derived from mm 2 . 1 . 2 are fixed onto the poe , and this corresponds to a molar mass for the pmm 2 . 1 . 2 of 1 , 150 g / mol . the thermal analysis of the copolymer reveals a glass transition temperature of − 16 ° c ., as well as a melting peak of 45 ° c . ( δh = 117 j / g ). carried out according to the technique described in example 1 , but the ovalbumin ( 60 mg ) is replaced by 2 mg of v3 28 peptide from the v3 bru loop of the gp 120 of hiv ( sequence nntrksihi gpgrafyatgdiigdirqa ). the microspheres obtained have an average size of 5 . 8 microns and 70 % of the v3 28 peptide used is encapsulated in the microspheres and this corresponds to an encapsulation of 0 . 48 % w / w . the study made in sweeping electronic microscopy reveals particles which are smooth and spherical . carried out following example 4 but pluronic f 68 is added into the aqueous phase containing the peptide at a concentration of 2 %. the microspheres obtained have a size of 7 . 0 microns and 70 % of the v3 28 peptide used is encapsulated in the microspheres . carried out following example 4 but 20 mg of poe - pmm copolymer are added into the aqueous phase containing the peptide . carried out following example 4 but 20 mg of poe - pmm copolymer are added into the organic phase containing the polymer . carried out following example 1 but the internal aqueous phase is constituted of 1 ml of 0 . 5m acetic acid containing 3 mg of type ii collagen . the microspheres thus obtained have an average diameter of 6 microns and 66 . 6 % of the collagen used in the preparation is encapsulated in the microspheres of pmm2 . 1 . 2 , and this corresponds to an encapsulation of 0 . 7 % ( w / w ). carried out following example 1 but the internal aqueous phase is constituted of 1 ml of distilled water . the microspheres thus obtained do not contain any biologically active substance . their average diameter is 7 . 0 microns . carried out following the technique described in example 1 but the ovalbumin ( 60 mg ) is replaced by the plasmid pcdna3 ( 5 mg ). the microspheres obtained have an average size of 7 μm and 9 . 8 % of the plasmid used is encapsulated in the microspheres and this corresponds to an encapsulation of 0 . 17 % ( w / w ). the study made in sweeping electron microscopy reveals particles which are smooth and spherical . carried out following example 10 but pluronic ® is added into the aqueous phase containing the plasmid , at a concentration of 2 %. the microspheres thus obtained have an average diameter of 7 μm and 12 % of the plasmid used is encapsulated in the microspheres and this corresponds to an encapsulation of 0 . 22 % ( w / w ). carried out following the technique described in example 1 but the ovalbumin ( 60 mg ) is replaced by the oligonucleotide ( pdt16 ) ( 2 mg ). the microspheres obtained have an average size of 4 . 8 μm and 20 . 6 % of oligonucleotide used is encapsulated in the microspheres which represents an encapsulation of 0 . 19 % ( w / w ). carried out following example 12 but pluronico at a concentration of 2 % is added into the aqueous phase containing the oligonucleotide . the microspheres obtained have an average diameter of 5 . 7 μm and 23 % of oligonucleotide used is encapsulated in the microspheres which corresponds to an encapsulation of 0 . 21 % ( w / w ).
| 2 |
the invention defines the use of several sources in the source - specific ssm multicasting system ( ssm , source specific multicasting ) without reducing the ssm &# 39 ; s data security or scaling properties . the source is discovered in a manner similar to the prior art msdp protocol ( msdp , multicasting source discovery protocol ), but not all the features specified for msdp are needed to implement the invention . the source is discovered with the source &# 39 ; s and receiver &# 39 ; s means , which means that the multicasting routing does not need any other functionalities than ssm support . pim - sm without the register / register stop messages is an example of this . the invention also simplifies the controlling of the source , because the original source of the ssm channel also controls the other sources . fig1 is a simplified depiction of the prior art msdp protocol method of implementing a multicasting tree . source s belongs to network domain d 1 together with rendezvous point rp 1 . source s registers as the source by sending a source active message to rendezvous point rp in the same network domain d 1 . rendezvous point rp 1 forwards the source active message ( sa ) to other rendezvous points rp 2 - rp 5 at the same level , which also register the source s as the source of the multicasting network . this way , the source active message spreads through the internet via all the rendezvous points rp in several network domains d 1 - d 5 . the actual multicasting 10 is not necessarily routed through rendezvous points rp 1 - rp 5 , but normal routing methods can be used . only msdp signalling is transferred through rendezvous points rp . in the msdp protocol , rendezvous points rp are directly connected to source s , if any of receivers r is interested in the source group in question . after this , the transmit network can be optimised for sending multicasting data so that the router closest to receiver r is connected directly to source s using the shortest possible route . however , information on active sources s is still transmitted through rendezvous points rp . fig2 is a simplified diagram of the arrangement according to the invention , in which new source s 1 is added to a channel according to the ssm protocol . the original ssm channel is formed of source s and source group g so that receiver r sends a request to join group g and source s . this way , the ssm channel ( s , g ) is formed before second source s 1 is connected to the system . the original ssm channel is used to discover the internal source s of the communication band in logical multicasting group 1 . in the invention , group controller gc is defined as the ssm channel &# 39 ; s original source s which acts , in relation to other sources s and receivers r , as a peer entity resembling the msdp protocol . group controller gc comprises means that can filter out unwanted messages received from other sources . the group controller may also operate without the source features so that it only takes care of the signalling of the multicasting traffic according to the invention . logical multicasting group 1 is defined according to the invention when several sources s , s 1 are handled in the source - specific ssm protocol . in logical multicasting group 1 , separate ssm channels 20 , 30 belong to the common multicasting group . at a minimum , logical multicasting group 1 can be comprised of one ssm channel ( s , g ) that contains one source s and a group of receivers r . the multi - source support according to the invention in the ssm protocol requires that , in addition to the ssm support , sources s , s 1 and receivers r must support certain msdp functionalities . contrary to this , no additional features are required of the routers besides the ssm support . according to the invention , rendezvous points rp are not needed in the network , there is no need to include information on rendezvous points rp in the multicasting addresses , and the pim register / register stop functionalities are not required in the designated router ( dr ). the discovery of new source s 1 in logical multicasting group 1 is based on the formed original ssm channel 20 , which is of the form ( s , g ) and in which s is both the source and group controller gc of multicasting group g . original ssm channel 20 ( s , g ) transports the source information together with the normal multicasting traffic originating from source s . when new source s 1 wishes to send to the same logical multicasting group 1 , it sends a source active ( sa ) message according to the msdp protocol to group controller gc . it must be noted that all the group addresses that are not covered by the ssm protocol , must be part of logical multicasting group 1 . message sa is sent to group controller gc &# 39 ; s unicast address by the tcp / ip protocol using udp port 639 . this port is the same as used by the msdp protocol . the msdp source active sa message is comprised of address s of group controller gc , address g of logical multicasting group 1 and address s 1 of the new active source . all the active sources must update the msdp source active information via group controller gc at predetermined intervals whereby the existing and new sources are kept up - to - date on the active sources of logical multicasting group 1 . when receiver r receives information on new active source s 1 , multicasting channel 30 according to the ssm protocol is established between source s 1 and receiver r . the new channel 30 is of the form ( s 1 , g ). all the traffic in logical multicasting group 1 may consist either of one or more ssm channels or transfer chains . fig2 shows , for reasons of simplicity , just one new source s 1 . however , the system according to the invention may include several new sources . it is furthermore possible to set an upper limit for the number of new sources . when group controller gc receives the source active sa message , it makes a decision based on the predetermined criteria on what procedure or access control is applied in forwarding the message to the original ssm channel ( s , g ). if it is in accordance with the procedure to forward the information , the group controller sets the destination address of the msdp source active message as the logical group address g . the message is sent by using the udp / ip protocol . at the same time group controller gc updates its own msdp cache . if the procedure decision denies the sending of the msdp source active message , the message is discarded . if the msdp source active cache entry expires , group controller gc must delete it from the cache . group controller gc can also work solely in the control role the way rendezvous point rp does , that is , it does not have to send actual multicasting data . receivers r find information on new sources s 1 by monitoring msdp source active messages on the original ssm channel 20 . depending on the implementation of the receiver &# 39 ; s host computer , receivers r can connect to new source s 1 either by sending reports according to the igmpv3 or mldv2 ( igmpv3 , internet group management protocol version 3 ; mldv2 , multicast listener discovery protocol version 2 ) to designated router dr . alternatively , receivers r may forward the decision - making to the application . in such a case , the application interface must be modified to support the decision . receivers r may also maintain the msdp source active cache , it is seen necessary to remove inactive sources and the associated status information . if the msdp source active status information expires , receiver r must send an igmp / mld leave message to delete the status information associated with source s . if receiver r wants to leave logical multicasting group 1 and all the sources s , s 1 connected with it , it sends the igmp / mld leave message to group address g . the functionality of the msdp peer entities in association with the invention deviates from what is presented in the standard in that only part of the normal features are employed in the invention . the following describes the differences in the msdp implementations . the messages of the msdp protocol are usually processed at rendezvous points rp , but in the invention the message processing is implemented at sources s , s 1 and receivers r . this reduces the load on the network . because the msdp messages are only sent to relevant multicasting groups , scaling problems typical for msdp do not occur . below , the term msdp - lite will be applied to the subset of the msdp protocol according to the invention . msdp - lite uses both udp and tcp over ip compared to tcp / ip in normal msdp . in udp , the port number corresponding to tcp is used . when the operation takes place by udp from group controller gc to receiver r , msdp - lite does not employ the msdp messages peer hold timer , keepalive timer or connectretry timer . msdp - lite does not support information encapsulation from the source . as msdp - lite only operates between designated sources s , s 1 , group controller gc and receivers r , there is no need for msdp peer rpf forwarding implementations . msdp - lite uses the same tlv format ( tlv , type length value ) in the messages as the normal msdp . msdp - lite supports tlv types 8 and 9 which are new tlv types designed for the purpose . the length of the source active message can be , for example , 1460 octets , excluding tcp , udp , ip and layer - 2 headers . fig3 a shows an msdp - lite source active tlv message adapted to the ipv4 protocol . here , the message is of type 8 . in the length field , the length of the message &# 39 ; s control information is presented . the length of the field is 12 octets plus four times the octets in the entry count field . the entry count field shows the number z of the sources . thus , several sources can effectively be included in the same logical multicasting group &# 39 ; s address . the group controller address field depicts group g &# 39 ; s address for the original ssm channel ( s , g ). in the source address field , the ip address of the active source in the logical multicasting group is presented . fig3 b shows an msdp - lite source active tlv message adapted to the ipv6 protocol . here , the tlv type is 9 . in the solution according to the invention , protective measures are taken against denial - of - service attacks by , for example , limiting and filtering the source active messages whereby an upper limit is set in the logical multicasting group for the public sources . the aforementioned means are implemented with prior art means , for example , by software components , memories or processors and they are not described in closer detail for this reason . the invention is not limited exclusively to apply to the presented embodiments , but many variations are possible within the scope of the inventive idea of the invention .
| 7 |
the frontal part of a combine harvester c illustrated in fig1 is equipped with three chain conveyors 1 , 2 and 3 . the chain conveyor 1 conveys the crop transported thereto by a header auger 4 to an indicatively illustrated threshing mechanism 5 . the chain conveyor 1 is located between the header auger 4 and the driven front wheels 6 of the combine harvester . it runs upwardly toward the front wheels 6 . the tailings or return conveyor 2 conveys the incompletely threshed crop back to the threshing mechanism 5 . the chain conveyor 3 conveys the sieved grains to the grain tank 42 . the chain conveyor 1 used for drawing in the crop preferably comprises two conveyor chains 43 , while the other two chain conveyors 2 and 3 are only equipped with one conveyor chain 43 . moreover , the two chain conveyors 2 and 3 are arranged within closed housings 9 and 10 . the tension adjusting devices , which will be explained in more detail hereinafter , are equipped with controlled hydraulic cylinders 11 , 12 and 13 . the chain conveyor 1 is equipped with a fixed driveable shaft 14 and a displaceable shaft 15 . in corresponding manner , the conveyor 2 is equipped with a fixed driveable shaft 16 and a displaceable shaft 17 . in similar manner , the chain conveyor 3 is equipped with a fixed driveable shaft 18 and a displaceable shaft 19 . mutually spaced feed rake slats are fixed to the chain in the conveyor 1 and feed plates 29 are fixed to the chains in the conveyors 2 and 3 . advantageously the tension adjusting elements in the tension adjusting devices are hydraulic cylinders 11 , 12 or 13 , although one should not exclude the possibility of using mechanical , motor driven , linear adjusting devices . one benefit of using hydraulic cylinders 11 , 12 , 13 is that they can be installed by a single person without any problem . to tension the conveyor chains 1 , 2 , 3 , the hydraulic cylinders are supplied with pressurized oil as hereinafter described . since a hydraulic system is already available in an agricultural harvesting machine c , the extra costs are extremely small . the components associated with the hydraulic cylinder are simple components which can be easily installed and have a long life . the arrangement of the hydraulic cylinder or the hydraulic cylinders and the design of the linkage or the connector members is determined by the size and the positioning of the conveyor 1 , 2 , 3 , within the machine c . in fig2 and 3 , the displaceable shaft ( i . e . 15 , 17 , or 19 ) is rotatably mounted in two swing levers 20 , 21 disposed externally near the walls of the housing 44 for the chain conveyor . the chain conveyor is provided with a partition wall . a pivotal axis 22 at one end of the swing levers is offset from the shaft 15 , 17 or 19 but is axially parallel therewith . coupling rods 23 are articulated at 23 a to the end of the swing levers 20 , 21 opposite the pivotal axis . the opposite ends of the two coupling rods are attached to a transverse member 24 which is engaged centrally by the piston rod 11 ′ of the hydraulic cylinder e . g . 11 . this hydraulic cylinder 11 is attached to the wall of the housing 44 facing the pivotal axis 22 . as shown in fig2 the shaft 15 lies approximately midway between the pivotal axis 22 and the articulation point 23 a for the coupling rod 23 . favorable transmission of the forces applied by the hydraulic cylinder 11 results when the displaceable shaft 15 , 17 , or 19 is mounted centrally between the pivot axis 22 and the articulation point 23 a of the swing levers 20 , 21 . the swing levers 20 , 21 then operate as a single arm , thereby resulting in a very effective moment on the displaceable shaft 15 , 17 , or 19 . to save space , it is expedient if the transverse member 23 or the piston rods 11 ′ are guided . two guide profiles 25 are fixed to the same wall of the housing , these being provided with slots 26 in which the transverse member 24 is guided . although in this case , the coupling rod would be inclined relative to the direction of conveyance of the chain conveyor , the hydraulic cylinder or the hydraulic cylinders would nevertheless be accessible . the guide profile 25 is arranged on the same wall of the housing as the hydraulic cylinder 11 . this embodiment is particularly recommended when the width of the chain conveyor 1 , 2 , or 3 is relatively large , for example , in the case of the feed chain conveyor 1 . to increase the tensional force , it is also possible to connect a hydraulic cylinder ( e . g . 11 ) to each coupling rod 23 . a suitable arrangement is shown in phantom lines in fig3 where the tension adjusting device incorporates two hydraulic cylinders 11 which are articulated to the associated ends of the two coupling rods 23 . the hydraulic cylinders 11 are then controllable in synchronism . a sprocket 27 is fixed on the shaft 15 , 17 or 19 so as to rotate therewith and the conveyor chain 28 is entrained thereover . mutually spaced feed plates 29 ( see fig2 ) are fixed to the conveyor chain 28 . a similar sprocket is mounted on the fixed shaft 14 so as to rotate therewith and thereby drive the conveyor chain 28 . the embodiment shown in fig4 and 5 is particularly well - adapted for use with the chain conveyors 2 and 3 . this embodiment is particularly suitable for the conveying to the grain tank and for the return of threshed material to the threshing device since these conveyors are relatively narrow . a sprocket 31 is fixed on the shafts 17 and 19 so as to rotate therewith and the conveyor chain 32 is guided thereover . the chain conveyors 2 and 3 are equipped with partition walls 33 which have y - shaped recesses ( see fig5 ) below the shafts 17 , 19 into which the hydraulic cylinders 12 , 13 are inserted . u - shaped yokes 34 are fixed to the piston rods 12 ′, 13 ′ of the hydraulic cylinders 12 , 13 , the shafts 17 , 19 being mounted therein . to prevent the displaceable shaft 17 , 19 from jamming or tilting , provision is made for the shaft to be guided in slots 36 in two parallel housing walls extending at right angles to the shaft 17 , 19 . guide disks 35 disposed at the ends of these shafts slide over the exterior of the housing and cover the slots . the slots 36 create a free - space for the displacement of the shafts 17 , 19 . the lower shafts 16 , 18 are mounted at fixed points and are driveable . sprockets of similar construction to the sprockets 31 are mounted thereon . these conveyor chains 32 have feed plates 29 inserted therein . this embodiment is extremely simple since the existing partition wall is used and the mounting for the displaceable shaft is established by means of the yoke . in an advantageous arrangement , the hydraulic cylinders for each of the chain conveyers are controllable in common . the circuit diagram of fig6 shows that two hydraulic cylinders 11 are used for the chain conveyor 1 while just one hydraulic cylinder 12 , 13 is employed in the respective chain conveyors 2 and 3 . pressurized oil is supplied from a common pressure source 37 over the pressure lines 38 to each of the hydraulic cylinders 11 , 12 , 13 . a non - return valve 39 is installed in each of the respective supply lines to the hydraulic cylinders 11 , 12 , 13 in such a manner that the pressurized oil can flow only in the direction in which the piston rods extend from the hydraulic cylinders 11 , 12 , 13 . for load relieving purposes , controlled valves 41 are provided in the bypass lines 40 so that the load can be selectively removed from either the two cylinders 11 or the cylinders 12 or 13 . with this design , it is possible to apply pressure simultaneously to all of the hydraulic cylinders and thereby tension each of the chains . the same pressure is thus applied to all of the cylinders . however , if different tensional forces are required , this can be done by using pistons of different diameter . the non - return valve prevents oil from returning , but the bypass line can relieve the load on a hydraulic cylinder when necessary . whenever the drive motor of the harvesting machine is restarted , each of the chain tension adjusting devices is simultaneously and automatically supplied with the hydraulic pressures associated therewith and the piston - cylinder units are refilled where necessary . the low pressure hydraulic system in the machine is particularly advantageous and fully adequate for this purpose . other objects , features and advantages of the present invention will be apparent to those skilled in the art . while preferred embodiments of the present invention have illustrated and described , this has been by way of illustration and the invention should not be limited except as required by the scope of the appended claims .
| 1 |
before the description of the present invention proceeds , it is to be noted that like parts are designated by like reference numerals throughout the accompanying drawings except for fig1 to 3 to which the prior art pertains . fig4 to 6 pertain to a first preferred embodiment of the present invention . fig4 is a schematic perspective view , with a portion cut away , of a line filter assembly ; fig5 is a sectional view thereof ; and fig6 is a side view thereof . in fig7 there is shown a multi - linked winding bobbin assembly made of synthetic resin . the multi - linked winding bobbin assembly shown therein comprises first and second bobbins 10 which have respective hollows 8 defined therein and are linked together in an in - line fashion by means of a thin - walled portion 9 of 0 . 5 to 2 mm in wall thickness . a copper wire having its peripheral surface coated with an electrically insulating material is wound around the first bobbin 10 so as to extend from one end of the first bobbin 10 towards the opposite end thereof adjacent the thin - walled portion 9 thereby to form a first coil 11 , and then around the second bobbin 10 so as to extend from one end of the second bobbin 10 adjacent the thin - walled portion 9 towards the opposite end thereof thereby to form a second coil 12 . the copper wire so wound around the multi - linked winding bobbin assembly has its opposite ends soldered to respective metallic terminal members 13 secured rigidly to the first and second bobbins 10 . third and fourth coils 14 and 15 are also formed on another multi - linked winding bobbin assembly of similar construction in a similar manner as shown in fig7 . however , the direction of turn of the copper wire used to form the third and fourth coils 14 and 15 is opposite to the direction of turn of the copper wire used to form the first and second coils 11 and 12 , while the total number of turns of the third and fourth coils 14 and 15 is equal to that of the first and second coils 11 and 12 . each bobbin assembly is folded 180 inwardly about the respective thin - walled portion 9 as shown in fig8 to allow the first and second coils 11 and 12 , or the third and fourth coils 14 and 15 , to be juxtaposed relative to each other . while the first and second bobbins 10 having the first and second coils 11 and 12 are juxtaposed to each other as shown in fig8 a generally u - shaped first core member 17 having a pair of arms is mounted on the juxtaposed bobbins 10 with the arms thereof inserted into the respective hollows 8 in the bobbins 10 with the first and second coils 11 and 12 thereby to complete a first coil unit . similarly , while the first and second bobbins 10 having the third and fourth coils 14 and 15 are juxtaposed to each other in a manner similar to that shown in fig8 a generally u - shaped second core member 17 having a pair of arms is mounted on the juxtaposed bobbins 10 with the arms thereof inserted into the respective hollows 8 in the bobbins 10 with the third and fourth coils 14 and 15 thereon thereby to complete a first coil unit . thereafter , the first and second coil units are coupled with each other , with the arms of the first core member 17 abutted end - to - end with the arms of the second core member 17 , by means of a generally u - shaped elastic metal clamp 18 that tightly embraces the first and second core members 17 together as shown in fig5 thereby completing the line filter assembly with the first and second core members 17 defining a closed magnetic circuit . it is to be noted that the elastic metal clamp 18 is preferably made of stainless steel and that each of the first and second core members 17 is made of ferrite . it is also to be noted that each of the first and second coils 11 and 12 and each of the third and fourth coils 14 and 15 should be so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of line currents counteract to each other whereas the first and second coils 11 and 12 and the third and fourth coils 14 and 15 should be so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of the line currents can remain the same with respect to each other . in the line filter assembly of the construction described hereinabove , a leakage inductance brought about by a leakage of the magnetic fluxes from the core members 17 to the outside thereof caused by each of the coils 11 and 12 , 14 and 15 is rendered to be 1 to 1 . 5 % of the inductance of each of the coils 11 and 12 , 14 and 15 , which is of a value lower than one half of that of the prior art line filter assembly . because of this , a magnetic saturation of the core material resulting from the line current can hardly take place and the line filter assembly can be manufactured of a size 20 to 30 % smaller than that of the prior art line filter assembly for a given inductance with the same line current . the multi - linked winding bobbin assembly employed in the line filter assembly according to the foregoing embodiment may be modified as shown in fig9 . in the example shown in fig9 the multi - linked winding bobbin assembly comprises first and second bobbin units . each of those first and second bobbin units comprises first and second bobbins 10 around which the first and second coils 11 and 12 , or the third and fourth coils 14 and 15 , respectively , are wound in a manner similar to those shown and described in connection with the foregoing embodiment of the present invention . they are then bent or folded 180 ° inwardly and are subsequently accommodated within the casing 16 to complete the line filter assembly . also , as shown in fig1 , the first and second bobbins 10 having the first to fourth coils 11 to 14 turned therearound may be housed within the casing 16 such that the first and second coils 11 and 12 can be positioned diagonally opposite to each other while the third and fourth coils 13 and 14 can be diagonally opposite to each other . in such case , the resultant line filter assembly can exhibit the leakage inductance within the range of 0 . 7 to 1 % of the inductance of each of the coils 11 and 12 , 14 and 15 , and can be manufactured in a size 20 to 30 % smaller than that of the prior art line filter assembly for a given inductance with the same line current . the line filter assembly according to the foregoing embodiment of the present invention may be also modified as shown in fig1 and 12 . according to the modification shown in fig1 , a first multi - linked winding bobbin 10 having the hollow 8 defined therein and also having a plurality of radially outwardly flanged collars 19 has coils 11 , 12 and 14 , 15 alternately turned therearound over the entire length thereof , and another similar second multi - linked winding bobbin 10 having the hollow 8 defined therein and also having a plurality of radially outwardly flanged collars 19 has coils 11 , 12 and 14 , 15 similarly alternately turned therearound . the first and second winding bobbins 10 having the coils thereon are juxtaposed with each other by means of generally u - shaped core members 17 having respective pairs of arms which are inserted into the respective hollows 8 of the first and second winding bobbins 10 and are connected together by means of an elastic metal clamp 10 used to embrace the first and second winding bobbins 10 together as shown in fig1 , so as to thereby complete the line filter assembly . it is to be noted that the number of turns of the coils 11 and 12 is chosen to be equal to that of the coils 14 and 15 , but the coils 11 and 12 are wound in a direction counter to the direction of turn of the coils 14 and 15 . in the modified line filter assembly of the construction shown in fig1 and 12 , the leakage inductance brought about by a leakage is found to be about 0 . 5 to 0 . 8 % of the inductance of any one of the coils 11 , 12 , 14 and 15 and , therefore , the modified line filter assembly can be assembled in a size 40 to 50 % smaller than that of the prior art line filter assembly . while in the foregoing embodiment of the present invention , reference has been made to the use of the elastic metal clamp for clamping the generally u - shaped core members 17 together to complete the line filter assembly with the arms of the core members 17 inserted into the hollows 8 of the bobbins 10 , the use may be made of a generally - shaped core member ( a core member in the form of a generally rectangular frame ) forming a closed magnetic circuit and , in such case , divided multi - linked winding bobbins are mounted on the core member , followed by a winding of respective wires therearound to complete the line filter assembly . even this line filter assembly can give similar effects as those afforded by the line filter assembly utilizing the generally u - shaped core members . according to the first preferred embodiment of the present invention , the line filter assembly can give a reduced leakage inductance resulting from a leakage of the magnetic fluxes ; is less susceptible to magnetic saturation of the material for the core member during the flow of the line current and can have an increased number of turn of the coils as compared with those used in the prior art line filter assembly . however , the coils of an increased number of turns tends to emit heat as a result of the flow of the line current and , therefore , the number of turns available is limited by an increase in temperature . this can be substantially suppressed when portions of the line filter assembly where the coils are formed are filled with resinous material such as epoxy resin , silicone resin or urethane resin and it has been found that the temperature increase could be suppressed about 50 %. when in the line filter assembly shown in and described with reference to fig4 to 6 those portions of the line filter assembly exteriorly of the coils are filled with epoxy resin by the use of a dipping method , the size of the resultant line filter assembly could have been reduced further 20 to 30 % to exhibit the same inductance at the same temperature increase when the same line current is passed . the line filter assembly according to a second preferred embodiment of the present invention is shown in fig1 to 16 . fig1 is a perspective view of a bobbin assembly used in the practice of the second preferred embodiment of the present invention ; fig1 is a side view of the bobbin assembly of fig1 ; fig1 is a perspective view of the first and second bobbins juxtaposed to each other ; and fig1 is an exploded view of the bobbin assembly shown in fig1 . a bobbin assembly shown in fig1 and made of synthetic resin comprises first and second bobbins 10 which have respective hollows 8 defined therein and also have radially outwardly extending end flanges 20 each having no metal terminal . those bobbins 10 are pivotally linked together by means of a connecting pin 21 having its opposite ends secured to the respective end flanges 20 so that one of the bobbins 10 can pivot relative to the other of the bobbins 10 . while the bobbins 10 are held substantially in line with each other , a copper wire having its peripheral surface coated with an electrically insulating material is wound around the first bobbin 10 so as to extend from one end of the first bobbin 10 towards the end flange 20 thereof to form the first coil 11 on the first bobbin 10 and then from the end flange 20 of the second bobbin 10 towards the opposite end thereof thereby to form the second coil 12 on the second bobbin 10 . the copper wire so wound around the bobbins 10 has its opposite ends soldered to respective metallic terminal members 13 secured rigidly to the first and second bobbins 10 . third and fourth coils 14 and 15 are also formed on another bobbin assembly of similar construction in a similar manner as shown in fig1 . however , the direction of turn of the copper wire used to form the third and fourth coils 14 and 15 must be opposite to the direction of turn of the copper wire used to form the first and second coils 11 and 12 , while the total number of turns of the third and fourth coils 14 and 15 is equal to that of the first and second coils 11 and 12 . one of the first and second bobbins 10 having the first and second coils 11 and 12 formed respectively thereon and connected together by means of the connecting pin 21 is rotated relative to the other of the first and second bobbins 10 in a direction shown by the arrow in fig1 so that the first coil 11 can be brought to a position juxtaposed to the second coil 12 as shown in fig1 . then , the arms of the generally u - shaped first core member 17 and the arms of the generally u - shaped second core member 17 are inserted into the respective hollows 8 of the first and second bobbins 10 from opposite directions until free ends of the arms of the first core member 17 are brought into abutment with free ends of the arms of the second bore member 17 within the hollows of the first and second bobbins 10 , thereby completing the first and second coil units . thereafter , the first and second coil units are clamped together by means of the elastic metal clamp 18 that embraces the first and second core members 17 together . the assembly is then enclosed in a casing 16 , thereby completing the line filter assembly . in the practice of the second embodiment of the present invention , during the formation of the first and second bobbins 10 by the use of a plastics molding technique , the connecting pin 21 is integrally formed with one of the first and second bobbins 10 while a socket 22 for receiving a free end of the connecting pin 21 is formed in the other of the first and second bobbins 10 as shown in fig1 , so that the first and second bobbins 10 can be connected together by means of the connecting pin 21 for rotation relative to each other . alternatively , as a modified form , the first and second bobbins 10 may be formed with respective sockets 22 as shown in fig1 so that the first and second bobbins 10 can be subsequently connected together by means of a separate connecting pin 21 , which may be made of synthetic resin , ceramics or metals , so that one of the first and second bobbins 10 can rotate relative to the other of the first and second bobbins 10 . in either case , after the first and second bobbins 10 have been juxtaposed in side - by - side fashion as shown in fig1 , the arms of the core members 10 are inserted into the respective hollows in the first and second bobbins 10 from opposite directions to complete the first and second coil units which are subsequently clamped together by means of the elastic metal clamp 18 thereby to complete the line filter assembly . at this time , each of the first and second coils 11 and 12 and each of the third and fourth coils 14 and 15 should be so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of line currents counteracted to each other whereas the first and second coils 11 and 12 and the third and fourth coils 14 and 15 should be so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of the line currents can remain the same with respect to each other . since during the fabrication the first and second bobbins 10 are rotatably connected together , the line filter assembly according to the second embodiment of the present invention is substantially free from a problem associated with the presence of fins which would be formed if the first and second bobbins are folded about the thin - walled portion such as employed in the first embodiment of the present invention and , therefore , the assembly can be beautifully accommodated within the casing 16 without requiring an increase in number of the manufacturing steps . in addition , since the first and second bobbins 10 remains connected even after they have been accommodated within the casing 16 , the physical strength of the complete line filter assembly can be increased advantageously . also , the storage of the bobbins 10 after the coils have been formed thereon can be easily accomplished with no coils being loosened . a third preferred embodiment of the present invention will now be described with reference to fig1 and 19 which show a perspective view , with a portion cut away , of the line filter assembly and an exploded view of the bobbin assembly used in the line filter assembly of fig1 , respectively . the bobbin assembly shown in fig1 and made of synthetic resin comprises two bobbins 10 which have respective hollows 8 defined therein . each of the bobbins 10 has a plurality of radially outwardly flanged collars 20 formed integrally therewith at its opposite ends and also at a generally intermediate portion thereof . a copper wire having its peripheral surface coated with an electrically insulating material is wound around one of the bobbins 10 so as to extend from one end collar 20 thereof towards the intermediate collar 20 thereof to form the first coil 11 on such one of the bobbins 10 with opposite ends of the copper wire soldered to terminals 13 fast with the bobbin 10 while another similar copper wire is wound around such one of the bobbins 10 so as to extend from the intermediate collar 20 towards the opposite end collar 20 thereof thereby to form the third coil 14 on such one of the bobbins 10 with opposite ends soldered to terminals 13 fast with the bobbin 10 . second and fourth coils 12 and 15 are also formed on the other of the bobbins 10 in a similar manner . however , the direction of turn of the copper wire used to form the third and fourth coils 14 and 15 must be opposite to the direction of turn of the copper wire used to form the first and second coils 11 and 12 , while the total number of turns of the third and fourth coils 14 and 15 is equal to that of the first and second coils 11 and 12 . in order for the bobbins 10 to be connected together in side - by - side fashion , the end collars 20 of one of the bobbins 10 is formed with a dovetail projection 23 and a dovetail groove 24 , respectively , whereas the end collars 20 of the other of the bobbins 10 is formed with a dovetail groove 24 and a dovetail projection 23 , respectively . accordingly , after the formation of the coils 11 and 14 on one of the bobbins 10 and of the coils 12 and 15 on the other of the bobbins 10 , the bobbins 10 are connected together in side - by - side fashion with each other with the dovetail projections 23 engaged in the dovetail grooves 24 so as to form respective dovetail joints . after the bobbins 10 with the coils thereon have been connected together by means of the dovetail joints , the arms of the generally u - shaped first core member 17 and the arms of the generally u - shaped second core member 17 are inserted into the respective hollows 8 of the bobbins 10 from opposite directions until free ends of the arms of the first core member 17 are brought into abutment with free ends of the arms of the second bore member 17 within the hollows 8 of the bobbins 10 . thereafter , the first and second core members 17 are clamped together by means of the elastic metal clamp 18 that embraces them . the assembly is then enclosed in the casing 16 , thereby completing the line filter assembly . at this time , each of the coils 11 and 12 and each of the third and fourth coils 14 and 15 should be so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of line currents counteract to each other whereas the first and second coils 11 and 12 and the third and fourth coils 14 and 15 should be so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of the line currents can remain the same with respect to each other . according to the third embodiment of the present invention , the bobbins 10 having the coils thereon are connected together by means of the dovetail joints and , therefore , the use of any bonding agent to connect the bobbins together can be advantageously dispensed with , thereby minimizing the number of manufacturing steps . the line filter assembly according to a fourth preferred embodiment of the present invention is shown in fig2 in sectional representation . in this line filter assembly , four multi - linked winding bobbins 10 all made of synthetic resin and each having the hollow defined therein are employed , and coils 11 , 12 , 14 and 15 are formed respectively on those four bobbins 10 . those bobbins 10 are housed within the casing 16 comprised of a pair of side walls 16a and 16b and an intermediate partition wall 16c and , thereafter , the opposite arms 17b of the first and second core members 17 are inserted into the hollows of the bobbins 10 until free ends of the arms 17b of the first core member 17 are brought into abutment with free ends of the arms 17b of the second bore member 17 within the hollows 8 of the bobbins 10 . each of the first and second core members 17 is made of ferrite or the like and is of a type comprising the pair of the opposite arms 17b connected together by means of a bridge 17a , said bridge 17a having a cross - sectional surface area which is 1 / 2 to 3 / 4 of that of any one of the arms 17b . thereafter , the first and second core members 17 are clamped together by means of the elastic metal clamp 18 that embraces them thereby to complete the line filter assembly . it is to be noted that the elastic metal clamp 17 is preferably made of stainless steel and is of a generally u - shaped configuration having a pair of opposite bent fingers 18a engageable respective side portions of the first and second core members 17 to clamp the first and second core members 17 together . in the assembled condition , the coils 11 and 14 are mounted around one of the arms 17b of the core member 17 while the coils 12 and 15 are mounted around the other of the arms 17b of the core member 17 and , at this time , each of the coils 11 and 12 and each of the third and fourth coils 14 and 15 are so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of line currents can be counteracted to each other whereas the first and second coils 11 and 12 and the third and fourth coils 14 and 15 are so arranged and so positioned that the directions of flow of magnetic fluxes developed in the respective core members 17 as a result of flow of the line currents can remain the same with respect to each other . in the construction as hereinabove described , when a line current is allowed to flow across the coils 11 and 12 , mounted on the opposed arms 17a of the core members 17 forming the closed magnetic circuit , and also across the coils 14 and 15 mounted on the opposed arms 17b of the same core members 17 , the magnetic fluxes passing only through the closed magnetic circuit defined by the core members 17 counter - act each other , accompanied by a leakage of the magnetic flux from the opposed arms 17b of the core members 17 into an ambient space exteriorly of the closed magnetic circuit . accordingly , no magnetic flux is substantially produced in the respective bridges 17a of the first and second core members 17 and , since the average length of the magnetic path defined in the closed magnetic circuit is reduced even though the cross - sectional surface area of each of the bridges 17a of the first and second core members 17 is chosen to be 1 / 2 to 3 / 4 of that of any one of the arms 17b thereof , an equal inductance can be obtained . accordingly , a performance comparable to the line filter can be obtained and , also , the volume and the space for installation of the line filter assembly can be reduced about 10 to 20 % as compared with a line filter assembly of a type wherein the cross - sectional surface area of each of the bridges of the first and second core members is chosen to be equal to that of any one of the arms thereof . the line filter assembly according to a fifth preferred embodiment of the present invention is shown in fig2 in sectional representation and is designed to withstand external vibration to ensure a highly reliable performance . referring now to fig2 , two multi - linked winding bobbins 10 all made of synthetic resin and each having the hollow defined therein are employed , and coils 11 and 14 are formed on one of the bobbins 10 while the coils 12 and 15 are formed on the other of the bobbins 10 . those bobbins 10 are housed within the casing 16 comprised of a pair of side walls 16a and 16b and an intermediate partition wall 16c and , thereafter , the opposite arms 17b of the first and second core members 17 are inserted into the hollows of the bobbins 10 until free ends of the arms 17b of the first core member 17 are brought into abutment with free ends of the arms 17b of the second bore member 17 within the hollows 8 of the bobbins 10 . each of the first and second core members 17 is made of ferrite or the like and is of a type comprising the pair of the opposite arms 17b connected together by means of a bridge 17a to render the respective core member 17 to represent a generally u - shaped configuration . thereafter , the first and second core members 17 are clamped together by means of the elastic metal clamp 18 that embraces them so as to thereby complete the line filter assembly . it is to be noted that the elastic metal clamp 17 is preferably made of stainless steel and is of a generally u - shaped configuration having a pair of opposite bent fingers 18a engageable respective side portions of the first and second core members 17 to clamp the first and second core members 17 together and also having a bent tip 18b continued from each finger 18a so as to extend perpendicular thereto . the bent end 18b integral with each finger 18a of the elastic metal clamp 18 is so designed and so dimensioned that the tip thereof can be brought into engagement with an inner surface of the side wall 16b of the casing 16 while the bent end 18b itself is held in contact with a corresponding one of the opposite ends of the bobbin 10 . in this construction , in the event that external vibration is applied to the line filter assembly constructed as shown in fig2 , the ends 18b of the respective fingers 18a of the elastic metal clamp 18 cooperate with the side walls of the casing 16 and the adjacent ends of the bobbin 10 to absorb the vibration so as to thereby to avoid any possible collision between the core members 17 and the bobbins 10 . accordingly , not only damage to the closed magnetic circuit defined by the core members 17 , but also any possible reduction in magnetic permeability can be advantageously avoided to enable the resultant line filter assembly to operate in a stabilized and reliable manner . the casing 16 used in the line filter assembly may be modified as shown in fig2 . the casing 16 shown in fig2 comprises the pair of the side walls 16a and 16b and the partition wall 16c positioned intermediate between the side walls 16a and 16b . the partition wall 16c has its opposite ends formed with respective core guide recesses 25 , a bottom face of each of said core guide recesses 25 having a deformable projection 26 formed integrally therewith . the deformable projection 26 in each of the core guide recesses 25 is capable of being deformed in contact with the associated bridge 17a of each of the core members 17 when the elastic metal clamp 18 is encircled to clamp the core members 17 together . to cause the closed magnetic circuit , defined by the core members 17 , to be sandwiched between the elastic metal clamp 18 and the deformable projections 26 is effective to substantially eliminate any possible rattling of some component parts of the line filter assembly which would occur during and after the assembly thereof and also to eliminate the need of use of any bonding agent , so as to thereby avoid a reduction in performance and to improve the reliability . the size of each of the deformable projection 26 in the partition wall 16c of the casing 16 is selected so as to be of a value which is greater than the difference between the maximum size thereof available or permissible within the tolerance in dimension of the core members 17 , forming the closed magnetic circuit , and the minimum size thereof available or permissible within the tolerance in dimension of the partition wall 16c of the casing 16 and , also , as to be of such a value that the limit in size thereof attainable by the respective deformable projection 26 when deformed can be smaller than the difference between it and the maximum size thereof available or permissible within the tolerance in dimension of the core members 17 forming the closed magnetic circuit . however , it is to be noted that , instead of the use of the deformable projections 26 in the partition wall 16c of the casing , the casing 16 may be either integrally formed with thin - walled portions during the molding of the casing 16 or fitted with cushioning elements , such as silicone rubber pieces , subsequent to the molding of the casing . a sixth preferred embodiment of the present invention will now be described with reference to fig2 and 24 . the bobbin assembly shown in fig2 and made of synthetic resin comprises two bobbins 10 which have respective hollows 8 defined therein . each of the bobbins 10 has a plurality of radially outwardly flanged end collars 20 formed integrally therewith at its opposite ends and also a plurality of radially outwardly flanged intermediate collars 19 at a generally intermediate portion thereof . the coils 11 and 14 are formed on one of the bobbins 10 and the coils 12 and 15 are formed on the other of the bobbins 10 . the bobbins 10 with the coils 11 , 14 and 12 , 15 mounted thereon respectively are subsequently housed within the casing 16 of a generally e - shaped cross - section , followed by a fitting of a bottom plate 27 to the casing 16 . thereafter , the arms of the generally u - shaped first core member 17 and the arms of the generally u - shaped second core member 17 are inserted into the respective hollows 8 of the bobbins 10 from opposite directions until free ends of the arms of the first core member 17 are brought into abutment with free ends of the arms of the second bore member 17 within the hollows 8 of the bobbins 10 . the first and second core members 17 are subsequently clamped together by means of the elastic metal - clamp 18 that embraces them . in this embodiment , each of the end collars 20 of each of the bobbins 10 has its opposite sides formed with respective engagement grooves 28 which open towards the side walls 16a and 16b and the partition wall 16c of the casing 16 . on the other hand , a portion of each of the side walls 16 and 16b and the partition wall 16c of the casing 16 , which confronts the associated engagement groove 28 in the corresponding end collar 20 is formed with an engagement rib 29 which is engageable into the associated engagement groove 28 as the assembly of bobbins 10 with coils thereon is housed within the casing 16 . also , respective lower edges of the side walls 16a and 16b of the casing 16 are formed with retainer pawls 31 for retaining in position the multi - linked bobbins 10 . the side walls 16a and 16b of the casing 16 is further formed with hook pawls 31 which can be snapped into respective detent holes defined in the bottom plate 27 to secure the latter to the casing 16 with the filter assembly housed therein in the form as sandwiched between the casing 16 and the bottom plate 27 . the system shown in fig2 and 24 is advantageous in that no bonding agent is employed to fix the component parts in position , thereby minimizing the number of manufacturing steps and that the component parts can be tightly fixed in position within the casing so as to thereby improve the reliability considerably . from the foregoing description of the preferred embodiments of the present invention , it is clear that substantial portion of magnetic leakage fluxes from one of the coils and also from the other of the coils can be counterbalanced to make a magnetic saturation difficult to occur . also , the core members forming the closed magnetic circuit may be small in size for the resultant line filter assembly to operate with the same line current to give the same inductance and , therefore , the line filter assembly as a whole can be manufactured compact in size , low in height and at a reduced manufacturing cost . also , any possible influence which may be brought by the line filter assembly on peripheral component parts can be minimized . thus , the present invention has a significant utility .
| 7 |
the invention enables the use of a pair of microphones for multi - channel surround recording . a conventional two - channel stereo microphone , or a two - channel microphone specifically optimized for use with the proposed algorithm , is used to generate two signals ( or a two - channel or stereo signal ). a post - processor is applied to the microphone generated signals to convert them to multi - channel surround . the so - generated surround audio signal mimics the natural spatial aspect of the sound that has arrived at the microphones . the stereo microphone needs to have directional responses such that the direction of arrival of sound can be estimated from level difference and possibly phase difference between the two microphone generated signals . as will be shown , the range of uniquely decodable directions of arrival can be up to or nearly up to 360 degrees , enabling true multi - channel surround sound . all the weaknesses of previous techniques mentioned in the introduction are addressed by the invention : since the necessary microphone is based on only two channels , it will be more cost effective to build than a multi - channel microphone . the two recorded channels can be stored similarly as storing the signal when using conventional stereo recording . the used microphone is coincident or nearly coincident and thus can have a small form factor . an additional benefit is that the recorded two signals are a good stereo signal , thus if the post - processing is not applied good stereo performance can be expected . in this section , various two channel microphone configurations are discussed with respect to their suitability for generating a surround sound signal by means of post - processing . since human source localization largely depends on the direct sound , due to the “ law of the first wavefront ”, the analysis is carried out for a single direct far - field sound arriving from a specific angle α at the microphone in free - field ( no reflections ). without loss of generality , for simplicity , we are assuming that the microphones are coincident , i . e . the two microphone capsules are located in the same point . given these assumptions , the left and right microphone signals can be written as : x 2 ( t )= r 2 ( α ) s ( t ) ( 1 ) where s ( t ) corresponds to the sound pressure at the microphone locations and r 1 ( α ) is the directional response of the left microphone for sound arriving from angle α and r 2 ( α ) is the corresponding response of the right microphone . the signal amplitude ratio between the right and left microphone is note that the amplitude radio captures the level difference and information whether the signals are “ in phase ” ( a ( α )& gt ; 0 ) or “ out of phase ” ( a ( α )& lt ; 0 ). if a complex signal representation is used , such as a short - time fourier transform , the phase of a ( α ) gives information about the phase difference between the signals and information about the delay . this information may be useful if the microphones are not coincident . fig1 illustrates the directional responses of two coincident dipole ( figure of eight ) microphones pointing towards ± 45 degrees relative to the forward x - axis . the parts of the responses marked with a + pick up sound with a positive sign and the parts marked with a − pick up sound with a negative sign . the amplitude ratio as a function of direction of arrival of sound is shown in fig2 ( a ). note that the amplitude ratio a ( α ) is not unique , that is for each amplitude ratio value exist two directions of arrival which could have resulted in that amplitude ratio . if sound arrives only from front directions , i . e . within ± 90 degrees relative to the positive x direction in fig1 , the amplitude ratio uniquely indicates from where sound arrived . however , for each direction in the front there exists a direction in the rear resulting in the same amplitude ratio . fig2 ( b ) shows the total response of the two dipoles in db , i . e . p ( α )= 10log 10 ( r 1 2 ( α )+ r 2 2 ( α )). ( 3 ) note that the two dipole microphones pick up sound with the same total response from all directions ( 0 db ). from the above discussion it is concluded that two dipole microphones with responses as shown in fig1 are not very suitable for surround sound signal generation because of these reasons : only for an angular range of 180 degrees does the amplitude ratio uniquely determine the direction of arrival of sound rear and front sound is picked up with the same total response . there is no rejection of sound from directions outside of the range in which the amplitude ratio is unique . the next microphone configuration considered are two cardioids pointing towards ± 45 degrees with responses as shown in fig3 . the result of a similar analysis as previously is shown in fig4 . fig4 ( a ) shows a ( α ) as a function of direction of arrival of sound . note that for directions between − 135 degrees and 135 degrees a ( α ) uniquely determines the direction of arrival of the sound at the microphones . fig4 ( b ) shows the total response p ( α ) as a function of direction of arrival . note that sound from the front directions is picked up most strongly and more weakly the more sound arrives from the rear . from this discussion it is concluded that two cardioid microphones with responses as shown in fig3 are suitable for surround sound generation : three quarters of all possible directions of arrivals ( 270 degrees ) can uniquely be determined by means of measuring the amplitude ratio a ( α ), that is , sound arriving from directions between ± 135 degrees . sound arriving from directions which can not uniquely be determined , i . e . from the rear between 135 and 225 degrees , is attenuated , partially mitigating the negative effect of interpreting these sounds as coming from different directions . a particularly suitable microphone configuration is the use of super - cardioid microphones . the responses of two super - cardioid responses , pointing towards ± 60 degrees , are shown in fig5 . the amplitude ratio as a function of angle of arrival is shown in fig6 ( a ). note that the amplitude ratio uniquely determines the direction of arrival of sound . this is so , because we have carefully chosen the super - cardioid microphone responses to have a null response at 180 degrees . the other null responses are at directions ± 60 degrees . note that this microphone configuration picks up sound “ in phase ” ( a ( α )& gt ; 0 ) for front directions in the range ± 60 degrees . rear sound is picked up “ out of phase ” ( a ( α )& lt ; 0 ), i . e . with a different sign . matrix surround [ 1 - 4 ] uses a similar philosophy for decoding two - channel signals to surround signals . thus obviously , from this perspective , this microphone configuration is suitable for generating a surround sound signal by means of processing the recorded signals . fig6 ( b ) illustrates the total response of the microphone configuration as a function of direction of arrival . during a quite large directional range , sound is picked up with similar intensity . towards the rear the total response is decaying until it reaches zero at 180 degrees . yields the direction of arrival of sound as a function of the amplitude ratio between the microphone signals . the function ( 4 ) is obtained by inverting the function given in ( 2 ) within the desired range in which ( 2 ) is invertible . for the example of two cardioids as shown in fig3 , the direction of arrival will be in the range of ± 135 degrees . if sound arrives from outside this range , its amplitude ratio will be interpreted wrong and a direction in the range between ± 135 degrees will be returned by the function . for the example of two super - cardioids as shown in fig5 , the determined direction of arrival can be any value except 180 degrees since both microphones have their null at 180 degrees . as a function of direction of arrival , the gain of the microphone signals needs to be modified ( compensated ) in order to pick up sound with the same or approximately the same gain within a desired range of directions . the gain modification ( compensation ) as a function of direction of arrival is where g determines an upper limit in db for the gain compensation . such an upper limit is often necessary to prevent that the signals are scaled by too large a factor . the solid line in fig7 ( a ) shows the gain modification within the desired direction of arrival range of ± 135 for the case of the two cardioids . the dashed line in fig7 ( a ) indicates the gain modification that is applied to sound from rear directions , i . e . between 135 and 225 degrees , where ( 4 ) yields a ( wrong ) front direction . fig7 ( b ) shows the total response of the two cardioids ( solid ) and the total response if the gain compensation is applied ( dashed ). the limit g in ( 5 ) was chosen to be 10 db , but is not reached as evident from fig7 ( a ). a similar analysis is carried out for the case of the super - cardioid microphone pair . fig8 ( a ) shows the gain modification for this case . note that at the sides of the graph , the limit of g = 10 db is reached . fig8 ( b ) shows the total response ( solid ) and the total response if the gain compensation is applied ( dashed ). note that the compensated total response is decreasing towards the rear , despite of compensation . due to the limitation of the compensation gain , the total response is decreasing towards the rear ( due to the nulls at 180 degrees infinite compensation would be required ). after compensation , sound is picked up with full level ( 0 db ) approximately in a range of ± 160 degrees , making the super - cardioid microphones in principle a very suitable for recording of signals to be converted to surround sound signals . the previous analysis shows that in principle two microphones ( or a two - channel microphone , or a stereo microphone ) can be used to record signal which contain sufficient information to generate a surround sound audio signal . the invention enables effective usage of two - channel microphones ( or stereo microphones , or use two microphone capsules ) together with post - processing to generate a surround sound signal . thus , effectively , the invention enables surround sound recording with a two channel microphone . use of knowledge ( or assumption ) about the directional responses of the microphones to obtain information about the directions to which sound components of the microphone generated input signals are rendered when generating the surround output signal . a sound component is defined as signal part contained in the microphone generated signals . additionally , two - channnel microphones suitable for surround recording have the property that the more sound arrives from the rear at the microphones , the lower is the level at which sound is picked up . this is due to the directional responses of the microphones , which are weaker towards the rear . thus , it is also important to consider knowledge ( or assumption ) about the directional responses of the microphone signals to determine compensations gains , which when applied to sound components , result in that sound components are picked up with the same or approximately the same gain within a desired range of directions . in the following , two examples are described on how to implement the invention . one way of converting the microphone signal pair to a multi - channel surround audio signal , is to use a modified matrix surround decoder [ 1 - 4 ]. the matrix surround decoder is modified to render sound components to the correct directions ( 4 ) and gain compensation according to ( 5 ) needs to be added too . note that when super - cardioid microphones are used , gain compensation can be applied to the two microphone generated signals , resulting in a signal which is matrix surround compatible . in this case , the matrix decoder already can use its mechanism for deteremining rendering direction of sound components , but gain compensation needs to be added to the matrix decoder . a more sophisticated way of generating the multi - channel surround audio signal is described in the following . usually , not only a direct wavefront reaches the microphones , but a mix of direct sound and reflections . thus , the signal model of ( 1 ) is extended to : x 1 ( t )= r 1 ( α ) s ( t )+ n 1 ( t ) x 2 ( t )= r 2 ( α ) s ( t )+ n 2 ( t ), ( 6 ) where s ( t ) represents a direct localizable sound and n 1 ( t ) and n 2 ( t ) represent reflected sound or generally speaking sound which is independent between the two microphones . the signal model ( 6 ) can be written simpler as x 2 ( t )= ws ( t )+ n 2 ( t ), ( 7 ) where now s ( t ) does not anymore directly relate to the sound pressure of direct sound at the microphone locations , but is a scaled version thereof . the weights w is the amplitude ratio of the direct sound . in order to improve performance and allow simultaneously sound arriving from different directions at different frequencies , the signal model is preferably considered independently at different frequencies . in this case , ( 7 ) and the analysis and synthesis below is considered in a filterbank subband domain or short - time spectral domain . there are many heuristic methods to obtain estimates of s ( t ), a , n 1 ( t ), and n 2 ( t ). one possibility is to use : where e {.} is a short time average or mean estimate and φ is a short - time estimate of the normalized cross - correlation : the estimated weight w is used as an estimate for the direct sound amplitude ratio a ( α ) ( 2 ). the gain compensated direct sound is where f ( w ) ( 4 ) is the direction estimate of the direct sound . the gain compensated direct sound signal is mixed to the surround sound output signal such that it is perceived from the correct or desired direction by a listener . multi - channel amplitude panning may be used to achieve this . one good option is to mix the left reflected sound signal n 1 ( t ) ( also denoted ambient sound or reflected sound signal ) to the front and rear left channels of the surround output signal . to improve ambience and improve spatial image stability , the signal given to the rear can be delayed and low - pass filtered . we are using a delay of 30 milliseconds and a low - pass filter with 8 khz cutoff frequency . similarly , n 2 ( t ) is mixed to the right front and right rear channels of the surround output signal . alternatively , reverberators may be applied to the reflected sound in the rear surround channels to decorrelate them from the reflected sound in the front surround channels . it is not obvious whether to apply the gain compensation only to the direct sound ( 10 ), or also to the reflected sound n 1 ( t ) and n 2 ( t ). we tried both and it does not seem to make a big difference . as mentioned , it is favorable to process the signals in a subband or spectral domain . we are using a short - time fourier transform . to reduce the number of spectral coefficients ( or subbands ), we are grouping subbands together to “ critical bands ”, with a frequency resolution motivated by the periphery of the human auditory system , in a similar fashion as described in [ 5 ]. the proposed processing is applied independently in each “ critical band ”. after processing , the spectral coefficients of the output surround signal are converted back to the time - domain to generate the time - domain surround sound output signals . the above described method will be suitably implemented in a device embedding an audio processor such as a dsp . this device comprises different software components dedicated to the various tasks performed . a first component concerns a first calculation means that determine directions of sound components related to the microphone characteristics . a second component concerns a second calculation means that determine compensation gains of sound components related to the microphone characteristics . a third component concerns a third calculation means for generating the output audio channels , y 1 , . . . , ym , by using the microphone generated audio channels , x 1 , x 2 , directions , and compensation gains . it is to be noted that in one embodiment of the invention , the compensation gains of the second calculation means are determined related to the sum of the responses of the microphones . in case that the calculation is executed in subbands , the device of the invention comprises a splitting means to convert the input signal into a plurality of subbands and the first , second , and third calculation means are acting on each subband as a function of time . the contents of the following publications are hereby incorporated by reference in their entirety , [ 1 ] j . hull , “ surround sound past , present , and future ,” tech . rep ., dolby laboratories , 1999 , www . dolby . com / tech /, [ 2 ] j . m . eargle , “ multichannel stereo matrix systems : an overview ,” ieee trans . on speech and audio proc ., vol . 19 , no . 7 , pp . 552 - 559 , july 1971 , [ 3 ] r . dressler , “ dolby surround prologic ii decoder - principles of operation ,” tech . rep ., dolby laboratories , 2000 , www . dolby . com / tech /, [ 4 ] k . gundry , “ a new active matrix decoder for surround sound ,” in proc . aes 19th int . conf ., june 2001 , and [ 5 ] c . faller and f . baumgarte , “ binaural cue coding — part ii : schemes and applications ,” ieee trans . on speech and audio proc ., vol . 11 , no . 6 , pp . 520 - 531 , november 2003 .
| 7 |
the electrical signal regenerator 1 shown in fig1 contains an equalizer 2 , a clock data recovery circuit 3 ( cdr in the following ) coupled to the output of the equalizer , a switch 4 for selecting either the output of the cdr circuit or via a bypass 24 the output of the equalizer . the selected signal from switch 4 is then fed to a decision circuit 5 , i . e ., a comparator which decides upon logical signal value 0 or 1 to produce output signal 7 . additionally , the signal regenerator has a loop back line 25 for test purposes . a basic idea of the present invention is to adapt the operation of the signal regenerator to the bitrate of the received signal . the invention recognizes that for an electrical input signal 6 operating at 2 . 7 gbit / s , i . e ., the lowest otn bitrate , electrical equalization is sufficient , while for approximately 10 gbit / s , additional cdr is necessary to improve the jitter properties of the signal regenerator . therefore , the cdr circuit 3 contains a frequency meter which measures the frequency of the input signal 6 and controls the switch 4 to select either the output of the cdr circuit 3 or the output of the equalizer as output signal 7 . the frequency meter is advantageously realized with an external quartz oscillator and a counter which counts the number of pulses of the recovered clock signal of the input signal per measurement cycle defined by the external oscillator . it shall be noted that signals of the third otn level , i . e ., at 43 gbit / s will not be discussed in the following as a bitrate of that level would encompass additional system limitations that shall not be discussed here and is not an object of the present invention . typically , if 43 gbit / s signals shall be processed electrically , one would choose a parallel format , e . g ., converting the 43 gbit / s into 4 × 10 . 75 gbit / s and process the 4 signals in parallel . the equalizer is shown in more detail in fig2 . input signal 6 is first amplified by amplifier op 20 . the amplified signal is fed to two taps t 1 , t 2 . each tap contains a multiplier m 20 , m 21 , however , multiplier m 21 in tap t 1 is fixed to value 1 in this example . multiplier m 20 can be adjusted via control loop 14 . tap 1 is a delay line which contains three cascaded amplifiers op 22 , op 23 , and op 24 and has a delay in the range of about 100 ps . in the embodiment shown , the delay line has a delay of 94 ps . the amplifiers are simple differential buffer amplifiers , i . e ., feedback - controlled current amplifier with a broadband frequency spectrum of up to 12 ghz and a delay of approximately 30 ps , each . the total amplification of the three amplifiers of the delay line is adjusted to the value 1 . both taps are connected to an adder - subtractor 8 . tap t 1 is connected to the inverted input and top t 2 to the non - inverted input of the adder - subtractor 8 , so that the signal from tap t 2 is subtracted from the signal from tap t 1 . the output of the adder - subtractor is fed to a limiter 9 at the signal output of the equalizer . the limiter 9 is a limiting amplifier which serves to adjust the total amplification of the equalizer to be greater than 1 . output 17 of the equalizer is fed to cdr circuit 3 in fig1 and via bypass 24 to switch 4 . peak detectors 10 and 11 measure the maximum pulse amplitude before and after the delay line of tap t 1 . the peak values are subject to a / d conversion by a / d - converter 12 and the digital values then evaluated by logic circuit 13 in order to determine a control signal to tune multiplier m 20 . in addition , the output of the equalizer can be fed back to the input for test purposes via test loop 21 and amplifier op 21 . the equalizer is optimized to compensate cable distortion of coax cables or backplanes that have a relatively smooth frequency response with low - pass characteristic , which is typically the case as long as there are no signal reflections . the frequency response of the equalizer is approximately a sinus curve , whereby the maximum value is controlled by multiplier m 20 in tap t 1 and the width of the curve depends on the delay value of tap t 1 . for 10 gbit / s applications , the frequency response of the equalizer has its maximum at 5 ghz , i . e ., approximately half the bitrate of interest because 5 ghz is the fundamental frequency of a signal operating at 10 gbit / s . the frequency response of a coax cable for example , has typically a “ sqrt ( f )” shape , which can be approximated relatively well by the rising edge of the sinus shape . in other words , the rising edge of the sinus shaped frequency response curve of the equalizer is used to compensate the cable distortion for signals up to approximately 10 gbit / s . the normalized frequency response curve of the equalizer is shown schematically in fig3 , denoted with reference sign 31 . curve 32 is the typical frequency response curve of a coax cable . it can be observed that the rising edge of the sinus - shaped equalizer curve approximates adequately the distortion of the coax cable . via multiplier m 20 , the ratio between and input and output of tap t 1 is adjusted . this ratio depends on temperature and other external conditions . the control loop in tap t 1 can thus be used to adapt the equalizer dynamically to changing conditions . however , it may also be sufficient to adjust tap t 1 only once when switching the equalizer on and let the initial ratio fixed afterwards . during start of the equalizer , a static signal is fed via test loop 21 to the input of the equalizer and amplifier op 20 turned off ( i . e ., no external input signal ). peak detector 10 measures the static test input and peak detector 11 measures the output of tap t 1 . the peak detectors are realized with a capacitor that is charged with the input signal until its voltage reaches the maximum signal amplitude after approximately 0 . 5 μs . this peak measurement is cyclical , i . e ., after a measurement cycle of about 2 μs , the voltage at the capacitor is reset to zero to start a new measurement cycle . cyclical measurement is necessary to enable detection of a loss of the input signal , because if the peak detectors will not be reset , they would hold the maximum value , once fully charged , forever even when the input signal has long disappeared . the results from the two peak detectors are fed via a / d - converter 12 to logic circuit 13 , which is implemented with logic gates but could alternatively also be implemented with a processor and corresponding control software . the logic circuit 13 is a state machine that considers input and output peak values and determines according to a predefined optimization routine a scheduled value for the ratio . in the preferred embodiment , the scheduled ratio is 0 . 3 . when the equalizer is switched on , the logic circuit 13 adjusts the ratio between input and output of tap t 1 in 10 steps . afterwards , it may be disabled . alternatively , it can continue to adjust the ratio to changing temperature conditions in an on - line tracking process . this may be advantageous , if the cooling of the entire signal regenerator is insufficient and therefore temperature will change during operation . peak detector 10 has thus two functions . on the one hand , it detects loss of input signal and raises via logic circuit 13 a corresponding alarm and on the other hand , it serves to measure and adjust the ratio between input and output of tap t 1 . the equalizer 2 can compensate distortion of about 12 to 14 m coax cable or alternatively of about 1 . 7 to 1 . 8 m backplane . fig4 a and 4 b show signal measurements of a 10 gbit / s signal after 104 cm backplane plus 3 m coax cable . such measurements are typically referred to as eye diagrams . fig4 a is an eye diagram of the distorted input signal . it can be observed that the eye is completely closed . fig4 b shows the eye diagram after equalization . it can be observed that the eye has been widely opened by the equalizer . it can also be observed , however , that the poorly defined crossing area and the relatively soft rising edge would lead to jitter in the regenerated signal . therefore , at 10 gbit / s , additional cdr is required . fig4 c shows the eye diagram after cdr . the signal is now perfectly re - shaped and does not show any jitter anymore . the signal regenerator according to the present invention is adapted to compensate electrical cable distortion but can , however , also be used to compensate distortion of an optical signal due to dispersion effects . fig5 shows the eye diagram of an optical signal after 1 km standard multi - mode fiber at the output from an optical receiver , i . e ., directly after o / e conversion . no optical dispersion compensation has been applied . the eye diagram before equalization , i . e ., the output signal from the optical receiver , has been nearly closed ( upper part of the figure ) and the equalizer perfectly opens the eye ( lower part of the figure ). the test loop via op 21 described above can advantageously also be used for testing the equalizer during manufacturing on the wafer or after packaging . as the entire equalizer circuit is an analog circuit without any logical components such as flip - flops in the signal path , looping back the inverted output to the input creates a ring oscillator . in particular , a first ring oscillator leads via tap t 1 and a second ring oscillator leads via tap t 2 . each ring oscillator oscillates at a different frequency . the difference of the two frequencies from these two paths gives an exact measure for the delay of the first tap t 1 . this can be used as a criterion to sort the chips during manufacturing , because the delay determines the maximum value frequency in the frequency response curve shown in fig3 . the tolerance for this frequency value is +/− 15 %. therefore , chips that have a deviation from the scheduled value of more than 15 % will be sorted out . the advantage of testing the chip this way is that no high frequency test equipment , i . e ., for test in the range of several ghz , is required because the ring oscillation is in the range of several mhz , only , but that the test nonetheless gives an exact measure for the high frequency properties of the chip . the cdr is a clock recovery circuit and a decider circuit clocked by the recovered clock . the clock recovery circuit is realized with a phase - locked loop ( pll ). the pll has a voltage - controlled oscillator , a loop filter , and a phase detector . the phase detector compares the phase of a recovered clock signal with the phase of the input signal and generates an error signal , which corresponds to the phase difference between the two . the loop filter generates two control signals from the error signal . it has a first loop that generates the first control signal , which serves to adjust the oscillator to dynamical phase shifts in the input signal and a second control loop , which generates the second control signal that adjusts the oscillator to long - term variations in the phase of input signal . the first loop is designed as an analogue circuit , while the second control loop is designed as a digital circuit . details of the phase - locked loop and the associated control circuitry , that detects when the pll has locked , is disclosed in co - pending european patent applications entitled “ phasenregelkreis , übertragungstechnische einheit , erkennungsschaltung und digital - analog - konverter ”, “ erkennungsschaltung , phasenregelkreis , übertragungstechnische einheit und digital - analog - konverter ”, and “ digital - analog - konverter , phasenregelkreis , übertragungstechnische einheit und erkennungsschaltung ” by the same inventor and filed the same day as the present application , which contents is incorporated by reference herein . the switch 4 in fig1 is build of basic switch circuits of the type described in co - pending european patent application entitled “ basic switching circuit ” by the same inventor and filed the same day as the present invention , which contents is incorporated by reference herein . the signal regenerator according to the invention is designed for use in network elements of optical transmission networks , where the internal signal processing is performed electrically . in particular , such network elements have internal electrical signal paths and these paths are terminated by electrical signals regenerators as described above . preferably , signal regenerator of the above type are used in an optical switch . an optical switch is a device for establishing cross - connections in an optical transport network and is therefore commonly also referred to as optical crossconnect . internally , such optical switches typically operate electrically . therefore , a number of internal signals must be distributed electrically and are thus subject to distortion . therefore , at the end of each internal signal path , a regenerator as described above is located . in a preferred embodiment , the optical switch has a bitrate - transparent , asynchronous switching matrix . the matrix is constructed of a number of individual switch modules . each switch module is a basic square matrix with a switching capacity of 32 input signals , i . e ., a 32 × 32 space switch . preferably , each switch module has a 33th input and output for test purposes . this allows to loop a test signal into the matrix and out of the matrix at any point in the matrix without having to change the cabling between the switch modules . the switch modules are arranged in the form of a three stage clos matrix to form a large space switching fabric . fig6 shows a block diagram of one switch module s 6 . it comprises 33 input ports i 1 - i 33 and 33 output ports o 1 - o 33 . electrical signal regenerators 1 are connected to each of the input ports i 1 - i 33 to compensate distortions in the input signals . fig7 shows how the switch modules are connected to form a three stage clos matrix . in this arrangement , 16 switch modules form a combined input / output stage and 10 switch modules form the center stage . the switching matrix has a overall switching capacity of 160 signals . even when in practice the input stage switches is 1 - is 16 and the output stage switches os 1 - os 16 are identical , for better graphical presentation they are shown isolated into output stage modules and input stage modules in the figure . 10 input ports of each input stage switch module is 1 - is 16 are used as inputs for the input stage and 20 output ports of each module is 1 - is 16 are used as outputs of the input stage towards the center stage . virtually , each input stage module as shown in fig7 is thus a 10 × 20 switch module . two outputs of each input stage module connect to each of the center stage modules cs 1 - cs 10 . conversely , the output stage modules os 1 - os 16 shown in the figure are virtually 20 × 10 switch modules , i . e ., have 20 input ports connected to the center stage modules and 10 output ports , each . each center stage module is connected on its output side to two input ports of each output stage module . it can be observed , that one “ virtual ” input stage module ( 10 × 20 ) and one “ virtual ” output stage module ( 20 × 10 ) combined into one real switch module uses 30 inputs and 30 outputs thereof . the remaining two inputs and outputs are unused . in total , the switch matrix thus contains 26 switch modules . this forms a fully non - blocking switching matrix where each input port can be connected to each output port . the cabling between the matrix modules and between the optical receivers and transmitters and the matrix is made with coax cables . in total , 960 cables are required . in order to balance signal distortion , each cable is terminated by an electrical signal regenerator 1 as described above . preferably , two regenerators of the above described type are combined into a single integrated circuit . this would allow to combine receive and transmit direction from and towards the same i / o port of the crossconnect within one ic . the switch modules are preferably of the type described in co - pending european patent application entitled “ electrical space switching matrix ” by the same inventor and filed the same day as the present invention , which contents is incorporated by reference herein . this type of switch module allows to switch electrical signals of arbitrary bitrate of up to 12 gbit / s . if the input signal is an otn signal ( g . 709 ) of the lowest hierarchy level , i . e ., otu 1 , with a bitrate of 2 . 7 gbit / s , the signals are subject to electronic equalization , only . the signal regenerators 1 automatically detect this bitrate and bypass their cdr circuits . if the input signal is otu 2 with a bitrate of 10 . 7 gbit / s , the regenerators 1 automatically select their cdr circuits for output . this arrangement has the advantage that any otn signals ( excluding here otu 3 for the reasons discussed above ) can be processed irrespective of their bitrate with the some hardware and without any manual hardware configuration . in a further advantageous improvement , the 33th signal input in each switch module is used to generate a 4 ghz frequency signal . this can easily be achieved with the switching modules described below by simply switching a loop back in the test input port of each module . this results in a ring oscillation of 4 ghz , similar to the ring oscillation described above for test purposes of the equalizer . this 4 ghz signal is used as a monitor signal and switched to any un - used output port of the module , i . e ., to each output port that carries no signal at the moment . the electrical signal regenerator connected to an un - used output in front of the subsequent switch module will automatically detect the 4 ghz tone rather than a 2 . 7 gbit / s signal or a 10 . 7 gbit / s and would thus know that the internal cable connection is alright . conversely , if a regenerator does not detect neither a 4 ghz tone nor a valid 1 . 7 or 10 . 7 gbit / s signal , it concludes that an internal cable is broken or disconnected and raises a corresponding alarm . the 4 ghz tone is thus used to continuously check internal matrix cabling that carry no signals at the moment . this improves reliability of the entire optical switch . having described by way of non - limiting examples various embodiments of the present invention , it will be clear to those skilled in the art , that the invention is not restricted to implementation details and particular figures given in these embodiments . conversely , those skilled in the art would appreciate that several changes , substitutions and alterations can be made without departing from the concepts and spirit of the invention .
| 7 |
19 -- third seam of body portion joining front and back panels together referring now to fig1 there is shown a woman &# 39 ; s garment 10 cut away at the armpit to show a pocket assembly 11 of a fabric such as cotton . as best seen in fig1 and 2 , the garment 10 is shown on its interior as having a main body 12 , a sleeve 13 , a stitched seam 14 where the sleeve is connected to the body and a vertical stitched seam 15 that runs the length of the sleeve 13 and down the side of the body 12 of the garment 10 . a pocket assembly 11 is shown connected to the garment 10 , by stitching to the existing seams 14 , 15 of the garment 10 . as shown in fig3 the bottom of the pocket assembly is shown as comprising four quadrants seamed at 21 and 22 . the seam lines 21 , 22 of the bottom of the pocket are connected to the existing seam lines 14 , 15 of the garment 10 . the pocket assembly 11 is thus seen to be attachable to a completed garment 10 . fig4 illustrates the top of the pocket assembly 11 as including a first piece 23 of the fabric cut the same shape and length of the bottom section and extending from one side a little more than one half of the width of the bottom section . a second piece 24 or top flap of fabric is cut to the same length of the bottom section and extends from the opposite side a little more than one half the width of the bottom and overlaps the first piece 23 . the first 23 and second 24 pieces form an opening through which an antiperspirant absorbent shield or pad , or any item the wearer wishes to have contained within the garment , can be inserted . the shape and size of the pocket assembly can be changed depending on the size of the existing garment , the area within the garment , where it will be attached and the fabric being used in construction of the pocket assembly . the pocket assembly could be a kite shape for mens &# 39 ; garments , oval shape for womens &# 39 ;, as well as rectangular , square or circular . with this assembly 11 the stitching lines can not be seen on the outside of the garment which would ruin the outer appearance of the garment . the pocket assembly 11 is also removable without destroying the garment . while the pocket assembly 11 is shown in the figs . as attached to the underarm area of a garment , it can , in fact , be attached to any area of the garment depending on the needs of the wearer , e . g . padding in a bra . additionally , it can be used in garments for both males and females . the pocket assembly may be of an elastic material to hold an inserted anti - perspirant shield therein . also the assembly may have double flaps as illustrated or a single flap with a small opening . regardless of the shape of the pocket assembly or the arrangement of the flap closure , the seams of the assembly are always stitched to the seam lines of the garment . it should be obvious that changes , additions and omissions may be made in the details and arrangement of parts without departing from the scope of the invention as defined in the appended claims .
| 0 |
ocular prosthesis 20 in the form of an artificial eye is illustrated in fig1 in place on orbital implant 22 under upper eyelid 24 and lower eyelid 26 . in fig2 device 20 has been removed exposing anterior surface 28 through which sclera simulation 30 , iris simulation 32 and cornea simulation 34 is visible . the front perspective view of fig3 shows one thirty - second inch round bore opening 36 and one thirty - second inch round vent opening 38 opening through anterior surface 28 above iris simulation 32 barely visible through sclera simulation 30 . in these locations both openings are under upper eyelid 24 when in use . in fig4 the rear perspective view shows posterior surface 40 and cap 42 . in fig5 transparent center cast section 44 covers and provides the visual appearance to display iris simulation 32 and cornea simulation 34 on the main body of the acrylic casting body 45 . as also shown in fig6 cavity 46 opens through access 47 to posterior surface 40 and through openings 36 and 38 through anterior surface 28 . cap 42 releasably closes cavity 46 and conforms to posterior surface shape 40 . alternative embodiments are illustrated in fig5 a , 5b , and 5c . artificial eye 48 is cast of body resin 50 with clear acrylic resin section 52 essentially covering the entire anterior surface and making cavity 54 visible when the wearer lifts upper eyelid 24 to check the contents of the cavity . bore opening 56 opens to the anterior surface and vent hole 60 opens directly through cap 58 to the posterior surface . in fig5 b , ocular prosthesis 62 includes cavity 63 closed by cap 42 &# 39 ;. the &# 34 ; prime &# 34 ; and &# 34 ; double prime &# 34 ; designations throughout the specification indicate that that element is essentially identical to that of an earlier figure . bore opening 64 and vent opening 65 open from cavity 63 through anterior surface 28 &# 39 ;. cavity 68 is drilled into solid body to receive lacrisert ® insert 70 into that cavity opening directly through anterior surface 28 &# 39 ;. cavity 68 is positioned directly below bore opening 64 so that lubricant flowing downwardly provides sufficient lubrication for the lacrisert ®. in fig5 c , device 72 includes bore openings 76 and lacrisert ® bore opening 80 drilled side by side and joined together opening from the cavity through anterior surface 28 &# 34 ;. vent hole 78 provides the standard air vent to facilitate flow . in this embodiment , the lacrisert ® 82 swells and lubricate through direct contact with lubrication fluid 88 inside cavity 74 . as shown in fig6 b , and 7 at least one detent projection 84 extends under lip edge 86 of the eye body around opening to cavity 46 . most views show detents , such as detents 84 , at each cross - section edge of the cap . however , this is due to choice of the cross - section cut and a plurality of detents are sufficient , preferably about four for each cap , spaced around the periphery . as illustrated in fig6 pin 89 can be used to remove cap 42 either by inserting it through bore opening 36 or vent opening 38 or as shown in fig6 a and 6b by prying under tab 85 of the cap to lift it off . tab 85 aids in positioning cap 42 over the access opening . in fig7 cap 42 has been removed exposing cavity 46 bounded by lip edge 86 . as shown here , bore opening 36 and vent opening 38 open directly from cavity 46 through anterior surface 28 . in fig8 standard one half ounce lubricant bottle 90 containing a standard lubricant solution approximating normal tears is equipped with bent polyethylene tube extension 92 which is inserted into hole 36 to fill cavity 46 with the liquid . since hole 36 is under upper eyelid 24 , it is necessary to lift the eyelid to insert tube 92 into the hole and fill the cavity . through capillary action , the contact with the eyelid draws fluid from the cavity to wet the eye ball . fig9 through 13 illustrate a method of manufacture of a device of the present invention . artificial eye 94 is made using standard methods well known in the art that has been impression fitted to the patient . clear section 98 is cast in the eye to provide the iris and cornea simulations . using a prosthesis mix quick set stone or plaster , platform 96 is made for pressing and fabrication of the chamber cap . the stone platform is trimmed and artificial eye 94 is removed as shown in fig1 . in fig1 , the artificial eye is inverted so that the posterior surface is facing upwardly . using rotary ball grinder 100 , cavity 102 is routed out of the eye from the rear . in fig1 plasticine , wax , clay , or silly putty ® are used as filler plug 106 in the cavity to form the space that will remain open . a plurality of detents 104 , similar to detents 84 above , are formed by forming a plurality of small hollows under the lip after which medical grade r . t . v . silicone , such as dow corning r . t . v . no . 382 silicone is spread over the plug . platform 96 is re - engaged and pressed for about one minute against the posterior surface of eye 94 forming silicone resin cap 108 to the exact shape of platform 96 . when the silicone rubber has fully cured , platform 96 is removed , the cap is pried off and the putty removed . holes are drilled into the cavity at the chosen points . twist drills , size sixty through eighty are used to drill the holes into the body , that is the bore openings and vent openings into the chambers . for certain embodiments , the cap may be shaped to hold a ball or button in place by merely indenting the putty to the chosen shape and allowing the silicone rubber to flow into the cavity and upon curing to form the means to hold the ball or button in place . the chamber may be positioned at any location in the artificial eye , but it is preferred that the chamber be positioned at the top upper most section so that the bore opening can be under the upper eyelid . the liquid flows outwardly under the lid and over the prosthesis and down to reach the lower portions of the eye . the chamber is ground with a small ball burr with an undercut leaving a rim around the circumference of the chamber rim to provide a surface for detents extending from the cap to hold the cap in place . the interior of the chamber is polished . the r . t . v . silicone is catalyzed for gelling in about twenty seconds . the chamber is overfilled and immediately the posterior surface of the artificial eye is pressed against the stone platform mold covered with a thin film of vaseline ®. hard hand pressure is applied for at least one minute to force the silicone into and around the chamber hole . the silicone sets sufficiently in ten minutes or less after which the silicone is lightly polished in the area of the chamber . the silicone is removed from the chamber and trimmed with scissors or a razor blade . the bore opening used to allow the lubricant to weep from the chamber is drilled with a drill or a fine burr and finely polished . lubricant is placed in the chamber , the cap is placed in position closing the chamber . a notch tab in the chamber access aids in placement of the cap . after the prosthesis has been cleaned and any excess lubricant removed , the prosthesis is inserted into the eye socket and attached to the orbital implant . an alternative cap composition is triad ii light cured acrylic resin supplied by dentsply of york , pennsylvania . this semi - rigid material is used in the same fashion as the silicone rubber except that it is covered by a transparent film and cured by exposure to the light after which it is trimmed and ground to the proper shape and surface smoothness . while devices with only one large chamber and a small chamber are illustrated , it will be clear that a plurality of chambers of the same or different sizes may be provided in the artificial eye . these chambers may be charged with the same lubricant or may be charged with different materials . thus one chamber can be filled with a lubricant , while the other can be charged with a medicine , such as a bactericide , antihistamine or the like . certain devices and mechanisms in the artificial eye are described hereinbelow to aid in dispensing the lubricant from the artificial eye . the simplest method is merely to have the patient press on the prosthesis thus exerting pressure on the cap against the orbital implant . this tends to dispense a small amount of lubricant from the chamber through the weep hole and effectively lubricate the eye . the flexible or semi - rigid character of the cap material allows the cap to flex when pressure is applied to dispense liquid from the chambers . in fig1 , device 110 utilizes ball applicator 112 which rotates freely while protruding through anterior surface 114 . as shown in fig1 , chamber 118 is carved out of body 116 . ball 120 is slightly larger than the diameter of the hole extending through anterior surface 114 from the chamber . cap 122 is formed of silicone rubber with extension 124 extending into the space of chamber 118 and holding ball 120 against the hole while allowing it to rotate as it contacts the upper eyelid . another applicator device is illustrated in fig1 through 19 wherein device 126 include button 128 flush with the anterior surface proximate weep hole 130 and vent hole 132 , all the openings extending into chamber 140 . button 128 is molded of the triad ii light cured acrylic resin and is shaped to extend out through opening 134 but of a size too large to come out of the hole . cap 136 is formed with extension 138 to abut the rear surface of button 128 and hold it in position . when button 128 is depressed with the person &# 39 ; s finger , lubricant is expelled through weep hole 130 . while this invention has been described with reference to the specific embodiments disclosed herein , it is not confined to the details set forth and the patent is intended to include modifications and changes which may come within and extend from the following claims .
| 8 |
the devices disclosed herein are useful in transport of agent into or across biological barriers including the skin ( or parts thereof ); the blood - brain barrier ; mucosal tissue ( e . g ., oral , nasal , ocular , vaginal , urethral , gastrointestinal , respiratory ); blood vessels ; lymphatic vessels ; or cell membranes ( e . g ., for the introduction of material into the interior of a cell or cells ). the biological barriers can be in humans or other types of animals , as well as in plants , insects , or other organisms , including bacteria , yeast , fungi , and embryos . the microneedle devices can be applied to tissue internally with the aid of a catheter or laparoscope . for certain applications , such as for drug delivery to an internal tissue , the devices can be surgically implanted . the present invention provides agents which can be a protein , peptide , cell homogenate , whole organism or glycoprotein effective as a sensing agent or protective agent . the present invention also provides a presentation configuration of the agent in which for sensing , single molecules , multimers , aggregates , or multimer through nanoparticle anchoring may be used ; whereas , for delivery ( vaccination ) the configuration of the biological molecule may also comprise : single molecules , multimers , aggregates , or multimers through nanoparticle anchoring . nanoparticle anchoring can be through nanoparticles of gold , silver , titanium , agarose , proteins , dendrimers , proteins or polymers . the preferred option is the multimeric nanoparticle presentation . the present invention also has applications in the food industry for quality detection and for one or more infective agent ( s ), the infective agent can be a microorganism . the microorganism can be selected from one or more of the group comprising a virus , bacteria , protozoa and / or fungus . the inventors have unexpectedly discovered that a novel delivery structure and composition , as well as the composition and configuration of the biological reagent for delivery and methods for their production . by forming the agents for delivery in the presence of removable and / or degradable nanoparticles of different composition to the composition of the delivery molecules , the nanostructured molecules incorporate a nanoporous structure capable of holding large and small molecules and nanoparticles - anchored biological molecules for delivery as vaccines and therapeutics . it is also recognised that a number of novel polymer systems which when subjected to certain stresses change composition to have a nanoparticular structure which is different to the surrounding polymer , and such polymers can have application with their improved solubility ( degradation properties ) for the delivery of reagents from polymer array patches . the aforementioned polyvalent nanoparticular vaccination particles can be released from polymer patches with penetration to the interstitial layer in live tissue the aforementioned polyvalent nanoparticular sensing agents can be retained on the surface of the polymer patches with conducting properties for signal transduction . the inventors have surprisingly found that the identical polymer is used for presenting ( delivery / anchored sensing ) the nanostructured molecule ( s ), and also unexpectedly , a polymer which although biocompatible is preferably not biodegradeable has advantages of speed of molecule delivery not requiring the lengthy time dependent degradation . in the aspect of the invention that has application to delivery for vaccination through the stratum corneum , resident time in this layer is of the order of two weeks . in a further aspect of the present invention there is provided a process for delivering molecule ( s ) precisely to the appropriate depth using the microneedle arrays having nanostructured delivery molecules . construction of the device and control of structure of the polymer , by embedding nanoparticle - sized materials with properties to allow dissolution of the nanoparticles to create a mesoporous structure with nanoporous cavities for holding reagents or nanoparticle structured reagents . to be delivered by the array patch structure . both hollow and solid penetrator ( solid needle ) arrays are constructed with any of a range of sizes between 20 μm and 250 μm but the preferred sizes ( lengths ) are 25 μm and 150 μm . the dimensions of the whole array could be in the order of 1 cm square or with a diameter of 1 cm . however , the size of the array patch would be based on the amount of material to be delivered and the needle density packing on the patches . the microneedles are preferred to be in an array format , but could be randomly arranged . the arrangement of the microneedles may be a result of the method used in manufacture . the microneedles may be arranged so that more than one reagent can be coated and delivered from the one array . a polymer which when subjected to certain stresses change composition to have a nanoparticle structure which is different to the surrounding polymer , and such polymers can have application with their improved solubility ( degradation properties ) for the delivery of reagents from polymer array patches . a polymer that contains a nanoparticle that can be selectively removed to produce nanosized pores or cavities on the microneedle surface . the microneedle array patches of the present also provide applications for the treatment and prevention of human diseases . preventative vaccination of a wide variety of human disease states can be achieved , for example , the present microneedle arrays can be used to vaccinate against any one or more of the disease states selected from the group comprising infectious diseases ( including but not limited to meningococcal disease and tuberculosis ) and autoimmune diseases ( including but not limited to multiple sclerosis and rheumatoid arthritis ). as used herein , the term “ nanoparticle ”, is intended to include particles that range in size from about 1 nm to about 1000 nm . preferably , the nanoparticles are in the range from about 50 nm to about 500 nm . as used herein , the term “ fabric ”, is intended to describe the material which the particle is composed of . as used herein , the term “ biocompatible ”, is intended to describe molecules that are not toxic to cells . compounds are “ biocompatible ” if their addition to cells in vitro results in less than or equal to 20 % cell death and do not induce inflammation or other such adverse effects in vivo . as used herein , “ biodegradable ” includes compounds are those that , when introduced into cells , are broken down by the cellular machinery into components that the cells can either reuse or dispose of without significant toxic effect on the cells ( i . e ., fewer than about 20 % of the cells are killed ). the agent that can be delivered by use of the present invention includes any therapeutic substance which possesses desirable therapeutic characteristics . these agents can be selected from any one or more of the group comprising : thrombin inhibitors , antithrombogenic agents , thrombolytic agents , fibrinolytic agents , vasospasm inhibitors , calcium channel blockers , vasodilators , antihypertensive agents , antimicrobial agents , antibiotics , inhibitors of surface glycoprotein receptors , antiplatelet agents , antimitotics , microtubule inhibitors , anti secretory agents , actin inhibitors , remodeling inhibitors , antisense nucleotides , anti metabolites , antiproliferatives , anticancer chemotherapeutic agents , anti - inflammatory steroid or non - steroidal anti - inflammatory agents , immunosuppressive agents , growth hormone antagonists , growth factors , dopamine agonists , radiotherapeutic agents , peptides , proteins , enzymes , extracellular matrix components , ace inhibitors , free radical scavengers , chelators , antioxidants , anti polymerases , antiviral agents , photodynamic therapy agents , and gene therapy agents . in particular , the therapeutic substance can be selected from any one or more of the group comprising alpha - 1 anti - trypsin , anti - angiogenesis agents , antisense , butorphanol , calcitonin and analogs , ceredase , cox - ii inhibitors , dermatological agents , dihydroergotamine , dopamine agonists and antagonists , enkephalins and other opioid peptides , epidermal growth factors , erythropoietin and analogs , follicle stimulating hormone , g - csf , glucagon , gm - csf , granisetron , growth hormone and analogs ( including growth hormone releasing hormone ), growth hormone antagonists , hirudin and hirudin analogs such as hirulog , ige suppressors , imiquimod , insulin , insulinotropin and analogs , insulin - like growth factors , interferons , interleukins , luteinizing hormone , luteinizing hormone releasing hormone and analogs , heparins , low molecular weight heparins and other natural , modified , or syntheic glycoaminoglycans , m - csf , metoclopramide , midazolam , monoclonal antibodies , peglyated antibodies , pegylated proteins or any proteins modified with hydrophilic or hydrophobic polymers or additional functional groups , fusion proteins , single chain antibody fragments or the same with any combination of attached proteins , macromolecules , or additional functional groups thereof , narcotic analgesics , nicotine , non - steroid anti - inflammatory agents , oligosaccharides , ondansetron , parathyroid hormone and analogs , parathyroid hormone antagonists , prostaglandin antagonists , prostaglandins , recombinant soluble receptors , scopolamine , serotonin agonists and antagonists , sildenafil , terbutaline , thrombolytics , tissue plasminogen activators , tnf -, and tnf - antagonist , the vaccines , with or without carriers / adjuvants , including prophylactics and therapeutic antigens ( including but not limited to subunit protein , peptide and polysaccharide , polysaccharide conjugates , toxoids , genetic based vaccines , live attenuated , reassortant , inactivated , whole cells , viral and bacterial vectors ) in connection with , addiction , arthritis , cholera , cocaine addiction , diphtheria , tetanus , hib , lyme disease , meningococcus , measles , mumps , rubella , varicella , yellow fever , respiratory syncytial virus , tick borne japanese encephalitis , pneumococcus , streptococcus , typhoid , influenza , hepatitis , including hepatitis a , b , c and e , otitis media , rabies , polio , hiv , parainfluenza , rotavirus , epstein barr virus , cmv , chlamydia , non - typeable haemophilus , moraxella catarrhalis , human papilloma virus , tuberculosis including bcg , gonorrhoea , asthma , atheroschlerosis malaria , e - coli , alzheimer &# 39 ; s disease , h . pylori , salmonella , diabetes , cancer , herpes simplex , human papilloma and the like other substances including all of the major therapeutics such as agents for the common cold , anti - addiction , anti - allergy , anti - emetics , anti - obesity , antiosteoporeteic , anti - infectives , analgesics , anesthetics , anorexics , antiarthritics , antiasthmatic agents , anticonvulsants , anti - depressants , antidiabetic agents , antihistamines , anti - inflammatory agents , antimigraine preparations , antimotion sickness preparations , antinauseants , antineoplastics , antiparkinsonism drugs , antipruritics , antipsychotics , antipyretics , anticholinergics , benzodiazepine antagonists , vasodilators , including general , coronary , peripheral and cerebral , bone stimulating agents , central nervous system stimulants , hormones , hypnotics , immunosuppressives , muscle relaxants , parasympatholytics , parasympathomimetrics , prostaglandins , proteins , peptides , polypeptides and other macromolecules , psychostimulants , sedatives , and sexual hypofunction and tranquilizers . paratuberculosis ( johne &# 39 ; s disease ) is a chronic , progressive enteric disease of ruminants caused by infection with mycobacterium paratuberculosis . the disease signs of infected animals include weight loss , diarrhea , and decreased milk production in cows . herd prevalence of johne &# 39 ; s disease is estimated to be 22 - 40 % and the economic impact of this disease on the dairy industry was estimated to be over $ 200 million per year in 1996 . in addition , m . paratuberculosis has been implicated as a causative factor in crohn &# 39 ; s disease , a chronic inflammatory bowel disease of human beings , which has served as a further impetus to control this disease in our national cattle industry . the treatment and prevention of johne &# 39 ; s disease has become a high priority disease in the cattle industry . the membrane protein p34 , seq id no 1a , elicits the predominant humoral response against m . paratuberculosis and within the published sequence antigenic peptide epitopes have been identified , which include but are not limited to : see for example , ostrowski , m et al . ( 2003 ) scandinavian journal of immunology , 58 , 511 - 521 . peptide regions on other potential antigens can also be used in the device which can include the antigens described in : alkyl hydroperoxide reductases c and d are major antigens constitutively expressed by mycobacterium avium subsp . paratuberculosis . olsen , et al . ( 2000 ) infection and immunity , 68 ( 2 ), 801 - 808 . two proteins p11 and p20 have been identified as potential antigens for use in vaccination . thus suitably nano - structured vaccinations for mycobacterium infection for diseases such as johnes disease can be made and delivered according to the methods and devices of the current invention . bovine mastitis is a serious problem , common in both lactating dairy - type and beef - type animals . the management of this disease is practiced mostly on the dairy - type animal where daily udder handling is required . mechanical milking machines may have caused an increased incidence of mastitis ; the true origins of the disease remain unknown . bacterial organisms identified from affected glands are varied ; however , the species of streptococcus and staphlococcus are most commonly isolated . purified proteins which act as antigens to bovine mastitis have also be described and are incorporated by reference ; immunisation of dairy cattle with recombinant streptococcus uberis gapc or a chimeric camp antigen confers protection against heterologous bacterial challenge . fontaine et al . ( 2002 ) vaccine , 2278 - 2286 . it would be expected that specific peptide epitopes from these proteins would be antigenic . paua protein has been successfully used to vaccinate cattle to prevent mastitis caused by challenge infection with s . uberis ( leigh , j . a . 1999 . “ streptococcus uberis : a permanent barrier to the control of bovine mastitis ?” vet . j . 157 : 225 - 238 ). vaccinated , protected cattle generated serum antibody responses that inhibited plasminogen activation by paua ., s . uberis paua protein sequence : epitope region peptides selected from this protein useful as vaccines candidates when presented in the appropriate nanoparticle form : including but not restricted to as well as the whole or selected fragments of the protein sequence above . omp85 proteins of neisseria gonorrhoeae and n . meningitides and peptide sequences derived therefrom can be used as vaccines against the organisms causing meningococcal disease when presented in nanoparticle form , or variants according to us 2005074458 , which is herein incorporated by reference . and the gonococcal and opacity proteins according to ep0273116 , including but not restricted to : fragments of the core protein used for in vitro immunisation can include but not be limited to : these can be used in conjunction with or without toll receptors and or lipoproteins as indicated by the following reference : cell activation by synthetic lipopeptides of the hepatitis c virus ( hcv )— core protein is mediated by toll like receptors ( tlrs ) 2 and 4 . liver flukes ( fasciola spp .) infect a wide range of animals , including humans . the disease that is caused is termed fasciolosis . as with most parasitic diseases , there is a complex life cycle . economically , sheep and cattle are of primary importance . infection with liver fluke leads to decreased production due to poor energy conversion ( meat and milk in cattle , meat and wool in sheep ) and can lead to mortality ( particularly in sheep ). vaccines targeting liver fluke have been investigated for many years , with most subunit vaccines centered on glutathione - 5 - transferase ( gst ), cathepsin l ( catl ) and fatty acid binding proteins ( fabp ). attenuated vaccines , created by the irradiation of metacercariae , are very effective , however this method of vaccination is not commercially viable . therefore , subunit vaccine candidates have been considered . dna vaccines have been assessed and recombinant proteins such as cathepsin b been cloned and analysed . antigens have been cloned and the use of cathepsin l proteases as vaccines described , see for example u . s . pat . nos . 6 , 623 , 735 and 20050208063 , which is herein incorporated by reference . the n - terminal sequences of the proteases to be used for in vitro immunisation can include but not be limited to : these can be incorporated into a nanoparticle ( s ) or can be formed as a nanoparticle . an injectable nanoparticle can be prepared that includes a substance to be delivered and a nanoparticular polymer that is covalently bound to the molecule ( s ), wherein the nanoparticle is prepared in such a manner that the delivery molecule ( s ) is on the outside surface of the particle . injectable nano - structured molecule ( s ) with for example , antibody or antibody fragments on their surfaces can be used to target specific cells or organs as desired for the selective dosing of drugs . the molecule for delivery can be covalently bound to the nanoparticular polymer by reaction with a terminal functional group , such as the hydroxyl group of a poly ( alkylene glycol ) nanoparticle by any method known to those skilled in the art . for example , the hydroxyl group can be reacted with a terminal carboxyl group or terminal amino group on the molecule or antibody or antibody fragment , to form an ester or amide linkage , respectively . alternatively , the molecule can be linked to the poly ( alkylene glycol ) through a difunctional spacing group such as a diamine or a dicarboxylic acid , including but not limited to sebacic acid , adipic acid , isophthalic acid , terephthalic acid , fumaric acid , dodecanedicarboxylic acid , azeleic acid , pimelic acid , suberic acid ( octanedioic acid ), itaconic acid , biphenyl - 4 , 4 ′- dicarboxylic acid , benzophenone - 4 , 4 ′- dicarboxylic acid , and p - carboxyphenoxyalkanoic acid . in this embodiment , the spacing group is reacted with the hydroxyl group on the poly ( alkylene glycol ), and then reacted with the molecule ( s ). alternatively , the spacing group can be reacted with the molecule , such as an antibody or antibody fragment , and then reacted with the hydroxyl group on the poly ( alkylene glycol ). the reaction should by accomplished under conditions that will not adversely affect the biological activity of the molecule being covalently attached to the nanoparticle . for example , conditions should be avoided that cause the denaturation of proteins or peptides , such as high temperature , certain organic solvents and high ionic strength solutions , when binding a protein to the particle . for example , organic solvents can be eliminated from the reaction system and a water - soluble coupling reagent such as edc used instead . according to another embodiment , the agent to be delivered can be incorporated into the polymer at the time of nanoparticle formation . the substances to be incorporated should not chemically interact with the polymer during fabrication , or during the release process . additives such as inorganic salts , bsa ( bovine serum albumin ), and inert organic compounds can be used to alter the profile of substance release , as known to those skilled in the art . biologically - labile materials , for example , procaryotic or eucaryotic cells , such as bacteria , yeast , or mammalian cells , including human cells , or components thereof , such as cell walls , or conjugates of cellular can also be included in the particle . injectable particles prepared according to this process can be used to deliver drugs such as non - steroidal anti - inflammatory compounds , anaesthetics , chemotherapeutic agents , immunotoxins , immunosuppressive agents , steroids , antibiotics , antivirals , antifungals , and steroidal anti - inflammatories , anticoagulants . for example , hydrophobic drugs such as lidocaine or tetracaine can be entrapped into the injectable particles and are released over several hours . loadings in the nanoparticles as high as 40 % ( by weight ) can be achieved . hydrophobic materials are more difficult to encapsulate , and in general , the loading efficiency is decreased over that of a hydrophilic material . in one embodiment , an antigen is incorporated into the nanoparticle , alternatively , the antigen can compose the entire nanoparticle . the term antigen includes any chemical structure that stimulates the formation of antibody or elicits a cell - mediated humoral response , including but not limited to protein , polysaccharide , nucleoprotein , lipoprotein , synthetic polypeptide , or a small molecule ( hapten ) linked to a protein carrier . the antigen can be administered together with an adjuvant as desired . examples of suitable adjuvants include synthetic glycopeptide , muramyl dipeptide . other adjuvants include killed bordetella pertussis , the liposaccaride of gram - negative bacteria , and large polymeric anions such as dextran sulfate . a polymer , such as a polyelectrolyte , can also be selected for fabrication of the nanoparticle that provides adjuvant activity . specific antigens that can be loaded into the nanoparticles described herein include , but are not limited to , attenuated or killed viruses , toxoids , polysaccharides , cell wall and surface or coat proteins of viruses and bacteria . these can also be used in combination with conjugates , adjuvants , or other antigens . for example , haemophilus influenzae in the form of purified capsular polysaccharide ( hib ) can be used alone or as a conjugate with diptheria toxoid . examples of organisms from which these antigens are derived include poliovirus , rotavirus , hepatitis a , b , and c , influenza , rabies , hiv , measles , mumps , rubella , bordetella pertussus , streptococcus pneumoniae , clostridium diptheria , c . tetani , vibrio cholera , salmonella spp ., neisseria spp ., and shigella spp . the nanoparticle should contain the substance to be delivered in an amount sufficient to deliver to a patient a therapeutically effective amount of compound , without causing serious toxic effects in the patient treated . the desired concentration of active compound in the nanoparticle will depend on absorption , inactivation , and excretion rates of the drug as well as the delivery rate of the compound from the nanoparticle . it is to be noted that dosage values will also vary with the severity of the condition to be alleviated . it is to be further understood that for any particular subject , specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions . the present invention will now be more fully described with reference to the accompanying examples . it should be understood , however , that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above . a polycarbonate sheet was laser ablated using an excimer laser beam . the needle cross - section is determined by the shape of the aperture that the laser beam passes through prior to irradiating the polycarbonate workpiece . this process known as excimer laser photolithographic ablation , uses an imaging projection lens to form the desired shapes . the depth of laser ablation , and hence the maximum height of the cast material is determined by a computer program operating the excimer micromachining system . using excimer laser ablation of a polycarbonate sheet , a series of moulds for a microneedle arrays were fabricated with eleven different shapes and heights in the ranges of 20 μm to 200 μm . moulds were fabricated for a number of different microneedle shapes including square , circular , oval , cross needle , triangular , chevron , jagged chevron and half moon . in addition to the shape of the microneedles , the density , depth and pitch of the microneedle were varied . for example , the laser ablation process was used to create moulds for two dense arrays : a ) 50 μm diameter shapes on a 50 μm pitch approx 100 μm high . the moulds were evaluated to determine their suitability for fabrication process with a variety of techniques including optical microscopy , laser scanning confocal microscopy and scanning electron microscopy . it has been our experience that good perforation structures are usually complex in cross section , and not normally simple conical protrusions . hence shapes were chosen that contain edge features and symmetry that , lead to improved performance for perforation . initial moulding trials were conducted with materials with two different viscosities . the most viscous material had a putty - like consistency , the second had a honey - like viscosity . these materials were applied to the polycarbonate moulds and pressure was applied via a glass tile to ensure the indentations were filled . to aid in the removal of gas bubbles in the moulds , a vacuum was applied to the moulded materials . the material was hardened by curing the polymer / polymer precursor using a sixty - second exposure to light from a handheld blue led source through the glass tile . demoulding was a simple process , relying on the material &# 39 ; s tendency to adhere more to the backing glass tile than to the polycarbonate mould . the moulds were made of polycarbonate sheet 250 to 500 μm thick and were more flexible than the glass tile . hence the moulded material could be “ peeled ” from the slightly more flexible mould . the resultant structures were examined under an optical microscope . some of the structures were measured using a laser scanning confocal microscope or imaged using a scanning electron microscope . the second honey - like material filled the mould , and the air bubbles formed in the needle recesses of the mould and were removed through the application of a vacuum . many of the structures demoulded satisfactorily and the mould was made usable for further trials with a combination of liquid and sonication cleaning . a silicone release agent was applied to the polycarbonate to assist in demoulding , alternatively , materials such as peek or silicone elastomers could be used as the female moulds . a number of microneedle arrays were fabricated with varying shapes , length , aspect ratios and needle densities . the various shapes are shown in fig1 . the cross - shaped needle moulds filled well with polymer , including the point at the intersection of the cross that is formed as a result of the ablation process . the combination of the relatively large side arms and the fine feature at the apex produces a robust structure with good mechanical properties . the circular microneedle approximately 140 μm high with an aspect ratio of about 3 was produced . a triangular microneedle which is approximately 100 μm high and has an aspect ratio of about 2 was prepared . the smooth apex of the shape is due to the polymer moulding material and has not fully reproduced the fine texture of the ablated mould . an array patches with circular microneedle 20 μm in diameter and 50 μm high and 100 μm in diameter at 100 μm pitch , approximately 100 μm high were produced a variety of different shaped needle profiles were produced to investigate the effect on skin perforation on the shape of the microneedle . array patches with a series of coloured spikes and crosses were constructed from polydimethylsiloxane ( pdms ), a clear elastomer material by excimer laser machining 2 moulds in polycarbonate with four patches of 10 mm × 10 mm each , with female features of tapering circular structures , and crosses . the pitch and depths of the structures were varied . clear and coloured pdms was cast from these features . initial moulding trials were conducted with standard pdms supplied by dupont . this is a two part formulation , with 10 % accelerator added to cause the material to set . the mixture was placed in a vacuum chamber to speed up outgassing prior to moulding to prevent bubble formation during curing . fig2 shows a top view of a fabricated pdms cross shaped microneedles and fig3 shows the side view of the fabricated cross shaped microneedles . fig4 , 5 and 6 show various microneedle arrays prepared according to the described methods . aqueous based colouring was added to the pdms prior to casting ; adding larger quantities of colouring intensified the colour , additional curing accelerator was added to compensate for the volume of aqueous colouring added . the material was hardened by curing the moulded material by placing in a 45 ° c . oven for several hours . curing rates were significantly slower for the coloured material . somewhat surprisingly demoulding the aqueous coloured material was more successful than the non - coloured material . this could be due to a range of effects such as increased curing accelerator , casting thicker pieces that tended to hold onto the needles more effectively during demoulding , or perhaps some inhibition of adhesion between pdms and polycarbonate as a result of the aqueous additive . the microneedles produced by the method of example 3 can be coated with a layer of a biocompatible electrically conducting polymer to modify the delivery characteristics of the microneedle . thus to assist in the delivery of certain types of molecules , a polyaniline coating can be applied to the solid polymeric microneedle after demoulding . the conducting polymer can be applied using techniques known in the art , including electrodeposition . during the electrodeposition phase ( including polymerisation ) biological reagents ( for vaccines , drug delivery etc ) can be included in the conductive polymer . the conductive polymer can be polymerised ( electrodeposited ) under conditions in such a way as that the electrodeposited polymer surface has characteristics that enable the diffusion of the biological reagent out into the surrounding environment ( skin ) in order for the biological reagent to be functional for its purpose . a number of different thickness coatings can be applied depending on the desired application , ranging from 20 nm to 20 μm can be produced . in another experiment , polyaniline and polypyrrole can be codeposited electrochemically on microneedles made from conductive materials under potentiostatic or galvanostatic conditions conditions . electropolymerisation can be carried out by varying the applied potential and the feed ratio of monomers . formation of polyaniline - polypyrrole composite coatings can be confirmed by the presence of characteristic peaks for polyaniline and polypyrrole in the infrared spectra . composite coatings composed of polyaniline and polypyrrole can be formed at applied potentials of & lt ; 1 . 0 v . polypyrrole is preferentially formed at 1 . 5 v . methods of electrodeposition have been described previously and include adeloju , s . b . and shaw , s . j ., ( 1993 ) “ polypyrrole - based potentiometric biosensor for urea ” analytica cimica actica , 281 , page 611 - 620 ; adeloju s . b . and lawal , a ., ( 2005 ) intern . j anal . chem ., 85 , page 771 - 780 , based on their use as a sensor . we have surprising found that the techniques can be applied to incorporating proteins and peptides into a polymer layer for delivery of the proteins and peptides as therapeutics such as peptide and protein antigens ( for vaccines ), hormones ( erythropoietin , parathyroid hormone ) and drugs ( insulin ). the nanoparticles can be formed from metals ( gold silver ) light metals , polymer material by any of the standard techniques ( u . s . pat . no . 6 , 908 , 496 to halas et al . ; u . s . pat . no . 6 , 906 , 339 to dutta ; u . s . pat . no . 6 , 855 , 426 to yadav ; u . s . pat . no . 6 , 893 , 493 to cho et al .). the surface of the nanoparticles can be functionalised to anchor / immobilise ( multimerise ) the biological reagents for improved immunisation efficiency . cao l , zhu t and liu z ( 2005 ) “ formation mechanism of nonspherical gold nanoparticles during seeding growth : role of anion adsorption and reduction rate .” journal of colloid interface science , july 11 . bilati u , alleman e and doelker e . ( 2005 ) “ poly ( d , l - lactide - co - glycolide ) protein - loaded nanoparticles prepared by the double emulsion method — processing and formulation issues for enhanced trapment efficiency .” journal of microencapsulation , 22 ( 2 ), 205 - 214 . rolland j p , maynor b w , euliss l e , exner a e , denison g m and desimone j m ( 2005 ) “ direct fabrication and harvesting of monodisperse , shape specific nanobiomaterials .” journal of the american chemical society , 127 ( 28 ), 10096 - 100 . the biological agents can be immobilized on the surface of a nanoparticle or integrally incorporated inside the nanoparticle during fabrication . the delivery agent may also be directly manufactured or naturally present in a nanoparticulate form . the biological agents insulin and ovalbumin were structured as nanoparticles using supercritical fluid technology , to produce nanoparticles of dimensions 50 - 300 nm . the insulin nanoparticles were suspended in a solvent ( ethanol ) and attached to the surface of the microneedles . insulin and ovalbumin attached to microneedles are each being delivered separately across the stratum corneum and the response to the delivery of insulin can be measured . erythropoietin is a glycoprotein hormone produced in the liver during foetal life and the kidneys of adults and is involved in the maturation of erythroid progenitor cells into erythrocytes . there are several human conditions and treatments for cancer which result in low levels of circulating red blood cells and therefore administration of erythropoietin is desirable . erythropoietin can be nanostructured by supercritical fluid technology and attached to microneedles for delivery by microneedle array , and delivery efficiency can be measured by physiological effects on red cell numbers in mice ( including flow cytometry ). the surface of a polymeric microneedle array can be nano - structured during fabrication by lining the microneedle mould with nanoparticles which can be selectively removed . the microneedles can then be cast , hardened and demoulded to produce microneedles with nanoparticles embedded on the surface of the microneedles . the embedded nanoparticles can then be removed , for example by dissolution or leeching techniques , to yield a microneedle that has nano - sized pores or cavities on their surface . the delivery agent molecules or nanoparticles can then be associated with the introduced pores by non - covalent interactions or covalent bonds . referring to the process shown in fig7 , the method includes the steps of : ii ) template nanoparticles removed with solvent leaving recesses over microneedle surface and then nano - structured reagent ( s ) are added to the solution ; iii ) nanostructured reagent ( s ) fits into recesses within needle structure to form the microneedles with the nanostructured reagents associated with the microneedles . the moulded microneedle can alternatively be chemically treated with a solvent , chemical reagent , electrochemical or physical treatment to induce surface cavity and / or nanopore formation . a polyaniline microneedle array can be fabricated by electropolymerization of a monomer solution contained in a microneedle array mould under an applied potential . the progress of electropolymerisation can be monitored by weight gain analysis and infrared spectroscopy . the nanoparticles can be added to the monomer solution prior to polymerization to form a microneedle array with the delivery molecule integrally incorporated into the needles , or the nanoparticles can be associated to the surface of the microneedles by a post demoulding step . to demonstrate the efficacy for the loading of patches with nanoparticles , a series of microneedle arrays was coated with quantum dots . quantum dots are semiconductor crystals typically between 1 and 10 nm in diameter and have unique properties between that of single molecules and bulk materials . under the influence of an external electromagnetic radiation source , quantum dots can be made to fluoresce and therefore their position accurately determined using readily available optical techniques . circular microneedle array patches with both bullet and cross shaped needles were constructed in plga ( poly - dl - lactic glycolic acid , 0 . 8 cm in diameter with a 2 mm edge ). the patches were coated with quantum dots by placing 100 μl of cdse / zns quantum dots ( 200 picomolar , invitrogen qtracker ™ 655 nm ) on top of the microneedles and air drying . the arrays were examined for fluorescence using confocal microscopy . the arrays demonstrated red fluorescence on the both the bullet and cross shaped needles indicating coating by the quantum dots . as shown in fig7 , coverage was shown at the tops over the needles and down the sides to the base . the cross shaped needles demonstrated more confluent coverage of quantum dots , as shown in fig8 . the uptake of quantum dots by lymphocytes can be observed by in vitro studies on cultured cells and by in vivo studies on hairless mouse models . to demonstrate the efficacy for the loading of patches with nanoparticulate biological molecules , a series of microneedle array patches were coated with nanostructured insulin . insulin can be nanostructured using various methods including super critical fluid technologies . the particle size of the insulin averaged 300 nm . circular plga patches in high density cross and needle shapes were coated with the nanostructured insulin by placing 100 μl of nanostructured insulin in iso - amyl alcohol ( total 0 . 6 units insulin / patch ) on top of the patches and air drying . the patches were then examined for the presence of insulin using field emission gun scanning electron microscope ( feg - sem ), as shown in fig9 and 10 . the patches demonstrated the presence of nanostructured insulin both over the top surfaces of the microneedles and down the side edges of the needles . the density of the insulin nanoparticles on the cross shaped microneedles was much lower due to the higher surface area of the crosses compared to the bullets . bullet shaped patches were coated with quantum dots by placing 100 μl of cdse / zns quantum dots ( 200 picomolar in saline , invitrogen qtracker ™ 655 nm ) on top of the microneedles and air drying . the patches were applied to the rear flank of hairless mice by manually pressing . the patch was removed and the skin excised and examined for fluorescence using confocal microscopy , as shown in fig1 . the skin demonstrated red fluorescence on the surface of the stratum corneum indicating deposition of the quantum dot present on the base of the array . confocal imaging deeper into the epidermis indicated red fluorescence in the shape of a bullet demonstrating penetration of the microneedle to a total depth of approximately 60 μm , as shown in fig1 . this experiment demonstrates conclusively that the microneedle array can be used to deliver nanoparticles across stratum corneum layer of the dermis . insulin was nanostructured using a supercritical fluid process . an average particle size of 300 nm was obtained . the insulin was suspended in various solvents including isopropanol , isoamyl ethanol , ethanol , methanol or other coatings onto the array . for coating of the microarrays , insulin nanoparticles were suspended in solvent to a final concentration of 120 u / ml ( 4 . 32 mg / ml ) and sonicated for 60 seconds to ensure complete dispersal throughout the suspension . the suspension was then applied to each microarray ( 6u in 50 μl ) and allowed to air dry . for subcutaneous delivery in the control experiments , the solution used to coat the microarrays was diluted 1 : 300 in normal saline ( final concentration of 0 . 4 u / ml ). hairless mice were anaesthetised with pentobarbitone ( 60 mg / kg , i . p .). blood samples were obtained by tail laceration and blood glucose was measured using a commercial glucose - meter ( optimum ™ xceed ™; abbot diagnostics ). after obtaining two consecutive readings , mice were treated as indicated and blood glucose was recorded every 20 minutes for the remainder of the experiment . mice were treated with either a positive control ( insulin suspension , 1u / kg , s . c . ), insulin loaded microarrays ( 2 patches for each mouse , 6u / patch ), or negative control ( 12u insulin applied directly to the skin without any microarray ). administration of the insulin via the microarray patch can be shown in the mouse by a change in the blood glucose levels . any discussion of documents , acts , materials , devices , articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention . it is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive .
| 0 |
according to the partial - response concept disclosed in the cited kretzmer patent , a channel having an available bandwidth w is excited at the theoretical maximum signaling rate of 2w symbols per second . where the channel does not have ideal shaping , i . e ., a flat amplitude - frequency characteristic with absolute cutoff at both upper and lower band edges , and a linear phase - frequency characteristic , intersymbol interference necessarily results . accordingly , the channel response to each impulse is dispersed over more than one signaling interval of duration ( 1 /( 2w ) second and a plurality of received samples must ordinarily be correlated in order to recover the original transmitted sequence . as part of the partial - response concept , the channel statistics can be predetermined and controlled in such a way that the channel dispersion can be compensated in advance of transmission by precoding . in the type of partial - response signal shaping that kertzmer has designated class iv the channel is shaped such that its response to each impulse includes two symmetrical nonzero components of opposite polarity spread over three signaling intervals with the center interval having a zero response . this class of partial - response shaping has found favor because its average direct - current component is zero , and the signal spectrum has zero transmission at both band edges without sharp , difficult - to - realize cutoffs . if the channel signal is designated s n at an arbitrary sampling instant n and results from the application of an impulse c n to such channel , then according to the class iv partial - response shaping , the c n components are typically multilevel at n levels and the s n components then have ( 2n - 1 ) levels . the receiver for the signal s n would normally correlate samples taken at alternate signaling intervals . however , c n may advantageously be precoded from another multilevel signal b n by addition of the c n - 2 component thereto . thus , addition modulo - n ( mod n ) signifies casting out multiples of n from the sum and recording only the excess thereover . this is analogous to determining that 3 p . m . is 4 fours after 11 a . m . by substracting n = 12 from the sum of 11 and 4 . if the c n components are derived from some basic signal b n in accordance with equation ( 2 ), then consequently , b n can be decoded at a receiver by a memoryless detector from single samples of the received signal s n . kretzmer disclosed how equations ( 1 ), ( 2 ) and ( 3 ) can be implemented for n = 2 , in which case s n would have three levels . in my cited copending application there is disclosed how these equations can be implemented for n = 2 m , where m is an integer . as long as m is an integer there is a one - to - one correspondence between the n signal levels and integral numbers m of binary digits . unfortunately , for n = 4 seven levels are required on the channel and many practical channels do not possess a low enough signal - to - noise ratio to permit reliable decisions among so many levels . however , it has been determined that five channel levels can be reliably distinguished in widely available telephone carrier channels . five partial - response channel levels assume three coding levels , hereinafter referred to as ternary . ternary coding further presupposes one and one - half binary signal bits per coding level , on the average . this invention is addressed to the implementation of equations ( 1 ), ( 2 ) and ( 3 ) broadly for the case where n is an integer not a power of two and , by way of specific example , where n = 3 . because of the absence of direct correspondence between coding levels and binary inputs partitioning of a binary signaling sequence is required as is explainable in connection with fig2 . line ( a ) of fig2 is diagrammatic of a binary serial bit stream a m of data moving from right to left ( time is increasing to the right ). in each equal signaling interval 0 through m an impulse is generated on one of two logic levels 1 or 0 , which may advantageously be respective positive and negative potentials . these intervals are partitioned into k groups of three with the groups designated by the integer k as shown . for k = 1 , binary intervals 1 , 2 and 3 occur ; for k = 2 , intervals 4 , 5 and 6 ; and for k = k , intervals m - 2 = 3k - 2 , m - 1 = 3k - 1 and m = 3k occur . line ( b ) of fig2 shows a group of equal signaling intervals 0 through n , which are exactly one and one - half times the duration of the intervals on line ( a ), e . g ., interval 1 on line ( b ) is one and one - half times the duration of interval 1 on line ( a ). these intervals are partitioned into k groups of two , in exact correspondence with the k groups of three on line ( a ). for k = 1 intervals 1 and 2 occur ; for k = 2 , intervals 3 and 4 ; and for k = k , intervals n - 1 = 2k - 1 and n = 2k . in each interval a ternary signal will be generated at one of three logic levels 0 , 1 and 2 , which may advantageously be respective negative , zero and positive potential levels . by way of specific example , the triplets of line ( a ) are mapped to the doublets of line ( b ) according to table a . table a______________________________________a . sub . 3k - 2a . sub . 3k - 1 a . sub . 3k b . sub . 2k - 1 b . sub . 2k b . sub . 2k - 1 . sup . 1 b . sub . 2k - 1 . sup . 0 b . sub . 2k . sup . 1 b . sub . 2k . sup . 0______________________________________0 0 0 1 0 0 1 0 00 0 1 1 1 0 1 0 10 1 0 2 1 1 1 0 10 1 1 0 1 0 0 0 11 0 0 2 0 1 1 0 01 0 1 0 0 0 0 0 01 1 0 2 2 1 1 1 11 1 1 0 2 0 0 1 1x x x 1 2 0 1 1 1______________________________________ the first three columns represent the eight possible permutations of binary triplets and the next two columns are the translated ternary doublets . it is seen that there are nine possible ternary pairs , and only eight possible binary triplets . the 1 - 2 ternary pair in the last row ( indicated by x &# 39 ; s ) does not correspond to any binary triplet and therefore is a violation of the selected coding . this pair can only validly occur between ternary groups , a circumstance which will be used to advantage at the receiver to preserve the correct pairwise association of ternary doublets . the coding is entirely arbitrary but is selected to optimize the error performance of the transmission system . since components and circuits for handling binary digits are more readily available than circuits for handling ternary digits , the ternary digits are encoded binary fashion as shown in the last four columns . the columns headed b 2k - 1 1 and b 2k - 1 0 are the binary equivalents of the ternary digits b 2k - 1 , the superscripts 1 and 0 indicating respectively the most and least significant binary digits . similarly , the columns headed b 2k 1 and b 2k 0 are the binary equivalents of ternary digits in the column headed b 2k . the following logic equations summarize the binary coding of the ternary digits : equations ( 4 ) through ( 7 ) are derived by induction from table a . equation ( 8 ) indicates how the ternary digit is the sum of its binary - coded levels . precoding is facilitated by the use of binary - encoded ternary digits as will be more fully discussed in connection with the description of fig4 . fig1 is a block diagram of a complete partial response data transmission system using ternary coding according to this invention . for purposes of specificity it is assumed that the bandwidth of channel 22 is 36 kilohertz , that the channel is of the type used in telephone carrier systems , that the channel signaling rate is 72 kilobauds per second and that the binary signaling rate is 108 kilobits per second . the data transmission system comprises a transmitter including elements 10 through 20 and timing source 37 , transmission channel 22 and a receiver including elements 24 through 36 . the transmitter portion comprises serial binary data source 10 , serial - to - parallel converter 12 , binary - to - ternary converter 14 , precoder 16 , digital - to - analog converter 18 and partial - response filter 20 . data source 10 generates serial binary data under the timing control of timing source 37 by way of lead 38 at the exemplary rate of 108 kilohertz . a representative serial data stream a m is shown on line ( a ) of waveform diagram fig8 . line ( d ) of fig8 shows the serial clock timing ( sct ) stream from timing source 37 . serial data from source 10 is transformed in groups of three to parallel form in converter 12 and the parallel outputs appear on leads 13 as labeled . lines ( a ), ( b ) and ( c ) of fig8 indicate the respective outputs for the representative data stream . binary - to - ternary converter 14 operates on the parallel outputs on leads 13 in accordance with equations ( 4 ) through ( 7 ) to produce binary encoded ternary digits on output leads 15 . the binary encoded equivalents of the representative data stream appear on lines ( g ) through ( j ) of fig8 . lines ( e ) and ( f ) of fig8 show the respective baud ( symbol ) clock timing ( bct ) and bct / 2 waves generated conventionally in timing source 37 . timing source 37 may advantageously include a 432 kilohertz crystal oscillator driving respective divide - by - four and divide - by - six countdown chains to produce the required sct and bct timing waves . precoder 16 operates on the binary - coded ternary digits on leads 15 in accordance with equation ( 2 ) evaluated for n = 3 . precoded ternary digits c n represented by pairs of precoded binary digits c n 1 and c n 0 on parallel output leads 17 [ lines ( n ) and ( o ) of fig8 ] are converted to serial analog form in converter 18 in conventional fashion . precoded binary - coded ternary digits c n thus presented on lead 19 are applied to partial - response filter 20 where , due to the dispersion effect , five - level line signals s n are created . partial - response filter 20 is designed to impart to transmission channel 22 a spectral shaping in accordance with kretzmer &# 39 ; s teachings which is dome - shaped , as shown in his fig2 b . signals c n and s n for the exemplary data sequence are shown on lines ( p ) and ( q ) of fig8 . wave c n is a summation of c n 1 and c n 0 and thus has three levels designated 0 , 1 and 2 . wave s n results from taking the difference of the present c n level and the twice - delayed c n - 2 level in accordance with equation ( 2 ). before turning to the receiver and the block framing problem , specific implementations of blocks 12 , 14 , 16 and 18 of fig1 are discussed . fig3 is a detailed logic diagram of an illustrative embodiment of serial - to - parallel converter 12 and binary - to - ternary converter 14 . serial - to - parallel converter 12 comprises a three - stage shift register having at its input the serial binary data sequence a m on line 11 , an advance lead 38 supplied with sct timing at the 108 kilohertz rate , and output leads 13 from the individual shift register stages . at any given instant three consecutive serial data bits will be stored in the respective shift register stages sr - 1 , sr - 2 and sr - 3 . the bit stored in stage sr - 1 is considered the present bit a m , as represented on line ( a ) of fig8 . stages sr - 2 and sr - 3 store the remaining bits a m - 1 and a m - 2 as shown on lines ( b ) and ( c ) of fig8 . these lines are seen to be identical except for the time difference , so that at times m = 3 , 6 , . . . , 3k three consecutive input digits are in parallel time coincidence for application to binary - to - ternary converter 14 . the sct wave is shown on line ( d ) of fig8 . at the input of converter 14 leads 13 connect through and - gates 40 to a logic matrix . a timing wave bct / 2 at 36 kilohertz , as shown on line ( f ) of fig8 has a positive transition every three bits of the a m data wave . applied to and - gates 40 by way of lead 39 , this timing wave admits samples of the signals on parallel leads 13 to the logic matrix in broken - line box 14 . this matrix implements equations ( 4 ) through ( 7 ) and table a . thus , the outputs of and - gates 40a , 40b and 40c are respectively designated a 3k - 2 , a 3k - 1 and a 3k . specifically , direct data samples and data samples inverted by inverters 41 are applied as shown to further and - gates 43 through 46 and or - gates 42 , 48 and 49 . in addition the outputs of and - gates 46 and or - gate 48 are combined in and - gate 47 . the ultimate outputs on lead pairs 15a and 15b are two binary - coded ternary digits b 2k - 1 and b 2k . these digits are shown in their binary coded forms on lines ( g ) through ( j ) of fig8 . the operation of the logic matrix is straightforward and is readily followed by one skilled in the art . for example , the more significant binary component b 2k 1 of ternary digit b 2k results from the logical summation of binary data digits a 3k - 2 and a 3k - 1 in and - gate 43 , in accordance with equation ( 6 ). similarly , the associated binary component b 2k 0 of ternary digit b 2k appears at the output of or - gate 49 as either the data digit a 3k - 1 ( if it is a 1 ) or the logical summation of the inverted a 3k - 2 data digit and the direct a . sub . 3k data digit , in accordance with equation ( 7 ). the b 2k - 1 digits are derived in accordance with equations ( 4 ) and ( 5 ) in the same way . fig4 is a logic diagram of an illustrative embodiment of precoder 16 and digital - to - analog converter 18 of fig1 . the following table b can be constructed in implementation of equation ( 2 ) and the convention adopted respecting the binary encoding of ternary digits : namely , ternary 0 is represented by the binary digit pair 00 ; ternary 1 , by binary 01 or 10 ; and ternary 2 , by binary 11 . allowing ternary 1 in the precoded digits c n to be represented by both the binary pairs 01 and 10 simplifies the logic . . [. table b______________________________________ternary digits binary digitsb . sub . n c . sub . n - 2 c . sub . m b . sup . 1 . sub . n b . sup . 0 . sub . n c . sup . 1 . sub . n - 2 c . sup . 0 . sub . n - 2 c . sup . 1 . sub . n c . sup . 0 . sub . n______________________________________0 0 0 0 0 0 0 0 00 1 1 0 0 0 1 1 00 1 1 0 0 1 0 0 10 2 2 0 0 1 1 1 11 0 1 0 1 0 0 0 11 1 2 0 1 0 1 1 11 1 2 0 1 1 0 1 11 2 0 0 1 1 1 0 02 0 2 1 1 0 0 1 12 1 0 1 1 0 1 0 02 1 0 1 1 1 0 0 02 2 1 1 1 1 1 1 0 . ]. ______________________________________ table b______________________________________ternary digits binary digitsb . sub . n c . sub . n - 2 c . sub . n b . sub . n . sup . 1 b . sub . n . sup . 0 c . sup . 1 . sub . n - 2 c . sup . 0 . sub . n - 2 c . sub . n . sup . 1 c . sub . n . sup . ______________________________________0 0 0 0 0 0 0 0 00 1 1 0 0 0 1 1 00 1 1 0 0 1 0 0 10 2 2 0 0 1 1 1 11 0 1 0 1 0 0 0 11 1 2 0 1 0 1 1 11 1 2 0 1 1 0 1 11 2 0 0 1 1 1 0 02 0 2 1 1 0 0 1 12 1 0 1 1 0 1 0 02 1 0 1 1 1 0 0 02 2 1 1 1 1 1 1 0______________________________________ the first three columns headed by b n , c n - 2 and c n represent ternary digits . subscript n represents the present digit and subscript n - 2 , the precoded digit which occurred two signaling intervals previously . the columns headed by b n 1 and b n 0 are the respective most and least significant binary digits encoding the ternary digit b n . similarly , the columns headed c n - 2 1 and c n - 2 0 are the binary digits encoding ternary digit c n - 2 ; and the columns headed c n 1 and c n 0 are the binary digits encoding ternary digit c n . it will be noted that rows 2 and 3 , 6 and 7 , and 10 and 11 are duplicates except for the alternate binary encoding of the ternary digit 1 . by standard techniques logic equations can be written row by row for the binary entries in table b wherever a 1 occurs in the c n 1 or c n 0 column . row 2 can be represented as which is interpreted to mean that c n 1 = 1 can result from the logical anding of the complements of b n 1 , b n 0 and c n - 2 1 with the uncomplemented c n - 2 0 . the remaining rows can be similarly represented . thus , for all rows in which c n 1 = 1 , the following logic equation can be written : the encircled plus sign indicates the exclusive - or function by which a 1 output is produced for 01 and 10 inputs and a 0 output otherwise . equation ( 10 ) and ( 12 ) are implemented in straightforward fashion as shown in fig4 in which the four - rail binary inputs are converted to a two - rail condition . equations ( 4 ) through ( 7 ) above are obtained by the same type of inductive analysis . the paired binary - coded ternary digits b 2k - 1 and b 2k appearing on lead pairs 15a and 15b [ lines ( g ) through ( j ) of fig8 ] from the ternary converter of fig3 are applied to and - gates 51a through 51d , which are alternately enabled in pairs by the bct / 2 timing wave on lead 39 [ line ( f ) of fig8 ]. and - gates 51a and 51b are enabled on the down stroke of the timing wave by way of inverter 53g and gates 51c and 51d , on the up stroke . the outputs of and - gates 51a and 51c , containing alternately the b 2k - 1 1 and b 2k 1 digits are combined in or - gate 52a to form the b n 1 digits at the system signaling rate . similarly , the outputs of and - gates 51b and 51d , containing the b 2k - 1 0 and b 2k 1 digits , are combined in or - gate 52b to form the b n 0 digits at the system signaling rate . thus , the outputs of or - gates 52a and 52b contain the binary - coded ternary digits in two - rail serial fashion , as shown on lines ( k ) and ( l ) of fig8 . precoder 16 combines the b n 1 and b n 0 digits in logic fashion according to equations ( 10 ) and ( 12 ) with its own precoder outputs delayed by two system signaling intervals t to form present precoded digits c n 1 and c n 0 , as shown on lines ( n ) and ( o ) of fig8 . precoder 16 illustratively comprises a plurality of and - gates 57 and 59 , or - gates 61 , inverters 53 and 58 , delay units 55 and 56 , and exclusive - or gates 54 as shown in fig4 . the effective inputs to precoder 16 are digits b n 1 , b n 0 , c n - 2 1 and c n - 2 0 . its outputs are c n 1 and c n 0 at or - gates 61a and 61b . and - gate 57a combines inverted digit b n 1 with inverted digit b n 0 . the inverted digits are obtained from inverters 53a and 53b . and - gate 57b combines digits b n 1 and b n 0 as shown . and - gates 57c and 57d similarly combine b n 1 , b n 0 and b n 0 , c n - 2 0 . the b n 1 b n 0 output of gate 57a is combined with the c n - 2 0 digit in and - gate 59a . exclusive - or gates 54a and 54b form the combinations b n 1 ⊕ c n - 2 1 and c n - 2 1 ⊕ c n - 2 0 , respectively . and - gates 59b through 59f operate on their inputs to form the groups b n 1 b n 0 c n - 2 0 , b n 1 b n 0 ( c n - 2 ⊕ c n - 2 0 ), b n 1 b n 0 , b n 0 c n - 2 0 ( b n 1 ⊕ c n - 2 1 ), b n 1 b n 0 c n - 2 1 and b n 1 b n 0 c n - 2 1 , respectively , in a conventional manner . or gate 61a combines the respective outputs of and - gates 59a , 59b and 59c to form binary - precoded digit c n 1 . or - gate 61b similarly combines the respective outputs of and - gates 59d , 59e and 59f to form binary precoded digit c n 0 . the c n 1 and c n 0 outputs are connected by way of leads 62 and 63 to delay units 55 and 56 as shown to furnish the inputs c n - 2 1 and c n - 2 . sup . 0 to the precoder itself . binary coded digits c n 1 and c n 0 from precoder 16 are further combined in linear adder 60 to form the ternary output digit c n on lead 19 . refer to line ( p ) of fig8 for a representative c n wave . the three - level c n wave in the output of adder 60 , by operation of partial - response filter 20 and channel 22 thereon in accordance with equation ( 1 ), becomes the five - level wave s n on line 21 of fig1 . passage through channel 22 also adds noise and distortion to its output on lead 23 . a representative s n wave is shown on line ( q ) of fig8 . this wave is capable of interpretation modulo - three as shown on line ( r ) of fig8 . waves s n and s n ( mod 3 ) are equivalents . positive levels 0 , 1 and 2 are identical in both waves . however , levels (- 1 ) and (- 2 ) in the s n wave become by modulo - three excess levels ( 2 ) and ( 1 ), respectively , in the s n ( mod 3 ) wave . the receiver for the ternary transmission system of this invention operates on the received s n wave to restore the binary encoding , to partition the paired blocks properly and to decode the binary message wave . as shown in fig1 the receiver comprises analog - to - digital converter 24 , ternary converter 26 , block - sync monitor 28 , framing control 36 , multilevel - to - binary converter 29 , timing recovery circuit 34 and binary data sink 30 . the received signal s n may be visualized from the section of an idealized eye pattern shown in fig5 . the eye pattern shown would be formed on an oscilloscope synchronized with the transmission rate of 72 kilobauds per second when a random message wave has successive periods superimposed . diamonds 71 and 72 represent eye openings in which the vertical dimensions indicate amplitude decision margins and horizontal dimensions indicate sampling time margins . for the idealized wave shown sampling times should occur at the centers of the diamonds . for an individual sample the amplitude level would occur on only one of the integrally numbered levels . slicing decision levels are those frictionally designated . analog - to - digital converter 24 , under the control of a sampling wave at 72 kilohertz on lead 33 from timing recovery circuit 34 , is effectively a multilevel slicer . the s n input wave on line 23 is applied in parallel to converter 24 and , by way of lead 32 , to timing recovery circuit 34 . converter 24 first slices the incoming signal about the 0 level designated l 0 in fig5 to determine the polarity of the sample . the wave is then folded by full - wave rectification for example , about the 0 level so that levels - 2 and - 1 are superimposed on levels + 2 and + 1 and sliced again at both the l 1 and l 3 levels . for each slice about the respective levels l 0 , l 1 and l 3 positive or negative outputs are obtained depending on whether the signal sample falls above or below the respective slicing levels . it is apparent that if all three slicers yield logical one outputs level + 2 was received , and if all three slicers yield logical zero outputs level 0 was received . a continuation of this analysis yields the following table c . . [. table c______________________________________slicers received binary codel . sub . n . sup . 0 l . sub . n . sup . 1 l . sub . n . sup . 3 level b . sub . n . sup . 1 b . sub . n . sup . 0______________________________________0 0 0 0 00 1 0 - 1 1 10 1 1 - 2 0 11 0 0 0 0 01 1 0 + 1 0 11 1 1 + 2 1 1 . ]. ______________________________________ table c______________________________________slicers received binary codel . sub . n . sup . 0 l . sub . n . sup . 1 l . sub . n . sup . 3 level b . sub . n . sup . 1 b . sub . n . sup . 0______________________________________0 0 0 0 0 00 1 0 - 1 1 10 1 1 - 2 0 11 0 0 0 0 01 1 0 + 1 0 11 1 1 + 2 1 1______________________________________ equations ( 13 ) and ( 14 ) are implemented in binary - coded ternary converter 26 . the binary digits on leads 27 are monitored in block - sync monitor 28 and are also decoded in multilevel - to - binary converter 29 to yield the original binary data train a m at the transmission rate of 108 kilobits per second for delivery to data sink 30 . block - sync monitor 28 detects the presence of the ternary pair 12 and sends an appropriate signal to framing control 36 . framing control 36 supplies both timing wave scr and framing wave bcr / 2 to binary converter 29 in the correct phase to decode the ternary digit pairs . it compares the occurrence of the violation pair 12 with the phase of the bcr / 2 ( 36 kilohertz ) wave . each time this pair occurs at the wrong phase , i . e ., within a partitioned pair , a counter is advanced . when the counter overflows , the phases of both the bcr / 2 and scr waves are shifted and the ternary pair is repartitioned . the counter avoids changing the timing on every occurrence of the violation pair , since a single occurrence may be due merely to channel noise . fig6 is a more detailed block diagram of an illustrative embodiment of blocks 26 , 28 and 36 on fig1 . the received wave s n on lead 23 is sliced in analog - to - digital converter 24 to yield the outputs l n 0 , l n 1 and l n 3 on leads 25 as previously explained . the bcr wave at 72 kilohertz is recovered in timing recovery circuit 34 from the input wave on lead 32 in a conventional manner by counting down from a master oscillator at 432 kilohertz , for example . this oscillator is also counted down to generate the scr wave at 108 kilohertz . the manner in which the phase of the master oscillator is controlled may , however , be accomplished more precisely as described in the copending application of j . g . kneuer , ser . no . 808 , 130 filed mar . 18 , 1969 . binary - coded ternary converter 26 in fig6 comprises exclusive - or gate 75 , inverter 76 , and and gates 77 , 78 and 79 , which together implement equations ( 13 ) and ( 14 ) in an obvious manner . consecutive binary - coded ternary digits appear on leads 27 and are applied to binary shift register pairs 80 and 81 as shown . these pairs , each containing separate storage cells for most and least significant binary parts of the encoded ternary digits , make available the present and immediately preceding digits simultaneously . these digits are provided on output leads 90 , timed by the bcr wave on lead 95 . proper data recovery requires a proper pairwise association of received ternary digits . the violation pair 12 is encoded in binary form as . [. b n - 0 .]. . iadd . b n - 1 0 . iaddend . = b n 1 = b n 0 = 1 . iadd . and . iaddend . b n - 1 1 = 0 . therefore , the occurrence of this pair can be represented logically by block sync information signal equation ( 15 ) is implemented in a straight - forward manner in broken line block 28 , which comprises inverter 82 and and - gate 83 . gate 83 combines digits b n - 1 0 and b n 1 with inverted digit b n - 1 1 as shown . line ( s ) of fig8 shows the occurrence of the bsi signal for the representative example . the bsi output on lead 84 is applied to framing control 36 , which illustratively comprises as shown in fig6 up - down counter 88 , divider 85 , delay unit 89 and phase control 91 . in addition to the bsi signal on lead 84 block 36 is also supplied with the bcr and scr timing waves on leads 33 and 35 . in operation up - down counter 88 is arranged to count on every occurrence of the bsi signal at input t . the direction of the count is determined by the bcr / 2 wave obtained from divide - by - two circuit 85 . if the bsi input occurs in the positive half - cycle of the bcr / 2 wave , the count is down . if it occurs in the negative half - cycle , the count is up . counter 88 overflows after a chosen number of up - counts without intervening downcounts . the overflow count is selected on consideration of the noise statistics of the channel and , by way of example , may be eight . at the time the overflow count occurs , an output appears on lead 92 which adds a count to divider 85 , thus shifting the phase of bcr / 2 by 180 °. the phase of the scr wave is changed to correspond to the new phase of the bcr / 2 wave by phase control 91 . finally , the counter is reset to a reference state by way of delay unit 89 . the phased scr and bcr / 2 waves are made available on leads 37 and 93 . in fig8 on line ( s ) the left - hand bsi pulse is assumed to cause the overflow occurrence in time with the negative half - cycle of the bcr / 2 wave on line ( t ). the bcr / 2 wave is seen to shift by half a cycle . at the same time the scr wave is shifted correspondingly . the remaining bsi pulses are coincident with the positive half - cycles of the bcr / 2 wave and cause no phase shift therein . the recovered data to the left of the first bsi pulse is seen to be spurious , but that to the right is valid . one function remains to be performed in the receiver and that is the conversion of the binary - encoded ternary digits properly partitioned to the serial binary state . this can be accomplished as shown in the illustrative embodiment of fig7 . ternary - to - binary converter 29 , as expanded in fig7 illustratively comprises input and - gates 96 , logic circuitry including further and - gates 99 , 103 , 104 and 106 ; or - gates 98 , 102 and 105 , and inverters 97 , 100 and 101 ; and shift register 109 . the inputs include two simultaneously available binary - coded ternary digits on lead 90 from fig6 the phased scr wave on lead 37 and the phase - shifted bsr / 2 wave on lead 93 . by analysis of table a the following logic equations can be written for the binary digits a 3k , a 3k - 1 and a 3k - 2 : in equations ( 16 ), ( 17 ) and ( 18 ) n replaces the 2k terms used in table a for simplicity . the binary inputs on leads 90 are admitted to the logic circuitry on the up strokes of the bcr / 2 timing wave on line 93 at the rate of 36 kilohertz . the logic circuitry operates on these inputs to implement equations ( 16 ), ( 17 ) and ( 18 ) in a straightforward manner . the parenthetical term in equation ( 16 ) results from combining the b n 0 digit inverted in inverter 97 with the direct b n - 1 1 digit in or - gate 98 and this resultant is further combined in and - gate 103 with the b n - 1 0 digit as shown to form the desired a 3k output digit . similarly , the parenthetical term in equation ( 17 ) is formed in or - gate 102 by combining the b n - 1 0 digit inverted in inverter 101 with the direct b n - 1 1 digit as shown . this resultant is in turn combined in and - gate 106 with the b n 0 digit to form the desired a 3k - 1 digit . in a similar manner the inverted a 3k - 2 digit defined by equation ( 18 ) is formed by the indicated logical operations in inverter 100 , and - gate 104 , or - gate 105 and and - gate 99 on the respective b n - 1 1 , b n - 1 0 , b n 0 , and b n 1 input digits . in addition , the direct a 3k and a 3k - 2 digits are derived by inverting the outputs of and - gates 103 and 99 in inverters 108 and 107 as shown . the three parallel binary digits a 3k , a 3k - 1 and a 3k - 1 thus derived from the two parallel binary - coded ternary digits are applied simutaneously to the respective stages sr - 4 , sr - 5 and sr - 6 of conventional shift register 109 at the bcr / 2 timing rate . these same digits are advanced from top to bottom of shift register 109 under the advance control of the scr timing wave from lead 37 onto output lead 31 to reconstitute the original serial data train a m . as shown in fig1 this data train is delivered finally to data sink 30 . line ( v ) of fig8 shows the reconstituted representative serial data train . although this invention has been disclosed in terms of a specific embodiment using a particular number of encoding levels and positive logic , it will be readily apparent to those skilled in the art that the principle of the invention is of much wider application .
| 7 |
the following examples illustrate aspects of this invention . they are not intended to limit the invention . modifications of the specific pre - coat compositions , hot melt adhesive materials , tufted carpets and procedures of these examples can be made without departing from the spirit and scope of this invention . this example illustrates a preferred specific embodiment of the composition of this invention , and how to prepare it . nine % of a low density polyethylene in pellet form having a melt index of 150 , and 2 % of a 50 % solution of azidosulfonylhexyl ( triethoxy ) silane (&# 34 ; silane &# 34 ;) in methylene chloride are placed in a tumble drier and tumble dried at ambient temperature for about two hours or until all the methylene chloride is evaporated to provide 10 % of a dry silane - coated polyethylene material . the 10 % dried silane - coated polyethylene material is placed in the hopper of an extruder and melt blended at a temperature of about 131 ° c . for a first pass through the extruder . the melt blended material is collected from the orifice of the extruder and placed in the hopper of the extruder again for a second pass through the extruder at a temperature of 160 ° c . the resulting material is then pelletized with the use of air drying devices instead of the conventional water bath to crystallize the polymer . the use of a water bath is avoided in order to prevent premature moisture - initiated coupling or bonding through the silyl group . in a tank equipped with an agitator and heated with steam at a temperature of about 150 ° c ., a resin blend is prepared by blending 70 . 2 % of a c 5 - c 9 resin having a ring and ball s . pt . of 60 ° c . ; 5 . 4 % polyethylene wax having a melting point of 115 ° c . and a molecular weight of 2000 ; and 14 . 4 % of a naphthenic oil having a specific gravity of 0 . 9000 and an s . u . viscosity at 38 ° c . of 500 sec . the silane - bonded polyethylene pellets ( 10 %) are then added to the tank containing the resin blend and mixed until a homogeneous blend is obtained . this example illustrates another specific embodiment of this invention . the composition is prepared according to the procedure of example 1 . the formulation of the composition is set forth in table i . table i______________________________________components percent______________________________________4 -( azidosulfonyl )- 4 &# 39 ;-( triethoxysilyl ) 10 . 0propyldiphenylether bonded low densitypolyethylene having a melt index of 150 . c . sub . 5 resin ( ring & amp ; ball s . pt . 95 ° c .). 70 . 4naphthenic oil ( sp . grav . 0 . 9000 ; 14 . 2s . u . viscosity at 38 ° c . 500 sec . ) polyethylene wax ( m . pt . 115 ° c .) 5 . 4______________________________________ this example illustrates another embodiment of this invention . the composition is prepared according to example 1 except that 3 -( methyldimethoxysilyl ) propyl azidoformate is used instead of azidosulfonylhexyl ( triethoxy ) silane . this example illustrates another embodiment of this invention . the composition is prepared according to the procedure of example 1 using the formulation of table i except that 3 -( methyldimethoxysilyl ) propyl azidoformate is used instead of 4 -( azidosulfonyl )- 4 &# 39 ;-( triethoxysilyl ) propyldiphenyl ether . this example illustrates another embodiment of this invention . the composition is prepared according to example 1 except that 3 -( trimethoxysilyl ) propyl diazoacetate is used instead of azidosulfonylhexyl ( triethoxy ) silane . this example illustrates another embodiment of this invention . the composition is prepared according to the procedure of example 1 using the formulation of table i except that 3 -( trimethoxysilyl ) propyl diazoacetate is used instead of 4 -( azidosulfonyl )- 4 &# 39 ;-( triethoxysilyl ) propyldiphenyl ether . this example illustrates another embodiment of this invention , and how to prepare it . forty - eight % of the pre - coat composition of example 1 and 22 % of an ethylene - vinyl acetate copolymer having a polymerized vinyl acetate content of 19 %, by weight of the copolymer , are melt blended in a container by aerating at 160 ° c . thirty % of a calcium carbonate filler is then added to the melt blend to provide a hot melt adhesive material . this example shows the tuft bond strength of finished carpets prepared with the precoat composition of this invention and an ethylene - vinyl acetate copolymer - based hot melt adhesive material containing the pre - coat composition of this invention as the backcoat . carpet specimens are prepared according to the procedures of ansi / astm d1335 - 67 using 10 oz ./ yd . 2 of the composition of example 1 as the pre - coat at 155 ° c . and then applying 24 oz ./ yd . 2 of the hot melt adhesive material of example 7 as the backcoat ( test specimen 1 ) and , as the control , 10 oz ./ yd . 2 of the composition of example 1 as the pre - coat and applying 24 oz ./ yd . 2 of the hot melt adhesive material of example 7 as the backcoat , both of which are minus the 10 % silane - coated polyethylene material ( test specimen 2 ). the carpet test specimens were mounted and tested for tuft bond strength according to ansi / astm d1335 - 67 . basically , this test measures the amount of force required to separate individual pile yarns from the carpet . the results of the test are tabulated below : ______________________________________ test specimenstuft bond strength , lbs . 1 2______________________________________initial 17 . 9 15 . 0 7 days 20 . 2 18 . 114 days 23 . 1 17 . 2______________________________________ * stored at 23 ° c . and 50 % relative humidity . this example illustrates another embodiment of this invention . a hot melt adhesive material is prepared according to the procedure of example 7 using 25 % of the pre - coat composition of example 1 except that a c 5 resin is used instead of the c 5 - c 9 resin , 45 % of an amorphous polymer of propylene having a ring & amp ; ball softening point of 150 ° c ., and 30 % of a calcium carbonate filler . this example shows the tuft bond strength of finished carpets prepared with the precoat composition of this invention , and a hot melt adhesive material based on an amorphous polymer of propylene containing the precoat composition of this invention as the backcoat . carpet specimens are prepared according to the procedures of ansi / astm d1335 - 67 using 10 oz ./ yd . 2 of the composition of example 2 as the pre - coat land then applying 24 oz ./ yd . 2 of the hot melt adhesive material of example 9 as the backcoat ( test specimen 3 ) and , as the control , 10 oz ./ yd . 2 of the precoat composition of example 2 as the pre - coat and then applying 24 oz ./ yd . 2 of the hot melt adhesive material of example 9 as the backcoat , both of which are minus the 10 % silane - coated polyethylene material ( test specimen 4 ). the carpet test specimens were mounted and tested for tuft bond strength according to ansi / astm d1335 - 67 . the results of the test are tabulated below : ______________________________________ test specimenstuft bond strength , lbs . 3 4______________________________________initial 17 . 1 15 . 0 7 days 22 . 1 18 . 114 days 24 . 1 17 . 2______________________________________ other features , advantages and specific embodiments of this invention will become apparent to those exercising ordinary skill in the art after reading the foregoing disclosures . such specific embodiments are within the scope of this invention . moreover , while specific embodiments of the invention have been described in considerable detail , it is not limited thereto , and variations and modifications of those embodiments can effected without departing from the spirit and scope of the invention .
| 3 |
in accordance with the invention , cobaltic hydroxide is dissolved to yield cobaltous chloride by contacting a water slurry of cobaltic hydroxide with a sufficient amount of an organic reductant from the group consisting of methanol , formaldehyde , and formic acid to reduce the cobaltic hydroxide and with hydrochloric acid added in the presence of the reductant at a rate such that the solution ph does not decrease below ph 1 . thus , the reaction is carried out with the water slurry of cobaltic oxide hydrate with the addition of the organic reductant prior to or in combination with the hydrochloric acid . preferably , when the organic reductant is added first to the slurry containing cobaltic hydroxide , a closed vessel fitted with a reflux condenser is used to prevent excessive losses of the volatile organic reductant . the reduction reaction from cobaltic to cobaltous ions is temperature dependent and accordingly the initial slurry temperature should be at least about 75 ° c . to obtain adequate reaction kinetics . the dissolution reaction is exothermic with the result that the slurry temperature tends to rise into the region of 90 ° to 95 ° c . dependent upon the addition rate of acid to the reaction mixture . the oxidation of methanol appears to occur in stepwise fashion through formaldehyde to formic acid and followed ultimately by the conversion of the initial methanol to co 2 and water . it is found , however , that even when a large excess of methanol is present the concentration of formic acid and formate during the reduction will be almost below the detection limit for these compounds . upon completion of the reaction involved any excess methanol can readily be recovered and cobalt can be recovered as cobaltous chloride hexahydrate simply by evaporation of excess water . the process of the invention can be used in a cobalt leach - electrowinning loop for the production of electrolytic cobalt using spent cobalt electrowinning electrolyte , hydrochloric acid and methanol to leach cobaltic hydroxide . in such as process , the chlorine evolved in the electrowinning can be used to prepare cobaltic hydroxide from impure cobalt - containing process liquor . materials which may be treated in accordance with the invention may contain , on a dry basis , about 50 % to about 58 % cobalt , up to about 2 % nickel , up to about 2 % iron , up to about 2 % copper , up to about 5 % sulfur . some examples will now be given . a water slurry was prepared by mixing 50 grams of cobaltic hydroxide in 100 milliliters of water . the cobaltic hydroxide contained , by weight , 57 . 6 % cobalt , 0 . 01 % copper , 0 . 43 % nickel , 0 . 11 % iron , 1 . 4 % sulfur , 0 . 18 % chlorine ion , 3 . 61 % sulfate ion , 3 . 08 % water . when this slurry was treated with the hydrochloric acid solution containing hydrochloric acid in the ratio of two moles hcl to each mole of cobalt , in an addition time of one minute , it was found that after three hours of reaction a final ph less than 1 resulted with a cobalt extraction of 56 % and a cobalt concentration in solution of 79 . 3 grams per liter . strong evolution of chlorine gas resulted . a series of similarly prepared cobaltic hydroxide slurries was then treated seriatim with mixtures of hydrochloric acid and methyl alcohol in which the molar ratio of methanol to hydrochloric acid was varied from 0 . 165 to 1 . 2 . the rate of addition of the hcl - methanol mixture was controlled to hold the ph in the reacting slurry above 1 . the initial slurry temperature was 75 ° c . and during reaction the temperature increased to 90 ° c . 0 . 2 milliliters of methanol was added to the slurry just before the first addition of acid - methanol mixture . the slurry was vigorously stirred to contact the reactants . the results of four experiments carried out under the four described conditions are set forth in the following table 1 . the results in the table establish that the presence of methanol not only prevents chlorine evolution but also promotes the extraction of cobalt in solution . a large excess of methanol , however , was required to achieve complete cobalt extraction . this was attributed to the fact that an open reaction vessel was used for the test . table 1__________________________________________________________________________ reagents hcl meoh addition reaction solution co ( mole / ( mole / time time final co extractiontest mole co ) mole co ) ( min ) ( min ) ph ( g / l ) (%) __________________________________________________________________________1 2 0 . 33 62 120 0 . 95 118 832 2 0 . 66 16 35 1 . 5 130 923 2 1 . 00 12 20 1 . 5 132 944 2 2 . 40 5 180 2 . 0 142 100__________________________________________________________________________ a slurry was prepared containing 400 grams of cobalt hydroxide cake assaying 50 % by weight cobalt in 0 . 5 liters of water in an open beaker . the slurry was reacted at 60 ° c . with a formaldehyde - hydrochloric acid mixture added continuously at a rate corresponding to 40 milliliters of 37 % formaldehyde solution and 80 milliliters of 12 normal hydrochloric acid per hour . a virtually clear leach solution was obtained after seven hours of reaction and the extraction of cobalt was 98 %. the ph of the leach solution was 1 . 75 with a cobalt concentration in solution 170 grams per liter as cobaltous chloride . the consumptions of hcl and formaldehyde were , respectively , two moles of hcl and one mole of formaldehyde per mole of the cobalt leached . another 400 gram sample of cobalt hydroxide cake which had been dried at 150 ° c . for 16 hours and had a particle size of less than - 200 mesh , assaying 50 % by weight cobalt was slurried with 0 . 5 liters of water in a glass reaction vessel open to the atmosphere through a reflux condenser . 40 milliliters of a 95 % by weight methanol solution were added to the slurry representing 200 % stoichiometric excess of methyl alcohol with respect to reduction of the feed trivalent cobalt to divalent cobalt . the slurry was heated to 80 ° c . and 12 normal hydrochloric acid solution was added on ph demand at ph setting of 2 . after nine hours of reaction the extraction of cobalt in solution was 81 % complete at a concentration in solution of 162 grams per liter . 200 grams of cobalt hydroxide cake assaying 50 % by weight cobalt were slurried with 0 . 5 liters of water in a glass reactor open to the atmosphere through a reflux condenser . 40 milliliters of a 95 % by weight methanol solution were added to the slurry representing 400 % stoichiometric excess of methanol for reduction of the feed trivalent cobalt to divalent cobalt . the slurry was heated to 90 ° c . and a 12 normal hcl solution was added on ph demand at a ph setting of 1 . 5 . after four hours of reaction at 90 ° c . the extraction of cobalt in solution was 96 % at a concentration in solution of 130 grams of cobalt per liter . the experiment described in example 3 was repeated and continued by adding to the reaction mixture 10 milliliters of a 98 % by weight formic acid solution and the reaction was then continued for 6 hours at 80 ° c . with addition of 12 normal hcl on ph demand at a ph setting of 2 . at this point the extraction of cobalt in solution was 95 % at a concentration of 172 grams of cobalt per liter . the experiment described in example 4 was repeated and continued by adding to the reaction mixture 10 milliliters of 98 % by weight formic acid solution and the reaction continued for two hours at 90 ° c . with a 12 normal hcl solution being added upon ph demand at a ph setting of 1 . 5 . the extraction of cobalt in solution was 98 . 5 % complete at a concentration of 133 grams per liter of cobalt . cobalt chloride leach solutions obtained in examples 3 and 6 were evaporated at 105 ° c . until the cobalt concentration in solution was approximately 400 grams per liter . the concentrated solutions were then slowly cooled while being stirred at 1 , 000 rpm . crystallization of 60 to 70 % of the cobalt as cobaltous chloride hexahydrate onto the walls of the container occurred . the solids were recovered after filtering and drying in air . analyses of the feed cobaltic hydroxide and of the cobaltous chloride hexahydrate resulting are shown in the following table 2 . table 2______________________________________ methanol andmethanol leach formic acid leachexample 4 example 6 feed * feed * co ( oh ). sub . 3 cocl . sub . 2 6h . sub . 2 o co ( oh ). sub . 3 cocl . sub . 2 6h . sub . 2 oelement ( wt . %) ( wt . %) ( wt . %) ( wt . %) ______________________________________co 25 . 3 25 . 3 27 . 1 27 . 1ni 0 . 42 0 . 29 0 . 17 0 . 11cu 0 . 003 0 . 0004 0 . 006 0 . 0012pb 0 . 004 0 . 001 0 . 0003 0 . 001fe 0 . 060 0 . 001 0 . 035 0 . 009ca -- 0 . 004 -- 0 . 001mg -- 0 . 0004 -- 0 . 0002na 0 . 60 0 . 049 0 . 014 0 . 002mn 0 . 011 0 . 003 0 . 007 0 . 003s -- 0 . 56 -- 0 . 069c -- 0 . 12 -- -- ______________________________________ note : composition of co ( oh ). sub . 3 feed cakes are referred to the same co as the cocl . sub . 2 . 6h . sub . 2 o product for sake of comparison . wet co ( oh ). sub . 3 cake usually assays 25 % co ; dried co ( oh ). sub . 3 assays 50 % co . while the process has been described hereinbefore through the use of methanol , formaldehyde and formic acid as the organic reductant the equivalence of ethanol and its oxidation products has been recognized in the art . in fact the equivalence of alcohols containing up to four carbon atoms and their oxidation products has already been recognized in the art , to that of methanol as a reductant for cobaltic ion . however , methanol , formaldehyde and formic acid are the preferred ingredients for purposes of reducing cobaltic ion , with the overall dissolution reactions believed to be as follows , respectively : 1 . 6 co ( oh ) 3 + 12hcl + ch 3 oh 6 cocl 2 + co 2 + 17 h 2 o 2 . 4 co ( oh ) 3 + 8hcl + ch 2 o 4 cocl 2 + co 2 + 11 h 2 0 3 . 2 co ( oh ) 3 + 4hcl + hcooh 2 cocl 2 + co 2 + 6 h 2 o although the present invention has been described in conjunction with preferred embodiments , it is to be understood that modifications and variations may be resorted to without departing from the spirit and scope of the invention , as those skilled in the art will readily understand . such modifications and variations are considered to be within the purview and scope of the invention and appended claims .
| 2 |
the ndo enzyme consists of three polypeptides : a reductase polypeptide ( rd , molecular weight about 37 , 000 ), an iron - sulfur ferredoxin polypeptide ( fd , molecular weight about 13 , 000 ) and a terminal oxygenase iron - sulfur protein ( isp ) that contains two subunits with an α 2 β 2 subunit structure ( molecular weights : α about 55 , 000 , β about 21 , 000 ). in substrate binding studies , isp binds to naphthalene and the reduction of this enzyme - substrate complex by nadh in the presence of rd , fd and oxygen results in the conversion of isp - bound naphthalene to cis - naphthalene dihydrodiol . the naphthalene oxidation limiting polypeptide was identified by adding the cell extract from cells expressing only one polypeptide encoded by a single ndo gene to the cell extract of a cell expressing all three polypeptides . three plasmids , each containing an isolated gene encoding one of three polypeptides of the ndo enzyme , were constructed . the constructions of the three plasmids , were done using recombinant techniques known to those skilled in the art . general methods used in the isolation of dna , the cleavage of dna with restriction enzymes , the construction of recombinant plasmids and the introduction of the recombinant plasmids into microbial host cells are known in the art and are described in many publications including maniatis et al ., molecular cloning -- a laboratory manual , cold spring harbor laboratory , chapters 3 , 4 , 5 , 8 , 11 and 12 ( 1982 ) and current protocols in molecular biology , edited by ausubel et al ., greene publishing associates and wiley interscience , chapters 1 , 2 and 3 ( 1987 ). all dna modifying enzymes used in the examples and experiments described below were purchased from bethesda research laboratories , gainesburg , md . or new england biolabs , beverly , mass . the organism , p . putida g7 , contains a plasmid designated as nah7 which was the source of dna for the constructs described below . the nah7 plasmid is involved in naphthalene degradation and is described in u . s . pat . no . 4 , 520 , 103 . the dna sequence of nah7 encoding the ndo enzyme system ( the naha gene ) was cloned by ensley et al ., science , 222 : 167 ( 1983 ) and subsequently sequenced . about 3500 base pairs ( bp ) of this dna sequence encode all of the ndo proteins . the genes encoding these proteins are clustered and sequentially located on the plasmid . the starting material for the construction of the pacl plasmid was the pcfm526 plasmid . the construction of the pcfm526 plasmid was described in u . s . pat . no . 4 , 710 , 473 . the pacl plasmid was derived from pcfm526 by substituting a dna sequence containing a synthetic p l promoter and a ribosome binding site between the unique aatii and clai restriction sites for the original dna sequence of pcfm526 . the substitution was performed by digesting pcfm526 with aatii and clai , isolating the resulting 4000 bp fragment from agarose gel and ligating the fragment with the following oligonucleotide : ## str1 ## the pacl plasmid thus contained a p l promoter as well as the other sequences of pcfm526 including a heat - inducible promoter , a restriction site bank cloning cluster , a plasmid origin of replication , a transcription terminator , genes regulating plasmid copy number , and a gene conferring ampicillin resistance . the following procedures were used to isolate and clone the three genes encoding the three polypeptides of the naphthalene dioxygenase enzyme . the gene encoding the isp polypeptide was a 2500 bp fragment of nah7 dna which was isolated and cloned into the publicly available plasmid puc9 to construct plasmid isp - pea2 , as shown in fig1 . plasmid isp - pea2 was then transformed into e . coli strain jm105 as described by ensley et al ., microbial metabolism and the carbon cycle , edited by hagedorn et al ., harwood academic publishers , pp . 437 - 455 ( 1988 ). the gene encoding the rd polypeptide of the ndo enzyme system was cloned into pacl by digesting the pror / sac plasmid , described below , with xhoi , removing the xhoi / xhoi fragment and religating the plasmid to itself . the resulting construction eliminated about 2200 bp of the pror / sac plasmid dna but retained all of the rd gene and was designated as rd - pacl . plasmid rd - pacl was also transformed into e . coli strain fm5 . in order to prepare a plasmid containing only the fd gene , the pror / sac plasmid was digested with kpni to eliminate the region containing the isp gene and the digested plasmid was isolated from an agarose gel . this was followed by a religation step to construct a plasmid designated pror / kpn . this construct was digested with clai and bamhi to release about a 1500 bp fragment containing both the rd and the fd genes . this fragment was further digested with ddei to generate a 343 bp fragment spanning the ddei and kpni restriction sites . the ddei site is 10 bp upstream of the initiation codon of fd while the kpni is 3 bp downstream of the termination codon of fd . the sticky end of the ddei site was blunt - ended using s1 nuclease and cloned into a blunt - ended ecori site of the pacl plasmid . the kpni sites of both the fd gene and pacl were kept intact for proper ligation . this construct containing the fd gene was designated as fd - pacl . plasmid fd - pacl was transformed into e . coli strap in fm5 . the transformed cells were cultured and grown under standard conditions . shaker flask experiments were performed using 500 ml of difco brain heart infusion ( bhi ) broth . cells were grown to an optical density of 0 . 5 ( 600 nm ) at 30 ° c . followed by a three hour incubation period at 42 ° c . at the end of three hours at 42 ° c ., the incubation was continued at 30 ° c . for six hours with the addition of indole at a rate of 100 mg / liter / h . cell extracts were prepared as described by ensley et al ., j . bacteriol ., 155 : 505 ( 1983 ). briefly , cells were resuspended ( 1 g wet weight cells per 2 ml buffer ) in 50 mm tris buffer , ph 7 . 8 , containing 10 % glycerol , 10 % ethanol and 0 . 5 mm dithiothreitol ( teg buffer ). the cells were disrupted by two passages through a french pressure cell at 7 , 000 lb / in 2 at 4 ° c . and the resulting mixture was centrifuged for one hour to give a supernatant crude cell extract . crude cell extracts prepared from the combined extracts of all three transformed cell lines reconstituted the ndo activity in indole - exposed cells . the ndo activity of the cell extracts was monitored using a standard procedure . samples of cells were removed from the growth medium and diluted in luria broth which gave a cell density measured by absorbance at 550 nm of approximately 0 . 25 . this corresponded to a whole cell protein concentration of approximately 0 . 05 mg / ml . a 0 . 5 ml aliquot of the diluted cell suspension was transferred to a small test tube , and the suspension was allowed to equilibrate at room temperature for five minutes . the assay reaction was started by the addition of 50 nmoles of 14 c - naphthalene dissolved in 5 μl of dimethylformamide . the specific activity of the naphthalene was generally between 5 , 000 and 10 , 000 counts / min / nmole . the reaction was allowed to proceed for five minutes with occasional vortex mixing . after five minutes , a 20 μl aliquot of the mixture was removed and spotted on a section of a thin layer chromatography plate . residual naphthalene in the reaction mixture was removed by drying the plate under a stream of air at room temperature for about thirty minutes . the volatile , labelled naphthalene was removed by the stream of air while any naphthalene metabolites produced during the ndo mediated reaction were non - volatile and remained on the plate . the amount of non - volatile 14 c - naphthalene metabolites on the plate were measured by liquid scintillation counting . the assay reaction using radio labelled naphthalene is proportional to the capacity of the enzyme to react with the indole . experiments using crude cell extracts from the clones containing isolated ndo polypeptides and those prepared from indole - exposed cells indicated the fd component to be the most metabolite - limiting polypeptide . this was demonstrated by adding increasing amounts of crude cell extracts , approximately 20 mg / ml of total protein prepared from each clone , to the extract prepared from induced host strain fm5 transformed with all three ndo genes six hours after indole addition . the data compiled in table 1 indicates there was a 2 . 5 - fold increase in activity with the addition of the fd polypeptide to the six hour crude extract . as used herein , the phrase &# 34 ; enhanced naphthalene dioxygenase activity &# 34 ; refers to a time related increase in the naphthalene dioxygenase enzymatic activity of a cell extract produced in a host strain in accordance with this invention as compared to the naphthalene dioxygenase enzymatic activity of a standard cell extract . the comparative standard cell extract is the cell extract of a host strain transformed with a dna sequence encoding a naphthalene dioxygenase enzyme as described in u . s . pat . no . 4 , 520 , 103 . table 1______________________________________ndo activity in 6 hour cellular extractndo activity ( cpm ) ______________________________________ added rd ( μl extract ) 4100 03500 22200 61800 101750 20 added fd ( μl extract ) 4700 08000 29800 511000 1011900 1512500 20 added isp ( μl extract ) 4100 05100 25000 54900 105900 155800 20______________________________________ the following examples are illustrative of particular embodiments of the invention . example 1 describes adding multiple copies of the fd gene to a transformed cell . example 2 describes culturing cells transformed with the ndo genes in the presence of iron . example 3 describes site selective mutation of the fd gene . the generation of a dna sequence containing multiple copies of the ferredoxin gene enhanced ndo activity and was constructed using a three step sequence to give the fd - 911 plasmid . the pror / sac plasmid was constructed from the plasmid pn1816 . the pn1816 plasmid , shown in fig2 was constructed by initially isolating a 5500 bp pvuii to bglii fragment of nah7 dna containing the ndo genes . this fragment was cloned into the hpai - and bamhi - digested pacl plasmid . in addition to the naha genes encoding the ndo polypeptides , the 5500 bp fragment of nah7 dna contained approximately 800 bp of pseudomonas dna upstream from the ndo genes and the nahb gene encoding cis - naphthalene dihydrodiol dehydrogenase downstream from the naha genes . to delete the nahb gene from the pn1816 plasmid , the sacii site located 30 bp downstream from the isp gene was used to generate the pror / sac construct , shown in fig2 . the pn1816 plasmid was partially digested with sacii , and the resulting restriction site sticky ends were blunted using klenow treatment . the dna was then digested with ecori releasing a 4300 bp fragment containing the naha genes . this 4300 bp dna fragment was cloned into the pacl plasmid between the ecori and hpai restriction sites creating a plasmid construct designated pror / sac . the pror / sac plasmid was transformed into e . coli strain fm5 , a host organism used for regulation of the p l expression system . the host organism , fm5 , was deposited with the american type culture collection , rockville , md . on may 19 , 1989 and was designated a . t . c . c . no . 53911 . the next step of the construction required modifying the 5 &# 39 ; end of the ndo gene to give the fd - pacl plasmid . about 800 bp of dna of unknown function in front of the rd gene in the pror / sac plasmid was deleted to give the 911 - pacl plasmid , shown in fig2 . a previously constructed plasmid , atg # 6 , containing an ssti site in front of the rd start - site was utilized to design the construct designated 911 - pacl . atg # 6 plasmid was constructed by initially digesting pror / sac with ecori and hindiii and cloning this fragment into similarly digested and commercially available m13mp11 . an ssti site was generated by site - directed mutagenesis at amino acid positions 2 and 3 of the rd gene without altering the amino acids at these positions . the nah genes including the mutation were removed from m13mp11 as an approximately 3500 bp fragment by digestion with ssti and hindiii and the ssti / hindiii fragment was cloned into paci that had been digested with ecori and hindiii along with an oligomer linker ( aattcaggaggaataacatatggagctc ) having an ecori and ssti sticky ends to give the atg # 6 plasmid . to construct the 911 - pacl plasmid , the atg # 6 plasmid was digested with ssti and hindiii and the nah gene insert removed from m13mp11 was ligated into hindiii and xbai digested pacl along with the linker ( ctagatggagct ) containing xbai and ssti sticky ends to give the 911 - pacl plasmid . the synthetic oligomer linker contained the initiation codon of rd and allowed proper spacing between the rd gene and the pacl plasmid . an additional copy of the fd gene was inserted in front of the cassette containing all of the ndo genes in the 911 - pacl plasmid . this construct was designated as fd - 911 , as shown in fig2 . the fd - pacl plasmid was digested with kpni and blunted with klenow treatment . this dna was further digested with hindiii . the 911 - pacl plasmid was first digested with clai and blunted with klenow treatment . the 911 - pacl plasmid was further digested with hindiii releasing a 3550 bp dna fragment containing all four genes . this 3550 bp dna fragment was isolated by agarose gel electrophoresis and ligated into the kpni blunted / hindiii digested fd - pacl plasmid to give the desired gene construct , the fd - 911 plasmid . the data in table 2 indicates the result of shaker flask experiments using strain fm5 transformed with the fd - 911 plasmid and shows enhanced ndo activity . table 2______________________________________ndo activity with plasmid fd - 911 time ( hours afterndo activity ( cpm ) heat induction ) ______________________________________5600 65700 84000 102000 12 100 21______________________________________ the addition of iron to cell culture broth has been reported to have little stimulating effect on ndo activity , see e . g ., ensley et al ., j . bacteriol ., 149 : 948 ( 1982 ). however , iron , by as yet an unknown mechanism , yields a significant effect in increasing the ndo activity during indigo production by the same enzyme . based on the results of crude cell extract studies , experiments were initiated to test the effect of iron supplementation on ndo activity using whole cells . increasing feso 4 . 7h 2 o concentrations were tested in bhi medium using e . coli fm5 transformed with pror / sac as the production strain . results obtained from shaker flask experiments , in which the medium was supplemented with iron confirmed this observation . the data shown in table 3 indicates higher concentrations of feso 4 . 7h 2 o increased ndo activity in cell extracts . table 3______________________________________ndo activity in cell extracts time ( hours after ndo activity ( cpm ) heat induction ) ______________________________________no iron 2000 6 1000 8 400 11added iron 2100 6 2000 8 1800 11______________________________________ the data in table 3 indicates ndo activity typically decreases both after indole feed and during indigo production . however , supplementing the crude cell extract with 0 . 3 μmol feso 4 . 7h 2 o maintained the ndo activity in both the 8 and 11 hour crude extracts to nearly normal levels . table 4 indicates the approximate saturating levels of added feso 4 . 7h 2 o . a total of 1 . 8 g / l or 3 . 6 g / l of feso 4 . 7h 2 o was added with 0 . 6 g / l of indole over a 6 hour period following induction . approximately 70 % and 50 % of the original activity remained after 6 and 10 hours following indole feed , respectively . table 4______________________________________ndo activity with plasmid pror / sac and iron time ( hours after ndo activity ( cpm ) heat induction ) ______________________________________no 9000 6feso . sub . 4 . 7h . sub . 2 o 5000 8 2000 10 1750 12 200 211 . 8 g / l 9000 6feso . sub . 4 . 7h . sub . 2 o 12000 8 9100 10 6300 12 200 213 . 6 g / l 9000 6feso . sub . 4 . 7h . sub . 2 o 12000 8 9100 10 6200 12 200 21______________________________________ additional experiments also showed the ndo activity may be enhanced by adding iron to the culture broth used to grow cells transformed with a dna sequence encoding an extra copy of the fd gene , exemplified by the fd - 911 plasmid , and to grow cells transformed with a dna sequence encoding a ferredoxin analog , as exemplified by the fd - 911abc plasmid . when the bhi medium was supplemented with iron during indole feed , ndo activity was retained for extended periods . the supporting data is compiled in table 5 . the results of the experiments in this example show ndo activity may be significantly enhanced by the addition of iron to the crude extracts or to the growth medium . table 5______________________________________ndo activity with plasmid fd - paclabc and fd - 911 time ( hours after ndo activity ( cpm ) heat induction ) ______________________________________plasmid fd - 911abc 8000 6and 1 . 8 g / l 11000 8feso . sub . 4 . 7h . sub . 2 o 12000 10 12250 12 1800 21plasmid fd - 911 5600 6and 1 . 8 g / l 8000 8feso . sub . 4 . 7h . sub . 2 o 9250 10 8000 12 3750 21______________________________________ a ferredoxin gene derivative modified by site - directed mutation also enhanced ndo activity . the change in the amino acid sequence at position 47 from his to cys made this position in consensus with about 23 other ferredoxin sequences reported in the literature . the change in the amino acid sequence at position 52 from met to ile eliminated the sulfur group found in the met while keeping the charge at that position similar to the naturally occurring amino acid . the change in the amino acid sequence at position 67 from his to arg eliminated the his at this position and replaced it with an amino acid having similar properties . these changes in the ferredoxin polypeptide resulted in increased ndo activity . the fd gene was changed to give different amino acids in the amino acid sequence at positions 47 , 52 , and 67 . these changes were his to cys , met to ile and his to arg , respectively . the oligomers used to make these mutations are shown below . site - specific changes are underlined . ______________________________________ amino acid geneoligomer change designation______________________________________ ## str2 ## hiscys a ## str3 ## metile b ## str4 ## hisarg c______________________________________ the fd - pacl plasmid was digested with xbai and hindiii and the resulting 345 bp fragment was cloned into plasmid m13mp11 , commercially available from new england biolabs , beverly , mass . the changes to the three dna sequences by site - directed mutagenesis were performed by essentially following known procedures described in current protocols in molecular biology , edited by ausubel et al ., greene publishing associates and wiley interscience , chapter 8 ( 1987 ). after mutagenesis , the mutated fd gene was removed from the m13mp11 plasmid by digestion with xbai and hindiii sites . this mutated fd gene was cloned into the pacl plasmid digested with xbai and hindiii to give the new plasmid , fd - paclabc . the fd - paclabc plasmid was then treated as described above in the construction of the fd - 911 plasmid to construct a plasmid designated fd - 911abc . the data showing extended ndo activity in a strain carrying the fd - 911abc plasmid is compiled in table 5 , discussed above . while the present invention has been described in terms of specific methods and compositions , it is understood that variations and modifications will occur to those skilled in the art upon consideration of the present invention . accordingly , it is intended in the appended claims to cover all such equivalent variations which come within the scope of the invention as claimed .
| 2 |
i have found that in general , the abnormal cells and tissues in the body have free lipids . thus , a lipid or compound having a lipidic character introduced into the body can be selectively taken by the abnormal cells . accordingly , it is believed that a potassium compound having lipidic properties is useful as a therapeutic agent for patients who have such abnormal cells . i have found that potassium can be incorporated in the molecule of a fatty acid by heating together an organic or inorganic salt of potassium with a fatty acid or its oil . preferably , the fatty acid or oil is previously oxidized by being heated and mixed with air or oxygen . the mixtures of potassium and fatty acids or oil are heated at a temperature above about 230 ° c . for a time until an exothermic reaction is observed , which reaction indicates that the incorporation is taking place . examples of the potassium / fatty acid or oil compositions that can be used according to the invention include the reaction products of allylic unsaturated fatty acids or esters and a potassium salt . these reaction products are produced by heating a liquid composition containing a fatty acid or fatty ester , structurally characterized by allylic unsaturation with a potassium salt . applicant believes that any potassium salt may be used in this invention . preferably , the potassium salt is an organic potassium salt such as potassium acetate or potassium carbonate , and the liquid is preferably oxidized for example , by bubbling air or oxygen through the reaction mixture . the allylically unsaturated compound is preferably a naturally occurring oil containing polyunsaturated fatty esters , such as an animal , vegetable , or fish oil , and , particularly , polyunsaturated vegetable oils . sesame oil , a vegetable oil consisting largely of triglycerides , is the most advantageous composition found to date in the practice of this invention . the composition utilized should contain a significant percentage of molecular species having allylic moieties to render the compositions useful according to the invention . such moieties are indicated by the following partial structures -- ch ═ ch -- ch 2 -- ch ═ ch -- and / or -- ch ═ ch -- ch ═ ch -- ch 2 --. as indicated , the unsaturation can be conjugated or nonconjugated , but the composition must contain allylic methylene hydrogen . such compositions may initially be oxidized or heated in the presence of air or oxygen at the temperature range between about 100 ° c . and about 150 ° c . the oxygen can be obtained by merely heating the composition in a vessel which is open to the atmosphere , but preferably and advantageously , the source of oxygen is a gas such as air which is injected into the heated oil . introduction of air also provides a source of agitation . the heating step is conducted for a period of from about 15 minutes to about two hours . the temperature should be maintained at an upper limit within the range of about 230 ° c . to 250 ° c ., and preferably about 235 ° c . to 240 ° c . these temperature limitations are based on a heating time of about one - half hour . the temperatures can be altered within limits depending on the time of heating . for example , when the temperature is about 235 ° c ., the time is about one - half hour , while temperatures as high as 250 ° c . require a shorter period of time for heating . higher temperatures for a prolonged period of time tend to degrade the composition and should thus be avoided . agitation , by stirring for example , aids in the reaction , and experiments to date indicate that a fairly violent stirring is advantageous . the introduction of air into the mixture during the heating is also very advantageous , particularly when the mixture is not subjected to prolonged heating and thus , is the preferred method . the mixing or stirring can be accomplished with the introduction of the air . after the reaction has taken place , the mixture is cooled . the remaining fluid is ready for use after appropriate sterilization for injection or incorporated into capsules , such as gelatin , for oral administration . the precise nature of the compositions which result from the above - described treatment or the identity of the effective component or components is not presently known . it is known , however , that these compositions do include potassium and that a proportion of potassium in the range of about 1 to 10 weight percent has been found to be effective . as mentioned above , although any potassium salt may be used , an organic salt of potassium , such as potassium carbonate or potassium acetate , is preferred , with the potassium bonding the eleostearic acid present in this oil . although any amount above 0 . 1 % of potassium incorporated into the composition is useful , the preferred amount ranges between about 1 to 10 weight percent . the products obtained have the potassium incorporated in general at the level of the double bonds of the different unsaturated fatty acids , this causes their toxicity to be exceptionally low . the injection of 1 ml of a product having 5 % potassium to a mouse does not kill it . the incorporated potassium composition may be administered orally , by injections , sublingually or rectally in the appropriate formulation . the incorporated potassium is believed to be absorbed by the abnormal cells , thus compensating for their low potassium content . this treatment produces objective and subjective improvement in the conditions , of patients having a variety of diseases based upon such abnormal cells . the neoplastic diseases are examples of diseased in which low cellular potassium abnormal cells are found . such low cellular potassium abnormal cells are believed to cause an catabolic imbalance in the body . this catabolic imbalance can be analyzed and diagnosed by blood and urine analyses . a low eosinophilia ( below 100 / cmm ), a high red cell sedimentation rate ( above 15 ml / 1 hour ), a high serum potassium ( above 4 . 5 meq ), a urinary acid ph ( below 7 ), high specific gravity ( above 1 . 016 ), low surface tension ( below 89 dynes / cm ), and low calcium or chloride excretion are indications of an catabolic imbalance . ( the opposite analyses would indicate a anabolic imbalance .) these analyses and clinical manifestations have to be changed by the administration of the incorporated potassium compound . in a 5 % potassium incorporated preparation , amounts from about 1 / 10 to 2 ml daily are predilectly used for the treatment of this catabolic imbalance . for other conditions with anabolic imbalances , doses from about 2 to 10 ml daily are predilectly used . in general the higher the dose used , the better are the clinical results . interesting results are those concerning pain , the changes induced in the lesions manifesting first an action upon pain . manifest changes in the tumors and in the subjective manifestations of the neoplastic diseases are obtained even in a very short time . thus , the incorporated potassium appears as a predilect treatment of the symptoms of neoplastic conditions , and possibly to the treatment of such condition themselves . good results were also obtained in the use of the incorporated potassium compounds for the different manifestations of aids ( acquired immune deficiency syndrome ) as well as for the arc ( aids related complex ). interesting also are the results in almost all the different conditions , such as neurological conditions , epilepsy and others , the problem of cellular potassium deficiency being a general pathological occurrence . interesting is the action of the lipidic potassium products on the viral infections . the incorporated potassium composition may be administered together with different other agents . while it is apparent that the invention herein disclosed is well calculated to fulfill the objects above stated , it will be appreciated that numerous modifications and embodiments may be devised by those skilled in the art , and it is intended that the appended claims cover all such modifications and embodiments as fall within the true spirit and scope of the present invention .
| 0 |
the apparatus of the invention is illustrated schematically in fig1 and its actual implementation in practice will be described as required . a trough 10 conveys the molten metal 12 to be tested from the furnaces in which it has been melted to subsequent treatment stages such as a degasser , filter bed and caster . alternatively for an off - line test which is not illustrated , a sample of about 2 kg of the metal would be transferred as quickly as possible from a holding furnace or transfer trough to a stirred test vessel heated as required to maintain the metal in molten condition . in accordance with the invention , the cleanliness of the molten metal , either in the flowing stream or in the stationary test vessel , can then be examined by drawing a sample , by means of reduced pressure , into a sample - receiving test container or vessel 14 which is removably mounted by any suitable means in an end cap 16 . the end cap is mounted by a standard 18 for vertical up and down movement , so that the test vessel 14 can be dipped at will into the flowing stream 12 and withdrawn therefrom . the end cap has four electrodes protruding downwardly therefrom , three of which are inside the container . the first of these three electrodes is a current - carrying electrode 20 consisting of a metal rod the upper part of which is encased in an insulating material 22 , so that only the exposed lower tip 24 immediately adjacent to a passage 26 in the container wall is in electrical contact with molten metal that enters the container . a similar current - carrying electrode 28 is mounted by the end cap so as to extend outside the container parallel to the first electrode 20 with its bare lower tip also immediately adjacent to the passage 26 . the resultant current path between the electrodes 20 and 28 and through the passage 26 is supplied with current from a battery 30 via a ballast resistor 32 that can be shunted when required by a switch 33 , one of the leads including a switch 31 and an ammeter 34 . the end cap 16 also provides a fluid connection from the interior of the test container to a three - way valve 36 , which permits the interior to be connected alternatively to a source of reduced pressure , or to a source of a suitable shielding inert gas , such as argon , or to the atmosphere . the reduced pressure source consists of a reservoir 38 which is exhausted as required in between tests through valve 39 by a pump 40 . the pump is shut off while the tests are underway , so that any electrical noise produced by its electric motor does not hinder electrical signal processing , and so that any pulsations in flow of the evacuating gas are not transmitted to the entering molten metal . the two electrodes 20 and 28 are connected to a differential amplifier 42 and thence to a logarithmic amplifier 44 , a peak detector 46 and multi - channel analyser 48 , which can also serve as a recorder . the analyser / recorder 48 is operated automatically so as to be switched on when sufficient metal has entered the container to contact the lower level electrode 50 of a metal level detector 52 , and to be switched off when sufficient metal has entered the sample - receiving vessel to contact the upper level detection electrode 54 of the level detector . alternatively the analyser recorder can be operated manually , the sampling period used then being a fixed period of time as set by the operator . before use the interior of the container 14 is flushed with argon gas to avoid as much as possible contamination of the metal by air . the container is then lowered into the stream , and the valve 36 is operated to connect the container interior to the reduced pressure reservoir , whereupon the molten metal is drawn smoothly and rapidly through the passage 26 . as soon as enough metal has entered the container to touch the tip 24 of the electrode 20 a current path is established between the two electrodes 20 and 28 and through the passage . the current flow is principally controlled by the ballast resistor 32 and this remains sufficiently constant ( less than 1 % variation ) during signal processing . since the area of contact between the liquid metal 12 and the electrodes 20 and 28 is limited to the tips 24 and 29 , the only changes in voltage that are measured are those arising from the displacement of conducting fluid by particles passing through the passage 26 . each of these particles when sensed produces a record as illustrated by fig5 consisting of a positive voltage pulse 50 over and above the steady state value . thus , as each particle passes through the passage 26 it displaces its own volume of the liquid metal and causes a change in the electrical resistance between electrodes 20 and 28 . in the presence of an applied current , this resistance change causes the above - described transient voltage pulse to appear between the two electrodes 20 and 28 . the magnitude of the transient voltage pulse is related to the equivalent spherical diameter of the particle according to the following equation as given by r . w . deblois and c . p . bean in review of scientific instruments ( 1970 ) 41 , 909 : ## equ1 ## where δv is the voltage change , ρ is the electrical resistivity of the molten metal , i is the current , d is the equivalent spoherical particle diameter and d is the passage diameter . the voltage pulses that result from the passage of the particles are of relatively low amplitude superimposed on a large d . c . signal ; these are fed to the differential pre - amplifier 42 and filtered to remove the large d . c . component and inevitable high frequency noise . the logarithmic amplifier 44 extends the dynamic range of the signal , and its output is fed to the peak detector which samples the signal and produces discrete pulses of fixed length that can be handled by the analyser 48 . the analyser counts the number of these pulses and also analyses them as to size . the output of the analyser is therefore a histogram of particle number from which the particle concentration in the specimen can be determined , and also particle size distribution , as illustrated by fig6 . the analyser can include a cathode ray tube for immediate display of this histogram , or a recorder , or a memory store from which the information is obtainable at any time . by adjustment of the gain of the amplifiers 42 and 44 and the current and knowing the input range of the multichannel analyser 48 , it is thus possible by application of the above equation to relate each channel of the analyser 48 to an equivalent spherical diameter of a particle , so that passage through the passage of such a particle causes a count to appear in that channel . the y - axis of the graph of fig6 is therefore representative of counts per channel , while the x - axis has the dual representation of the channel number of the analyser and the spherical diameter in micrometers equivalent to each channel . severe problems are involved in obtaining usable information as to particle count and size distribution of unwanted particulates when the liquid involved is a molten metal , and do not appear to have been overcome hitherto , but are overcome by the method and apparatus of the invention . in a specific apparatus that has been tested successfully the metal involved was aluminum at a temperature of about 700 ° c . ( 1260 ° f .). other metals which have also been analysed with this apparatus are zinc at 450 ° c ., lead at 400 ° c . and gallium at 35 ° c . the sample - receiving container 14 that was employed is a tube of borosilicate glass ( kimble 45052 ) of length 20 . 0 cm , diameter 2 . 5 cm , and wall thickness 0 . 13 cm , while the orifice 18 is as illustrated by fig4 of about 300 micrometers minimum diameter that has been formed by a flame - piercing procedure described below . the electrodes 20 and 28 are of steel rod of 6 . 5 mm diameter enclosed in a glass sheath of 1 . 0 mm thickness , with approximately 5 . 0 mm of the rod end exposed to the molten metal . copper wire is unsatisfactory for this purpose , although other metals more resistant to attack by molten aluminum , such as titanium , or steel clad copper rods would also be adequate . the volume of a typical sample between the level electrodes 50 and 54 is about 16 ml and takes about 60 seconds to draw into the vessel using a vacuum of about 12 . 5 cm ( 5 ins .) mercury . when the test container is immersed in a flowing stream such a sample will have been taken from about 300 - 600 kg of metal that has passed by the container . the molten metal can be blown out of the tube by use of the pressurized argon and the particle sizes again monitored . the apparatus is then immediately ready for a new test ; alternatively the interior can be connected to atmosphere until the vacuum is relieved and then the tube replaced with a new one . it will be noted that the signal processing procedure could be reversed by applying positive pressure to the interior of a filled sample - receiving vessel and monitoring for the presence and size of the particulates as they are expelled through the passage and out into the surrounding melt ; such a procedure can then be &# 34 ; backed - up &# 34 ; by applying suction to the vessel interior to draw liquid metal into it while monitoring the signal produced . if a positive pressure source is used then preferably it is a quiescent source such as a pre - pumped reservoir of compressed gas so as to avoid the presence of pump pulsations during the test . it is believed to be surprising that a molten metal can be handled in this manner , particularly molten aluminum , which is known to be chemically highly aggressive , and also to have a high surface energy so that considerable difficulty would be anticipated in attempting to pass it through an aperture of the necessary small size within a sufficiently short period of time and without freezing or any mechanical difficulty , such as enlargement of the passage by the flow of the molten metal through it . the passage diameter for the above - described preferred embodiment is about 300 micrometers , but a range of diameters can be used depending upon the metal under test and the size and nature of the particles to be examined . the diameter will in practice be in the range from 100 to 5000 micrometers , more usually from about 200 to about 500 micrometers . for example , the deleterious inclusions commonly found in aluminum are within the range of about 20 - 80 micrometers effective diameter . however , in the case of molten steel it is found to contain deoxidation products of size in the range about 10 - 80 micrometers , reoxidation products of size in the range about 100 - 500 micrometers , and slag particles of as yet unknown size , but many of which are believed to be of size about 1000 micrometers . it is known that with a molten metal the conductivity is completely an electronic phenomenon , as contrasted with the ionic conductivity characteristic of the prior art coulter apparatus employing an aqueous media described above . the currents that are required to obtain a useful reading can be very large and the battery 30 must be capable of delivering a steady current of about 1 to 500 amperes during the period of the test , depending upon the diameter of the orifice , the resistivity of the metal being tested and the sensitivity desired . in the case of molten aluminum , with an aperture diameter of 200 to 500 micrometers , a preferred narrower range of current is from 1 to 100 amperes corresponding to a current density through a 300 micrometer diameter aperture of from 1 . 4 × 10 7 to 1 . 4 × 10 9 amps / m 2 and a power density in a 300 micrometer diameter aperture of from 5 × 10 7 to 5 × 10 11 watts / meter 3 . despite these extraordinarily high power densities , the metal in the aperture does not vaporize during the test because of its short residence time in the passage . each apparatus of the invention will require to be custom designed for the metal with which it is to be used and the range of particle sizes to be detected and , in particular , the range of currents that will be employed is relatively wide . table i below gives the electrical resistivities of some typical metals to which the invention is applicable , the values being taken from the 8th edition of &# 34 ; metals handbook &# 34 ;, published by the american society for metals , 1964 . table 1______________________________________ electrical temperature resistivitymetal ° c . μω - m______________________________________aluminum 700 0 . 25bismuth 271 1 . 29copper 1083 0 . 22iron ( steel ) 1536 1 . 39gallium 30 0 . 26mercury 100 1 . 03sodium 97 0 . 096nickel 1450 0 . 85lead 340 0 . 98zinc 413 0 . 35magnesium 650 0 . 27potassium 64 0 . 14tin 232 0 . 45cadmium 400 0 . 34______________________________________ for example , if an aperture of 300 micrometers diameter is taken as standard then , as indicated above , the typical preferred current value for molten aluminium for the detection of particles in be range 20 - 150 micrometers is 60 amperes . if equivalent voltage pulses are to be obtained then molten sodium will require an applied current of about 150 amperes [( 60 × 0 . 25 )÷ 0 . 096 ], while molten iron will require an applied current of about 11 . 5 amperes [( 60 × 0 . 25 )÷ 1 . 3 ]. again for example , with molten iron if the applied current is reduced to 1 ampere , while the lower limit for the detection of particles is 20 microvolts , then the smallest size of particle that can be readily detected rises from 20 micrometers to 45 micrometers [ 20 ×( 11 . 5 ) 1 / 3 ]. with currently readily available equipment voltage pulses of less than 20 microvolts start to become indistinguishable from the background electrical noise . it will be seen therefore that the ultimate limits of particle sizes which can be detected depend upon the size of the aperture used , the metal to which the invention is applied , the current that is applied , and the threshold voltage pulses that can usefully be detected . it has been found practical to provide the required constant current through the circuit from a current source comprising a 6 volt lead acid battery and an appropriate ballast resistor . it is desired to use a source that is as smooth and noise free in power delivery as possible and the d . c . battery system described is found to be effective and economical . the size and shape of the aperture is found to be unexpectedly critical in obtaining usable readings . a simple drilled opening as illustrated by fig2 can be employed , but does have a tendency to cause turbulence in the flow through it . thus , preferably it should not cause turbulence in the metal flow and to this end can be made of the shape of fig4 in which it presents an opening to the entering molten metal that is considerably larger than its minimum cross - section area , and then tapers smoothly outwardly from the minimum area portion into the body of the test container . for detection of particles of about 20 micrometers effective diameter or larger suspended in aluminum the minimum area portion will need to have a diameter of less than 300 micrometers when using the preferred applied current of 60 amperes , the exact length of the passage being of no consequence . it can be shown that the signal amplitude is inversely proportional to the fourth power of the passage minimum diameter , but the sampling rate is dependent on flow rate through the passage and is therefore proportional to the passage cross - section area ( d 2 ), and these two parameters are in conflict with one another . the problem of possible blockage of the passage by large particles of course increases with decrease of minimum diameter , and the values given are a practical compromise . it can also be shown that there is a direct relationship between signal amplitude and current . a principal problem is the inevitable background noise and the usual precautions were taken to reduce this as far as possible , e . g . by twisting lead wires together , together with the unusual precaution particular to this invention of using a secondary battery as a d . c . power source . background noise was also found to be caused by various other mechanical sources , such as vibration of the apparatus , and this must also be avoided as much as possible . in the specific example , the background noise was found to be about 5 microvolts rms of which 2 microvolts was input noise of the amplifier . it is at present believed that one factor that permits operation of the method and apparatus is that the liquid metal surrounding the current passage serves as an excellent faraday shield , which reduces the background noise to an acceptable value and permits the use of the necessary high - gain amplifiers . a passage of the form of fig2 has a relatively long length of constant diameter ; a long passage has the potential disadvantage that more than one particle can be passing through at any one time , but also has the potential advantage that the elongated pulse produced gives an opportunity of also examining the geometry of the particle . a passage of the cross - section illustrated by fig3 is advantageous in reducing inflow turbulence and can be formed by drilling and countersinking , the resultant passage being of diameter a and effective length b ; difficulty is experienced in counterboring the inner orifice because of the restricted space available . a preferred cross - section for the passage is illustrated by fig4 in which the passage decreases smoothly , progressively and somewhat exponentially toward a central minimum , and increases in a corresponding manner away from the centre . it is found with a container of a glassy material that the orifice can readily be formed to this preferred profile by piercing with a suitably sized and shaped gas flame ; the material softens and its surface energy moves it to form the preferred profile automatically . the sampling tube may be disposable . it has also unexpectedly been found advantageous to precondition the newly - formed passage before a test is performed by passing an extremely heavy current ( 2 to 10 times the normal operating current ) in the flow path for a specific minimum period of time . in the apparatus of fig1 this can be obtained by closing the switch 33 and short - circuiting the ballast resistor 32 . this preconditioning current will be in the range of 10 to 1000 amperes , and as a specific example , with an apparatus intended to operate with a normal test current of about 60 amps the preconditioning current should be in the range 120 to 600 amps . the preconditioning current will be applied for at least 1 to 5 seconds the period being increased if the lower currents are used . it is believed that this preconditioning may operate by causing intense local heating and possibly vaporization of the metal in the passage which attacks the surface and rids it of adsorbed gases and small holes , thus ensuring that the metal is in complete contact with the wall of the passage . this operation is also carried out if , during a test , it is observed that the baseline of the electrical recorder becomes unstable . in the latter case it is believed that the instability may be due to particles , particularly smaller particles , adhering to the passage wall , and that the intense localized heating by this preconditioning current increases the contact angle between the metal and any such particles , thus promoting their removal . owing to the high sensitivity required of the apparatus to obtain usable results above the level of the background noise present or generated during a test it was also found , as described above , that a completely quiescent vacuum source was necessary to draw the molten metal into the test container , since the pulses produced by any type of vacuum pump resulted in the imposition of an additional pulsing signal on the peak detector read - out that would otherwise have required computer analysis and filtering to remove . in the specific test equipment described above the vacuum reservoir used had a volume of about 10 liters , so that there was no substantial change of pressure during a test . the use of argon gas in the apparatus minimized any production of oxide particles that might subsequently cause errors if the sample is analysed by microscopic methods . the molten metal can alternatively be moved through the orifice by application of pressurized gas to the metal outside the container , but in practice this is not as satisfactory or as economical as the vacuum method described . a specific form of the test apparatus employed as the differential amplifier 42 ( type 5a22n of tektronix ) is the front end of a tektronix type 5223 digitizing and storage oscilloscope that also served for direct observation of the signals . this differential amplifier is equipped with suitable selectable high and low pass filters . the maximum excursion of the particle pulses fed to the preamplifier was in the range of about 5 - 1000 microvolts on the 0 . 30 volt baseline ; for practical purposes the voltage difference was measured between the tips of the two current - carrying electodes 20 and 28 , so that the d . c . component arises from the voltage drop along each electrode as well as the voltage drop across the path through the passage . pulses smaller than 5 microvolts were completely lost in the overall background noise and the amplifier output was fixed at 50 millivolts per division ; amplifier gains of 500 - 5000 were normally used by adjusting the sensitivity control . the log amplifier 44 and peak detector 46 consisted of a tracor northern type tn 1214 which gave a satisfactory output of about 0 - 10 volts and includes a sample and hold circuit capable of providing pulses of about 2 microseconds duration from the relatively long pulses of about 500 microseconds produced by the passages of the particles . these short pulses were required for the multichannel analyser 48 used , a tracor northern model 1206 , which has a ten bit analog / digital converter that will divide a 0 - 8 volt input into 510 equal voltage channels and count , store and display up to 10 6 - 1 events per channel . fig6 shows a typical plot that is obtained with the method and apparatus of the invention as just specifically described . it will be noted that the graph begins at the channel equivalent to particles of size of equivalent spherical diameter about 20 micrometers and terminates at the channels equivalent to particles of size greater than about 50 micrometers , the number of particles detected decreasing progressively between these values . fig7 will be referred to below . in a method of operation according to the invention a sample of metal to be tested is provided from a stream or batch thereof and is tested by the method and using an apparatus of the invention . when the inclusion content for particulates of greater than the said predetermined value is above a given value as determined by operation of the invention then the stream or batch from which the sample was taken is treated to reduce the inclusion content , for example by directing the stream or batch to a suitable location at which the inclusion content is reduced for example by chlorine - nitrogen degassing or a repeat application of sparging gas . fig8 shows in graphical form the magnitudes of the voltage pulses that will be observed when essentially non - conducting particles of various equivalent spherical diameters pass through holes of respectively 200 , 250 and 300 um diameter in the wall of the sample - receiving vessel . the equivalent particle diameter in micrometers is recorded on this graph abscissa , while the corresponding pulse magnitude in microvolts is recorded on the ordinate . these values given are for molten aluminium through which a test current of 60 amperes is passed , the value of ρ being 25 × 10 - 8 ohm - metres . a series of examples are now provided to illustrate the use and versatility of the method and apparatus of the invention for the monitoring of molten metal cleanliness characteristics . unless otherwise specified , the following set of operating conditions were used : ______________________________________diameter of passage ( minimum ) = 300 micrometerselectrical current through passage = 60 amperespreamplifier gain = 1000logarithmic amplifier response = 3 . 33 log . sub . 10 v . sub . in + 6 . 67v . sub . out ( volts ) gauge pressure during sampling = - 12 . 5 cm hg ( vacuum ) minimum particle size analysed for = 20 micrometers ( based on diameter of an equivalentvolume sphere ) liquid metal tested = aluminum______________________________________ a bath of 25 kg of commercial purity aluminium was held within a temperature range of 710 °- 725 ° c . and fed with a 9 mm diameter aluminum rod containing titanium diboride grain refining nuclei ( aluminium + 5 % ti + 1 % b ). four successive additions were made to the stirred bath , resulting in the data points shown in fig9 . as expected , a linear correlation was obtained between the inclusion count rate ( ordinate ) and amount of titanium added ( abscissa ), the latter being computed in parts per million ( ppm ). this is an example of the use of the method and apparatus of the invention for studying the behaviour of inclusions in aluminum melts . referring to table 2 below , commercially pure aluminum was melted and held at 700 ° c . in a 100 kg resistance heated furnace for a period of six hours ( a ). the melt was stirred ( b ), settled for two hours ( c ), and treated with a 20 p . p . m . addition of boron stirred into the melt ( d ) so as to nucleate and precipitate ( ti - v ) b particles . following subsequent periods of settling and stirring ( e through i ), a second boron addition of 85 p . p . m . was made ( j ), followed by final periods of settling and stirring ( k - m ). table 2 therefore gives a history of the melt &# 39 ; s cleanliness as measured using the invention during the sequence of processing operations noted . it illustrates the settling characteristics of ( ti - v ) b particles and demonstrates the requirement of minimal convection and stirring to rid aluminum melts of such impurity particles . it also illustrates the type of operation that can be achieved using the rapid test procedure provided by the invention . table 2______________________________________ resistive pulse reading ( total counts perprocessing operations minute ≧ 20 μm ) ______________________________________a metal held at 700 ° c . for 6 hrs . 32b melt stirred 305c a 2 hr . settling period allowed 108d a 20 p . p . m . addition of boron stirred 2750 into melte following a 5 - minute settling period 847f melt stirred 2767g following a 5 minute settling period 727h following a 1 hr . settling period 310i following a further 1 hr ., ten minute 295 periodj an 85 p . p . m . addition of boron stirred 8405 into meltk following a 10 minute settling period 3527l following an overnight ( 12 hr ) settling 79 periodm melt stirred 2748______________________________________ following boron additions to a 50 tonne tilting furnace held at 710 ° c . for the precipitation of ( ti - v ) b from the melt , tests were carried out to determine the influence of settling time on melt cleanliness . for this example sample of molten aliminum were taken from the transfer launder , into which metal from the tilting furnace was poured . fig1 shows the results which it was possible to observe with the process and apparatus of the invention , namely the differences in melt cleanliness that were observed when standard operating practices for tilting furnaces were employed , as shown by curve a , in which an initial one hour settling period is observed , and when a different practice was employed ( curve b ); in which the tilting furnace was filled and emptying and casting procedures initiated immediately afterwards . curve b shows the much higher inclusion count rate in excess of 1000 counts per minute ( c . p . m .) obtained at the start of casting with this different practice , settling of ( ti - v ) b particles within the tilting furnace subsequently resulting in cleaner exiting metal , with the entrained inclusions finally reaching more normal levels after 120 minutes of pouring to become similar to those registered by curve a . a magnesium aluminum alloy was first treated by passing the melt prior to casting through a filter bed consisting of a box of tabular alumina balls , its purpose being to filter undesirable inclusions from the metal . the metal was sampled before and after the filter and the results are those given in table 3 below , obtained after five minutes into casting . the table shows the size distribution of particles before and after passage through the filter bed , and indicates the efficiency of the filter for different particle sizes . the overall efficiency for particle removal was 70 % and , as shown , appeared to be independent of equivalent particle diameter for sizes ranging between 16 and 50 micrometers . the apparent drop in efficiency at high particle diameters may be due , in part , to the random error in sampling procedure which increases in significance at the low count rates at larger particle sizes . table 3______________________________________particle size counts counts filtermicrometers before filter after filter efficiency______________________________________16 - 20 740 210 72 % 20 - 25 460 115 75 % 25 - 30 158 47 70 % 30 - 34 69 19 72 % 35 - 40 38 12 68 % 40 - 45 14 9 36 % 45 - 50 8 5 38 % 50 14 13 7 % ______________________________________ tests were carried out to monitor cleanliness levels during the casting of aluminum can stock from a tandem furnace continuous casting system . in this series of tests , the results were obtained employing the method and apparatus of the invention compared with those obtained with the known podfa system . in this latter test system ( porous disc filtration apparatus ) a sample of at least 1 kg of molten aluminum is forced under pressure through a porous ceramic filter disc which will retain all solid inclusions of greater than a predetermined size . some metal is allowed to remain on the disc and permitted to freeze . the disc and the sample are then sectioned and polished and the section examined microscopically by a trained observer . the procedure can only be regarded as semi - quantitative ; there is some indication of particle size and size distribution and the composition and source of the inclusions can be deduced , but a highly skilled operator is needed and the time required to obtain useful test results is about 24 - 48 hours . fig7 therefore provides a comparison of the results obtained with the two cleanliness measurement techniques , those of the invention being shown in solid lines while those of the podfa technique are shown in broken lines . the results of the invention are recorded at the left ordinate in terms of inclusion count rate per minute , while those on the right ordinate scale are from the porous disc filtration analysis , in terms of the relative area of inclusions observed per unit sample weight . it will be seen that the results of the tests correlated relatively closely with one another , with the exception that the test results of the apparatus of the invention were immediately available in more detailed form . table 4 below provides examples of the particle size distributions sampled at the 35 , 55 and 150 minute mark respectively . table 4______________________________________particle size inclusions per kg . after elapsed timemicrometers 35 min 55 min 150 min______________________________________20 - 25 22 , 350 12 , 000 6 , 30025 - 30 10 , 800 2 , 700 1 , 35030 - 35 5 , 400 1 , 500 60035 - 40 3 , 150 600 30040 - 45 1 , 800 -- -- 45 - 50 1 , 800 -- -- 50 1 , 800 -- -- ______________________________________ the initial peak observed in fig7 after 30 minutes corresponded to the completion of tapping from one furnace and the start of pouring from the second furnace . the large peak in particle count rate corresponded to the entrainment of surface impurities in the fresh stream of metal . following the first 35 minutes of flow from that particular furnace , metal cleanliness improved as sedimentation of particles within the tandem furnace continued . after 185 minutes of casting , another furnace was tapped leading to another surge in entrained particulates , again followed by subsequent improvement quality .
| 6 |
hereinafter , an exemplary embodiment of the present invention will be described in detail . however , the following exemplary embodiment does not limit the scope of the claimed invention , and all combinations of features of the exemplary embodiment are not necessarily required to address the problem described above . as illustrated in fig1 and 2 , a vehicle lamp 10 according to the exemplary embodiment includes a housing 12 , an outer cover 14 , lamp units 16 , 17 , and an extension 38 . the vehicle lamp 10 is configured as a headlamp which is mounted on each side of a front portion of a vehicle so that the lamp 10 is oriented in a forward direction x shown in fig1 . right and left headlamps are symmetrically configured . therefore , only one of the headlamps will be described below . fig1 is a sectional view of the headlamp 10 taken along a vertical plane including the optical axis of the lamp unit 16 . the housing 12 is formed to have a box - like shape having a front opening . the outer cover 14 is made of transparent resin or glass , and has a bowl shape . the edge portion of the outer cover 14 is attached to the housing 12 to cover the opening of the housing 12 , whereby a lamp chamber is formed as a region enclosed by the housing 12 and the outer cover 14 . the lamp units 16 , 17 and the extension 38 are disposed inside the lamp chamber . the lamp units 16 , 17 are both arranged such that irradiate a region in front of the headlamp 10 . more specifically , the lamp unit 16 produces a low beam and the lamp unit 17 produces a high beam . the lamp unit 17 may be configured in a similar manner as the lamp unit 16 except that a reflector and other components of the lamp unit 17 are configured and arranged to form a high beam light distribution pattern . therefore , only the lamp unit 16 will be described in detail below , and description of the lamp unit 17 will be omitted . the lamp unit 16 is attached to the housing 12 via aiming screws 18 . the lower aiming screw 18 is configured such that it is rotated when a leveling actuator 20 is operated . that is , the optical axis of the lamp unit 16 can be moved in up and down directions by operating the leveling actuator 20 . the lamp unit 16 includes a projection lens 30 , a support member 32 , a reflector 34 , a bracket 36 , a light emitting module 40 , heat dissipating fins 42 , and a cooling fan 44 . the projection lens 30 is a plano - convex aspherical lens having a convex front surface and a flat rear surface . the projection lens 30 projects a light source image formed on the rear focal plane thereof toward the front of the headlamp 10 as an inverted image . the support member 32 supports the projection lens 30 . the light emitting module 40 includes a semiconductor light emitting device . according to the exemplary embodiment , the semiconductor light emitting device is a white light emitting diode ( led ). however , the semiconductor light emitting device may be a laser diode . further , the light emitting module 40 may not necessarily include a semiconductor light emitting device . for example , the light emitting module 40 may include an incandescent lamp with a filament or a discharge lamp . the reflector 34 reflects light from the light emitting module 40 to form the light source image on the rear focal plane of the projection lens 30 . accordingly , the reflector 34 has a reflecting surface formed by mirror treatment such as aluminum deposition . as described above , the reflector 34 and the projection lens 30 function as optical components that collect and forwardly project the light emitted from the light emitting module 40 . the heat dissipating fins 42 are arranged on a rear surface of the bracket 36 to dissipate heat generated primarily by the light emitting module 40 . the cooling fan 44 is attached to the heat dissipating fins 42 , and sends air toward the heat dissipating fins 42 to enhance the heat dissipation from the heat dissipating fin 42 . the support member 32 includes a shade 32 a . the shade 32 a shields a part of the light emitted from the light emitting module 40 and reflected by the reflector 34 so as to form a cutoff line of a low beam light distribution pattern ahead of the vehicle . the low beam light distribution pattern is well known and thus description thereof is omitted here . the extension 38 is provided so as to surround the projection lens 30 . the outer surface of the extension 38 is subjected to a mirror treatment such as aluminum deposition , and functions as a design surface that is visible from the outside . the housing 12 has a groove portion 12 f along an opening edge of the housing 12 . the groove portion 12 f is formed such that it is opened toward the front of the headlamp 10 , and a sealing member 50 fitted therein . the edge portion of the outer cover 14 is inserted into the groove portion 12 f in which the sealing member 50 has been provided . in this manner , the sealing member 50 seals up a space between the housing 12 and the outer cover 14 . the sealing member 50 is made of a hot - melt adhesive . the hot - melt adhesive is a sealing material which melts when heated , but does not become completely solidified after being cooled . according to the exemplary embodiment , the hot - melt adhesive has viscosity in a range of about 10 pa · s to 70 pa · s and a viscosity variation rate of about 20 % or lower . more specifically , the sealing member 50 is a gelled hot - melt adhesive . the hot - melt adhesive includes a styrene thermoplastic elastomer ( sebs ), butyl rubber or the like as a base polymer and additives including a tackifier made of resin or the like , a wax made of a polypropylene or the like , an anti - oxidizing agent , a pigment , and a plasticizing agent made of a low molecular polymer or the like . to provide the sealing member 50 , a molten hot - melt adhesive may be automatically supplied into the groove portion 12 f of the housing 12 using an automatic supply apparatus . the housing 12 with the hot - melt adhesive filled in the groove portion 12 f is then cooled until the hot - melt adhesive is gelled . next , the edge portion of the opening of the outer cover 14 is inserted into the groove portion 12 f of the housing 12 , and the outer cover 14 is attached to the housing 12 . as described above , the reflecting surface of the reflector 34 and the extension 38 are mirror treated by aluminum deposition or the like . such vapor deposition processed components may scatter deposition residues inside the lamp chamber due to a vibration of the vehicle or the like . further , inside the lamp chamber , there are mechanical fastening parts such as a bolt and a nut , and other metal parts . such mechanical parts may also scatter particles such as chipped off burrs inside the lamp chamber . when such particles stick onto , for example , the design surface of the extension 38 , the soiled surface is visible from the outside , which leads to deterioration of an aesthetic aspect of the headlamp 10 . in order to address this problem , the headlamp 10 according to the exemplary embodiment includes an adhesive member 52 arranged inside the lamp chamber . the adhesive member 52 has an adherence property that catches the internally - generated particles describes above so that the particles adhere to the adhesive member 52 . the adhesive member 52 is made of the same material as the sealing member 50 . therefore , the adhesive member 52 can be provided on the inner surface of the lamp chamber during the process of automatically filling the groove portion 12 f with the hot - met adhesive for the sealing member 50 . more specifically , an additional teaching may be input to a robot ( i . e ., the automatic supply apparatus ), to fill a recessed portion 12 e of the housing 12 with the hot - met adhesive to provide the adhesive member 52 in the same process as filling the groove portion 12 f with the hot - met adhesive for the sealing member 50 . according to this method , the adhesive member 52 can be provided productively with low cost . the adhesive member 52 is arranged on a portion of the inner surface of the housing 12 adjacent to the groove portion 12 f . according to this structure , a wall of the groove portion 12 f configured to receive the sealing member 50 can be used to restrict an area in which the hot - melt adhesive for the adhesive member 52 is provided . the housing 12 further includes a rib 12 d adjacent to the portion of the inner surface where the adhesive member 52 is arranged . the rib 12 d is arranged to extend substantially parallel to a direction along which the groove portion 12 f extends . owing to this , even when the headlamp is turned upside down for example during the manufacturing process or the delivering process , the adhesive member 52 is blocked from moving . accordingly , the design surface is prevented from being soiled by the adhesive member 52 . more specifically , the inner surface of the housing 12 includes a bottom portion 12 a and a vertical surface 12 b vertically extending down from the front end of the bottom portion 12 a . the housing 12 further includes a horizontal surface 12 c arranged to horizontally extend toward the front from the lower end of the vertical surface 12 b . the horizontal surface 12 c forms a part of the wall that defines the groove portion 12 f . the rib 12 b is provided protrude toward the front from the vertical surface 12 b . the recessed portion 12 e , which is opened toward the front , is defined by the rib 12 b , the vertical surface 12 b and the horizontal surface 12 c . the adhesive member 52 is provided in this recessed portion 12 e . that is , the rib 12 d provides the recessed portion 12 e to easily and reliably arrange the adhesive member 52 . the rib 12 d extends from a region below the lamp unit 16 to a region below the lamp unit 17 . therefore , as shown in fig2 , the adhesive member 52 is arranged to extend in a substantially entire region below the lamp units 16 , 17 along the width direction of the lamp units 16 , 17 . however , the adhesive member 52 may not necessarily be provided in this manner , and may be partially arranged in a region below the lamp unit 16 or the lamp unit 17 . as shown in fig1 , the groove portion 12 f and the recessed portion 12 e are both opened toward the front of the headlamp 10 . therefore , during the process for filling the groove portion 12 f with the hot - melt adhesive for the sealing member 50 , the hot - melt adhesive for the adhesive member 52 can be easily and reliably provided in the recessed portion 12 e . the bottom portion 38 a of the extension 38 is formed on substantially the same level as the bottom portion 12 a of the housing 12 . the bottom portion 38 a of the extension 38 and the bottom portion 12 a of the housing 12 form a receiving surface 58 which extends substantially in the horizontal direction in a region below the lamp unit 16 . the rear end 38 b of the extension 38 is spaced slightly away from the front end of the rib 12 b . in other words , the receiving surface 58 is formed with a gap 58 a which penetrates the receiving surface 58 in the vertical direction . the adhesive member 52 is arranged directly below the gap 58 a . the internally - generated particles described above drops onto the receiving surface 58 from , for example , the lamp unit 16 . because the gap 58 a is formed in the receiving surface 58 and the adhesive member 52 is arranged directly below the gap 58 a , the particles efficiently caught by the adhesive member 52 and adhere to the adhesive member 52 . the receiving surface 58 may be provided separately from the housing 12 and the extension 38 . in this case as well , a gap 58 a may also be formed in the receiving surface , and the adhesive member 52 may be disposed directly below the gap . according to the exemplary embodiment described above , the adhesive member 52 is disposed inside the lamp chamber of the headlamp 10 . however , the adhesive member 52 may be disposed inside a lamp chamber of other types of vehicle lamps . while the present invention has been described with reference to a certain exemplary embodiment thereof , the scope of the present invention is not limited to the exemplary embodiment described above , and it will be understood by those skilled in the art that various changes and modifications may be made therein without departing from the scope of the present invention as defined by the appended claims .
| 5 |
one embodiment of the tool is illustrated in fig1 ( side view ), fig2 ( sectioned view , head area ) and fig3 ( partially sectioned view near handle ). in this embodiment the parts are made of metal and / or plastic . the tool fig1 has a cylindrical rod 12 of sufficient length to access the length of work piece . the rod 12 is attached to a handle 20 at one end . the rod 12 fits within a tubular sleeve 16 which is of a length shorter than the rod 12 and is enlarged at end 14 . sleeve 16 moves freely upon rod 12 . the diameter and length of rod 12 and sleeve 16 are proportionate to the work piece . attached to the sleeve 16 at the end nearest handle 20 is a collar 18 which is secure to the sleeve 16 while allowing the free movement of rod 12 through it . collar 18 exterior surface may be textured such as with circumferential diamond knurling as shown . the portion of rod 12 opposite handle 20 , and exposed from the sleeve , has straight knurling parallel to rod axis . the rod 12 has a female thread to accept the mating thread of a cylindrical head 10 . head 10 is shown attached to rod 12 and may include exterior texturing such as circumferential diamond knurling shown . the size of the head 10 is proportionate to the work piece bore . also shown in fig1 is a patch / swab 22 typically made of a pliable material such as woven cloth , felt or foam sheet . a tubular swab 30 is shown and which may be made of a preformed felt , foam rubber , cotton fiber or other pliable material . tubular swab 30 may also be slit 31 along the axis through one wall cross section allowing access to inside diameter along entire axis . the size of the patch or swab is determined by the size of the work piece bore . patch will be a term used to describe the cut material prior to being formed into a swab . swab will be the term used to describe a patch that has been formed about the tool or a separate type of preformed swab material such as a tubular swab 30 . looking at fig2 the sectioned view reveals an annular recess 24 in head 10 . the end of rod 12 is shown tapered down providing a gradual transition between rod 12 basic diameter and the minor diameter of annular recess 24 . also revealed is a recess / concave 28 area at end of head 10 . this recess / concave 28 area may be shaped differently in order to fit the object it is likely to act upon such as a conical projectile . also seen in fig2 is a portion of sleeve 16 . in fig3 the sectioned view of collar 18 reveals a snap ring 34 which is captive in a groove 32 . the snap ring 34 is shown positioned within a indentation 36 formed in the rod 12 ( not sectioned ). also seen are the sleeve 16 and a portion of the handle 20 . the user of the above described embodiment has multiple options as to how they use the tool . some of these options will be described in the following . fig4 a - 4d show the tool being used with a patch 22 to form an undersized swab which , is inserted into the bore of a work piece 26 then expanded at the user &# 39 ; s desired location to the desired size . in order to accomplish this , the user first wraps a patch 22 around rod 12 as seen in fig3 a . the straight knurling of the rod 12 assists in preventing the patch 22 from slipping while being wrapped around the rod 12 . after patch 22 is completely wrapped about rod 12 , it is moved towards head 10 where it is slid into the annular recess 24 ( visible in fig2 ) of head 10 , thus preventing the unwrapping of patch 22 . next as seen in fig4 c the assembly is inserted into the work piece bore 26 to the user &# 39 ; s desired location . then at the handle 20 end of the tool , the user can push sleeve 16 towards head 10 , typically using their thumb against collar 18 while maintaining the rod 12 static position at handle 20 . the results of this action are seen in fig4 d wherein the enlarged end 14 of sleeve 16 has compressed the patch / swab 22 against the head 10 . the result of this compression is the increased diametrical size of patch / swab 22 . the user can then manipulate the assembly , to and fro , as they see fit to achieve the desired cleaning or application . upon removal from work piece 26 the patch / swab 22 can be removed and replaced with clean , unused one . similar results to the above can be achieved using a preformed tubular swab 30 in place of cloth patch . to install the tubular swab 30 onto the rod 12 the head 10 can be removed swab 30 slid onto rod 12 then head 10 replaced . alternatively , the tubular swab 30 , when made from an elastic material , can be pulled over head 10 into place between head 10 and enlarged end 14 of sleeve 16 as seen fig1 . if a slit 31 is present along axis of tubular swab 30 it can be installed onto rod 12 between head 10 and enlarged end 14 of sleeve 16 by passing rod through slit 31 in tubular swab 30 until rod is within center of tubular swab 30 . once tubular swab 30 is in place on rod 12 the assembly can be inserted into work piece 26 , expanded to a larger diameter and manipulated in the same manner as previously described using the wrapped patch / swab 22 . alternatively , the same embodiment of the tool can be used as seen in fig5 a - 5c . the patch 22 is placed before head 10 and pushed down bore of work piece 26 and seen in fig5 b . if additional radial force of patch / swab 22 upon bore of work piece 26 is desired , the sleeve 16 can be manipulated towards head 10 , as described above , to compress and expand patch / swab 22 as seen in fig5 c . the sleeve 16 and collar 18 assembly can be kept from inadvertently moving along rod 12 by moving the collar 18 towards handle 20 until snap ring 34 enters indentation 36 in rod 12 as seen on fig3 . in addition , the described embodiment can be used with other implements such as brushes , pullers and retrieval worms , commercially available which can be threaded into the end of rod 12 in place of head 10 using standard threads . also , this embodiment can be used to push objects ahead of it , such as projectiles , using the recess / concave 28 area of head 10 as seen in fig2 to maintain the assemblies centered position in respect to the item it acts upon and minimize damage thereto . some of the additions and alternatives to the above described embodiment are described in the following using nomenclature used on previously described figures for reference . various different materials may be used to increase compatibility and durability with work piece and substances the tool may encounter in use . the cross sections of rod 12 , head 10 , and sleeve 16 , described as cylindrical in the above first embodiment , may be made in various sizes and shapes such as polygonal . multiple head 10 diameters may be made to allow rod 12 effective use on multiple work piece bore sizes . the head 10 may be formed at the end of rod 12 as one homogeneous piece . the tapered portion of the rod 12 where it meets head 10 may be of different angles in order to allow patch / swab 22 to transition to annular groove 24 uninterrupted . this may included no angle or , in the case of an annular recess 24 with a minor diameter larger than the rod 12 diameter , increase to allow the gradual transition between diameters . this is with the understanding that the diameter of the annular recess 24 may be determined in part by the work piece size . the head 10 may be made without annular recess 24 . the recess / concave 28 may be shaped other than concave in order to fit the object it is likely to act upon such as a conical projectile . the handle 20 may include a means to allow the rod 12 to rotate at point of attachment such as a bearing . the inclusion of handle 20 and collar 18 may be excluded . the enlarged end 14 of sleeve 16 may be of different shapes and / or sizes or excluded entirely . the head 10 may be textured , knurled , grooved or smooth on its circumferential surface . the rod 12 may be textured , knurled , grooved or smooth on its circumferential surface . the rod 12 and sleeve 16 may be mated with additional sections extending the reach of the tool . the inclusion of a taper or increasing the diameter of rod 12 from a smaller basic diameter increasing in size towards the head 10 which would force the swab to increase in diameter when sleeve 16 is moved towards the head 10 as described in the above first embodiment . from the description above , a number of advantages of some embodiments of my deep bore cleaning rod and applicator with expandable swab become evident : ( a ) debris can be removed from far end of work piece bore without first pushing debris towards far end of bore by inserting swab into bore with swab in its minor diameter state then , upon reaching a desired location , expanding swab allowing user to pull debris towards insertion point . ( b ) the loss of liquids applied to the swab will be reduced by first inserting swab containing liquid into work piece bore in its minor diameter state then expanding swab when completely within bore minimizing loss of liquid at point of insertion . ( c ) the event of a stuck or jammed swab will be reduced by allowing the user to incrementally remove debris or apply coatings . ( d ) in the event a swab does become stuck or jammed , radial force of swab upon work piece can be reduced making it easier to remove . ( e ) user is able to control the amount of radial force swab directs upon bore of work piece at any point . this is advantageous for number of applications including the controlled cleaning of specific areas of a work piece as well as the controlled polishing or removal of material when used with abrasives . ( f ) the tool can be used to perform other tasks such as pushing a projectile down a bore like a ram rod or as a rod to affix a brush or other implement onto in order to extend the reach of the implement . ( g ) the expanding swab feature makes it adjustable to bore sizes within its limits so that one tool may fit a range of work piece bore sizes . accordingly , the reader will see that the tool for expanding a swab within a bore of various embodiments can be used in a controllable manner to clean the bore of a work piece by removing debris and coatings . it also can be used to apply coatings and polish as well as used with abrasive materials forming abrasive swabs . in addition , it can be used to push items before it as well as used as an extension for other implements . furthermore , the tool for expanding a swab within a bore has the additional advantages in that : it can be produced in various lengths and diameters to better fit the intended application ; its advantages can be realized in numerous examples of work pieces ; it can be made using numerous types of materials resulting in compatibility with numerous work piece materials and substances it may contact during its use ; it can be attached to and operated by an actuator or robotic device allowing for the remote operation . while my above description contains many specificities , these should not be construed as limitations on the scope of the embodiments but merely providing examples of some of several embodiments . many other variations are possible . thus the scope of the embodiments should be determined by the appended claims and their legal equivalents , rather than by the examples given .
| 1 |
the basic teachings and formulations and techniques regarding formation of silicone - based sgp lenses are known in the art , as reflected in the earlier - mentioned patents , the disclosures of which are expressly incorporated herein by reference . the sgp lens is formed from the polymerization product of compositions containing at least one polymerizable vinylic siloxane ( pvs ) monomer , and at least one hydrophilic vinylic monomer . the polymerizable vinylic siloxane monomer contains at least one polymerizable vinylic group such as acrylic , styrenyl or vinylic group , at least one polysiloxanyl group , and at least one linkage connecting these two groups ; thus , for example : ## str1 ## hydrophilic vinylic monomers suitable for use in sgp lens compositions along with the pvs include , for example , n , n - dimethylacrylamide ( nndma ), 2 - hydroxyethyl methacrylate ( hema ), glyceryl methacrylate ( gma ), n - vinyl pyrrolidone and the like . the lenses per se are formed by lathe cutting , cast molding , spin casting , or other like known techniques . as earlier noted , sgp lenses made according to the known formulations possess a high oxygen permeability but exhibit poor clinical performance . in the present invention , it has been discovered that by increase of the proportion of hydroxy acrylic monomer ( ham ) units , preferably hema and / or gma units , to silicon units at the lens surface , the clinical performance can be substantially improved . as used herein , the units referred to are the structural monomeric units or the number of silicon atoms , including those as part of an overall copolymeric structure . hydroxy acrylic monomer ( ham ) suitable for the practice of this invention correspond to the formula ## str2 ## wherein r is h or a substituted or unsubstituted alkyl , such as methyl or ch 2 cooh ; and x is a radical selected from the group consisting of hydroxyalkyloxy , hydroxyalkyl amine , and hydroxy ; with the alkyl being substituted or unsubstituted , and preferably selected from c 1 to c 10 alkyls , most preferably c 2 and c 3 alkyls ; and with the hydroxy on the alkyl being either a single hydroxy ( e . g ., as in 2 - hydroxyethyl methacrylate ) or multiple hydroxy ( e . g ., as in glyceryl methacrylate ). exemplary and preferred hydroxy acrylic monomers are : 3 . ethylene glycolato ethyl acrylate or methacrylate , i . e ., ch 2 ═ crcoo -- ch 2 -- ch 2 -- o -- ch 2 -- ch 2 -- oh 4 . glycerolglyceryl acrylate or methacrylate , i . e ., ch 2 ═ crcoo -- ch 2 ch ( oh )-- ch 2 -- o -- ch 2 -- ch ( oh )-- ch 2 -- oh as noted , the sgp lens of the invention is made from the known sgp lens compositions and , after lens formation , the lens is then treated to provide on its surface a proportion of ham units to silicon units ( e . g ., by increase of ham units and / or by decrease of silicon units ) sufficient to provide improved clinical performance of the lens , such as functional wettability , deposition resistance , dehydration resistance and comfort . one means for achieving the requisite surface proportion of ham to silicon units is by reaction of the lens surface , preferably in the dehydrated state , with a polyol of the formula r 1 ( oh ) n where r 1 is a substituted or unsubstituted alkyl , preferably a c 2 to c 5 alkyl , and n is an integer of at least 2 , such as glyceryl methacrylate , ethylene glycol , glycerine , glycerine - glycerine , polyglycerine , or the like . the reaction is preferably carried out in the presence of a base , such as sodium hydroxide , preferably in a concentration of 0 . 1 to 10 mole percent based on the polyol , or an acid or acid - containing mixture , such as ethanol / sulfuric acid , the reaction being conducted to the extent that the physical properties of the base lens ( e . g ., strength , oxygen permeability , softness , rebound elasticity , etc .) are essentially unaffected . this reaction is intended to increase the ham units in the surface layer by transesterification and / or to reduce the silicon units by the cleavage of siloxane bonds catalyzed by base or acid . alternatively , the core lens can be treated with a ham , preferably 2 - hydroxyethyl acrylate or methacrylate , by grafting , deposition or coating to the lens surface so as to provide a sufficient proportion of ham units to silicon units at the lens surface . the grafting , deposition or coating can be carried out using known radiation - induced reactions , including reactions induced by uv , x - ray , γ - ray , and other electromagnetic radiation , such as radio frequency , microwave and the like , electron beam radiation , including electrical discharge , and the like , with reactions induced by uv , γ - ray or electron beam radiation being preferred . the treating techniques per se that can be used in the practice of this invention are well known in the art , such as the grafting , deposition or coating cured by uv , γ - ray or electron beam , illustrated in u . s . pat . nos . 3 , 916 , 033 and 3 , 854 , 982 ; coating by spin casting or cast molding of the lenses cured by radiation ; or plasma treating techniques , such as those disclosed in u . s . pat . nos . 3 , 925 , 178 and 4 , 143 , 949 , as is well known in the art . the disclosures of these prior art patents are expressly incorporated herein by reference . in the preferred embodiment of the invention , the surface treatment produces on the lens surface a thin coating consisting essentially of poly ( hydroxy alkyl acrylate and / or methacrylate ), more preferably poly ( 2 - hydroxyethyl acrylate and / or methacrylate ). the required sufficient proportion of ham units to silicon units on the lens surface that produces the desirable clinical performance will vary primarily depending upon the type and amount of particular pvs and hydrophilic monomer employed . however , the sufficient proportion in the surface layer will , at any proportion , be higher than that existing in the lens body or core . preferably , the proportion of ham units to silicon units in the surface layer is at least 0 . 5 . generally , the higher the proportion the better the clinical performance of the lens , and the thicker the treated surface layer the better the durability of the lens wettability . however , the treated layer can not be so thick that the desired properties of the lens are adversely affected . the extent of acceptable surface treatment can be monitored by high resolution photoelectron spectroscopy ( esca ) or based on the clinical response as illustrated in the examples of this specification . thus , based on the disclosure of this invention , the sufficient proportion of ham units to silicon units on the lens surface can easily be determined by those skilled in the art . although not wishing to be bound by any theory as such , it is postulated that the improvement in the clinical performance of the lens comes about , at least in part , by virtue of establishment of compatibility between the delicate corneal wetting mechanism of the eye and the composition and structure of the lens surface . the known sgp lens having insufficient proportion of ham units to silicon units or containing too high a level of silicon units on the surface are too hydrophobic for the spreading and binding of mucin to the lens surface . mucin is the excellent wetting agent used in the cornea and contains a certain proportion of hydrophilic sites to hydrophobic sites . with increasing amount of ham units on the lens surface , there are provided increased sites for hydrogen bonding with the hydrophilic sites on the mucin , while reduction of silicon surface units provides fewer hydrophobic sites and thus better spreading of mucin on the lens surface . as a consequence of the preferred embodiment of the invention herein , which results in the lens surface having a sufficient proportion of ham units to silicon units , the lens surface becomes more closely matched to , and receptive to , tear mucin . as a result , the mucin can better spread on and bind to the lens surface so as to provide the improved clinical performance . thus , when the wetting angle of the lens is controlled to that of the corneal surface free of mucin , the best results of this invention may result . the invention is further illustrated with reference to the following examples . sgp lenses were fabricated from buttons which were made according to the formulations and procedures set forth in u . s . pat . no . 4 , 182 , 822 , the starting formulation consisting of 36 % ( by weight ), γ - tris ( trimethylsiloxy ) silylpropyl methacrylate ( tsm ) prepared according to example 1 of the above patent , 59 % n , n - dimethylacrylamide ( nndma ), and 5 % methyl methacrylate ( mma ) with 0 . 3 % t - butylperoxypyvalate included as a catalyst . the formulation was placed in a teflon tube . after deoxygenation by nitrogen for 15 minutes , the tube was sealed and the formulation was polymerized in a 40 ° c . water bath for six hours , followed by a 100 ° c . treatment for another six hours . the buttons cut from the rods were post - cured at 110 ° c . under high vacuum ( 0 . 5 torr ) for six hours . the lens can be made by the lathe technique known in the art . the hydrated lenses were extracted and conditioned in physiological saline solution for a time sufficient to insure no substantial irritation . the lens thus made has high dk , about 4 to 5 times higher than that of the conventional poly hema soft lens , and contains about 50 % by weight of water , and thus has softness , rebound elasticity and a highly hydrophilic lens surface . the proportion ham units to silicon units on the lens surface is equal to zero . clinically , the lenses were very poor in performance such as functional wettability , deposition resistance and comfort , making the lens unsuitable for extended wear . provision of 6 % by weight hema in the formulation , such that the formulation comprised 36 % tsm , 58 % nndma and 6 % hema , results in a lens having high dk , softness , rebound elasticity , a highly hydrophilic surface and a proportion of ham to silicon units equal to 0 . 15 , and thus an improved sgp lens having improved clinical performance , such as functional wettability , deposition resistance and comfort as compared to the control lens above . clinically , the lenses could be worn for up to several hours by test patients . in the same manner , using 20 % by weight hema , such that the lens formulation contains 36 % tsm , 44 % nndma and 20 % hema , results in a lens having high dk , softness , rebound elasticity , a highly hydrophilic surface and a proportion of ham units to silicon units equal to 0 . 5 , and thus even more improved clinical performance , such as functional wettability , deposition resistance and comfort , as compared to the control lens . clinically , the lenses could be worn continuously for up to several days by test patients , with wettability marginally unacceptable in certain circumstances . further increase of the ham to silicon proportion by increase of the amount of hema in the composition is at the expense of tsm , and thus reduces the oxygen permeability of the lens and / or causes the formation of opaque material . as shown in the following examples , further increase of the ham to silicon proportion can be achieved by surface treatment . the lens containing 20 % hema as made in example 1 , after being hydrated in physiological saline solution , is then extracted in isopropanol for 24 hours , followed by treatment in the dry state with glycerine ( 96 % purity , colgate palmolive co .) containing 1 mole % naoh at 70 ° c . for 30 minutes by stirring . the strength of the lens after the treatment was not significantly affected . the resulting lens could be used for at least weekly extended wear by the test patients . the clinical of long term wearing on one patient showed that the lenses could indeed continuously be worn for up to 3 months for at least certain patients . thus , the surface treatment resulted in substantially improved clinical performance . a sgp lens comprising 47 % ( by weight ) tsm , 45 % nndma and 8 % hema , having 38 % water content , high dk , softness , highly hydrophilic lens surface and a proportion of ham units to silicon units equal to about 0 . 15 , was found to be unsuitable for extended wear . clinically , the lens produced poor vision , discomfort and encountered serious deposition problems within less than four hours of wear . however , treatment of the same lens in dehydrated state by stirring the lens in a glycerine reagent ( 96 % purity , colgate palmolive co .) containing 10 mole % naoh at 70 ° c . for 2 hours converted the lens to one which on the same patient could be used for weekly extended wear for a three week testing period with stable vision and no observable deposition , and demonstrated a liquid layer over the lens surface . according to an independent surface study ( about 100 a ° surface layer ) by photoelectron spectroscopy ( esca ) analysis of the lens after being treated as described in example 3 showed that there was a reduction of about 18 % silicon or about 30 % siloxy group and an increase of overall carbon content from 62 . 5 to 65 % in which the c in the co group increased from 10 . 5 to 12 . 5 % and the c in the coor group increased from 5 . 3 to 6 . 3 % after the treatment . the increase of co and coor content should indicate that the transesterification of glycerine occurs , i . e ., the formation of glyceryl methacrylate . the reduction of silicon units and / or the increase of glyceryl methacrylate units after the treatment increases the proportion of ham units to silicon units which provides the substantially improved clinical performance as described above . ( note : esca data is the average value of the treated surface with 100 a ° depth . thus , the value right at the surface is substantially higher than those reported above .) an unhydrated optically polished lens button was made according to u . s . pat . no . 4 , 182 , 822 employing 36 % ( by weight ) tsm , 42 % nndma and 22 % hema , and glycerine surface treated as set forth in example 3 herein . the button was fully hydrated in physiological saline solution , and its surface was subjected to a number of simulated cleaning cycles , each cycle involving thumb - rubbing 10 times in tap water , followed by wetting in physiological saline solution . the surface wettability to the physiological saline solution was substantially the same based on visual inspection after sixty ( 60 ) cleaning cycles , equivalent to about one years service life of the lens in weekly extended wear . the surface of the untreated button was substantially not wettable by physiological saline solution under the same testing condition . although the invention has been described in connection with particular preferred embodiments , it is not intended to limit the invention to particular forms set forth , but on the contrary , it is intended to cover such alternatives , modifications and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims .
| 6 |
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention , which may be embodied in other specific structure . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . fig8 and 9 show an implant 400 sized and configured to supplement , repair , or replace a dysfunctional native heart valve leaflet or leaflets . in use ( see , in particular , fig9 ), the implant 400 defines a pseudo - annulus that rests adjacent the native valve annulus and includes a neoleaflet element that occupies the space of at least a portion of one native valve leaflet . the implant 400 allows the native leaflets to coexist with the implant 400 . if desired or indicated , one or more native leaflets can be removed and replaced by the implant 400 . in its most basic form , the implant 400 is made — e . g ., by machining , bending , shaping , joining , molding , or extrusion — from a biocompatible metallic or polymer material , or a metallic or polymer material that is suitably coated , impregnated , or otherwise treated with a material to impart biocompatibility , or a combination of such materials . the material is also desirably radio - opaque to facilitate fluoroscopic visualization . as fig8 shows , the implant 400 includes a base or scaffold 420 that , in the illustrated embodiment , is sized and configured to rest adjacent the mitral annulus . at least a portion of the base 420 forms an annular body that approximates the shape of the native annulus . for this reason , the base 420 will also be referred to as a “ pseudo - annulus .” the base 420 supports a bridge 430 that extends into the valve . the bridge 430 is sized and configured ( see fig9 a ) to overlay the space of at least a portion of one native valve leaflet . in fig9 a , the bridge 430 overlays an anterior leaflet . however , as fig9 b shows , the bridge 430 could be oriented to overlay a posterior leaflet . as will be described later ( see fig1 ), two bridges can be formed to overlay both leaflets . as fig8 shows , the implant 400 includes a material 410 that covers or spans the bridge 430 . the spanning material 410 may be attached to the implant 400 with one or more attachment means 440 . for example , the spanning materials 410 may be sewn , glued , or welded to the implant 400 , or it may be attached to itself when wrapped around the implant 400 . the spanning material 410 may be made from a synthetic material ( for example , thin nitinol , polyester fabric , polytetrafluoroethylene or ptfe , silicone , or polyurethane ) or a biological material ( for example , human or animal pericardium ). together , the bridge 430 and the spanning material 410 comprise a neoleaflet element 470 coupled to the base 420 . the neoleaflet element 470 may be rigid , semi - rigid , or flexible . the neoleaflet element 470 is coupled to the base 420 in a manner that exerts a mechanical , one - way force to provide a valve function that responds to differential pressure conditions across the neoleaflet element . in response to one prescribed differential pressure condition , the neoleaflet element 470 will deflect and , with a native leaflet , assume a valve opened condition . in response to another prescribed pressure condition , the neoleaflet element 470 will resist deflection and , by coaptation with a native leaflet ( or a companion neoleaflet element ) at , above , or below the annulus plane , maintain a valve closed condition . in the context of the illustrated embodiment ( when installed in a mitral valve annulus ), the neoleaflet element resists being moved in the cranial ( superior ) direction ( into the atrium ), when the pressure in the ventricle exceeds the pressure in the atrium — as it would during ventricular systole . the neoleaflet element 470 may move , however , in the caudal ( inferior ) direction ( into the ventricle ), when the pressure in the ventricle is less than the pressure in the atrium — as it would during ventricular diastole . the neoleaflet element 470 thereby mimics the one - way valve function of a native leaflet , to prevent retrograde flow . the implant 400 is sized and shaped so that , in use adjacent the valve annulus of the mitral valve , it keeps the native valve leaflet closed during ventricular systole ( as shown in fig9 a and 9b ), to prevent flailing and / or prolapse of the native valve leaflet it overlays during ventricular systole . the implant 400 thus restores to the heart valve leaflet or leaflets a normal resistance to the high pressure developed during ventricular contractions , resisting valve leaflet eversion and / or prolapse and the resulting back flow of blood from the ventricle into the atrium during ventricular systole . the pressure difference serves to keep valve leaflets tightly shut during ventricular systole . the implant 400 , however , does not interfere with opening of the native valve leaflet or leaflets during ventricular diastole ( see , e . g ., fig1 ). the implant 400 allows the leaflet or leaflets to open during ventricular diastole , so that blood flow occurs from the atrium into the ventricle . the implant 400 thereby restores normal one - way function to the valve , to prevent retrograde flow . the functional characteristics of the implant 400 just described can be imparted to the neoleaflet element 470 in various ways . for example , hinges and springs ( mechanical or plastic ) can be used to couple the bridge to the base . desirably , the implant 400 is made from materials that provide it with spring - like characteristics . as shown in fig8 , in the illustrated embodiment , the base 420 and bridge 430 are shaped from a length of wire - formed material . the shape and material properties of the implant determine its physical spring - like characteristics as well as its ability to open in one direction only . the spring - like characteristics of the implant 400 allow it to respond dynamically to changing differential pressure conditions within the heart . more particularly , in the illustrated mitral valve embodiment , when greater pressure exists superior to the bridge 430 than inferior to the bridge ( i . e ., during ventricular diastole ), the shape and material properties of the bridge 430 accommodate its deflection into the ventricle — i . e ., an opened valve condition ( as fig1 shows in another illustrative embodiment ). when greater pressure exists inferior to the bridge 430 than superior to the bridge ( i . e ., during ventricular systole ), the shape and material properties of the bridge 430 enable it to resist superior movement of the leaflet into the atrium , and otherwise resist eversion and / or prolapse of the valve leaflet into the atrium ( as fig9 a and 9b also show ). the implant 400 may be delivered percutaneously , thoracoscopically through the chest , or using open heart surgical techniques . if delivered percutaneously , the implant 400 may be made from a superelastic material ( for example superelastic nitinol alloy ) enabling it to be folded and collapsed such that it can be delivered in a catheter , and will subsequently self - expand into the desired shape and tension when released from the catheter . for example , percutaneous vascular access can be achieved by conventional methods into the femoral or jugular vein . as fig2 a shows , under image guidance ( e . g ., fluoroscopic , ultrasonic , magnetic resonance , computed tomography , or combinations thereof ), a catheter 52 is steered through the vasculature into the right atrium . a needle cannula 54 carried on the distal end of the catheter is deployed to pierce the septum between the right and left atrium . as fig2 b shows , a guide wire 56 is advanced trans - septally through the needle catheter 52 into the left atrium . the first catheter 52 is withdrawn , and ( as fig2 c shows ) under image guidance , an implant delivery catheter 58 is advanced over the guide wire 56 into the left atrium into proximity with the mitral valve . alternatively , the implant delivery catheter 58 can be deployed trans - septally by means of surgical access through the right atrium . the distal end of the catheter 58 encloses an implant 400 , like that shown in fig8 , which is constrained in a collapsed condition . a flexible push rod in the catheter 58 can be used to expel the implant 400 from the catheter 58 . free of the catheter , the implant 400 will self - expand to its preordained configuration , e . g ., like that shown in fig9 a or 9 b . the implant 400 may be fixed to the annulus in various ways . for example , the implant 400 may be secured to the annulus with sutures or other attachment means ( i . e . barbs , hooks , staples , etc .) also , the implant 400 may be secured with struts or tabs 450 ( see fig8 and 9a ), that extend from the base 420 above or below the plane of the annulus . the struts 450 are preferably configured with narrow connecting members that extend through the valve orifice so that they will not interfere with the opening and closing of the valve . in this arrangement , the struts 450 are desirably sized and configured to contact tissue near or within the heart valve annulus to brace the base 420 against migration within the annulus during the one - way valve function of the neoleaflet element . in this arrangement , it is also desirable that the base 420 be “ elastic ,” i . e ., the material of the base 420 is selected to possess a desired spring constant . this means that the base 420 is sized and configured to possess a normal , unloaded , shape or condition ( shown in fig8 ), in which the base 420 is not in net compression , and the struts 450 are spaced apart farther than the longest cross - annulus distance between the tissue that the struts 450 are intended to contact . in the illustrated embodiment , the base 420 is shown resting along the major ( i . e ., longest ) axis of the valve annulus , with the struts 450 contacting tissue at or near the leaflet commissures . however , other orientations are possible . the struts 450 need not rest at or near the leaflet commissures , but may be significantly removed from the commissures , so as to gain padding from the leaflets . the spring constant imparts to the base 420 the ability to be elastically compressed out of its normal , unloaded condition , in response to external compression forces applied at the struts 450 . the base 420 is sized and configured to assume an elastically loaded , in net compression condition , during which the struts 450 are spaced apart a sufficiently shorter distance to rest in engagement with tissue at or near the leaflet commissures ( or wherever tissue contact with the struts 450 is intended to occur ) ( see fig9 a or 9 b ). when in its elastically loaded , net compressed condition ( see fig9 a and 9b ), the base 450 can exert forces to the tissues through the struts 450 . these forces hold the base 420 against migration within the annulus . furthermore , when the struts 450 are positioned at or near the commissures , they tend to outwardly displace tissue and separate tissue along the major axis of the annulus , which also typically stretches the leaflet commissures , shortens the minor axis , and / or reshapes surrounding anatomic structures . the base 450 can also thereby reshape the valve annulus toward a shape more conducive to leaflet coaptation . it should be appreciated that , in order to be therapeutic , the implant may only need to reshape the annulus during a portion of the heart cycle , such as during ventricular systolic contraction . for example , the implant may be sized to produce small or negligible outward displacement of tissue during ventricular diastole when the tissue is relaxed , but restrict the inward movement of tissue during ventricular systolic contraction . as the preceding disclosure demonstrates , different forms of heart valve treatment can be performed using a single implant . implants having one or more of the technical features just described , to thereby function in situ as a neo - leaflet , may be sized and configured in various ways . various illustrative embodiments will now be described . in fig1 , an implant 600 ( like implant 400 ) includes a base 620 that defines a pseudo - annulus , with a bridge 630 carrying a spanning material 640 together comprising a neoleaflet element 650 appended to the base 620 within the pseudo - annulus . the neoleaflet element 650 overlays an anterior native leaflet with the same purpose and function described for the implant 400 . alternatively , the neoleaflet element 650 could overlay a posterior native leaflet , as fig9 b shows . the implant 600 also includes struts 670 , which desirably contact and exert force against tissue near or within the annulus ( in the manner previously described ) to brace the base 420 against migration within the annulus . in addition , the implant 600 includes an orientation and stabilization framework 610 that may extend from the annulus to the atrial dome . in fig1 , the framework 610 rises from the base 620 with two substantially parallel arched wires , which connect to form a semicircular hoop above the base 620 . the framework 610 helps to accurately position the implant 600 within the atrium , and also helps to secure the implant 600 within the atrium . preferably the framework 610 does not interfere with atrial contractions , but instead is compliant enough to contract with the atrium . as such , the implant 600 may have nonuniform flexibility to improve its function within the heart . fig1 and 12 show another illustrative embodiment of an implant 700 . in fig1 and 12 , the implant 700 contains two neo - leaflet elements . the implant 700 includes an anterior bridge 730 spanned by an anterior bridge material 710 , and a posterior bridge 735 spanned by a posterior bridge material 720 . the bridges and materials together comprise anterior and posterior neoleaflet elements 780 a and 780 p . the implant 700 also includes an orientation and stabilization framework 770 , shown having a configuration different than the framework 610 in fig9 , but having the same function and serving the same purpose as previously described for the framework 610 . in fig1 and 12 , the base 760 includes structures like the anchoring clips 740 that , in use , protrude above the plane formed by the annulus of the valve . additionally , the implant 700 may be secured with struts 750 that extend from the base 760 on narrow connecting members and below the plane of the annulus into the ventricular chamber . the anchoring clips 740 and struts 750 desirably contact and exert force against tissue near or within the annulus ( in the manner previously described ) to brace the base 760 against migration within the annulus . fig1 shows the dual neo - leaflets 780 a and 780 b ( i . e ., the covered anterior and posterior bridges 730 and 735 ) in a closed valve position . fig1 shows the dual neo - leaflets 780 a and 780 b in an open valve position . fig1 shows another illustrative embodiment of an implant 1000 having a full sewing ring 1030 with a membrane 1010 that serves as a neo - leaflet . the device 1000 has an opening 1020 though the sewing ring 1030 opposite the membrane 1010 for blood flow . alternatively , this embodiment could have two neo - leaflets . this embodiment could be surgically attached to the valve annulus and / or combined with a framework for anchoring the device within the atrium using catheter based intraluminal techniques . additionally , the device may be secured with struts 1040 that extend from the base on narrow connecting members and below the plane of the annulus into the ventricular chamber . the struts 1040 , which desirably contact and exert force against tissue near or within the annulus ( in the manner previously described ) to brace the base 420 against migration within the annulus . as can be seen , a given implant may carry various structures or mechanisms to enhance the anchorage and stabilization of the implant in the heart valve annulus . the mechanisms may be located below the plane of the annulus , to engage infra - annular heart tissue adjoining the annulus in the ventricle , and / or be located at or above the plane of the annulus , to engage tissue on the annulus or in the atrium . these mechanisms increase the surface area of contact between the implant and tissue . a given implant can also include tissue in - growth surfaces , to provide an environment that encourages the in - growth of neighboring tissue on the implant . once in - growth occurs , the implant becomes resistant to migration or dislodgment from the annulus . conventional in - growth materials such as polyester fabric can be used . fig1 shows another illustrative embodiment of an implant 1100 having a framework 1120 and struts or tabs 1110 . this implant 1100 includes a membrane 1130 , that serves as a neo - leaflet , attached to the base 1140 of the device with an attachment means 1150 . fig1 shows another illustrative embodiment of an implant 1200 . in this embodiment , the implant 1200 includes a base 1220 that defines a pseudo - annulus and that , in use , is rests adjacent all or a portion of a native valve annulus . the base 1240 supports a duckbill valve 1210 , which forms a neoleaflet element . peripherally supported on the base 1240 , the duckbill valve 1210 rests in the pseudo - annulus . struts 1230 ( which also carry additional tab structures to increase the surface area of tissue contact ) help brace the base 1240 to tissue near or within the heart valve annulus . in this embodiment , the duckbill valve 1210 replaces the native anterior and posterior leaflets . the duckbill valve 1210 serves as dual neo - leaflets , which mutually open and close in response to changes in pressure , replacing the function of the native leaflets . fig1 shows the duckbill valve 1210 in the open valve position . in fig1 , the arrow shows the direction of blood flow through the opened valve . fig1 shows the duckbill valve in the closed valve position . when closed , the duckbill valve 1210 resists eversion and regurgitation . when the implant 1200 is used to replace a mitral valve ( see fig1 and 18 ), the duckbill valve 1210 extends from the plane of the valve annulus and into the ventricle . the duckbill valve 1210 is shown to have a more rigid or thick composition emerging from the base member , and gradually becoming less rigid or thick away from the base member . this variation in mechanical properties ensures a valve that responds dynamically to pressure changes , but that is also rigid enough to not become everted . fig1 shows the valve 1210 in an opened valve condition . in fig1 , the arrow shows the direction of blood flow through the opened valve . fig1 shows the duckbill valve in the closed valve position , without eversion and regurgitation . fig1 and 20 show another illustrative embodiment of an implant 1600 of the type shown in fig1 and 16 . like the implant 1200 , the implant 1600 includes base 1620 defining a pseudo - annulus to which a duckbill valve 1630 is appended , which serves as a neoleaflet element to replace the native anterior and posterior leaflets and serves as dual neo - leaflets . fig1 shows the duckbill valve 1630 in the open valve position , allowing forward flow of blood through the opened valve . fig2 shows the duckbill valve 1630 in the closed valve position , resisting eversion and regurgitation . in fig1 and 20 , the implant 1600 includes an orientation and stabilization framework 1610 . the framework 1610 rises from the base 1620 as two arches extending from opposite sides of the base 1620 . the dual arch framework 1610 possesses compliance to contract with the atrium . as before explained , the framework 1610 helps to accurately position the implant 1600 within the atrium , and also helps to secure the implant 600 within the atrium . the implant 1600 also includes struts 1640 , which desirably contact and exert force against tissue near or within the annulus ( in the manner previously described ) to brace the base 1620 against migration within the annulus . while the new devices and methods have been more specifically described in the context of the treatment of a mitral heart valve , it should be understood that other heart valve types can be treated in the same or equivalent fashion . by way of example , and not by limitation , the present systems and methods could be used to prevent or resist retrograde flow in any heart valve annulus , including the tricuspid valve , the pulmonary valve , or the aortic valve . in addition , other embodiments and uses of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . the specification and examples should be considered exemplary and merely descriptive of key technical features and principles , and are not meant to be limiting . the true scope and spirit of the invention are defined by the following claims . as will be easily understood by those of ordinary skill in the art , variations and modifications of each of the disclosed embodiments can be easily made within the scope of this invention as defined by the following claims .
| 0 |
the present invention includes modified - release dosage formulations of the compounds 4 , 4 ′- diaminodiphenylsulfone , its didextrose sulfonate derivative ( glucosulfone ), their analogs thereof , including sulfoxone , sulfetrone , thiazolsulfone , acedapsone , and its metabolites thereof , including monoacetyldapsone , n - hydroxymonoacetyldapsone , n - hydroxydapsone , and pharmaceutically and therapeutically acceptable salts thereof pharmaceutically and therapeutically acceptable salts of the active ingredients of the present invention include , but are not limited to hydrochloride derivatives , sulphate , phosphate , citrate , fumarate , methanesulphonate , acetate , tartarate , maleate , lactate , mandelate , salicylate , succcinate , methylsulphonic acid derivatives , and cynnamic acid derivatives . pharmaceutically acceptable carriers , excipients or diluents of the present invention may include but are not limited to sprays , gels transdermal or subcutaneous , liquids and solids incorporating lactose , sucrose , glucose , wax , mannitol , phthalates , methacrylate , silicic , sodium citrate , 1 , 2 - benzenedicarboxylic acid , ethylycellulose , dicalcium phosphate acid , absorption enhancing agents may include kaolin , sodium glycocholate , sodium caprate , n - lauryl - β - d - maltopyranoside , microcrystalline cellulose , hydrophilic polymer and compression binders may also include , sucrose , starch , hydroxypropylmethyl cellulose , polyethylene glycol , microcrystalline cellulose , hydroxymethyl cellulose , polyvinylpyrrolidone , carboxymethyl cellulose , alginates , gelatin , and mixtures thereof , disintegrating agents such as calcium carbonate , sodium starch glycholate , corn starch , tapioca starch , alginic acid , certain silicates , and sodium carbonate , lubricants and anti - adherents such as stearates including calcium stearate , magnesium stearate , talc , sodium lauryl sulfate , sodium ricinoleate , sodium tetradecylsulphate , sodium dioctylsulphosuccinate , poloxamer , glycerylmono stearate , a polysorbate , sorbitan monolaurate or a lecithin , physiological saline . active ingredients also addressed by the present invention include any and all enantiomers and diastereomers , and any combination thereof , of sulfone ( s ) contemplated herein . the above compounds are synthesized according to conventional methodology known to those skilled in the art ( e . g ., yuasa , 1997 ), and may be prepared as a composition through combination with one or more therapeutically or pharmaceutically acceptable carrier ( s ), diluent ( s ) or excipient ( s ). the modified - release dosage formulations of the present invention are based on a clinico - pharmacological rationale such as increase compliance , reduced side effects and improved efficacy . the actual dosage — quantity administered at a time — and the frequency of administrations will depend on the potency and the pharmacokinetic properties of the drugs . if a more potent compound , or a compound with longer duration of therapeutic activity is chosen . the dose and the dosing frequency may be adjusted accordingly . modified - release dosage forms of the present invention for oral administration may include but are not limited to capsules , tablets , pills , powders , granules , compression pressed granulates , micro - encapsulations , micro - spheres in a polymer film coated compressed tablet normally reserved for the stomach only — in this particular instance may be used in a controlled - release formulation of the present invention in the distal intestinal tract . modification of particle size of active substance including various degrees of micronization will also result in improved absorption of sulfone ( s ) in the distal segments of the intestinal tract . in such solid forms of the present invention , the active and inert compound ( s ) may be mixed with varying “ carrying capacities ”— to achieve the desired effect with at least one inert pharmaceutically acceptable or slightly active carrier . excipient ( s ) including fillers or binders of a central core may encompass starches , lactose , sucrose , glucose , mannitol , silicic acid and mixtures thereof . effective absorption enhancing agent ( s ) may include those such as kaolin , sodium glycocholate , microcrystalline cellulose , sodium caprate , n - lauryl - β - d - maltopyranoside and mixtures thereof . hydrophilic polymer binder ( s ) including for example , hydroxymethylcellulose , polyethylene glycol , polyvinylpyrrolidone , hydroxypropylmethylcellulose carboxymethylcellulose , alginates , gelatin , microcrystalline cellulose , sucrose , and mixtures thereof . disintegrating agent ( s ) such as calcium carbonate , sodium starch glycholate , corn starch , tapioca starch , alginic acid , certain silicates , and sodium carbonate , lubricant ( s ) such as talc , calcium stearate , magnesium stearate , sodium lauryl sulfate , sodium ricinoleate , sodium tetradecylsulphate , sodium dioctylsulphosuccinate , poloxamer , glycerylmonostearate , a polysorbate , sorbitan monolaurate or a lecithin and mixtures thereof . a preferred embodiment of an oral modified - release formulation is an enteric - coated compressed tablet consisting of the active therapeutic ingredient of the present invention . this formulation could provide a delayed release , sustained release or controlled release delivery of the active therapeutic ingredient ( s ). for the enteric - coated tablet enteric - coating ( s ) that may be used consist of ph sensitive polymers , typically the polymers are carboxylated and interact very little with water at low ph , while at high ph , as found in the distal gastrointestinal tract , including but not limited to the ascending , transverse and descending colon , polymers ionize causing swelling , or dissolving of the active hydrophilic polymer ( s ). coatings can therefore be designed to remain intact in the acidic environment of the stomach protecting either the stomach from the drug or the drug from this environment , but to dissolve in the more alkaline environment of the proximal and distal gastrointestinal tract . examples of the coating ( s ) that may be used include ethylycellulose , wax and cellulose acetate phthalate . little or no release takes place in the acidic medium of the stomach . however , as the drug leaves the stomach and enters the gastrointestinal tract , it is subjected to the intestinal fluids of ph 5 . 5 - 6 . 8 . at this ph the enteric coat commences to expose the drug to the action of the intestinal ph which the solubility of active compounds of the present invention is fairly high , which then results in high dissolution and hence higher absorption into the blood stream . the rate of release ( dissolution ) of the drug is relatively linear ( a function of the rate limiting diffusion process through the enteric - coating ) and inversely proportional to the coating thickness . the variation of enteric coatings used in the present invention allow the active therapeutic ingredient ( s ) of varying dose regimes to disseminate either in a sustained , controlled , or delayed action thereby increasing compliance , reducing side effects and improving efficacy of the active therapeutic ingredient ( s ). as will be apparent to those skilled in the art in the light of the foregoing disclosure , many alterations and modifications are possible in the practice of this invention without departing from the spirit or scope thereof . the surprising effects of controlled release preparations of 4 , 4 ′- diaminodiphenylsulfone , its didextrose sulfonate derivative ( s ), its analogs and its metabolites , pharmaceutically and therapeutically acceptable salts can be demonstrated by the following tests : 1 . toxicological effects and pharmacological side effects of the compounds 4 , 4 ′- diaminodiphenylsulfone , glucosulfone , sulfoxone , sulfetrone , thiazolsulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone separately when administered orally in a conventional “ instant release ” formulation . groups of mice ( males , 22 - 25 grams ) are each administered orally one of the compounds 4 , 4 ′- diaminodiphenylsulfone , sulfoxone , sulfetrone , thiazolsulfone , glucosulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone in increasing concentrations , and the doses causing side effects are determined . particular attention is paid to severe toxic manifestation such as the development of methemoglobinemia . other known side effects of 4 , 4 ′- diaminodiphenylsulfone include anorexia , psychosis , agranulocytosis , peripheral neuritis , hemolysis , nausea , vomiting , dizziness , tachycardia , nervousness , insomnia and skin disorders , and the doses causing all such side effects are determined using statistical methodology . particular attention is paid to the possible development of nervousness , and specific test methods are used in order to define the dose levels of each compound that cause such an effect . 2 . toxicological effects and pharmacological side effects of the compounds 4 , 4 ′- diaminodiphenylsulfone , sulfoxone , sulfetrone , thiazolsulfone , glucosulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone when administered in a controlled release formulation . since clinically used “ modified - release ” preparations are designed for use in humans , they cannot be used in laboratory animals . it is therefore necessary to mimic the pharmacokinetics of the modified - release formulations of the drug in humans from a carefully selected modified - release preparation ( s ). thus , in the present experiments the same dose as that given in the acute experiments described above is given as divided doses with 5 administered sub - doses , given at 2 hour intervals . groups of animals treated this way are given increasing concentrations of the compound , and the doses causing side effects are determined . particular attention is paid to severe toxic manifestation such as the development of methemoglobinemia . expected side effects of 4 , 4 ′- diaminodiphenylsulfone include anticholinergic affects , and the doses causing such side effects are determined using statistical methodology . particular attention is paid to the development of nervousness , and specific test methods are used in order to define the dose levels of 4 , 4 ′- diaminodiphenylsulfone that cause such side effects . 3 . pharmacological effects of the compounds 4 , 4 ′- diaminodiphenylsulfone , sulfoxone , sulfetrone , thiazolsulfone , glucosulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone when administered orally in a conventional “ instant release ” formulation . groups of mice ( males , 22 - 25 grams ) are administered orally one of the compounds 4 , 4 ′- diaminodiphenylsulfone , sulfoxone , sulfetrone , thiazolsulfone , glucosulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone in increasing concentrations and the doses causing anorexia , psychosis , agranulocytosis , peripheral neuritis , hemolysis , nausea , vomiting , dizziness , tachycardia , nervousness , insomnia or skin disorders are determined . particular attention is paid to manifestation of nervousness . other therapeutically important pharmacological effects of 4 , 4 ′- diaminodiphenylsulfone include methemoglobinemia , and the doses causing such effects are determined using pharmacological and statistical methodology . 4 . pharmacological effects of the compounds 4 , 4 ′- diaminodiphenylsulfone , sulfoxone , sulfetrone , thiazolsulfone , glucosulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone when administered in controlled release formulation . side effects of dapsone include anorexia , psychosis , agranulocytosis , peripheral neuritis , hemolysis , methemoglobinemia nausea , vomiting , dizziness , tachycardia , nervousness , insomnia and skin disorders , as well as other side effects that are described in the prior art . the formation of the toxic dapsone metabolite , hydroxylaminedapsone , has now been found to be reduced , by certain controlled release formulations of dapsone , its didextrose sulfonate derivative ( s ), its analogs or metabolites . this application deals with controlled release formulations that avoid the exposure of said 4 , 4 ′- diaminodiphenylsulfone , its didextrose sulfonate derivative ( glucosulfone ), sulfoxone , sulfetrone , thiazolsulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone to the intestinal tract . various galenic formulations of 4 , 4 ′- diaminodiphenylsulfone , its didextrose sulfonate derivative ( glucosulfone ), sulfoxone , sulfetrone , thiazolsulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone may be used to avoid exposure of the drug of the present invention to the upper gastrointestinal tract . numerous rectal and nasal delivery systems are known to those skilled in the art that allow the absorption of the drugs without exposure to the stomach or the upper intestines . trans - dermal delivery systems that allow absorption of drugs through the skin have also been described in the prior art . galenic formulations of 4 , 4 ′- diaminodiphenylsulfone , sulfoxone , sulfetrone , thiazolsulfone , glucosulfone , acedapsone , monoacetyldapsone , n - hydroxymonoacetyldapsone and n - hydroxydapsone may be dosed regularly ( e . g ., one to several times daily ), intermittently ( when needed ), or as a combination of regular and intermittent dosages . when used regularly or intermittently , the galenic formulations of the present invention can be combined with each other , or with other dosage forms of the same drug , or with other drugs to be used by the patient . various enteric - coated tablets have also been described , or are being used therapeutically for unrelated pharmaceuticals . enteric - coated tablets , pills , caplets etc . do not release the active components of the present invention into the stomach or upper intestines , but instead deliver the drug in the non - acid environment of the intestines after passing the stomach . modified - release dosage forms of the present invention include but are not limited to parenteral injection , nasal , transdermal , rectal administration or oral formulations except acute or instant - release formulations , including “ delayed release ” formulations ( for example , see roy et al ., 1989 ), “ sustained release ” formulations ( for example , see yang and swarbrick , 1986 ), “ controlled release ” formulations ( for example , see u . s . pat . nos . 5 , 863 , 560 and 3 , 948 , 262 ), and also includes other oral formulations that are designed to offer therapeutic activity while avoiding toxicological effects and pharmacological side effects . the pharmaceutical compositions of the present invention may be formulated for , oral administration in solid , liquid , spray or gel form , for parenteral injection , nasal , transdermal or rectal administration . the compounds of the present invention may be administered by rectal suppositories such as those described in u . s . pat . nos . 4 , 368 , 185 , 4 , 698 , 359 and 5 , 482 , 973 , the disclosures of which are hereby incorporated by reference . the compounds of the present invention may be administered by nasal delivery devices such as those described in u . s . pat . nos . 4 , 294 , 829 , 4 , 624 , 965 , 4 , 749 , 700 , 5 , 250 , 287 , 5 , 629 , 011 and 5 , 693 , 608 , the disclosures of which are hereby incorporated by reference . preferably the compounds of the present invention may be administered by enteric - coated delivery devices such as those described in u . s . pat . nos . 4 , 704 , 295 , 4 , 775 , 536 and 5 , 225 , 202 , the disclosures of which are hereby incorporated by reference . preferably the compounds of the present invention may be administered by trans - dermal delivery devices such as those described in u . s . pat . nos . : 3 , 598 , 123 ; 4 , 292 , 302 ; 5 , 164 , 189 ; 5 , 312 , 627 and 5 , 464 , 387 , the disclosures of which are hereby incorporated by reference . the preferred selected dosage level chosen for the patient of the drug to be administered will be determined on an individual basis , and will be based on the pharmacological potency of the drug , age , route of administration , diet , time of administration , body weight , sex , general health , rate of excretion , drug combination , the condition , prior medical history of the patient being treated , and at least in part , on consideration of the individual &# 39 ; s size , the symptoms , and the severity of the symptoms to be treated and the results sought . also the carrying capacity of the drug may be adjusted to accommodate for the varying dosage regimes incorporated within the embodiment of the present invention . however , it is within the skill of the art to start doses of the compound at levels lower than required for to achieve the desired therapeutic and preventative effect and to gradually increase the dosage until the desired effect is achieved . in general , preferred quantities of the compounds sufficient to eliminate an unwanted medical condition will be administered . the actual dosage ( quantity administered at a time ) and the frequency of administrations will depend on the potency and the pharmacokinetic properties of the drugs . for example about from 5 mg to about 500 mg of a compound can be contained in one or more doses , one to ten such doses can be given daily . 1 . 1 ml is accepted as the maximum volume of solid a person can swallow — of course some people can swallow more and some less — and that means about 1 . 3 gm is the maximum acceptable tablet weight since the compressed tablet can have a density greater than 1 . 0 . most commercial products intended to be swallowed whole weigh 1 . 0 gm or less usually about 400 - 600 mg . the amount of active ingredient of the present invention may be combined with carrier materials to produce one or more single dosage ( s ) form will depend on the patient and the particular mode of administration . for example , a modified - release formulation intended for oral administration of humans may contain from 5 mg to about 500 mg of active agent ( s ) compounded with an appropriate and convenient amount of carrier material ( s ) which may vary from about 5 to about 95 percent of the total composition . preferred dosage unit forms will generally contain between from about 5 mg to about 500 mg of active ingredient , typically 5 , 10 , 15 , 20 , 30 mg , 50 mg , 75 mg , 100 mg , 120 mg , 150 mg , 200 mg , 250 mg , 300 mg , 400 mg or 500 mg . however , it is within the skill of the art to start doses of the compound at levels lower than required for to achieve the desired therapeutic and preventative effect and to gradually increase the dosage until the desired effect is achieved . one skilled in the art will recognize that modifications may be made in the present invention without deviating from the spirit or scope of the invention . the invention is illustrated further by the following examples which are not to be construed as limiting the invention or scope of the specific procedures described herein . a granulate is prepared , according to the process described below , which is used for the preparation of one or more of the inner layers of the tablet . this granulate contains ( per tablet ): dapsone 100 mg mannitol 10 mg microcrystalline cellulose 70 mg sodium laurylsulphate 5 mg total tablet weight 185 mg carrying capacity 40 % dapsone 60 % excipient ( mostly com - pression binder ) the manufacturing process consists in preparing a granulate by mixing together the amounts of substances as shown above and compressing into tablets . tablets are coated with ethylycellulose . in order to evaluate the release properties of the complete tablets , the vane machine ( described in usp xxiii ) is used , working at 100 rpm and using as dissolution liquid a 0 . 01m hcl solution at 37 degrees celcius . the release of the active substance is monitored by spectrophotometric determination using a sampling and automatic reading system . a controlled release of the active substance is obtained in about 17 hours . in order to evaluate the absorption of the sulfone from the distal intestinal tract with surfactant present in the tablet , tablets with and without surfactant are inserted into a distal intestinal pouch surgically created in a series of rats , with subsequent measurement of blood levels of dapsone . with surfactant present , absorption rate in the distal intestinal tract is greater . in order to evaluate the ability of a coating to protect the tablet from commencement of dissolution in the relatively acidic proximal intestinal tract , coated and non - coated tablets are placed in 0 . 01m hcl solution at 37 degrees celcius . the release of the active substance is measured after 10 minutes by spectrophotometric determination . then the respective tablets are placed in phosphate - buffered saline at ph 7 . 4 at the same temperature . the release of the active substance is again measured after 10 minutes by spectrophotometric determination . the smaller amount of dapsone release from coated tablets compared to un - coated tablets indicates that the coated tablets are resistant to dissolution in acid environment . no “ capping ”. a compressed granulate is prepared , according to the process described below , which is used for the preparation of one or more of the inner layers of the tablet . this granulate contains ( per tablet ): dapsone 100 mg mannitol 10 mg microcrystalline cellulose 50 mg alginate 15 mg sodium laurylsulphate 45 mg total tablet weight 230 mg carrying capacity 40 % dapsone 60 % excipient ( mostly com - pression binder ) the manufacturing process consists in preparing a granulate by mixing together the amounts of substances as shown above and compressing into tablets . tablets are coated with alginate . in order to evaluate the release properties of the complete tablets , the vane machine ( described in usp xxiii ) is used , working at 100 rpm and using as dissolution liquid a 0 . 01m hcl solution at 37 degrees celcius . the release of the active substance is monitored by spectrophotometric determination using a sampling and automatic reading system . a sustained release of the active substance is obtained in about 22 hours . in order to evaluate the absorption of the sulfone from the distal intestinal tract with surfactant present in the tablet , tablets with and without surfactant are inserted into a distal intestinal pouch surgically created in a series of rats , with subsequent measurement of blood levels of dapsone . with surfactant absent , absorption rate in the distal intestinal tract is greater . in order to evaluate the ability of a coating to protect the tablet from commencement of dissolution in the relatively acidic proximal intestinal tract , coated and non - coated tablets are placed in 0 . 01m hcl solution at 37 degrees celcius . the release of the active substance is measured after 10 minutes by spectrophotometric determination . then the respective tablets are placed in phosphate - buffered saline at ph 7 . 4 at the same temperature . the release of the active substance is again measured after 10 minutes by spectrophotometric determination . the smaller amount of dapsone release from coated tablets compared to un - coated tablets indicates that the coated tablets are resistant to dissolution in acid environment . no capping .
| 0 |
as best shown in fig3 and 4 , a preform 10 includes a throat 12 , a transition portion 14 , and a body 18 . throat 12 is illustrated in fig3 and 4 having a finish 21 , even though the present invention encompasses preforms that lack a finish , such as preforms adapted for forming wide mouth container in which the thread portion is blown , as will be understood by persons familiar with such wide mouth forming processes in view of the present disclosure . throat 12 forms a throat opening 20 formed therein . a circumferential support ring 23 is formed on an exterior surface of throat 20 below finish 21 . throat 12 yields to transition 14 , which yields to body 16 . body 16 is generally cylindrical , even though the present invention is not limited to employing any particular geometry of the body . body 16 terminates in an enclosed end 18 . preform 10 has an interior surface 22 and an external surface 40 . internal surface 22 includes a throat internal surface 32 , a transition internal surface 34 , and a body internal surface 36 . in general , throat internal surface couples to transition internal surface , which couples to body internal surface . the term “ couple ” when used herein to describe relationships of corresponding surfaces , encompasses having another surface disposed between the surfaces that are the objects of the term . further , the present invention encompasses radiused portions or other transitions between coupled surfaces . external surface 40 includes a throat external surface 42 , a transition external surface 44 , and a body external surface 46 . body external surface defines a diameter d1 , throat opening 20 defines an opening diameter d2 , and body internal surface defines a body internal diameter d3 . in a most preferred embodiment , and as shown in the figures , body internal diameter d3 is less than throat opening diameter d2 such that transition internal surface 34 makes the transition therebetween . throat 20 preferably has a smooth bore such that throat inner surface 32 without protrusions . throat internal surface 32 and the upper portion of body internal surface 36 are illustrated as defining substantially tight circular cylinders . the present invention is not limited to such configurations , but rather encompasses any geometric or irregular shape . further , transition internal surface 34 is illustrated as having a substantially frusto - conical shape , although the present invention encompasses any shape , including a curved shape ( in longitudinal cross section ), steps , irregularities , and the like , as will be understood to persons familiar with preform and blow molding technology considering the present disclosure . plural projections , such as elongate embosses 26 , are disposed on transition internal surface 34 . preferably , as best illustrated in fig5 three projections 26 are disposed circumferentially equidistant apart . as best shown in fig6 and 7 , each projection preferably forms a point contact 27 with an adjacent preform 10 ′ that is insertable into throat 12 . each projection 26 includes an upper rounded surface , such as half a hemisphere 28 , and a downwardly extending longitudinal tail or lower portion 30 . as best shown in fig7 projection 26 in longitudinal cross section , defines an inner edge 31 opposite transition internal surface 34 . preferably , inner edge 31 is substantially rectilinear . inner edge preferably is either parallel to preform longitudinal centerline c or inclined at a positive angle a thereto . a longitudinal line c ′ that is parallel to preform centerline c is shown in fig7 . angle a is referred to as a positive angle to indicate that projection lower portion 30 does not form an undercut , but rather is formed to facilitate removal of preform 10 from the mold . because projections 26 preferably are disposed in transition portion 14 , projections 26 are disposed in a portion of the preform that will likely be stretched and are likely to diminish or disappear during the blowing process . projections preferably are not disposed on body internal surface 36 where body internal surface forms a right circular cylinder , as a projection in such geometry would cause an undercut that would interfere with removal of preform 10 from the mold during injection molding or like process . further , the dashed lines , indicated schematically by reference numeral 11 , about preform 10 in fig4 illustrate a mold 11 employed for forming preform 10 . mold 11 forms a cavity that has the attributes of preform 10 described herein . mold manufacturing for anti - locking features described herein is generally easier and less expensive than for conventional anti - nesting features . the present invention , however , is not limited to molds that are easier and less expensive to manufacture , but rather encompasses any mold configuration subject to the description herein with respect to preform 10 . the description of the embodiment shown in the figures is provided to illustrate an embodiment of the present invention . however , the present invention is not limited to the particular attributes described herein . for example , projections 26 encompass any shapes that can provide point contact with preform 10 ′. further , point contact between projections 26 and preform 10 ′ is not required . rather , the present invention encompasses any contact between projections 26 and preform 10 ′. further , the present invention encompasses any geometry and location of projections 26 .
| 1 |
below , embodiments of the present invention will now be described with reference to the appended drawings . fig1 is a plan view of a template used for a method for manufacturing a covered string - like object according to one embodiment of the present invention . a template 1 shown in fig1 is used for an earphone cord as a string - like object to be covered . the template 1 is configured such that a plate body 2 having a rectangular shape is provided within a frame 4 , and the plate body 2 has two cut - out holes 6 and 8 formed in accordance with the shape of the string - like object to be covered . as indicated by the dashed lines in fig1 , the cut - out holes 6 and 8 are respectively covered with backings 10 and 12 attached to one surface ( the back - surface side ) of the plate body 2 using an easily removable adhesive or the like , and the string - like object ( not shown ) can be placed on the backings 10 and 12 via the cut - out holes 6 and 8 . it is preferable that the plate body 2 has such a rigidity that the plate body 2 does not deform due to the attachment of the backings 10 and 12 . the plate body 2 can be formed from , for example , cardboard , a synthetic - resin plate , or a metal plate . in accordance with the overall shape of the earphone to be covered , the cut - out holes 6 and 8 are each formed so as to be able to accommodate roughly half of the earphone cord . the cut - out hole 6 can accommodate roughly a plug - side half of the earphone cord in a straightened state . the cut - out hole 8 can accommodate the bifurcated portions of the earphone cord both in a straightened state . the cut - out hole 6 comprises a narrow holding part 6 a and a slot - like insertion part 6 b on the respective sides in the lengthwise direction . the distal part of the earphone cord is held by the holding part 6 a , and , on the other hand , an insert ( not shown ) is inserted into the insertion part 6 b to latch the mid part of the earphone cord , and it is thus possible to fix the earphone cord within the cut - out hole 6 . as with the cut - out hole 6 , the cut - out hole 8 also comprises holding parts 8 a and an insertion part 8 b . as long as the earphone cord can be reliably fixed within the cut - out holes 6 and 8 , fixing means other than the holding parts 6 a and 6 b and the insertion parts 8 a and 8 b may be used . the backings 10 and 12 are sheet - like components that a sewing - machine needle can penetrate , and it is preferable that the backings 10 and 12 are flexible so as to conform to the earphone cord during sewing . examples of the material of the backings 10 and 12 include synthetic resin film , metal foil , thin paper , and the like . since the backings 10 and 12 are eventually separated from the earphone cord , it is preferable that the backings 10 and 12 have excellent tearability , and , for example , a stretched polyethylene film or the like that is easily torn in the direction of stretch can be suitably used . next , a method for manufacturing a covered string - like object using the above - described template 1 will now be described with reference to fig2 . fig2 shows partially enlarged views of the cut - out hole 6 of the template shown in fig1 . first , as shown in fig2 ( a ) , the plug 20 a side of the earphone cord 20 in a straightened state is accommodated inside the cut - out hole 6 , the proximal part of the plug 20 a is held by the holding part 6 a , and also the side of the earphone cord 20 at the center is fixed at the insertion part 8 b shown in fig1 . in this way , the earphone cord 20 is positioned on the backing 10 via the cut - out hole 6 . subsequently , this template 1 is placed on an automatic sewing machine ( not shown ), and as shown in fig2 ( b ) , a section of the earphone cord 20 from the plug 20 a side to near the center is sewn to the backing 10 with a sewing material 22 . as shown in the enlarged view of fig3 , the sewing material 22 is composed of an upper thread 22 a and a lower thread 22 b , and a sewing - machine needle is caused to penetrate the backing 10 on both sides of the earphone cord 20 to entwine the upper thread 22 a and the lower thread 22 b by way of zigzag lockstitching , and thus the upper thread 22 a is disposed in a zigzag manner so as to cover the earphone cord 20 on the front - surface side of the backing 10 . on the back - surface side of the backing 10 , the lower thread 22 b is disposed in a zigzag manner . a pitch p of the zigzag pattern of the upper thread 22 a is emphasized in fig3 so as to appear large , but , practically , it is preferable that the upper thread 22 a is sewn at such a small pitch p that the earphone cord 20 is not exposed . it is also possible to entwine the upper thread 22 a and the lower thread 22 b in such a way that one thread forms a zigzag pattern , and the other thread linearly extends along the earphone cord 20 . as shown in fig4 ( a ) , the place where the upper thread 22 a and the lower thread 22 b are entwined may be above ( on the front - surface side of ) the backing 10 , and , also , it may be in the interior of the backing 10 or below ( on the back - surface side of ) the backing 10 as well . the thread tension can be suitably adjusted . an embroidery thread can be suitably used as the embroidery material 22 , thus making it possible to enhance the aesthetic characteristics by taking advantage of its color , luster , etc . the embroidery material 22 may be a string - like or belt - like embroidery material other than a thread - like material . the embroidery material 22 may be intended primarily for textural , anti - allergic , or like purposes other than aesthetic purposes . after about half of the earphone cord 20 is sewn to the backing 10 with the embroidery material 22 in this way , the rest of the earphone cord 20 is sewn to the backing 10 with the embroidery material 22 in the same manner as above by using the cut - out hole 8 shown in fig1 . in this way , substantially all the earphone cord 20 can be sewn to the backing 10 . thereafter , the earphone cord 20 is removed from the template 1 to separate the backing 10 from the earphone cord 20 as shown in fig4 ( b ) , and , thereby , the entire outer circumference of the earphone cord 20 is covered with the upper thread 22 a and the lower thread 22 b , and , as shown in fig2 ( c ) , it is thus possible to obtain the covered string - like object 30 in which the earphone cord 20 is covered with the embroidery material 22 . after the backing 10 is separated from the earphone cord 20 , there may be a slight remainder of the backing 10 between the earphone cord 20 and the embroidery material 22 ( see fig4 ( b ) ). forming the zigzag pattern of the embroidery material 22 at a small pitch makes it possible to prevent the remaining backing 10 from being exposed to the outside and adversely affecting the appearance . thereafter , the backing 10 ( 12 ) remaining on the template 1 is removed , then a new backing 10 ( 12 ) is attached , and it is thus possible to used the template 1 again . as described above , according to the method for manufacturing a covered string - like object of the present embodiment , the earphone cord 20 is sewn to the backings 10 and 12 with the embroidery material 22 , and then the backings 10 and 12 are separated from the earphone cord 20 . it is therefore possible to easily and reliably cover the earphone cord 20 with the embroidery material 22 without damaging the earphone cord 20 with a sewing - machine needle or the like , and thus possible to obtain the covered string - like object 30 that has good durability . moreover , the use of the template 1 on one surface of which the backings 10 and 12 have been attached makes it possible to more easily manufacture the covered string - like object 30 . one embodiment of the present invention has been described in detail above , but the specific aspects of the present invention are not limited to the above embodiment . for example , the above embodiment has been described using an earphone cord as an example of a target to be covered with an embroidery material , but other string - like objects may be used as well , such as power cords , extension cords , and like electrical cords , and cables . moreover , as shown in fig5 , one or more decorative parts 14 c may be formed by making slots that are in communication with a linear cut - out hole 14 formed in a template 1 ′, such that a backing 16 is attached so as to cover the cut - out hole 14 and the decorative parts 14 c . as shown in fig6 , with this template 1 ′, the string - like object 20 such as an earphone cord is placed in the cut - out hole 14 , a decoration 30 ( such as a leaf or a flower of a plant ) is placed in the decorative parts 14 c , and the decoration 30 can be sewn to the backing 10 with an embroidery material 32 during the course of sewing the string - like object 20 to the backing 10 with the embroidery material 22 in the lengthwise direction . the embroidery materials 22 and 32 may be the same or may be different . thereafter , the backing 10 is separated from the string - like object 20 and the decoration 30 , and it is thus possible to obtain a covered string - like object having enhanced aesthetic characteristics . in fig5 , the same components as in fig1 are given the same reference numbers .
| 7 |
the compound pime is prepared by reacting 1 , 4 - bisacryloyl - piperazine with n - methyl - ethanol amine , both of them being commercially available products . the preparation is made following conventional procedures that the skilled person well knows . preferably , the molar ratio between 1 , 4 - bisacryloyl - piperazine and n - methyl - ethanol amine is 1 : 2 . usually the reaction is performed in an appropriate solvent , at such a temperature that the reaction can take place in an appropriate period of time without creating by - products or decomposition products under an uncontrolled way . preferably , the temperature is included in the range of 10 and 50 ° c ., for a period lasting from some hours to some days . isolation and purification of the final product are performed with usual and known methods , i . e . by precipitating and , when necessary , further purifying the product . the use of the compound pime as chain extender in the preparation of polymers does not require any particular procedure , but the usual polymerisation techniques . in a first preferred realisation of the invention , the polymer is a polyurethane . especially preferred the polyurethane is prepared with an aliphatic diisocyanate , e . g . 1 , 6 - hexamethylene diisocyanate , and a macroglycol , selected among those conventionally known . the conditions of the reaction are known and described in the pertaining literature . therefore , temperature , pressure , solvents and catalysts are easily determined as a function of the desired polymer type . pime can be used as chain extender for polymers of biomedical interest , e . g ., besides the polyurethanes , the polyesters . polymers obtainable by using pime as chain extender can be used for the preparation of biomedical items to be used in contact with blood , to be implanted or not , such as for example circuits for extra - corporeal circulation and dialysis , catheters , probes , cardiovascular prostheses , an artificial ventricle in particular . such polymers can be used for surface coating of other materials or devices in order to improve their haemocompatibility . such polymers and devices and materials that incorporate them are heparinizable that is they form complexes with heparin , and such complexes are inside the present invention . to a solution prepared by dissolving at room temperature under magnetic stirring 3 g of 1 , 4 - bisacryloyl - piperazine ( bispip , 15 . 4 mmol ) in methanol ( 21 ml ), 2 . 3 g of n - methyl - ethanol amine ( mea , 30 . 9 mmol ) are added . the syringe used to add mea is then washed with ≡ 10 ml of methanol that is added to the reaction mixture . the reaction is allowed to take place at room temperature and in the dark for 3 days , always under stirring . the reaction mixture is concentrated to 1 / 4 of the original volume with a rotating evaporator under reduced pressure and at 55 ° c . the product is then precipitated into 100 ml diethylether and recovered by filtration . the filtrated powder is then washed three times with 50 ml diethylether each and dried under vacuum at 40 ° c . 5 . 6 g of a white powder are obtained ( yield = 99 %). elemental analysis : found % c 55 . 66 ; % h 9 . 40m % n 16 . 08 ( calculated % c 55 . 79 ; % h 9 . 36 ; % n 16 . 27 ) 0 . 5 g of pime , dried to constant weight for 12 h in oven at 40 ° c . under vacuum , is dissolved into distilled water and titrated with hcl 0 . 1n . 0 . 4075 g are titrated with 24 . 6 ml hcl 0 . 096n , corresponding to a 99 . 3 % purity . the point of colour change has been determined with an orion mod . sa 720 phmeter . the determination of the colour change was made by the differential method . potassium dichromate ( k 2 cr 2 o 7 ) is desiccated in oven at 150 - 200 ° c . for 2 h . after cooling down , a 0 . 1n aqueous solution is prepared . a 0 . 1n solution of mohr salt ( hexahydrated ammonic ferrous sulphate , fe ( nh 4 ) 2 * 6h 2 o ) is prepared and titrated with the k 2 cr 2 o 7 solution . as titration indicator a solution of ferroin is used , prepared by dissolving 1 . 485 g of o - phenantroline and 0 . 695 g of ferrous sulphate in 100 ml water . 0 . 35 g of vacuum dried pime is dissolved in water and 100 ml of k 2 cr 2 o 7 solution are added . the ph is lowered with concentrated sulphuric acid to ph & lt ; 2 . after stirring for a few minutes , 3 drops of ferroine are added and the excess of k 2 cr 2 o 7 is titrated with the mohr salt solution . a mixture of ethanol : chloroform : ammonium hydroxide in the ratio 10 ml : 5 ml : 30 drops was used as eluant . tlc plates , with 0 . 2 mm thick silica gel on aluminium support were used . tlc were developed by exposing to iodine vapours . retention factor is r f pime = 0 . 158 . instrument : bio - rad chr . system , equipped with a value chrom ™ chromatography software ; columns : bio - gel tsk - 30 + tsk - 40 ( bio - gel ); detector : uv , λ = 220 nm . phosphate buffer ( 0 . 1 m na 2 so 4 , 0 . 02 m nah 2 po 4 ph = 6 . 8 ) as eluant was used , at a flow rate of 1 ml / min . the sample of pime is solubilized in the same buffer ( 0 . 2 % w / v ) and injected . the chromatogram points out the presence of a single peak ( retention time : 19 . 55 min ). transmission infrared spectroscopy analysis ( ir ) was performed with a fourier - transformed spectrometer ft 1710 perkin elmer . the sample was directly deposited onto the kbr crystal by solvent casting from acetone solution . table 1 reports the main absorptions and their attributions . table 1______________________________________frequency ( cm . sup .- 1 ) attribution______________________________________3500 - 3300 stretching of oh 3000 - 2880 symmetric and asymmetric stretching of -- ch . sub . 2 2815 - 22780 symmetric stretching of -- ch . sub . 3 and of n -- ch . sub . 3 2820 stretching of amine -- n -- c -- h 1650 - 1600 stretching of amido c ═ o 1500 - 1350 bending of -- ch . sub . 2 1370 - 1310 stretching of tertiary aliphatic amine & gt ; n -- ch . sub . 3 1300 - 1150 stretching of tertiary amide c -- n 1230 - 1030 stretching of tertiary aliphatic amine c -- n______________________________________ . sup . 1 hnmr an 80 mhz instrument was used . the sample was dissolved in cdcl 3 , and the reference was tms . in table 2 values and attributions of the signals are reported . table 2______________________________________chemical shift ( ppm )* integration attribution______________________________________2 . 2 ppm ( s ) 6 h n -- ch . sub . 3 2 . 4 - 2 . 9 ppm ( m ) 12 h ch . sub . 2 3 . 2 ppm ( s )** 2 h oh 3 . 4 - 3 . 7 ppm ( m ) 12 h ch . sub . 2______________________________________ * s = singlet ; m = multiplet ; ** exchange with d . sub . 2 o dsc analyses were recorded with a differential calorimeter mettler ta3000 instrument , previously calibrated with an indium standard . the sample of 7 - 9 mg weight was heated at a rate of 20 ° c ./ min under nitrogen , in the temperature range from - 50 ° c . to + 180 ° c . a melting peak was observed at 110 . 5 ° c . ( δh = 197 . 9 j / g ). pime is soluble at room temperature in methanol , water , chloroform , and methylene chloride , dimethylacetamide ( concentration 10 mg / ml ); insoluble in diethylether at room temperature . 0 . 4231 g of pime desiccated to constant weight in oven at 40 ° c . under vacuum are left in the air ( relative humidity = 67 %) and weighed every 10 &# 39 ;. after 1 h the sample reaches the weight of 0 . 4293 ( weight % gain = 1 . 47 ) cytotoxicity of pime has been evaluated towards human endothelial cells ( hec ). hec were isolated from human umbilical vein by treatment with 0 . 1 % collagenase and cultured to confluence into plastic culture wells in medium 199 containing 20 % foetal calf serum , 50 mg / ml endothelial cell growth supplement , 50 mg / ml heparin , 50 u / ml penicillin , 50 mg / ml streptomycin , 2 . 5 mg / ml fungizone . as described in literature ( e . dejana , m . g . lampugnani , j . cell . biol ., 109 , 367 - 375 ( 1989 )). hec suspensions were seeded in tissue culture microplates of 96 well , 0 . 28 cm 2 , ( 4 × 10 3 cells / well ). after 4 h incubation , adhesion was verified , the medium was replaced with fresh one containing different pime concentrations ( 1 , 0 . 1 or 0 . 01 % w / v ). all the tests were made in triplicate . as controls , adhesion and growth values in wells containing only the culture medium were used . evaluation of cells growth was carried out stopping the experiment after 40 and 72 h from seeding ; non - adherent cells were removed by twice washing with ca ++ and mg ++ free pbs , fixed and stained with crystal violet . optical density was then read at 560 nm with an automatic photometer tirtrek . by this way , the cells viability was evaluated , being directly related to the colour intensity . table 3 shows the values for the control sample at increasing times table 3______________________________________time optical density at 560 nm______________________________________ 4 h 0 . 055 ± 0 . 007 40 h 0 . 108 ± 0 . 009 72 h 0 . 181 ± 0 . 012 * ______________________________________ the wells containing pime , in every concentration tested , gave optical density values identical or slightly higher than the control . from these results it can be deduced that pime shows a very good compatibility with the cell growth . the reaction takes place in two steps . in the first step the diisocyanate ( 1 , 6 - hexamethylene diisocyanate , hdi ) reacts with the macroglycol giving the macrodiisocyanate ; the reaction is catalysed by dibutyl - tin - dilaurate ( dbtdl ). in the second step the addition of the chain extender to the macrodiisocyanate occurs , creating high molecular weight linear chains . the stoichiometric ratio of the reagents macroglycol : diisocyanate : extender was 1 : 2 : 1 . by using three different macroglycols ( polytetramethylene glycol having molecular weight of 2000 and 1000 , poly ( 1 , 6 - hexyl 1 , 2 - ethyl carbonate ) diol and the same diisocyanate and chain extender three copolymers were synthesised , named in the following hepitan 2000 , hepitan 1000 and hepitan ca . copolymers hepitan 1000 and hepitan 2000 are obtained with polytetramethylene glycol ( ptmg ) having molecular weight of 1000 and 2000 , respectively . from poly ( 1 , 6 - hexyl 1 , 2 - ethyl carbonate diol ) ( ca ) the copolymer hepitan ca is prepared . the macroglycol was desiccated under reduced pressure at 90 ° c . for 24 h ; the chain extender was desiccated at 60 ° c . under reduced pressure for 14 h . the solvent of the reaction ( dmac , n , n &# 39 ;- dimethylacetamide ) was distilled under reduced pressure and kept over molecular sieves . a solution of hdi ( 1 . 61 g ; 10 mmol ) and catalyst ( 0 . 1 g ) is prepared under inert atmosphere , at 65 ° c ., under stirring . the macroglycol ( 5 mmol ) dissolved into 25 ml dmac is added dropwise . the mixture is allowed to react for 90 min at 65 ° c . ( the reaction time was estimated by titration of the isocyanate groups ). the reaction mixture is then precipitated into deionized water and the precipitate is washed twice with water , each washing lasting two hours . the product is desiccated under reduced pressure at 40 ° c . until constant weight . the titration of unreacted -- nco groups was carried out on samples withdrawn from the reaction mixture at different reaction times . the method of the analysis follows the guidelines of astm d2572 - 70 standard practice , according to which a sample of the reaction mixture is reacted with an excess of n - dibutyl amine , according to the following reaction : at the end of this reaction , the excess of n - dibutyl amine is determined by inverse titration with hcl of known titre . a sample of about 1 g weight is taken from the reaction mixture , weighed with a technical scale . dilution is made with 25 ml of dmac . 5 ml of 0 . 05m n - dibutyl amine in dmac is added with a burette , the solution is stirred for 15 minutes . titration is performed with 0 . 05n hcl , using blue of bromophenol as indicator . blank titration is performed separately . theoretical -- nco moles present in the sample taken from the reaction mixture are : ## equ2 ## where w is the weight of the sample . the reaction mixture is regularly sampled until the -- nco content is constant . from these data , the reaction can be considered ended after 5 h from the addition of the macroglycol to the solution containing the diisocyanate and catalyst . a 15 % solution of the copolymer in dimethylacetamide at 40 ° c . is prepared . the solution is washed three times with equal volume of petroleum ether in a separatory funnel . residual tin content , evaluated by inductively coupled plasma emission spectrophotometry ( icp ), is ≦ 50 ppm . considering that hard segment is composed of the diisocyanate and the chain extender , the weight per cent of hard segments (% s h ) is calculated as follows : ______________________________________ hard molar mass 2 × mhdi + mpime % s . sub . h = -- × 100 = -- × 100 polyurethane 2 × mhdi + mglycol + molar mass mpime______________________________________ table 4______________________________________ % s . sub . h______________________________________ hepitan 2000 25 . 3 hepitan 1000 40 . 5 hepitan ca 29______________________________________ characterisation is performed by viscosimetry , gel permeation chromatography ( gpc ), fourier transformed infrared spectroscopy ( ft - ir ), differential scanning calorimetry ( dsc ), and mechanical tensile tests . solubility tests of the copolymers were also performed . solubility of the purified copolymer , at a concentration of 0 . 5 % w / w , was checked . the copolymer was cut into pieces of about 3 × 2 × 0 . 7 mm and put in each of the selected solvent . it was left for 24 h under stirring at room temperature . a identical solution was then prepared , letting it at a temperature ranging between 40 ° c . and 50 ° c ., until a maximum time of 6 h . the copolymers were soluble at room temperature in dimethylacetamide , dimethylformamide , and tetrahydrofuran ; insoluble in acetone , 2 - butanone , methanol , ethanol , petroleum ether , diethyl ether , and hexane . soluble in ethanol and methanol at 45 ° c . a capillary viscometer in a thermostatic bath ( haake dc3 ) at 40 ° c . was used . the sample was dissolved into dimethylacetamide at a concentration of 1 g / dl . results are reported in table 5 . table 5______________________________________ [ η ] ______________________________________ hepitan 2000 0 . 91 hepitan 1000 0 . 98 hepitan ca 0 . 90______________________________________ the analyses have been performed with a waters gpc instrument ( pump , column thermostat , refraction index detector , thermostat , integrator ) equipped with a set of four columns in series : shodex ad 802 / s , ad 804 / s , kd 803 , ad 80 m / s . as eluant , dimethylformamide hplc grade at 40 ° c . and at a flow rate of 1 ml / min was used . the calibration curve , obtained with a kit of polymethylmethacrylate standard samples ( polymer laboratories ), had a coefficient of linear regression higher than 0 . 99 . all the samples were filtered before the analyses . all polyurethanes showed m w and m n values in agreement with data reported in literature , having dispersion indexes comprised between 1 . 5 and 2 . 5 . an example : hepitan 2000 shows m w = 257 . 000 , m n = 173 . 000 ( d = 1 . 48 ). the transmission infrared spectroscopic analyses were performed with a fourier transformed infrared spectrometer ft 1710 perkin elmer . samples were circular films of 3 cm diameter obtained by solvent casting from 0 . 5 % w / v dmac solutions . a differential scanning calorimeter mettler ta 3000 was used , with indium for calibration . the sample ( 10 - 16 mg weight ) was cooled at - 150 ° c . and subsequently heated to 300 ° c . at a flow rate of 20 ° c ./ min under dry nitrogen ( nitrogen flow rate = 50 cm 3 / min ). table 6______________________________________ tm (° c .) tmll (° c .) tg ( δh / j / g ) ( δhj / 1 ) ______________________________________hepitan 2000 - 72 14 . 5 ( 29 . 7 ) 270 ( 20 . 1 ) hepitan ca - 68 23 . 2 ( 56 . 5 ) 234 ( 4 ) ______________________________________ mechanical tensile tests on hepitan 2000 have been performed at a deformation rate of 20 mm / min at 25 ° c . with a instron dynamometer model 4301 having a 1 kn load cell and connected with a pc , allowing the control and programming of the apparatus with a software supplied by the manufacturer ( instron series xii ). the sample sheets were prepared by solvent casting from a 15 - 20 % w / v solution in dmac . the solution was cast into 8 × 5 cm rectangular dies made of glass ( about 3 . 5 g of polymer in each cast ), and then maintained at 40 ° c . under reduced pressure for 48 - 72 h . the obtained sheets had a thickness of 0 . 5 - 1 mm . from the sheets , with a manually operated cutter , specimens having size and form according to astm d - 638 standard practice , which provides the use of at least 5 dog - bone specimens , were obtained . the stress / strain curves show the typical trend of polyurethane elastomerics ( see fig1 ). following an initial increase of the modulus until the yield point , the material shows a relaxation , with a decrease of the elastic modulus , which then increases again until break . tests of structural stability were carried out for hepitan 2000 in deionized water ( 21 days at 37 ° c .) and buffered saline solution , pbs ( 25 days at 37 ° c .). as reference , two commercial polyurethanes , a polyether - urethane ( pellethane 2363 80 ae ) and a polycarbonate - urethane ( corethane ) were selected . to evaluate the presence of products released from the materials , gp - hplc analyses of contacting solutions were performed after 25 days in pbs and 14 / 21 days in h 2 o . two samples for each material , having a rectangular shape of 10 × 20 mm , with a thickness ranging from 0 . 3 to 0 . 5 mm , were desiccated in a vacuum oven at 40 ° c . for 16 h ( until constant weight ), before and after incubation with h 2 o and pbs . the samples were cut from sheets obtained by solvent casting . stability in h 2 o at 37 ° c . ( 21 days ) the samples were immersed into glass tubes containing 20 ml of deionized water . after 14 days immersion , a hplc analysis of the water in contact with the samples was performed . after having replaced this water with a fresh one , the samples were left at 37 ° c . for an additional week . this water was analysed by hplc too . the samples were then weighed , after having been dried in a vacuum oven at 40 ° c . for 16 h . table 7______________________________________stability in h . sub . 2 o at 37 ° c . for 21 days weight loss ( mg ) weight loss (%) ______________________________________hepitan 2000 0 - 0 . 3 0 . 18 corethane 80a 0 - 0 . 1 0 . 06 pellethane 0 - 0 . 2 0 . 08______________________________________ after 21 days immersion into deionized water at 37 ° c ., a per cent weight loss & lt ; 1 % was observed for the analysed polyurethanes . the chromatographic analysis of water in contact for 14 days with the materials shows only not significant traces of released substances . moreover , chromatography of the second contacting water evidenced that no substances were released from the samples . the samples were immersed into 20 ml glass tubes containing pbs ( phosphate buffered saline solution , ph = 7 . 4 ), prepared by dissolving a tablet of phosphate buffer into 200 ml of deionized water . 0 . 02 % sodium azide was added to prevent bacterial growth . the tubes were placed in oven at 37 ° c . for 25 days . after this time , as shown in table 8 , a per cent weight loss & lt ; 1 % was observed for the considered polyurethanes . table 8______________________________________stability in h . sub . 2 o at 37 ° c . for 21 days weight loss ( mg ) weight loss (%) ______________________________________hepitan 2000 0 . 8 - 1 0 . 72 corethane 80a 0 . 3 - 0 . 2 0 . 24 pellethane 0 . 4 - 0 . 8 0 . 52______________________________________ the ability of binding heparin stably by hepitan 2000 copolymer was evaluated with 125 i labelled heparin , in comparison with two commercially available biomedical polyurethanes ( pellethane 2363 80ae , and corethane 80a ). the kinetic versus time of the binding between heparin and polyurethanes was evaluated . then , the subsequent release of adsorbed heparin was checked in physiological buffer solution ( pbs ), alkaline solution ( naoh 1m ) and detergent solution ( sds 2 %), in the order . the amount of released heparin has been measured by gamma radiation counter ( cobra ii auto - gamma ( camberra packard )). heparin was reacted with the bolton - hunter reactive ( thrombosis research , 14 , 845 - 860 ( 1979 )) ( shpp : succinimidyl hydroxyphenyl propionate ), which has an aromatic ring capable of binding 125 i isotope . a gel filtration was carried out in order to purify the derivatized heparin from the unreacted reactive . the amount of labelled heparin was evaluated by a calorimetric method . 5 . 3 mg of heparin were reacted with an excess of succinimidyl hydroxyphenyl propionate ( shpp ( 5 . 3 mg )) in 5 ml of 0 . 05m sodium borate ( ph 9 . 2 ) at 4 ° c . for 20 h . the unreacted shpp excess was hydrolysed into acid and separated by gel filtration in water on a pd - 10 column ( pharmacia ) filled with a previously equilibrated sephadex g - 25 m . radio - iodination was carried out by incubating at room temperature a solution of heparin and na 125 i in a glass tube coated with iodogen ( 1 , 3 , 4 , 6 - tetrachloro - 3a , 6a - diphenyl glycoluryl , used as oxidative reagent ). free 125 i is separated from labelled heparin through a g - 25 resin column . the amount of 125 i present in the eluant was measured by gamma counter . disks ( 5 mm diameter , 0 . 5 mm thickness ) were cut from film obtained by solvent casting . tests were made in duplicate for every test time . samples were preincubated in pbs + 0 . 02 % nan 3 for 2 days ; subsequently , pbs + nan 3 is substituted and the labelled heparin ( 60 ml , 150 mg , corresponding to 50000 cpm ) is added . the amount of bonded heparin was evaluated after 30 &# 39 ;, 60 &# 39 ;, 2 h , 4 h , 6 h , 24 h . after each incubation time , the samples were washed twice with pbs + nan 3 and dried before counting radioactivity . in fig2 obtained results are plotted : time is reported in minutes along the abscissas , while the amount of absorbed heparin in mg / cm 2 is reported on the ordinates values were calculated considering that heparin is bonded at the surface of the sample , which is calculated considering the two faces of the disk and the lateral surface . the samples that had been incubated with heparin for 6 h were repeatedly washed with pbs to evaluate the amount of adsorbed , but not stably bonded , heparin . subsequently , these samples were washed with 1m naoh , in order to evaluate the amount of electrostatically bonded heparin . finally , they were washed with a detergent solution ( 2 % sds ). hepitan 2000 shows a far higher ability of binding heparin , if compared to the commercial polyurethanes , for which heparin binding is almost zero . for hepitan , the amount of bonded heparin grows quickly in the first part of the kinetic curve , after 6 h the curve reaches almost a plateau . observing the plot of heparin release it is possible to draw the conclusion that heparin is very stably bonded on hepitan 2000 : in fact , the release is slow and incomplete for the washings with in pbs and naoh , but it is necessary to use a detergent in order to achieve the total release . from these data one can conclude that the bond type between hepitan 2000 and heparin seems to be not exclusively of the ionic type , as the washing with naoh 1m does not give the total release of bound heparin . hydrophobic interactions ( which are eliminated with a detergent , such as sds ), are likely to occur together with the ionic bond .
| 8 |
the present invention provides an emissive circuit capable of adaptively adjusting the brightness . some of the embodiments of the present invention will be described in detail and clearly as follows . otherwise , for easily understanding and clarifying the invention , the parts of the illustration is not depicted in corresponding scale . some scales and related ratio has been exaggerated , and the unrelated parts have not fully shown for the concise drawing . however , except for the detailed description , the invention can widely apply in others . and the invention is not limited here but the claims . referring to fig2 , it shows a schematic diagram illustrating a circuit for a pixel unit of display of one embodiment of the present invention . in order to clarify the present invention , only one pixel unit is depicted here . however , the technician who is familiar in the field knows how to combine all the pixel units to form a dots array display . furthermore , the emissive device can be adapted to the invention although the embodiments take examples as an organic light emitting diode ( oled ), however , the other emissive device can to applicable the present invention . the pixel unit normally combines the emissive device 202 and the driving circuit 201 is electrically connected in series . in the present embodiment , the emissive device 202 is an organic light emitting diode ( oled ); the driving circuit 201 includes a p type thin film transistor ( p - tft ) and it can further be a low temperature poly - silicon ( ltps ), the amorphous silicon ( a - si ) or the organic thin film transistor . the pixel unit ( 201 , 202 ) and the brightness adjusting circuit 203 are electrically connected in series and they are normally using the same procedures to be formed on the glass substrate . the brightness adjusting circuit 203 is basically an optical sensor or optical detecting device or circuit . for example , it can be a device of the photo - reactive resistance ( or say light - resistance ) or it can be an apparatus that generates leakage current when receiving light . the cathode of the oled 202 is electrically connected to the power end vss and the anode is electrically connected to the drain , d of the p - tft . the two ends of the brightness adjusting circuit 203 are connected to the other power end vdd and the source , s of the p - tft , respectively and between the two ends , there is a potential difference . the potential difference depending on the changing of the intensity of the incident ray adjusts the potential of the source , s of the p - tft . the data signal vdata transmitting to the gate , g of the p - tft and the potential difference of the source , s of the p - tft control the emissive intensity of the emissive device 202 . the brightness adjusting circuit 203 is for receiving the incident ray from the ambient environment and according to the intensity of the incident ray it changes the characteristics ( such as adjusted the resistance value or adjusted the two ends potential difference ) for adjusting the potential or current of the pixel unit 201 , 202 . for instance , when the intensity of incident ray increases , the brightness adjusting circuit 203 reduces its resistance or reduces its two ends potential . in the present embodiment , when the potential difference of the two ends of the brightness adjusting circuit 203 reduces , and the inputting data vdata of the driving circuit 201 are not changed , so the source s and the gate g of the potential difference of the p - tft increase so as to immediately increase the driving current id of the emissive device 202 , then the emissive intensity of the emissive device 202 increases and the brightness and the contrast of the display are kept . on the contrary , when the intensity of the incident ray decreases , the brightness adjusting circuit 203 adjusts the driving current id for avoiding harsh lightening . referring to fig3 , it shows a schematic diagram illustrating another circuit for a pixel unit of the display of another embodiment of the present invention . similarly , in order to clarify the present invention , only one pixel unit is depicted here . in the present embodiment , the pixel unit is combined with oled 302 and n type thin film transistor ( n - tft ) 301 are electrically connected in series . the anode of the oled 302 is electrically connected to the power end vdd and the cathode is electrically connected to the drain d of the n - tft 301 . the two ends of the brightness adjusting circuit 303 are electrically connected to the other power end vss and the source s of the n - tft 301 , respectively . the inputting data vdata are received from the gate g of the n - tft 301 and it uses to control the emissive intensity of the emissive device 302 . the brightness adjusting circuit 303 receives incident ray from the ambient environment and according to the intensity of the incident ray it changes its characteristic ( such as adjusted the resistance value or adjusted the two ends potential difference ) for adjusting the outputting potential of the brightness adjusting circuit 303 , the potential of the pixel unit 301 , 302 or the value of the id current . the theory of the circuit operation is similar to fig2 and it is not going to repeat the description . fig4 shows a schematic diagram illustrating an emissive circuit and a brightness adjusting circuit according to the further embodiment of the present invention . referring to fig4 , it helps to further understand the internal operation of the brightness adjusting circuit ( including 203 or 303 ) and to understand the relation between the brightness adjusting circuit and other pixel units . the display area 402 includes the pixel unit 100 arranged in dot a array . every sequential pixel unit is electrically connected to the power line 403 , respectively . and then every power line 403 is collected to be a power bus b . the other power bus a is electrically connected to the power end vdd . in the present embodiment , the brightness adjusting circuit 401 includes one or more p - tft 4011 . however , the brightness adjusting circuit 401 also can use n - tft or other optical sensor or optical detector . when the display operation , the potential vs between the power bus b and power line 403 is : wherein , the “ i ” means that the current goes through the power bus a , the brightness adjusting circuit 401 and the power bus b . the “ ra ” means the resistance of the power bus a . the “ rb ” means the resistance of the power bus b . and the “ r401 ” means the resistance of the brightness adjusting circuit 401 . the gate - source potential vgs of the driving tft ( such as p - tft in fig2 ) in the pixel unit is : according to the equation , when the intensity of the incident ray is increased it brings about the resistance r 401 of the brightness adjusting circuit 401 decreased or the potential difference of the two ends of the brightness adjusting circuit 401 reduced , the vgs of the p - tft of the pixel unit 100 goes more negative . in other words , the absolute value of gate - source potential | vgs | of the p - tft goes larger ( such as | vgs | become big ) so as to increase the id current , which goes through emissive device ( such as emissive device 202 shown in fig2 ) to emit more strongly . it means that the intensity of the incident ray is substantially in direct proportion to the current , which goes through oled . another embodiment , since the intensity of the incident ray decreases , the resistance r 401 of the brightness adjusting circuit 401 increases . when the resistance r 401 of the brightness adjusting circuit 401 increases , the current id which goes through the oled decreases to emit more light . as the result , the invention achieves the purpose of auto - adjusting brightness . although the description discloses the preferred embodiment herein , it is not limit the spirit of the invention . it is intended that the specification and examples to be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims . for instance , in the embodiment of the present invention , the power line 403 and the power bus b can be suitably and selectively layout . the brightness adjusting circuit 401 is required depending on the actual condition to increase or decrease . the layout and the amount of the brightness adjusting circuit 401 also can be adjusted . for example : the brightness adjusting circuit 401 can be placed on the bottom of the display and be formed as a bar . when the shadow partially blocks the brightness adjusting circuit the display changes a little light and it does not affect viewing . when the ambient environment is not any light , the brightness adjusting circuit 401 adaptively adjusts to the minimum brightness and the user will not feel as harsh .
| 6 |
fig1 through 4 of the drawing are concerned with one form of system according to the invention in which electromagnetic energy is transmitted into an explosion prone area by means of a coaxial cable conduit . in fig1 an explosion prone area is indicated diagrammatically as an enclosing structure 10 consisting of side walls and a top or ceiling wall . the components of the lighting system include a plurality of lighting devices 20 , a plurality of radiating antennas 30 which are connected to a coaxial cable conduit 40 , and an electromagnetic radio frequency power oscillator 50 located outside the structure 10 . for this system , the power oscillator 50 may generate radio frequency energy in the lower frequency ranges beginning at about 13 . 5 mhz , for example . the lighting device 20 consists of a fluroescent lighting tube 21 which may have similarities to conventional fluorescent lighting tubes , but without any electrodes . the tube 21 may be an elongated sealed glass envelope preferably having no metallic parts , the inner surface of which is coated with a fluroescent or phosphorescent material such as calcium tungstate , zinc sulphide or zinc silicate , which emit visible light when excited . the tube also contains a gas such as mercury vapor , the molecular structure of which is capable of excitation by radio frequency electromagnetic radiation , so that the excited gas in turn activates the fluorescent material . the tube may be energized then by radio frequency electromagnetic energy which irradiates the tube from an exterior radiating device and without the need of any electrical or physical connection . in this system , utilizing the medium to high frequency mode of operation , it is important that the length of the tube 21 be equal to at least a one - quarter wave length of the generated radio frequency energy of the system . it is also important that the associated radiating element or antenna , to be described , have a length equal to at least a one - quarter wave length of the generated radio frequency energy . with this described matching of physical lengths and wave lengths , the light output from the tube will be uniform and will be maximized . while the tube 21 is inherently safe , from the standpoint of causing an explosion , because it is cool operating and does not have any spark creating electrodes , the tube is desirably encased in an envelope or sleeve 22 of transparent plastic material for example to minimize the possibility of breakage from external impact for example . the outer envelope 22 may be closed in any suitable manner . the tube 21 may be conveniently retained within the outer envelope 22 by cushioning devices such as encircling o - rings 23 . as seen in fig1 the lighting devices 20 may be supported from the top wall or other surface of the structure 10 by means of a suitable bracket 24 which is electrically insulating and preferably contains no metallic parts . as seen in fig1 the coaxial cable 40 is suspended from the top wall of the structure 10 by means of suitable insulating brackets 41 , and would traverse the top wall of that structure to pass adjacent to the several lighting devices 20 . as seen in fig3 the coaxial cable 40 consists of a central conductor 42 , heavy surrounding sleeve of core insulation 43 , an outer tubular conductor 44 surrounding the core insulation , and a rugged outer insulation sleeve 45 surrounding the outer conductor preferably formed of thick plastic . in this system , as will now be described , the outer conductor 44 is not connected electrically to any component or structure within the structure 10 , but serves as a shield for the radio frequency energy transmitted by means of the central conductor 42 . accordingly , even should the outer conductor 44 be exposed through damage to the cable , there is little chance that such exposure could create a spark which might trigger an explosion within the explosion prone area . a radiating antenna 30 is coupled to the coaxial cable adjacent to each of the lighting devices 20 ; and for maximum performance of the system it is important that these antennas be tapped into the coaxial cable at the high point of the current node of the generated radio frequency energy . the proximity of the antenna 30 to the lighting device 20 would be dependent on the power of the generated radio frequency energy . in a system of low power it may be desirable that the antenna 30 be very close , such as within a few centimeters , of the lighting device . the antennas 30 may be physically supported relative to the coaxial cable in any suitable manner ; and it may be desirable that the antenna and lighting device be supported relative to or even contiguous to each other in any suitable manner . as an alternative structure , it may be desirable that the antenna 30 and the lighting device 20 be so arranged as to be contained in a single housing 70 , made of a transparent plastic or other transparent insulating material which completely encapsulates the antenna and the lighting device . the purpose of this encapsulating housing is to mitigate spurious radio frequency emissions ; and for this purpose the housing may be coated on the inside with an optically transparent but conductive coating to shield , contain and absorb the radio frequency energy . alternatively , conductive wires may be embedded in the walls of the housing 70 to serve the same purpose . the electrically conductive optically transparent coating , or the embedded wires in the housing walls , serve as a &# 34 ; faraday shield &# 34 ; and contain the radio frequency energy within the housing thereby reducing or eliminating the leakage of radio frequency energy from the housings . further , where wires or other conductive strands are embedded in the walls of the container , or possibly secured to the interior surfaces of the container walls , these wires or strands may have a flat or strip - like geometry , with the flat surfaces of the strands oriented parallel to the direction of the emitted light in order to maximize the light output from the housing . the antenna 30 consists of an elongated rod or tube 31 of copper for example completely enclosed , except at its coupling end , by a sleeve or coating of rugged insulating material which is of course transmissive of electro magnetic radio frequency energy . the insulating coating is to prevent the exposure of any metallic surface within the explosion prone area . at the coupling end , the antenna rod 31 is electrically connected to the center core 42 of the coaxial cable by means of a conductor lead 33 ; and the antenna 30 is physically supported relative to the coaxial cable in any suitable manner . to enable the coupling to the coaxial cable , a side opening is made through the outer insulation 45 , the outer conductor 44 and the core insulation 43 to expose the center conductor 42 ; and after the coupling is made , this exposed area of the coaxial cable is entirely sealed with an electrically insulating material 34 which also seals the coupling end of the antenna 30 , to assure that the lead conductor 33 is fully insulated from exposure . for maximum system efficiency , it is desirable that the radiation from the antenna 30 be directionalized toward the associated lighting device 20 . one form of directional lighting reflector is illustrated in fig3 and 4 , where the position of a lighting device 20 relative to the antenna 30 is indicated in phantom lines . for the illustrated antenna , as best seen in fig4 it is assumed that the exterior surface of the insulation body 32 surrounding the rod 31 is cylindrical and concentric with the rod 31 . approximately one half of this cylindrical surface , on one side of an axial plane , is provided with a coating or layer 36 of a material which is reflective of radio frequency electromagnetic radiation , and which may or may not include metallic particles or components . the antenna , including this layer 36 , is then enclosed or encapsulated by an outer insulating layer or sleeve 37 which is , of course , transmissive of radio frequency electromagnetic radiation . for maximum efficiency of this reflector , the distance between the antenna rod and the reflector may desirably be related to the wave length of the radiated waves . the power oscillator 50 is illustrated as having an associated power supply 51 , the power supply having a variable power control 52 for controlling the power of the generated radio frequency energy . fig5 and 6 of the drawing are concerned with another form of system according to the invention in which radio frequency electromagnetic energy is transmitted into an explosion prone area by means of a waveguide conduit 60 . in fig5 an explosion prone area is again indicated diagrammatically as an enclosing structure 15 consisting of side walls and a top or ceiling wall . the components of the lighting system include a plurality of lighting devices 20 as previously described , the wave guide 60 and associated radiating devices in the form of resonant horns 65 , and the electromagnetic radio frequency power oscillator 50 again located outside the structure 15 . for this system , the power oscillator 50 will generate radio frequency energy in the super high frequency range for example , wherein that energy must be transmitted through suitable waveguide . the lighting devices 20 may have the same construction previously described ; and are indicated as being supported horizontally from the ceiling of the structure 15 by suitable brackets 26 , again fabricated from electrically insulating material . the waveguide 60 may be fabricated from copper tubing , either circular or rectangular in cross section , and dimensioned in accordance with the frequency of the energy to be transmitted into the explosion prone area . in this higher frequency range , it is not necessary that the radiating antenna be positioned parallel to the lighting device ; and it has been found that the system works well with the radiating horn aligned axially with an elongated tubular lighting device . also , since the wave length of the radiant energy is short relative to the length of the tube , the length of the lighting tube 21 is not so critical for efficient operation . in the illustrated system , a plurality of resonant horns 65 are associated each with respective lighting devices 20 ; and these resonant horns are secured to the principal waveguide transmission conduit 60 by means of branch conduits 61 . the radiating horns 65 may be completely encased or surrounded by a thick layer of an insulating material 62 which is transmissive of electromagnetic radiation , fabricated from a plastic material for example , to prevent the possibility of another metal object contacting the horn and reducing its radiation efficiency . similarly the entire waveguide transmission conduit 60 and branch conduits 61 may be coated or otherwise protected with an insulating material for the same reason , and also to eliminate the possibility of an explosion triggering spark from metal to metal impact . should one of the lighting tubes 20 be broken by an external object , there is no danger of explosion since there is no internal electric arc , only excited gas molecules . the radiating antenna for this system may be a dishshaped antenna , rather than the illustrated resonant horn antenna 65 ; and in either case the radiating device or antenna will radiate a concentrated field of electromagnetic energy to the lighting device 20 for efficient system operation . again , as an alternative construction , the resonant horn 65 and the lighting device 20 may be arranged as to be contained in a single housing 80 made of a transparent plastic or other transparent insulating material which completely encapsulates the horn and lighting device . the purpose of the housings 80 is the same as that of the housings 70 for the system of fig1 namely to mitigate spurious radio frequency emissions . in the above described systems , the coaxial cable 40 and the waveguide 60 are described as being directly connected to the power oscillator 50 . it will be appreciated that the single conductor 42 of the coaxial cable or the wave guide may be dielectrically coupled to the generator 50 without a direct electrical connection . this will protect against the generator being struck by lightning , or being contacted by a power line , for example . one aspect of the present invention is a method for providing illumination in an explosion prone area ; and the above described systems are examples of systems for providing such illumination according to a method which includes some or all of the following steps . at least one and preferably a plurality of lighting devices are placed at the desired locations within the explosion prone area to provide the necessary or desired illumination . the lighting devices are fabricated to include a sealed envelope which has fluorescent material on the inner wall surfaces thereof , which fluorescent material is responsive to some form of excitation such as radiation to cause it to fluoresce and produce visible light . the envelopes of the lighting devices also contain a gas which is responsive to radio frequency electromagnetic radiation to excite or activate the fluorescent material of the lighting device . radio frequency electromagnetic energy is generated at a location remote from , or outside of , the explosion prone area ; and that electromagnetic energy is transmitted into the explosion prone area by means of a suitable transmission conduit such as coaxial cable or waveguide . the transmission conduit is insulated to minimize the possibility of any electric spark created either internally , or through contact with another metal object within the explosion prone area . at least one and preferably a plurality of radiating devices are placed within the explosion prone area and connected to the transmission conduit . these radiating devices are so related to the conduit to tap into the conduit at maximum energy points for efficiency of radiation ; and the radiating devices placed in physical relation to the several lighting devices to efficiently irradiate the several lighting devices with electromagnetic radiation . the radiating devices are encased or otherwise insulated with electrically insulating material which is passive to electromagnetic radiation , to prevent contact with other articles within the explosion prone area which might tend to cause a spark or intense heat . the lighting devices are excited or activated by the radiating electromagnetic energy to provide the desired illumination within the explosion prone area . all components of the system are supported within the explosion prone area in a manner to be electrically isolated from the structure which defines that explosion prone area . what has been described is a novel method and system for providing desired illumination in explosion prone areas , where the atmosphere of such areas is inherently explosion prone because of dust , vapors , or other environmental conditions , and where the occurrence of flame , spark , or intense heat may trigger an explosion . a principal feature and advantage of the system is that there is almost no possibility of the occurrence of such flame , spark or intense heat resulting from the lighting system . another advantage of the system is that the possibility of such flame , spark or intense heat is remote , even when the system is interfered with by elements within the explosion prone area which are not a part of the lighting system . an important feature of the system is that the lighting devices are completely sealed , are physically independent of the energizing source in that there is no wired or other physical connection , and may be protected against breakage without significantly impairing the illumination capability . another important feature of the invention is that the lighting devices are capable of being excited or activated by radio frequency electromagnetic energy which may be generated and irradiated over a very wide range of frequencies ; and that electromagnetic energy may be generated exterior of or remote from the explosion prone area and transmitted into the explosion prone area by suitable insulated and protected transmission conduits . an advantage of the invention is that the system may utilize conventional fluorescent tubes with damaged electrodes , which have no further useful life in the conventional fluorescent lighting systems which require direct electrical connection to the fluorescent tubes . while preferred embodiments of the invention have been illustrated and described , it will be understood by those skilled in the art that changes and modifications may be resorted to without departing from the spirit and scope of the invention .
| 7 |
the present invention relates to metal strip resistors and a method of making metal strip resistors . the method is suitable for making an 0402 size or smaller , low ohmic value , metal strip surface mount resistor . an 0402 size is a standard electronics package size for certain passive components with 0 . 04 inch by 0 . 02 inch ( 1 . 0 mm by 0 . 5 mm ) dimensions . one example of a smaller size of packaging which also may be used is an 0201 size . in the context of the present invention , a low ohmic value is generally a value suitable for applications in power - related applications . a low ohmic value is generally one that is less than or equal to 3 ohms , but often times in the range of 1 to 1000 milliohms . the method of manufacturing the metal strip resistor uses a process wherein the terminations of a resistor are formed by adding copper to the resistive material through sputtering and plating . this method utilizes photolithographic masking techniques that allow much smaller and better defined termination features . this method also allows the use of the much thinner resistance materials that are needed for the highest values in very small resistors yet , the resistor does not use a support substrate . fig1 is a cross - sectional view of one embodiment of a metal strip resistor of the present invention . a metal strip resistor 10 is formed from a thin sheet of resistance material 18 such as , but not limited to evanohm ( nickel - chromium - aluminum - copper alloy ), manganin ( a copper - manganese - nickel alloy ), or other type of resistive material . the thickness of the resistance material 18 may vary based on desired resistance . however , the resistance material may be relatively thin if desired . note that the resistance material 18 is central to the resistor 10 and provides support for the resistor 10 and there is no separate substrate present . the resistor 10 shown in fig1 also includes an optional adhesion layer 16 which may be formed of cutiw ( copper , titanium , tungsten ). the adhesion layer 16 , where used , is sputtered over the surface of the resistive material 18 for the copper plating 14 to bond to . some resistance materials may require the use of the adhesion layer 16 and others do not . whether the adhesion layer 16 is used , depends on the resistance material &# 39 ; s alloy and if it allows direct bonding of copper plating with adequate adhesion . if an adhesion layer 16 is desirable and both sides of the resistance material 18 are to receive pads then both sides of the resistance material 18 should be sputtered with an adhesion layer 16 . prior to the sputtering process a metal mask ( not shown in fig1 ) may be mated with the sheet of resistance material 18 to prevent the cutiw material from depositing onto areas of the sheet that will later become the active resistor areas . this mechanical masking step allows one to eliminate a gold plating and etch back step later in the process thus reducing cost . where gold plating is used , or other highly conductive plating , the gold plating 24 overlays the copper plating 14 . a plating 28 is provided which may be a nickel plating . a tin plating 12 overlays the nickel plating 28 to provide for solderability . also shown in fig1 is an insulative coating material 20 which is applied to the resistance material 18 . the insulative coating material 20 is preferably a silicone polyester with high operating temperature resistance . other types of insulating materials may be used which are chemical resistant and capable of handling high temperature . fig2 illustrates a relatively thin sheet of resistance material such as evanohm , manganin or other type of resistance material 18 . the resistance material 18 serves as the substrate and support structure for the resistor . there is no separate substrate present . the thickness of this sheet of resistance material 18 may be selected to achieve higher or lower resistance value ranges . a field layer of cutiw ( copper , titanium , tungsten ) or other suitable material is sputtered over the surface of the resistive material 18 as an adhesion layer 16 for the copper plating to bond to . prior to the sputtering process , a metal mask may be mated with the sheet of resistance material 18 to prevent the cutiw material or other material for the adhesion layer 16 from depositing onto areas of the sheet that will later become the active resistor areas . this mechanical masking step eliminates a gold plating and etch back step later in the process thus reducing cost . next a photolithographic process is performed . the photolithographic process may include laminating a dry photoresist film 22 to both sides of the resistance material 18 to protect the resistance material 18 from copper plating . a photo mask may then be used to expose the photoresist with a pattern corresponding to the copper areas to be deposited onto the resistance material . the photoresist 22 is then developed , exposing the resistive material in only the areas where copper or other conductive material is to be deposited as shown in fig2 . fig3 illustrates the copper pattern 14 . the copper pattern may include individual terminal pads , stripes , or near complete coverage except in areas that will be the active resistor area . the pad size may be defined at the punching operation in cases where stripes and near - full coverage patterns are used . the terminal pad geometry and number can vary depending on the pcb mounting requirements and electrical connections required such as 2 - wire or 4 - wire circuit schemes , or multi - resistor arrays . copper 14 is plated in an electrolytic process . a thin layer of au ( gold ) 24 is electroplated over the copper . the photoresist material is then stripped as shown in fig4 and subsequently the cutiw material 16 not covered by copper plating 14 is stripped from the active resistor areas in a chemical etch process . in another embodiment the gold layer 24 is not added and the cutiw layer 16 is not stripped back after removing the photoresist layer to save manufacturing cost but at the expense of electrical characteristics . in a further embodiment the gold is not added and stripping is not necessary because the cutiw material was mechanically masked at the sputtering step . the resulting terminated plate may be processed as a sheet , sections of a sheet , or in strips of one or two rows of resistors . the sheet process will be described from this point on but these subsequent processes also apply to sections and strips . as shown in fig5 , the sheet 19 is a continuous solid ( although alignment holes may be present ) and areas of the sheet 19 may then be removed to define the resistor &# 39 ; s design dimensions of length and width . preferably this is done with a punch tool but may also be done by a chemical etching process or by laser machining or mechanical cutting away of the unwanted material . the resistance values of the unadjusted resistors are determined by the copper pad spacing , defined by the photo mask , length , width , and the thickness of the sheet of resistive material . as shown in fig6 , adjustment of the resistance value may be accomplished by a laser or other means of removing material 26 to increase the resistance while at the same time measuring the resistance value . adjustment of the resistance value may also be accomplished by adding more termination material , or other conductive material , in areas where the resistive material is still exposed to reduce the value . the resistors work equally as well with no material removed or added but the resistance value tolerance is much broader . as shown in fig7 and fig8 , exposed resistor material between the terminations is covered by a coating material 20 which is an insulating material to prevent electroplating onto the resistive element and changing its resistance value . the coating material 20 is preferably a silicone polyester with high operating temperature resistance but may be other insulating materials that are chemical resistant and capable of handling high temperatures . the coating material 20 is preferably applied by a transfer blade . a controlled amount of coating material 20 is deposited on the edge of the blade and then transferred to the resistor by contact between the blade and resistor . other methods of applying the coating material 20 may be used such as screen printing , roller contact transfer , ink jetting , and others . the coating material 20 is then cured by baking the resistors in an oven . any markings that are put on the coating material 20 would be applied by ink transfer and baking or by laser methods at this point in the process . a die cutter may be used to remove each single resistor from the carrier plate . other methods to singulate the resistors from the carrier may be used such as a laser cutter or photoresist mask and chemical etching . individual resistors are then put into a plating process where nickel 28 and tin 12 are added to make the part solderable to a pcb as shown in fig1 . other plating materials may be used for other mounting methods such as gold for bonding applications . dc resistance may be checked on each piece and those in tolerance are placed into product packaging , usually tape and reel , for shipment . therefore a low resistor value material strip resistor has been disclosed . the resistor may achieve a small size , including an 0402 size or smaller package . the present invention contemplates numerous variations including variations in the materials used , whether an adhesion layer is used , whether the resistor is 2 terminal or 4 terminal , the specific resistance of the resistor , and other variations . in addition a process for forming a low resistance value metal strip resistor has also been disclosed . the present invention contemplates numerous variations , options and alternatives , including the manner in which a coating material is used , whether or not a mechanical masking step is used , and other variations .
| 7 |
with reference to the fig1 and 2 this invention will be described in greater detail hereinbelow . on a connection part 1 of a conductor is applied an inner semiconductive layer 2 , and then a reinforcing insulation layer 3 is provided on the inner semiconductive layer 2 . as a material for producing the reinforcing insulation layer 3 , polyolefins that are employed conventionally in cable insulation can be used , such as polyethylene , uncross - linked polyethylene containing a cross - linking agent such as dicumyl peroxide , ethylene / propylene copolymers , etc . these materials can be applied in the form of a tape by winding it around the inner semiconductor , or alternatively they can be applied by pouring into a metal mold ( not shown ) placed around the inner semiconductive layer 2 . it is preferred to apply the reinforcing material by pouring into a metal mold , since the surface of the reinforcing insulation layer is thus rendered smooth , and the interface between the outer semiconductive members 4 , 4 &# 39 ; and a specific insulated portion 5 becomes smoother . on the thus - formed reinforcing insulation layer 3 is placed a heat shrinkable tube 6 comprising the outer semiconductive members 4 and 4 &# 39 ; and the specific insulated portion 5 and the tube 6 is heat shrunk using a burner , torch lamp , or similar conventional heating means . thereafter , the whole assembly of connection parts is heated under pressure to cause the reinforcing insulation layer 3 , inner semiconductive layer 2 , cable insulator 7 and heat shrinkable tube 6 to become integrated with each other , thereby forming an insulated connection part for cross - linked polyolefin insulated electrical wires or cables . with respect to the heat shrinkable tube 6 used in this invention tips 8 and 8 &# 39 ; of the semiconductive members in the specific insulated portion 5 are formed in a round shape in order to avoid concentration of the electric field . preferably , the tips 8 and 8 &# 39 ; may be folded as shown in fig2 . examples of materials for the specific insulated portion 5 include thermoplastic resins which can adhere to the reinforcing insulation layer 3 , such as polyethylene , ethylene - vinyl acetate copolymers , ethylene - propylene copolymers , etc ., since it is desirable to bond the specific insulated portion 5 to the reinforcing insulation layer 3 in order for the resulting electrical wires or cables to have satisfactory electric properties . a mixture of the above - described thermoplastic resin and carbon black can be used as a material for producing the outer semiconductive members 4 and 4 &# 39 ;. the heat shrinkable tube 6 can be produced as follows . first , a semiconductive heat shrinkable tube member 4 is formed by bombarding electron beams onto a tube made of the above - described semiconductive material , or by heating a tube of semiconductive material , or by heating a tube of semiconductive material containing a cross - linking agent , to effect cross - linking , and then heating the cross - linked material at a temperature higher than the softening point thereof to endow heat - shrinkability to the material thereby obtaining a semiconductive heat shrinkable member . then , two heat shrinkable tube members 4 and 4 &# 39 ; thus - produced are combined with each other through the specific insulated portion 5 comprising the above - described insulating material so as to form an assembly of the outer semiconductive members 4 and 4 &# 39 ; with the specific insulated portion 5 . preferably , the tips 8 and 8 &# 39 ; of the semiconductive members 4 and 4 &# 39 ; in the specific insulated portion may overlap each other . the assembly is then placed around a metal pipe having a diameter larger than that of the reinforcing insulation layer 3 and heated to form an integrated unit which retains heat - shrinkability . more particularly , a heat shrinkable tube according to a preferred embodiment of this invention is produced as follows . a tube having an inner diameter of 25 mm and a thickness of 2 mm is extrusion molded using a semiconductive polyethylene blended with carbon black and expanded so as to have an inner diameter of 70 mm after it is bombarded with electron beams at an intensity of 15 mrad . a tube member 30 cm in length is cut out of this tube and one end 9 thereof is folded in a length of 5 cm as shown in fig2 . the thus - obtained tube member 4 is placed over the surface of a longitudinally split half pipe of aluminum pipe 10 and is heated using a torch lamp ( not shown ) to effect shrinking . then , a cross - linked polyethylene tape which has preliminarily been elongated longitudinally is wound around the folded end 9 of the tube and the surface of the aluminum pipe adjacent thereto to a thickness of about 3 mm . further , another semiconductive heat shrinkable tube member 4 &# 39 ; having one end 9 &# 39 ; thereof folded in the same manner as above is placed so that it covers a part of the portion on which cross - linked polyethylene is wound and the aluminum pipe . the thus - formed assembly on the aluminum pipe is then heated using a torch lamp to cause shrinkage . after the whole assembly is heated at 150 ° c . for 30 minutes to form an integrated unit , the aluminum pipe is removed to obtain a heat shrinkable tube of this invention . it is preferred to further bombard electron beams onto the heat shrinkable tube thus - obtained in a narrow region thereof , including the specific insulated portion 5 , at an intensity of 20 mrad , in order to render the shrink ratio of the region including the specific insulated portion 5 smaller than the shrink ratio of the remainder of the heat shrinkable tube . since , in the heat shrinkable tube 6 according to this invention , the semiconductive members 4 and 4 &# 39 ; and the specific insulated portion 5 together form an integrated unit preliminarily before use , there is no occurrence of disadvantageous phenomenon such as that the tip of the outer semiconductive member in the specific insulated portion is fluidized or deformed to form a sharp protrusion leading to deteriorated electrical properties which would often be encountered in the conventional method in which an outer semiconductive member and the specific insulated portion are formed by winding uncross - linked polyethylene tape around the reinforcing insulation layer and these members are heat molded simultaneously together with the reinforcing insulation material . in addition to the above , insulated electrical wires and cables produced in accordance with this invention have another advantage . that is , in the heat shrinkable tube according to this invention , the shrink ratio of the specific insulated portion and the neighboring region is made smaller than the shrink ratio of the remainder of the heat shrinkable tube , and as a result this invention is free of the problem of shape retention at the connecting part of the wires or cables , and the problem wherein the tip of the outer semiconductive layer in the specific insulated portion penetrates into the reinforcing insulation layer , which would be observed in the case wherein the outer semiconductive layer and the specific insulated portion are formed by placing first a semiconductive heat shrinkable tube and then an insulating heat shrinkable tube on the reinforcing insulation layer , whereafter both tubes are heat molded simultaneously together with the reinforcing insulation layer . further , when the reinforcing insulation layer made of a cross - linking agent containing thermoplastic resin , e . g ., polyethylene , is heat treated to cross - link it and then first a semiconductive heat shrinkable tube followed by an insulating heat shrinkable tube are provided on the reinforcing insulation layer , followed by heating , penetration of the tip of the outer semiconductive layer in the specific insulated portion into the reinforcing insulation layer can be prevented . however , this method takes a relatively long time to connect the cable since heat molding is conducted twice . nevertheless , this embodiment can reduce time for working or connecting electrical wires or cables since the heat shrinkable tube can be heat molded together with the reinforcing insulation layer simultaneously after the former is placed on the latter . in this invention , it is for the purpose of preventing the occurrence of voids that heating of the connection part of electrical wires or cables is performed under pressure . as a means for pressurization a method can be used in which the connection part is sealed in a pressurizing container and a gas , or oil or similar fluid is introduced under pressure , or a method can be used in which tension generated by winding the vulcanized rubber tape strongly around the connection part of the electrical wire or cable is used to create pressure . of these methods the use of a pressurizing container and an inert gas such as nitrogen gas for pressurization is preferred , since the period of time required for heat molding can be shortened and at the same time it is possible to form a smooth finish on the surface of the connection part of the electrical wire or cable . a further advantage of this method is that there is no danger that the gas for pressurization will be incorporated in the reinforcing insulation layer since the reinforcing insulation layer is covered by the heat shrinkable tube , and that it is unnecessary to wipe out oils after heat molding . thus , this invention fully utilizes the advantages derived by the use of heat shrinkable tubes . in order to demonstrate the effects of this invention comparison was made between this invention ( examples 1 to 3 ) and conventional methods ( comparison examples 1 to 5 ) as described below . insulated connection parts were formed using a cross - linked polyethylene insulated cable having a conductor of cross section of 150 mm 2 and an insulation layer of 7 mm in thickness according to the methods shown in table 1 below . table 1__________________________________________________________________________ comparison comparison comparison comparisoncable connection method example 1 example 2 example 3 example 4__________________________________________________________________________reinforcing insulation poured into a poured into tape wound tape woundlayer ( thickness : 10 mm ) metal mold a metal moldouter semiconductive tape wound tape wound semiconductive semiconductivemember or layer heat shrinkable heat shrinkable tube tubespecific insulated portion tape wound tape wound insulating heat insulating heat ( thickness : 3 mm shrinkable tube shrinkable tubelength : 30 mm ) heat moldingreinforcing insulation shaped simulta - vulcanized shaped simulta - under nitrogenlayer neously , vulcan - tape wound neously , at gas pressure ized tape wound 210 ° c . for 210 ° c . for 2 210 ° c . for 2 * 1 210 ° c . for 4 4 hours hours under hours hours nitrogen gas pressure * 2outer semiconductive ( see above ) vulcanized ( see above ) under nitrogenmember or layer provided with tape wound gas pressurespecific insulated 210 ° c . for 210 ° c . for 2portion 2 hours hoursreinforcing insulation poured into a tape wound poured into a poured into alayer ( thickness : 10 mm ) metal mold metal mold metal moldouter semiconductive semiconductive heat shrinkable heat shrinkable heat shrinkablemember or layer heat shrinkable tube consisting tube consisting tube consisting tube of an integrated of an integrated of an integrated unit of outer unit of outer unit of outer semiconductive semiconductive semiconductive member and member and member and specific insu - specific insu - specific insu - lated portion lated portion lated portionspecific insulated insulating heat ( see above ) ( see above ) ( see above ) portion ( thickness : shrinkable tube3 mm , length : 30 mm ) heat moldingreinforcing insula - shaped simulta - shaped simulta - shaped simulta - shaped simulta - tion layer neously at 210 ° c . neously at 210 ° c . neously , neously at 210 ° c . for 2 hours for 2 hours vulcanized tape for 2 hours under nitrogen under nitrogen wound at 210 ° c . under nitrogen gas pressure gas pressure for 4 hours gas pressureouter semiconductive ( see above ) ( see above ) ( see above ) ( see above ) member or layer provided withspecific insulatedportion__________________________________________________________________________ note : * 1 vulcanized tape wound : vulcanized sbr rubber tape was elongated 10 % an wound to a thickess of 10 mm to effect pressurization . * 2 nitrogen gas pressure : pressurization was performed at a pressure of 5 kg / cm . sup . 2 using a pressurizable container . the appearance of the surface , condition of the tip of the outer semiconductive member on layer in the specific insulated portion , and ac initial breakdown value were compared and the results obtained are shown in table 2 below . table 2__________________________________________________________________________ comparison comparison comparison comparisonresults example 1 example 2 example 3 example 4__________________________________________________________________________state of interface between uneven uneven rather smoothreinforcing insulation unevenlayer and outer semiconduc - tive member or layerstate of tip of outer protrusion no protrusion protrusion no protrusionsemiconductive member or layer in penetratingspecific insulated portion into reinforcing insulation layerac initial break down value 80 kv 160 kv 110 kv 170 kvstate of interface between smooth rather uneven uneven smoothreinforcing insulationlayer and outer semiconduc - tive member or layerstate of tip of outer protrusion no protrusion no protrusion no protrusionsemiconductive member or layer in penetrating intospecific insulated portion the reinforcing insulation layerac initial break down value 120 kv 190 kv 180 kv 230 kv__________________________________________________________________________ from the results shown in table 2 above , it can be seen that forming insulated connection parts according to this invention as in examples 1 to 3 is superior to the conventional methods as in comparison examples 2 and 4 in that this invention enables one to form the parts in a much shortened period of time , and in that this invention can prevent the occurrence of protrusion formed by fluidization or deformation of the tip of the outer semiconductive layer in the specific insulated portion , which was observed in comparison example 1 or penetration of the tip of the outer semiconductive layer in the specific insulated portion into the reinforcing insulation layer , which was encountered in comparison examples 3 and 5 . thus , this invention can provide a cable connection having improved electrical properties . while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .
| 8 |
the present invention is directed to a latex paint which , when applied as a single coat , provides the hiding , tannin blocking , corrosion resistance , durability and application performance of a conventional paint system consisting of a primer coat plus two coats latex paint . the latex paint of the present invention comprises a tannin - blocking latex emulsion and low water absorbing microspheres . tannin blocking emulsions useful in the present invention include those water - borne polymer emulsions that are effective in preventing the water soluble phenolic compounds from penetrating the coating . commercially available tannin blocking latex emulsions include rhoplex ® mv - 23lo emulsion copolymer from rohm and haas company which is an all acrylic composition and eps 2532 emulsion from engineered polymer solutions , inc . which is a styrenated acrylic composition . tannin blocking emulsions are those emulsions having a rating of at least 2 on the tannin stain blocking test described below . the tannin blocking latex emulsions may be used alone , or may be used in combination with a conventional latex emulsion . the amount of tannin blocking latex emulsion present in the coating composition is generally at least about 15 % by weight of the total latex emulsion present in the coating composition . conventional latex emulsions include those prepared by polymerizing at least one ethylenically unsaturated monomer in water using surfactants and water soluble initiators . typical ethylenically unsaturated monomers include vinyl monomers , acrylic monomers , allylic monomers , acrylamide monomers and mono - and dicarboxylic unsaturated acids . vinyl esters include vinyl acetate , vinyl propionate , vinyl butyrates , vinyl isopropyl acetates , vinyl neodeconate and similar vinyl esters ; vinyl halides include vinyl chloride , vinyl fluoride and vinylidene chloride ; vinyl aromatic hydrocarbons include styrene , α - methyl styrene , and similar lower alkyl styrenes . acrylic monomers include monomers such as lower alkyl esters of acrylic or methacrylic acid having an alkyl ester portion containing between 1 to 12 carbon atoms as well as aromatic derivatives or acrylic and methacrylic acid . useful acrylic monomers include , for example , acrylic and methacrylic acid , methyl acrylate , and methacrylate , ethyl acrylate and methacrylate , butyl acrylate and methacrylate , propyl acrylate and methacrylate , 2 - ethyl hexyl acrylate and methacrylate , cyclohexyl acrylate and methacrylate , decyl acrylate and methacrylate , isodecylacrylate and methacrylate , and benzyl acrylate and methacrylate . preparation of latex compositions is well - known in the paint and coatings art . any of the well - known free - radical emulsion polymerization techniques used to formulate latex polymer can be used in the present invention . polymerization techniques suitable for use herein are taught in u . s . pat . no . 5 , 486 , 576 , incorporated by reference . the addition of low water absorbing microspheres to the paint composition provides a paint composition having a high volume solids content . useful low water absorbing microspheres include those microspheres having a maximum pigment loading of at least 50 %. the maximum pigment loading ( mpl ) percentage is an indication of the water absorption of the spherical particles . the higher the mpl , the lower the water absorption of the particles . the mpl for an extender is determined by first preparing a base mix as follows : using the base mix , a plurality of samples are prepared using different amounts of the extender . each sample is prepared and evaluated as follows : first , 300 grams of the base mix are added to a container having a diameter of 7 inches . a 3 inch hsd blade placed 1 inch from the bottom of the container is used for mixing the base mix . next , the extender is added to the container and mixing continues for 5 minutes . the sample is then cooled to 77 ° f . (± 3 °) and the viscosity is measured using an lv brookfield viscometer . the amount by weight of extender added is converted into a volume amount for the sample . using the foregoing procedure , a plurality of viscosity values for different amounts of the extender are obtained . these viscosity value are plotted vs . the gallons of dry extender per 12 . 65 gallons of base mix . from the plots , the mpl is determined . the plots result in a hyperbolic shape in which two straight lines can be drawn from the two constant slopes . the intersection of these two lines represents the point at which the mixture becomes dilatent . the x - axis reading of this point is the mpl . the mpl percentage is equal to the maximum pigment volume divided by the sum of the maximum pigment volume and base mix volume . the mpl for several conventional extenders as well as several microsphere extenders are shown in table a below . microspheres useful in the present invention have an mpl of at least 50 %. examples of such low water absorbing microspheres include expancel 551 de20 , an expanded acrylonitrile / vinylidene chloride copolymer commercially available from expancel , inc . ; sil - cell 35 / 34 , sodium potassium aluminum silicate particles commercially available from silbrico corporation ; dualite 27 polyvinylidene chloride copolymer coated with calcium carbonate , commercially available from pierce & amp ; stevens corporation ; fillite 150 ceramic spherical particles commercially available from fillite north america , inc . ; microbeads 4a soda lime plate glass particles , commercially available from cataphote inc . ; sphericel ® hollow glass spheres commercially available from potter industries inc . ; eccosphere ftd 235 hollow glass spheres commercially available from emerson & amp ; cumming ; z - light sphere w - 1200 , ceramic hollow spheres commercially available form zeelan industries inc . ; scotchlite k46 glass bubbles commercially available from 3m , and vistamer uh 1500 and vistamer hd 1800 , polyethylene particles commercially available from composite particle . preferably , the microspheres have a diameter from about 1 to about 210 microns . pigments , such as titanium dioxide and extenders , such as zinc oxide , silicon oxide , clay , calcium carbonate , talc and nepheline syenite may be added to the paint of the present invention . the amount of low water absorbing microspheres present in the coating composition is at least 50 % by volume of the total amount of extenders present . preferably , the microspheres make up at least about 75 % by volume of the total amount of extenders present . of the total volume of the coating composition , the low water absorbing microspheres make up at least 5 % by volume . there are paint additives that are useful in helping to control the problem of tannin stain bleed . these additives contain cations that will form lightly - colored water insoluble compounds with the tannate ions to prevent their migration through the paint film . reactive pigments , which include base pigments such as wollastonite , talc or mica in combination with phosphate or borate of ca or zn , and as a doping agent or active additive , one amphoteric metal hydrate of al , ti , zr , zn or si may be added to the paint composition . a preferred reactive pigment is calcium barium phosphosilicate , commercially available as halox bw - 100 from halox pigments . other reactive pigments that may be used in the paint composition include calcium phosphosilicate and aluminum zirconium phosphosilicate . a complexing agent for a transition metal ion may also be included in the paint composition . a preferred complexing agent is a salt of phosphonic acid commercially available as bubond 357 from buckman laboratories . extenders useful in helping to prevent the migration of tannate ions include calcium carbonate , nepheline syenite , talc and zinc oxide . the pigments and extenders present in the paint formulation contribute to the in tannin blocking characteristics in the paint film . the relationship between durability of the coating and the amount of pigment is represented by pigment volume concentration ( pvc ), which is the fractional volume of pigment in a unit volume of resin . thus , low pvc coatings , such as semi - gloss paints , contain relatively low levels of pigment , and high pvc coating compositions , such as satin to flat paints , contain high levels of pigments . the pvc of the coating composition of the present invention is generally within the range of 25 to 65 %, and preferably about 40 %. the solids content by volume ( nvv ) of the coating composition is generally within the range 30 - 50 %, and preferably at least 40 %. the latex paint of the present invention is prepared according to standard manufacturing techniques . such techniques involve the preparation of a polymeric binder or binders , mixing of component materials , dispersing of pigments , and a thinning adjustment to commercial standards . high speed dispersers or dissolvers are typically used in the dispersing step to intersperse the pigments into a liquid phase containing other paint components . the binder and pigment dispersions can be thoroughly and uniformly mixed with raw batch ingredients by homogenizing the binders , pigments , plasticizers and other components to form a uniform blend . the polymeric binder further maintains the pigment in stable dispersion . although special equipment conventionally used to produce high solid systems or incorporate microspheres can be employed , this invention requires no modification to any conventional latex paint manufacturing process . a paint coating composition comprising the following raw materials was produced : a coating composition was prepared substantially in accordance with that of example 1 , except that hydrous clay was used in place of the silicon dioxide and the sil - cell sodium potassium aluminum silicate microspheres were replaced with z - light sphere 1200 ceramic hollow spheres . a coating composition was prepared substantially in accordance with that of example 1 , except that the tannin blocking resin used was rhoplex mv - 23 and hydrous clay was used in place of the silicon dioxide . in addition the microspheres used were sphericel hollow glass spheres . a coating composition was prepared substantially in accordance with that of example 1 except that the tannin blocking resin used was rhoplex mv - 23 and the silicon dioxide extender was replaced with calcium carbonate . a coating composition was prepared substantially in accordance with that of example 1 , except that the tannin blocking resin used was rhoplex mv - 23 , the silicon dioxide extender was replaced with nepheline syenite extender and the microspheres used were expancel 551 de20 expanded acrylonitrile / vinylidene chloride copolymer . a coating composition was prepared substantially in accordance with that of example 1 , except that the silicon dioxide extender was replaced with nepheline syenite and the microspheres used were sphericel hollow glass spheres . a coating composition was prepared substantially in accordance with that of example 1 , except that the tannin blocking resin used was rhoplex mv - 23 , the silicon dioxide was replaced with nepheline syenite and the microspheres used were expancel 551 de20 expanded acrylonitrile / vinylidene chloride copolymer . table i below summarizes the composition and characteristics of examples 1 - 7 : the coating compositions of the present invention were evaluated for tannin stain blocking and corrosion resistance . tannin stain blocking was measured by first applying the coating composition to a six - inch section of a redwood panel and allowing the coating to dry overnight ( approximately 16 hours ). the dry . film thickness of the coating was about 4 mils . the panels were placed in a qct ( cleveland condensing cabinet ) which was maintained at 100 ° f . for 24 hours . the panels were removed from the qct and allowed to dry thoroughly . control panels were prepared by applying two coats of a commercially available premium quality exterior latex paint ( hereinafter referred to as the “ control paint ”) to redwood panels . the control paint is a white pastel base containing an acrylic polymer and having a volume solids content nvv of 34 %, a pigment volume concentration ( pvc ) of 42 % and a y - reflectance of 86 . 31 . the formulation for the control paint is set forth in control example 1 . the total dry film thickness of the coating was about 4 mils . the control panels were subjected to the qct in the same manner as the coating compositions of the present invention . each coating composition was applied to 4 different redwood panels and the y - reflectance of the coated panels was measured using fmc ii mathematics and a macbeth color - eye spectrophotometer . the percentage improvement in y - reflectance of each coating composition of the present invention over the control coating was determined and then assigned a relative rating of 0 to 5 . a rating of 0 indicates no improvement in tannin blocking over the control coating and a rating of 5 indicates at least a 50 % improvement over the control coating . a tannin blocking rating of at least 3 indicates the coating composition exhibits superior tannin blocking . corrosion resistance was measured by applying the 2 . 0 grams of each coating composition to a 3 inch by 3 inch section of a cold rolled steel panel . after allowing the panel to dry overnight , ( approximately 16 hours ) the panel was placed on a qct maintained at 100 f for 8 hours . the panels were qualitatively rated on a scale of 1 to 10 , with 10 indicating superior corrosion resistance . a rating below 5 indicates unacceptable corrosion resistance . the paint compositions of examples 9 and 10 were combined in various weight percentages with the composition of example 8 , which does not contain a tannin blocking latex resin . the corrosion resistance and tannin stain blocking were measured for the resulting compositions as shown in table ii . the durability of the coating compositions was evaluated by subjecting the coating compositions to quv testing . each coating composition was tinted with 3 ounce / gallon of phalocyanine blue colorant and applied to an aluminum panel using a 7 mil clearance dow - type applicator and allowed to dry for 1 week . the panels were then placed on a quv weatherometer and cycled between a uv light cycle at 60 ° c . for 4 hours using uva340 bulbs ( radient . 77 ) and a condensation cycle at 50 ° c . for 4 hours . the total cycle time was 1000 hours with about 500 hours of uv light time . the coatings were evaluated by measuring the δl ( change in lightness / darkness ) and δe ( total change in color ). a paint coating composition comprising the following raw materials was produced : this paint composition was evaluated for durability by the accelerated exterior exposure test emmaqua ( astm g90 ). for this test , aluminum panels were coated with a single coat and a double coat of the coating composition of example 11 . in example np , a panel was coated with two coats of the control paint of control example 1 . in example p1 , a panel was coated with a single coat of a commercially available latex primer followed by two coats of the control paint of control example 1 . in example p2 , a panel was coated with a single coat of a commercially available alkyd primer followed by two coats of the control paint of control example 1 . the spread rate for the topcoats was 300 ft 2 / gal for each coat . as shown in table iv , a single layer of the coating composition of the present invention out performed two layers of the commercially available paint which was applied over a primer layer . the control paint referred to earlier was produced from the following raw materials : the control paint has an nvv of 34 %, a pvc of 42 %, an x - reflectance of 81 . 72 , a y - reflectance of 86 . 31 , and a z - reflectance of 86 . 26 . the coating composition of the present invention was evaluated for exterior durability on various substrates and compared to 14 different commercially available exterior latex paints . the paints were exposed for 22 months to the climate of ohio and then evaluated for tannin blocking , adhesion to different substrates , corrosion resistance , efflorescence and cracking . for the tannin blocking test , the coating of the present invention was applied as a single coating having a dry film thickness of about 4 mils over redwood panels that were not primed . the commercial exterior paints were applied as two coats having a dry film thickness of about 4 mils over redwood panels that had not primed and redwood panels that had been primed with a latex primer having a dry film thickness of about 2 mils . each coating was applied to multiple redwood panels and the results presented in table v are the average rating for each coating . the adhesion of the paints was evaluated by applying each paint to a glossy alkyd substrate , a chalky alkyd substrate , a chalky aluminum substrate , a weathered vinyl substrate and a galvanized steel substrate . the glossy alkyd substrate had a 60 ° gloss of 75 . the chalky alkyd substrate had an astm d4214 chalk rating of 6 and the chalky aluminum substrate had a chalk rating of 2 . the coating of the present invention was applied to each substrate in a single coat having a dry film thickness of about 4 mils . the commercially available comparative paints were each applied to the different substrates in two coats having a total dry film thickness of about 4 mils . the corrosion resistance of the paints was evaluated by applying the coating composition of the present invention ( single coat ) and the commercially available comparative paints ( 2 coats ) to cold rolled steel substrates . the degree of efflorescence of the paints was evaluated by applying the coating composition of the present invention ( single coat ) and the commercially available comparative paints ( 2 coats ) to hot ( high ph ) cement panels . the hot cement panels were prepared by brushing onto the panels an aqueous solution of block aid powder , commercially available from glidden , and then coating the panels within 24 hours with the paint to be evaluated . the cracking resistance of the paints was evaluated by applying the coating composition of the present invention ( single coat ) and the commercially available comparative paints ( 2 coats ) to southern yellow pine panels . as shown in table v , the coating composition of the present invention consistently obtained good and excellent ratings for tannin blocking , adhesion to various substrates , corrosion resistance , efflorescence and cracking . 5 = excellent 4 = good 3 = fair 2 = poor 1 = very poor
| 2 |
reference is now made to the drawings listed above , wherein like numerals refer to like parts throughout . as used herein , the terms “ chattel ” and “ chattels ” refers generally to any type of property or possession ( regardless of ownership ), which may generally be carried on or by a person ( including within associated transport devices such as luggage , etc .). chattel includes , without limitation , car keys , personal security devices ( e . g ., mace , pepper spray ), knives , handguns , ammunition , tools , personal electronic devices , pharmaceuticals , cosmetics , jewelry , belt buckles or other metallized apparel , wrist watches , hats , cellular telephones , usb keys , glasses , magnetic or optical media , electric razors , personal computers , cameras , film , pagers , electronic games , purses , currency , ipods , etc . as used herein , the term “ passenger ” shall mean any entity , whether human or otherwise , who utilizes a transportation modality . as used herein , the term “ transportation modality ” refers to any form of transportation for either person , animals , and / or inanimate objects including , without limitation , aircraft , ships , ferries , land vehicles ( buses , trains , cars , etc . ), shuttles , etc . as used herein , the term “ computer program ” is meant to include any sequence of human or machine cognizable steps which perform a function . such program may be rendered in virtually any programming language or environment including , for example , c / c ++, fortran , cobol , pascal , assembly language , markup languages ( e . g ., html , sgml , xml , voxml ), and the like , as well as object - oriented environments such as the common object request broker architecture ( corba ), java ™ ( including j2me , java beans , etc .) and the like . as used herein , the term “ application ” refers generally to a unit of executable software that implements theme - based functionality the themes of applications vary broadly across any number of disciplines and functions ( such as e - commerce transactions , shipping transactions , entertainment , calculator , internet access , etc . ), and one application may have more than one theme . the unit of executable software generally runs in a predetermined environment ; for example and without limitation , the unit could comprise a downloadable java xlet ™ that runs within the javatv ™ environment . as used herein , the term “ database ” refers generally to one or more tangible or virtual data storage locations , which may or may not be physically co - located with each other or other system components . as used herein , the term “ network ” refers generally to data or communications networks regardless of type , including without limitation , lans , wans , intranets , internets , the internet , cable systems , telecommunications networks , satellite networks , and virtual private networks ( vpns ), or collections or combinations thereof , whether based on wired , wireless , or matter wave modalities . such networks may utilize literally any physical architectures and topologies ( e . g . atm , ieee - 802 . 3 , x . 25 , token ring , sonet , 3g / 3gpp / umts , 802 . 11 , hybrid fiber - coax ( hfc ), etc .) and protocols ( e . g ., tcp / ip , http , ftp , wap , gprs , rtp / rtcp , wifi , 3g , ieee 802 . 11 , etc .). as used herein , the term “ service provider ” refers generally to services provided remotely to the user including , for example , data streaming , data analysis , financial account management and trading , data archiving and storage , internet access , content delivery , telecommunications , etc . as used herein , the term “ speech recognition ” refers to any methodology or technique by which human or other speech can be interpreted and converted to an electronic or data format or signals related thereto . it will be recognized that any number of different forms of spectral analysis ( such as mfcc ( mel frequency cepstral coefficients ) or cochlea modeling , may be used . phoneme / word recognition , if used , may be based on hmm ( hidden markov modeling ), although other processes such as , without limitation , dtw ( dynamic time warping ) or nns ( neural networks ) may be used . myriad speech recognition systems and algorithms are available , all considered within the scope of the invention disclosed herein . as used herein , the term “ celp ” is meant to include any and all variants of the celp family such as , but not limited to , acelp , vcelp , and qcelp . it is also noted that non - celp compression algorithms and techniques , whether based on companding or otherwise , may be used . for example , and without limitation , pcm ( pulse code modulation ) or adpcm ( adaptive delta pcm ) may be employed , as may other forms of linear predictive coding ( lpc ). as used herein , the term “ digital processor ” is meant generally to include all types of digital processing devices including , without limitation , digital signal processors ( dsps ), reduced instruction set computers ( risc ), general - purpose ( cisc ) processors , microprocessors , gate arrays ( e . g ., fpgas ), plds , reconfigurable compute fabrics ( rcfs ), array processors , and application - specific integrated circuits ( asics ). such digital processors may be contained on a single unitary ic die , or distributed across multiple components . as used herein , the term “ integrated circuit ( ic )” refers to any type of device having any level of integration ( including without limitation vlsi , vlsi , and lsi ) and irrespective of process or base materials ( including , without limitation si , sige , cmos and gas ). ics may include , for example , memory devices ( e . g ., dram , sram , ddram , eeprom / flash , rom ), digital processors , soc devices , fpgas , asics , adcs , dacs , transceivers , memory controllers , and other devices , as well as any combinations thereof . as used herein , the term “ display ” means any type of device adapted to display information , including without limitation crts , lcds , tfts , plasma displays , leds , and fluorescent devices . the present invention allows users at a pod or other location to rapidly and easily ship their chattels to another location , such as to their travel destination or public gathering place ( concert , amusement park , sporting event , etc . ), to their home , or even a third party . as is known , millions of personal prohibited items are collected each year at airport security points alone . faced with the choice of discard or abandoning the item ( s ) or canceling their travel , the great majority of people choose to abandon the chattel , or perhaps attempt to recover it later . massive amounts of such items are collected each day throughout the nation &# 39 ; s airports . in its simplest form , the mechanism for shipment comprises a human agent and / or drop box akin to those used for fedex or other comparable courier services , that is disposed adjacent to the security checkpoint of the pod . standard courier methods are used , which may be aided through the use of more sophisticated apparatus and techniques so as to facilitate rapid and cost effective use by the customer . a variety of coding and / or tracking methods may be used , including bar codes , magnetic strips , and rfid tags of the general type well known in the art . these techniques may also be used in conjunction with one another , such as to perform different functions at different points throughout the processing or transit chain of the chattels . in more sophisticated embodiment , personal electronics ranging from user - specific rfid devices , usb keys , pdas , handhelds , cell phones or the like are used to transfer information to and / or from the kiosk or other processing entity associated with the service . it is noted that while the system and methods of the invention disclosed herein are described with respect to point - of - departure ( pod ) management of chattels , such as might occur at an airport or other transportation facility , certain aspects of the invention may be useful in other applications , including , without limitation , other types of transaction relating to chattels , such as insuring or valuation thereof , courier services between two non - pod locations , etc . referring now to fig1 , a first embodiment of a system utilizing radio frequency identification ( rfid ) tags is described . the system 100 comprises generally one or more shipping elements 104 with associated tags 106 , and a parent device 102 ( e . g ., kiosk ). the kiosk 102 contains an rf antenna 105 , as well as interrogator / reader module 108 and analysis / display module 110 . it will be recognized by those of ordinary skill that the various components and modules being part of the system 100 may be combined or integrated into one physical device as applicable , or separated , modularized , or any combination thereof , the illustrated embodiment being merely exemplary . the tags 106 of each shipping element comprise radio frequency id tags ( rfid ). rfid tags are well known in the communications art . the main advantages of an rfid sensor and tag system over other forms of id tagging include ( a ) the orientation of the tag with respect to the sensor is not critical for a correct read of the tag information ; ( b ) communication can occur within comparatively harsh operating environments ; and ( c ) the communication range between the sensor and tag can be significant even when the rf frequencies used are within the power limitations of federal communications commission ( fcc ) rules concerning unlicensed transmitters . accordingly , rfid technology is useful for several applications , especially those relating to asset inventory and management . rfid tags or various configurations are now ubiquitous and available at extremely low cost , thereby further enhancing the economic viability of the present invention . the process of “ reading ” and communicating with an rfid tag such as that used in the system 100 of fig1 comprises bringing a rfid tag within proximity to an rfid sensor (“ reader ”) 108 which emanates a radio frequency or electric wake - up field having a limited range . the rfid tag 106 detects the presence of the wakeup field of the reader 108 , and subsequently various forms or protocols of handshake occur between the tag 106 and the reader 108 in order to exchange data . all of this communication between the tag and the sensor is performed using , e . g ., rf carriers ( or even wideband waveforms ) of one or more prescribed frequencies . as is well known in the art , so - called “ low - frequency ” systems operate in the khz ( e . g ., 125 khz ) to low - mhz range ( unlicensed ). low frequency systems are generally low cost and complexity and have comparatively limited range , but are attractive since the low frequency energy tends to suffer low losses from materials like metal , polymers , tissue , and the like . high - frequency systems operate in the low - mhz to ghz range ( sometimes licensed ). high - frequency systems in general have greater range , but are more directional . additionally , the performance of these high frequency tags may be adversely affected by electromagnetic radiation or proximate metallic objects . additionally , rfid tags are generally categorized as being “ active ” ( i . e ., carry an associated power source for operation of the on - tag integrated circuit , and are capable of spontaneous transmission after reader interrogation ), or “ passive ” which utilizes incident rf energy or electric field ( from the reader , for example ) to generate electrical energy for use by the ic , and transmission . passive tags are highly energy efficient , and require only an extremely small amount of electrical power to function . in the present application , due to the premium on space and desire for ultra - light weight and low cost , a small antenna and package form factor is desired . this also avoids disincentives to the disposability of the device ( and its parent shipping element ). based on the foregoing considerations , the present embodiment of the invention utilizes a low frequency ( e . g ., 125 khz nominal ) miniature passive tag having a miniature monopole antenna 109 of the type well known in the art , although it will be recognized that active tag architectures , lower or higher frequency systems , and alternate antenna configurations ( such as “ fig8 ” loop , etc .) may be used depending on the particular application and desired attributes . passive tags are a preferred mode , yet active tags are a utilitarian and desirable mode as well for certain applications . the rfid tag 106 of the present invention further optionally includes an integrated circuit ( ic ) device ( not shown ) including a transceiver section and processing logic , as well as an integrated random access memory ( ram ) device of the type commonly available with such devices adapted to store a plurality of data bytes such as data correlating to the identity of a given user , its date of deposit , its location ( i . e ., terminal a at airport b ), destination , urgency / priority , contents classification ( e . g ., metallic , hazardous , etc . ), weight as deposited , user &# 39 ; s destination ( if different from the shipping destination ), contact information , etc . and the like . the memory device may also comprise , without limitation , proms , eproms , eeproms , uveproms , srams , drams , sdrams , “ flash ” memory , and ferroelectric memory devices . in this capacity , the construction of the parent shipping element 104 is simplified , and less complex “ off the shelf ” rfid devices meeting the physical space limitations may be used with little or no adaptation . in an exemplary embodiment , the rfid tag is distributed on one or more surfaces of the shipping element using a capacitive type substrate tag . see for example the “ bistatix ™” rfid devices previously manufactured by motorola / indala corporation ( now assa abloy ). these devices utilize a very thin , lightweight and low cost substrate employing non - metallic printed circuit technology . they are also extremely rugged , allowing for bending , crumpling , folding , etc ., and can be printed on many different types of dielectric substrates . they also utilize an extremely small ic , capable of storing a limited amount of data ( e . g ., 96 bits ), thereby mitigating the costs associated with the shipping element 104 , and its overall form factor . it will also be recognized that the shipping element surface ( s ) may be used as the substrate itself , thereby further reducing cost . in short , the “ tag ” can be printed and / or embedded onto or in the shipping element ( box , envelope , carton , canister , etc .) at manufacture or thereafter in a highly cost - efficient manner . it will be recognized that capacitive or inductive tags may be used consistent with the invention . hence , by employing this ( e . g ., bistatix ) technology within the element 104 of the present invention , the rfid tag may be disposed on any surface at extremely low cost and low profile . a complementary motorola bistatix reader may be used as the reader 108 of fig1 , although other configurations may be used as described elsewhere herein . in operation , the tag “ reader ” 108 of fig1 interrogates the element ( s ) 104 and rfid device 106 at its designated frequency , causing the tag to “ wake ” and initiate communications protocols disposed within the tag ic / memory . once such protocols are established , the reader transmits preformatted data representative of the parameters desired to be loaded into the rfid memory device . for , example , a box of “ smart ” envelopes 200 ( described below with respect to fig2 a ) can be swiped by the interrogator / reader 108 before use in the kiosk and encoded with identifying information , such as for example the airport / pod identification code , date of coding , etc . the envelopes or other elements 200 can optionally be sequentially encoded with numbers ( e . g ., envelope no . 1 , 2 , 3 , etc .) to distinguish one from another . alternatively , the tags 106 associated with the elements 200 can be pre - coded at manufacture , such as via slightly variant frequency of emission , etc . a variety of different approaches for distinguishing between two similarly situated shipping elements are well known to those of ordinary skill in the rfid arts , and accordingly are not described further herein . as can be readily appreciated , the ability to uniquely identify a plurality of different shipping elements 104 using rf technology has great implications for , inter alia , accounting for such elements during use , security scanning and shipment . herein lies a primary attribute or feature of the present invention ; i . e ., tracking and control of a number of different parcels or elements 104 . for example , the present invention allows the system operator to rapidly inventory and specifically identify particular elements 104 before shipment , and afterwards ( i . e ., during delivery to the user or designated recipient ), thereby easily and efficiently accounting for all elements 104 . this is also useful during security scanning , and inventory before loading on the selected transportation mode ( aircraft , etc . ); e . g ., to verify that no one such as a terrorist has surreptitiously inserted a “ dummy ” package into the transport bin or other mechanism between unloading of the kiosk and loading onto the aircraft . it will also be recognized , however , that the kiosk or other receptacle ( or portion thereof ) may simply be made mobile and securable such that it can be directly transferred to the aircraft without having to load or unload , thereby potentially frustrating attempts to gain unauthorized access thereto . the rfid tags 106 of the embodiment of fig1 has further utility for conducting inventory of “ smart ” shipping elements after manufacture . since each element carries it &# 39 ; s own tag , each capable of uniquely identifying itself ( whether by unique frequency assignment , or data encoded on the tag memory and transmitted to the reader ), rapid reading of a plurality of tags disposed in close proximity to one another is possible . for example , a manufacturer , distributor or pod could also use the system 100 of the present invention to control inventory ( such as by placing a reader at a “ choke point ” of a storage facility , thereby knowing precisely when each “ smart ” element 104 was brought in or out of the facility ), or determine when a re - order of supplies is needed . using the wireless data interface capabilities described subsequently herein , the kiosk can even automatically alert a supplier that it needs more shipping elements , akin to well known prior art cdpd approaches used for , inter alia , vending machines . in yet another embodiment , the tag reader 108 is placed at the door or portal to the room or space ( e . g ., airport ingress / egress ) by which a subject must pass , thereby necessarily exposing the subject to the interrogation field generated by the reader 108 . hence , where someone such as a terrorist attempts to obtain one or more elements 104 for unauthorized use ( such as to try to sneak a package into a bin of authorized elements 104 ) from the kiosk , a security perimeter is established and interrogation automatically conducted . this security perimeter can be quite small , such that anyone attempting to steal or smuggle in coded envelopes or containers 104 from the kiosk will trigger a proximity sensor based on the aforementioned interrogation . another feature of the present invention is coordination of the type of tag used , its frequency , its radiated power , etc ., thereby allowing the user to control the range at which the interrogation field generated by the reader 108 will elicit a response from the tag 106 . it is undesirable to have the tags 106 respond at too great a distance , since this would necessitate removing the shipping elements in question and the reader 108 from the proximity of other devices in order to perform an inventory ( i . e ., the user would not be able to spatially differentiate between various tagged shipping elements 104 ). hence , the aforementioned low - power low - frequency passive tag is well suited to such applications . in the exemplary embodiment , the foregoing parameters are controlled such that the tag reader 108 has an effective “ wake up ” range of 1 - 3 ft ., thereby allowing sufficient spatial resolution ; however , this value can clearly be adjusted as need in the particular application . for example , in the “ exit door ” reader embodiment described elsewhere herein , a wake - up field lobe having a main axis of 5 - 10 feet may be needed to ensure adequate tag coverage as personnel ingress / egress . the rfid tag 106 and reader 108 of the present invention , as well as other wireless or wired data links associated with the apparatus 100 , may also optionally utilize an encrypted data protocol , such that any transmissions from the tag 106 are encrypted , and accordingly must be decrypted by the authorized reader 108 before processing of the tag data , and / or writing of the tag 106 by the reader 108 , is permitted . such encryption may be applied using any number of well known techniques instituted at the protocol level , or even at the air interface . for example , in one embodiment , the rfid tag 106 and reader 108 comprise more complex variant having a direct sequence spread spectrum ( dsss ) communication system incorporating a pn ( pseudo - noise ) spreading code of the type well known in the communications art . in another embodiment , a frequency hopping spread spectrum ( fhss ) having a hopping sequence is used to enhance security . the use of multi - bit encryption / encrypted data protocols and spread spectrum techniques for security is well known in the art , and accordingly will not be described further herein . see u . s . pat . no . 5 , 539 , 775 entitled “ modulated spread spectrum in rf identification systems method ” issued jul . 23 , 1996 , and u . s . pat . no . 5 , 629 , 981 entitled “ information management and security system ” issued may 13 , 1997 , both incorporated herein by reference in their entirety . in addition or instead of the air interface , encryption may also be applied at the protocol level , such as where public / private key methods , ike , ipsec , or other techniques may be used to frustrate surreptitious interception or alteration of data transmitted to / from the rfid device , or between other components . furthermore , well known vpn or other tunneling protocols for encapsulating data during transmission across an untrusted network may be used between various entities of the present system , such as between a kiosk and a local distribution or management node . additionally , well known secure socket layer ( ssl ) or equivalent approaches may be employed across one or more links of the network ( s ), so as to enhance security . it will be appreciated that many different variations and combinations of the foregoing radio frequency communications apparatus and methods may be employed consistent with the invention ; such different variations and combinations being too numerous to describe herein . all such variations and combinations , however , are easily recognized and within the possession of those of ordinary skill . as shown in fig1 , the receptacle module 110 takes the data obtained from the tags 106 via reader 108 and analyzes it according to one or more algorithms . in the illustrated embodiment , the module 110 comprises a cisc or risc processor having one or more computer programs running thereon , the programs analyzing the digitized tag data and for example , comparing it to stored data representing a series of allowed or authorized id values for shipping elements 104 , hence enhancing security . the receptacle can also be selectively locked until the reader 108 and module 110 validate the authenticity or other information associated with the particular transaction ( including , e . g ., user payment authorization , maximum allowed weight , size restrictions , etc .). to this end , the kiosk can be configured with an electronic scale integrated with the tag reader 108 , or other complementary systems . in terms of size , the code of each shipping element 104 advantageously helps the system automatically determine the maximum size of the package ; i . e ., the family designation of each element 104 , when read by the reader 108 , tells the central processor that the package cannot physically be larger than certain dimensions . it will further be recognized that each item of inventory or shipment can have associated with it other descriptive data , as shown in the example below : owning transaction routing id code category description entity date number 0001 airport pod 10 × 12 phl / a dec . 25 , 2003 0000 - 1111 - shipping envelope 2222 - 3333 this descriptive data can , in whole or part , also be produced during a discrepancy alert ( or when merely performing a normal transaction ) to help identify the item in question . as can be appreciated , the analysis / display functionality of the module 110 may also be provided by or integrated with another device . for example , so as to reduce clutter or space requirements , an existing device such as a fedex or airborne drop box , atm machine , internet or wifi kiosk , flight insurance kiosk , etc . may be used as the parent platform for the reader 108 and / or module 110 . many existing devices include sufficient processing and storage capacity to perform the transaction processing function ( s ) along with those normally required by that equipment , and hence can be readily programmed or otherwise adapted by those of ordinary skill to accommodate the functionality described herein . as yet another alternative , a standard desktop or laptop pc , or airport boarding gate terminal may be used to provide the desired analysis / display functionality , such as where the user gets the item through security , yet none - the - less desires to ship the item rather than carry it on the aircraft . as yet another alternative , the reader 108 and analysis / display module 110 may be integrated into a single device 170 ( fig1 a ), such as a handheld device akin to portable gps receivers now ubiquitous . the user ( which may be an employee , or even the shipper ) may simply then pick up the unit , interrogate the items to be shipped ( thereby encoding the package and retrieving id data for the database in data communication with the handheld ), and then deposit the package in a one - way access receptacle ( which may also be interlocked with the handheld via wired or wireless link if desired ). as previously referenced , it will be recognized that the methods of the invention ( as exemplified in fig1 ) are ideally embodied in the form of one or more computer programs . such program ( s ) may be rendered in virtually any programming language / environment including for example c , c ++, java , fortran , basic , visual basic , unix , perl , corba , or any other medium capable of reasonably implementing such a functionality . in one exemplary embodiment , the reader module 108 comprises an antenna portion with embedded antenna 105 , the latter being either monopole or dipole as desired to interface with the antenna structure of the tag 106 at the selected centerline frequency ( ies ). the antenna 105 of the module of the exemplary embodiment generates the wakeup or interrogation field needed to elicit a response from the tag 106 when the module is brought in sufficient proximity to the tag or vice - versa . the interrogation field intensity can also be made adjustable by the user , such that each facility can “ tune ” its module to the desired range / sensitivity . this adjustment can also be accomplished automatically and / or algorithmically ( such as under control of the kiosk &# 39 ; s central processor previously described herein , or an associated microcontroller ). the reader module 108 is also optionally equipped with a rf transceiver , such as a bluetooth 2 . 4 ghz or ieee - 802 . 11a / b / g device , for communications with other entities , such as a local server or wireless gateway to another network . for example , the siw1502 radio modem ic manufactured by silicon wave corporation of san diego , calif ., is a low - power consumption device with integrated rf logic and bluetooth protocol stack adapted for bluetooth applications . the chip is a fully integrated 2 . 4 ghz radio transceiver with a gfsk modem contained on a single chip . the siw1502 chip is offered as a stand alone ic or , may be obtained with the silicon wave odyssey siw1601 link controller ic . the siw1502 form factor is 7 . 0 × 7 . 0 × 1 . 0 mm package which is readily disposed within the interior volume of the kiosk described herein , or even a portable reader or “ wand ” which may be used by the carrier , such as for providing hand scans of chattels . an rf transceiver and modulator device is adapted to generally comply with the well known “ bluetooth ™” wireless interface standard , ieee - 802 . 11 , uwb , or alternatively , so - called “ 3g ” ( third generation ) communications technologies . the bluetooth wireless technology allows users to make wireless and instant connections between various communication devices , such as mobile devices ( e . g ., cellular telephones , pdas , notebook computers , remote monitoring stations , and the like ) and desktop computers or other fixed devices . since bluetooth uses radio frequency transmission , transfer of data is in real - time . the bluetooth topology supports both point - to - point and point - to - multipoint connections . multiple ‘ slave ’ devices can be set to communicate with a ‘ master ’ device . the devices are authenticated ( optionally ) using a rand - based bonding or pairing process of the type well known in the art ( e . g ., in mode 3 link layer security , or mode 2 “ l2cap ” or service - based security ). in this fashion , the kiosk / reader of the present invention , when outfitted with a bluetooth wireless suite , may communicate directly with other bluetooth compliant mobile or fixed devices including a subject &# 39 ; s cellular telephone , pda , notebook computer , desktop computer , or other kiosks . alternatively , a number of different rf - enabled “ wands ” performing chattel scanning may be monitored in real time at a centralized location , such as the kiosk or even a remote location using the kiosk or a local wireless gateway as a proxy node . bluetooth - compliant devices , inter alia , operate in the 2 . 4 ghz ism band . the ism band is dedicated to unlicensed users , including airports , thereby advantageously allowing for unrestricted spectral access . the exemplary modulator uses one or more variants of frequency shift keying , such as gaussian frequency shift keying ( gfsk ) or gaussian minimum shift keying ( gmsk ) of the type well known in the art to modulate data onto the carrier ( s ), although other types of modulation ( such as phase modulation or amplitude modulation ) may be used . spectral access of the device is accomplished via frequency hopping spread spectrum ( fhss ), although other approaches such as frequency divided multiple access ( fdma ), direct sequence spread spectrum ( dsss , including code division multiple access ) using a pseudo - noise spreading code , or even time division multiple access may be used depending on the needs of the user . for example , devices complying with ieee std . 802 . 11a / b / f / g may be substituted for the bluetooth transceiver / modulator arrangement previously described if desired . literally any wireless interface capable of accommodating the bandwidth and / or other requirements of the system may be used . for example , in the case of an airport , the uwb system described below may be considered optimal , due to its low radiated power level , e . g ., less than − 41 . 3 dbm / mhz according the fcc unlicensed spectral uwb mask issued circa late 2003 . this low power reduces the chance of deleterious interference with , e . g ., aircraft communications systems , iff systems , or other instrumentation or control functions . in yet another embodiment of the invention , the module 400 utilizes an ultra wide - band ( e . g ., tm - uwb , ofdm , etc .) protocol for communication with other entities . specifically , in one embodiment , the module 400 is fitted with a tm - uwb soc device which utilizes pulse - position modulation ( ppm ), wherein short duration gaussian pulses ( nanosecond duration ) of radio - frequency energy are transmitted at random or pseudo - random intervals and frequencies to convey coded information . information is coded ( modulated ) onto the short duration carrier pulses by , inter alia , time - domain shifting of the pulse . for example , a pulse encodes a bit by being temporal shifting of the pulse with respect to a reference , such that a “ late ” pulse encodes a “ 0 ”, while an early pulse encodes a “ 1 ”. this scheme is somewhat akin to the well known frequency shift keying ( fsk ), wherein two ( or more ) side - band frequencies are utilized to encode data e . g ., 67 khz down - shift = 0 ; 67 khz up - shift = 1 . tm - uwb devices have the advantage of ready penetration of various mediums , as well as ultra - low power consumption and low spectral density , thereby reducing power requirements and potential interference with other device , respectively . in one exemplary variant , the tm - uwb device of the invention comprises a half duplex , 2 . 0 ghz with variable data rate in excess of 1 mbps with no forward error correction ( fec ). the gaussian monopulse is of the form : where τ is a time decay constant related to the gaussian monopulse duration , and center frequency f c = k / τ . the monopulse &# 39 ; s bandwidth and center frequency are therefore directly related to the monopulse &# 39 ; s temporal width or duration . this approach also shifts the transmission time of each monopulse over a significant time interval in accordance with a pseudo - nose ( pn ) “ hopping ” code of the type well known in the art , thereby advantageously distributing spectral density to make the spread . this approach is roughly comparable to frequency hopping spread spectrum ( fhss ) except in the time domain . exemplary devices incorporating tm - uwb components including the timer , correlator , and digital baseband signal processor and controller units ( not shown ) are available from ibm corporation ( sige or silicon germanium - based ) in the form of a chip set , although it will be recognized that an integrated single device is optimal for the invention . additional detail on the implementation of tm - uwb systems is found in , e . g ., “ time modulated ultra - wideband for wireless applications ”; time - domain corporation , 2000 , which is incorporated herein by reference in its entirety . by using ism or uwb communications , the rf module can also advantageously communicate with its parent device ( e . g ., a central node or gateway , another kiosk 110 with transceiver , etc .) without mutual interference with the rf signal of the tags 106 , the latter operating at 125 khz in the nominal embodiment . in another exemplary embodiment of the system , an object - oriented distributed program having client and server portions distributed on respective client and server devices is utilized ( fig1 b ). as used herein , the terms “ client device ” and “ personal electronic device ” ( ped ) include , but are not limited to , personal computers ( pcs ), whether desktop , laptop , or otherwise , personal digital assistants ( pdas ) such as the apple newton ®, “ palm ®” family of devices , handheld computers such as the hitachi “ e - plate ” or dell axim , personal communicators such as the motorola accompli devices , motorola evr - 8401 , j2me equipped devices , cellular telephones , set - top boxes , or literally any other device capable of interchanging data with a network . such devices may interface using wired or optical fiber mechanisms such as an ieee std . 802 . 3 ethernet interface , digital subscriber line ( dsl ), v . 90 modem , docsis modem , hybrid fiber - coax ( hfc ) cable , or alternatively via wireless mechanisms and protocols such as is - 95 / cdma - 2000 , bluetooth ™, irda interface , ieee std . 802 . 11 ( a ) or ( b ), wireless application protocol ( wap )/ wtls , gprs , gsm , third - generation or “ 3g ” systems ( 3gpp / umts ), or any other of myriad data communication systems and protocols well known to those of skill in the communications arts . creation of such computer programs is readily accomplished by those of ordinary skill in the programming arts , and accordingly is not described further herein . as shown in fig1 b , the distributed software embodiment of the architecture 150 utilizes a server portion 152 and client portion 154 distributed on respective server 156 and client devices 158 , ostensibly disposed at different physical locations , and in data communication with each other via a network 160 . the client portion 154 of the software can be made “ thin ” to accommodate the comparatively lower hardware capabilities associated with many client devices 158 . this architecture 150 is especially well suited to an object oriented programming environment ( e . g ., corba ), as will be recognized by those of ordinary skill . in use , the user manually or automatically establishes communication between the client device and the sever portion , thereby allowing for transfer of data relevant to the impending transaction , such as the user &# 39 ; s home address , credit card or payment information , etc . this approach obviates the user having to ( i ) stand at the kiosk and enter the information manually , and ( ii ) saves time since the link can be established while the user is performing other tasks , such as walking to the security checkpoint , parking their car , etc . hence , the user merely need walk to the kiosk , insert their chattel into a shipping element 104 , and deposit it on the reader 108 . when authenticated and encoded , the receptacle will open to allow the element 104 to gravity feed into the locked receptacle . alternatively , the encoding can be performed after entry into the receptacle ( so as to frustrate surreptitious encoding and removal ). the aforementioned communication channel between the client device and module / server can also be used for two - way ( i . e ., forward and reverse channel ) traffic , such as where transaction information is transmitted back to the client device for storage thereon . alternatively , such information may be transmitted to a third party or proxy , such as to an e - mail server or url , wherein the information is directly or indirectly provided to the user ( such as via a direct confirmatory e - mail , or as a line item on a monthly statement ). the transmitted information may optionally include date / time , user id , location , routing or tracking number , payment method , and even other information such as the weight of the shipment , results of a security scan ( e . g ., by an installed e - beam , x - ray , neutron , magnetometer , or chemical “ sniffer ” device co - located with the kiosk ), an image of the tracking label , estimated time / date of delivery , addressee , listing of contents , etc . the transfer of information to the client device may be fully automated , conditional upon assent from the user , or fully manual as desired . the foregoing architecture may also be used to remotely initiate processes on other devices , such as peds , “ smart ” phones , network agents , or home pcs . for example , in one exemplary variant , the client device software is programmed to initiate an o / s window or java applet running on a j2me or equivalent equipped distant ( e . g ., ped ) device upon transmission of a prompt corresponding to a given event . the window or applet includes a user name / password feature , wherein the distant user may instruct their client software to initiate certain algorithms or actions , such as transmission of personal information . in one embodiment , a wap 2 . 0 client and proxy are utilized . alternatively , of course , the distant end user may access the desired target ip address or other network node via the internet or comparable network directly via the ped , thereby effectuating the desired transaction . in another embodiment of the invention , a sip ( session initiation protocol ) enabled device or comparable is used to establish a secure user session to transmit the required information . in one variant , a “ poc ” ( push - to - talk { ptt } over cellular ) approach is used , wherein the user &# 39 ; s mobile device includes an architecture that supports instantaneous communications via , e . g ., the aforementioned sip protocol layered over a umts ims architecture of the type well known in the communications arts . for example , the user &# 39 ; s client process can be configured to instigate a poc session upon the user selecting the chattel proxy or application server as a “ buddy ” and invoking a ptt transmission . so - called “ ptx ” or “ push - to - anything ” technology may be used for this purpose ; e . g ., pre - formatted packages of data necessary to perform chattel management or related functions can be immediately transmitted to the desired receiver via a one - button transmit functionality . these packets may be encapsulated for security purposes , e . g ., via an application layer or other protocol such as digest , ipsec , mikey , etc . alternatively , where bluetooth is utilized , the proxy or application server can conduct a ( e . g ., user - permissive ) object pull according to the k - 11 or obex profiles . the proxy or application server may also require authentication of the user ( or mutual authentication ) before any data push or pull is allowed , such as via a rand challenge - based approach or the like . this helps mitigate “ spoofing ” or surreptitious denial of service to the user , and substitution of an unauthorized device in place of the true chattel owner , or reception of the user &# 39 ; s personal data by an unauthorized device . in another embodiment , the user &# 39 ; s cellular telephone equipped with assisted gps ( a - gps ) or other such locating system can be used to provide forwarding information . specifically , in one variant , the user &# 39 ; s a - gps system is prompted to save the coordinates of a particular location where the package must be delivered . for example , a user may want his chattel shipped to a third party where he / she is presently located . the user can merely push a soft function key on their client process , the soft function key either saving the coordinate for a later time / date , or transmitting it to a designated agent ( such as the chattel management proxy ) described elsewhere herein . that way , the user can merely specify the saved / transmitted location as the destination , without having to remember addresses , zip codes , etc . for the destination . alternatively , the user can maintain a log or listing of saved gps coordinates ( and or address information ) for easy recall at a later date . in a manner somewhat analogous to the a - gps , the user can also use their client process to exchange information with other user &# 39 ; s devices ( such as via a bluetooth “ discovery ” process or obex object exchange ). for example , a user may want their chattel shipped to a friend they are traveling with ; the user can then handshake with their friend &# 39 ; s device to pull / receive an electronic business card with the required delivery information . such an approach may be useful where the chattel is rented out or intended for temporary use . consider , for example , where the user rents a car , drives to the airport , leaves the car , and approaches the security checkpoint . the user can ( while at the car rental agency ) use either gps location or “ pushed / pulled ” data as the basis for a communication to the chattel management system , the data instructing the latter as to where to return the car keys . myriad other configurations will be recognized by those of ordinary skill provided the present disclosure . in yet another exemplary embodiment , a user can utilize a more simplified device for communicating with the kiosk or module 110 . for example , a coded rfid device ( to be distinguished from that in the shipping element 104 ) may be used to automatically provide the kiosk / module 110 with the user &# 39 ; s information , much in the way the prior art mobil “ speed pass ” provides fueling station pumps with payment information , or the mastercard paypass system allows for commercial transactions . as another option , a usb key of the type well known in the art can be simply plugged into an accessible usb port of the module 110 , thereby potentially both ( i ) transferring the user &# 39 ; s information , and ( ii ) saving a user record of the transaction within the user &# 39 ; s key . this approach can be coupled with the rapid drop capability described elsewhere herein , such that the kiosk associates a given chattel passed through its aperture or slot with a given user . for example , in one variant , the user simply places the chattel in a holding slot or receptacle , this action which prompts the user via a crt , lcd , tft , leds , audio prompt , or other ui to scan their rfid device past a sensor . after the kiosk controller / processor module and reader interrogates and retrieves the desired information from the rfid device ( and also another entity or database , if desired , such as a pay authorization entity ), the user is presented with a visual or other display of the shipping information , at which point the user may confirm or cancel . if confirmed , the kiosk then automatically opens the aperture or slot to receive the user &# 39 ; s device . internal mechanisms within the kiosk then either ( i ) tag the chattel as belonging to a particular user , such as via attachment of a tag or label , insertion in a “ tagged ” shipping element 104 , diversion to a segregated chute or container , etc . alternatively , the user can be prompted to affix a bar code , label , tag , or other identifying device , such as may be issued by the kiosk . hand sorting of the various chattels may then be accomplished by personnel emptying the kiosk receptacle . in another embodiment , computer - readable purchase receipts using multi - dimensional bar codes of the type well known in the art , or other comparable mechanisms , may be used consistent with the invention for encoding the chattels and / or shipping elements 104 . as yet another alternative , the user may simply affix their personal rfid device to the chattel , scan as previously described ( such as where the receptacle holding slot / aperture is integrated with or proximate the personal rf id reader ), and authorize , at which point their chattel and their personal rfid device are collectively shipped to the destination . this variant obviates use of the second rfid device within the shipping element , since the user &# 39 ; s rfid device contains all of the necessary information , some of which can be encoded onto the device at the time of scan at the kiosk . for example , the user &# 39 ; s rfid device can be equipped to have sufficient storage capacity and to receive data from the kiosk reader / interrogator such that this encoding of additional information occurs seamlessly . as yet another alternative , the kiosk may be fitted with a card reader adapted to receive cards pre - encoded (“ pre - paid ”) with a given monetary value . for example , as is well known , cards bearing magnetic media may be encoded at a remote terminal after the user deposits a given amount of currency . such cards are currently employed , for example , in libraries where photocopy machines are present , or for telecommunications services . in the present context , the user might deposit a comparatively large amount of currency at the encoding terminal to encode or pre - pay for the deposited amount . subsequent insertions of the card into the card reader read the encoded data ( correlating to a currency balance remaining ), subtract the amount of the current transaction , and then recode the card commensurate with the remaining balance . in this fashion , the user may avoid having to carry currency or change each time they wish to use the terminal ; rather , they simply swipe or insert / retract the card from the reader / encoder , thereby automatically debiting the card . as yet another alternative , a user &# 39 ; s pre - paid cellular device can be exchanged for services in shipping their chattel . in one exemplary embodiment , the prepaid cellular device is configured to interface with the kiosk ( such as via direct physical or wired connection , or wireless link such as rf , inductive , irda , or other ) such that the service provider for the prepaid device authorizes payment of the chattel shipping via the cell phone / kiosk interface . as even another alternative , the user who travels frequently can pre - code their devices using apparatus disposed at the pod , their home , or other locations . for example , in one embodiment , the user can attach an rfid devices to their chattels of any significant worth ( e . g ., cell phone , pda , car keys , etc .) and encode them with their personal information . alternatively , these devices may be disposed within the chattels at time of manufacture , and then encoded at or after purchase by the user . once encoded , these devices can then be immediately scanned when placed in proximity to the reader 108 at the kiosk or other location . this obviates having to carry another currency source or personal rfid device . in another embodiment , user - specific biometric data can be used alone or in conjunction with other data sources to authenticate or provide the required input to the kiosk . for example , in one variant , the user &# 39 ; s fingerprint , retinal scan , facial recognition software scan , or voiceprint are used in a two - of - two , three - of - three , etc . coincidence circuit ; i . e ., when all inputs can be authenticated and correlated to one individual , the user &# 39 ; s data is accessed ( such as may be kept in a secure data facility in data communication with the kiosk or its proxy ) and used as the basis for payment , shipping destination , etc . in another embodiment , the system 100 can be coupled to the passenger reservation system operated by the relevant transportation agent ( e . g ., airline or travel agent ), such that upon entry of the user &# 39 ; s personal information , the reservation system is accessed to retrieve the user &# 39 ; s destination and / or routing information . the option of “ route to destination ” can then be presented to the user , such as via a touch screen display on the kiosk , thereby allowing one - touch destination selection . other options may include “ home ”, “ office ”, or any parties designated by the user either manually or via download of information from the personal rfid device or client device ( e . g ., pda or cell phone ). the foregoing approaches also have the added benefit ( to varying degrees ) of reducing overhead costs associated with setting up and managing the trust , since electronic transactions / reporting are often more cost efficient that manual performance ( such as by employees interacting with various entities in person or over the telephone or via mail ). it will also be recognized that use of the invention in a pod application may also carry certain economies of scale which can be exploited to the advantage of the carrier or others . for example , where many people traveling on an aircraft utilize the services described herein to forward their chattel to their travel destination , that same aircraft on which they are traveling can be used as the carrier mechanism for these chattels . hence , if the shipping and security scanning procedures of the chattels can be accomplished rapidly enough , the chattels can optionally be loaded on the very same aircraft ( or another traveling to that same destination ), and provided to the traveler upon their egress from the aircraft using procedures which are in effect substantially the inverse of those described herein for registering / shipping the chattel . in yet another embodiment , the shipping service provided to the user can be virtual in nature either in place of or in conjunction with the tangible services previously described . for example , where the user has an electronic device with important information ( e . g ., laptop , pda , etc . ), yet they are not allowed to take the device or magnetic media on the aircraft or other modality , they can ( i ) download the relevant information to a proxy agent ( e . g ., software process ) running on the kiosk or its proxy , and direct the proxy agent to forward the information to a designated real or virtual storage location ( such as an e - mail account , accessible url , third party storage facility , etc . ), and ( ii ) utilize the kiosk to physically transfer the device to a designated location . hence , where the user simply needs a few data files from their pda , they can download these using , e . g ., a bluetooth , wifi , or other wireless link and encrypted protocols to the proxy , which then forwards the files via e - mail to an account accessible by the user at the destination . they then contemporaneously ship the device to their home for later retrieval . it will also be recognized that depending on the configuration of the tag 106 , it may be encoded at time of deposit ( or before / after , such as via the user &# 39 ; s pda which can transmit data to the kiosk module 110 or a connected device ) with various other types of information , including visual or voice data . hence , the shipping element can carry audible instructions or information when decoded at the destination using an appropriate reader with audio capability . hence , the package can also be authenticated to some degree by the recipient before opening it . other types of information , including images , data , etc . can also be encoded into the shipping element . in another variant , the kiosk may be equipped to generate photographic , ir , x - ray , spectrographic , or even holographic images of the chattel for , e . g ., ( i ) electronic transmission to the user at the destination , such as where merely the appearance or other attribute of the device is important or sufficient ; ( ii ) for a security or “ purchase receipt ” record of what was actually deposited at the kiosk , e . g ., for insurance policy claim use or loss claims against the carrier ; or ( iii ) use by the carrier in sorting a bin of chattels . in the case of option ( iii ), users may simply swipe their personal rfid device , which after authorization , results in the kiosk generating the image of the chattel , one ( tactile or electronic ) copy being provided to the user either directly or indirectly , such as via paper copy or e - mail to the user &# 39 ; s designated account , and one for use by the carrier in sorting the receptacle . other data relating to the chattel may also be obtained and encoded / transmitted , such as the item &# 39 ; s weight , ferrous content / magnetization , electric field , luminance , fluorescence , or phosphorescence , fast neutron activation ( fna ) signature , etc . referring now to fig2 a - 2 c , various embodiments of the “ smart ” shipping element 104 of the invention are described . in these embodiments , the rfid tag 106 is disposed within a soft , pliable substrate ( which may be part of the shipping element 104 itself or otherwise mated thereto , such as using an adhesive ). ideally , the tag 106 is made as discreet as possible , thereby not alerting users to its presence . an envelope ( fig2 a ), box ( fig2 b ), and tube ( fig2 c ) are shown , although other forms may be used . the envelope pouch of fig2 a is ideally formed from a flexible material such as a polymer ( e . g ., polyethylene ), tyvek , or even paper , although other materials such as aramid fibers , elastomers , shrink - wrap or thermally responsive polymers , or flexible composites may be used as well . in yet another embodiment ( not shown ) the non - metallic conductive inks of the tag 106 are printed directly on the pliable material during manufacture ( and the ic mated accordingly ). the exemplary “ bistatix ” tag 106 is generally substrate - agnostic , and therefore will operate suitably using the materials listed above or others . it will be apparent from the foregoing discussion that myriad different types of shipping element 104 and tag 106 configurations may be used , the foregoing embodiment being merely exemplary . the receptacle / kiosk may be adapted to accept only certain shapes and / or sizes of element 104 , thereby limiting what can be deposited therein . in yet another embodiment , the kiosk can be configured to automatically package the chattel for the user , the latter merely depositing down a sized slot or aperture . the slot or aperture ( in conjunction with other mechanical elements ) creates an upper bound on the size of chattel that can be inserted . the user then merely swipes their personal rfid device past the reader , which encodes the tag 106 on the shipping element , seals the element 104 , and charges the user &# 39 ; s account based on the prevailing cost structure ( e . g ., weight / destination / priority / special handling ). if for whatever reason the item cannot be processed , such as where it is too heavy or the user &# 39 ; s payment method is refused , the kiosk merely activates a chute at the bottom of the kiosk to eject the user &# 39 ; s chattel into a tray , much akin to a vending machine . again , the slot or aperture can be actuated only upon conditions precedent if desired , such as authentication of the user &# 39 ; s payment source , etc . in another embodiment , the kiosk includes an lcd display and magnetic card reader of the type well known in the art e . g ., similar to those commonly found on gasoline pumps . such terminal also includes a “ soft ” keypad having a plurality of fixed or soft ( programmable or software controlled ) function keys . such soft keypad may comprise , for example , a capacitive keypad , crt - based “ touch screen ”, lcd , tft , or any other similar technology . it will be recognized that mechanical keys or button assemblies may also be used ; however , such devices are generally less weather and foreign - matter resistant , and require greater maintenance . the function keys provide a number of different functions to the user , including a “ print receipt ” function ( which may be coupled to a paper or electronic receipt functionality ), debit / credit select keys , transaction acknowledgement key , as well as an alpha - numeric keypad for entering data such as passwords , y / n inputs , etc . such functions and technology are well known to those of ordinary skill in the electronic arts , and accordingly not described further herein . once the commands for the desired transactions have been received by the kiosk , the user is prompted and then selects their payment mode ( e . g ., debit card ) via a fixed function key , and then swipes their card through the card reader . when the magnetic strip ( or smart card ) is read by the reader , the user &# 39 ; s debit information is transferred to the processor of the terminal , wherein the algorithm running thereon next initiates a request for the user &# 39 ; s password or “ pin ” code via the display device ( or alternatively via an audio interface driven by e . g ., stored celp voice data file , not shown ). after the user enters the pin code or password via the keypad , the authorization is obtained from the user &# 39 ; s cca or financial institution using any number of existing commercial financial transaction secure links well known in the industry . once authorized , the controller of the controller issues a command to enable the reader 108 and , optionally unlock the locking device to allow insertion of the shipping element 104 . in yet another embodiment , the chattels of two or more users can be aggregated into a common shipment or shipping element 104 in order to reduce costs . for example , where a number of passengers in a security checkpoint are traveling to the same destination , and a plurality of them have chattels which cannot be taken on board , the users can pair up in groups of two or more and utilize a common shipping element . to this end , the pod facility , air carrier , etc . can also provide or facilitate such a service , such as where the air carrier provides a kiosk whereby all user &# 39 ; s with rejected chattels can deposit their chattels for shipment to the destination via the passenger &# 39 ; s aircraft or another aircraft / mode . this service may be provided either gratuitously or for a fee . in another embodiment , the user , carrier or service provider can provide “ stick - on ” or otherwise selectively attachable rfid , bar code , magnetic strips , or even printed tags which the user can apply to their chattels for tracking . for example , in one case , the user can apply a number of pre - coded bar code labels to each of their chattels before travel ( or even at the pod once they know that the chattel cannot be transported via the selected modality ). the user then simply scans the label with a bar code reader provided a the kiosk ( akin to a prior art supermarket checkout kiosk ), and deposits the chattel in the receptacle ( whether in a shipping element 104 or not ) for subsequent handling by the carrier . to this end , users can establish pre - existing accounts , much like a prior art fedex or ups account , whereby the payment , shipment , etc . information is already known by the carrier . multiple different options can also be selected by the user such as , e . g ., at time of scanning , wherein the crt or other kiosk display device prompts the user to select a shipping destination , etc . the carrier can also utilize the aforementioned economies regarding co - location to make the service more cost efficient . for example , a kiosk at san diego airport is likely to receive a large number of chattels from people in the greater san diego area requesting that the chattels be returned to their home address , thereby allowing for grouping of deliveries for greater economy . furthermore , “ intelligent ” kiosk management can be utilized , whether in operation and / or construction , so as to increase economies . for example , the kiosk or subsequent handling mechanisms can be configured to selectively sort the deposited shipping elements or chattels based on destination . furthermore , the controller module of the kiosk can be programmed to alert a parent or proxy node of the need for unloading of the receptacle under certain conditions , such as when a sufficient number of items for a given destination are received . in order to reduce cost to the user , the latter may also be given the option to trade cost for latency ; i . e ., if a user can wait longer to get their chattel back , their cost of shipment can be lowered . this dynamic is particularly relevant to the present invention , since many travelers won &# 39 ; t arrive back home for several days anyway , thereby increasing their tolerance to longer shipping delays . this metric can also be managed by the kiosk or carrier , such as where kiosks are preferentially distributed ( or alternatively are equipped with receptacles equating to different shipping priorities or delays ) such that their users are skewed towards the relevant portion of the population . for example , a “ long delay ” shipment kiosk may be placed at the international terminal , a shorter latency kiosk may be suited better to the domestic or commuter flight terminals . also , the carrier or provider of the kiosk can coordinate with other carriers ( such as fedex or ups ) so as to intelligently schedule and manage distribution of the chattels to their destinations . for example , with data coupling of the kiosk carrier system with that of other carriers , and coordination there between , duplication of routes can be minimized , such as through a cross - carrier distribution agreement . as shown in fig3 , the internet or other internet / intranet is used as the basis for one embodiment of the “ backbone ” of the system 300 . the system 300 includes , for example , a backend server 306 , a plurality of “ front end ” kiosk devices 308 , including one or more mobile wap - enabled wireless devices 310 , the kiosks interfaced through a wireless base station 312 and wap gateway 314 of the type well known in the art , the latter being in data communication with the internet 302 . the wap associated wtls security protocols may also be employed if desired . clearly , the use of wap and a wireless topology in this embodiment is merely illustrative . the internet 302 advantageously makes use of the well known and generally ubiquitous tcp / ip protocol , thereby assuring compatibility and access by a wide variety of existing client devices . the server 306 is coupled to a database 307 which provides , inter alia , storage of user - related data and information such as personal information , statistics , security information , credit card information , etc . it will be recognized that multiple database entities may be used , such multiple entities being either co - located or disparate . the database 307 may also be functionally ( as opposed to physically ) partitioned and firewalled , such that various types of data are restricted from access by certain entities . additionally , the pod kiosks 308 may coupled directly to the internet , lan , wan , man , intranet , etc . via a service provider 332 ( dedicated or otherwise ). the kiosks 308 may include for example audio - visual apparatus such as an h . 323 - compliant protocol suite adapted for transfer of audio - visual data between the user and a customer service agent 336 , whereby the user and agent can communicate audibly ( such as via voip software installed on the kiosk and agent terminal ) and visually to complete the transaction . alternatively , the kiosk 308 can be configured with speech recognition software of the type now well known in the art to convert audible speech by the user to text or other data which is then utilized by the distant end to accomplish any number of functions such as chattel deposit and routing , providing on - demand information , etc . a text - to - speech ( tts ) capability may also be employed , wherein pre - stored or dynamically generated data files may be converted to audible speech at the kiosk . alternatively , pre - stored celp or similar compressed speech data files may be decompressed and played at the kiosk to provide audio information . a capacitive or other type of touch screen is optionally provided as an input device , with the display of the kiosk 308 ( not shown ) acting as both a display device and an input device , thereby simplifying the user interface . in another embodiment , a peer - to - peer arrangement ( either aided by a network agent or server , or true p2p ) may be used as the model for communications between entities , whether customer - to - carrier , customer - to - customer , carrier - to - carrier , etc .). it is even envisioned that a user - based bidding or barter system may be established , such as where users may place bids on unclaimed chattels ( somewhat akin to the prior art “ ebay ” paradigm ), or barter between themselves via p2p to exchange chattels . for example , a user unable to carry a given chattel on an aircraft may invoke a p2p session over their wifi link , and solicit a bid for the chattel form another party on say , an incoming aircraft or waiting to pick up a passenger in the terminal . the selling user can then deposit the chattel in a nearby kiosk as described elsewhere herein , and the purchaser can be electronically enabled to access the chattel after payment is made . hence , the kiosk can act as an electronic transaction arbiter and temporary storage location , for a fee to be extracted from the seller or buyer ( or both ). the particular kiosk where the chattel is deposited can also be readily identified to the purchaser via their ped or other means , such as a page to their cell phone , etc . a user can also reroute their chattel to another location after deposit . these transactions can also be conducted via cell phone if desired , again with the kiosk or system 100 acting as the intermediary for the transaction . it will be recognized that myriad different audio , display , and input technologies may be utilized consistent with the invention to transfer information between the user and the “ agent ” of the carrier . furthermore , the term “ kiosk ” is not limited to any particular physical layout , location , or arrangement . for example , a kiosk may be fixed or mobile , stand - alone or as part of another structure or component , indoor or outdoor , etc . also , the kiosks or their components also need not be in one physical location ; rather a “ virtual ” kiosk scattered at various locations throughout the pod for example is envisaged , acting electronically as one kiosk . in this fashion , data received and actions taken by various different physical kiosks can be coordinated and / or analyzed as desired . furthermore , the kiosks of the present invention ( s ) need not be fixed , but may also be mobile , such as where they are mounted on vehicles which are roving in nature . in one variant , an airport cart is configured with a mobile kiosk with secure wifi or uwb link ; the driver drives the cart to different security locations periodically to pick up chattels from users ( or merely allow them to interact with the kiosk as previously described herein ), or even for incidental user contact , much the way one waves down a taxicab . as yet another option , the interface between the shipping agent or its proxy and the user may be implemented using a virtual private network ( vpn ) of the type well known in the art , which provided secure end - to - end communications between two or more points via an untrusted network such as the internet . this embodiment may be implemented via the aforementioned wap / wtls technology suite and associated protocol stacks , through a dedicated or shared radius server and tunneled packets , or any other comparable arrangement capable of restricting access to the transmissions , database or other repositories of information to only authorized personnel . use of such security technology may be an important criteria in certain contexts , since users may want to have their personal data ( i . e ., identity , place of residence , credit card information , etc .) maintained in strict confidence to avoid any fear of surreptitious theft and use of this information without authorization ( e . g ., “ identity theft ”), or attempts to interfere with the delivery of the shipping element at or near its destination . the internet may also advantageously be used as a medium for receipt of shipment requests or solicitation of new prospective participants , in that a url ( e . g ., designating a worldwide website ) may be used to provide information , receive data , requests for additional information , etc . furthermore , meta - tags embedded in the site will key internet search engines to locate the site upon the initiation of an appropriate search using an internet search engine ( such as yahoo !, google ™, etc .). in one embodiment , an applet or comparable browser mechanism is initiated upon such search , the applet being configured to alert the user to the existence of the url / website when a search having appropriate parameters is initiated . it will be appreciated that the chattel transport services described herein may also be provided in conjunction with other services , whether related or not . for example , chattels may be stored ( either at the pod or another location ) for a finite period of time at the user &# 39 ; s request , somewhat like an airport or bus terminal locker . in one variant , the transport destination may be designated as opod ( original pod ), such that the user can merely pay for the storage of his / her chattel , and then recover it at a later time , such as upon the completion of their return flight . others may also be authorized to access the storage facility / receptacle , such as family members , etc . other services may comprise , e . g ., cleaning , repair , maintenance , testing , etc . of the chattel , registration in a database , etc . the user may also be presented with pos ( point of sale ) options at the pod for these or other goods / services , such as flight insurance , chattel shipment insurance , mp3 or music downloads , or even carrier - authorized replacement chattels for those being surrendered by the user . it is also noted that the various tracking or marking mechanisms described herein ( i . e ., rfid , bar codes , magnetic strips , etc .) are not exclusive of one another , and in fact may be used together to advantage , such as to perform different functions at different points throughout the processing or transit chain of the chattels . for example , the rfid tagging approach may be more suitable to one portion of the chain ( such as user interface at the kiosk ), whereas magnetic media may be more desirable for other processing tasks . these different media may also be made selectively removable if desired , so that a chattel or shipping element 104 can be “ marked ” and “ unmarked ” if desired during processing , delivery , security scanning , etc . encodings used on the shipping elements can also be made human readable if desired to facilitate such processing . it should be recognized that while the foregoing discussion of the various aspects of the invention has described specific sequences of steps necessary to perform the methods of the present invention , other sequences of steps may be used depending on the particular application . specifically , additional steps may be added , and other steps deleted as being optional . furthermore , the order of performance of certain steps may be permuted , and / or performed in parallel with other steps . hence , the specific methods disclosed herein are merely exemplary of the broader methods of the invention . while the above detailed description has shown , described , and pointed out novel features of the invention as applied to various embodiments , it will be understood that various omissions , substitutions , and changes in the form and details of the device or process illustrated may be made by those skilled in the art without departing from the invention . the described embodiments are to be considered in all respects only illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than the foregoing description . all changes that come within the meaning and range of equivalence of the claims are to embraced within their scope .
| 6 |
a digital phase locked loop which could employ the digital data phase detector of this invention is fully described and discussed in the cross reference patent application entitled &# 34 ; apparatus and method for controlling the frequency at which data is written in a disk drive system &# 34 ;. the digital data phase detector of this invention could be used as the data digital phase detector 36 of fig2 of this cross referenced patent application . fig2 is an illustration of a typical analog signal read from the magnetic media . prior to the sampling of the analog signal by one or more analog to digital convertors , the analog signal is processed to have a baseline value of rb such that the samples will have a value of r1 , rb or r2 if the phase and frequency of the clock is the same as the data . one such apparatus that performs such processing is disclosed in the crossed referenced patent application entitled &# 34 ; apparatus for compensating for non - linear characteristics of magnetoresistive heads &# 34 ;. in many system that employ a digital phase locked loop , the clock is square wave whose rising edge is used to initiate the sampling of the analog signal to obtain a digital sample . fig2 also shows 15 samples of the analog waveform taken in the sequence of s1 , s2 , s3 , s4 , s5 , s6 , s7 , s8 , s9 , s10 , s11 , s12 , s13 , s14 and s15 with values of r2 , r2 , r1 , r1 , r2 , r2 , r1 , r1 , r2 , r2 , rb , r1 , r1 , r2 and r2 respectively . assuming that an encoding scheme encoded the data such that a transition occurred in the magnetic field of the magnetic media whenever a binary 1 occurred in the data stream to be recorded . the sequence of binary bits encoded in the analog waveform would be 1 , 0 , 1 , 0 , 1 , 0 , 1 , 0 , 1 , 0 , 0 , 1 , 0 , 1 and 0 . fig1 shows a block diagram of the digital phase detector of the invention . the digital sample s generated during each clock period is presented via line 53 to shift register 15 for storage . shift register 15 has four stages , ya , yb , yc and yd , for storing the value of four consecutive digital samples . the contents of shift register 15 is made available estimators 16 , 17 , 18 , and 19 every cycle of clock a on line 54 . clock a is obtained by dividing in half the clock provided by the phase locked loop . table a demonstrates the contents of shift register 15 and which samples will be evaluated during consecutive clock a periods . table a______________________________________clock a shift register 15 evalu . period ya yb yc yd yb yc______________________________________1 s2 s1 s12 s4 s3 s2 s1 s3 s23 s6 s5 s4 s3 s5 s44 s8 s7 s6 s5 s7 s65 s10 s9 s8 s7 s9 s86 s12 s11 s10 s9 s11 s107 s14 s13 s12 s11 s13 s12______________________________________ table a shows the order in which samples are shifted through the shift register 15 and that each samples will be effectively evaluated in the sequence that the samples are stored in shift register 15 . it should be noted that each stage of shift register 15 stores a multi bit positive or negative binary number . estimators 16 , 17 , 18 and 19 each generates a predicted value for the sample received from stages ya , yb , yc or yd respectively via buses 31 , 32 , 33 or 34 respectively . the predicted value is that value which the sample should have had , r1 , rb or r2 , if the phase and frequency of the clock and the data are the same . two threshold values t1 and t2 are stored in registers 65 and 66 respectively and are provider to each of the estimators 16 , 17 , 18 and 19 via buses 67 and 68 respectively . fig2 illustrates that threshold value t1 has a value between the value of rb and r1 and that threshold value t2 has a value between the value of rb and r2 . each estimator 16 , 17 , 18 and 19 has three outputs labeled r1 , rb and r2 , one output will be high and the remaining two outputs will be low during any given period of clock a . referring to fig4 each of the estimators 16 , 17 , 18 and 19 is comprised of comparators 80 and 81 and nor 82 . comparator 80 generates the output labeled r1 which will be high only when the value of the sample received from the stage y of shift register 15 has a value greater than threshold value t1 . comparator 81 generates the output labeled r2 which will be high only when the value of the sample received from the stage y of shift register 15 has a value less than threshold value t2 . nor 82 generates the output labeled rb which will be high only when both of the outputs labeled r1 and r2 are low , that is when the value of the sample in stage y is equal to or less than the threshold value t1 and is equal to or greater than the threshold value t2 . error detector 20 generates a correction signal at terminal 10 which is provided to adder 22 via bus 47 . the correction signal is indicative of the magnitude and the direction of the error between the phase of the clock and the data encoded in the analog signal . the correction signal is derived from the value of the sample stored in stage yb received via bus 32 at terminal 0 . the sign of the correction signal is obtained from the slope of the analog signal when the sample stored in stage yb was obtained from the analog signal . the slope is determined from the sequence of predicted values established by the raised output of estimators 16 , 17 and 18 . the three outputs from estimators 16 , 17 and 18 via buses 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 and 43 respectively are received at terminal 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 and 9 respectively . the values for rb , r1 and r2 are stored in registers 57 , 58 and 59 and are provide to error detector 20 via buses 60 , 61 and 62 at terminals 11 , 12 and 13 respectively . error detector 21 generates a correction signal at terminal 10 which is provided to adder 22 via bus 48 . the correction signal is indicative of the magnitude and the direction of the error between the phase of the clock and the data encoded in the analog signal . the correction signal is derived from the value of the sample stored in stage yc received via bus 33 at terminal 0 . the sign of the correction signal is obtained from the slope of the analog signal when the sample stored in stage yb was obtained from the analog signal . the slope is determined from the sequence of predicted values established by the raised output of estimators 17 , 18 and 19 . the three outputs from estimators 17 , 18 and 19 via buses 38 , 39 , 40 , 41 , 42 , 43 , 44 , 45 and 46 respectively are received at terminal 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 and 9 respectively . the values for rb , r1 and r2 are stored in registers 57 , 58 and 59 and are provide to error detector 21 via buses 60 , 61 and 62 at terminals 11 , 12 and 13 respectively . fig5 shows the logic included within error detectors 20 and 21 . fig3 is a chart showing the sequences of predicted sample values which can be used in generating a correction signal , the slope associated with each sequence , the encoded value for each sequence , the logic element of fig5 which tests for each sequence and the formula for generating the correction value for each sequence . commonly used values are 1 for r1 , 0 for rb and - 1 for r2 and are so used in fig3 and in the discussion of the operation of error detectors 20 and 21 . the sequence of 0 1 1 in the sequence column indicates that the predicted value for the sample in stage ya is 0 and therefore the output rb of estimator 16 is raised , the predicted value for the sample in stage yb is 1 and therefore the output r1 of estimator 17 is raised and the predicted value for the sample in stage yc is 1 and therefore the output r1 of estimator 17 is raised . slope information can be obtained from the sequences listed in the sequence column of fig3 . those sequences not listed do not provided sufficient information to derive the slope of the analog signal such that the sign for any correction value can reliably be determined and therefore a correction value of 0 is generated for those sequences . referring to fig2 if the phase of the clock lags the phase of the data , that is the clock is running slow , then the analog waveform would be shifted to the left . using for example the samples s2 , s3 , s4 and s5 , such a shift to the left results in the sample value for samples s2 and s3 on the positive slope being more positive than r2 and r1 respectively and the sample value for samples s4 and s5 on the negative slope being less positive than r1 and r2 respectively . the correction value is obtained on the positive slope by subtracting from the measured sample value the predicted sample value , that is either r1 , rb or r2 , for that measured sample value and on the negative slope by subtracting the measured sample value from the predicted sample value , that is either r1 , rb or r2 , for that measured sample value . the resulting correction value will have positive sign which causes the voltage controlled oscillator in the digital phase locked loop to increase in frequency thereby effectively moving the analog signal to the right . conversely , if the phase of the clock leads the phase of the data , that is the clock is running fast , then the analog waveform would be shifted to the right . using for example the samples s2 , s3 , s4 and s5 , such a shift to the right results in the sample value for samples s2 and s3 on the positive slope being less positive than r2 and r1 respectively and the sample value for samples s4 and s5 on the negative slope being more positive than r1 and r2 respectively . the correction value is obtained on the positive slope by subtracting from the measured sample value the predicted sample value , that is either r1 , rb or r2 , for that measured sample value and on the negative slope by subtracting the measured sample value from the predicted sample value , that is either r1 , rb or r2 , for that measured sample value . the correction value will have a negative sign which causes the voltage controlled oscillator in the digital phase locked loop to decrease in frequency thereby effectively moving the analog signal to the left . it should be remembered that the samples can be either a positive or negative number and that the value of r2 is a normally a negative number . as can be seen in fig3 the measured sample value y for all sequences having a negative slope is subtracted from the predicted value yb for the sequence of ya yb yc or from the predicted value yc for the sequence of yb yc yd to obtain the correction value for the voltage controlled oscillator . in like manner for all sequences having a positive slope , the predicted value yb for the sequence of ya yb yc or the predicted value yc for the sequence of yb yc yd is subtracted from the measured sample value y to obtain the correction value for the voltage controlled oscillator . the calculations for obtaining the magnitude and sign for the correction value for a measured sample value y where r1 is a positive number , rb is equal to zero and r2 is a negative number , are as follows : referring to fig5 the logic of error detector 21 will be discussed with rb = 0 , r1 = 1 and r2 =- 1 and in conjunction with the subject matter presented in fig3 . error detector 20 will not be discussed since the operation of error detector 20 is the same as the operation of error detector 21 except for the source of the inputs at terminal 0 - 9 . a raise output will be designated as a 1 and a low output will be designated as a 0 . the predicted values generated by each estimator is encoded into two bits m and l as set forth in the following truth table : ______________________________________ m l______________________________________r1 ( 1 ) 1 1rb ( 0 ) 0 1r2 (- 1 ) 0 0______________________________________ the encoding is obtained by using the output r1 as bit m and the inverted output of r2 as bit l for each of the estimators used in determining the slope and if a valid sequence for providing a valid correction value is present in stages yb , yc and yd of shift register 15 . inverter 102 inverts the r2 output from estimator 17 appearing at terminal 3 of error detector 21 . inverter 107 inverts the r2 output from estimator 19 appearing at terminal 9 of error detector 21 . it is only necessary to investigate the first and third sample values of a sequence in order to determine the slope of the sequence and whether the sequence is a valid sequence . referring to fig3 the encoded column set forth the encode value for bit md and ld for the first predicted value yd and the encoded value for mb and lb for the third predict value yb for each sequence listed in the sequence column . the value of mb will be a 0 and the value of ld will be a 1 only when there is a negative slope . referring to fig5 the slope is determined by or 110 which will have an output value on line 130 of a 1 when the slope is positive and an output value of a 0 when the slope is negative . inverters 100 , 103 , 105 and 108 and nors 101 , 104 , 106 and 109 form a detector that will provide a 1 to or 111 only when a sequence shown in the sequence column of fig3 is being processed which in turn will then provide a 1 on line 131 . the predicted value yc as determined by estimator 18 is provided on bus 132 . transmission gate 112 will pass the value of 1 ( r1 ) at terminal 12 from register ( r1 ) 58 onto bus 132 if the r1 output received at terminal 4 from estimator 18 is a 1 . transmission gate 115 will pass the value of 0 ( rb ) at terminal 11 from register ( rb ) 57 onto bus 132 if the rb output received at terminal 5 from of estimator 18 is a 1 . transmission gate 119 will pass the value of - 1 ( r2 ) at terminal 13 from register ( r2 ) 59 onto bus 132 if the r2 output received at terminal 6 from of estimator 18 is a 1 . therefore the proper predicted value will be present on bus 132 for the calculation of the correction value . the sample value y stored in stage yc of shift register 15 is transferred from bus 33 at terminal 0 to bus 135 within decoder 21 . when the output of or 110 is a 1 ( positive slope ) the sample value y on bus 135 will pass through transmission gate 114 onto bus 133 to input a of subtractor 123 and the predicted value on bus 132 will pass through transmission gate 116 onto bus 134 to input b of subtractor 123 . when the output of or 110 is a 0 ( negative slope ) the sample value y on bus 135 will pass through transmission gate 121 onto bus 134 to input b of subtractor 123 and the predicted value on bus 132 will pass through transmission gate 120 onto bus 133 to input a of subtractor 123 . subtractor 123 performs the function of a - b . which digital values are received at input a and input b of subtractor 123 is determined by the slope of the sequence thereby allowing the correction calculation , shown in the correction calculation column of fig3 to be performed . each of the six binary bits of the correction value provided at the output of subtractor 123 is connected to one of the ands 140 - 145 . when the output of or 111 is a 1 , indicating a valid sequence , the outputs of ands 140 - 145 will be equal to the correction value of subtractor 123 . when the output of or 111 is a 0 , indicating a invalid sequence , the outputs of ands 140 - 145 will be a correction value equal to zero . the outputs of ands 140 - 145 are connect to bus 136 which exits error detector 20 at terminal 10 and continues on via bus 47 to adder 22 . in a similar manner , for each cycle of operation , error detector 21 will provide a correction value on bus 48 to adder 22 . while the subtractor 123 of error detector 20 is shown to have an output containing six binary bits , it is well understood by those skilled in the art that the number of binary bit in the output of subtractor 123 is not limited to six but rather will be defined by the designer of the specific embodiment of the invention to met the specific requirements of the designer . adder 22 algebraically adds together the two correction values to generate a total correction value and places the total correction value on bus 49 for use in the phase locked loop to control the phase of the voltage controlled oscillator . effectively the digital phase detector provides a total correction value every other clock cycle thereby allowing the digital phase detector to operate at one half the clock frequency while deriving phase information from each sample which are generated at he clock frequency . there are many logic configuration that can be designed to detect the slope and the validity of the sequence other than the preferred logic included in error detector 21 described herein . while the invention has been particularly shown and described with reference to the described embodiment therefore , it will be understood by those skilled in the art that changes in form and detail may be made therein without departing from the spirit and scope of the invention . given the above disclosure of general concepts and specific embodiments , the scope of the protection sought is defined by the following .
| 7 |
referring to fig5 and 6 , it can be seen that the tool carousel according to this embodiment of the invention comprises a number of bracket units 200 which are interlocked to form a carousel wheel 500 . each bracket unit 200 is connected with a respective pot unit 300 and retention collar 400 . each bracket unit 200 , pot unit 300 and retention collar 400 is injection moulded from a plastics material which comprises a chemical lubricant . of course , the components could be manufactured from a different material and an alternative lubricant could be used . each of the three primary components shown in fig6 will now be described in detail . where the bracket units are described , expressions such as &# 34 ; radial &# 34 ;, &# 34 ; axial &# 34 ; and &# 34 ; circumferential &# 34 ; are used with reference to the assembled carousel wheel shown in fig5 . one of the bracket units 200 is shown in detail in fig7 a to 9 . it can be seen that the unit comprises a main bracket body portion 202 , which has a generally wedge - shaped profile when viewed in plan , such as in fig9 . on a first radially extending side of the body portion 202 , there is provided a male dovetail portion 212 . on the opposite radially extending side of the body portion 202 , there is provided a female dovetail portion 214 . each bracket unit 200 has the same configuration , so the dovetail formations from two adjacent bracket units 200 can be interlocked , so as to join them together . due to the wedge - shape of the body portion 202 , thirty bracket unit can be joined together so as to form a complete ring , thereby defining the carousel wheel shown in fig5 . of course , it is not necessary for the carousel ring to be formed from thirty bracket assemblies . if it is intended for the carousel wheel to hold a smaller or greater number of tools , then a corresponding number of bracket units should be used . in such a case , the bracket units will need to have the radially extending sides of the body portion 202 moulded at an appropriately different angle of separation . generally speaking , if a greater number of bracket assemblies are required in order to house a respectively larger number of tools , then the angle between the two sides of the body portion 202 will be relatively smaller . on the other hand , if fewer bracket units are required , then the angle between the two sides of the body portion 202 would be relatively greater . this configuration is particularly suitable for manufacture from plastics materials , hence a lightweight , relatively inexpensive wheel can be constructed , without sacrificing strength and durability . furthermore due to its modular construction , the wheel can easily be repaired or modified . integrally formed with the body portion 202 , there is a hinge arm 204 . the hinge arm 204 extends from the radially outer end of the body portion 202 and is inclined at an angle of 50 ° to the carousel wheel axis . as can be seen particularly clearly in fig8 and 9 , the hinge arm 204 is defined by a generally box - like outer wall structure 216 which is strengthened by three intersecting cross - webs 218 , 220 and 222 . an integrally formed cylinder 224 is situated at the intersection of the three cross - webs 218 , 220 and 222 . it should be noted that the cross - webs and the cylinder all have walls which are generally parallel with the wheel axis . this feature can best be seen in fig6 . the box - like section of the hinge arm 204 has generally parallel sides 226 and 228 . moving away from the junction of the hinge arm 204 with the body portion 202 , the walls 226 and 228 lead into a distal end portion of a relatively narrower width 230 , via inclined walls 232 and 234 . the distal end portion of the hinge arm 230 is provided with a transversely extending barrel 236 having a generally circular cross - section . the barrel 236 has length which is very slightly longer than the width of the distal end portion 236 . each end face 238 of the barrel 236 is provided with a respective axle lug 240 of a generally circular cross - section . the barrel 236 comprises a pair of pockets 242 , each having a rectangular cross - section . the pockets 242 extend in a direction parallel to the cross - webs 218 - 222 and the wheel axis . the cross - webs , 218 - 222 , the cylinder 224 and the pockets 242 result in a strong , yet lightweight unit that can be manufactured from a relatively small amount of material . as can be seen most clearly in fig7 a and 7b , a flexible tongue 206 extends perpendicularly from the bracket unit body 202 from a region close to the junction of the hinge arm with the body portion 202 . the tongue 206 comprises an elongate hook portion 244 extending transversely along its distal end , so as to face generally towards the barrel 236 . the tongue 206 is provided with four integrally formed ribs 246 on the opposite side to the hook portion 244 and in the region of the end at which it is joined to the body portion 202 . the ribs 246 each have a thickness which tapers in a curved fashion from the junction of the tongue 206 and the body portion 202 towards the distal end of the tongue 206 . the ribs 246 serve to constrain the flexion of the tongue 206 in a gradually reducing fashion towards its distal end , thereby providing a precisely controlled spring characteristic . the tongue comprises a further four ribs 247 on its opposite face , these ribs being directed towards the barrel and tapering in thickness from the hook portion 244 to the axial centre of the tongue . the ribs 247 reduce stresses in this part of the unit to an acceptable level when the unit is fully loaded . on a surface of the hinge arm 204 which generally faces the tongue 206 , there are provided a pair of stops 248 , one of which can be seen clearly in fig7 a . each stop is located generally towards the side of the hinge arm 204 and includes a square - section rebate 250 running in a direction generally perpendicular to the axis of the tongue 206 . as can be seen from fig7 a and 7b , the body portion 202 has a general box - structure which is strengthened by a pair of further cross - webs 252 and 254 . this structure also provides strength with low weight and requires a relatively small amount of material for manufacture . extending from the tongue - side face of the body portion 202 are a pair of lugs 256 and 258 , which extend generally parallel to the tongue 206 . each lug is generally in the form of a cylinder which extends into the box of the body portion 202 . as can be seen from fig9 the bores of the cylinders 256 , 258 extend through to the opposite surface of the body portion 202 . a further generally cylindrical portion 260 is situated in a crook defined between the cross - webs 252 and 254 and generally towards the opposite end of the body portion 202 . as with cylinders 256 and 258 , the bore of cylinder 260 extends through to the opposite surface of the body portion 202 . lugs 256 , 258 are used for radial positioning in conjunction with an annular groove in the hub upon which the carousel wheel 500 is mounted . if the annular groove is replaced by a series of accurately bored holes , the lugs can be used for circumferential as well as radial positioning of the bracket units . in such a case , the dovetail formations 212 , 214 could be omitted . the opposite surface of the body portion 202 is provided with a generally trapezoidal wall 208 that extends perpendicularly from the face of the body portion 202 in a direction parallel to the wheel axis . when the bracket units are assembled together to form a carousel wheel , the walls 208 together define a series of radial slots which are used as carousel - locator slots in a &# 34 ; geneva wheel &# 34 ; mechanism for controlling the rotational position of the carousel wheel . the end face of the body portion 202 that faces radially inwardly , when the bracket units are connected together as shown in fig5 comprises a series of radially - inwardly facing teeth 210 which , in conjunction with the teeth provided on the other connected bracket units 200 define a circular gear rack . in use , the gear rack is used to control the rotational orientation of the carousel wheel . since both the geneva mechanism and the gear rack have the same general purpose , one or the other may be deleted . however if both are provided on the bracket units , a choice of rotational position control mechanisms is provided , without requiring two different types of bracket unit to be produced . referring to fig6 and 10a to 12 , the pot units 300 will now be described . each pot unit comprises a tool cylinder 302 integrally formed with a hinge arm 304 , which extends generally radially from an outer surface of the tool cylinder 302 . the hinge arm 304 is hollow and formed from two generally planar flank walls 308 joined by a transverse end wall 310 at their distal ends . each of the flank walls 308 comprises a circular aperture 312 . due to the natural resilience of the flank walls 308 , the apertures 312 snap - fit over the axle lugs 240 provided on a bracket unit . the attachment of a pot unit to a bracket unit in this manner can be seen clearly in fig6 . as an alternative , the hinge arm 204 could be constructed to provide the necessary resilience to enable the snap - fit . each flank wall 308 comprises a cut - away portion 314 which has a generally v - shaped profile , with a somewhat rounded bottom . the cut - away portions 314 are set into the respective edges of the flank walls 308 which address a bracket unit when the two are connected together and arranged in the manner of fig6 . the cut - away portions 314 serve to accommodate the box portion 316 of the bracket assembly . the end wall 310 of the hinge arm 304 is provided with a series of axially extending ridges 316 which interlock with ribs 247 provided on the bracket unit 300 . each of the ridges 316 terminates in an undercut 322 . in use , the transversely extending hooked portion 244 provided on the tongue 206 of the bracket unit 200 snap - fittingly locates underneath the undercut 322 when the pot is rotated about the hinge 240 , 312 in the clock - wise direction , to the position shown in fig6 . this secures the position of the pot unit 300 , relative to the bracket unit 200 . although this clipping method has been found particularly effective , other arrangements may be employed . for example , a much bigger clip , for gripping a cylinder , may be provided on each bracket unit 200 . on the axially opposite side to the cut - away portions 314 , the hinge arm 304 is provided with an integrally formed barrel 318 . the barrel comprises a bore 320 , which extends in a direction perpendicular to the axial direction and the radial direction of the cylinder 302 . in use , the barrel co - operates with a lifting mechanism which comprises a fork 122 for constraining the barrel , the mechanism being used to cause rotation of the pot assembly about the hinge 312 , 240 . such a mechanism is described below . the hinge arm 304 further comprises an internal , lateral cross member 324 for strength and stiffness . two further , mutually parallel internal walls 325 extend perpendicular to the cross member 324 . these also enhance the stiffness of the structure . the tool cylinder 302 is provided , at one axial end , with a seat portion 306 for accommodating a retention collar 400 . referring to fig1 , it will be seen that the seat portion 306 takes the form of an axially extending seat cylinder 326 concentrically situated at one end of the tool cylinder 302 . extending radially into the mouth of the seat cylinder 326 , there are provided three lugs 328 at 120 ° intervals . circumferentially in line with each lug and axially inwardly of the mouth of the cylinder 326 , there is provided an elongate recess channel 329 , which has a part - circular cross - section . a similarly shaped channel 330 is provided between each pair of lugs 328 and extends from the mouth of the cylinder 326 to a shoulder 332 which faces axially back towards the mouth of the cylinder 326 . referring to fig6 and 14 , it will be seen that the retention collar 400 is generally cylindrical and provided with three radially projecting lugs 402 which are located at 120 ° intervals about its periphery , each at an axial distance which is approximately mid - way between the two end surfaces of the holder . each lug 402 is in the form of a flexible bridge , which extends across a respective axially extending channel 403 . the radially outer surface of each lug 402 is provided with an axially extending rib 404 , mid - way between its two circumferential ends . the lugs 402 co - operate with the lugs 328 provided in the cylinder 326 of the tool cylinder 302 . in use , the retention collar 400 is presented to the cylinder 326 , with the ribs 404 circumferentially aligned with the channels 330 provided on the inner face of the cylinder 326 . the retention collar is then inserted axially into the cylinder 326 , until the advancing end surface of the collar 400 abuts the shoulder 332 . at this point , the collar 400 is rotated and the lugs 402 flex radially inwardly , as the ribs 404 are urged out of the channels 330 . to secure the collar 400 in place , it is rotated until the lugs 402 are each situated behind a respective lug 328 , at which point the ribs 404 become circumferentially aligned with the channels 329 and snap into position due to the inherent flexibility of the lugs 402 . the combination of the bridge - shape of the lugs 402 and the channels 403 provides sufficient radial flexibility for this operation to be performed . once the lugs 402 are located axially behind the lugs 328 , the collar 400 is axially secured within the tool cylinder 302 . to remove the collar 400 from the tool cylinder 302 , the collar 400 must first be rotated against the radial resilience of the lugs 402 , until the ribs 404 are once again circumferentially aligned with the channels 330 , whereupon the collar can be axially withdrawn . the retention collar 400 further comprises six internal , axially extending tongues 406 , which are arranged in three groups of two , the groups being located at 120 ° intervals . each tongue 406 is secured at one end to the inner wall of the collar cylinder 400 , and , at the opposite end ( towards the top of fig1 ) is unrestrained , thereby enabling each tongue 406 to flex radially . each tongue is provided with a radially inwardly facing tool - gripping lug 408 proximate to its distal end . in use , the tongues co - operate to grip the pull - stud of a tool holder 600 to secure the tool axially within the cylinder 302 . in this regard , it can be seen in fig6 that the pull - stud of the illustrated tool holder 600 comprises a radial flange 602 . in practice , the tool holder is inserted into the tool cylinder 302 from the end of the tool cylinder that is opposite to the end in which the tool holder 400 is inserted . therefore , the pull - stud of the tool holder enters the collar 400 from the bottom of fig1 . as the pull - stud moves between the lugs 408 , the tongues 406 move radially outwardly . once the flange 602 has moved above the lugs 408 , as shown in fig1 , the tongues snap back into place , thereby resisting downward movement of the pull - stud 600 . radially inwardly directed struts 410 serve restrict radial displacement of the pull - stud during insertion , thereby protecting the tongues 406 from over - flexion . as a consequence of the described arrangement , collars having different internal dimensions , for holding tool holders configured to different standards , may be interchangeably secured within the pot cylinder . it is even possible to configure a retention collar to be axially reversible ; that is to say with means for gripping one type of pull - stud in one axial end region and different means for gripping a different type of pull - stud in the opposite axial end region . in use , the bracket units are connected together in the manner shown in fig5 . each bracket unit is provided with a respective pot unit 300 , these being connected together as shown in fig6 . each pot unit 300 has a retention collar 400 fitted inside in the manner described above . the assembled carousel is fitted to a tool changer of the general type shown in fig1 . in this arrangement , the geneva wheel indexing mechanism will be situated towards the right of the tool carousel , as viewed in fig1 and the open , tool receiving end of each tool cylinder 302 will face towards the left of fig1 . the carousel is caused to rotate using either the geneva wheel mechanism or the gear rack 210 , until the desired tool is situated at the bottom of the tool carousel . when in this position , a tool release mechanism ( described below ) causes the tongue 206 to lift up , thereby allowing the tool cylinder to rotate around the hinge 240 , 312 . the rotation of the tool cylinder is controlled by a lifting / lowering mechanism ( described below ) which interacts with the barrel 318 . once the pot unit has been moved into a position whereby the tool cylinder has its axis vertically aligned , the tool can be removed from the cylinder using a tool arm in the standard manner . a pot lifting and lowering mechanism 700 will now be described with reference to fig1 to 19 . the mechanism comprises a vertically - mounted cam wheel 702 which rotates on a horizontal axis 704 . the cam wheel comprises a radially outer geared periphery 706 which meshes with drive gearing provided on a drive motor 708 . the cam wheel 702 comprises two primary camming formations . the first of these is a spiral channel 710 which is moulded into a first face of the cam wheel 720 . the spiral channel accommodates a lug ( not shown ) of a lifting arm 121 , which extends generally vertically , as can be seen in fig1 . as the cam wheel 702 is caused to rotate by the motor 708 , the lug , which is entrained within the spiral channel and which is constrained to move only vertically , is caused to move up or down , depending upon the direction of rotation of the cam wheel 702 . this , in turn , causes the arm 121 to move up and down and , thus , the fork 122 with its mouth 123 moves up and down correspondingly . on its opposite side , as can best be seen from fig1 and 20 , the cam wheel 702 is provided with a generally circumferentially extending camming surface 712 . this camming surface bears against a release pin 714 , which is vertically mounted and comprises a lifting catch 716 at its axially lowermost end . the lifting catch 716 is hooked underneath the tongue 206 of the bracket unit currently in position . a helical compression spring 718 encircles the release pin 714 between its head 720 and the upper surface of a mounting bracket 722 , through which it extends . the compression spring 718 urges the release pin 714 upwards , but this action is resisted by the camming surface 712 , which bears on the head of the pin 720 . referring to fig1 , it will be seen that the camming surface 712 has a part - circular portion 713 that extends for 270 ° about the axis at a constant , maximum radial distance . whilst this part - circular bearing surface 713 bears against the head of the release pin 714 , the pin is maintained in the lowermost position shown in fig1 . however , the camming surface 712 also comprises a chamfered portion 715 defined by two flat portions 717 , each of which is radially closer to the rotation axis of the cam wheel 702 than the part - circular portion 713 . consequently , when the cam wheel 702 is rotated to bring the chamfered portion 715 above the release pin 714 , the pin is allowed to move upwardly , under the action of the compression spring 718 , and the lifting catch 716 lifts the tongue 206 of the pot unit 200 upwards . this releases the pot unit 300 in such a manner that it can be rotated about the hinge 240 . due to the relative configurations of the spiral 710 and the cam surface 712 , at the time that the hinge is lifted upwards , the arm 121 is caused to move downwardly and the fork 122 then begins to push the barrel 318 downwardly , thereby causing the pot unit 300 to rotate about the axis . more specifically , referring to fig1 , when the cam wheel 702 is orientated such that position a on its circumference is at the lowermost point , the arm and the release pin 714 will be positioned as shown in fig1 . if the wheel 702 is then caused to rotate in the clockwise direction of fig1 , the arm 121 is first lifted slightly , so causing the fork 122 to take the load of the clip 206 . the release pin 714 is then allowed to spring upwards , thereby lifting the tongue 206 . thereafter , the arm 121 is gradually lowered , until point b is lowermost , at which time the pot unit has been rotated around the axle 240 to such an extent that it will not longer be interfered with by the tongue 206 . therefore , the cam surface 712 once again lowers the catch . as the cam wheel 702 is rotated further in the clockwise direction , the arm 121 is lowered still further until it reaches a lowest point , when circumferential point c of the cam wheel 702 is lowest . at this point , the tool cylinder 302 has its axis aligned vertically and the tool is ready for removal by the transfer arm 4 . to lift the pot unit , the cam wheel 702 is merely rotated in the opposite direction , so as to move the cam wheel 702 anticlockwise as seen in fig1 . fig2 shows a drive mechanism 800 for use in conjunction with the circular gear track 210 . the drive mechanism comprises a motor 801 fitted with a drive shaft 802 with a radial gear 804 for meshing with the drive track 210 . the drive shaft is fitted with a steel bar 806 that rotates as the drive shaft 802 rotates . three proximity switches 808 , 810 and 812 are provided along the rotational path of the bar 806 . these are connected with a control device 814 that controls the rotational speed of the motor 801 . the operation of the mechanism will now be described with reference to fig2 . upon application of a current to the motor , it ramps up to a maximum speed indicated at w in fig2 . the motor continues at this speed until an end 850 of the bar 806 passes proximity switch 808 , as shown in chain - dot line in fig2 . once the proximity switch detects the presence of the iron bar , the motor is ramped down to an intermediate speed , the occurrence of which is shown at x in fig2 . the motor then continues to rotate at the intermediate speed , until proximity switch 810 detects the presence of the iron bar . this event is indicated at y in fig2 . it will be seen that the controller 814 then steps the motor down to the minimum rotational speed , until the leading edge of the bar end passes proximity switch 812 and the trailing edge of the bar end simultaneously passes proximity switch 810 , when the controller sends a signal for the motor to stop , as indicated at z in fig2 . this arrangement allows the rotational velocity of the motor to be arrested in a precise and controlled manner that avoids damage to any of the components of the carousel . whilst the present invention has been described in connection with what is considered the most practical and preferred embodiment , it is to be understood that this invention is not limited to the disclosed embodiment , but is intended to cover various arrangements including within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements .
| 8 |
the present invention will now be described with reference to the accompanying drawings . fig1 shows a principle of the double effect absorption type refrigerator according to the invention . the double effect absorption refrigerator is comprised of regenerators 1a and 1b , a condenser 2 , an evaporator 3 , an absorber 4 , pump means 8 for circulating absorbing solutions 6 , 6a and 6b and refrigerant 7 among these structural components and a heat exchanger 5 . each component will operate as follows . a cool water 10 is supplied into interiors of an evaporator tube bundle 9 of the evaporator 3 whereas a refrigerant 7 supplied from a refrigerant pump 8b is sprayed to the outside of the tube bundle through spray nozzles 11 to thereby remove heat out of the cool water by its evaporation latent heat . an aqueous lithium bromide solution has a vapor pressure much lower than that of water kept at the same temperature and enables to absorb water vapor generated at a considerably low temperature . in the absorber 4 , a refrigerant vapor generated in the evaporator 3 is absorbed into the aqueous lithium bromide solution ( absorbing solution ) 6 sprayed onto the outer surfaces of cooling tubes 12 of the absorber 4 . absorption heat generated at this time is cooled by a cooling water 13 passing through the tubes . a diluted absorbing solution 6b which absorbs the refrigerant at the absorber 4 to reduce its concentration has a weak absorbing ability . therefore , a part of the absorbing solution 6b is fed to a high temperature regenerator 1a by a solution circulating pump 8a and is heated thereat by a gas burner or the like to thereby evaporate and separate a high temperature refrigerant vapor 14 therefrom . as a result , the solution is condensed and returned back to the absorber 4 . the other part of the diluted absorbing solution is fed to a low temperature regenerator 1b by the solution circulating pump 8a and is heated and condensed by the high temperature refrigerant vapor 14 . subsequently , the solution 6b is mixed with the absorbing solution 6a fed out of the high temperature regenerator in the heat exchanger 5 and is returned back to the absorber 4 . the high temperature refrigerant vapor 14 separated from the solution at the high temperature regenerator 1a discharges or radiates a part of its heat and is introduced into the condenser 2 where it is cooled and condensed to be liquefied by the cooling water 13 flowing through interiors of cooling pipes 15 to become refrigerant 7 and to be returned back to the evaporator 3 . the diluted solution 6b kept at a low temperature which flows toward the high temperature regenerator 1a and the low temperature regenerator 1b from the absorber 4 is preheated by the condensed solution 6a which flows toward the absorber 4 from the low temperature regenerator 1b , to enhance its heat or thermal efficiency . the solution circulating pump 8a serves to circulate the aqueous lithium bromide solution ( absorbing solution ) and the refrigerant pump 8b serves to circulate the refrigerant ( water ). fig2 shows a cross - sectional view of the high temperature regenerator provided with an electric anti - corrosive means . the high temperature regenerator is composed of a shell 16 , tube plates 17 , heating tubes 18 , a burner 19 , an exhaust gas discharge funnel 20 and a refrigerant vapor pipe 21 . the absorbing solution 6b passes through the interiors partitioned apart from a combustion chamber 22 by the tube plates 17 and the heating tubes 18 disposed in the shell 16 and is heated and condensed in the heating tubes 18 to be circulated through the interior of the high temperature regenerator in accordance with the temperature difference . a burnt exhausted gas is discharged from the funnel 20 to the outside of the apparatus . the refrigerant vapor separated from the absorbing solution heated is introduced into the low temperature regenerator through the refrigerant vapor pipe 21 . in this apparatus , the inner surfaces of the shell 16 , the tube plates 17 and the heating tubes 18 are subjected to corrosion . however , the electric anti - corrosion is carried out thereon by applying anti - corrosive currents to the shell 16 , the tube plates 17 and the heating tubes 18 while using non - soluble electrodes 23a and 23b which are each made of meshes of palladium coated titanium wires . in the case where the electrodes 23a and 23b are used as cathodes by applying a negative voltage to the non - soluble electrodes , the shell 16 , the tube plates 17 and the heating tubes 18 are subjected to an anode electric anti - corrosion effect whereas in the case where the electrodes 23a and 23b are used as anodes by applying a positive voltage to the non - soluble electrodes , the shell 16 , the tube plates 17 and the heating tubes 18 are subjected to an cathode electric anti - corrosion effect . as the non - soluble electrodes 23a and 23b , it is not desirable to use a planar structure which would prevent convection of the absorbing solution and is preferable to use a mesh structure . as a result of the inventors &# 39 ; studies , it was found that a carbon steel constituting a part of the high temperature regenerator showed a passive state in the aqueous concentrated lithium bromide solution kept at a high temperature . in view of this fact , it was considered that a method in which a voltage was applied thereto from the outside in order to keep its passive potential , that is , the anode anti - corrosion method was available . actually , the use of both the method and the inhibitor provided a good result . a value of optimum anti - corrosion potential depended on the kinds of the inhibitors used as described in the table 1 and in addition was somewhat varied in a higher or lower direction in accordance with concentration and temperature of the solution . table 1______________________________________absorbing solution concentration : libr 63 %, lioh 0 . 2 % temperature : 160 ° c . optimum anti - corrosioninhibitor potential ( mv ) ______________________________________lino . sub . 3 - 620licro . sub . 4 - 580na . sub . 2 moo . sub . 4 - 550na . sub . 2 moo . sub . 4 + bta - 600na . sub . 2 b . sub . 4 o . sub . 7 + bta - 550______________________________________ note : bta represents benzotriazole . accordingly , the values listed in the above table 1 should be used for reference but should be disregarded in some particular cases . the values should be determined on the basis of the polarization curve measurement of anode conducted under predetermined conditoins . also , it was found that a cathode electric anti - corrosive method which had been considered undesirable was available . by changing a potential value of a carbon steel in a direction lower by 100 to 200 mv than a natural potential in the absorbing solution , an anti - corrosion effect somewhat lower than that obtained by the anode electric anti - corrosive method was confirmed . it was preferable to use this method together with the effect of inhibitor . table 2 shows natural potential values of solution . the concentrations and temperatures of the absorbing solution are the same as those indicated in table 1 . the natural potential values are also varied in accordance with a kind of inhibitor . table 2______________________________________ natural potentialinhibitors ( mv ) ______________________________________lino . sub . 3 - 700licro . sub . 4 - 760na . sub . 2 moo . sub . 4 - 740na . sub . 2 moo . sub . 4 + bta - 770na . sub . 2 b . sub . 4 o . sub . 7 + bta - 740______________________________________ since the potential is varied somewhat in a higher or lower direction in accordance with the temperature and concentration of the solution , the potential should be measured under necessary conditions , and the optimum anti - corrosive potential should be determined on the basis of the measurement . also in either of the electric anti - corrosion methods , the non - soluble electrodes made mainly of palladium coated titanium are preferably used as cathode or anode electrodes . the non - soluble electrodes made of zinc , aluminum or the like are not preferable since soluted ions such as zn 2 + or al 3 + would change its absorbing solution characteristics . as model tests , the experiments were conducted under the conditions similar to those in the high temperature regenerator of the triple effect absorption type refrigerator . a carbon steel was dipped in an absorbing solution into which was added 0 . 2 % lithium chromate admixed with 0 . 2 % lithium hydroxide and 65 % lithium bromide concentration solution as the absorbing solution . n 2 gas was inspired into the absorbing solution and deaerated so that its temperature was elevated up to a temperature of 200 ° c . and was corroded for 200 hours . one side of the carbon steel test piece was electrically anti - corroded while a palladium coated titanium electrode was used as a cathode and the potential of the carbon steel was maintained at - 580 mv by a dc constant voltage device . the other side of the test piece was dipped as it was . a corrosion of the carbon steel after 200 hours was 750 mg / dm 2 in the case of the inhibitor of lithium chromate solely whereas a corrosion was 56 mg / dm 2 in the case of additionally using the anode electric anti - corrosion method , which was one - tenth or less of the former case . in the case of using solely the lithium chromate inhibitor , a remarkable pitting corrosion was generated . on the other hand , in the case of using additionally the electric anti - corrosion method , there was almost no corrosion . the same constituents of the solution and experimental conditions as in the foregoing example 1 were used in the example 2 except for the followings . in the example 2 , one side of a carbon steel test piece was subjected to a cathode electric anti - corrosion method so that it was connected as a palladium coated titanium electrode and the surface potentional of the carbon steel was kept at - 900 mv . also , the other side of the carbon steel was used as it was . the corrosion of the carbon steel after 200 hours was 750 mg / dm 2 in the case of using solely the lithium chromate inhibitor whereas it was 120 mm / dm 2 in case of using additionally the cathode anti - corrosion method , which was a good result . the experiment was carried out in the same manner as in the example 1 . however , sodium molybodate was added by 0 . 2 % as the inhibitor and the test piece was corroded at a temperature of 200 ° c . for 200 hours . the carbon steel test piece 1 was subjected to the anode electric anti - corrosion while the potential was maintained at - 550 mv , the same test piece 2 was subjected to the cathode anti - corrosion while the potential was maintained at - 860 mv , and the test piece 3 was dipped without any measure . as a result , the corrosion was 600 mg / dm 2 in the test piece 3 whereas it was 70 mg / dm 2 in the test piece 1 and it was 136 mg / dm 2 in the test piece 3 . the present invention was applied to the double effect absorption type refrigerator having a refrigerating capacity of 60 rt . first of all , an absorbing solution containing 0 . 5 % by weight lithium nitrate as an inhibitor ( a solution of lithium bromide and lithium hydroxide ) was sealed in the double effect apparatus and were operated at a full load for 100 hours . when the amount of hydrogen gas generated at this time was measured , the generated rate was 1 ml / min . subsequently , in the high temperature regenerator of the 60 rt double effect apparatus of the same tipe , 10 electrode rods ( 15 mm in diameter × 300 l ) to which palladium was applied were used as cathodes and the wall of the high temperature regenerator was used as an anode while the surface potential was kept at - 0 . 9 v in the high temperature regenerator wall by a dc stabilizing electric source . under such a condition , a current was applied thereto . the apparatus was operated at the full load for 100 hours . the measured hydrogen generating rate was 0 . 05 to 0 . 2 ml / min , which was one - sixth or less of the case of using solely the inhibitor . the hydrogen gas is generated due to the corrosion of the carbon steel which is the constituent member of the apparatus . therefore , the hydrogen generating rate of 1 / 6 or less means that the corrosion rate is 1 / 6 or less . as has been apparent from the above , in the absorption type refrigerator , in addition to using the absorbing solution containing the inhibitor , the parts where the absorption solution temperature is kept high , that is , the high temperature regenerator is further subjected to the electric anti - corrosion method of the external electric source type so that respective parts of the refrigerator are subjected to the anti - corrosion effect in accordance with the respective corrosion conditions with a high efficiency . accordingly , in accordance with the present invention , in case that the absorbing solution temperature reaches 200 ° c ., a hole corrosion or the like is not caused and a small amount of hydrogen is generated . in addition , a refrigerator having a good corrosion proof property and an enhanced reliability may be provided with a long service life . therefore , it is possible to develop the refrigerator up to triple and four stage effect apparatus with a high efficiency .
| 5 |
it has been unexpectedly discovered that a composition comprising polyphenylene ether resin and polystyrene resin can be used to advantageously mold pipes for the transmission and distribution of water and other fluids . this pipe offers advantages of being able to transmit water or other fluids at elevated temperatures of 80 ° c ., without undergoing any warpage or distortion . the pipe , because of its high temperature stability , can also be used through day and night during all seasons of the year without risk of damage to its dimensions . additionally , because of the chemical stability of the molded pipe , the water does not become contaminated with impurities . the polyphenylene ether resins used in compositions generally comprise a plurality of aryloxy repeating units preferably with at least 50 repeating units of formula ( i ) wherein in each of said units independently , each of r1 , r2 , r3 and r4 are hydrogen , halogen , hydrocarbon radical , substituted hydrocarbon radical , alkoxy radical , cyano radical , phenoxy radical , or nitro radical and n is an integer showing the degree of polymerization . non - limiting examples of substituents r1 , r2 , r3 and r4 in the formula ( i ) above are chlorine , bromine , iodine , methyl , ethyl , propyl , allyl , phenyl , benzyl , methyl benzyl , chloro methyl , bromo methyl , cyano ethyl , cyano , methoxy , ethoxy , phenoxy , nitro and combinations comprising at least one of the foregoing substituents . suitable but non - limiting examples of polyphenylene ether resins that can be used in the pipe are poly ( 2 , 6 - dimethyl - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - ethyl - 1 , 4 - phenylene ) ether , poly ( 2 - methyl - 6 - ethyl - 1 , 4 - phenylene ) ether , poly ( 2 - methyl - 6 - propyl - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - propyl - 1 , 4 - phenylene ) ether , poly ( 2 - ethyl - 6 - propyl - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - methoxy - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - chloromethyl - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - bromo methyl - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - phenyl - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - tolyl - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - chloro - 1 , 4 - phenylene ) ether , poly ( 2 , 6 - di - benzyl - 1 , 4 - phenylene ) ether , poly ( 2 , 5 - di - methyl - 1 , 4 - phenylene ) ether and combinations comprising at least one of the foregoing polyphenylene ether resins . a preferred polyphenylene ether resin is one wherein r1 and r2 in the formula ( i ) are alkyl radicals having 1 to 4 carbon atoms , r3 and r4 are hydrogen and wherein the degree of polymerization ‘ n ’ is about 50 . the polyphenylene ether resin may be either a homopolymer or a copolymer . suitable copolymers include random copolymers containing 2 , 6 - dimethyl - 1 , 4 - phenylene ether units and 2 , 3 , 6 - trimethyl - 1 , 4 - phenylene ether units . other suitable copolymers are those wherein a styrenic polymer is grafted onto a polyphenylene ether backbone . examples of styrenic polymers , which can be grafted on to the polyphenylene ether backbone , are polystyrene , α - methyl polystyrene , homopolymers of vinyltoluene , homopolymers of chloro - styrene , and combinations comprising at least one of the foregoing alkenyl aromatics . there is no particular restriction to the viscosity of the polyphenylene ether resin used in the molded pipes , however , a preferred intrinsic viscosity is in an amount of about 0 . 1 to about 0 . 5 deciliters / gram ( dl / g ) when measured in chloroform at 25 ° c . the term “ polystyrene resin ” as used herein includes polymers , which contain at least 25 % by weight of structural units derived from a monomer of the formula ( ii ) wherein r5 is a hydrogen or an alkyl radical having from 1 to 4 carbon atoms ; z 1 is a halogen or an alkyl having from about 1 to about 4 carbon atoms and p is an integer from 0 to about 5 . the polystyrene resins are generally homopolymers of styrene ( homo polystyrene ) including syndiotactic polystyrene , which has a syndiotactic content of greater than 50 mole % as determined by nuclear magnetic resonance . copolymers of styrene may also be used in the pipes . examples of styrenic monomers that may be copolymerized with styrene to form polystyrene copolymers are p - methyl styrene , α - methyl styrene , α - methyl - p - methyl styrene , chlorostyrene , bromostyrene , and combinations comprising at least one for the foregoing styrenic monomers . other polymers which may be copolymerized with the polystyrene include polybutadiene , polyisoprene , butyl rubber , ethylene - propylene diene monomer ( epdm ), ethylene - propylene copolymer , natural rubber , mixture of natural rubber with epichlorohydrin or a synthetic rubber containing styrene or modified styrene , copolymers of natural rubber with a synthetic elastomer , styrene - acrylonitrile copolymer ( san ), styrene - butadiene copolymer ( sbr ), styrene - maleic anhydride copolymer , acrylonitrile - butadiene - styrene copolymer ( abs ) and combinations comprising at least one of the foregoing polymers . the preferred polystyrene resin is homo polystyrene , syndiotactic polystyrene or rubber reinforced high impact polystyrene . it is envisioned that recycled polystyrene resin recovered from moldings or from foam can be used in the pipes . the recycled polystyrene resin may contain flame retardant additives if so desired . in addition , the polystyrene resin may be recovered from polystyrene moldings having a surface , which coated or plated with a metal . the weight average molecular weight of the polystyrene resin used in the pipe is preferably greater than or equal to about 30 , 000 g / mole , more preferably greater than or equal to about 50 , 000 g / mole . it is generally desirable to vary the amount of polyphenylene ether resin from about 5 wt % to about 95 wt % based on the total weight of the composition . similarly , it is generally desirable to vary the polystyrene resin from about 5 wt % to about 95 wt % based on total weight of the composition . a blend of polyphenylene ether resin and polystyrene resin having the above detailed characteristics respectively will display excellent thermal resistance , mechanical strength , flowability , and dimensional stability . other additives may optionally be added to the composition . these include at least one type selected from the group consisting of a rubbery impact modifier , fibrous filler , non - fibrous filler , olefinic polymer , alicyclic saturated hydrocarbon resins , higher - grade fatty acid esters , waxes such as low molecular weight polyethylene and montan wax , petroleum variety hydrocarbons , fluoro polymers such as polytetrafluoroethylene , antistatic agents such as sulfonic acid or polyoxyalkylene glycols such as polyethylene glycol or polypropylene glycol , ultraviolet ( uv ) absorbers such as compounds containing hindered amine group , benzotriazole group , benzophenone group , epoxy group and combinations comprising at least one of the foregoing uv absorbers pigments . impact modifiers may also be used in the composition . the impact modifier may be present as a homopolymer or a copolymer . in general it is desirable for the impact modifier to comprise at least one rubbery component having a glass transition temperature of greater than − 100 ° c . and less than 50 ° c . examples of such rubbery components are polyisoprene , polybutadiene , polyolefins , polyacrylics , polyesters and the like . the preferred impact modifiers are those , which contain polybutadiene such as styrene - butadiene rubber copolymerized with styrene or hydrogenated styrene . impact modifiers comprising three polymers wherein one polymer has as an acid component may also be used . non - limiting examples are acrylic acid - butadiene - styrene copolymer , carbonic acid - butadiene - styrene copolymer or an acid compound containing carbonic acid anhydride - butadiene - styrene copolymer . impact modifiers having a rubbery component that comprises polyolefins such as ethylene or propylene can also be used . copolymers of ethylene and propylene can also be used . rubbery components such as a polyolefin containing an acid modified component such as butadiene or a reactive epoxy functionality may also be used . fibrous fillers having aspect ratios from 2 to 1000 may be used to impart strength to the composition . noon - limiting examples of such fibers are glass fibers , hollow glass fibers , carbon fibers , hollow carbon fibers , titanium oxide whiskers , and warstonite . non - fibrous fillers may also be utilized to impart strength and dimensional stability to the pipe . such fillers may exist is in the form of platelets , particles which may be crystalline or amorphous . non - limiting examples of such non - fibrous fillers are talc , clay , silica , glass flakes , glass beads , hollow filler etc . combinations of fibrous and non - fibrous fillers may also be used . impact modifiers may generally be used in the pipe composition in an amount of up to about 7 wt % based on the total weight of the composition . in addition to being added as impact modifiers , polyolefins may be added to modify the chemical resistance characteristics and mold release characteristics of the composition . homo polymers such as polyethylene , polypropylene , polybutene can be used either separately or in combination . polyethylene can be added as high density polyethylene ( hdpe ), low density polyethylene ( ldpe ) or branched polyethylene . polyolefins may also be used in copolymeric form with compounds containing carbonic acid radicals such as maleic acid or citric acid or their anhydrides , acid compounds containing acrylic acid radicals such as acrylic acid ester , and the like , as well as combinations comprising at least one of the foregoing . alicyclic , saturated hydrocarbon resins such as those available from hydrogenation of aromatic hydrocarbon resin , for example generally , c9 hydrocarbon resin , c5 / c9 hydrocarbon resin , indene - chroman resin , vinyl aromatic resin , terpene - vinyl aromatic resin and the like may also be used . with respect to the terpene variety , terpene resins formed by using α - pinene , β - pinene , and diterpenes as the raw material is preferred . terpene denatured by aromatic hydrocarbon ( phenol , bisphenol a , and the like ) or hydrogen - saturated terpenes , and the like are also useful . with regards to the petroleum hydrocarbons , a liquid fraction of petroleum fraction is appropriate for use . similarly with regards to the aromatic hydrocarbon petroleum resin , aromatic hydrocarbon fraction polymer represented by c9 carbon variety is used . the hydrogen addition ratio is desired to be high , preferably at least about 30 %. if the quantity of aromatic component is greater , then desirable properties may be lost . thermal stabilizers , which increase the thermal stability of the composition , may also be added . such compounds include phosphite stabilization agents , epoxy compounds , beta - diketone , inorganic stabilizers such as perchloric acid salts , talc , zeolite and the like , as well as combinations comprising at least one of the foregoing thermal stabilizers . preferred phosphite stabilization agents are tri alkyl phosphite , alkyl aryl phosphite , tri aryl phosphite and combinations comprising at least one of the foregoing phosphite stabilization agents . thermal stabilizers may be added in quantities of greater than or equal to about 0 . 01 , preferably greater than or equal to about 0 . 1 parts by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . it is also generally desirable to add thermal stabilizers in quantities of less than or equal to about 70 , preferably less than or equal to about 50 parts by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . flame retardants such as phosphorus compounds , silicone compounds , metal salts and combinations comprising at least one of the foregoing flame retardants may also be used . flame retardants may be added in quantities of about 0 . 01 to about 50 parts by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . within this range it is preferable to use an amount of greater than or equal to about 0 . 1 , more preferably greater than or equal to about 3 , and most preferably greater than or equal to about 5 parts by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . within this range , it is also generally desirable to add thermal stabilizers in quantities of less than or equal to about 30 parts by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . drip prevention agents such as those that prevent dripping during combustion , may also be utilized . polytetrafluoroethylene is preferred as a drip prevention agent because of its ability to form fibrils in the composition . other drip prevention agents , which can form fibrils , are also preferred . drip prevention agents may be added in quantities of about 0 . 01 to about 5 parts by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . within this range it is preferable to use the drip prevention agent in an amount of greater than or equal to about 0 . 05 by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . within this range , it is also generally desirable to add the drip prevention agents in quantities of less than or equal to about 3 parts by weight based on 100 parts of weight of polyphenylene ether resin and polystyrene resin . the polyphenylene ether resin and the polystyrene resin along with other desired additives may be melt blended and subsequently molded into a pipe . melt blending operations are generally carried out in an extruder , ball mixer , roll mill , buss kneader and the like . during the melt blending operation , a small quantity of solvent may be added to the melt to facilitate processing if desired . during melt blending , the various components such as the polyphenylene ether , polystyrene and the other additives may be added simultaneously or sequentially if desired . in one embodiment , in one manner of proceeding , the melt blending of the polyphenylene ether , polystyrene and other additives may be compounded in an extruder by adding the components simultaneously at the throat or sequentially through different feeders located at different positions along the barrel of the extruder . the extrudate emanating from the extruder may be either fed directly to a molding machine or cooled and converted into pellets , powder , and the like for use in a future molding operation . the pipe may be molded from pellets , powder , and the like by methods such as injection molding , extrusion molding , blow molding , vacuum forming , and any other molding operations known in the art . alternatively , the pipe may be molded by feeding the components such as the polyphenylene ether resin , polystyrene resin , and additives directly into the molding machine , where the components may be mixed immediately prior to molding . both straight pipe sections as well as pipe joints may be molded . extrusion molding is generally preferred for straight sections while for injection molding is preferred for molding joints . while pipe diameter , wall thicknesses , and shape may be chosen as desired , a preferred wall thickness is from about 2 . 0 to about 10 millimeters ( mm ). pipe shapes may vary from cylindrical to quadrilateral to hexagonal , with cylindrical shapes generally being preferred . pipes made from the above composition may also be constructed in multi - layered or laminated form comprising at least two layers . multilayered pipes may be constructed utilizing as many layers as may be desired so long as they are thermally stable and have water proof properties . when a pipe has two or more layers , it is desirable that at least one layer be constructed from the composition comprising polyphenylene ether resin and polystyrene resin . pipes made for water transmission and distribution , from the above - described composition display thermal stability , strength and ability to withstand high pressures in measures similar to pvc pipes without any of the drawbacks associated with pvc . for example , the outstanding thermal stability of the composition as reflected in a v - cut softening point test measured as per jis k7206 , is more than 80 ° c . similarly a test plate cut from the pipe composition has a tensile strength greater than about 350 kgf / cm 2 at 15 ° c . and greater than about 120 kgf / cm 2 at 90 ° c . additionally because of its chemical stability , the pipe does not release any chlorine into the water and can be recycled for further use . the excellent ability of the pipe composition to provide pipes that can withstand high pressures can be seen in the water pressure test and the internal pressure creep test where water leakage does not occur . further no cracks and fissures were seen in the flatness test , which indicates the excellent pressure resistance characteristics of the composition . pipes made from the above - described composition are also advantageous in that they do not contain components such as lead , which may be transmitted by the water . further other detrimental factors such as increase in muddiness , color change , odor absorption , loss of taste , and the like , normally associated with steel pipes does not occur . additionally , since the pipe does not contain any pvc , chlorine does not get into the water from the pipe . because to the excellent thermal stability and chemical characteristics of the pipe composition , potassium permanganate normally used to purify drinking water may be used in lower quantities . the present invention has been explained below in further detail with non - limiting examples . however , the present invention is not restricted to these practical examples . the polyphenylene ether resin used in the examples was poly ( 2 , 6 - di methyl - 1 , 4 - phenylene ) ether obtained from ge plastics co . ( japan ) having an intrinsic viscosity of 0 . 46 dl / g when measured in chloroform at 25 ° c . topolex 870st , a high impact polystyrene commercially available from japan polystyrene co . ltd , was also used . triphenyl phosphate ( tpp ), commercially available from daihatsu chemical industries ltd . was used as a flame retarding agent . adegastab mk2112 , a phosphate stabilizer commercially available from asahi electro - chemical industries , was used as thermal stabilizer . kraton g - 1651 , comprising hydrogenated styrene - butadiene copolymer commercially available from shell chemical co ., was used as the impact modifier . other additives such as nuc 6570 , a denatured ethylene copolymer commercially available from japan uniker co . ltd was also used . table 1 shows the details of the composition . the composition was extruded using a biaxial extrusion - kneading machine with the barrel temperature set at about 270 ° c . to about 280 ° c . and a screw speed of 200 rpm . the extruded strand was the pelletized . the pellets were then extruded into a water distribution cylindrical pipe having external diameter of 32 mm , thickness of 3 . 5 mm and total length of 4 meters in a uniaxial extrusion machine . the extrusion conditions are shown in table 2 . [ 0035 ] table 2 practical practical practical comparative molding temperature example 1 example 2 example 3 example 1 extrusion zone 1 190 ° c . 230 ° c . 215 ° c . 200 ° c . machine zone 2 200 ° c . 240 ° c . 225 ° c . 210 ° c . zone 3 210 ° c . 250 ° c . 235 ° c . 220 ° c . zone 4 220 ° c . 260 ° c . 245 ° c . 230 ° c . ad 220 ° c . 260 ° c . 245 ° c . 230 ° c . die die 1 220 ° c . 260 ° c . 245 ° c . 230 ° c . part die 2 220 ° c . 260 ° c . 245 ° c . 230 ° c . die 3 220 ° c . 260 ° c . 245 ° c . 230 ° c . die 4 220 ° c . 260 ° c . 245 ° c . 230 ° c . sizing part sizing 60 ° c . 80 ° c . 60 ° c . 60 ° c . former vacuum water industrial industrial industrial industrial water tube spray water water water water tensile tests and thermal measurements were performed on the extruded pipe . two sections of the extruded pipe as shown in fig1 were tested for tensile strength as per jis k6776 . thermal stability ( v softening point temperature ) was also measured as per jis k7206 at a load of 5 kgf ( 49n ). the test material having a length of 10 mm , breadth 10 mm , and thickness between 2 . 5 and 4 . 5 mm was cut from the pipe . water pressure tests were measured on a test plate ( cut from the pipe ) having a length of more than 1000 mm as per jis k6776 at a water pressure of 40 kgf / cm 2 ( 3 . 92 mpa ) applied for a time period of 1 minute at room temperature . after the removal of pressure , the plate was visually examined for water leakage . high temperature internal pressure creep tests were performed on a test plate having length of more than 500 mm ( cut from the extruded pipe ) as per jis k6776 . the test consists of subjecting the plate to a water pressure of 15 kgf / cm 2 ( 1 . 47 mpa ) for 1 hour at 90 ± 2 ° c . after the removal of pressure , the plate was visually examined for water leakage . a flatness test was also performed wherein a circular test plate having a length of more than 50 mm was cut from the extruded pipe as per jis k6776 and was sandwiched between 2 flat plates and it was compressed at right angles to the direction of the pipe axis at a speed of 10 ± 2 mm per minute till the external diameter of the pipe is reduced in ½ . the pipe was then visually examined for the presence of cracks and fissures . dissolution tests were performed on a section of pipe cut in a specific size as per jis k6776 . the pipe section was then washed with hot water having temperature of 90 ± 2 ° c . for 1 hour . after this , one end was blocked with a plug containing polyethylene film after which the pipe section was filled with the test water . the test water comprised limewater added to refined water and the ph was regulated between 8 . 0 and 7 . 5 by passing co 2 through the water . chlorine was then added to the test water such that it contains approximately 2 ppm of free ( liberated ) residual chlorine following which the other end was plugged ( corked ) and it was kept undisturbed for 24 hours at normal temperature . after 24 hours , muddiness , degree of color , quantity of consumption of potassium permanganate , quantity of lead , reduced quantity of residual chlorine of the test water were evaluated as per the jis k6776 appendix . materials having the same to be less than 1 . 0 were taken as having passed the test . smell and taste were evaluated as per functional tests . as can be seen from the data of table 1 , the extruded pipe has excellent thermal stability and exhibits a good resistance to pressure . for example , it does not get damaged even if hot water having temperature in the vicinity of 80 ° c . is transmitted through it . the pipe displays an excellent balance of mechanical properties such as strength , impact resistance with thermal properties and chemical properties . it does not suffer from any damage to its dimensions , despite being subjected to the vagaries of the weather . furthermore , impurities do not contaminate water transmitted through the pipe . this pipe can therefore be used as a substitute for polyvinyl chloride piping . while the invention has been described with reference to exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention .
| 2 |
in the basic design shown schematically in fig1 of a cooker , one can see that this is based upon the principle of a tubular bundle heat exchanger . this is provided within a pipe - shaped jacket or casing 1 , which transitions on its two ends into a connection hub 2 , 2 ′. in the area of the transition from jacket housing 1 into the connection hubs 2 , 2 ′, there are two pipe plates 3 , 3 ′, which exhibit a large number of closely bunched boreholes 3 a , through which a correspondingly narrow bunched preferably straight tubes 4 extend . the device described until now exhibits a very slim shape ( the relationship of length to diameter is greater than 3 : 1 ) and is oriented erect . it is provided with a number of connections , namely , a pipe fitting 11 close above the lower pipe plate 3 ′ for the introduction of the material to be treated ; a pipe fitting 12 close below the upper pipe plate 3 for the withdrawal of the treated material , as well as with two pipe fittings 18 and 19 in the vicinity of the two connection hubs 2 , 2 ′ for the introduction or , as the case may be , removal of the heating medium . further , connection pipe fittings can be provided for the supplemental introduction or also withdrawal of the materials . this is shown in fig1 by way of example as a supplemental connection 15 . in operation the material to be treated flows from the lower introduction pipe fitting 11 into the jacket housing and exits through the upper end withdrawal pipe fitting 12 . the heating medium flows in , counter - current , from upwards downwardly ; it enters in the upper introduction pipe fitting 18 , flows through the bundle of tubes 4 and leaves the device through the lower withdrawal pipe fitting 19 . it is also possible for the pipe fitting 12 to be the introduction fitting , and the pipe fitting 11 to be the withdrawal fitting , so that material being treated flows through the cooker from above downwardly . for the heating medium , there applies then likewise the reverse flow direction . what is important is that within the jacket , housing baffles or deflection plates 5 are provided , which , respectively with the exception of the openings 6 , are connected flow - tight with the inner wall la of the jacket housing 1 and are also flow tight passed through by tubes 4 . the openings 6 of the deflection plates 5 are thereby in rising sequence diametrically offset with respect to each other , and namely in such a manner , that the opening 6 of the first , lower deflection plate is located precisely along the oppositely lying side of the introduction pipe fitting 11 , the opening of the next higher deflection plate 5 on the opposite lying side to the first opening , etc ., up to the upper opening , which again is situated on the opposite side of the withdrawal pipe fitting 12 . the internal space of the cooker is divided into individual flow chambers by the deflection plates , and it is achieved by the diametrically opposite lying arrangement of the openings 6 , that the material flowing into the jacket housing flows through the individual chambers respectively zigzag pattern from below towards upwards , until the mass finally again leaves through the withdrawal pipe fitting 12 . the material can pass from one chamber into the next sequential chamber only by passing through the area of the openings 6 , and this with a respective direction change of 180 °. therewith , the material can only flow perpendicular to the tubes 4 within the chambers , never in the same direction as the tubes . thereby , only very short contact times result at the individual tubes , which along all points within the cooker are practically of identical lengths . there are no points of the heating tubes 4 which experience a substantially longer contact time for the material , with which the dwell time of partial streams deviate substantially from the main stream of flow . the mass is thus evenly and carefully heated . overall , the flow - directing components within the jacket housing , that is , the deflection plates 5 with the openings 6 , are so designed , that the viscosity change of the material to be treated is precalculated in such a manner , that the flow speed perpendicular to the tube bundle between the deflection plates is kept as constant as possible . this can be achieved thereby , that the separation between two deflection plates , that is , the volume of the chambers defined between two deflection plates , is varied , for example — increases from below going upwards in a predefined manner . also , the size and shape of the openings 6 can be appropriately varied for keeping the flow as even as possible along the flow path of the material , whereby the details of the size and shape of the openings 6 are naturally also influenced by the type of the material to be treated . fig2 shows five examples of different shaped openings 6 a - 6 e . in the description of the inventive cooker it has until now been presumed that the flow directing components within the jacket housing 1 are not variable . this need not be the case . by further pursuing the inventive concept it can be seen that the size and shape of the openings 6 can be varied . fig3 shows one possibility of a stepless change of the openings 6 with the aid of an adjustment plate 7 a , which is moved upwards or downwards from outside by using a rod 9 a which can be acted upon from outside , thereby changing the size and shape of the openings 6 . fig4 shows an equivalent solution with the aid of adjustment segments 7 b , which can be rotated for example with the aid of a rotation drive 9 b from a vertical to a horizontal position , in order to change the area and shape of the openings 6 . both cases , that are shown in fig3 and 4 , make it possible to change the inner structure of the cooker without having to disassemble the cooker . this can be necessary for example when dramatic changes in the consistency of the materials to be treated occur , and this is also advantageous when a cooker is to be switched from treatment of a material a to the treatment of a different material b . one can also see from fig3 the possibility of using deflection struts 8 for supporting the evenness of the flow through . it is also of course possible , however not possible to illustrate the figure , that these deflection struts can be provided rotatable about their longitudinal axis , so that as required they can be oriented more or less perpendicular to the direction of flow and the flow of the material can therewith be more or less strongly influenced . likewise , not further illustrated is the possibility , of providing the deflection plates 5 as such slideable within the jacket housing 1 , for example , with an aid of a rod along the rod 9 a , in order to vary the size of the chamber between two deflection plates , and this either for the carrying out of the treatment of one particular material a as well as a changing over from material a to a material b . finally , it can be mentioned that the circular cross - section of the jacket housing 1 may represent a conventional design of a pipe bundle heat exchanger , but is , however , in no way a limitation for the herein described cooker . rather , it is also possible , and in many cases more advantageous , when the jacket housing 1 is provided with a different cross - section shape , for example , oval or elliptical , or in certain cases even an extended polygon . thereby , in individual cases , when the parameters of the material to be treated require it , a better result with respect to the evenness and careful heating of the material can be achieved . common to all possible designs of the inventive cooker is that the temperature difference between the heating medium and the end product temperature is very small , so that a very careful and conservative heating occurs . this mitigates against a deposition of the product on the heating surfaces in the case of product which have a tendency to burn . certainly such adhesion of product is not ruled out in all possible cases ; however , it is very minimal in comparison to known cookers not having scraped heat surfaces ( inclusive of the cooker known in de - c 35 28 426 ), and these can be removed with relatively simple means following relatively long possible production times without intermediate cleaning , that is , as a rule without chemical additives . the possibility of the addition of products which have a relatively strong tendency towards burning to an already heat treated main material mass via one or more supplemental , side pipe fittings , for example , the support or auxiliary pipe fitting 15 between inlet and outlet , further improves this relationship . an advantageous use of this cooker is that is also recommended for recipes which contain no component which have a tendency towards burning , since the reduced thermal requirement also has a positive effect on the product quality . with additional downstream equipment or components , it is possible to so influence the pressure , in the cooker , so that on the one hand , by heating under pressure higher temperatures are possible without reduction in the water component as would be the case under atmospheric conditions , this being useful for example for acceleration of carmelization ( with suppression of boiling ), or , as the case may be , to use low pressures at low temperatures to achieve higher dryness in substances with care or preservation of product , for example , for avoidance of carmelization . the compact design and the small outer dimensions , compared to known cookers , make possible with small constructive expenditure a simple incorporation of the cooker in an equipment setup .
| 5 |
referring to fig1 and 6 , a preferred form is shown of the vascular sealing device 10 for effecting closure of a puncture in a blood vessel which has been entered through percutaneous techniques . the device 10 is useable with a procoagulant which is injected through a standard percutaneous vascular sheath or introducer . the vascular sealing device 10 is shown to have an elongated thin , generally tubular body or conduit 15 with proximal and distal ends 11 and 12 , respectively . basically , the proximal end 11 of the device 10 is for physician manipulation and connection to associated medical apparatus described further below , while the distal end 12 is for insertion into the patient &# 39 ; s body . located at the proximal end 11 of device 10 is an inflation / deflation port 14 . the body member 15 has a tubular structure constructed of hypotubing or a similar material . this structure also has a cylindrical and thin outer body wall with a central , continuous , and longitudinally extending lumen 28 . the body member 15 has an outside diameter preferably not greater than 0 . 038 inches ( 0 . 965 mm .). the body 15 is semiflexible and , importantly , has a predetermined rigidity such that central lumen 28 integrity is maintained . this is particularly important during longitudinal translational manipulation by the physician , through vascular introducer means ( described below ), into a percutaneous puncture in the patient &# 39 ; s skin . the hypotubing of the body 15 is preferably constructed of a metallic material such as stainless steel , for example . alternatively , the body 15 may be constructed of a polymeric material . the body member 15 is shown to have a length preferably of at least 11 . 79 inches ( 30 cm ). the proximal end 11 of the lumen or hollow interior 28 is sealed with elastomeric material , preferably silicone , to form an inflation / deflation port 14 . the seal forms the inflation / deflation port 14 by adhering to the internal wall surfaces of the proximal end 11 of body 15 . the seal is of sufficient strength to maintain a pressure difference between the internal lumen 28 and the proximally disposed exterior of the seal . this pressure difference is of a magnitude sufficient to maintain inflation of the balloon 34 , which is in continuity with the lumen 28 . the inflation / deflation port 14 is utilized by piercing its proximal face , preferably with a syringe needle , to a depth which allows the needle lumen to be in continuity with the lumen 28 . an external syringe , attached to the proximal end of the needle , provides a piston means by which a gas or liquid is pumped into the balloon 34 for inflation , or out of the balloon 34 for deflation . removal of the needle from the inflation / deflation port 14 causes the seal to reestablish the pressure differential barrier . the structure of the proximal end 11 also allows the user to later slide a standard vascular sheath over the device body 15 and then to advance it to the puncture site for positioning within the blood vessel lumen . this allows reentry into the blood vessel , if necessary , for a further interventional procedure . the bottom or distal end 12 of the device body 15 is shown to have a distal tip 29 . the distal tip 29 further has an inset segment 32 . the inset segment 32 has a tubular configuration and is oriented coaxially with respect to the distal tip 29 . the inset segment 32 preferably has a diameter which is less than that of the distal tip 29 and a length equivalent to that of the wall of the balloon 34 when deflated . thus , an inset with respect to the distal tip 29 is formed by this structure . the lumen 28 extends into the inset segment 32 and is communicatively connected to an orifice 33 , which is disposed in the side wall of the inset segment 32 . the orifice 33 is shown to have a circular configuration . referring to fig1 a and b , the balloon 34 is disposed about the inset segment 32 . in an uninflated state , the balloon 34 has a tubular configuration and is sealingly secured at each of its ends to respective ends 30 and 31 of the inset segment 32 . sealing securement may be made by various methods , including adhesives , ultrasonic welding , and compression fitting . the uninflated diameter of the balloon 34 is such that it is disposed substantially within the recess space formed by the difference in diameter of the inset segment 32 and the distal tip 29 . this provides a low profile device diameter which reduces vascular trauma and puncture site diameter upon removal . in an inflated state the balloon 34 preferably assumes a rounded configuration , for example elliptical with a minimum inflated diameter of two times the french size of the introducer sheath puncture hole being sealed . in addition , the height or thickness of the inflated balloon 34 is preferably less than one half the diameter of a typical blood vessel being sealed , so as to minimize obstruction of flow through the blood vessel . the balloon 34 is preferably constructed of an expandable material such as natural latex . a flexible atraumatic extension 37 is shown disposed at the distal end 12 of the vascular sealing device 10 , extending from the inset segment 32 . the extension 37 preferably has a tubular structure with a diameter equivalent to that of distal tip 29 . importantly , the extension 37 is formed of a flexible material such as guidewire as known in the art . the extension 37 is shown to have an end portion which is preferably curved in its inoperative state . this structure decreases the level of trauma to the vessel wall during insertion and manipulation of the device 10 . referring to fig1 refers to a distance marker upon body 15 for the purpose of indicating to the user that the balloon 34 is distal to the sheath taper end 48 shown in fig2 and 3 . by alignment of marker 81 at the top of the hemostatic valve opening at cap 45 , proper location of the balloon 34 with respect to sheath tapered end 48 is assured . referring generally to fig2 - 5 , in use , the vascular sealing device 10 is inserted into the input end 45 of an introducer or vascular sheath device 43 which has been previously positioned within the lumen 58 of a blood vessel 56 . the typical introducer 43 , as is well known , comprises a body structure 46 , an elongated sheath 47 with a tapered end 48 , a hemostatic ingress / egress valve 80 within a cap 45 , an auxiliary tube 44 and a suture connector 49 which may be used to maintain the introducer 43 in an operative position on the patient &# 39 ; s skin surface 55 for prolonged periods of time and to thereby permit reaccess to the patients vascular system 56 . the body 46 of the introducer 43 remains on the exterior of the patient &# 39 ; s body at all times , while the sheath 47 extends through puncture 60 in the skin surface 55 , tissue 59 , and vessel wall 57 . the vascular sealing device 10 is first inserted through the valve or gasket 80 of the introducer 43 , distal end 12 first , and is advanced by physician manipulation of the body member 15 , primarily , until the distal end 12 extends just beyond the distal tapered tip 48 of the sheath 47 . next , an inflator such as a syringe ( not shown ) pierces the inflation / deflation port 14 of device 10 . fluid or gas is advanced into the device 10 until a predetermined amount of balloon 34 inflation is attained . then , the inflating means is removed . next , the inflated balloon section 34 is pulled up against the vessel wall 56 at the puncture site 60 , by manipulating the body member 15 . at this point in the procedure , a hemostatic seal is effected at the puncture site 60 . next , and importantly , a procoagulant is injected through a fluid access port 44 of the introducer 43 and is released out its distal end 48 at the puncture site 60 . next , the introducer sheath 47 is withdrawn by manipulation of the introducer body 46 and sheath 47 proximal end . the balloon section 34 remains abutted against the inner intraluminal surface 56 of the puncture site 60 . after a predetermined time period , on the order of 1 - 3 minutes , the balloon 34 is deflated and the device 10 is pulled proximally out of the puncture site 60 . the procoagulant may include one of the following substances or combinations of substances : ( 1 ) thrombin , ( 2 ) collagen , ( 3 ) fibrin / fibrinogen , ( 4 ) cyanoacrylate , ( 5 ) thrombin and collagen , ( 6 ) fibrin / fibrinogen and collagen , ( 7 ) cyanoacrylate and collagen , and ( 8 ) thrombin and fibrin / fibrinogen . the advantages of the device 10 and method of the present invention include , but are not limited to , both individually and cooperatively , ( 1 ) that the inflated balloon 34 blocks egress of blood immediately upon being properly positioned in the blood vessel at the puncture site to provide fast hemostasis ; ( 2 ) that the inflated balloon 34 acts as an internal marker to permit the user to accurately gauge the depth of the puncture and the thickness of the tissues surrounding the puncture ; and ( 3 ) that the inflated balloon 34 acts as a backstop at the inner wall of the blood vessel to ( i ) precisely position the sealing clot in the puncture and ( ii ) to prevent procoagulant from entering the patient &# 39 ; s circulatory system . the descriptions above and the accompanying drawings should be interpreted in the illustrative and not the limited sense . while the invention has been disclosed in connection with the preferred embodiment or embodiments thereof , it should be understood that there may be other embodiments which fall within the scope of the invention as defined by the following claims . where a claim is expressed as a means or step for performing a specified function it is intended that such claim be construed to cover the corresponding structure , material , or acts described in the specification and equivalents thereof , including both structural equivalents and equivalent structures .
| 0 |
turning first to fig1 , there is shown a preferred embodiment of an interactive literacy learning guide system 10 according to the present invention . the guide system 10 includes three components . a first component is a data disc 12 which , in the preferred embodiment , is a digital video disc ( dvd ) containing an audiovisual presentation which includes examples and portrayals of how the written characters are to be formed . a second component is a work book 14 which includes pre printed pages with areas for practicing what is depicted in the audiovisual presentation . a third component of the system is an appropriate writing implement 16 which may be specially adapted for use by children with the limited motor skills commensurate with their relative immaturity . additionally , in the preferred embodiment , the writing implement 16 is a dry - erase marker for use on the dry erase pages of the work book 14 that are also present in the preferred embodiment . in the preferred embodiment , the data storage device 12 is mounted in the cover 18 of the work book 14 . the writing implement ( or implements ) 16 is held in a case 20 which is mounted to a backing board 22 upon which the work book 14 is mounted , as well . in use , the work book 14 is opened to a work page and the data disc 12 is placed in an appropriate playing device which provides an audiovisual program that can be followed by the student . turning next to fig2 , there is shown in perspective view , the learning guide 10 with the work book 16 opened to one of the work pages 24 . in the preferred embodiment , each of the pages 24 has sets of lines 26 to provide work spaces within which the alphanumeric characters can be drawn . in the preferred embodiment , each set of lines 26 includes an upper , capital letter limit 28 , a lower case letter limit 30 , a dashed line 32 as an upper limit guide for lower case letters and a set separator 34 . in the preferred embodiments , each of the lines of the set 26 is in a different color to aid in identifying a particular line . on each set of lines 26 , the outline of a character is placed for reference . as shown , on successive lines there is a lower case “ n ” 36 , an upper case “ n ” 38 , a lower case “ i ” 40 and an upper case “ i ” 42 . additional matter is provided for guidance in creating the characters such as a straight arrow 44 adjacent the straight segment of the “ n ” 36 and a curved arrow 46 adjacent the curved portion of the “ n ” 36 . referring now to fig3 , a depiction of a sample screen from the preferred embodiment of interactive literacy learning guide 10 is depicted . a partially formed “ n ” 48 is depicted . this letter is being exemplified by the exemplar hand 50 on the screen . when the learner views the materials on the disk , the learner is shown how to create the letters in much the same manner as would be employed by an in person teaching professional . in the preferred embodiment , the exemplar is a cartoon or puppet character for children . in a first alternative embodiment , such as one for an adult audience , the exemplar may include an individual or simply text being drawn on the screen . in the preferred embodiment , the exemplar hand 50 is depicted creating the characters one or more times to aid the learner in grasping the correct methodology for forming a particular character . the text of the partially formed “ n ” 48 will be completed by the exemplar hand 50 slowly , so that the learner may grasp the methodology . in the preferred embodiment , in between and along with the instruction in creating the characters , entertaining and playful characters help to maintain a child &# 39 ; s interest while learning through interaction with the child . in alternative embodiments , little or no such interaction , apart from the instruction in the way in which to create the characters , may be given . accordingly , an interactive literacy learning guide has been described . it is to be understood that the description above is not intended to limit the scope of the invention beyond that of the description of the invention in the claims . alternative embodiments , other than those depicted herein , may still be within the scope and spirit of the invention . the invention is only limited to extend described in the following claims .
| 6 |
referring firstly to fig2 ( a ), 2 ( b ) and 2 ( c ) , fig3 ( a ), 3 ( b ) and 3 ( c ) and fig4 , preferred embodiments of the invention comprise three main elements which together enable an autonomous cabinet system 28 , in the sense of a data center facility within a single equipment cabinet that does not rely on external service provision other than electrical power and coolant connections . if required , power and coolant facilities can be provided using plant skids which may , for example , include a generator set for the provision of electrical power . suitably secure mains power connections are of course possible and , in most cases , preferred . the first element of the system is the equipment cabinet 30 itself , which is sealed from its immediate environment . when used in non - controlled environments 32 as in fig2 ( a ), 2 ( b ) and 2 ( c ) , the cabinet is placed within a secondary outer enclosure 34 which insulates it from the environment and provides a zone where humidity can be controlled by a small package cooling unit 36 . an equipment cooling unit ( ecu ) 38 within the cabinet 30 provides cooling / heating and humidity control and connects by a pipework system 40 to a plant skid 42 ( shown in fig4 ). the door 44 of the outer enclosure 34 is interlocked with the cabinet door via the control system to prevent both being open at the same time . further , if in an external environment , extra panels 46 may be added outside and spaced from the secondary enclosure 34 as shown in fig3 ( a ), 3 ( b ) and 3 ( c ) . these provide for passive cooling by virtue of airflow through the gaps between the panels 46 and the enclosure 34 and also ensure that the walls of the outer enclosure 34 are in shade conditions . this reduces the cooling required for the outer enclosure space 32 . specifically , the extra panels 46 reflect direct solar gain and by virtue of the gaps , they also provide a means of passive ventilation / cooling . in the event of solar gain experienced by the panels 46 , air heated in the gap between the panels 46 and the outer enclosure 34 creates a chimney / stack effect in which air enters below the bottom edge of the panel 46 and exits at the top edge . thus , there is a continuous supply of cooling fresh air and exhaust of warm air before that warm air can transfer significant heat to the outer enclosure . similarly a horizontal panel may provide a through - vented roof cavity . this ensures that the main insulated outer enclosure structure remains in shade conditions reducing the amount of cooling required to maintain a suitable ambient environment . referring now to fig4 in particular , the second element of the system 28 is the pipework system 40 connecting the cabinet ecu 38 to the remote chiller plant skid 42 . this comprises a prefabricated , insulated pipe - in - pipe system to provide maximum protection against leakage . the system 42 can be connected at high or low level to the cabinet 30 via a flexible pipe - in - pipe hose 48 . the flexible hose 48 is connected to a valve box 50 which contains flow and return isolating valves ( for individual cabinet systems ) or a prefabricated commissioning balancing set ( for multiple cabinets ). rigid pipe - in - pipe 52 runs from the valve box 50 to the chiller plant skid 42 itself . the third element of the system 28 is the remote chiller plant skid 42 comprising one of a range of modular skids sized to suit whatever permutations of cabinet numbers are required . though not shown , each skid 42 is provided with two chillers ( providing n + 1 redundancy ), a buffer tank , a mixing manifold , variable speed pump sets , an actuator and a control panel . this combination of elements allows for truly scaleable deployment , firstly cabinet - by - cabinet , and secondly by modular remote plant . as cabinets are added in small increments over time , a point will be reached where the multiplicity of remote plant modules will not be sized correctly in relation to the total load to provide maximum efficiency in running and maintenance costs . in the invention , the plant skids 42 which are therefore designed on a ‘ plug and play ’ basis can be added into or withdrawn from the pipework system 40 without closing down the service . this allows plant skids 42 to be swapped out at any time in the future , and more appropriate size modules added to maintain maximum efficiency with regard to running and maintenance costs . in contrast with current data center technology , plants are typically sized for the ultimate total load , which means that the plant may be oversized for periods of sometimes years until the actual load approaches that level . if , conversely , the plant is undersized for the eventual total load , then this may cause disruption to live services requiring upgrading . in terms of service connections , the cabinet 30 of the invention is carried by the raised floor of the data room or directly by the solid floor of the building as required . electrical power cables are connected to the cabinet 30 via panel mounted ‘ commando ’ plugs located both on the bottom and top of the cabinet 30 to allow either connection from the raised floor void or the ceiling void or other overhead services if a suspended ceiling is not fitted . there are four electrical connections to the cabinet : ( i ) 32 amp a and b ‘ clean ’ secured supply to power the dual corded equipment rack power distribution unit &# 39 ; s ( pdu &# 39 ; s ); ( ii ) 16 amp c1 and c2 ‘ dirty ’ secured supply to power the ecu 38 . these supplies ( clean and dirty ) are separated to avoid any possible earth noise problems being transmitted from the ecu 38 to the equipment rack pdu &# 39 ; s . the c1 and c2 supplies are run via the rack mounted fpu which contains a 16 amp circuit breaker which is opened in the event of a fire alarm condition to shut down the cabinet fans . an emergency power off ( epo ) link is also run from the fpu to the pdu link boxes to shut down the pdu &# 39 ; s in the event of a fire condition . if a transfer switch or rackable ups is fitted this is also connected to the fpu &# 39 ; s epo . ( iii ) between the a and b electrical inlet plugs and the equipment pdu &# 39 ; s two link boxes ( a and b ) are located in the bottom of the racked space which constantly monitor the rms voltage , rms current , and kwh of each pdu . each of the individual socket outlets ( iec 1oa as standard one socket outlet for each u position of rack space ) is remotely switchable ( no switches are fitted to the pdu strip to avoid personnel accidentally switching off the wrong service ).] ( iv ) the link boxes are provided with an lcd display of the instantaneous rms current , rms voltage , and cumulative kwh . a 32a class c double pole mcb provides over current protection . a communication port ( eia rs485 ) is 5 provided for individual socket switching , data input / output and power and a data programming port ( rj45 ). there are two chilled water connections onto the cabinet made with ‘ dry break ’ connectors and flexible hoses ( pipe - in - pipe ) 48 , either at low level or at high level . the flexible hoses connect to the sealed valve box 50 , with the outer hose screwed onto the housing of the box while the inner hose passes through the box to connect to valves therein . the valve box 50 contains either isolation valves ( single cabinet ) or a balancing / commissioning set ( multiple cabinets ). thus those items which might possibly give rise to a leak , namely the valve connections / valve bodies , are contained within a leak - proof enclosure . a rigid pipe - in - pipe system 52 runs from the other side of the valve box 50 to the plant skid 42 . the pipe system 40 is supplied in pre - fabricated format ( 3 m / 5 m lengths ) comprising an inner triple layered plastic / metal / plastic pipe to which insulation is bonded . the outer corrugated pipe facilitates pulling back the outer sleeve and insulation to make the pipe joint ( either fusion welded or crimped ). the joint , is made and a vapor seal collar applied over the joint . adjustable pre - assembled pipe supports allow fixing of the outer pipe run to the building fabric . leak detection tape can be provided in the outer pipe linked to the cabinet controller . a buffer tank requires filling with water ; but once filled does not require , a permanent cold water feed . where it is required ( and if there is sufficient cooling capacity ) to connect the cabinet system 28 into an existing facility chilled water supply , then it is necessary to provide a plant module to raise the chilled water supply temperature to 11 . 5 ° c . before entering the cabinet chilled water main . the cabinet system 28 can operate as completely stand alone , or have a data connection run from the cabinet controller to a local desktop pc , a local control room , or via a lon gateway or snmp to communicate via an intranet or internet link for remote access . similarly , the remote plant skid control panel can be linked to a local desktop pc , a local control room , or via a lon gateway or snmp to communicate via an intranet or internet link for remote access . the mains pipe - in - pipe leak detection ( if fitted , being optional ) is connected to cabinet controller . referring now to fig5 ( a ), 5 ( b ), 5 ( c ) and 5 ( d ) , the cabinet 30 of the invention is generally cuboidal and is constructed largely of rectangular steel panels which may be structural , although the cabinet 30 may also have an underlying structural frame to which the panels are attached . the panels define parallel horizontal top and bottom walls 56 , 58 and parallel vertical side walls 60 , 62 , 64 , 66 extending between the top and bottom walls 56 , 58 . a vertical partition 68 extends parallel to the side walls , also between the top and bottom walls 56 , 58 . the cabinet 30 comprises two main parts divided by the partition 68 , namely a rackable equipment space 70 beside an equipment cooling unit or ecu 38 ( fig2 ( a ) ). in other words , the partition 68 within the cabinet 30 defines a server chamber 83 for racking beside a plant chamber 85 for impelling and cooling air to pass through and between servers in the racking . the partition 68 does not extend to the full depth of the side walls 60 , 62 , 64 , 66 or the top or bottom walls 56 , 58 , therefore leaving gaps or slots at the front and rear of the partition . these gaps or slots provide for recirculating airflow between the server space and the plant space , via a front supply plenum extending over the front face of a bank of servers supported by the racking and a rear exhaust plenum extending over the rear face of that bank of servers . the invention therefore contemplates a cabinet carcass forming two internal areas ; an equipment rack space 70 and an ecu space . advantageously , the part of the carcass defining the ecu space is removable from the part of the carcass defining the rack space 70 to allow for easier installation access in existing buildings with limited door opening width . however , this is not essential to the invention in its broad sense . the carcass has a double - skin construction to reduce weight , provide structural integrity , reduce noise transmission , reduce thermal transmission and increase security . the carcass may be constructed from any of a variety of materials to best suit specific applications , or a combination of them , for example steel , aluminum or plastic skins with mineral wool filling , aluminum honeycomb , high density foam or synthetic honeycomb cores . the cabinet 30 contains racking 72 defining bays capable of accommodating a corresponding number of 1 u units such as servers . of course , deeper units of 2 u or more in thickness can be accommodated if the overall number of units in the cabinet is decreased . the units are positioned close together in a layered stack - like configuration , although the units are supported from the sides of the cabinet and are not actually stacked in the sense of resting upon one another . this means that units can be removed and replaced without disturbing adjacent units above or below . some capacity in bays at the bottom of the cabinet 30 may be devoted to an electrical power management unit such as a ups and a further capacity in bays at the top of the cabinet may be devoted to a gas fire suppressant unit . this leaves the remaining capacity for other units such as servers protected by the power management unit and the fire suppressant unit . the fire suppressant unit may , for example , be a gas dump unit containing heptafluoropropane suppressant , as is commonly sold under the trade mark fm200 of great lakes chemical corporation and known generically as hfc - 227ea . gas dumping can be triggered by a smoke detector such as is sold under the trade mark vesda of vision systems &# 39 ; group . in conventional manner , each server within the cabinet 30 defines an airflow path between ventilation openings such as grilles in its front and rear faces , which openings may be referred to as front ventilation openings and rear ventilation openings respectively . there may of course be other openings in the top , bottom or sides of servers . each server typically also includes an impeller to promote cooling airflow along that path around heat sources within the server . it will be apparent that each cabinet 30 defines a sealed environment that , in emergency situations , has an important element of self - sufficiency in terms of cooling , fire protection and power supply . to that extent , each cabinet 30 is a mini data center that is apt to be retro - fitted to an existing site , and that can be filled to its maximum capacity without overheating as will be discussed in more detail later . access to the interior of the cabinet 30 is via four doors , two on the front 74 , 76 and two on the rear 78 , 80 . one door of each pair 76 , 80 gives access to the ecu 38 and the other door of each pair 74 , 78 gives access to the equipment rack . the doors are side - hinged and sealed around their periphery . they may be glazed although that is not technically significant . the doors 74 , 78 giving access to the equipment rack 70 are spaced from the front and rear of the server units so that in conjunction with the side panels 60 , 66 and the partition 68 , they create a front supply plenum 82 communicating with the front ventilation openings of the server units and a rear exhaust plenum 84 communicating with the rear ventilation openings of the server units . the rear exhaust plenum 84 is closed to all sides but one , where it communicates with the plant chamber 85 through a gap or slot 86 at the rear of the partition , thereby to exhaust air that has been warmed by its passage through the server units . that air is cooled , filtered and impelled through the plant chamber 85 into the front supply plenum 82 via a gap or slot 88 at the front of the partition . like the rear exhaust plenum 84 , the front supply plenum 82 is closed on all other sides . substantially all of the incoming air must pass through the front plenum 82 and from there through the front ventilation openings of the servers . to ensure this where the cabinet is not full , blanking plates should be fixed across any bays not occupied by servers ; otherwise , air would flow preferentially through the resulting gaps , around rather than through the servers . each door 74 , 76 , 78 , 80 is lockable by electric ( preferably magnetic ) door locks under smart card control , to which end a smart card reader ( not shown ) is provided on the front and rear of the cabinet . smart cards may be programmed to give access to either the ecu doors , the equipment rack doors 74 , 78 or all doors depending on the duties of the personnel issued the card . additionally , cards can be programmed to operate the access doors to the room where the cabinet 30 is located and all the other access doors en route to it . at the base of the cabinet 30 , a secure drawer unit 90 houses programmable control systems that operate the system 28 . however , this positioning is not essential : other variants or models may locate the control system elsewhere , for example within the ecu space or door mounted . whatever the position , the principle is the same in that access to the controls is possible without having to enter the rackable space 70 . where different personnel maintain the ecu / controls and the rackable space , neither must have free access to the other &# 39 ; s area of responsibility to avoid operational / maintenance incidents which might result in downtime . consequently , upon presentation of the smart card to the smart card reader , the programmable controller inside the cabinet 30 checks with a security record that the user is authorized to enter the cabinet . having confirmed this , the controller then uses sensors to check the external and internal environment , which should be similar although the cabinet environment is more precisely controlled . if there is a discrepancy between the external and internal environment that could result in a dew point problem when the doors are opened , then the electric door locks are not released . otherwise , room air can deposit moisture either within the cabinet 30 to be carried by airflow onto the racked equipment or directly onto the racked equipment itself . so , in the event of such discrepancy , a warning is given by a light or buzzer to the person trying to gain access , alerting them that the cabinet environment must be adjusted first . to harmonize the external and internal environments , the controller may use variable speed fans and chilled water valves to adjust the internal environment to eliminate the problem . once this has been achieved , the warning indication ceases and the door locks release . should the external and internal environments be too far apart to harmonize in this manner , then the door locks will not release . the user then has to address the reason for the external data room environment having moved so far outside its specified limits . should the reason for denying access be due to a fault with the controller , this can be verified via another alarm ( general ) condition . if this is the case , then it is possible to open the doors with a manual override key which should be held at a separate security point . manual locks or latches may be provided in addition to the electric locks to ensure that door seals are maintained at all times when the doors are supposed to be closed . once the purpose of entry to the cabinet 30 has been completed , the user closes the 10 door ( s ) and re - presents the smart card which locks the cabinet 30 and puts the ecu 38 into ‘ soft start ’ mode . soft start is used at initial commissioning to bring the internal environment back up to set point over a timed delay ( normally 15 to 20 minutes ) to avoid any dew point problems with the room air that has been introduced into the cabinet . the ecu space contains cooling equipment comprising a chilled water coil 92 ( heat exchanger ) and a vertical array of fans . the relationship between the fans 94 and the coil 92 varies between variants . in the first variant shown in fig5 ( a ) to 5 ( c ) , the fans 94 are positioned at the rear of the cabinet 30 and draw air from an exhaust plenum 84 at the rear of the rack space 70 . the airflow is then pushed into a middle plenum 96 and then through the coil 92 and filters 98 , downstream of the fans 94 , to the front of the cabinet 30 , where it flows into the supply plenum 82 . the supply plenum 82 delivers the airflow to the front of the racked equipment , where it passes through the equipment ventilation holes , collecting heat from the electronic components and exhausting into the exhaust plenum 84 to start the cycle again . it will be appreciated that the air flow circulates continuously in a horizontal pattern akin to the movement of a curtain . this movement pattern avoids problems with stack / chimney effect , as each device is directly fed with cooled air from the coil 92 . this means that unlike all vertical airflow systems , it is no longer critical where the hottest devices are placed . the horizontal airflow also encounters less problems with cabling resistance , which is an increasing problem for containment due to the effects of compaction already noted . moreover , the invention provides a much greater ‘ duct area ’ than is possible with a vertical system . consider that the effective duct width for a conventional vertical system is set by the overall width of the cabinet enclosure ( 600 mm ) although normally , due to structural requirements , the actual width is inside the rack rails , namely 500 mm or less . ignoring systems which place the duct opening directly under the rack , the duct height depends upon the space available in front of the rack . this space can be as little as 30 mm in some cases ; whereas from tests carried out with a variety of airflow areas , the minimum duct height should be 75 mm to 100 mm . even assuming a duct height of 100 mm is provided across the full 600 mm width of the cabinet enclosure , then the maximum effective duct area for conventional vertical airflow is just 0 . 1 × 0 . 6 = 0 . 06 m2 . in comparison , the horizontal airflow of the invention enables full use of the cabinet height as the effective duct width . for example a 42 u version of the cabinet has a duct extending for 1 . 9 m in cabinet height . thus , for the same duct height of 100 mm , the effective duct area is 0 . 1 × 1 . 9 = 0 . 19 m 2 or over three times that of the conventional vertical system . the cabinet 30 of the invention also benefits from markedly lower resistance to airflow . the horizontal airflow system of the invention requires four changes of direction to complete a full cycle whereas vertical airflow employing a central plant requires ten , made through more restricted ducts . thus , the horizontal airflow system makes it possible to provide greater airflow to deal with very high loads ; with less system resistance to airflow . in the invention , the proximity of the cooling unit 38 to the equipment being cooled means that very little heat is transferred from the airflow to the inner walls of the cabinet . this , combined with the sealed environment , ensures that the cooling loads generated by the housed equipment do not influence other equipment close by . the more limited environmental area allows more precise automatic cooling to the level necessary at any given moment thus minimizing power consumption , and removing reliance on human intervention that is required with many existing cabinet enclosures . in a second variant of the invention as illustrated in fig6 ( a ) and 6 ( b ) , the fans are positioned at the front of the cabinet 30 b and pull air through the coil 92 which is located upstream of the fans , towards the rear of the cabinet 30 b . the airflow is then as above , moving into the supply plenum 82 ; through the racked equipment ; into the exhaust plenum 84 and then back through the coil 92 to start the cycle again . in the preferred embodiments illustrated in fig5 ( a ) to 5 ( c ) and fig6 ( a ) and 6 ( b ) , six fans 94 are arranged in a vertical array to push or pull the airflow through the coil 92 . five fans 94 are needed for load with one for redundancy in an n + 1 arrangement . the number of fans 94 is directly related to the total cooling load and coil configuration . currently a total of six are used for models which have total capacities of 15 kw to 20 kw of it cooling load . lower loads may require less fans but the principle is the same . it is desirable that all fans 94 should run all the time , because fans are more likely to fail on start - up , especially if they have not been turned over regularly during maintenance . should a fan fail , a non - return flap 100 closes over the failed fan to prevent ‘ short circuiting ’ of the airflow , whereupon the remaining fans speed up to take up the load . this non - return valve 100 feature is advantageous in the first embodiment where the fans are upstream of the coil , but is not necessary in the second embodiment where the fans are downstream of the coil . the fans 94 are hot - swappable requiring the release of quick - release fittings and an electrical plug connector in a process that involves approximately four minutes to swap out a fan . monitoring equipment can detect increased power consumption by any fan , 94 indicating a possible future fan failure and allowing the unit to be swapped before the failure occurs . the combination of variable speed and chilled water valves linked to sensors permits efficient cooling levels to be maintained . in other words , only the level of cooling required of the mechanical equipment is delivered automatically at anytime . n + 1 redundancy is important for the fans 94 , which are the most likely components to fail but is less important for the coil 92 which rarely fails . in any event , providing two coils 92 to achieve the same ( n + 1 ) level of redundancy as the fans would increase air resistance through the system , requiring larger fans and increasing power consumption . coils rarely fail , but when they do it is sometimes catastrophically on commissioning or more likely as a result of a blow hole . brazing flux lodged in a hole may not be revealed with a factory air test , but will then fail when filled with water upon commissioning . these incidents are very rare but not unknown , so the invention contemplates providing n + 1 redundancy on the service but not the coil itself . this is achieved by designing the coil as a cartridge which can be hot - swapped without shutting down the cabinet . to this end , the coil 92 complete with solenoid water isolation valves and two ( or three ) port modulating chilled water valves is made as an assembly 102 , as shown in fig7 . the assembly 102 is mounted on telescopic rails 104 and connected to the flow and return pipework via ‘ dry break ’ connectors 106 in which an inner valve closes before an outer coupling releases to avoid any coolant spillage . monitoring procedures detect leaks and pressure loss within the coil 92 . in the event of a coil failure , an engineer opens the doors to the ecu space leaving the fans 94 running . room air continues to circulate through the racked equipment which might rise in temperature but will stay within its operational limits . by maintaining some airflow during coil swapping , the suddenness of temperature rise within the cabinet 30 is minimized and hence the risk of thermal shock damage to the equipment protected by the cabinet 30 is reduced . a thermal shock ‘ spike ’ representing a rate of temperature rise of 10 ° c . per hour is considered acceptable in this context . once access is gained by opening the doors 76 , 80 to the ecu space , the dry break connectors 106 are disconnected together with electrical plugs . a retaining clamp is undone and the whole coil cartridge 102 slid out of the cabinet 30 on the telescopic rails 104 . in this position , retaining bolts holding the coil cartridge 102 on the rails 104 are removed and the coil 92 lifted off the rails and replaced . the procedure is reversed with a new coil , the coil bled and the doors closed to resume normal operation . it is envisaged that the total time necessary to swap a coil will be less than about ten minutes . the area in the ecu space below the coil cartridge 102 is tanked so that in the event of a spillage the contents of the coil 92 and the cabinet pipework etc are contained . leak detection sensors within the tanked area provide an alarm condition in this situation . in the event of a catastrophic leak , the chilled water valves automatically close to prevent more fluid entering the cabinet enclosure ( this facility can be disabled if required ). in standard format , the outer hose of the aforementioned pipe - in - pipe system can be used as a drain . however if a fire - rated cabinet is required then this hole is fire - sealed and it is necessary to drain the ‘ tanked ’ area manually . as mentioned above in relation to the door lock system , the cooling system is designed to maintain the cabinet environment above dew point to prevent condensation forming on the heat exchanger coil and being carried into the racked equipment by airflow or forming directly on the surface of the racked equipment . design set point for the heat exchanger water inlet temperature is 11 . 5 ° c . with a 16 . 5 ° c . outlet temperature . the sealed environment of the cabinet means the external dew point can be ignored other than when the cabinet doors are opened , when the interlocking of the door locks and the environmental controls ( described above ) prevent dew point problems . the cabinet ecu 38 in combination with the cabinet 30 provides a closed loop air / water system dealing with sensible heat only . for this reason there is no dehumidifier within the ecu 38 . the continuously circulating air is drawn originally , and from time to time during operational and maintenance access from the room air . in a data center , this air will be maintained within prescribed humidity levels — normally 50 % relative humidity ( rh ) plus or minus 5 % from the central make up fresh air system . some oem specifications allow for a much wider humidity tolerance while quoting the figure of 50 % rh as ideal . while too high humidity is to be avoided to prevent problems with condensation on equipment , too low humidity levels are also undesirable to avoid potential problems with static electricity . during the last few years , there has been an increase in the number of equipment component failures due to humidity problems . this stresses the need to target the environment within an ideal humidity tolerance band . where the cabinet 30 is to be located outside data center environments , i . e ., lacking close temperature and humidity control , care must be taken to ensure the ability of the control system to prevent condensation via door interlocking is still viable . in other words the internal and external environment must be capable of being matched to stay above dew point but also maintain adequate cooling conditions for the equipment . where there is any doubt as to this requirement , then an outer enclosure should be used as illustrated in fig2 ( a ) to 2 ( c ) and fig3 ( a ) to 3 ( c ) . this provides an insulated outer zone which is provided with a small package hvac unit 36 to maintain a stable ambient environment of 22 ° c . 50 % rh . the unit 36 provides cooling , heating ( if required ) and humidity control and is linked to the plant skid 42 by a similar but independent pipework system . if the interconnecting pipe - in - pipe flow and return mains linking the cabinet heat exchanger to the plant skid 42 are not insulated , then a sensor is attached to the pipe . thus , in the event of the measured room dew point approaching the fluid temperature set point , the skid control panel will by means of the skid actuator and variable speed pump raise the fluid temperature say 1 ° c . or more to avoid condensation forming . however in standard format the pipe - in - pipe system is supplied pre - tested and insulated , so this facility is not needed . the skid primary chilled water circuit is 7 . 5 ° c . on supply . the cabinet 30 of the invention is provided with dual - corded a and b power supplies as shown in fig4 , power monitoring and control facilities , and dual - corded c1 and c2 utility power supplies to the ecu 38 . the cabinet 30 of the invention may contain various internal features which are not essential to the invention and are not shown . for example , each power distribution unit ( pdu ) within the cabinet may contain an iec socket outlet ( a range of other outlets is possible to suit the country of location ) which is numbered and has a status neon lamp . if required , 8 u high modules ( 8 socket outlets ) can be provided with individual socket power monitoring . another internal feature not shown is a rack - mounted fire protection unit ( fpu ) which provides an in - cabinet microprocessor - controlled sub - system for extinguishing fires within the cabinet 30 . fire detection is provided by an in - cabinet laser smoke detection unit . fm200 extinguishing agent ( in a dual bottle arrangement ) is preferred as this agent is electrically non - conductive and not harmful to electronic equipment or to personnel . in the event of a fire situation detected by the smoke detection unit , only the individual cabinet 30 is flooded with extinguishing agent and shut down rather than the whole room . after a fire , extinguishant gas and fire residue may be extracted from the cabinet using a mobile gas bottle and vacuum pump , connected to a tap off valve on the cabinet side . this also removes the need to install high and low level extract ductwork , complete with dampers and fans required for room level solutions . the invention minimizes the impact of fire on the user &# 39 ; s service , and minimizes the cost : say a replacement cost of $ 340 . 00 for gas as opposed to perhaps $ 136 , 000 . 00 for flooding a whole room of area 1 , 000 m 2 , let alone the cost of downtime and possible equipment damage involved in flooding the whole room . indeed , a suitably sensitive early warning detection system provides control personnel with the option to shut off the power to the rack , which will normally prevent a potential fire , before flooding the cabinet 30 with extinguishing agent . an increased risk of fire follows from the process of compaction , requiring users to 20 consider their fire strategy . the value of business interruption for many users is far greater than the capital cost of equipment loss . the automatic system installed in the cabinet of the invention protects the racked equipment and limits the damage to one rack . being a sealed cabinet , the risk of cold smoke damage to other equipment / services in the room is removed . in contrast , the majority of data rooms use a form of total flooding ( either gas or water mist ) to protect the room space directly but the rack interiors and equipment indirectly . the invention has further benefits . for example , the cabinet construction of the invention together with its security systems provides a very high level of physical security required by many users and their insurers . moreover , by obviating raised floors , the invention avoids other problems such as the problem of metal whiskers , namely swarf from the edge of the floor tile cut - outs which may be carried by the airflow systems into the racked equipment of unsealed floor - ventilated rack cabinets . the continuing increase in equipment and cable weight has the effect of increasing the loading within rack cabinets and therefore onto the raised floor . the full load capability of a raised floor is only realized when all of its tiles are in place . in other words , the lateral strength of the floor depends upon the presence of the tiles . as ‘ discussed above , tiles are often missing in many data centers . the increased load on the raised floor increases the point loads on the structural floor , often beyond acceptable limits . for users in earthquake zones , raised floor systems create an additional hazard . while all systems are liable to experience downtime of hours or days due to loss of connectivity in the event of an earthquake , collapsed raised floors result in racked equipment damage which can extend downtime to more than a month . operation of the invention will now be described in more detail . the function of the plant is to maintain air in the data cabinet supply plenum at 22 ° c . 50 % rh . the basic temperature ‘ set point ’ is 22 ° c . which can be adjusted via an optional remote display and adjust panel ( not shown ). all other parameters to tune the control loops can also be adjusted via the optional local display and adjust panel . due to temperature stratification in the supply air plenum 82 , the average of two temperatures is used to ensure that the supply air temperature is adjusted to counter the mean cooling load in the cabinet . the supply air temperature set point is adjusted down from 22 ° c . to 20 ° c . when the average return temperature exceeds 34 ° c . should any of the necessary sensors be unreliable , i . e ., open or short circuit , it is removed from the averaged calculation . the average of the two supply temperatures is compared with a sliding set point produced by the return air average temperature exceeding 34 ° c . the chilled water valve will then be modulated in accordance with a proportional plus integral control algorithm to maintain the set point . all digital inputs are normally open for the fail condition to ensure that the wiring circuit integrity and circuit breakers are also monitored . the alarm output is switched off for an alarm condition , for the same reason . each variable volume fan maintains a constant static pressure under the control of a proportional plus integral control algorithm , using the duct static pressure transmitter as input . should this transmitter be unreliable , the fan speed will be controlled at a fixed value . following a power failure , the fan speed will ramp up gradually . each of the variable volume fans runs continuously unless disabled by any of the following conditions , namely : ‘ gas gone ’— if the in - cabinet fire protection gas dump system is active ; if smoke input from the in - cabinet fire detection system is active ; if the local isolator / alarm reset switch is off ( hardwired into the controlled equipment ); or the fan &# 39 ; s respective fault condition is detected ( hardwired into the controlled 20 equipment ). the chilled water valve will be forced 100 % open if any of the following conditions is active , namely the supply fan is disabled or if all of the return air temperatures are unreliable ( either open or short circuit ). the solenoid water isolating valves will be switched . off if water is detected within the unit . in terms of security function , a ‘ door open panel light ’ will illuminate when all the 30 following conditions are active : there is a request from the control room system ( if connected ) and the cabinet card reader ; the dew point temperature in the cabinet is higher than the dew - point required to condense moisture from air entering the unit when the doors are opened ; and there is no signal from the ‘ gas gone ’ alarm of the fire protection ( extinguishing ) unit . the ‘ door open light panel light ’ will flash when all of the following conditions are active : there is a request from the control room system ( if connected ) and the cabinet card reader ; the dew point temperature in the cabinet is being adjusted to prevent condensation of moisture from the air entering the unit when the doors are opened ; and there is no signal from the ‘ gas gone ’ alarm of the fire protection ( extinguishing ) unit . the ecu door magnetic locks will open when all of the following conditions are active : there is a request from the control room system ( if connected ) and the cabinet card reader ; the dew point temperature in the cabinet is higher than the dew point required to condense moisture from the air entering the unit when the doors are opened ; and there is no signal from the ‘ gas gone ’ alarm of the fire protection ( extinguishing ) unit . the equipment rack space magnetic locks will open when all of the following conditions are active : there is a request from the control room system ( if connected ) and the cabinet card reader ; the dew point temperature in the cabinet is higher than the dew point required to condense moisture from the air entering the unit when the doors are opened ; and there is no signal from the ‘ gas gone ’ alarm of the fire protection ( extinguishing ) unit . moving on now to the fire detection and protection system , the fire protection unit ( fpu ) has a lockable isolating switch , for use when work is being carried out in the cabinet . if the unit is locked off , the common fault will be activated . this common fault will not include the low gas pressure alarm , which is a separate input . when the air sampling smoke detection system gateway is included , the smoke input will come from a lon snvt which will replace the hardwired connection . in a manual condition , which assumes that a control room system is connected , the remote manual gas dump will be enabled if the following conditions are active : the control room has authorized that this function is active via a network connection ; the smoke input from the air sampling smoke detection system unit is active ; the door magnetic locks are not released ( ecu or equipment rack ); the pre - alarm input from the air sampling smoke detection system unit is active ; and in an automatic condition , which assumes a stand - alone configuration in which a control room system is not connected , the remote manual gas dump will be enabled if the following conditions are active . this is also a backup system to the remote manual gas dump , if the control room has not authorized the function within a given time , and the other inputs are still active : the first knock is active ( hardwired input from the air sampling smoke detection system to the fpu ); the pre - alarm input from the air sampling smoke detection system unit is active ; the second knock ( smoke input from the air sampling smoke detection system 15 unit ) is active ; the door magnetic locks are not released ( ecu and equipment rack sections ); moving on now to alarms , a ‘ common plant alarm ’ will be enabled if any of the following conditions is active : there is a fire ! smoke alarm from the air sampling smoke detection system unit ; there is a fault signal from the air sampling smoke detection unit ; there is a pre - alarm from the air sampling smoke detection unit ; the front door status does not match the commanded position ( following a grace period of 5 minutes — only if the control room is connected ); the back door status does not match the commanded position ( following a grace period of five minutes — only if the control room is connected ); the temperature ‘ set - point ’ is not being maintained ( plus or minus 2 ° c .) following 30 minutes after a power failure ; or the cabinet humidity is less than 45 % rh or greater than 50 % rh , following minutes after a power failure . the above output will latch until reset via a control room system ( if connected ) or from the portable display and adjust panel . a “ fire alarm ’ ( flashing lamp on ’ the panel ) will be enabled if there is a fire / smoke ’ alarm from the air sampling smoke detection unit . this output will also latch until reset via a control room system ( if connected ) or from the portable display and adjust panel . a ‘ gas gone lamp ’ will be enabled if there is a ‘ gas gone ’ signal from the fpu ( this is a hardwired signal ) and this will indicate which unit the alarm relates to when several units are connected together . it will be apparent to those skilled in the art that the invention has very numerous and considerable benefits over the prior art . it provides a safe and secure total environment for locating existing and new it / electrical critical technology in high - density deployment . this environment is provided in a form that can be utilized in any location where it might reasonably be required : it is not necessarily dependent on a conventional data room location . the environment is also provided in a form that permits full use ( i . e ., 100 %) of the equipment space for hot devices if required . the environment systems of the invention provide high availability and fault tolerance 10 both under operational and maintenance conditions . the environment is ‘ room neutral ’ i . e . the cabinet of the invention does not contribute to any additional cooling loads or receive any additional cooling loads from its surrounding space . it provides means for remote proactive monitoring and control of the environment systems to ensure maximum uptime . it removes as far as possible the need for personnel to schedule the order of deployment ( stacking ) of equipment for good thermal management . it automates as far as possible the environment control systems to avoid the need for manual intervention and the resulting risks of downtime . it provides true scalability upwards and downwards across all environmental systems , while maintaining environmental conditions suitable for the correct operation of all vendor / oem products . the invention allows efficient energy consumption both for operational and maintenance requirements throughout the whole life of an installation and at any given stage of build - out . the invention provides a seamless means of avoiding the ‘ fuzzy edge disease ’ of the industry , in the words , the interface problems arising between traditional complex systems provided from a variety of specialist sources , especially high costs , increased timescales , lower availability , multiple points of failure and long mean times to repair . it provides certainty to users , removing as many of the traditional uncertainties and variables as possible and thereby simplifying the decision / design process when configuring a facility . in general , the invention may be embodied in many forms . when determining the scope of the invention , reference should therefore be made to the appended claims and to other conceptual statements herein , rather than the foregoing ’ specific description .
| 7 |
referring to fig2 to 5 c , an example of a rotor blade of a turbomachine . such a blade can for example be a blade of an airplane turbojet , for example at a low - pressure stage . the blade includes a lower side and an upper side positioned on either side of a stacking axis . the blade can thus include an airfoil 101 extending along a stacking axis of the blade . the airfoil 101 extends between a proximal end 102 and a distal end 103 of the blade . the blade includes a root 104 at its proximal end 102 , by which it is for example attached to a disc of the rotor of the turbomachine . the disc can drive the blade in rotation about an axis of the turbomachine . the blade has at its distal end 103 a heel 105 . the heel 105 can be made in such a manner that , when several movable blades are attached to a rotor disc , their heels 105 are set edge to edge so as to form a rotating ring delimiting a surface of revolution about an axis of rotation of the blades . this ring has in particular the function of delimiting an outer surface of a passage for the gas flow circulating between the airfoils 101 and thus to limit possible gas leaks at the distal end 103 of the blades . the heel 105 includes a platform 2 having a first edge 201 on the lower side and a second edge 202 on the upper side . the first and second edges 201 and 202 are for example opposite lateral edges . the platform 2 can delimit on the outside the gas flow passage circulating between the blades 101 . the heel 105 includes at least one seal lip 3 . the seal lip 3 has a first end portion 301 on the lower side and a second end portion 302 on the upper side . the seal lip 3 has a seal lip top extending radially outward from said platform 2 between said first 301 and second 302 end portions . the heel 105 can include an upstream seal lip 3 and a downstream seal lip 4 , upstream and downstream being defined according to the direction of gas flow . the upstream 3 and downstream 4 seal lips can be made in such a manner that , when several movable blades are attached to a rotor disc , the seal lips 3 and 4 of the blades are set edge to edge so as to form a rotating ring along the axis of rotation of the blades , this ring being contained substantially within a radial plane . such a ring makes it possible to limit the existing clearance between the blades and a stator , or a stator shroud , which surrounds them , so as to limit possible gas leaks at this location . the part of the platform 2 extending upstream of the upstream seal lip 3 constitutes an upstream portion 203 or upstream spoiler . the portion of the platform 2 extending downstream of the downstream seal lip 4 constitutes a downstream portion 205 or downstream spoiler . between the upstream portion 203 and the downstream portion 205 , the platform 2 has a central part 204 extending between the upstream 3 and downstream 4 seal lips . for the purpose of damping vibrations to which the blades are subjected in operation , the blades can be mounted on their rotor disc with a torsional stress about their stacking axis . thus , the platforms 2 can be dimensioned in such a manner that each blade is given a torsional stress by pressing against its neighbors at the heels 105 , mainly along the end portions of the seal lips 3 and 4 . for at least one seal lip 3 , for example for each seal lip 3 , the heel 105 includes , at one of its edges 201 and 202 at least , a portion forming a cup 5 extending along the end portions 301 or 302 of the seal lip 3 which corresponds to the edge 201 or 202 , the portion forming the cup 5 being designed to receive a deposit of anti - wear material 7 . thus , the heel 105 can include , for at least one seal lip 3 , for example for all seal lips 3 , at the first 201 , respectively second 202 edge , a first , respectively second portion forming a cup 5 extending along the first 301 , respectively second 302 end portion of the seal lip 3 , the first , respectively second portion forming a cup 5 being designed to receive a deposit of an anti - wear material 7 . compared to the prior art , the portion forming the cup 5 , along an end portion 301 or 302 of the seal lip 3 , allows stiffening of this seal lip 3 and therefore to better withstand the loads caused by contact with adjacent heels 105 . the referred figures represent portions forming a cup 5 at the upstream seal lip 3 , but such portions forming cups 5 can be present , alternatively or complementarily , at the downstream seal lip 4 . each portion forming a cup 5 can include two walls 501 and 502 extending on either side of the end portion of the corresponding seal lip 3 . these walls thus form two faces 501 and 502 forming lateral walls of the cup 5 and the end portion of the seal lip 3 forms the bottom of the cup 5 . these walls 501 and 502 can be reworked during subsequent machining . thus the blade can include a layer of anti - wear material 7 deposited in each cup 5 thus formed . the [ material ] constituting the blade generally has poor resistance to wear and the anti - wear material makes it possible to extend its lifetime by protecting the parts subjected to wear . the layer of anti - wear material 7 can be obtained by brazing plates of a specific alloy with high hardness to the cups 5 . the layer of anti - wear material 7 can be obtained by loading this lateral face with a melted alloy . the necessary heat can for example come from an electric arc sheathed with neutral gas or even from a laser beam . the anti - wear material 7 can be a cobalt - based alloy , for example an alloy of cobalt , chromium tungsten and carbon , for example such an alloy of the type of those marketed under the brand name “ stellite ,” having good anti - wear properties . the anti - wear material 7 can also be made on a rough blade from the foundry prior to machining , by stelliting . the presence of the cup 5 in the seal lip 3 makes it possible to deposit a small quantity and without any risk of overflowing . indeed , the portion forming the cup 5 acts like a “ gutter ” during deposit of the melted material , overflow being limited by the edges of the cup 5 . the edges of the walls of the cup 5 extending past the anti - wear material deposited can then be removed during subsequent machining allowing the machined blade of being obtained . the walls 501 and 502 of the cup portion 5 must thus have sufficient thickness to not melt completely during depositing of the melted anti - wear material . their condition after depositing can however be modified during machining . thus a thickness of 1 . 5 mm for the walls 501 and 502 , for example , is sufficient . likewise , the deposit of anti - wear material 7 does not need to have imperfections because the form of the layer can be modified during subsequent machining and possible subsequent sanding . such a blade also allows depositing of stellite along the seal lip 3 , which provides a greater lifetime for the blade because the areas protected by the anti - wear material 7 are supported on the seal lip 3 . moreover , such a blade allows automated depositing of anti - wear material and no longer requires any manual operation . as the material distributes itself along the cup 5 , it is thus easier to accomplish a deposit of a small quantity of material . it is thus possible to obtain , after machining , a layer of anti - wear material 7 . the layer of anti - wear material 7 has for example a thickness of 1 mm or a greater thickness . moreover , such a blade does not require a subsequent checking stage , the portion forming a cup 5 avoiding any overflow and the final form of the portion being obtained after machining . the result is a simplification of the method for depositing the anti - wear material , and more generally of the method of manufacture of rotor blades for a turbomachine . referring to fig6 , a method for depositing anti - wear material on a rotor blade of a turbomachine is described there . the method includes a first step 601 consisting of supplying a rough rotor blade for a turbomachine as describe above and as shown in fig5 a . the method includes a second step consisting of depositing a layer of anti - wear material 7 as described above in each cup 5 formed , to obtain a heel 105 as shown in fig5 b . the method includes a third step 603 consisting of machining the edges of the walls 501 and 502 of the cup 5 extending past the layer of anti - wear material 7 deposited , so as to obtain a machined blade as shown in fig5 c . the method can include a fourth step 604 consisting of sanding the surface of the layer of the anti - wear material 7 and of the portion forming a cup 5 after machining , so as to make them smooth .
| 5 |
in the following description , various aspects of the present invention will be described . those skilled in the art will also appreciate that the present invention may be practiced with only some or all aspects of the present invention . for purposes of explanation , specific numbers , materials and configurations are set forth in order to provide a thorough understanding of the present invention . however , it will also be apparent to one skilled in the art that the present invention may be practiced without the specific details . in other instances , well known features are omitted or simplified in order not to obscure the present invention . parts of the description will be presented in terms of operations performed by a computer system , using terms such as data , flags , bits , values , characters , strings , numbers and the like , consistent with the manner commonly employed by those skilled in the art to convey the substance of their work to others skilled in the art . as well understood by those skilled in the art , these quantities take the form of electrical , magnetic , or optical signals capable of being stored , transferred , combined , and otherwise manipulated through mechanical and electrical components of the computer system ; and the term computer system include general purpose as well as special purpose data processing machines , systems , and the like , that are standalone , adjunct or embedded . various operations will be described as multiple discrete steps in turn in a manner that is most helpful in understanding the present invention , however , the order of description should not be construed as to imply that these operations are necessarily order dependent , in particular , the order of presentation . referring now to fig1 a - 1 b , wherein a perspective view and an internal architectural view of one embodiment of a conventional video conferencing camera suitable for use to practice the present invention are shown . for the illustrated embodiment , video conferencing camera 100 includes lens 102 , communication interface 104 , video capture 106 , random access memory 108 , digital signal processor 110 , and bus 112 coupling elements 104 - 110 to each other . together , these elements 102 - 112 cooperate to enable video conferencing camera 100 to be attached and used by a computer ( not shown ) to conduct a video conference for a user of the computer . each of these elements 102 - 112 performs its respective conventional function known in the art . that is , video capture 106 in cooperation with lens 102 captures and digitizes visual images , memory 108 provides temporary storage to the digitized video data , digital signal processor 110 generates video signals representative of the visual images , and provides them to the attached computer through communication interface 104 , and so forth . elements 102 - 112 are intended to represent a broad range of these elements known in the art . in fact , video conferencing camera 100 is intended to represent a broad range of video conferencing camera known in the art . [ 0020 ] fig2 a - 2 c illustrate a perspective view , a back view and an internal architectural view of one embodiment of the camera converter of the present invention . for the illustrated embodiment , camera converter 120 includes microcontroller 122 , random access memory 124 , removable non - volatile storage medium 126 , general i / o interface 128 , first and second communication interfaces 130 and 132 , and bus 134 coupling elements 122 - 132 to each other . camera converter 120 also includes housing 136 having disposed thereon on / off switch 138 , viewfinder 140 , snap shot control button 142 , battery 144 , first and second visual displays 146 and 148 , and fastening features 150 . together , these elements cooperate to temporally convert video conferencing camera 100 of fig1 into a digital camera . housing 136 houses the electronic elements 122 - 132 , and removably accepts video conferencing camera 100 when it is not attached to a computer . video conferencing camera 100 is physically secured to camera converter 200 using fastening features 150 . camera converter 200 and video conferencing camera are electrically and communicatively coupled to each other through communication interfaces 104 and 130 . battery 144 supplies power to the electronic elements of camera converter 120 as well as to video conferencing camera 100 , through communication interfaces 104 and 130 . the physical shape and dimensions of housing 136 as well as fastening features 150 are application , i . e . video conferencing camera , dependent . communication interfaces 104 and 130 may be any one of a number of serial or parallel communication interfaces known in the art . similarly , any one of a number of known battery types as well as sizes may be employed for battery 144 . on / off switch 138 in cooperation with general i / o interface 128 facilitates a user powering the combined unit on or off . responsive to a change of position of on / off switch 138 , microcontroller 122 applies or removes power supplied by battery 144 to / from the electronic elements of video conferencing camera 100 as well as the electronic elements of camera converter 120 . upon powering up the electronic elements of the combined unit , camera converter 102 initializes and directs video conferencing camera 100 through communication interfaces 104 and 130 as an attached computer would direct video conferencing camera 100 . in response , video conferencing camera 100 starts outputting video signals for visual images “ seen ” by video capture 106 . the video signals , however , are received by camera converter 120 instead , also through communication interfaces 104 and 130 . the fact that the video signals are received by camera converter 120 is transparent to video conferencing camera 100 . view finder 140 enables a user to see the same visual images “ seen ” by video capture 106 of video conferencing camera 100 , and snap shot control button 142 in cooperation with general i / o interface 128 enables the user to control the actual taking of still images . responsive to each “ signaling ” by the user , through snap shot control button 142 , e . g . by depressing snap shot control button 142 , microcontroller 122 generates a still image by taking a “ snap shot ” of the “ current ” visual image represented by the video signals . view finder 140 is optically coordinated with lens 102 of video conferencing camera 100 to enable a user to see the same visual images “ seen ” by video capture 106 of video conferencing camera 100 . snap shot control button 142 and general i / o interface 128 are intended to represent a broad range of these elements known in the art . memory 124 is used to provide temporary storage for the received video signals , and working storage for generating the still images . removable non - volatile storage medium 126 is used to provide permanent storage for the generated still images ( until deleted ). any one of a number of memory types may be employed for memory 124 . in one embodiment , removable non - volatile storage medium 126 is a removable flash memory card . in another embodiment , it is a diskette . in yet another embodiment , the non - volatile storage medium is a fixed non - volatile storage medium instead , such as a disk drive . the stored still images may be transferred to a display and / or processing device ( not shown ), such as a compatibly equipped computer , by removing removable non - volatile storage medium 126 and “ coupling ” it to the compatibly equipped computer through a compatible input / output mechanism . for example , in the case of a flash memory card , by placing the flash memory card in a flash memory card reader of the computer . for the illustrated embodiment , the stored still images may also be transferred to a display and / or processing device , by coupling the display and / or processing device to the combined unit through communication interface 132 . communication interface 132 may also be one of a number of known serial or parallel communication interface . visual display 146 and 148 are used to provide feedback to the user to facilitate operation of the combined unit as a digital camera . for the illustrated embodiment , visual display 146 is a lcd display for use to display a numeric count of the number of still images stored , and visual display 148 is a lcd display for use to display user messages for the user . both types of displays are rendered by microcontroller 122 . [ 0029 ] fig3 a - 3 c are three flow charts illustrating one embodiment of the operational steps of the present invention . as illustrated in fig3 a and alluded to earlier , in response to a power on event , microcontroller 122 powers on the electronic elements of video conferencing camera 100 through communication interfaces 104 and 130 , as well as the electronic elements of camera converter 102 , step 152 . upon powering up , camera converter 102 starts receiving the video signals representing the visual images “ seen ” by video capture 106 , step 154 . camera converter 102 continues to receive the video signals until the power - off event is detected , step 156 , which for the illustrated embodiment , is denoted by an interrupt to microcontroller 122 triggered by general i / o interface 128 in response to the changing of the position of power on / off switch 138 . as illustrated in fig3 b , while receiving the video signals , in response to a snap shot event , camera converter 120 generates a still image of the current frame using the video signals , and stores the generated still image in non - volatile storage medium 126 , step 158 . for the illustrated embodiment , te snap shot event is denoted by an interrupt to microcontroller 122 triggered by general i / o interface 128 in response to the user “ signaling ” from snap shot control button 142 . as illustrated in fig3 c , while connected to a computer and “ idle ”, in response to a command from the attached computer , camera converter 120 downloads the stored still image to the attached computer , step 160 , if the received command is a “ download ” command . camera converter 120 deletes the stored still image , step 162 , if the received command is a “ delete ” command . otherwise , camera converter 120 handles the command in accordance with the semantics of the command , step 164 . [ 0031 ] fig4 a - 4 b illustrate a hardware view and a software view of one embodiment of a computer system suitable for use to download and display / process the generated still images . as shown , for the illustrated embodiment , computer system 200 includes processor 202 , processor bus 206 , high performance i / o bus 210 and standard i / o bus 220 . processor bus 206 and high performance i / o bus 210 are bridged by host bridge 208 , whereas i / o buses 210 and 212 are bridged by i / o bus bridge 212 . coupled to processor bus 206 is cache 204 . coupled to high performance i / o bus 210 are system memory 214 and video memory 216 , against which video display 218 is coupled . coupled to standard i / o bus 220 are disk drive 222 , keyboard and pointing device 224 and communication interface 226 . these elements perform their conventional functions known in the art . in particular , disk drive 222 and system memory 214 are used to store a permanent and a working copy of still image download / display / process application 242 . the permanent copy may be pre - loaded into disk drive 222 in factory , loaded from distribution medium ( not shown ), or down loaded from a remote distribution source ( not shown ). disk drive 222 and system memory 214 are also used to store a permanent and a working copy of operating system 244 including camera device driver 246 and communication interface driver 248 . the constitutions of these elements are known . any one of a number of implementations of these elements known in the art may be used to form computer system 200 . in general , those skilled in the art will recognize that the present invention is not limited by the details described ; instead , the present invention can be practiced with modifications and alterations within the spirit and scope of the appended claims . the description is thus to be regarded as illustrative instead of restrictive on the present invention . thus , a method and apparatus for temporally converting a video conferencing camera into a digital camera .
| 7 |
a preferred embodiment of the present invention will be described hereinafter in connection with a computer program named “ products generator ”, which was written by the present inventors . as used herein , the names “ products generator ”, “ e - commerce essential ”, “ e - commerce management system ”, product grabber ”, “ website database wizard ”, “ ems integrator ”, “ control panel wizard ”, “ products database ”, “ product window ”, “ refresh window ”, and “ special feature products database ” are trademarks for the computer program described herein and are owned by the present inventors . the products generator computer program is a comprehensive software package contained on a removable storage medium such as a cd . the products generator program is loaded onto and executed by a client computer operated by a registered affiliate . the client computer is preferably a typical personal computer running the microsoft windows operating system or any other suitable operating system such as apple os or linux . in addition , the client computer is connectable to a client / server network , preferably the internet , and is capable of accessing one of more vendor websites over the network . the affiliate website may reside on the client computer , but preferably resides on and is hosted by a remote server that is accessible by the client computer and other computers over the network . the other computers include computers operated by consumers for making e - commerce purchases over the internet . as described hereinafter , the products generator computer program provides users with a turnkey , fully automated system for acquiring one or more commission earning products for sale from one or more participating vendor websites , and creating or updating an affiliate website to include any or all of the acquired products . the products generator program automates the process of searching for and retrieving products from vendor websites . the products generator program is an easy - to - use , user - friendly gui - based software package that allows a user who has become a registered affiliate of one or more participating vendor websites to automatically search those vendor websites for products of interest . in order to commence an automated product search of vendor websites , the registered affiliate is required to enter a list of keywords relating in some manner to products of interest to be searched for and retrieved from each vendor website . in response , the products generator program automatically retrieves all required product codes and inserts the registered affiliate &# 39 ; s unique tracking number for each vendor website into retrieved product codes before the display and marketing of such products on the affiliate website . the products generator program stores the registered affiliate &# 39 ; s unique tracking number for each vendor website and automatically incorporates the correct tracking number into all product codes retrieved from the respective vendor websites prior to storage of the product codes in a products database to guarantee payment of a commission from the respective vendor to the registered affiliate for each successful sale . accordingly , the products generator program automates the process of searching for , retrieving and incorporating product codes into an affiliate website and avoids the need for the registered affiliate to go through a lengthy log - in and product search process as required by some vendors and described above in connection with some of the conventional vendor / affiliate methods . the products generator program provides an intuitive user interface and provides a highly automated and fast method for selectively retrieving commission earning products from one or more vendor websites as compared to the time - consuming manual method currently used in connection with most vendor websites that offer registered affiliates the capability to acquire product information online . as described below , the products generator program also provides a “ website database wizard ” that automatically imports acquired product codes into an existing affiliate website . alternatively , the website database wizard assists the registered affiliate in creating an affiliate website . in addition , the products generator program includes a control panel wizard that generates a “ live on the internet ” control panel specific to each particular vendor . the control panel allows the registered affiliate to update the affiliate website in real time by enabling the registered affiliate to refresh products via new product searches , and also enables the updating , validation , selection and deselection of retrieved products from the products database so that only selected products appear on the affiliate website . in addition , as well being able to update and validate products stored in the products database , the products generator program is also capable of displaying products in “ real time ” from the affiliate &# 39 ; s website . accordingly , the products generator computer program is organized in four distinct sections , including : ( 1 ) a product search section for searching for and retrieving products from vendor websites in a fully automated , semi - automated , or manual manner ; ( 2 ) a website database wizard for assisting the registered affiliate in creating an original affiliate website complete with all the necessary code for the display of retrieved products , via template pages or by means of individual scripts ; ( 3 ) a control panel wizard for allowing a registered affiliate to create a “ live ” on the internet control panel to enable the registered affiliate to edit retrieved products directly from an affiliate website by validating , selecting and de - selecting retrieved products from a products database so that only selected and current products appear on the affiliate website ; and ( 4 ) an e - commerce management system which allows the registered affiliate to conduct product searches of vendor websites directly from an affiliate website . each of these distinct sections is described separately below . fig1 a and 1b are a flowchart illustrating many of the various functions performed by the product search section of the products generator software package in connection with a single vendor website . as will be readily apparent to those of ordinary skill in the art , the same or similar functions are performed for additional or different vendor websites . in order to simplify the process of acquiring products from vendor websites , the products generator program provides a user - friendly interface which provides step - by - step instructions and prompts the registered affiliate to enter text and other required data into simple text boxes and to make selections using familiar data input devices such as check boxes and pull - down menus . fig2 - 14 illustrate the user interface of the product search section of the products generator program . more specifically , fig2 - 14 are screen images or screen shots of images displayed on a monitor of the client computer during operation of the products generator program . thus , fig2 - 14 illustrate what the registered affiliate or other user of the products generator program would view on a computer monitor when running the program on a typical personal computer . as will be appreciated by those skilled in the art , the products generator program is designed with an intuitive user interface that utilizes selectable “ buttons ”, text boxes , check boxes , and the like , in the same manner as countless other computer programs designed for use with the microsoft windows and apple operating systems . during use , the products generator program requires users to make various selections by clicking on various buttons or check boxes and prompts the user to enter text into text boxes . the functional characteristics and operation of the product search section of the products generator program will now be described hereinafter with reference to the flowchart of fig1 a and 1b and the screen images of fig2 - 14 . when the products generator program is first activated , it generates a “ switchboard ” screen ( step 1 ). fig2 is an image of the switchboard screen . the switchboard screen displays various user - selectable options each of which launches a different products generator software routine . in particular , the switchboard screen includes vendor website selection buttons 10 , 11 , 12 , 13 for allowing selection of any one of a plurality of participating vendor websites from which goods may be searched for and selected by the registered affiliate . when any one of the vendor website selection buttons 10 - 13 is clicked on by the user , the products generator program launches a product search routine for conducting a search for products on the selected vendor website . in the presently described embodiment , vendor website selection buttons are provided for amazon . com 10 , allposters . com 11 , e - merchandise . com 12 , and art . com 13 . this is not intended to limit the scope of the present invention . as will be appreciated by those skilled in the art , a different software routine is provided in the products generator software package for each vendor website that is searchable . although product searches of all vendor websites are performed using string searches , the search routines contained in the products generator program differ from each other based on the unique steps required by the respective online vendors to access the vendor website , search for products , and acquire product codes . thus , the steps performed by the products generator program for each respective vendor website differ slightly in terms of the way they access product codes based upon differences in the format and location of product codes in each vendor website . the products generator program includes a different product search software routine unique to each vendor website that can be accessed . although the presently described embodiment of the products generator program includes only the four vendor websites mentioned above , the products generator program may be limited to one vendor website or updated to include additional or different vendor websites by adding new software routines for accessing such vendor websites in accordance with the teachings of the present invention . also , as described below , the products generator program further includes a product grabber software routine that allows users to acquire codes from any vendor or affiliate website that offers products for sale online . referring again to fig2 , in addition to the vendor website selection buttons 10 - 13 , the switchboard screen also includes a website database wizard selection button 14 that launches a website database wizard software routine for assisting the registered affiliate in creating an original affiliate website complete with all the necessary code for display of the retrieved products , via template pages or by means of individual scripts . in addition , the switchboard screen includes a control panel wizard selection button 15 that launches a control panel wizard software routine that sets up a control panel that can be accessed directly from the affiliate website without requiring the user to load and execute the products generator program . thus , the control panel wizard sets up a live control panel that is unique to each respective vendor for allowing the registered affiliate to validate , select or de - select products from the products database , directly from the affiliate website , so that only selected and current products appear on the affiliate website . the switchboard screen also includes a setup products grabber button 16 and an ems integrator button 17 . each of these features of the products generator software package are described in separately - labeled sections below . in the presently described embodiment of the products generator computer program , the switchboard screen remains “ open ” or “ active ” to enable the registered affiliate to select any one of the buttons 10 - 17 at any time during operation of the products generator program . in other words , the switchboard screen remains in the background and may be selectively called up and moved to the foreground to allow the registered affiliate to conduct additional product searches or launch one of the wizards . when the registered affiliate selects one of the vendor website selector buttons 10 - 13 by clicking on the selected button , the product search section commences a search for products on a respective vendor website based upon a newly - created or previously - stored keyword list . in the following description , it is assumed that the user has clicked on the amazon . com button 10 . prior to commencing the search , the product search section displays a welcome screen to advise first - time users of the functional characteristics of the products generator program ( step 2 ). as shown in fig3 , the welcome screen contains instructions and descriptive text to explain the purpose of the products generator program . more specifically , the welcome screen advises users that they must register with one or more of the participating vendor websites shown in the switchboard of fig2 to obtain a unique tracking number which is used to credit the registered affiliate with a commission from each sale made on the affiliate website . the welcome screen further advises users that the products generator program goes to a selected vendor website and , from a list of products that the user has input as keywords , searches the vendor website for relevant products , and retrieves for the user &# 39 ; s database product codes consisting of images , prices , descriptions and links for those products . in addition , the welcome screen advises users that as the products generator program retrieves this information , it automatically inserts the registered affiliate &# 39 ; s unique tracking number into the product code for each selected product to guarantee commission for the registered affiliate &# 39 ; s business for each sale made . accordingly , the welcome screen provides first - time users of the products generator program with an overview of the program which simplifies operation thereof . when the user clicks on the “ next ” button at the bottom right - hand side of the welcome screen using a mouse or other appropriate input device , the products generator program proceeds to display the image shown in fig4 a ( step 3 a ). thus , the next screen can be displayed once the user has read the contents of the welcome screen . users who are already familiar with the features of the products generator program may quickly proceed to the next screen without reading the contents of the welcome screen . in order for the products generator program to automatically search a vendor website for products of interest and acquire product codes for incorporation into an affiliate website , the user must first create a keyword list for use by the products generator program to search for such products on a vendor website . the products generator program does this in an automated manner as described below . fig4 a illustrates a list creation screen that is displayed when the user has selected the amazon . com button 10 in the switchboard screen of fig2 . the products generator program refers to such lists as “ pgf ” files , which is an abbreviation for “ products generator file ”. products generator files are lists formatted by the products generator program . the list creation screen shown in fig4 a includes check boxes 20 , 24 and 26 , which permit previously - created lists to be imported . such lists may be in the pgf format , meaning that they have been created or modified by the products generator program , or in another known format . in addition , the list creation screen includes a “ create a new pfg list ” check box 22 to enable the user to create a new list . when a list has been created by the user in a previous session using the products generator program or using another program or application , such as a word processing program , the user would select the appropriate one of the “ import ” check boxes 20 , 24 , or 26 to open such list . when a list created by another program is imported into the products generator program , the list is converted into a pgf file . such lists may be in the form of , for example , text files , the known csv format , or any other format suitable for such purpose . another “ import ” check box 26 is used to import a list exported from a live control panel ( described below ) ( steps 3 f , 3 g ). the “ lists ” of keywords referred to herein may be a list of any searchable terms for which products may exist , such as titles of movies , television shows , books , names of movie stars , celebrities , personalities , cars , sports teams or figures , and the like . there are no particular limits to the type or number of words or categories that may be included in such lists . in the list creation screen shown in fig4 a , the user has clicked on the “ import a csv or text list ” check box 20 and entered the name and location of the list to be imported by clicking on a text box 28 and entering the name (“ c :\ mylistfile . csv ”) therein ( step 3 b ). the registered affiliate has also clicked on a text box 30 and entered the name (“ c :\ windows \ desktop \ tommo . pgf ”) under which the pgf file is to be stored . thus , when a csv list is imported into the products generator program , it is converted into the pgf format and stored with the file name entered by the user in the text box 30 labeled “ output pgf files ” ( step 3 c .) fig4 b illustrates a list creation screen that is similar to that shown in fig4 a , but in which the registered affiliate has clicked the “ create a new pgf list ” check box 22 and provided a name and location for this list (“ c :\ windows \ desktop \ mylistfile . pgf ”) in the text box 30 ( step 3 d ). similarly , fig4 c is an image of the same screen shown in fig4 a and 4b . in fig4 c , however , the user has clicked on the “ open a pgf list file ” checkbox 24 and has provided a name and location for this list ( c :\ amazon . pgf ) in a text box 32 ( step 3 e ). this option opens a list that was previously stored as a pgf list . when the user clicks on the next button in the screen shown in fig4 b , the screen image shown in fig5 is displayed by the products generator program ( step 4 ). in this image , a text box 34 is provided that contains the items contained in the list to be created . the user may add or remove items from the displayed list by typing the name of the item in the “ item name ” text box 36 or highlighting the name in the text box 34 and clicking on the appropriate add item button 38 , remove item button 40 or update item button 42 . items inserted in the text box 34 may also be removed or updated by highlighting the items and clicking on the remove item button 40 or the update item button 42 . pgf files are lists entered into the textbox 34 shown in fig5 to enable the products generator program to search for products on a selected vendor website . when the user clicks on the next button in fig5 , the image illustrated in fig6 is displayed by the products generator program ( step 5 ). in fig6 , the registered affiliate is prompted to enter in a textbox 46 the affiliate tracking number provided by the particular vendor which , in this case , is amazon . com . thus , in the illustrated example , the products generator program prompts the user to enter the tracking number provided by the amazon . com website . the image shown in fig6 is also displayed after the user has clicked on the next button after the user has clicked on the “ open a pgf list file ” option 24 in fig4 a . in addition , the registered affiliate is provided with a set currency values button 48 for launching a currency setting routine , which will be described below . if the registered affiliate has opened a previously saved pgf list in the list creation screen of fig4 c , the previously - stored affiliate id associated with that list is displayed and need not be re - entered again in fig6 . the tracking number is inserted into all retrieved product codes for a respective vendor and is used by the vendor to pay commissions for online product sales made through the registered affiliate &# 39 ; s affiliate website . when the user clicks on the next button in fig6 , the screen illustrated in fig7 is displayed . this screen provides the registered affiliate with various products menus to make product category selections ( step 6 ). more specifically , in the presently described implementation of the products generator program , the registered affiliate is provided with the ability to create up to 10 different product windows in an affiliate website . a product window is a window created in an affiliate website in which product code for an individual product is displayed . the use of 10 product windows is merely illustrative and is not intended to limit the scope of the invention . there is no limit to the number of product windows that may be made available in the products generator program . in the product window screen shown in fig7 , product category selections may be made by the registered affiliate for one or more of the 10 pull - down product menus 50 . for each product menu 50 , a drop - down list is provided with a list of appropriate product categories . these product categories include , but are not limited to , dvd , vhs , music , books , videogames , apparel , classical , theatrical , toys , software , magazines , baby , pc - hardware , electronics , photo , tools , garden , kitchen , and wireless . these categories depend upon the specific vendor selected on the switchboard screen . the product categories can be changed at any time and the products generator program is designed to be updatable to accommodate changes in the vendor website . in the example shown in fig7 , a different selection has been made for each of the ten product menus 50 . also in fig7 , the user has clicked on the “ use filter ” checkbox 52 to ensure the integrity of retrieved products ( step 7 a ). the filter is a software routine in the products generator program that compares retrieved product codes with the words of the user &# 39 ; s keyword list and selected product categories to ensure that the retrieved products correspond thereto . a product search is performed without use of the filter routine when the “ use filter ” checkbox 52 is unchecked by the user ( step 7 b ). the filter routine double checks retrieved product results to ensure that they relate to the original keywords . for example , assuming that a search is conducted for the keyword “ play time ” and a retrieved product code contains the description “ a long time ago ”. when the filter routine has been selected by clicking on the checkbox 52 , this product will be deleted because it does not relate to the keyword . however , if the item description contains the term “ play time ”, then the product is retained . once the product category selection or selections have been made in one or more of the product menus 50 , the user clicks on the generate products button 54 in fig7 to commence automatic selection of products from the target website which , in the presently described example , is amazon . com ( step 8 ). in the lower portion of the fig7 screen , a progress calculator display 56 is provided . while the products generator program is conducting a search of the vendor website for products based on the keyword list and the selected product categories , products falling within the search categories are identified and the product codes for the identified products are retrieved . as the products generator program performs this process , it calculates the value of new and used products generated , the percentage complete , and the revenue generated at a maximum commission rate of 15 %. this figure is for calculation purposes only . commission rates vary from vendor to vendor . a user - defined applicable commission rate or percentage may be input into an appropriate text box provided for this purpose . the progress calculator displays this information in the progress calculator display portion 56 of fig7 . fig8 a - 8d illustrate various progress read - outs . as shown in fig8 a , for the keyword entry “ titanic ”, the products generator program searches the amazon . com vendor website for all products . as this search progresses , the products generator program displays a progress report indicating the percentage completed , the value of new and used products generated , and the revenue at a maximum commission rate paid by the vendor . fig8 b - 8d show similar progress reports for searches conducted for the movies “ goldfinger ”, “ batman ” and “ star wars ”. to enable use of the products generator program in different countries , a currency setting routine is also provided . for this purpose , the screen illustrated in fig6 is provided with a set currency values button 48 . when this button is clicked on by the registered affiliate , a currency setting menu is displayed , as shown in fig9 . the currency setting menu allows the user to specify the currency type for products that are to be acquired from the vendor website identified in the fig6 screen ( products input currency ) and to specify the currency type for display of the products on the affiliate website ( products display currency ). the currency setting menu also enables users to specify an applicable currency conversion rate . in the illustrated embodiment , the products generator program is capable of inputting and displaying products in u . s . dollars , british pounds , euros , or any other currency of choice . clicking on the generate products button 54 in fig7 causes the products generator program to commence an automatic search and selection of products from a target vendor website which , in the presently described example , is amazon . com . when the search is completed and all products on the vendor website corresponding to the keywords and product categories have been retrieved , they are displayed to the user for editing in a control panel ( step 9 ). the control panel provides the user with a wide variety of options for utilization of the acquired product codes in an affiliate website . operation of the control panel is described below in connection with reference to fig1 - 14 . referring first to fig1 , when the products generator program has completed its search for products identified in the keyword list , a plurality of product windows 60 are displayed showing the retrieved product codes , including graphic images , obtained from the vendor website . in particular , each product window 60 contains a graphic image of the acquired product , the price of the product , and a box indicating the type of the product . in the control panel screen , only 10 product windows 60 are displayed at any given time . product windows for additional retrieved products may be displayed by clicking on the “ next ” button at the bottom of the screen , or by use of the numeric and alphabetic menu shown at the top left - hand side of the screen . upon activation of a number or character , the related keywords are made available via a drop - down list . when any keyword in the list is clicked on , it activates the control panel to display products corresponding to that selection in the product windows . at the top right - hand side of the fig1 screen , the value of new products and used products , along with the maximum commission payable , are displayed for the products shown in the screen . the top of the control panel screen of fig1 includes a set of five tabs , including help / intro 69 , view / edit products 66 , output to database 68 , output to csv 70 , and advanced 72 . each of these tabs allows selection of a particular screen or part of the products generator program , as described below . in fig1 , the view / edit products tab 66 is selected , and the product windows 60 are displayed along with the edit buttons “ r ” 74 , “ c ” 76 , “ x ” 78 , and an unlock / lock symbol 80 in the form of an icon resembling a padlock ( step 10 ). the edit buttons 74 - 78 provided within each individual product window are used to edit the product in that respective product window ( step 11 ). in addition , similar edit buttons are provided at the bottom of the screen to perform a global edit on all product windows displayed on the screen ( step 12 ). the edit buttons allow the user to select various options , as follows : selection of this option clears the corresponding product and shows other products that have just been searched for and retrieved live from the vendor website that may be selected from . more specifically , selection of this option will clear the current product and open a new refresh window with other products that have been searched for and retrieved “ live ” and that can be selected from . when the user clicks on select on a displayed product , the selected product will replace the previous one in the source product window . it could also replace another product in another product window in the control panel that has been selected from the drop - down list in the current refresh window . if the user wishes to select all of the new products retrieved from the vendor &# 39 ; s website in the current refresh window a select all function is available . select all will take all of the products in the refresh window and will populate the control panel product windows with all of the products , thereby replacing all the current products . exceptions to this are any product windows that use the lock feature . when any product window is ‘ locked ’ no new products may be allowed to replace the current ‘ locked ’ product in that product window . the user might wish to choose this option to locate a product with a higher price so that a greater commission would be payable on a sale . “ c ”— clear this product window of current product ( steps 11 b , 12 b ). selection of this option leaves the product window open for new product searches and entries . in other words , selection of this option deletes the current product from the selected product window and leaves it open for new products if the user runs a new product search or selects “ r ” ( refresh ) again . “ x ”— disable this product window from future product entries and delete the current product ( steps 11 c , 12 c ). the padlock icon is displayed in the form of an unlocked / locked padlock to provide a lock / unlock function ( step 11 d ). if the padlock open symbol is displayed , the user has allowed new products to be entered into that product window from any and all searches . if the padlock symbol is closed or locked the current product is locked into the current product window and therefore not subject to change without the lock being de - activated . users can manually clear or update individual products with this unique products generator control panel specifically designed to edit the products which have been retrieved from vendor &# 39 ; s web sites . fig1 is the refresh window that appears when the user clicks on “ r ” ( refresh ) 74 or 82 in the control panel screen of fig1 . when the user clicks on “ select ” on a displayed product , the selected product will replace the previous one in the source product window . it could also replace another product in another product window in the control panel that has been selected from the drop - down list in the current refresh window . if the user wishes to select all of the new products retrieved from the vendor &# 39 ; s website in the current refresh window a “ select all ” function is available . “ select all ” will take all of the products in the refresh window and will populate the control panel product windows with all of the products , thereby replacing all the current products . exceptions to this are any product windows that use the “ lock ” feature . when any product window is locked , no new products may be allowed to replace the current locked product in that product window . referring now to fig1 , the “ output to database ” tab 68 has been selected ( step 13 ). output of the retrieved product codes to an internet database is illustrated in fig1 . the products generator program provides for two separate output options to enable the products generator database to run on the user &# 39 ; s website . in the first option , a sql table structure is created by clicking on the create file — table structure button 88 in fig1 ( step 14 ). then , an “ insert to sql ” script is created and the create file — data button 90 is clicked on . the first time a database is constructed or data is input thereto , the user must select the “ insert ” check box 92 prior to clicking on the create file — data button 90 . if the user is updating an existing database , the “ update ” check box 94 is selected prior to clicking on the create file — data button 90 . once the database files are produced , they may be run on the client computer or uploaded for the script to run on a server hosting the affiliate website ( step 15 ). once the script is run , the table is constructed and the product data is inserted therein . in the section option “ create php script ”, the user creates a php script , if supported by the web hosting company that serves the affiliate website ( step 16 ). the hosting company and database details are entered in the appropriate text boxes shown in the lower left - hand side of the screen and the registered affiliate then clicks on a create php script button 96 , which results in generation of a file that is then uploaded to the server and executed ( step 17 ). the products generator program also provides an ftp facility which will upload the files to the affiliate website ready for use , thereby eliminating the need for any third - party ftp program or similar upload utility . selection of either of the above - described options for outputting the product codes to an internet database results in the data being available for serving alongside the affiliate website ( step 18 ). referring now to fig1 , the “ output to csv ” tab in fig1 has been selected ( step 19 ). this screen allows the user to create a csv file containing relevant data . a csv file is a universally importable , comma - delimited text file which can be imported into any compatible program such as but not limited to microsoft word , microsoft access , and / or microsoft excel . the screen shown in fig1 allows the user to select all or none of the ten product windows ( step 20 ), or to select individual products by clicking on any of ten check boxes ( step 21 ). the user may also select whether the csv file to be created should include or exclude ( steps 22 a , 22 b ) the product category and headings ( steps 23 a , 23 b ). when the user has made the desired selections , a “ create csv file ” button is selected by the user ( step 24 ). when the advanced tab 72 in the control panel shown in fig1 has been selected ( step 25 ), the screen shown in fig1 is displayed . this screen allows the user to perform various edit features on a global basis . for instance , the user may view , edit , or remove keywords in the keyword list ( step 26 ). thus , the advanced screen is used for viewing and editing , e . g ., adding , deleting or updating existing keywords in the pgf keyword list file after the a product search and retrieval exercise has already been performed . items or keywords can be inserted singly ( step 27 ) or imported from , for instance , a list or csv file ( step 28 ). in addition , when a user selects a given keyword , the advanced screen can display how many products are assigned to the selected keyword , the value of products retrieved for that keyword , and the commission value of all the products retrieved for that keyword . the user can also globally update and / or validate all the products in the pgf file . this function allows the user to globally throughout the entire keyword list set the product window categories for each and every keyword ( step 29 ). alternately , the user can either update and / or validate each and every product in the products database ( steps 30 , 31 ), update any disabled ( step 32 ) or empty ( step 33 ) product entries and using the filter or alternative search term update and validate all products . this global option can be set so that each individual product window or a plurality of product windows can be updated and or validated . it should be noted that the control panel described above and illustrated in fig1 - 14 operates while the products generator program is being executed on the client computer . as will be described in greater detail below , the products generator program also creates a “ live ” control panel which enables the identical operations described above in connection with the control panel to be performed by a registered affiliate directly from the affiliate website . the products generator program does this by inserting software into the affiliate website to enable the above - described operations to be performed directly from the affiliate . thus , the “ live ” control panel differs from the products generator program control panel in that the “ live ” control panel runs in a browser , i . e . internet explorer , netscape navigator , or the like , and is used to edit the live data that is currently being served along with the affiliate website , i . e ., the products database which is being used for the affiliate website . therefore , it follows that if the “ live ” products database is being edited , this will result in the changes being reflected live on the affiliate website . contrastingly , the products generator program control panel works within the products generator program and edits a static pgf file on the computer . this file is static . if it is altered , then only this file is changed and only the program operator can view the altered data . in addition to the fully automated method of searching for and acquiring product codes described above , the products generator program provides a manual input method for acquiring product codes . there are various instances where a registered affiliate may encounter a product of interest and want to acquire the code for such product without going through the above - described process . thus , the products generator program provides a manual product grabber routine that enables manual product code acquisition . the product grabber routine allows a registered affiliate to acquire product codes for any product from any website , so long as the product itself originates from a participating vendor website ( in this case , amazon . com , allposters . com , e - merchandise . com , and art . com ). the product grabber routine is illustrated in fig1 a - 15c . fig1 a is a setup screen that is displayed when the product grabber software routine is setup upon selection of the setup products grabber button 16 in the switchboard screen shown in fig2 . to set up products grabber , the registered affiliate is prompted to identify one or more vendor websites and load a given setup . after setting up products grabber , the registered affiliate may import any products of interest from the identified vendor websites . as shown in fig1 b , when the registered affiliate encounters a product of interest while viewing any website , right - clicking on the computer mouse while the mouse pointer is located on the product causes a menu to be displayed on the monitor . the menu is similar to that generated by the windows operating system in response to right - clicking on the mouse . however , the menu includes additional options entitled “ products generator — grab product ” and “ products generator — grab product ( program )” that allow the registered affiliate to “ grab ” the product code for the desired product . the former option is a “ live ” version of products grabber that results in updating of the affiliate website . the latter version is used when the products generator software is being executed and does not result in automatic updating of the affiliate website . more specifically , once loaded on the computer of the registered affiliate , various products generator resources remain active and can be run at any time . these include the products grabber and manual input resources and the control panel , as described above . the “ grab product ” option can be selected by the user at any time the products generator program is running in the background . the “ grab product —( program )” option is selected by the user while the products generator program is actively running , such as during its first use . when the registered affiliate selects one of the “ grab product ” options , the manual input screen shown in fig1 c is displayed on the monitor . the manual input screen contains various text boxes in which identifying data relating to the product code acquired from the vendor website are displayed , such as the link to the product and a description of the product . thereupon , the product code is ready for specific product window selection and assignment . while the manual input screen is automatically filled in by the products grabber routine , the manual input screen also enables manual input of a specific product &# 39 ; s details . the products generator program provides a search facility within the manual input screen that enables a user to search for a specific product via the url or vendor &# 39 ; s product id . once the detail has been entered , it then retrieves all the product info . in addition to inputting products manually , a user can also manually edit existing products via the same method . as pointed out above , when the user selects the website database wizard button 14 in the switchboard screen shown in fig2 , the website database wizard is launched . fig1 is a flowchart of the website database wizard and fig1 - 30 are screen images of the various screens generated by the website database wizard . when the database wizard is initially launched ( step 16 a ), the welcome screen shown in fig1 is displayed to inform users that the website database wizard enables users to create a single or multiple web pages in a few short steps complete with all the code needed to display retrieved products stored in the products database created by the products generator program . when the user clicks on the next box in fig1 , the option screen shown in fig1 is displayed . the option screen provides users with two options for the creation of an affiliate website . option 1 launches a standard website template wizard which creates customized web pages complete with all the code necessary to display the retrieved products on the user &# 39 ; s website ( step 16 b ). option 2 launches a routine that creates php scripts to be used within an existing affiliate website to display products ( step 16 c ). selection of option 1 commences an automated process of creating an affiliate website with all the necessary coding to display retrieved products . although selection of option 1 will automatically create an affiliate website with a pre - prepared template design , it does allow the user to select several feature options , as described below . when the user has selected option 1 and clicked on the next box in fig1 , the screen shown in fig1 is displayed . this screen prompts the user to enter into text boxes the title of the web page to be created and the main heading to be inserted at the top of the web page ( step 16 d ). in fig1 , the user has entered “ my web page ” as the title in the appropriate text box and “ the greatest business in the world ” as the main heading in the appropriate text box . the user has also selected black as the color of the main heading text . when the user has clicked on the next box in fig1 , the “ web page features ” screen shown in fig2 is displayed ( step 16 e ). this screen prompts the user to select the number of columns ( 1 - 3 ) of the web page to be generated by clicking on the appropriate checkbox and allows the user to specify whether or not a search box and a drop down list are to be included in the affiliate website . thus , selection of option 1 provides the user with several multi - choice options for the features of the affiliate website . when the user clicks on the next box in fig2 , the screen shown in fig2 is displayed ( step 16 f ). in this screen , the user is prompted to click on a checkbox to indicate whether or not products retrieved from a particular vendor website are to be included in the affiliate website . in addition , the user is also prompted to indicate the number of products that are to appear in each column of the affiliate website , as well as the currency type products input from the vendor website , the currency type of products to be displayed on the affiliate website , and an appropriate conversion rate . the screen illustrated in fig2 assumes that the user has previously selected “ three ” columns in the fig2 screen . in addition , the screen shown in fig2 is specific to the amazon . com vendor website . however , if the user has conducted searches of other vendor websites , additional screens similar to that in fig2 will successively appear when the user clicks on the next button in fig2 ( steps 16 g , 16 h and 16 i ). in the screen shown in fig2 , the user is prompted to enter information needed to access the products data stored in the products database on the affiliate website ( step 16 j ). as can be seen , this information includes host , database name , username and password . the user then selects the generate button to generate the php script . ( step 16 k ). by selecting option 1 and following the instructions contained in the screens illustrated in fig1 - 22 and steps 16 b through 16 k , the products generator program produces a pre - defined template to enable a user to supply information to link to their uploaded products database ( step 16 l ). fig2 illustrates a screen generated by the products generator program when the user has selected option 2 in fig1 . this option gives the user greater control over the appearance of the affiliate website . when option 2 is selected , the “ web page features ” screen shown in fig2 is displayed ( step 16 m ). in this screen , the user is prompted to select individual features for the affiliate website , including a search box , a drop down list , and an individual result . when the user clicks on the next box in fig2 , the screen shown in fig2 is displayed , which prompts the user to select vendor websites from which products are to be displayed on the affiliate website ( step 16 n ). when the user has selected the “ individual result ” in fig2 , the screen shown in fig2 is displayed ( step 16 o ). this screen allows the user to devote an affiliate website or a single affiliate web page to one particular person or subject and to include products relating only to that person or subject . in the illustrated example , the user has entered batman as the individual value and movies as the product category . when the user has clicked on the next box in fig2 , the screen shown in fig2 is displayed ( step 16 p ). this screen prompts the user to enter information needed to link to the uploaded products database , including host , database name , username and password . when the user clicks on the generate button in fig2 , the website database wizard generates the html / php code , as shown in fig2 ( step 16 q ). under option 1 , the user must copy the html / php code and paste into the affiliate web page . under option 2 , the user must save the code as a php file to upload to the server of the affiliate website . if the user has saved the code as a php file , it can be uploaded separately and used below the & lt ; body & gt ; tag to access it . then , as shown in fig2 , after the code has been generated by the products generator program in step 16 r , there are options available to the user . for instance , the user may select the number of products required from each vendor website by clicking on a drop - down list for selection ( step 16 s ). then , the code is displayed as shown in fig3 and is ready to be copied and pasted ( step 16 t ). the user must copy and paste the code into the affiliate website ( s ) below the & lt ; body & gt ; tag wherever the user requires products to appear . ( step 16 l ) in order to enable the user to take advantage of the various editing features of the control panel described above without the need to load the products generator computer program , the products generator program generates a “ live ” control panel that is built into the affiliate website and enables the registered affiliate to edit product windows in real time . the control panel described above in connection with the product search section of the products generator program and illustrated in fig1 - 14 operates while the products generator program is being executed on the client computer . however , the products generator program also creates a “ live ” control panel which enables the same control panel operations to be performed by a registered affiliate directly from the affiliate website . this is achieved by the insertion of software into the affiliate website to enable the above - described operations to be performed directly from the affiliate . the “ live ” control panel differs from the products generator program control panel in that the “ live ” control panel runs in a browser , i . e . internet explorer , netscape navigator , or the like , and is used to edit the live data that is currently being served along with the affiliate website , i . e ., the products database which is being used for the affiliate website . therefore , it follows that if the “ live ” products database is being edited , this will result in the changes being reflected live on the affiliate website . fig3 - 35 illustrate the features of the control panel setup wizard which sets up the live control panel . in response to selection of the control panel wizard selection button 15 in fig2 , the welcome screen shown in fig3 is displayed , which instructs the user that the control panel enables editing and viewing in real time , on the affiliate website , products that the products generator program brings back from vendor websites . in fig3 , the user is prompted to select a vendor website from the participating vendor websites . a separate control panel is set up for each of the vendor websites to enable the registered affiliate to individually edit products from a respective vendor website directly from the affiliate website . when the user has clicked on the next box in fig3 , the screen shown in fig3 is displayed . this screen prompts the user to enter information needed to link to the uploaded products database , including host , database name , username and password . fig3 prompts the user to enter the affiliate id or tracking number for the selected vendor website , and fig3 permits the user to enter a user name and password in order to access the live control panel . when the foregoing information has been entered , products generator creates a file that is saved as a php script and uploaded to the server from which the affiliate website is served . this file allows the registered affiliate to perform any of the functions described above in connection with fig1 - 14 directly from the affiliate website rather than requiring the user to load the products generator program . the products generator software system is of a type referred to as an “ ems ” system . ems is an acronym for e - commerce management system . as opposed to the known content management system ( cms ), ems is a unique stand - alone system capable of generating e - commerce . ems comes into existence when integrated into a cms system . for instance , the database used by the website www . famouslocations . com is an example of a cms , and is a system of content storage for storing for display items such as locations , actors , directors , movies , and the like . the cms provides keywords for the ems product search . the full integration of a ems system into a cms system involves the use of the ems within the cms system . for instance , from anywhere within the famous locations operations windows ( such as the movies input window ), there is a link to the products generator program for the immediate search and retrieval of products . this means that if a user inputs a new , or old , movie title into the movies list of the www . famouslocations . com website , an immediate search of the participating vendor ( s ) for commission - earning products , via the products generator program , can be activated from a link on the www . famouslocations . com window . the same technique applies to actors , directors , etc . any relevant keyword in any cms can be used for the instant activation of product searches using the ems . ems integrator , or e - commerce management system integrator , is a software program or routine built into the products generator program that will add all the necessary coding , plus banner and drop - down vendor list containing the user &# 39 ; s list of registered vendors to an existing or new cms , or content management system , ( e . g ., the www . famouslocations . com database ) to enable it to access or activate the ems or e - commerce management system ( products generator ) from anywhere inside the cms . using the www . famouslocations . com database as an example of a cms , or content management system , this means that as a user inputs a new movie title , location , actor &# 39 ; s or director &# 39 ; s name , or the like , the same user can instantly generate products for that movie title , location , actor &# 39 ; s or director &# 39 ; s name , etc ., by activating one or more links to products generator ( the ems , or e - commerce management system ) from the movie title , location , actor &# 39 ; s or director &# 39 ; s name location input page on www . famouslocations . com ( the cms ). fig3 illustrates the famous locations ( cms or content management system ) “ actor ” input page with a products generator ( the ems or e - commerce management system ) banner and link to the “ get products ” function of the products generator program . the drop - down “ get products ” box has a list of vendors , amazon . com , allposters . com , art . com and emerchandise . com . when a desired vendor is selected from the drop - down list , the live control panel for that vendor is activated with the keyword , which in this case is russell crowe , a well - known actor , carried forward into the control panel . at the same time , the keyword , russell crowe , is carried forward into a refresh window which is activated with products retrieved from the vendor for that actor ready for selection and to be placed into the control panel . the result therefore is that in 2 clicks from data input into the cms the ems is activated with products available for selection . fig3 illustrates the famous locations ( cms or content management system ) “ movie ” input page with products generator ( the ems or e - commerce management system ) banner and link to “ get products .” the drop - down “ get products ” box has a list of vendors , including amazon . com , allposters . com , art . com and emerchandise . com . when the desired vendor is selected from the drop - down list the control panel for that vendor is activated with the keyword , or name of movie , titanic , as per this example carried forward into the control panel . at the same time , the keyword , movie , titanic , is carried forward into a refresh window which is activated with products retrieved from the vendor for that movie , titanic , ready for selection and to be placed into the control panel . the result therefore is that in 2 clicks from data input into the cms the ems is activated with products available for selection . although the products generator program has been described above in connection with a preferred embodiment which enables a user to search for and retrieve commission - earning products from a vendor website , the present invention is not limited to the foregoing description . for instance , the products generator program is also capable of retrieving and displaying any products , not limited to commission - earning products , from multiple vendor websites . the products generator program can also be used , for example , by a vendor to retrieve and display its own products . also , order fulfillment and credit card processing are additional features of the products generator program . a vendor has its own products and displays its own products via the products generator program . for instance , if a customer clicks on any of the displayed products on the vendor website , the customer is clicked through to an order fulfillment page and credit card processing page similar but not limited to worldpay . accordingly , the present invention includes these features as well . for instance , the products generator program also offers a facility whereby a piece of code is generated by the program and inserted into the affiliate website via the website database wizard , but not limited to the website database wizard , whereby a product designated by a particular vendor can be inserted by the vendor into a “ special feature products database ” on the affiliate website . the special product is then displayed as a “ special ” for a specific keyword on the affiliate website . for example , if the vendor obtains a brand - new stock of titanic collectors box set dvds , the vendor has the ability to instantly promote it and establish it as a “ special ” for the keyword “ titanic ” on all of its registered affiliate &# 39 ; s affiliate websites . by this method , the vendor has the facility to promote to all of the registered affiliates the vendor &# 39 ; s latest special ( s ). if the affiliate website adopts the “ special ” product by manually inserting it into the affiliate &# 39 ; s own main products database as soon as the special appears in the main products database , it is removed from the “ special feature products database .” this method saves on product runs and assures both the vendor and its registered affiliates that the latest and greatest products for every keyword are being displayed . with respect to the below claimed subject matter and specifically with request to any alterations presented in relation to any parent , child or related application set out above , applicants make no disclaimers or disavowals of any subject matter in the present application and none should be inferred .
| 6 |
as shown in fig1 a and 1b , a wind driven electrical power generating apparatus comprises a rotor 2 , a gear assembly 4 and a generator 6 . the rotor 2 is a propeller - type rotor supported on a rotating shaft . the rotating shaft is rotatably supported in a housing 1 . the rotating shaft of this rotor 2 is connected to an input shaft of the gear assembly 4 . an output shaft of the gear assembly 4 is connected to a rotating shaft of the generator 6 . note that when viewing fig1 a from a direction vertical to the plane of the figure , although the left side shaft consisting of the rotating shaft of the rotor 2 and the input shaft of the gear assembly 4 , and the right side shaft consisting of the output shaft of the gear assembly 4 and the rotating shaft of the generator 6 are drawn as if the left side and right side shafts constitute one - piece structure or are directly connected to each other , the two shafts may be connected to each other via suitable coupling means or a power transmission mechanism . in fig1 b , numeral 8 denotes a controller . in addition , a sensor 10 for detecting parameters representing the generating power of the generator 6 is provided in the apparatus . for example , the sensor includes a speed sensor capable of detecting the rotational speed of the output shaft of the gear assembly 4 or the rotating shaft of the generator 6 , and / or a current meter , a voltage meter , a power meter and the like for detecting the generating power of the generator 6 . a signal from the sensor 10 is supplied to the controller 8 . based on this input signal , the controller 8 supplies a control signal to a gear ratio control mechanism within the gear assembly 4 to vary the gear ratio of the gear assembly 4 . [ 0044 ] fig2 illustrates a characteristic diagram indicating the generating power of the generator 6 , in which the axis of abscissa stands for wind speed ( m / s ) and the axis of ordinate stands for generating output power ( w ). the controller 8 controls the gear ratio of the gear assembly 4 such that the generator 6 operates at as low rotational speed as possible while securely outputting its maximum power . in the wind driven electrical power generating apparatus configured above , when the rotational speed of the rotor 2 varies in accordance with the change of wind speed , the controller 8 supplies a signal to a gear ratio control mechanism of the gear assembly 4 to vary the gear ratio of the gear assembly 4 and thus the generator 6 operates always within a desirable range of rotational speed limited to the rated rotational speed as an upper speed limit , whereby the output power of the generator never fluctuates largely . for example , when wind speed is low and the rotational speed of the rotor 2 is low , the speed increasing ratio of the gear assembly 4 is made high . on the contrary , when wind speed is high and the rotational speed of the rotor 2 is high , the speed increasing ratio of the gear assembly 4 is made low . in both cases , the controller 8 controls the gear ratio of the gear assembly 4 so that the generator 6 operates within a desirable range of rotational speed limited to the rated rotational speed as an upper speed limit . fig3 to 5 illustrate views of a preferred example of the gear assembly 4 . fig3 is a perspective view of a planetary roller type traction drive gear assembly . as shown in fig3 an outer ring 38 is disposed coaxially with a sun roller 36 and planetary rollers 40 are sandwiched between and frictionally engaged with the sun roller 36 and the outer ring 38 , and a planetary carrier 42 is connected to propellers ( not shown ). external teeth 44 are formed on the outer periphery of the outer ring 38 and a differential pinion 46 connected to a motor 48 is meshed with the teeth . thus , the motor 48 is driven in accordance with the output of the sensor ( not shown ) and as a result , the gear ratio can be controlled . [ 0047 ] fig4 a and 4b illustrate views of a preferred example of a continuously - variable - ratio transmission of the toroidal - race rolling - traction type . that is , the transmission is configured that by varying the tilt angle of a roller 54 frictionally engaged with an input disc 50 and an output disc 52 , the gear ratio between the input disc 50 and the output disk 52 can be varied . fig4 a is for a half - toroidal type transmission and fig4 b is for full - toroidal type transmission . [ 0048 ] fig5 illustrates a view of a preferred example of a continuously - variable - ratio transmission of cone traction drive type . an input shaft 21 and an output shaft 22 are disposed coaxially and the input shaft 21 is rotatably supported in a casing 25 via a shaft bearing 23 and a holder 24 , and the output shaft 22 is supported in the casing 25 via a shaft bearing 26 . a plurality of double cones 27 disposed in the peripheral space near the output shaft 22 within the casing 25 are rotatably mounted on support shafts 29 of a carrier 28 disposed movable along the output shaft 22 . on the end portion of the input shaft 21 is provided an annular member 30 frictionally engaged with one cone surface 27 a of the double cone 27 and on the end portion of the output shaft 22 is provided a cone 31 frictionally engaged with the other cone surface 27 b of the double cone 27 . the cone surfaces 27 a and 27 b of the double cone 27 , the annular member 30 and the cone 31 have the operational and structural relationship with each other described as follows : the annular member 30 and the cone 31 act pressing on the frictional contact surfaces of the double cone 27 ; and as a result of the pressing force , axial forces as reaction force are generated in the input shaft 21 and the output shaft 22 , respectively , such that the two axial forces pull each other . therefore , the rotational force of the input shaft 21 is transmitted to the double cone 27 via the annular member 30 and then the rotational force of the double cone 27 is taken out to the output shaft 22 via the cone 31 . in addition , by moving the double cone 27 along the axis of the output shaft 22 via a conveyor 32 sequentially moved to engagement with the carrier 28 , the rotational speed of the output shaft 22 can be changed . generally , as the rotational speed of a rotor of wind driven electrical power generating apparatus is low , the apparatus employs a speed - increasing gear taking into account of the generating efficiency of generator . one of typified traction drive type transmission apparatus having a constant gear ratio is a planetary roller type power transmission apparatus , in which wheels constituting a planetary toothed - wheel are replaced by rollers or ring - shaped members . the transmission apparatus is composed of a sun roller as a high - speed rotating shaft , an outer ring disposed coaxially with the sun roller , a plurality of planetary rollers disposed in a space formed between the sun roller and the outer ring , and a carrier as a low - speed rotating shaft to rotatably support the planetary rollers at equal intervals in a circumferential direction . the above - described planetary roller type power transmission apparatus is classified into two major apparatuses depending on the manner in which planetary rollers and a carrier are frictionally engaged with each other . that is , one is configured that a carrier is frictionally engaged with the inner circumferential surface of annular - shaped planetary rollers and the other is configured that a carrier is frictionally engaged with the outer circumferential surface of planetary rollers . in both types , the rotational force is transmitted between the sun roller and the carrier by making the outer ring not to rotate in a circumferential direction . in a pair of planetary roller type power transmission apparatuses described above , although it is theoretically possible that the gear ratio of a gear assembly represented by an equation , [( rotational speed of high - speed rotating shaft )/( rotational speed of low - speed rotating shaft )], is made equal to or greater than ten , it is usually made equal to three to six for balancing one bearing stress between the frictional surfaces of the sun roller and the planetary rollers , and the other bearing stress between the frictional surfaces of the outer ring and the planetary rollers . to make the gear ratio greater than the above - described usual value , it is proposed that two sets of planetary rollers are disposed in series in an axial direction ( japanese patent laid - open publication no . hei . 5 - 79450 ). such a conventional technique disclosed in the publication nearly needs two sets of planetary roller type gear assemblies and the entire space needed for a wind driven electrical power generating apparatus equipped with the gear assemblies becomes enlarged , leading to the occurrence of the problems of heaviness or bulky space occupation of apparatus . different from other various apparatuses , a wind driven electrical power generating apparatus needs to be installed at high place and therefore , it is required to become smaller and more compact . in order to overcome the above - described problems , the gear assemblies having configurations illustrated in fig6 to 14 can be employed in a wind driven electrical power generating apparatus . first , a gear assembly illustrated in fig6 and 7 includes a sun roller 134 and an outer ring 140 disposed coaxially with each other , and two kinds of rollers 136 and 138 disposed in the annular space formed between the sun roller 134 and the outer ring 140 . the rollers 136 and 138 are configured such that three or more pieces of same kind of rollers are disposed at equal intervals in a circumferential direction and multiple kinds of rollers are disposed in a radial direction ( multiple stages ) . moreover , at least one kind of rollers disposed along the same circumferential line ( at the single stage ) consist of a plurality of cylindrical rollers and further two orbital planes having turning radiuses different from one another are formed in the one kind of rollers , whereby a high gear ratio of gear assembly can be obtained . in this case , between the sun roller 134 and the outer ring 140 are interposed two sets of four pieces of rollers , the two sets consisting of first rollers 136 and second rollers 138 , and the first rollers 136 are made being frictionally engaged with the outer circumferential surface of the sun roller 134 and the second rollers 138 are made being frictionally engaged with the inner circumferential surface of the outer ring 140 . the first roller 136 is formed so as to have steps and two turning radiuses . the sun roller 134 , the outer ring 140 , and the first and second rollers 136 , 138 are assembled in a pressed and contact state by such means as shrinkage fitting to make a constant normal force act on each frictionally contacting portion regardless of torque to be transmitted . in addition , an output shaft 130 is rotatably supported in a casing 110 via two pieces of bearings 132 . moreover , there is provided means that prevents the first roller 136 and the second roller 138 from rotating ( revolving ) around the sun roller 134 . for example , a second roller support shaft 126 is mounted in the casing 110 and the second roller 138 is rotatably supported on the second roller support shaft 126 via a needle roller bearing 128 . as a result , the second roller 138 is made not to revolve and consequently the first roller 136 is also made not to revolve , whereby the first roller 136 and the second roller 138 only rotate on their axes . furthermore , an input shaft 120 is rotatably supported in the casing 110 via two pieces of bearings 122 and the input shaft 120 and the output shaft 130 are disposed coaxially . a carrier 124 is formed integrally with the input shaft 120 at the end portion thereof and the outer ring 140 is fixed to the peripheral portion of the carrier 124 with bolts 141 . in this manner , the input shaft 120 and the outer ring 140 are integrated coaxially with each other . note that in this case , although the input shaft 120 and the outer ring 140 are illustrated so that the two structures are respectively independent pieces and integrated with each other by using bolts 141 , the outer ring 140 and the carrier 124 may be formed to be of one - piece structure . in other words , the inner circumferential surface of the peripheral portion of the carrier 124 may be made to be frictionally engaged with the second roller 138 . the gear ratio , e 1 , of the gear assembly configured above can be represented by the equation , [( rotational speed of the output shaft 130 )/( rotational speed of the input shaft 120 )], and assume that when the rotational directions of the input shaft 120 and the output shaft 130 are different , the sign of e 1 becomes negative . under the above - stated condition , e 1 is represented by the following equation . e 1 =( r o × r 1l )/( r s × r 1s ) where : r o is the inner diameter of the outer ring 140 ; r 1l is the large outer diameter of the first roller ; r 1s is the small outer diameter of the first roller ; and next , fig8 and 9 show another embodiment of the present invention , particularly , the primary portion of a friction type multi - stage roller gear assembly . it is composed of an input shaft 120 and an output shaft 130 rotatably supported in a casing 110 via bearings 122 and 132 , respectively . the input shaft 120 is formed integrally with or coupled to a rotor 2 . a carrier 124 is formed integrally with the input shaft 120 at the end portion thereof to hold a second roller 138 . the carrier 124 is provided with a plurality of pins , four pieces of pins 126 in this case , at equal intervals in a circumferential direction . the second roller 138 is rotatably supported on each pin 126 via a needle roller bearing 128 . the output shaft 130 is formed integrally with or coupled to the rotating shaft of a generator 6 . a sun roller 134 is formed on the end portion of the output shaft 130 . an outer ring 140 is disposed coaxially with the sun roller 134 and fixed to the casing 110 with bolts 141 . first rollers 136 and second rollers 138 are disposed in the annular space formed between the sun roller 134 and the outer ring 140 . the first roller 136 is made being frictionally engaged with the outer circumferential surface of the sun roller 134 and the second roller 138 is made being frictionally engaged with the inner circumferential surface of the outer ring 140 the first and second rollers 136 and 138 , four pieces each in this case , are disposed at equal intervals in a circumferential direction . the first roller 136 is formed so as to have steps and two raceway surfaces having two different turning radiuses . the sun roller 134 , the outer ring 140 , and the first and second rollers 136 , 138 are assembled in a pressed and contact state by such means as shrinkage fitting to make a constant normal force act on each frictionally contacting portion regardless of torque to be transmitted . according to this embodiment , the second roller 138 and the first roller 136 are made to be capable of revolving by fixing the outer ring 140 to the casing 110 not to rotate and further rotatably mounting the second roller 138 on the input shaft 120 so as to be frictionally engaged with the inner circumferential surface of the outer ring 140 . note that a pair of side plates 142 is attached to both side surfaces of the outer ring 140 . as the inner diameter of the side plates 142 is shorter than that of the outer ring 140 , the side plates acts on the second roller 138 so that the second roller 138 is guided to revolve along the side plates . by making the first and second rollers 136 and 138 revolve around the sun roller 134 , the rotational force between the input shaft 120 and the output shaft 130 is transmitted to each other . in this configuration of the gear assembly of the embodiment , the gear ratio , e 2 , is represented by the following equation . e 2 = 1 −[( r o × r 1l )/( r s × r 1s )] that is , the gear ratio , e 2 is correlated with the gear ratio , e 1 , of the gear assembly shown in fig6 and 7 by the following equation regardless of the roller types and the number of rollers . it should be noted that although the embodiment corresponding to fig8 and 9 employs a friction type two - stage roller gear assembly , the embodiment is not limited thereto , but may employ a friction type three - stage roller gear assembly , or a friction type multi - stage , i . e ., greater than or equal to four - stage or more , roller gear assembly . in the embodiment shown in fig1 and 11 , a gear assembly includes a toothed - wheel transmission mechanism on the side of a rotor 2 and a traction drive on the side of a generator 6 . that is , teeth 125 is formed on the outer circumferential surface of a carrier 124 of an input shaft 120 and at the same time , teeth 127 is also formed integrally with a second roller 138 , and the teeth 125 and 127 are thereby meshed with each other . fig1 to 14 illustrate the embodiment employing the configuration that a gear assembly 4 and a generator 6 are connected integrally with each other . that is , in this embodiment , a sun roller 134 is formed on a rotating shaft 130 ′ of the generator 6 and pins 126 for supporting a second roller 138 are mounted in a generator casing 110 ′. while there has been described what are at present considered to be preferred embodiments of the invention , it will be understood that various modifications may be made thereto , and it is intended that the appended claims cover all such modifications as fall within the true spirit and scope of the invention .
| 8 |
embodiments of the present invention and the advantages thereof are best understood by referring to the following descriptions and drawings , wherein like numerals are used for like and corresponding parts of the drawings . according to the present invention and referring now to fig1 , joint prosthesis 10 is shown for use in arthroplasty . arthroplasty is a well known procedure for the treatment of osteoarthritis . for a further explanation of arthroplasty may be found in charnley , sir john . low friction arthroplasty of the hip . new york : springer , verlock , berlin , and heidelberg , 1979 incorporated herein by reference in its entirety . the joint prosthesis 10 is positioned in a long bone 12 . while the long bone 12 may be any long bone within the human anatomy , the present invention is particularly well suited for long bones which have a arcuate shape particularly adjacent the resected portion of the bone . for example , the long bone 12 may be in the form of a humerus or , as shown in fig1 , a femur . the femur 12 is resected along resection line 14 relieving the epiphysis 16 from the femur 12 . the epiphysis is shown as dashed line 11 . the prosthesis 10 is implanted in the femur 12 by positioning the prosthesis 10 in a cavity 20 formed by reaming a portion of cancellous bone 22 within medullary canal 24 of the femur 12 . the cavity 20 may be formed in the cancellous bone 22 of the medullary canal 24 by either broaching or reaming or other similar techniques to remove the cancellous bone 22 from the canal 24 . as shown in fig1 , the cavity 20 extends from metaphysis 26 into diaphysis 30 of the femur 12 . any suitable combination of drilling , reaming or broaching can be used to form a cavity which corresponds closely to the periphery of the prosthesis . typically , a broach ( not shown ) is driven into the medullary canal to form the cavity . this broach has a shape generally only slightly smaller than the portion of the implant that fits into the canal 24 so that the prosthesis is press fitted into the cavity 20 . preferably and as shown in fig1 , the prosthesis 10 includes a body or stem 32 , a portion of which is positioned within the cavity 20 of the femur 12 , and a cup 34 which is connected to natural acetabulum 36 . the stem 32 is pivotally connected to the cup 34 . the stem 32 may be in direct contact with the cup 34 or may , as shown in fig1 , include a liner or bearing 40 positioned between the cup 34 and the stem 32 . the cup 34 may be made of any suitable , durable material which is compatible with the human anatomy . for strength and durability typically the cup 34 is made of a metal such as stainless steel , a cobalt chrome alloy or titanium or may be made of a ceramic . the liner 40 may be made of any suitable , durable bearing material and is often made of polyethylene for example ultrahigh molecular weight polyethylene . while the stem 32 may be made of unitary construction typically the stem 32 includes a stem portion 42 and a head portion 44 . the two - part construction of the stem 32 provides for easier manufacture and for providing varying offsets for the prosthesis by utilizing a plurality of head portions 44 and / or a plurality of stem portions 42 . the stem portion 42 may be connected to the head portion 44 in any suitable fashion . for example , the stem portion 42 may include a male taper portion 46 which mates with a female taper portion 50 on the head portion 44 . as shown in fig1 , the stem portion 42 includes a proximal stem portion 52 , a distal stem portion 54 extending downwardly from the proximal stem portion , and a neck portion 56 extending upwardly from the proximal stem portion 52 . the proximal stem portion 52 and the distal stem portion 54 are located within the cavity 20 formed within the cancellous bone 22 of the medullary canal 24 . hip prosthesis are secured to the medullary canal of the femur typically either by a press - fit with the medullary canal or with the use of a cement mantel which is positioned between the prosthesis and the cancellous bone . in utilizing a cement mantel the cavity is broached or reamed slightly larger than the stem and a quantity of cement ( for example , pmma — polymethylmethacrylate ) is placed within the cavity and the stem inserted therein . a small uniform layer of , for example , 1 – 4 mm of cement is formed between the stem portion 42 and the femur 12 . while the present invention may have some value for use in prosthesis having stems which utilize a cement mantel , the present invention is generally directed toward a prosthesis having a stem which is press - fitted into the cancellous bone . as body load or weight is transferred through the torso from the acetabulum 36 to the femur 12 the load is transmitted along trabeculae or load lines 60 . these trabeculae or load lines 60 are positioned in a direction generally conforming to the length of the femur and are curved in a direction toward the head of the femur . in the diaphysis 30 or the more distal portion of the femur 12 , the load lines 60 are generally linear and run parallel to longitudinal axis 62 of the femur 12 . this is mainly due to the fact that the femur 12 within the diaphysis has a generally circular cross - section in a generally cylindrical shape . on the other hand , within the metaphysis 26 the trabeculae or load lines 60 have a curved or arcuate shape or path and digress continually from the longitudinal axis 62 in the proximal direction . according to wolff &# 39 ; s law , hypertrophy is defined as a thickening of the cortex with retention of normal cortical texture . according to wolff &# 39 ; s law , the hypertrophy will occur at the area of highest stress surrounding an implant . the thickening of the cortex caused by the hypertrophy is a very desirable event in the postoperative patient . for many implants within a femur the location of hypertrophy is often at the distal end of the implant . this is caused by the artificially raised stress at the point of sudden transition from the flexible distal femur to the artificially stiffened proximal femur . this is true for both press - fit and cemented stems . this phenomenon of hypertrophy thus results in excellent adhesion in the diaphysis but results in a less than desirable condition between the implant and the femur in the metaphysis . to provide for the increased loading of the femur within the metaphysis and the resulted improvements caused by hypertrophy and wolff &# 39 ; s law , according to the present invention surface features 64 are located on outer periphery 66 of the proximal stem 52 . the surface features 64 serve to increase the stress or load between the implant and the femur in the metaphysis 26 to thereby gain the benefit of wolff &# 39 ; s law and hypertrophy within that portion of the femur . preferably , as shown in fig1 , the stem 32 has a shape generally conforming to the shape of the femur 12 . thus , typically , within the diaphysis 30 , the distal stem 54 is generally circular , having a shape generally similar to the circular shape of the femur within the diaphysis 30 . similarly , within the metaphysis 26 , the proximal stem 52 has a generally oval cross - section and an arcuate orientation in the direction toward the acetabulum 32 . further the proximal stem 52 becomes larger in the direction of the acetabulum 36 . this curving , oval and enlarging toward the acetabulum configuration of the proximal stem provides a shape generally conforming to the cancellous bone within the metaphysis 26 of the femur 12 . according to the present invention and referring now to fig1 , 4 and 5 , the applicants have found that the surface features 64 should be positioned in an orientation to optimally transfer load between the stem 32 and the femur 12 . applicants have further found that the surface features 64 should be positioned in an orientation relative to the load lines or trabeculae 60 . the load lines or trabeculae 60 pass through the proximal cancellous bone 22 . the load lines 60 also pass through cortical bone or cortex 65 . the cortical bone 65 has layers or normal lamellae 71 through which the load lines pass and which are concurrent therewith . the orientation of the surface features 64 to the load lines 60 is defined by angle α . applicants have further found that the surface features 64 should be optimally positioned in an orientation generally normal to the load lines or trabeculae 60 or that the angle α is optimally around about 90 degrees . while the benefit of positioning the steps in relationship to the load lines or trabeculae are optimized when the steps are positioned generally normally or perpendicular to the load lines . it should be appreciated that the invention may be practiced where the steps 64 are positioned less than an ideal 90 degrees or normal to the load lines . for example , the steps may be positioned from about 70 degrees to about 110 degrees with respect to the trabeculae or load lines . while the steps are optimally positioned generally normally or perpendicular to the load lines 60 , it should be appreciated that every long bone in every person &# 39 ; s anatomy has a different anatomical shape . for example , referring to fig1 , the long bone may have a shape other than that of long bone 12 . the long bone may have a shape as shown in long bone 13 or as shown in long bone 15 , both shown as dashed lines . while it might be ideal to make an individual , customized prosthesis with surface features designed and manufactured optimally normal to the load lines , this is probably not economically feasible . applicants have thus found that the invention may , thus , be commercially practiced by designing the surface features 64 to be selected to be optimally positioned generally normal to the load lines or to have at the surface features designed to be aligned around 70 to 110 degrees from the load limes for a average or normal femur or long bone . the outer periphery 66 of the proximal stem 52 is typically designed to be positioned within and to be spaced from and to conform generally to the inner periphery 67 of the cortical bone 65 of an average femur or long bone . the outer periphery 66 thus , preferably , generally conforms to inner periphery 67 of the cortical bone 65 of the long bone to which it was designed . referring again to fig1 , since the load lines 60 pass through normal lamellae of the cortex 65 and are concurrent therewith , the inner periphery 67 of the cortex 65 is generally in alignment with the load lines 60 . as stated earlier , to optimized the positioning of the surface features 64 , the features 64 are positioned normal to the load lines and the inner periphery 67 of the cortex 65 . thus , for an average long bone to which a prosthesis 10 is designed , the outer periphery 66 of the proximal stem 52 conforms generally to the load lines 60 . applicants have thus found that in commercially utilizing this invention , the prostheses may be designed and manufactured with the surface features positioned with respect to the outer periphery 66 of the proximal stem 52 of the prosthesis 10 . since the load exerted on the prosthesis is large around the proximal stem 52 at the center of the inner periphery of the medial portion of the proximal stem also known as medial periphery 69 of the outer periphery 66 , the applicants have discovered that the surface features 64 may be positioned with respect to the medial periphery 69 of the outer periphery 66 the surface features 64 form an angle β with medial periphery 69 . for example , the surface features may be positioned from about 70 degrees to about 110 degrees with respect to the medial periphery 69 of the proximal stem 52 of the prosthesis 10 . the surface features 64 may optimally be positioned in an orientation generally normal to the medial periphery 69 or the angle β may optimally be around about 90 degrees . thus , as shown in fig1 , in the portion of the metaphysis 26 next to the diaphysis 30 , the surface features 64 run generally perpendicular to the load line 60 and also nearly perpendicular to the longitudinal axis 62 . conversely in the portion of the metaphysis 26 further from the diaphysis 30 , the surface features 64 run generally perpendicular to the load line 60 , but far from being perpendicular to the longitudinal axis 62 . the surface features 64 are generally in the form of grooves , ribs or ridges extending inwardly or outwardly from the surface 66 . the surface feature 64 generally has a uniform cross - section as shown fig1 a through 1c . applicants have found that by positioning the surface feature 64 in an orientation generally perpendicular to the load line 60 the supporting ability of the surface features 64 may be optimized . by optimizing the load capacity of the surface feature 64 , the stress imparted from the stem 32 to the femur 12 may maximize the stress at that position . further , because wolff &# 39 ; s law encourages hypertrophy or the thickening of the cortex in the metaphysis 26 of the femur 12 , the adherence and bone growth around the implant within the metaphysis area 26 is thereby improved . the applicants have found that a large portion of the load transferred by the stem is concentrated in that portion of the stem adjacent the more curved portion of the femur 12 . for example , referring now to fig2 a , a typical cross section of the proximal stem 52 of the prosthesis 10 is shown . it should be appreciated that the proximal stem 32 may have any suitable cross section . since the cross section of the proximal portion of the long bone 12 is typically oval or non - circular , a non - circular prosthesis cross section is preferred . the shape of fig2 a is pentagonal or five sided with a large semicircular portion on the medial side . the surfaces 70 , 72 and 74 which approximate the curved portion of the femur 12 transfer a major portion of the load between the femur 12 within the metaphysis 26 . applicants have found that if the surface features 64 are positioned generally normal or perpendicular to the load lines 60 on surfaces 70 , 72 and 74 a large majority of the benefit of providing the surface features generally normal to the load lines may be accomplished . thus the surface features 64 located on other surfaces , for example , surfaces 76 , 80 and 82 may be oriented in directions other than normal to the load lines or surface features 64 may be omitted from the surfaces 76 , 80 and 82 . referring now to fig1 a , to optimize the load carrying or stress increasing capacity of the surface features 64 , the surface features as shown in fig1 a may be in the form of steps or terraces . such steps or terraces are more fully shown in u . s . pat . no . 4 , 790 , 852 to noiles and incorporated herein by reference in its entirety . the terraces 64 have an inner edge 84 and an outer edge 86 . a ledge 90 is formed between outer edge 86 and inner edge 84 . the ledge is positioned distally and serves to provide optimum support or stress for the stem 32 . the terraces 64 has a vertical spacing - v - between terraces of approximately 0 . 50 to 3 . 0 mm and a depth - d - of approximately 0 . 2 mm to 1 . 5 mm . it should be appreciated that while the terraces 64 as shown in fig1 a are preferred , the invention may be practiced with other types of surface features . for example , as shown in fig1 b , the surface features may be in the form of ribs 164 which provide an angled support surface 190 . alternatively referring to fig1 c , the surface features may be in the form of grooves 164 ′ which extend inwardly from the surface . to further promote bone growth between the stem and the femur and referring again to fig1 a , the surface 66 of the surface features 64 may be coated by a coating 92 . the coating 92 may be any coating which promotes bone growth and / or interconnections between the prosthesis and the femur . for example the coating 92 may be a bio - ceramic . such suitable bio - ceramics include hydroxyapatite or tricalcium phosphates . alternatively , the coating 92 may be a porous coating . alternatively , the coating may be a porous coating and a bioceramic coating in combination . various porous coatings have found to be very effective . one particularly effective coating is sold by the assignee of the instant application under the tradename porocoat . the porocoat coating is more fully described in u . s . pat . no . 3 , 855 , 638 to pilliar and hereby incorporated herein by reference in its entirety . this porous coating consists of a plurality of small discreet particles of metallic material bonded together at their points of contact with each other to define a plurality of connected interstitial pores in the coating . the particles are of the same metallic material as the metallic material from which the substrate is formed . examples of suitable material include austenitic stainless steel , titanium , titanium alloys and cobalt alloys . the stem 32 may be made of any suitable durable material and , for example , may be made of a titanium , a cobalt chrome molybdenum alloy or stainless steel . the applicants have found that titanium ti - 6al - 4v is well suited for this application . it should be appreciated that while , as shown in fig1 , the proximal stem 52 has a taper design , the aligning of surface features with respect to the load lines of the present invention may be practiced with the taper design or with a non - taper design . further it should be appreciated that while , as shown in fig1 , the prosthesis 10 is shown with a coating 92 , the invention may be practiced without the porous coating 92 . the terraces 64 are aligned in a direction generally normal to the medial curve or load line 64 on the anterior face 70 , the medial arcuate surface 74 and the posterior surface 72 . the terraces 64 become horizontal as they approach the lateral aspect of the implant , ( surfaces 76 , 80 and 82 ) ( see fig2 a ) to align roughly normal to the lateral face of the implant . referring now to fig2 , the stem 32 is shown in an anterior / posterior view . the stem 32 is shown with the distal stem 54 not including the surface features or terraces 64 . the proximal stem 52 however includes the terraces 64 on posterior lateral surface 76 and on anterior lateral surface 80 . as shown in fig2 , the proximal stem 52 does not have terraces 64 in the lateral surface 82 . as shown in fig2 the terraces 64 on the posterior lateral surface 76 and the anterior lateral surface 80 are generally perpendicular to longitudinal axis 62 . it should be appreciated that the terraces 64 on surfaces 76 and 80 may be positioned normal to the load lines 60 . however , since most of the benefit of the positioning of the surface features 64 normal to the load line 60 is accomplished on surfaces 70 and 72 , for simplicity of design and manufacture , the terraces 64 , as shown in fig2 , may be positioned normal to the longitudinal axis 62 . further , for simplicity and ease of manufacture , the lateral surface 82 , as shown in fig2 , may be made without terraces 64 . referring now to fig3 the stem 32 is shown in a posterior / anterior position . the medial surface 74 is shown with terraces 64 on surface 66 in the proximal stem 52 . the terraces 64 are positioned normal to load lines 60 . as shown in fig3 the distal stem 54 may include a polished tip 94 extending a distance of , for example , one - half to one inch from the distal end of the stem 32 . the distal stem 54 may , for example , be grit blasted in the remaining portion 96 of the distal stem 54 . referring now to fig6 , an alternate embodiment of the present invention is shown as prosthesis 210 . prosthesis 210 is similar to prosthesis 10 of fig1 except that , whereas prosthesis 10 of fig1 includes a separate stem and head which are connectable together , the prosthesis 210 includes a head portion 244 which is integral with stem portion 242 . prosthesis 210 includes stem 232 which is pivotally connected to cup 234 and includes a bearing or liner 240 placed therebetween . as with prosthesis 10 , prosthesis 210 includes steps 264 similar to steps 64 of prosthesis 10 which steps 264 are positioned generally normal or perpendicular to load lines or trabeculae 260 . as in the prosthesis 210 the steps 264 are positioned on the proximal stem 252 of the stem 232 . the steps 264 are preferably similar to the steps 64 of the prosthesis 10 of fig1 . referring now to fig7 an alternate embodiment of the present invention is shown as shoulder prosthesis 310 . the shoulder prosthesis 310 includes a stem 332 which is implanted into a humerus ( not shown ). the prosthesis 310 also includes a head portion 344 attached to the stem 322 . the head portion 344 may be secured to the stem 322 in any suitable manor and may alternatively be integral therewith . the head portion may have a external taper 346 extending therefrom which mates with an internal taper 350 in the stem 332 . such a configuration is shown in u . s . pat . no . 5 , 314 , 479 to rockwood et al . incorporated by reference herein in its entirety . the stem portion 342 of the stem 332 includes a proximal stem 352 and a distal stem 354 . for the same reasons expressed with regard to the prosthesis 10 of fig1 , the prosthesis 310 includes steps 364 similar to the steps 64 of the fig1 prosthesis . the steps 364 are aligned generally perpendicular or normal to the trabeculae or load lines 360 . for the same reasons expressed with regard to the fig1 prosthesis 10 , the steps 364 are preferably positioned on the proximal stem 352 . referring now to fig7 a , a alternate securing arrangement is shown for connecting the head portion to the stem . in this arrangement the stem 332 ′ may have a external taper 346 ′ extending therefrom which mates with an internal taper 350 ′ in the head portion 344 ′. such a configuration is shown in u . s . pat . no . 6 , 120 , 542 to camino et al . incorporated by reference herein in its entirety . another embodiment of the present invention is shown in fig8 through 10 as stem portion 432 . stem portion 432 is similar to stem portion 32 of the fig1 prosthesis except that the proximal stem 452 of the stem portion 432 includes steps 464 similar to the step 64 of the prosthesis 10 which steps 464 are positioned completely around the periphery of the proximal stem 452 . referring now to fig8 , the stem portion 432 includes the distal stem 454 , the proximal stem 452 and neck portion 456 . the steps 464 are positioned completely around the periphery of the proximal stem 452 . in fact the steps 464 are positioned on the anterior face 472 , the anterior lateral face 480 and the posterior face 470 . referring now to fig9 the steps 464 are positioned on the posterior lateral face 476 , on the lateral face 482 and on the anterior lateral face 480 . referring now to fig1 the steps 464 are also positioned on the medial face 474 of the proximal stem 452 . referring now to fig1 , 12 and 13 a further embodiment of the present invention is shown as a stem portion 532 . stem portion 532 is similar to stem portion 32 of the fig1 prosthesis except that steps 564 , which are similar to steps 64 of the fig1 prosthesis , are positioned only on the anterior , posterior and medial faces . referring now to fig1 , the stem portion 532 includes a distal stem 554 , a proximal stem 552 and a neck portion 556 . the steps 562 , similar to the steps 64 of the fig1 prosthesis 10 , are positioned only on the proximal stem of 552 . the applicants have found since the loading on the stem portion 532 is primarily on the anterior , posterior and medial faces , the invention may be practiced with steps 562 positioned only on these faces . in fact , the invention may be practiced with the steps on perhaps less than these three faces . as shown in fig1 the steps 562 are located on the medial face 574 , the posterior face 570 and the anterior face 572 . the anterior lateral face 580 , as shown in fig1 , does not include the steps 564 . referring now to fig1 , no steps 562 are positioned on the posterior lateral face 576 , on the lateral face 582 and on the anterior lateral face 580 . referring now to fig1 the medial face 574 of the proximal stem of 552 includes these steps 564 . by providing a prosthesis which has a stem with steps which are aligned in a direction generally normal to the load lines or trabeculae of the prosthesis load carrying capacity of the proximal femur may be optimized . by optimizing the loading of the proximal femur , a manifestation of wolff &# 39 ; s law can occur which causes the raised stresses at the greatest loading to create a thickening of the cortex and improvement of the bone growth and adherence of the prosthesis to the proximal femur . by providing a prosthesis having surface features in the form of steps which are positioned generally normal to the load lines of the prosthesis , the prosthesis may benefit from a long term stability and fixation by providing an environment optimum for femoral bone remodeling . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions , and alterations can be made therein without departing from the spirit and scope of the present invention as defined by the appended claims .
| 0 |
fig1 can be a left side elevational view of a motorcycle - type two - wheeled vehicle having an engine in accordance with an embodiment . the embodiments disclosed herein are described in the context of a motorcycle - type two - wheel vehicle because these embodiments have particular utility in this context . however , the embodiments and inventions herein can also be applied to other vehicles , such as scooters , all train vehicles and other vehicles with more than two wheels which have limited space for accommodating a propulsion system . it can be to be noted that , as used herein , the terms “ front ,” “ rear ,” “ left ,” “ right ,” “ up ” and “ down ,” correspond to the direction assumed by a driver of the vehicle 1 . fig1 can be a side view of a motorcycle 1 according to an embodiment . fig2 can be a side view of the engine of the motorcycle 1 . fig3 through 10 are explanatory views illustrating a structure of a camshaft drive mechanism . a motorcycle 1 of this embodiment can be described as follows with reference to fig1 through 10 . the arrow f in the drawings indicates the forward direction in which the motorcycle 1 moves . the motorcycle 1 of this embodiment can have a head pipe 2 and a main frame 3 connecting its front end to the head pipe 2 . the main frame 3 can be formed to extend rearwardly . a front wheel 5 can be rotatably attached to the head pipe 2 via a front fork 4 . handlebars 6 can be fixed to a top end of the head pipe 2 . a rear wheel 8 can be rotatably attached to the rear of a rear arm 7 . a fuel tank 9 can be installed above the main frame 3 . at the rear of the fuel tank 9 , a driver &# 39 ; s seat 10 can be provided . to the head pipe 3 can be attached a down pipe 11 extending downwardly . a water - cooled v - type , 4 - cylinder engine 20 can be mounted between the down pipe 11 and the lower end of the main frame 3 . a radiator 12 for cooling a coolant to circulate within the v - type , 4 - cylinder engine 20 can be installed in front of the down pipe 11 . as shown in fig2 , the v - type , 4 - cylinder engine 20 according to this embodiment can be provided with a crankcase 21 for accommodating a crankshaft 22 , which can be made up of an upper crankcase 21 a and a lower crankcase 21 b . four main cylinder bodies ( not shown ) can be integrally formed with each other on the upper crankcase 21 a of the crankcase 21 . a cylinder head 23 tilts forwardly and thus forms a front bank 51 . another cylinder head 24 tilts rearwardly and thus forms a rear bank 52 . the cylinder heads 23 , 24 can be mounted to the topside of the main cylinder body . the front bank 51 can be an example of a “ first bank ” and the rear bank 52 can be an example of a “ second bank ”. however , as used herein , the identification of any component as “ first ” or “ second ” are merely arbitrary labels used solely for purposes of convenience . similarly , the cylinder head 23 can be an example of a “ first cylinder head ” and the cylinder head 24 can be an example of a “ second cylinder head ”. top covers 40 a and 40 b can be attached to the topside of the cylinder heads 23 and 24 , respectively . the crankshaft 22 can have two sprockets 22 a and 22 b as shown in fig3 . however , other sprockets can also be used . fig2 shows that a balance weight 41 , a crankshaft 22 , a primary shaft 42 and a secondary shaft 43 can be placed , in order from front to back , along a mating face between the upper crankcase 21 a and the lower crankcase 21 b . the balance weight 41 rotates at the same speed as the crankshaft 22 but in a direction reverse . the main function of the balance weight 41 is to absorb the primary vibrations of the crankshaft 22 . the primary shaft 42 and the secondary shaft 43 can be respectively provided with one or pa plurality of speed change gears ( not shown ). the primary shaft 42 , the secondary shaft 43 and the groups of speed change gears constitute a transmission 44 . a housing portion for housing the transmission 44 can be integrally formed with the crankcase 21 , on a rearward side of the main cylinder body ( not shown ) which is also on the side of the rear bank 52 on the crankcase 21 . in other words , the rear bank 52 can be positioned toward the housing portion for housing the transmission 44 while the front bank 51 can be positioned on the opposite side to the housing portion for housing the transmission 44 . as shown in fig3 , an intake camshaft 25 having a sprocket 25 a and a gear 25 b , and an exhaust camshaft 26 having a gear 26 a engaged with the gear 25 b of the intake camshaft 25 can be rotatably attached to the cylinder head 23 forming the front bank 51 . a cam chain 29 can be wound around between the sprocket 22 a of the crankshaft 22 and the sprocket 25 a of the intake camshaft 25 at the cylinder head 23 forming the front bank 51 . the cam chain 29 on the side of the front bank 51 can be located in chain chambers 23 a and 21 c which can be located at the axial midsection of the intake camshaft 25 and the exhaust camshaft 26 . as shown in fig3 , a straight chain guide member 31 can be provided on the side where the cam chain 29 for the front bank 51 is tightened , and in turn an arcuate chain guide member 32 can be provided on the side where the cam chain 29 for the front bank 51 is loosened . the side where the cam chain 29 is tightened refers to the side where the cam chain 29 is tightened by the rotation of the crankshaft 22 . the side where the cam chain 29 is loosened refers to the side where the cam chain 29 is loosened by the rotation of the crankshaft 22 . the arcuate chain guide member 32 can have a hole portion 32 a performing as a rotational pivot , a pressed portion 32 b , a vibration - absorbing portion 32 c located toward the cylinder head 23 above the pressed portion 32 b for absorbing the vibration of the cam chain 29 , and a guide portion 32 d for guiding the cam chain 29 . the hole portion 32 a of the chain guide member 32 for the front bank 51 can be rotatably supported by a support shaft 37 a of a support member 37 as shown in fig3 and 10 . a cam chain tensioner 33 for pressing the loosened - side chain guide member 32 for the front bank 51 against the cam chain 29 can be disposed between the front bank 51 and the rear bank 52 . with reference to fig3 , an intake camshaft 27 having a sprocket 27 a and a gear 27 b , and an exhaust camshaft 28 having a gear 28 a engaged with the gear 27 b of the intake camshaft 27 can be rotatably attached to the cylinder head 24 forming the rear bank 52 . the intake camshaft 27 can be example of a “ first camshaft ” and the gear 27 b can be an example of a “ first gear ”. the exhaust camshaft 28 can be an example of a “ second camshaft ” and the gear 28 a can be an example of a “ second gear ”. a cam chain 30 can be wound around between the sprocket 22 b of the crankshaft 22 and the sprocket 27 a of the intake camshaft 27 on the cylinder head 24 forming the rear bank 52 . the cam chain 30 on the side of the rear bank 52 can be located in the chain chambers 24 a and 21 d ( see fig3 ) which can be located at the axial ( b direction in fig4 ) midsection of the intake camshaft 27 and the exhaust camshaft 28 . in short , the embodiment of the present invention employs a center cam chain system . in this embodiment , a straight chain guide member 34 can be provided on the side where the cam chain 30 for the rear bank 52 is tightened ( during operation ), and in turn an arcuate chain guide member 35 can be provided on the side where the cam chain 30 is loosened ( during operation ). as shown in fig8 and 9 , the arcuate chain guide member 35 can have a hole portion 35 a performing as a rotational pivot , a pressed portion 35 b , a vibration - absorbing portion 35 c located toward the cylinder head 24 above the pressed portion 35 b for absorbing the vibration of the cam chain 30 , and a guide portion 35 d for guiding the cam chain 30 . the hole portion 35 a of the chain guide member 35 on the side of the rear bank 52 can be supported by a support shaft 37 b of a support member 37 as shown in fig3 and 10 . a cam chain tensioner 36 for pressing the loosened - side chain guide member 35 for the rear bank 52 can also be disposed therein . the cam chain tensioner 36 can be an example of a “ tension applying member ”. the cam chain tensioner 36 on the side of the rear bank 52 can be provided below the exhaust camshaft 28 as shown in fig2 and 3 . to be more specific , in this embodiment , the cam chain 30 can be wound not around the exhaust camshaft 28 but around the intake camshaft 27 , which results in no cam chain 30 being located below the exhaust camshaft 28 . this allows the cam chain tensioner 36 to be located below the exhaust camshaft 28 on the side of the rear bank 52 , thereby preventing the cam chain tensioner 36 from protruding outward of the exhaust camshaft 28 . engagement of the gear 27 b of the intake camshaft 27 with the gear 28 a of the exhaust camshaft 28 enables the rotation of the intake camshaft 27 to be transmitted to the exhaust camshaft 28 . this can reduce a distance between the intake camshaft 27 and the exhaust camshaft 28 , compared to the case where the cam chain 30 is wound around between the intake camshaft 27 and the exhaust camshaft 28 to transmit the rotation from the intake camshaft 27 to the exhaust camshaft 28 . this makes it possible to make a shape of a combustion chamber ( not shown ) undersurface of the cylinder head 24 flatter , resulting in improved combustion efficiency . in the illustrated embodiment , the cam chain tensioner 36 on the side of the rear bank 52 can be located across the mating face 24 b of the cylinder head 24 and the upper crankcase 21 a , as shown in fig2 and 3 . more specifically , as shown in fig3 , the cam chain tensioner 36 on the side of the rear bank 52 can have a mounting portion 36 a located inside the cylinder head 24 , and a pressing portion 36 b located so as to protrude toward the upper crankcase 21 a for pressing the pressed portion 35 b of the chain guide member 35 . the mounting portion 36 a of the cam chain tensioner 36 can be provided with mounting holes 36 c and 36 d through which mounting screws 60 can be inserted , and an oil supply port 36 e , as shown in fig7 . the mounting holes 36 c and 36 d and the oil supply port 36 e can be designed to extend substantially in the vertical direction with respect to the mating face 24 b ( see fig6 ) of the cylinder head 24 and the upper crankcase 21 a . the mounting holes 36 c and 36 d , designed to extend substantially in the vertical direction ( as shown by the arrow c in fig6 ) with respect to the mating face 24 b , allow the screws 60 to be inserted and secured from above the cylinder head 24 in the c direction of fig6 . this facilitates mounting of the mounting portion 36 a of the cam chain tensioner 36 to the cylinder head 24 . the oil supply port 36 e can be designed to connect to an oil passage 36 f shown in fig6 through another oil passage ( not shown ). the top end of the oil passage 36 f can be sealed by a ball - shaped plug 36 g . fig6 also shows that the pressed portion 36 b of the cam tensioner 36 can be provided with a protrusion 36 i , which can be inserted into an opening 36 h and can move in a direction shown by the arrow d by given pitch . a compression coil spring 36 j can be provided for urging the protrusion 36 i in the direction shown by the arrow d , although other types of springs can also be used . in addition , a spring 36 k for moving the protrusion 36 i in the direction shown by the arrow d by a given pitch can be located such that the spring 36 k abuts on the outer periphery of the protrusion 36 i . inside of the protrusion 36 i , a passage member 361 forming the oil passage can be attached . also , inside of the protrusion 36 i , a check ball 36 m which functions as a check valve for sealing the oil passage made of the passage member 361 , and a compression coil spring 36 n for urging the check ball 36 m in the direction in which the oil passage made of the passage member 361 can be sealed . the protrusion 36 i can have a pin 36 o attached to its side surface . a lock 36 p , which can rotate between the engaging position with respect to the pin 36 o and the disengaging position , can also be provided . the lock 36 p is configured to engage with the pin 36 o under the initial condition ( at the time when it has just been assembled ). the protrusion 36 i can be thus prevented from moving in the d direction of fig6 . this dispenses with the need for a worker to completely push in and hold the tip end of the protrusion 36 i so it does not protrude , when the worker assembles the pressing portion 36 b of the cam chain tensioner 36 so as to press the pressed portion 35 b of the chain guide member 35 . this allows the worker to easily assemble the cam chain tensioner 36 . when the cam chain tensioner 36 has been assembled , the lock 36 p can be rotated in the e direction of fig6 due to the vibration created by driving the cam chain 30 . this allows the lock 36 p to be disengaged from the pin 36 o . disengagement of the lock 36 p from the pin 36 o allows the protrusion 36 i to move by given pitch in the direction shown by the arrow d , depending on how much slack there can be in the cam chain 30 with time . therefore , the extent to which the protrusion 36 i protrudes can be automatically adjusted depending on how much slack there can be in the cam chain 30 , thereby preventing the cam chain 30 from being loosened for a long period of time . a passage member 36 q that forms the oil passage to be connected to the oil passage 36 f can be fitted into the opening 36 h . the check ball 36 s , which functions as a check valve for sealing the oil passage made of the passage member 36 q , can be placed inside of the opening 36 h . also , inside of the opening 36 h , a spring retainer 36 r can be disposed to retain the compression coil spring 36 j and press the check ball 36 s using an urging force produced by the compression coil spring 36 j such that the oil passage made of the passage member 36 q can be sealed . now , operations of the intake camshaft 25 and exhaust camshaft 26 for the front bank 51 as well as those of the intake camshaft 27 and exhaust camshaft 28 for the rear bank 52 are described with reference to fig3 . first , the reciprocating motion of the piston ( not shown ) results in a counterclockwise rotation of the crankshaft 22 , which is transmitted to the intake camshaft 25 for the front bank 51 via the cam chain 29 on the side of the front bank 51 . the rotation of the intake camshaft 25 for the front bank 51 is transmitted to the exhaust camshaft 26 for the front bank 51 through the engagement of the gear 25 b of the intake camshaft 25 with the gear 26 a of the exhaust camshaft 26 . thus , the intake camshaft 25 and exhaust camshaft 26 on the side of the front bank 51 can be driven with the rotation of the crankshaft 22 . the counterclockwise rotation ( see fig3 ) of the crankshaft 22 can be also transmitted to the intake camshaft 27 for the rear bank 52 through the cam chain 30 on the side of the rear bank 52 . the rotation of the intake camshaft 27 is transmitted to the exhaust camshaft 28 for the rear bank 52 through the engagement of the gear 27 b of the intake camshaft 27 with the gear 28 a of the exhaust camshaft 28 . thus , the intake camshaft 27 and exhaust camshaft 28 on the side of the rear bank 52 are also driven with the rotation of the crankshaft 22 . as described above , in this embodiment , the cam chain tensioner 36 on the side of the rear bank 52 for tensioning the cam chain 30 through the chain guide member 35 can be mounted across the mating face between the cylinder head 24 and the upper crankcase 21 a . also , the pressing portion 36 b of the cam chain tensioner 36 can be located on the side of the upper crankcase 21 a , which allows the point where the cam chain tensioner 36 presses against the chain guide member 35 to be located downward of or apart from the upper end of the chain guide member 35 . this can provide a longer length of the vibration - absorbing portion 35 c formed between the point where the chain guide member 35 can be pressed and the upper end thereof , so that the vibration - absorbing portion 35 c tends to easily bend . this results in sufficient absorption of the vibration of the cam chain 30 . further , in this embodiment , the mounting portion 36 a of the cam chain tensioner 36 can be mounted inside of the cylinder head 24 , as described above . thus , a possible slight oil leakage from the cam chain tensioner 36 does not cause undesirable results because lubricant oil or other oils have already adhered to the inside of the cylinder head 24 . therefore , a sealing member such as o - ring can be unnecessary , even if a hydraulic cam chain tensioner 36 is employed . the above embodiment shows an example of the present inventions to the center cam chain system in which the cam chain can be located in the chain chamber which can be located at the axial midsection of the intake and exhaust camshaft . however , the inventions are not limited to that , but they may also be applied to a side cam chain system in which the cam chain is located in the chain chamber which is located at the axial end of the intake and exhaust camshaft . in the above description of the embodiment , an example can be shown in which the tension applying means can be applied to the cam chain tensioner on the side of the rear bank . however , the present inventions are be not limited to that , and may also be applied to the cam chain tensioner on the side of the front bank . furthermore , in the above description of the embodiment , an example is shown in which the inventions are applied to a v - type , 4 - cylinder engine for motorcycles . however , the present inventions are not limited to such , and can also be applied to v - type , 4 - cylinder engines to be mounted to vehicles other than motorcycles , such as three - wheelers and atvs ( all terrain vehicles ). still furthermore , the inventions can also be applied to v - type cylinder engines other than v - type , 4 - cylinder engines , or other types of engines . further , although these inventions have been disclosed in the context of certain preferred embodiments and examples , it will be understood by those skilled in the art that the present inventions extend beyond the specifically disclosed embodiments to other alternative embodiments and / or uses of the inventions and obvious modifications and equivalents thereof . in addition , while several variations of the inventions have been shown and described in detail , other modifications , which are within the scope of these inventions , will be readily apparent to those of skill in the art based upon this disclosure . it can be also contemplated that various combination or sub - combinations of the specific features and aspects of the embodiments may be made and still fall within the scope of the inventions . it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the disclosed inventions . thus , it can be intended that the scope of at least some of the present inventions herein disclosed should not be limited by the particular disclosed embodiments described above .
| 5 |
in an embodiment a personal vaporizer unit comprises a mouthpiece configured for contact with the mouth of a person . at least part of this mouthpiece has an antimicrobial surface . this mouthpiece may also comprise silicone rubber , thermoplastic elastomer , organosilane , silver impregnated polymer , silver impregnated thermoplastic elastomer , and / or polymer . the mouthpiece may be removed from the personal vaporizing for washing or replacement , without using a tool . the mouthpiece may be provided in different colors . designs or other patterns may be visible on the outside of the mouthpiece . in an embodiment , a personal vaporizer unit comprises a first conductive surface configured to contact a first body part of a person holding the personal vaporizer unit , and a second conductive surface , conductively isolated from the first conductive surface , configured to contact a second body part of the person . when the personal vaporizer unit detects a change in conductivity between the first conductive surface and the second conductive surface , a vaporizer is activated to vaporize a substance so that the vapors may be inhaled by the person holding unit . the first body part and the second body part may be a lip or parts of a hand ( s ). the two conductive surfaces may also be used to charge a battery contained in the personal vaporizer unit . the two conductive surfaces may also form , or be part of , a connector that may be used to output data stored in a memory . in an embodiment , a personal vaporizer unit comprises a chamber configured to receive a cartridge . the cartridge may hold a substance to be vaporized . the chamber may be configured at the distal end of the personal vaporizer unit . a user may inhale the vaporized substance at the proximal end of the personal vaporizer unit . at least one space between the exterior surface of the cartridge , and an interior surface of the chamber , may define a passage for air to be drawn from outside the personal vaporizer unit , near the distal end , through the personal vaporizer unit to be inhaled by the user along with the vaporized substance . the personal vaporizer unit may also include a puncturing element that breaks a seal on the cartridge to allow a substance in the cartridge to be vaporized . an end surface of the cartridge may be translucent to diffuse light produced internally to the personal vaporizer unit . the translucent end may be etched or embossed with letters , symbols , or other indicia that are illuminated by the light produced internally to the personal vaporizer unit . in an embodiment , a personal vaporizer unit comprises a first wick element and a second wick element having a porous ceramic . the first wick element is adapted to directly contact a liquid held in a reservoir . the reservoir may be contained by a cartridge that is removable from the personal vaporizer unit . a heating element is disposed through the second wick element . an air gap is defined between the first wick element and the second wick element with the heating element exposed to the air gap . air enters the first wick element through a hole in a housing holding the first wick element . in an embodiment , a personal vaporizer unit comprises a light source internal to an opaque cylindrical housing that approximates the appearance of a smoking article . a cylindrical light tube is disposed inside the opaque cylindrical housing to conduct light emitted by the light source to an end of the opaque cylindrical housing . this allows the light to be visible outside of the opaque cylindrical housing of the vaporizer . in an embodiment , a personal vaporizer unit comprises a microprocessor , memory , and a connector . the connector outputs data stored in the memory . the microprocessor may gather , and store in the memory , information including , but not limited to , the number of cycles the device has been triggered , the duration of the cycles , the number cartridges of fluid that are delivered . the microprocessor may also gather and store times and dates associated with the other information gathered and stored . the microprocessor may detect an empty cartridge by detecting a specific change in resistance between a wick and a housing that is equivalent to a “ dry wick ”, and thus signifies an empty cartridge . in an embodiment , a case comprises a cradle adapted to hold a personal vaporizer unit . the personal vaporizer unit has dimensions approximating a smoking article . the case includes a battery and at least two contacts . the two contacts may form an electrical contact with the personal vaporizer unit when the personal vaporizer unit is in the cradle . the two contacts may conduct charge from the battery to the personal vaporizer unit to charge the personal vaporizer unit . the case may also download and store data retrieved from the personnel vaporizing unit . the case may download and store this data via the at least two contacts . the case may send this data to a computer via wired or wireless links . the case may have more than one cradle and sets of contacts ( e . g ., two sets of two contacts in order to hold and charge two personal vaporizer units ). fig1 is a perspective view of a personal vaporizer unit . in fig1 , personal vaporizer unit 100 comprises outer main shell 102 , mouthpiece cover 114 , mouthpiece 116 , and mouthpiece insulator 112 . the mouthpiece 116 and mouthpiece cover 114 define the proximal end of personal vaporizer unit 100 . the opposite end of personal vaporizer unit 100 will be referred to as the distal end . a cartridge 150 may be inserted into the distal end of personal vaporizer unit 100 . cartridge 150 may hold the substance to be vaporized by personal vaporizer unit 100 . the substance after vaporizing may be inhaled by a user holding the personal vaporizer unit 100 . the substance may be in the form of a liquid or gel . fig2 is a side view of a personal vaporizer unit . fig2 illustrates personal vaporizer unit 100 as viewed from the side . fig2 illustrates personal vaporizer unit 100 comprising outer main shell 102 , mouthpiece cover 114 , mouthpiece 116 , and mouthpiece insulator 112 . fig2 also illustrates cartridge 150 inserted into the distal end of personal vaporizer unit 100 . fig3 is an end view of the proximal end of a personal vaporizer unit . fig3 shows the proximal end view of personal vaporizer unit 100 comprising mouthpiece cover 114 . fig4 is an end view of the distal end of a personal vaporizer unit . fig4 shows the distal end view personal vaporizer unit 100 comprising the visible portion of cartridge 150 . fig4 a is an alternative end view of personal vaporizer unit 100 comprising a visible portion of cartridge 150 that has visible logos , letters , or other symbols . these visible logos , letters , or other symbols may be illuminated or backlit by a light source internal to the personal vaporizer unit 100 . the light source may be activated intermittently under the control of a microprocessor or other electronics internal to personal vaporizer unit 100 . the light source may be activated in such a manner as to simulate the glowing ash of a cigar or cigarette . fig5 is a figure map of fig6 and 7 . fig6 is a cross - section of the proximal portion of a personal vaporizer unit along the cut line shown in fig2 . in fig6 , the proximal portion of personal vaporizer unit 100 comprises mouthpiece cover 114 , mouthpiece 116 , mouthpiece insulator 112 , outer main shell 102 , battery support 106 , and battery 104 . the mouthpiece cover 114 surrounds and is engaged with the distal end of mouthpiece 116 . mouthpiece 116 and outer main shell 102 are preferably made of an electrically conductive material ( s ). mouthpiece 116 is separated from outer main shell 102 by mouthpiece insulator 112 . mouthpiece 116 and outer main shell 102 are thus electrically isolated from each other by mouthpiece insulator 112 . in an embodiment , personal vaporizer unit 100 is configured such that other main shell 102 comprises a first conductive surface configured to contact a first body part of a person holding personal vaporizer unit 100 . mouthpiece 116 comprises a second conductive surface , which is conductively isolated from the first conductive surface . this second conductive surface is configured to contact a second body part of the person . when personal vaporizer unit 100 detects a change in conductivity between the first conductive surface and the second conductive surface , a vaporizer internal to personal vaporizer unit 100 is activated to vaporize a substance in cartridge 150 so that the vapors may be inhaled by the person holding personal vaporizer unit 100 . the first body part and the second body part may be a lip or parts of a hand ( s ). the two conductive surfaces of outer main shell 102 and mouthpiece 116 , respectively , may also be used to charge battery 104 contained in the personal vaporizer unit 100 . the two conductive surfaces of outer main shell 102 and mouthpiece 116 , respectively , may also be used to output ( or input ) data stored ( or to be stored ) in a memory ( not shown ). battery support 106 functions to hold battery 104 in a position which is fixed relative to our main shell 102 . battery support 106 is also configured to allow air and vaporized substance to pass from the distal end of personal vaporizer unit 100 past battery 104 along one or more passageways . after air and the vapors of the vaporized substance pass by battery 104 , they may pass through openings in mouthpiece 116 , mouthpiece cover 114 , and mouthpiece insulator 112 , to be inhaled by a user . fig7 is a cross - section of the distal portion of a personal vaporizer unit along the cut line shown in fig2 . in fig7 , the distal end portion of personal vaporizer unit 100 comprises outer main shell 102 , light pipe sleeve 140 , and atomizer housing 132 , distal wick 134 , proximal wick 136 , pc board 123 , pc board 124 , spacer 128 , and main housing 160 . fig7 also illustrates cartridge 150 inserted into the distal end of personal vaporizer unit 100 . as can be seen in fig7 , cartridge 150 may hold a substance ( e . g ., a liquid or gel ) in direct contact with distal wick 134 . the substance may be drawn through distal wick 134 to be vaporized inside atomizer assembly . the atomizer assembly comprises atomizer housing 132 , distal wick 134 , proximal wick 136 , and a heating element ( not shown ). fig8 is an exploded side view of components of a personal vaporizer unit . fig9 is an exploded cross - section of components of a personal vaporizer unit along the cut line shown in fig2 . in fig8 and 9 , personal vaporizer unit 100 comprises ( from left to right ) mouthpiece cover 114 , mouthpiece 116 , mouthpiece insulator 112 , battery 104 , battery support 106 , pc board 123 , spacer 128 , pc board 124 , main housing 160 , proximal wick 136 , distal wick 134 , atomizer housing 132 , light pipe sleeve 140 , and cartridge 150 . mouthpiece cover 114 surrounds and covers the proximal end of mouthpiece 116 . the distal end of mouthpiece 116 is inserted into mouthpiece insulator 112 . battery 104 is held in place by battery support 106 . pc board 123 , spacer 128 and pc board 124 are disposed within main housing 160 . proximal wick 136 and distal wick 134 are disposed within atomizer housing 132 . atomizer housing 132 ( and therefore proximal wick 136 , distal wick 134 ) are disposed inside light pipe sleeve 140 and main shell 102 . ( note : for clarity , main shell 102 is not shown in fig8 and 9 .) light pipe sleeve 140 is disposed within main shell 102 . light pipe sleeve 140 is positioned such that light emitted from a light source mounted on pc board 124 may be conducted via light pipe sleeve 140 to a location where it is visible on the outside of personal vaporizer unit 100 . cartridge 150 is disposed within light pipe sleeve 140 . when assembled , a substance contained within cartridge 150 is held in direct contact with distal wick 134 . when cartridge 150 is inserted into personal vaporizer unit 100 atomizer housing 132 or distal wick 134 may puncture a seal or cap that contains the substance to be vaporized within cartridge 150 . once punctured , the substance held within a reservoir of cartridge 150 may come in direct contact with distal wick 134 . fig1 is a perspective view of a mouthpiece cover of a personal vaporizer unit . fig1 is a distal end view of the mouthpiece cover of fig1 . fig1 is a cross - section of the mouthpiece cover along the cut line shown in fig1 . as can be seen in fig1 - 12 , mouthpiece cover 114 has an opening 114 - 1 that allows air and the vaporized substance to be drawn through mouthpiece cover 114 . mouthpiece cover 114 is configured for contact with the mouth of a person . in an embodiment , at least part of the mouthpiece cover has an antimicrobial surface . this antimicrobial surface of mouthpiece cover 114 may comprise , but is not limited to : silicone rubber , thermoplastic elastomer , organosilane , silver impregnated polymer , silver impregnated thermoplastic elastomer , and / or polymer . mouthpiece cover 114 is also configured to be removable from personal vaporizer unit 100 by a user without the use of tools . this allows mouthpiece cover 114 to be replaced and / or washed . in an embodiment , mouthpiece cover 114 may be held in place on personal vaporizer unit 100 by annular ridge 114 - 2 which interfaces with a groove on mouthpiece 116 of personal vaporizer unit 100 to secure mouthpiece cover 114 in place . in another embodiment , mouthpiece cover 114 may be held in place on personal vaporizer unit 100 by a friction fit . fig1 is a perspective view of a mouthpiece of a personal vaporizer unit . fig1 is a side view of the mouthpiece of fig1 . fig1 is a cross - section of the mouthpiece along the cut line shown in fig1 . as can be seen in fig1 - 15 , mouthpiece 116 has a passageway 116 - 1 that allows air and the vaporized substance to be drawn through mouthpiece 116 . mouthpiece 116 may comprise a conductive surface or material configured to contact a first body part of a person holding personal vaporizer unit 100 . this first body part may be part of a hand , or at least one lip of the person holding personal vaporizer unit 100 . in an embodiment , mouthpiece 116 has an annular groove 116 - 2 around an outside surface . this groove is configured to receive annular ridge 114 - 2 . thus , annular groove 116 - 2 helps secure mouthpiece cover 114 to personal vaporizer unit 100 . fig1 is a perspective view of a mouthpiece insulator of a personal vaporizer unit . fig1 is a distal end view of the mouthpiece insulator of fig1 . fig1 is a side view of the mouthpiece insulator of fig1 . fig1 is a cross - section of the mouthpiece insulator along the cut line shown in fig1 . as discussed previously , mouthpiece insulator 112 is disposed between main shell 102 and mouthpiece 116 . as can be seen in fig1 - 18 , mouthpiece insulator 112 has a passageway 112 - 1 that allows air and the vaporized substance to be drawn through mouthpiece insulator 112 . because mouthpiece insulator 112 is disposed between main shell 102 and mouthpiece 116 , mouthpiece insulator 112 can electrically isolate main shell 102 and mouthpiece 116 . thus , in an embodiment , mouthpiece insulator 112 comprises , or is made of , a non - electrically conductive material . this electrical isolation between main shell 102 and mouthpiece 116 allow electrical impedance changes between main shell 102 and mouthpiece 116 to be detected . for example , a first conductive surface on mouthpiece 116 may be configured to contact a first body part of a person holding personal vaporizer unit 100 . a second conductive surface on main shell 102 ( which is conductively isolated from said first conductive surface by mouthpiece insulator 112 ) may be configured to contact a second body part of the person . personal vaporizer unit 100 may then activate in response to detecting a change in conductivity between the first conductive surface and the second conductive surface . in an embodiment , this change in conductivity may comprise a drop in impedance between the first conductive surface and the second conductive surface . in an embodiment , the change in conductivity may comprise a change in capacitance between the first conductive surface and the second conductive surface . the first body part may be a finger . the second body part may be a lip . the second body part may be a second finger . in an embodiment , the first conductive surface and the second conductive surfaces may be used to pass a charging current to battery 104 . the first and second conductive surfaces may also be used to transfer data to or from personal vaporizer unit 100 . fig2 is a perspective view of a main housing of a personal vaporizer unit . fig2 is a distal end view of the main housing of fig2 . fig2 is a proximal end view of the main housing of fig2 . fig2 is a side view of the main housing of fig2 . fig2 is a cross - section of the main housing along the cut line shown in fig2 . main housing 160 is configured to hold pc - boards 123 and 124 , and spacer 128 . main housing 160 is configured to fit within main shell 102 via a friction fit . main housing 160 has several holes 166 that allow light generated by a light source ( s ) on pc - board 124 to pass . once this light passes through holes 166 , it may be coupled into light pipe sleeve 140 where it is conducted to a visible location on the outside of personal vaporizer unit 100 . main housing 160 also has a hole 165 that allows an electrical conductor ( not shown ) to run from pc - board 123 or pc - board 124 through main housing 160 . this electrical conductor may be , or connect to , a heating element ( not shown ). this heating element may help vaporize the substance to be inhaled by the user of personal vaporizer unit 100 . this heating element may be controlled by circuitry on pc - board 123 or pc - board 124 . this heating element may be activated in response to a change in conductivity between the first conductive surface and the second conductive surface , described previously . the exterior of main housing 160 may also have a flat surface 164 ( or other geometry ) forming a galley that is configured to allow the vaporized substance and air to pass between the main housing 160 and the main shell 102 . once the vaporized substance and air pass by main housing 160 , they may travel through passageway 112 - 1 , passageway 116 - 1 , and opening 114 - 1 to be inhaled by a user of personal vaporizer unit 100 . the exterior of main housing 160 may also have one or more standoffs 167 ( or other geometries ) that are configured to allow air and the vaporized substance to reach the passageway formed by flat surface 164 and main shell 102 . fig2 is a perspective view of a main housing of a personal vaporizer unit . fig2 is a second perspective view of the main housing of fig2 . fig2 is a distal end view of the main housing of fig2 . fig2 is a proximal end view of the main housing of fig2 . fig2 is a side view of the main housing of fig2 . fig3 is a cross - section of the main housing along the cut line shown in fig2 . main housing 260 may be used as an alternative embodiment to main housing 160 . main housing 260 is configured to hold pc - boards 123 and 124 , and spacer 128 . main housing 260 is configured to fit within main shell 102 via a friction fit . main housing 260 has several holes 266 that allow light generated by a light source ( s ) on pc - board 124 to pass . once this light passes through holes 266 , it may be coupled into light pipe sleeve 140 where it is conducted to a visible location on the outside of personal vaporizer unit 100 . main housing 260 also has a hole 265 that allows an electrical conductor ( not shown ) to run from pc - board 123 or pc - board 124 through main housing 260 . this electrical conductor may be , or connect to , a heating element ( not shown ). this heating element may help vaporize the substance to be inhaled by the user of personal vaporizer unit 100 . this heating element may be controlled by circuitry on pc - board 123 or pc - board 124 . this heating element may be activated in response to a change in conductivity between the first conductive surface and the second conductive surface , described previously . the exterior of main housing 260 may also have flat surfaces 264 ( or other geometry ) that form a galley that is configured to allow the vaporized substance and air to pass between the main housing 260 and the main shell 102 . once the vaporized substance and air pass by main housing 260 , they may travel through passageway 112 - 1 , passageway 116 - 1 , and opening 114 - 1 to be inhaled by a user of personal vaporizer unit 100 . the exterior of main housing 260 may also have one or more standoffs 267 ( or other geometries ) that are configured to allow air and the vaporized substance to reach the passageway formed by flat surfaces 264 and main shell 102 . fig3 is a perspective view of a printed circuit board assembly of a personal vaporizer unit . fig3 is a distal end view of the pcb assembly of fig3 . fig3 is a perspective exploded view of the pcb assembly of fig3 . fig3 is a side exploded view of the pcb assembly of fig3 . as can be seen in fig3 - 34 , the pcb assembly is comprised of pc - board 123 and pc - board 124 separated by a spacer 128 . pc - board 124 may have mounted upon it light emitting diodes ( leds ) 125 - 127 or other light sources . leds 125 - 127 are configured and positioned such that when they produce light , that light passes through holes 166 or 266 in main housings 160 and 260 , respectively . this light may then be conducted by light pipe sleeve 140 to a location where it will be visible exterior to personal vaporizer unit 100 . pc - board 123 may have mounted on it a microprocessor , memory , or other circuitry ( not shown ) to activate or otherwise control personal vaporizer unit 100 . this microprocessor may store data about the operation of personal vaporizer unit 100 in the memory . for example , the microprocessor may determine and store the number of cycles personal vaporizer unit 100 has been triggered . the microprocessor may also store a time and / or date associated with one or more of these cycles . the microprocessor may cause this data to be output via a connector . the connector may be comprised of the first and second conductive surfaces of mouthpiece 116 and / or main shell 102 . in an embodiment , the microprocessor may determine a duration associated with various cycles where personal vaporizer unit 100 has been triggered . these durations ( or a number based on these duration , such as an average ) may be stored in the memory . the microprocessor may cause these numbers to be output via the connector . the microprocessor may determine an empty cartridge condition and stores a number associated with a number of times said empty cartridge condition occurs . the microprocessor , or other circuitry , may determine an empty cartridge condition determined based on a resistance between atomizer housing 132 or 232 and a wick 134 , 234 , 136 , or 236 . the microprocessor may also store a time and / or date associated with one or more of these empty cartridge conditions . the number of times an empty cartridge condition is detected , and or times and / or dates associated with these empty cartridge conditions may be output via the connector . battery 104 , pc - board 123 , pc - board 124 , and all electronics internal to personal vaporizer unit 100 may be sealed in a plastic or plastic and epoxy compartment within the device . this compartment may include main housing 160 or 260 . all penetrations in this compartment may be sealed . thus , only wires will protrude from the compartment . the compartment may be filled with epoxy after the assembly of battery 104 , pc - board 123 , pc - board 124 , and leds 125 - 127 . the compartment may be ultrasonically welded closed after assembly of battery 104 , pc - board 123 , pc - board 124 , and leds 125 - 127 . this sealed compartment is configured such that all vapor within personal vaporizer unit 100 does not come in contact with the electronics on pc - boards 123 or 124 . fig3 is a perspective view of a proximal wick element of a personal vaporizer unit . fig3 a is a perspective view of a heating element disposed through a proximal wick element of a personal vaporizer unit . fig3 b is a perspective view of a heating element of a personal vaporizer unit . fig3 is a distal end view of the wick element of fig3 . fig3 is a cross - section of the wick element along the cut line shown in fig3 . proximal wick 136 is configured to fit within atomizer housing 132 . as can be seen in fig3 - 37 , proximal wick 136 includes internal wire passageway 136 - 1 and external wire passageway 136 - 2 . these wire passageways allows a conductor or a heating element 139 to be positioned through proximal wick 136 ( via internal wire passageway 136 - 1 ). this conductor or heating element 139 may also be positioned in external wire passageway 136 - 2 . thus , as shown in fig3 a , a conductor or heating element 139 may be wrapped around a portion of proximal wick 136 by running the conductor or heating element 139 through internal wire passageway 136 - 1 , around the distal end of proximal wick 136 , and through external wire passageway 136 - 2 to return to approximately its point of origin . the heating element 139 may , when personal vaporizer 100 is activated , heat proximal wick 136 in order to facilitate vaporization of a substance . fig3 is a perspective view of a distal wick element of a personal vaporizer unit . fig3 is a distal end view of the wick element of fig3 . fig4 is a cross - section of the wick element along the cut line shown in fig3 . distal wick 134 is configured to fit within atomizer housing 132 . as can be seen in fig3 - 40 , distal wick 134 comprises two cylinders of different diameters . a chamfered surface transitions from the smaller diameter of the distal end of distal wick 134 to a larger diameter at the proximal end of distal wick 134 . the cylinder at the distal end terminates with a flat surface end 134 - 1 . this flat surface end 134 - 1 is the end of distal wick 134 is a surface that is placed in direct contact with a substance to be vaporized when cartridge 150 is inserted into the distal end of personal vaporizer 100 . the proximal end of distal wick 134 is typically in contact with proximal wick 136 . however , at least a part of proximal wick 136 and distal wick 134 are separated by an air gap . when distal wick 134 and proximal wick 136 are used together , this air gap is formed between distal wick 134 and proximal wick 136 by stand offs 136 - 3 as shown in fig3 . fig4 is a perspective view of a distal wick element of a personal vaporizer unit . fig4 is a distal end view of the wick element of fig4 . fig4 is a cross - section of the wick element along the cut line shown in fig4 . proximal wick 234 may be used as an alternative embodiment to distal wick 134 . proximal wick 234 is configured to fit within atomizer housing 232 . as can be seen in fig4 - 43 , proximal wick 234 comprises two cylinders of different diameters , and a cone or pointed end 234 - 1 . a chamfered surface transitions from the smaller diameter of the distal end of proximal wick 234 to a larger diameter at the proximal end of proximal wick 234 . the cylinder at the distal end terminates with a pointed end 234 - 1 . this pointed end 234 - 1 is the end of proximal wick 234 that is in direct contact with a substance to be vaporized . this pointed end 234 - 1 may also break a seal on cartridge 150 to allow the substance to be vaporized to come in direct contact with proximal wick 234 . the proximal end of proximal wick 234 is typically in contact with proximal wick 136 . however , at least a part of proximal wick 136 and proximal wick 234 are separated by an air gap . when distal wick 134 and proximal wick 236 are used together , this air gap is formed between proximal wick 234 and proximal wick 136 by stand offs 136 - 3 as shown in fig3 . fig4 is a perspective view of an atomizer housing of a personal vaporizer unit . fig4 is a distal end view of the atomizer housing of fig4 . fig4 is a side view of the atomizer housing of fig4 . fig4 is a top view of the atomizer housing of fig4 . fig4 is a cross - section of the atomizer housing along the cut line shown in fig4 . atomizer housing 132 is configured to fit within main shell 102 . as can be seen in fig4 - 48 , atomizer housing 132 comprises roughly two cylinders of different diameters . a chamfered surface 132 - 3 transitions from the smaller diameter of the distal end of atomizer housing 132 to a larger diameter at the proximal end of atomizer housing 132 . the larger diameter at the proximal end of atomizer housing 132 is configured to be press fit into light pipe sleeve 140 . the cylinder at the distal end terminates with a spade shaped tip 132 - 2 . this spade shaped tip 132 - 2 may break a seal on cartridge 150 to allow the substance to be vaporized to come in direct contact with distal wick 134 . other shaped tips are possible ( e . g ., needle or spear shaped ). chamfered surface 132 - 3 has one or more holes 132 - 1 . these holes allow air to pass , via suction , through atomizer housing 132 into distal wick 134 . this suction may be supplied by the user of personal vaporizer 100 sucking or inhaling on mouthpiece cover 114 and / or mouthpiece 116 . the air that is sucked into distal wick 134 enters distal wick 134 on or near the chamfered surface between the two cylinders of distal wick 134 . the air that is sucked into distal wick 134 displaces some of the substance being vaporized that has been absorbed by distal wick 134 causing it to be atomized as it exits distal wick 134 into the air gap formed between distal wick 134 and proximal wick 136 . the heating element disposed around proximal wick 136 may then vaporize at least some of the atomized substance . in an embodiment , one or more holes 132 - 1 may range in diameter between 0 . 02 and 0 . 0625 inches . in an embodiment , placing holes 132 - 1 at the leading edge of the chamfered surface places a set volume of the substance to be vaporized in the path of incoming air . this incoming air has nowhere to go but through the large diameter ( or “ head ”) end of the distal end wick 134 . when the air enters this area in distal end wick 134 it displaces the substance to be vaporized that is suspended in distal end wick 134 towards an air cavity between distal end wick 134 and proximal end wick 136 . when the displaced substance to be vaporized reaches the surface of distal end wick 134 , it is forced out of the wick by the incoming air and the negative pressure of the cavity . this produces an atomized cloud of the substance to be vaporized . in an embodiment , the diameter of the head of distal end wick 134 may be varied and be smaller than the diameter of the proximal end wick 136 . this allows for a tuned volume of air to bypass proximal end wick 136 and directly enter the cavity between distal wick 134 and distal wick 136 without first passing through distal wick 136 . fig4 is a perspective view of an atomizer housing of a personal vaporizer unit . fig5 is a distal end view of the atomizer housing of fig4 . fig5 is a side view of the atomizer housing of fig4 . fig5 is a top view of the atomizer housing of fig4 . fig5 is a cross - section of the atomizer housing along the cut line shown in fig5 . atomizer housing 232 is an alternative embodiment , for use with proximal wick 234 , to atomizer house 132 . atomizer housing 232 is configured to fit within main shell 102 and light pipe sleeve 140 . as can be seen in fig4 - 53 , atomizer housing 232 comprises roughly two cylinders of different diameters . a chamfered surface 232 - 3 transitions from the smaller diameter of the distal end of atomizer housing 232 to a larger diameter at the proximal end of atomizer housing 232 . the larger diameter at the proximal end of atomizer housing 232 is configured to be press fit into light pipe sleeve 140 . the cylinder at the distal end terminates with an open cylinder tip 232 - 2 . this open cylinder tip 232 - 2 allows the pointed end 234 - 1 of proximal wick 234 to break a seal on cartridge 150 to allow the substance to be vaporized to come in direct contact with proximal wick 234 . chamfered surface 232 - 3 has one or more holes 232 - 1 . these holes allow air to pass , via suction , through atomizer housing 232 into proximal wick 234 . the air that is sucked into proximal wick 234 enters proximal wick 234 on or near the chamfered surface between the two cylinders of proximal wick 234 . the air that is sucked into proximal wick 234 displaces some of the substance being vaporized that has been absorbed by proximal wick 234 causing it to be atomized as it exits proximal wick 234 into the air gap formed between proximal wick 234 and proximal wick 136 . the heating element disposed around proximal wick 136 may then vaporize at least some of the atomized substance being vaporized . in an embodiment , one or more holes 232 - 1 may range in diameter between 0 . 02 and 0 . 0625 inches . in an embodiment , placing holes 232 - 1 at the leading edge of the chamfered surface places a set volume of the substance to be vaporized in the path of incoming air . this incoming air has nowhere to go but through the head of the distal end wick 234 . when the air enters this area in distal end wick 234 it displaces the substance to be vaporized that is suspended in distal end wick 234 towards an air cavity between distal end wick 234 and proximal end wick 236 . when the displaced substance to be vaporized reaches the surface of distal end wick 232 , it is forced out of the wick by the incoming air and the negative pressure of the cavity . this produces an atomized cloud of the substance to be vaporized . in an embodiment , the diameter of the head of distal end wick 234 may be varied and be smaller than the diameter of the proximal end wick 236 . this allows for a tuned volume of air to bypass distal wick 236 and directly enter the cavity between proximal wick 234 and distal wick 236 without first passing through distal wick 236 . fig5 is a perspective view of an atomizer housing and wicks of a personal vaporizer unit . fig5 is an exploded view of the atomizer housing , wire guides , and wicks of fig5 . fig5 is a side view of the atomizer housing and wicks of fig5 . fig5 is a distal end view of the atomizer housing and wicks of fig5 . fig5 is a cross - section of the atomizer housing and wicks along the cut line shown in fig5 . the atomizer housing and wicks shown in fig5 - 58 is an alternative embodiment for use with proximal wick 236 . the embodiment shown in fig5 - 58 use atomizer housing 232 , proximal wick 234 , proximal wick 236 , wire guide 237 , and wire guide 238 . proximal wick 236 is configured to fit within atomizer housing 232 . as can be seen in fig5 - 58 , proximal wick 236 includes internal wire passageway 236 - 1 . this wire passageway 236 - 1 allows a conductor or a heating element ( not shown ) to be positioned through proximal wick 236 ( via internal wire passageway 236 - 1 ). the conductor or heating element may be positioned around wire guide 237 and wire guide 238 . thus , a conductor or heating element may run the through wire passageway 236 - 1 , around wire guides 237 and 238 , and then back through wire passageway 236 - 1 to return to approximately its point of origin . the heating element may , when personal vaporizer unit 100 is activated , heat proximal wick 236 in order to facilitate vaporization of a substance . fig5 is a perspective view of the proximal end wick assembly of fig5 - 58 . fig5 a is a perspective view showing a heating element disposed through the proximal end wick and around the wire guides of fig5 - 58 . fig5 b is a perspective view of the heating element of a personal vaporizer unit . fig6 is a distal end view of the wick element and wire guides of fig5 - 58 . fig6 is a cross - section of the wick element and wire guides along the cut line shown in fig6 . as can be seen in fig5 a , a conductor or heating element 239 may run through wire passageway 236 - 1 , around wire guides 237 and 238 , and then back through wire passageway 236 - 1 to return to approximately its point of origin . in an embodiment , distal wicks 134 , 234 , and proximal wicks 136 , 236 , may be made of , or comprise , for example a porous ceramic . distal wicks 134 , 234 , and proximal wicks 136 , 236 , may be made of , or comprise aluminum oxide , silicon carbide , magnesia partial stabilized zirconia , yttria tetragonal zirconia polycrystal , porous metal ( e . g ., steel , aluminum , platinum , titanium , and the like ), ceramic coated porous metal , woven metal , spun metal , metal wool ( e . g ., steel wool ), porous polymer , porous coated polymer , porous silica ( i . e ., glass ), and / or porous pyrex . distal wicks 134 , 234 , and proximal wicks 136 , 236 , may be made of or comprise other materials that can absorb a substance to be vaporized . the conductor or heating element that is disposed through proximal wick 136 or 236 may be made of , or comprise , for example : nickel chromium , iron chromium aluminum , stainless steel , gold , platinum , tungsten molybdenum , or a piezoelectric material . the conductor or heating element that is disposed through proximal wick 136 can be made of , or comprise , other materials that become heated when an electrical current is passed through them . fig6 is a perspective view of a light pipe sleeve of a personal vaporizer unit . fig6 is an end view of the light pipe sleeve of fig6 . fig6 is a cross - section of the light pipe sleeve along the cut line shown in fig6 . light pipe sleeve 140 is configured to be disposed within main shell 102 . light pipe sleeve 140 is also configured to hold cartridge 150 and atomizer housing 132 or 232 . as discussed previously , light pipe sleeve 140 is configured to conduct light entering the proximal end of light pipe sleeve 140 ( e . g ., from leds 125 - 127 ) to the distal end of light pipe sleeve 140 . typically , the light exiting the distal end of light pipe sleeve 140 will be visible from the exterior of personal vaporizer 100 . the light exiting the distal end of light pipe sleeve 140 may be diffused by cartridge 150 . the light exiting the distal end of light pipe sleeve 140 may illuminate characters and / or symbols drawn , printed , written , or embossed , etc ., in an end of cartridge 150 . in an embodiment , light exiting light pipe sleeve 140 may illuminate a logo , characters and / or symbols cut through outer main shell 102 . in an embodiment , light pipe sleeve 140 is made of , or comprises , a translucent acrylic plastic . fig6 is a perspective view of a cartridge of a personal vaporizer unit . fig6 is a proximal end view of the cartridge of fig6 . fig6 is a side view of the cartridge of fig6 . fig6 is a top view of the cartridge of fig6 . fig6 is a cross - section of the cartridge along the cut line shown in fig6 . as shown in fig6 - 69 , cartridge 150 comprises a hollow cylinder section with at least one exterior flat surface 158 . the flat surface 158 forms , when cartridge 150 is inserted into the distal end of personal vaporizer unit 100 , an open space between the exterior surface of the cartridge and an interior surface of light pipe sleeve 140 . this space defines a passage for air to be drawn from outside personal vaporizer unit 100 , through personal vaporizer unit 100 to be inhaled by the user along with the vaporized substance . this space also helps define the volume of air drawn into personal vaporizer unit 100 . by defining the volume of air typically drawn into the unit , different mixtures of vaporized substance to air may be produced . the hollow portion of cartridge 150 is configured as a reservoir to hold the substance to be vaporized by personal vaporizer unit 100 . the hollow portion of cartridge 150 holds the substance to be vaporized in direct contact with distal wick 134 or 234 . this allows distal wick 134 or 234 to become saturated with the substance to be vaporized . the area of distal wick 134 or 234 that is in direct contact with the substance to be vaporized may be varied in order to deliver different doses of the substance to be vaporized . for example , cartridges 150 with differing diameter hollow portions may be used to deliver different doses of the substance to be vaporized to the user . cartridge 150 may be configured to confine the substance to be vaporized by a cap or seal ( not shown ) on the proximal end . this cap or seal may be punctured by the end of atomizer housing 132 , or the pointed end 234 - 1 of proximal wick 234 . when inserted into personal vaporizer unit 100 , cartridge standoffs 157 define an air passage between the end of light pipe sleeve 140 and main shell 102 . this air passage allows air to reach the air passage defined by flat surface 158 . the hollow portion of cartridge 150 also includes one or more channels 154 . the end of these channels are exposed to air received via the air passage ( s ) defined by flat surface 158 . these channels allow air to enter the hollow portion of cartridge 150 as the substance contained in cartridge 150 is drawn into a distal wick 134 or 234 . allowing air to enter the hollow portion of cartridge 150 as the substance contained in cartridge 150 is removed prevents a vacuum from forming inside cartridge 150 . this vacuum could prevent the substance contained in cartridge 150 from being absorbed into distal wick 134 or 234 . in an embodiment , cartridge 150 may be at least partly translucent . thus cartridge 150 may act as a light diffuser so that light emitted by one or more of leds 125 - 127 is visible external to personal vaporizer unit 100 . fig7 is a side view of a battery of a personal vaporizer unit . fig7 is an end view of the battery of fig7 . fig7 is a perspective view of a battery support of a personal vaporizer unit . as can be seen in fig7 , battery support 106 does not form a complete cylinder that completely surrounds battery 104 . this missing portion of a cylinder forms a passageway that allows air and the vaporized substance to pass by the battery from the atomizer assembly to the mouthpiece 116 so that it may be inhaled by the user . fig7 is a top perspective view of a personal vaporizer unit case . fig7 is a bottom perspective view of a personal vaporizer unit case . personal vaporizer case 500 is configured to hold one or more personal vaporizer units 100 . personal vaporizer case 500 includes a connector 510 to interface to a computer . this connector allows case 500 to transfer data from personal vaporizer unit 100 to a computer via connecter 510 . case 500 may also transfer data from personal vaporizer unit 100 via a wireless interface . this wireless interface may comprise an infrared ( ir ) transmitter , a bluetooth interface , an 802 . 11 specified interface , and / or communicate with a cellular telephone network . data from a personal vaporizer unit 100 may be associated with an identification number stored by personal vaporizer unit 100 . data from personal vaporizer unit 100 may be transmitted via the wireless interface in association with the identification number . personal vaporizer case 500 includes a battery that may hold charge that is used to recharge a personal vaporizer unit 100 . recharging of personal vaporizer unit 100 may be managed by a charge controller that is part of case 500 . when case 500 is holding a personal vaporizer unit 100 , at least a portion of the personal vaporizer unit 100 is visible from the outside of case 500 to allow a light emitted by personal vaporizer unit 100 to provide a visual indication of a state of personal vaporizer unit 500 . this visual indication is visible outside of case 500 . personal vaporizer unit 100 is activated by a change in impedance between two conductive surfaces . in an embodiment , these two conductive surfaces are part of main shell 102 and mouthpiece 116 . these two conductive surfaces may also be used by case 500 to charge battery 104 . these two conductive surfaces may also be used by case 500 to read data out of personal vaporizer unit 100 . in an embodiment , when a user puts personal vaporizer unit 100 in his / her mouth and provides “ suction ,” air is drawn into personal vaporizer unit 100 though a gap between the end of main shell 102 and cartridge 150 . in an embodiment , this gap is established by standoffs 157 . air travels down galley ( s ) formed by flat surface ( s ) 158 and the inner surface of light pipe sleeve 140 . the air then reaches a “ ring ” shaped galley between atomizer housing 132 , cartridge 150 , and light pipe sleeve 140 . air travels to distal wick 134 via one or more holes 132 - 1 , in chamfered surface ( s ) 132 - 3 . air travels to distal wick 234 via one or more holes 232 - 1 , in chamfered surface ( s ) 232 - 3 . air is also allowed to enter cartridge 150 via one or more channels 154 . this air entering cartridge 150 via channels 154 “ back fills ” for the substance being vaporized which enters distal wick 134 . the substance being vaporized is held in direct contact with distal wick 134 or 234 by cartridge 150 . the substance being vaporized is absorbed by and may saturate distal wick 134 or 234 and proximal wick 136 or 236 . the incoming air drawn through holes 132 - 1 displaces from saturated distal wick 134 the substance being vaporized . the displaced substance being vaporized is pulled from wick elements 134 into a cavity between distal wick 134 and 136 . this cavity may also contain a heating element that has been heated to between 150 - 200 ° c . the displaced substance being vaporized is pulled from wick elements 134 in small ( e . g ., atomized ) droplets . these atomized droplets are vaporized by the heating element . in an embodiment , when a user puts personal vaporizer unit 100 in his / her mouth and provides “ suction ,” air is drawn into personal vaporizer unit 100 though a gap between the end of main shell 102 and cartridge 150 . in an embodiment , this gap is established by standoffs 157 . air travels down galley ( s ) formed by flat surface ( s ) 158 and the inner surface of light pipe sleeve 140 . the air then reaches a “ ring ” shaped galley between atomizer housing 232 , cartridge 150 , and light pipe sleeve 140 . air travels to proximal wick 234 via one or more holes 232 - 1 , in chamfered surface ( s ) 232 - 1 . air is also allowed to enter cartridge 150 via one or more channels 154 . this air entering cartridge 150 via channels 154 “ back fills ” for the substance being vaporized which enters proximal wick 234 . the substance being vaporized is held in direct contact with proximal wick 234 by cartridge 150 . the substance being vaporized is absorbed by and may saturate distal wick 243 and proximal wick 236 . the incoming air drawn through holes 232 - 1 displaces from saturated proximal wick 234 the substance being vaporized . the displaced substance being vaporized is pulled from wick elements 234 into a cavity between wick distal wick 234 and proximal wick 236 . this cavity may also contain a heating element that has been heated to between 150 - 200 ° c . the displaced substance being vaporized is pulled from distal wick 234 in small ( e . g ., atomized ) droplets . these atomized droplets are vaporized by the heating element . in both of the previous two embodiments , the vaporized substance and air are drawn down a galley adjacent to battery 104 , through mouthpiece insulator 112 , mouthpiece 116 , and mouthpiece cover 114 . after exiting personal vaporizer unit 100 , the vapors may be inhaled by a user . the systems , controller , and functions described above may be implemented with or executed by one or more computer systems . the methods described above may be stored on a computer readable medium . personal vaporizer unit 100 and case 500 may be , comprise , or include computers systems . fig7 illustrates a block diagram of a computer system . computer system 600 includes communication interface 620 , processing system 630 , storage system 640 , and user interface 660 . processing system 630 is operatively coupled to storage system 640 . storage system 640 stores software 650 and data 670 . processing system 630 is operatively coupled to communication interface 620 and user interface 660 . computer system 600 may comprise a programmed general - purpose computer . computer system 600 may include a microprocessor . computer system 600 may comprise programmable or special purpose circuitry . computer system 600 may be distributed among multiple devices , processors , storage , and / or interfaces that together comprise elements 620 - 670 . communication interface 620 may comprise a network interface , modem , port , bus , link , transceiver , or other communication device . communication interface 620 may be distributed among multiple communication devices . processing system 630 may comprise a microprocessor , microcontroller , logic circuit , or other processing device . processing system 630 may be distributed among multiple processing devices . user interface 660 may comprise a keyboard , mouse , voice recognition interface , microphone and speakers , graphical display , touch screen , or other type of user interface device . user interface 660 may be distributed among multiple interface devices . storage system 640 may comprise a disk , tape , integrated circuit , ram , rom , network storage , server , or other memory function . storage system 640 may be a computer readable medium . storage system 640 may be distributed among multiple memory devices . processing system 630 retrieves and executes software 650 from storage system 640 . processing system may retrieve and store data 670 . processing system may also retrieve and store data via communication interface 620 . processing system 650 may create or modify software 650 or data 670 to achieve a tangible result . processing system may control communication interface 620 or user interface 670 to achieve a tangible result . processing system may retrieve and execute remotely stored software via communication interface 620 . software 650 and remotely stored software may comprise an operating system , utilities , drivers , networking software , and other software typically executed by a computer system . software 650 may comprise an application program , applet , firmware , or other form of machine - readable processing instructions typically executed by a computer system . when executed by processing system 630 , software 650 or remotely stored software may direct computer system 600 to operate as described herein . the above description and associated figures teach the best mode of the invention . the following claims specify the scope of the invention . note that some aspects of the best mode may not fall within the scope of the invention as specified by the claims . those skilled in the art will appreciate that the features described above can be combined in various ways to form multiple variations of the invention . as a result , the invention is not limited to the specific embodiments described above , but only by the following claims and their equivalents .
| 1 |
the following explanation discloses a preferred mode of practicing the invention but other implementations are possible given the teachings of the invention . u . s . patent application ser . no . 09 / 792 , 557 for storing frame modification information in memory , described in more detail in the cross reference section of this application , is incorporated herein by reference . this invention is relates particularly to the frame alteration logic 212 as shown in fig2 thereof . as frames arrive from the network , they are stored in a memory . an area is reserved in memory immediately preceding the frame &# 39 ; s data for storage of one or more frame alteration control blocks . during frame processing , software executed by a processor writes the frame alteration commands into the frame alteration control blocks . the frame is then queued for transmission onto the network by placing it in a port queue . hardware apparatus then services the port queue by reading the frame alteration control blocks , applying the requested alterations to the frame data and transmitting the modified frame onto the network . fig1 shows a 128 - bit ( quadword ) frame alteration control block . in fig1 , a one - bit bottom - of - stack field 11 specifies the frame is the bottom of stack if set to 1 . the first frame alteration control blocks in a list of multiple frame alteration control blocks will have the first bit set to 0 . the bottom - of - stack bit is then set to 1 in the frame alteration control block immediately preceding the first quadword of the packet data . a three - bit field 12 indicates the type of frame access control block . more than one type can be defined , each containing frame alteration commands that are specific to a particular scenario . some frame access control block types may be optimized for ethernet frame alteration and others , for packet - over - sonet frame alteration . the system uses the frame alteration control block type field 12 to determine how to parse information in the frame alteration commands field 17 . a four - bit displacement field 15 is used only in the bottom - of - stack frame alteration control block to define the offset to the first valid packet data byte in the first quadword of the packet data . this field is required as the starting byte position to skip over unused bytes in the first quadword of the packet data . bits 8 through 127 of the quadwords in the frame alteration control block stack contain the frame alteration commands 17 . these are the commands to be applied to a packet as it is transmitted . the frame alteration commands are specific to the frame alteration control block type . fig2 shows an example of an frame alteration control block stack with two quadwords of a data packet . the bottom - of - stack field 201 of the first frame alteration control block is set to 0 as are those of the following two quadwords . the bottom - of - stack field 202 of the fourth quadword is set to 1 since it is at the bottom of the stack . the displacement field 203 of the fourth quadword points to the beginning of the packet data in the following quadword or buffer . the flowchart of fig3 illustrates an example of a frame alteration procedure where the changes are to insert , to overlay , or to delete data within the frame . a terminal block 301 starts the procedure . a process block 302 fetches the frame alteration control block from a memory device storing the frame to be altered and parses it into the frame alteration control block portion and the data portion . the frame alteration control block commands are stored in hardware registers by a process block 303 . in a process block 305 , the input data pointer is set to the value of the disp field of the frame to skip the unused bytes in order to locate the beginning of the data in the input frame and the pointer to the output data bytes is set to zero . the first input byte is read from the input frame by an input / output block 315 . a decision block 306 determines whether the current input byte is to be deleted . this is accomplished by testing the contents of the input data pointer against the offset field in the frame alteration control block for equality . if the frame alteration control block command specifies that the current data byte is to be deleted , the input data byte pointer is incremented by a process block 307 . no further is action is performed and the present data byte is not written to the output as part of the altered frame . the process then continues at a decision block 318 which determines whether the last input data byte has been read from the frame alteration control block storage memory , i . e ., whether the end of the input frame has been reached . if so , the process is exited at a terminal block 319 . if the end of the frame has not been reached , the process continues at the input / output block 315 to read the next input data byte . if the frame alteration control block command is not a delete instruction , the process continues from the decision block 306 to a decision block 308 to determine whether the frame alteration control block command is an insert instruction . if so , the replacement byte is read from the appropriate frame alteration control block field or the alteration array 511 ( fig5 ) and written as the output byte by a process block 316 next , the output data pointer is incremented by a process block 317 . the end - of - frame test is then performed at the decision block 318 as previously described . if the frame alteration control block command is not an insert instruction , the process continues from the decision block 308 to a decision block 311 to determine whether it is an overlay instruction . if so , then the new ( overlaying ) byte is read from the frame alteration control block data field and the input data pointer is incremented in a process block 310 . the overlaying byte is then written as the output byte . if the frame alteration control block command is neither a delete , an insert , nor an overlay instruction , then the byte read from the input frame is written as the output byte after incrementing the input data pointer at the process block 310 . adding other frame alteration control block commands is within the skill of the art given the present explanation . for example , bytes can be incremented , decremented , inverted , and otherwise modified as desired . in fig4 , a data flow controller 401 is coupled to a processor 403 for generating the frame alteration commands based on the protocol of the network . in the data flow controller 401 , a receive interface 405 transfers a frame from the network to a memory interface 407 for storage in a memory . the memory interface 407 extracts the frame header from the memory 415 and transfers it to the processor 403 via a control interface 409 . the processor 403 generates the frame alteration commands contained in the header and returns frame alteration control blocks to the memory 415 via the control interface 409 and memory interface 407 . the frame alteration control blocks are stored in the memory 415 immediately preceding the beginning of the frame data . next , the data flow controller 401 reads the frame alteration control block and data from the memory 415 under the control of a transmit controller 411 and transfers them to a read unit 417 . the frame alteration control block and data are transferred to a frame alteration unit 419 which applies the alterations according to the contents of the frame alteration control blocks . the output frame data is then moved to a transmit unit 421 which transmits them to the network . details of the frame alteration unit 419 are shown in fig5 . a frame parser 501 separates the frame alteration control blocks and frame data . unaltered and unaligned frame data are sent a data aligner 503 which realigns the data to even 16 - byte boundaries since the unaltered frame data may not be so aligned . this was accomplished by setting data pointers as shown in the process block 305 of fig3 . the aligned data is then applied to an alteration engine 505 . the frame alteration control blocks are applied from the frame parser 501 to an frame alteration control block decoder 507 . the frame alteration control block decoder 507 interprets the frame alteration control block bits and moves the frame alteration commands to a frame alteration controller 509 . the frame alteration controller 509 disassembles the frame alteration commands from the frame alteration control block decoder 507 into basic instructions which are coupled to the alteration engine . an alteration array 511 is an optional storage device that supplies frequently used data patterns to be inserted or overlay data in the input frame under alteration . when a frame alteration command is decoded that designates one of the patterns is to be inserted or to overlay frame data , the designated configuration is extracted from the alteration array 511 by the frame alteration controller 509 and moved to the alteration engine 505 . the described operations accomplish the frame alterations in the alteration engine 505 by using the instruction to insert , to delete , to overlay , to increment , plus others as needed to assemble altered data frames which are then applied to the transmit unit 421 of fig4 . the process for executing the instructions were described above with reference to fig3 . fig6 shows an example of a frame alteration . fig6 a illustrates an exemplary input frame with its accompanying frame alteration control block and fig6 b illustrates a resulting altered output frame . this example inserts four bytes of data from the frame alteration control block ( top row of fig6 a ) at a 50 - byte data offset specified by bits 16 to 31 of the frame alteration control block . the bos ( bottom - of - stack bit 0 ) is set to 1 to indicate that this is the only frame alteration control block in the stack . the frame alteration control block type ( bits 1 - 3 ) identifies the format of bits 8 - 127 . the disp field ( displacement bits 4 - 7 ) specifies where the data begins . the cmd ( command field bits 8 - 15 ) is a unique code which in this example indicates that there is 4 - byte data field to be inserted at a point in the data field specified - by the offset ( bits 16 - 31 ). the data to be inserted is the field comprising bits 32 - 63 . fig6 b shows the altered frame as transmitted . the data is aligned on even numbered 16 - byte data fields and the inserted data is shown at the 50th byte , i . e ., byte 48 plus 16 bits ( two bytes ). a hardware implementation of the alteration engine 505 in fig5 is shown in fig7 . bytes from the unaltered input frame are stored in a register 709 . bytes from the frame alteration control block field to be inserted or overlaid are stored in a register 707 . each successive byte is stored by a timing signal clk . the command in the frame alteration control block cmd field is gated to a decoder 701 to be executed . in the example under consideration , the instructions are overlay ( ov ), insert ( in ), and delete ( de ). the ov and in output signals from the decoder 701 are applied to input terminals of an or gate 715 . the output signal from the or gate 715 is applied to an input terminal of an and gate 717 . the other input signal to the and gate 717 is from a flip - flop 741 which is set by a comparator 711 when the read address is equal to the offset field of the frame alteration control block . the flip - flop 741 is reset by an eof signal indicating that the end of the data to be inserted or overlaid has been reached . this permits the input ptr counter 703 to continue to advance and to address the next input data bytes from the input frame &# 39 ; s data field . the disp field contents of the frame alteration control block are set into a counter input ptr 703 by an initialization signal init and is incremented by successive clk timing signals when the command being executed is not an insert instruction by means of an and gate 737 and an inverter 739 . when the instruction is an insert , the inverter 739 inhibits the and gate 737 . the input ptr counter 703 keeps track of the next byte to be read from the unaltered input frame &# 39 ; s data field so its output signals also supply the read address of the bytes . the other input to the comparator 711 is an offset register 705 which is loaded by the init signal and stores the contents of the offset field of the frame alteration control block . the comparator 711 supplies an output signal when the read address from the input ptr 703 equals the offset value , causing the flip - flop 741 to be set at the next clk signal . the output signal from the flip - flop 741 enables the and gate 717 when bytes are to be overlaid or inserted during execution of an overlay or insert instruction from the decoder 701 as indicated by the output signal from the or gate 715 . when the and gate 717 is enabled , the new byte is passed by an and gate 723 to an or gate 724 . when the and gate 717 is disabled , either because the offset address has not been reached or the command being executed is neither an overlay or insert instruction , an inverter 719 enables an and gate 721 to pass the current input byte from the register 709 to the or gate 724 . the byte from the or gate 724 is coupled to an and gate 731 to be gated as the output byte at the next clk signal if the command is not a delete instruction ( de from the decoder 701 ). the clk signal is applied to an and gate 729 except when inhibited by the output from an inverter 727 when the command being executed is a delete instruction . when the output signal from the and gate 729 gates the output byte at the and gate 731 , it also increments an output ptr counter 735 . some data patterns are common and often repeated . for example , converting from one protocol to another usually necessitates that fixed patterns be inserted or overlaid on part of the frame data . fig8 is a block diagram showing details within the frame alteration controller 509 in fig5 for providing the new byte to the new register 707 of fig7 . data to be inserted from the facb header is coupled to one input of an and gate 801 . a pattern identifier , which can be an address supplied by a frame alteration command , reads a desired data pattern from the alteration array 511 to an input of an and gate 803 . source control signals from a frame alteration command and decoded by the facb decoder 507 enables one of the and gates 801 or 803 if a new byte is to be supplied to the alteration engine . the output from an enabled and gate is applied to an or gate 807 to supply the new byte . the contents of the alteration array 511 can be dynamic . that is , its contents can be altered under software control to enable the logic to handle a wide variety of protocols and standard data patterns . the operation of the read unit of fig5 as well as the interfaces are well known in the art and need not be explained in detail for an understanding of the invention or how to make and to use it . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes and modifications in form and details may be made therein without departing from the spirit and scope of the invention according to the following claims .
| 7 |
fig4 shows network architecture according to an embodiment of the invention . remote destination node 102 is a server in the same subnet that the gateway 112 and router 104 are in . remote destination node 114 is another server in a different subnet from that the gateway 112 is in . the wan ip address of router 104 is cloned to local node 108 , duplicating the ip address . as shown in fig5 a , the wan ip address of router 104 can be obtained from isp 320 by dynamic destination node control protocol ( dhcp ). in step 322 , the router 104 sends a dhcp request to isp 320 . in step 324 , the isp 320 responds to router 104 with information for configuring wan interface 204 a . similarly , the router 104 can provide a dhcp service on its lan interface 104 b , and the ip address of local node 108 can be obtained therefrom . in step 304 , the local node 108 sends a request to router 104 , and in step 304 , the router 104 responds to local node 108 , assigning the same ip address of the wan ip of router 104 to the local node 108 , 223 . 82 . 179 . 6 in fig5 a . when the wan interface 104 a changes dynamically , the ip address of local node 108 is also synchronized . for example , if the wan interface 104 a fails to link to the internet , instead of assigning the wan ip address to the local node 108 , the router 104 acts as a conventional local area network dhcp server , and the local node 108 acts as a conventional local area network node having a virtual ip address , for example , 192 . 168 . 1 . 2 . as shown in fig4 , when a packet from local node 108 is destined for remote destination node 102 , it must be received and processed by the router 104 before transfer to remote destination node 102 . according to the open standard interface ( osi ) specification , packet transfer in the same subnet is accomplished by physical layer identification of a media access control ( mac ) address . in this case , in order for packets from local node 108 to be received by the lan interface 104 b of router 104 for further processing , the local node 108 queries the mac address of the destination remote destination node 102 , for example , by the way of conventional address resolution protocol , arp , and the router 104 responds with the mac address of lan interface 104 b . thus packets from local node 108 destined for remote destination node 102 are physically transferred to router 104 , and the router 104 transfers the packets to remote destination node 102 directly by physical layer identification . in another example , when a packet from local node 108 is destined for remote destination node 114 within a subnet different from wan interface 104 a , the packets are physically destined for gateway 112 for further routing . the router 104 must first receive the packet and reroute it to gateway 112 . similarly , in order for packets from local node 108 to be received by the lan interface 104 b of router 104 for further processing , the local node 108 queries the mac address of the destination gateway 112 ( aa : 00 : 00 : 00 : 00 : ff in fig5 b ), the router 104 responds with the mac address of lan interface 104 b ( 7f : 7f : 7f : 7f : 7f : 7f in fig5 b ) thus packets from local node 108 destined for remote destination node 114 are physically transferred to router 104 , and by physical layer identification . the packets can then be transferred to gateway 112 and routed toward remote destination node 114 . fig5 b shows the procedure based on arp . in step 306 , an arp request is first broadcasted , and in step 308 , upon receiving the request , the router 104 responds a packet to the local node 18 , wherein address provided in the response to this arp request is actually mac address 7f : 7f : 7f : 7f : 7f : 7of lan interface 204 b . the local node 108 accordingly fills the destination mac address in outbound packets with 7f : 7f : 7f : 7f : 7f : 7f , such that the router 104 physically receives all the packets . fig5 c shows the steps of the local node 108 sending a packet to remote destination node 102 . the local node 108 fills the destination mac address of the outbound packet 312 with the mac address of lan interface 104 b , 7f : 7f : 7f : 7f : 7f : 7f . thus the router 104 receives the outbound packet 312 and rewrites the source and destination mac addresses for further transmission . in some embodiments , the source mac address in the rewritten outbound packet 314 is the mac address of the wan interface 104 a , 80 : 80 : 80 : 80 : 80 : 80 , and the destination mac address is mac address of the remote destination node 102 , aa : bb : cc : dd : ee : ff . fig5 d shows the steps of the remote destination node 102 sending a packet to local node 108 . before the router 104 reroutes the inbound packet 318 , a verification sequence must be processed as router 104 may comprise several services , each occupying certain sessions and ports , such as nat table 210 and pat table 220 in fig3 . when the packet type does not correspond to any other services in the router 104 , it is rewritten to inbound packet 316 and sent to local node 108 . variations can be implemented for further applications . for example , the wan interface 104 a of router 104 can access isp 320 using point to point protocol over ethernet ( pppoe ) or serial line internet protocol ( slip ). in the same subnet , packets from local node 106 and local node 108 are processed in the router 104 using different schemes , therefore it is necessary to distinguish which node is associated with the packet . one solution is to provide a non - volatile memory in router 104 , to store the mac address of local node 108 , thereby whether a packet is associated with local node 108 can be determined . in summary , some embodiment of invention accomplish transparency by binding a real ip address to a destination node in local area network and using the router as an arp proxy to route every packet to and from the destination node . while the invention has been described by way of example and in terms of preferred embodiment , it is to be understood that the invention is not limited thereto . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements .
| 7 |
preferred embodiments of the invention will be described hereinbelow with reference to the drawings . fig1 is a sectional view of a first structural example of an ultrasonic transducer of the invention . the ultrasonic transducer 1 shown in fig1 is a push - pull electrostatic ultrasonic transducer , in which a diaphragm ( vibrating electrode layer ) 10 having a conducting layer is sandwiched between upper fixed electrodes ( upper driving fixed electrodes 21 a and an upper detecting fixed electrode 22 a ) and lower fixed electrodes ( lower driving fixed electrodes 21 b and a lower detecting fixed electrode 22 b ). the upper fixed electrodes ( first fixed electrodes ) and the lower fixed electrodes ( second fixed electrodes ) are arranged so as to face both sides of the diaphragm 10 . in the ultrasonic transducer 1 shown in fig1 , the fixed electrodes 21 a and 22 a and the fixed electrodes 21 b and 22 b are symmetric with respect to the diaphragm 10 . the fixed electrodes 21 a and 22 a are on the upper side and the fixed electrodes 21 b and 22 b are on the lower side with respect to the diaphragm 10 for the convenience of description ( the same applies to the other drawings ). the upper driving fixed electrode 21 a and the lower driving fixed electrode 21 b shown in fig1 are collectively called a driving fixed electrode 21 . the upper detecting fixed electrode 22 a and the lower detecting fixed electrode 22 b are collectively called a detecting fixed electrode 22 . the upper and lower fixed electrodes are collectively called a fixed electrode 20 . an upper amplitude detecting section 30 a and a lower amplitude detecting section 30 b are collectively called an amplitude detecting section 30 . an upper voltage control section 40 a and a lower voltage control section 40 b are collectively called a voltage control section 40 . fig2 a to 2c are diagrams showing structural examples of the diaphragm 10 . the diaphragm ( vibrating electrode layer ) 10 shown in fig2 a has a structure in which a conducting layer ( electrode layer ) 12 is sandwiched between insulating layers 11 . the diaphragm 10 shown in fig2 b has a structure in which one side of the insulating layer 11 is coated with the conducting layer ( electrode layer ) 12 . the diaphragm 10 shown in fig2 c has a structure in which both sides of the insulating layer 11 are coated with the conducting layer ( electrode layer ) 12 . when the diaphragms 10 shown in fig2 b and 2c are used , it is desirable to provide an insulating layer on the fixed electrode 20 that faces the conducting layer ( electrode layer ) 12 of the diaphragm 10 . referring again to fig1 , the fixed electrode 20 may have a plurality of electrode arrays that is insulated from one another . the fixed electrode 20 has through portions ( through holes ) for the sound waves generated from the diaphragm 10 to pass through . the through portions may be arranged between the array electrodes , or alternatively , may be through holes in the fixed electrode 20 . parts of the vertically opposing electrode arrays of the fixed electrode 20 are used as the upper driving fixed electrode 21 a and the lower driving fixed electrode 21 b . to the upper driving fixed electrode 21 a , the upper voltage control section 40 a is connected and , to the lower driving fixed electrode 21 b , the lower voltage control section 40 b is connected , to both of which alternating current signals ( driving signals ) are applied . the other parts of the electrode arrays of the fixed electrode 20 are used as the upper detecting fixed electrode 22 a and the lower detecting fixed electrode 22 b . to the upper detecting fixed electrode 22 a , the upper amplitude detecting section 30 a is connected and , to the lower detecting fixed electrode 22 b , the lower amplitude detecting section 30 b is connected , with which information on the vertical amplitude of the diaphragm 10 is obtained . on the basis of the amplitude information obtained by the upper amplitude detecting section 30 a and the lower amplitude detecting section 30 b , the signals ( drive voltages ) to be applied to the upper driving fixed electrode 21 a and the lower driving fixed electrode 21 b are controlled so as to vibrate the diaphragm 10 vertically symmetrically , or in response to the ( vertically ) symmetrically positive and negative input signals . the details of the structure and the operation of the amplitude detecting section 30 and the voltage control section 40 will be described later . the fixed electrode shown in fig1 has a gap across between the diaphragm 10 and the fixed electrodes 20 . alternatively , the gaps between the diaphragm 10 and the upper and lower fixed electrodes 20 may not be provided . a fixed electrode with the gap is suitable for a loud speaker ; a fixed electrode with a structure in which the diaphragm 10 is in contact with the fixed electrode 20 is suitable for an ultrasonic speaker . in the example of fig1 , the detecting fixed electrode has a structure in which one upper detecting fixed electrode 22 a is provided for the upper fixed electrode , while one lower detecting fixed electrode 22 b is provided for the lower fixed electrode . alternatively , multiple detecting fixed electrodes may be provided . in this case , the central portion where the maximum amplitude can be obtained can be used as the driving fixed electrode . the average of the amplitude voltages measured by the multiple detecting fixed electrodes is used as the amplitude output . fig1 shows the cross section of the ultrasonic transducer 1 . the plan view of the fixed electrode may be circular , rectangular , or other various patterns . also , the plan view of the through portion for a sound wave may be circular , rectangular , concentric circular ring , concentric rectangular ring , and other various patterns . fig3 is a diagram of a second structural example of the ultrasonic transducer 1 , which further has an upper actuator 23 a that adjusts the gap between the diaphragm 10 and the upper fixed electrodes ( the upper driving fixed electrodes 21 a and the upper detecting fixed electrode 22 a ) and a lower actuator 23 b that adjusts the gap between the diaphragm 10 and the lower fixed electrodes ( the lower driving fixed electrodes 21 b and the lower detecting fixed electrode 22 b ). in this example , the gaps are adjusted so that the diaphragm 10 vibrates with high fidelity to ( in proportion to ) the input signal , according to the information on the amplitude of the diaphragm 10 which is measured by the upper amplitude detecting section 30 a and the lower amplitude detecting section 30 b . the adjustment of the gaps are performed in response to the signals sent from an upper gap control section 50 a and a lower gap control section 50 b to the upper actuator 23 a and the lower actuator 23 b ( the upper gap control section 50 a and the lower gap control section 50 b are collectively called a gap control section 50 ). fig4 is a diagram of a third structural example of the ultrasonic transducer 1 , which has a combination structure of the function of the first ultrasonic transducer shown in fig1 and the function of the second ultrasonic transducer shown in fig3 . in the ultrasonic transducer 1 shown in fig4 , parts of the electrode arrays of the vertically opposing fixed electrode 20 are used as the upper driving fixed electrode 21 a and the lower driving fixed electrode 21 b . to the upper driving fixed electrode 21 a , the upper voltage control section 40 a is connected and , to the lower driving fixed electrode 21 b , the lower voltage control section 40 b is connected , to both of which driving signals are applied . the other parts of the electrode arrays of the fixed electrode 20 are used as the upper detecting fixed electrode 22 a and the lower detecting fixed electrode 22 b . to the upper detecting fixed electrode 22 a , the upper amplitude detecting section 30 a is connected and , to the lower detecting fixed electrode 22 b , the lower amplitude detecting section 30 b is connected , with which information on the vertical amplitude of the diaphragm 10 is obtained . on the basis of the amplitude information obtained by the upper amplitude detecting section 30 a and the lower amplitude detecting section 30 b , the signals ( drive voltages ) to be applied to the upper and lower fixed electrodes 20 are controlled by the upper voltage control section 40 a and the lower voltage control section 40 b so as to vibrate the diaphragm 10 vertically symmetrically . the ultrasonic transducer 1 further includes the upper actuator 23 a that adjusts the gap between the diaphragm 10 and the upper driving fixed electrodes 21 a , and the lower actuator 23 b that adjusts the gap between the diaphragm 10 and the lower driving fixed electrodes 21 b , with which the gaps are adjusted so that the diaphragm 10 vibrates with high fidelity to ( in proportion to ) the input signals , according to the information on the amplitude of the diaphragm 10 which is obtained by the upper amplitude detecting section 30 a and the lower amplitude detecting section 30 b . the adjustment of the gaps are performed in accordance with the signals sent from the upper gap control section 50 a and the lower gap control section 50 b to the upper actuator 23 a and the lower actuator 23 b . in this third structural example , the drive - voltage control by the voltage control section 40 and the gap control by the gap control section 50 are selectively used depending on the asymmetry of the upper amplitude and the lower amplitude of the diaphragm 10 which are detected by the upper amplitude detecting section 30 a and the lower amplitude detecting section 30 b . for example , while the vertical asymmetry of the amplitude of the diaphragm 10 is larger than a specified value , the gap control by the gap control section 50 is selected ; when the asymmetry becomes smaller than the specified value , the drive voltage control by the voltage control section 40 is selected . the principle of amplitude detection is similar to that of a capacitor microphone . there is a capacitor between the diaphragm 10 and the detecting fixed electrode 22 . accordingly , when the diaphragm 10 vibrates to vary the gap between it and the detecting fixed electrode 22 , the capacitance of the capacitor varies to change the electric charge in the capacitor . as a result , the voltage between the capacitor electrodes changes . thus , the gap between the diaphragm 10 and the detecting fixed electrode 22 , or the amplitude , can be determined by determining the voltage between the diaphragm 10 and the detecting fixed electrode 22 . fig5 shows a structural example of the amplitude detecting section 30 . the amplitude detecting section 30 is composed of the upper amplitude detecting section ( first amplitude detecting means ) 30 a and the lower amplitude detecting section ( second amplitude detecting means ) 30 b . the upper amplitude detecting section 30 a determines the amplitude voltage between the diaphragm 10 and the upper detecting fixed electrode 22 a by an upper voltage detecting section 31 a and detects the maximum point of the detected voltage waveform by an upper peak detecting section 32 a , thereby determining the upper amplitude of the diaphragm 10 . the lower amplitude detecting section 30 b determines the voltage between the diaphragm 10 and the lower detecting fixed electrode 22 b by a lower voltage detecting section 31 b and detects the maximum point of the detected voltage waveform by a lower peak detecting section 32 b , thereby determining the lower amplitude of the diaphragm 10 . the amplitude of the diaphragm 10 responsive to the positive and negative signals can thus be determined , allowing the asymmetrical distortion of the diaphragm 10 to be detected . fig6 shows a structural example of the voltage control section . the voltage control section 40 includes the upper voltage control section 40 a and the lower voltage control section 40 b corresponding to the upper amplitude detecting section 30 a and the lower amplitude detecting section 30 b ( refer to fig5 ), respectively . the upper voltage control section 40 a and the lower voltage control section 40 b have the same circuit structure . an upper error detection circuit ( first error detection means ) 41 a outputs the deviation of the amplitude ( detected upper amplitude ) of the diaphragm 10 which is detected by the upper amplitude detecting section 30 a ( refer to fig5 ) relative to a target upper amplitude . a lower error detection circuit ( second error detection means ) 41 b outputs the deviation of the amplitude ( detected lower amplitude ) of the diaphragm 10 which is detected by the lower amplitude detecting section 30 b ( refer to fig5 ) relative to a target lower amplitude . the target amplitudes may be set in correspondence with the drive voltage in advance or , alternatively , may be set such that the amplitude determined by one detecting fixed electrode as the target amplitude of the opposing electrode . an upper variable - gain amplifying circuit ( a first variable - gain control means ) 42 a amplifies an alternating current signal ( driving signal ) while controlling the gain of the amplifying circuit depending on the deviation from the target amplitude outputted from the upper error detection circuit 41 a . a lower variable - gain amplifying circuit ( a second variable gain control means ) 42 b amplifies an alternating current signal ( driving signal ) while controlling the gain of the amplifying circuit depending on the deviation from the target amplitude outputted from the lower error detection circuit 41 b . in this case , the gain is increased when the detected amplitude is smaller than the target amplitude (+ deviation ); the gain is decreased when it is larger (− deviation ). after the gain is thus controlled depending on the deviation in amplitude , the power is amplified by an upper power amplifier 43 a and a lower power amplifier 43 b , and the driving signal is supplied to the upper driving fixed electrode 21 a and the lower driving fixed electrode 21 b . while the gain control by the upper variable - gain amplifying circuit 42 a and the lower variable - gain amplifying circuit 42 b is principally under automatic control ( setting ), it may be under manual control ( setting ). for example , factory - default manual control allows the ultrasonic transducer to be shipped in the optimum condition . fig7 shows a structural example of the gap control section 50 . the gap control section 50 includes the upper gap control section 50 a and the lower gap control section 50 b corresponding to the upper actuator 23 a and the lower actuator 23 b ( refer to fig3 and 4 ), respectively . the upper gap control section 50 a and the lower gap control section 50 b have the same circuit structure . an upper error detection circuit ( first error detection means ) 51 a outputs the deviation of the detected upper amplitude of the diaphragm 10 relative to a target upper amplitude . a lower error detection circuit ( second error detection means ) 51 b outputs the deviation of the detected lower amplitude of the diaphragm 10 relative to a target lower amplitude . the target amplitude may be set in correspondence with the drive voltage in advance or , alternatively , may be set such that the amplitude measured by one detecting fixed electrode as the target amplitude of the opposing electrode . a gap control circuit ( first gap control means ) 52 a controls the gap between the diaphragm 10 and the upper driving fixed electrode 21 a via the upper actuator ( actuator element ) so that the deviation in amplitude ( the output of the upper error detection circuit 51 a ) becomes zero . similarly , a gap control circuit ( second gap control means ) 52 b controls the gap between the diaphragm 10 and the lower driving fixed electrode 21 b via the lower actuator ( actuator element ) so that the deviation in amplitude ( the output of the lower error detection circuit 51 b ) becomes zero . as the upper gap control circuit 52 a and the lower gap control circuit 52 b , a pi controller or a pid controller can be used . fig1 shows an example of the fixed electrode of the ultrasonic transducer in which the gaps can be controlled . as shown in fig1 , the actuator element ( an upper actuator 23 a and a lower actuator 23 b ) has a structure in which a film ( planer ) piezoelectric element such as a polyvinylidene fluoride ( pvdf ) resin is sandwiched between the diaphragm 10 and the upper driving fixed electrode 21 a and between the diaphragm 10 and the lower driving fixed electrode 21 b . the thickness of the pvdf film varies by controlling the voltage applied to the pvdf by the gap control section 50 , allowing fine control of the gap . the piezoelectric element is provided only on the surface where the fixed electrode 20 is in contact with the diaphragm 10 so as not to interfere with the vibration of the diaphragm 10 and the radiation of sound waves . other actuator means capable of fine control may also be used . although the ultrasonic transducers shown in fig3 , 4 , and 10 have a structure in which the upper and lower gap can be controlled individually , only one of the upper and lower gaps may be controlled . although the gap control by the upper gap control circuit 52 a and the lower gap control circuit 52 b is principally under automatic control ( setting ), it may be under manual control . for example , factory - default manual control allows the ultrasonic transducer to be shipped in the optimum condition . the fixed electrode 20 shown in fig1 has a gap between the diaphragm 10 and the fixed electrode 20 , thus having large vibration area and so is suitable for loud speakers with importance on reproduction in audible range . while fig1 shows the cross section of the ultrasonic transducer 1 , the plan view of the sound - wave through portion may be circular , rectangular , concentric circular ring , concentric rectangular ring , and other various patterns . fig8 shows a structural example of the fixed electrode 20 of the ultrasonic transducer , part of the fixed electrode being cut away , in which the double - side insulating diaphragm 10 is sandwiched between the fixed electrodes in contact therewith . the example of fig8 shows part of an electrode array . practically , the structure shown in fig8 is arranged side by side . since the structural example shown in fig8 has a smaller vibrating area than that of the structure shown in fig1 , it is suitable for ultrasonic speakers . in this case , structural examples of the vibrating electrode layer and the fixed electrode are as follows . in the first case , the diaphragm 10 having both sides coated with an insulating layer is used ( refer to fig8 ). in the second case , both sides of the diaphragm 10 are coated with an electrode layer , and the surfaces of the upper and lower fixed electrodes which face the diaphragm 10 have an insulating layer ( not shown ). in the third case , as shown in fig9 , the diaphragm 10 is an insulating layer having one side coated with a conducting layer ( electrode layer ), and the surface of the fixed electrode which faces the conducting layer of the diaphragm 10 has an insulating layer . although the first case ( the diaphragm having both sides coated with an insulating layer ) is preferable in consideration of vertical symmetry , it is difficult to manufacture such a diaphragm . two diaphragms of the third case ( the diaphragm with an insulating layer having one side coated with a conducting layer ) may be bonded together to form the diaphragm of the first case . however , it is difficult to bond them evenly , possibly causing local variations in the characteristic of the layer and providing little vertical symmetry . also , a conductive adhesive agent should be used . the second and third cases have no significant problem in manufacturing the diaphragm , because the technique of depositing the electrode layer on the surface of the insulating layer has already been established . also , the technique of forming the insulating layer on the fixed electrode is present , so that there is no significant problem in manufacturing . however , the case of forming the insulating layer on the step - shaped fixed electrode has the problem of causing vertical asymmetry , because it is difficult to control the thickness with high accuracy . thus the structure of fig8 tends to have a higher vertical asymmetry than that of the structure of fig1 in terms of manufacturing . the invention allows the transducer with a vertical asymmetrical structure to be vibrated vertically symmetrically . while the examples shown in fig8 and 9 have a rectangular sound - wave through portion , the through portion may be circular or other shapes . the cross section of the fixed electrode is in the form of a step to have large electrostatic force to be applied to the diaphragm 10 . alternatively , a tapered shape or a straight hole without the step is possible . the invention has been described above based on embodiments . the configuration of the ultrasonic speaker using the ultrasonic transducer of the invention can suppress the asymmetrically positive and negative distortion when driving the transducer by a modulated wave generated by modulating an ultrasonic carrier wave by an audio - range signal , thereby reducing an audible component that is generated directly from the transducer . this allows a higher directivity ultrasonic speaker to be achieved . while the invention has been described with reference to preferred embodiments , it is to be understood that the ultrasonic transducer of the invention is not limited to the foregoing embodiments , and that various modifications can be made without departing from the spirit and scope of the invention .
| 7 |
referring now to the drawings , and initially to fig1 there is illustrated a computer system generally indicated by the reference numeral 10 . the computer system 10 comprises a plurality of processors 12 , 14 , 16 which are coupled to a common memory unit 20 by a bus 18 . the common memory unit 20 , which may comprise a block of ram , is in turn coupled to an access summary device 22 used to store requests to a common resource 24 . for example , the memory ram can be divided into 32 ring buffers 21 with each ring buffer being allocated to one of the processors 12 , 14 , 16 for storing requests to the common resource 24 . the common memory unit 20 is in turn coupled to an encoder 23 by an access event bus 26 and to the common resource 24 by a bus 28 . the common resource 24 may comprise , e . g . a processor configured to perform preselected operations or processing services for the other processing devices of the system . the output of the encoder 23 is coupled by an encoded access event bus 27 to an access summary device 22 . the access summary device 22 is in turn coupled to the common resource 24 , by a bus 34 . the access summary device 22 may comprise , e . g . a block of combinational logic 30 , and a summary register 32 . the block of combinational logic 30 determines the priority of the resource requests , from the requests made by the processors 12 , 14 , 16 in the common memory 20 . the summary register 32 stores a value which indicates that a resource request has occurred and , furthermore , which ring buffer of the memory 20 has been assigned the highest priority by the combinational logic block 30 indicating that it should be serviced next by the common resource 24 . the common resource 24 can read the summary register 32 via the bus 34 to determine which ring buffer was assigned the highest priority by the access summary device 22 and should be serviced next . after reading the summary register 32 the common resource 24 asserts a read signal which enables the clear input of the summary register 32 . the common resource 24 , which has access to the common memory unit 20 through bus 28 , can then proceed to access the selected ring buffer of the common memory unit 20 . fig2 illustrates the access summary device 22 of fig1 in greater detail . the access summary device 22 comprises a decoder 28 which has its input coupled to the five bit encoded access event bus 27 . the encoded access event bus 27 is coupled to an encoder 23 , which monitors the common memory unit 20 via the access event bus 26 to determine when requests have been written to the ring buffers in the common memory unit 20 . the encoder 23 supplies a five bit encoded access event signal to the decoder 28 as an input signal by means of the bus 27 . the encoded access event signal serves to indicate that one of the ring buffers to the memory 20 has been written to and provides a number value indicating the particular ring buffer that was accessed . the decoder 28 decodes the five bit access event signal into a 32 bit set - bit signal , with each bit in the set - bit signal representing one of the ring buffers . only one bit of the set - bit signal may be high at any one time , with the high bit indicating which particular ring buffer was written to . the output of the decoder 28 is coupled by a thirty - two bit bus 30 to a set input of a thirty - two bit logic array referred to as a bitmap 32 . accordingly , each bit in the thirty - two bit logic array referred to as the bitmap 32 comprises one of n one bit storage locations 33 . a high bit in the decoder output signal set - bit , will have the effect of setting the corresponding bit in the thirty - two bit array , bitmap 32 . thus , at any given time , there may be a number of bits set in the bitmap 32 one for each request indicated by a series of access events . a clear input to the bitmap 32 is supplied by a thirty - two bit line 34 . line 34 couples the output of a logic device 36 to the second input of the bitmap 32 . the logic device 36 is representative of an array of 32 and gates with each and gate having the clear signal output by the or gate 74 as one input and a respective bit of the signal nr & lt ; 31 : 0 & gt ; as an input . the output of the logic device 36 is a 32 bit clear - bit signal input to the bitmap 32 . a high bit in the 32 bit clear - bit signal will serve to clear the corresponding bit in the bitmap 32 as will be described below . the output of bitmap 32 is coupled to a thirty - two bit bus 38 which splits into four eight bit busses 38a through 38d . each 8 bit bus 38a through 38d is in turn , coupled to a first input of a corresponding first through fourth request priority logic block rprio ( 0 ) through rprio ( 3 ) 40 - 43 . the request priority logic blocks rprio ( 0 ) through rprio ( 3 ) 40 - 43 together perform an evaluation between the most recently read bitmap output signal r & lt ; 31 : 0 & gt ; from the bus 38 , which indicates the current requests for priority , and the previously determined priority request represented by a next request output signal nr & lt ; 31 : 0 & gt ;, determined by the rprio logic blocks 40 - 43 in a previous cycle of operation . thus , the bus 38 divides the 32 bit bitmap output signal r & lt ; 31 : 0 & gt ;, which represents the resource request stored in the bitmap 32 , into four 8 bit signals r & lt ; 7 : 0 & gt ;, r & lt ; 15 : 8 & gt ;, r & lt ; 23 : 24 & gt ; and r & lt ; 31 : 14 & gt ;. each of the 8 bit signals serves as a one byte input signal to a corresponding rprio logic block . the first logic block rprio ( 0 ) 40 has the lowest 8 bits r & lt ; 7 : 0 & gt ; of the bitmap output signal as a resource request input signal ri & lt ; 7 : 0 & gt ;. the second logic block rprio ( 1 ) 41 has the next highest 8 bits r & lt ; 15 : 8 & gt ;, of the bitmap output signal r & lt ; 31 : 0 & gt ;, as a resource request input signal ri & lt ; 15 : 8 & gt ;. the third logic block rprio ( 2 ) 42 , in turn , has a resource request input signal ri & lt ; 23 : 16 & gt ; which consists of bits 23 through 16 r & lt ; 23 : 16 & gt ; of the bitmap output signal r & lt ; 31 : 0 & gt ;. finally , the fourth logic block rprio ( 3 ) 43 has the highest 8 bits r & lt ; 31 : 24 & gt ; of the bitmap output signal r & lt ; 31 : 0 & gt ; as a resource request input signal ri & lt ; 31 : 24 & gt ;. in addition to the resource request input signals ri , each rprio logic block 40 - 43 is supplied with a common clock signal , by a line 44 , which couples the second input of each rprio logic block 40 through 43 to the output of a system clock ( not illustrated ). a third input of each of the rprio logic blocks 40 - 43 is coupled to the output of a read detect state machine 46 by a line 48 . the read detect state machine 46 provides a priority clear or pc output signal which indicates that the common resource 24 has read the summary register 32 . the priority clear , pc signal indicates that a new priority request must be determined . the read detect state machine 46 , which generates the priority clear pc signal has both a system clock signal and the read signal as inputs . the read signal , which indicates that the common resource 24 has read the summary register 32 , is supplied to the first input of the read detect state machine 46 by the common resource 24 , whenever it reads from the summary register 32 . the system clock signal is supplied to the second input of the read detect state machine 46 , by the line 44 . the line 44 is also coupled to a clock input of a start - up state machine 50 . the start up state machine 50 , serves to put the access summary device 22 into a known good state when the system is powered up or reset . the output of the start up state machine 50 is coupled to a first input of an or gate 52 by a line 54 . the second input of the or gate 52 is coupled to a first output of the fourth request priority logic block rprio ( 3 ) 43 by a line 56 . thus , the or gate 52 has both the output signal from the start up state machine 50 and a token - out , to signal from logic block rprio ( 3 ) 43 as inputs the output of the or gate 52 is coupled to the fourth input of logic block rprio ( 0 ) 40 by a line 58 . thus , a token - in - in , ti , signal output by the or gate 52 , serves as the fourth input signal to logic block rprio ( 0 ) 40 . the request priority logic blocks rprio ( 0 ) through rprio ( 3 ) 40 - 43 , each have four output signals , a token - out signal , to , a new result signal w , a next request signal nr , and a clear request signal c . the token - out signal to from the first output of each of the rprio logic blocks rprio ( 0 ) through rprio ( 3 ) 40 - 43 serves as the token - in input signal for the next rprio logic block in the sequence . the second output of each rprio logic block is the new result signal w , which indicates that a new request has been assigned the highest priority by the respective rprio logic block and should be serviced next . the third output of each of the rprio logic blocks is an eight bit next request signal , nr . the next request signals nr , are combined into a thirty - two bit signal nr & lt ; 31 : 0 & gt ; which indicates the next request which should be serviced . the fourth output of each of the rprio logic blocks is the clear bit signal c which is used to clear from the bitmap 32 the bit for the ring buffer which has been assigned the highest priority and which is to be serviced next . the lowest rprio logic block rprio ( 0 ) 40 has its fourth input coupled to the or gate 52 by the line 58 . the or gate 52 has , in turn , both the first output signal of rprio ( 3 ) 43 , to , and the output of the start - up state machine 50 as inputs . in this manner , the token - in signal ti , supplied to the fourth input of logic block rprio ( 0 ) 40 , can be supplied by either the start up state machine 50 or wrap around from the first output of the last logic block rprio ( 3 ) 43 . the first output of the first logic block rprio ( 0 ) 40 is in turn coupled to the fourth input of the second rprio logic block 42 by a line 60 . thus , the token - out , to , signal from logic block rprio ( 0 ) 40 serves as the token - in signal supplied to logic block rprio ( 1 ) 41 . the first output of logic block rprio ( 1 ) 41 , is coupled to the fourth input of logic block rprio ( 2 ) 42 by a line 62 . thus , the token - out signal of logic block rprio ( 1 ) 41 is supplied as the token - in signal to the fourth input of logic block rprio ( 2 ) 42 . following this sequence , the first output of logic block rprio ( 2 ) 42 is coupled by a line 64 to the fourth input of logic block rprio ( 3 ) 43 . the line 64 therefore supplies the token - out signal from logic block rprio ( 2 ) 42 as the token - in signal of logic block rprio ( 3 ) 43 . as noted earlier , the token - out signal of logic block rprio ( 3 ) is supplied to an or gate 52 , which generates the token - in signal to logic block rprio ( 0 ) 40 thus creating a closed loop between the rprio logic blocks 40 - 43 around which token signals may pass . in this manner , the token - in and token - out signals provide a means of communicating between the individual rprio logic blocks 40 - 43 which form the closed loop . the rippling of the token signals through the rprio logic blocks , serves as an indication to each individual logic block whether it may select the next request priority signal or whether that is the function of one of the other rprio logic blocks at any given time . the third outputs of the individual rprio logic blocks 40 - 43 are coupled , by four eight bit sections 66a through 66d of a thirty two bit bus 66 , to the input of an encoder 68 and the input of the logic device 36 . thus , each rprio logic block 40 - 43 supplies a byte of the total thirty - two bit next request signal nr & lt ; 31 : 0 & gt ;, which indicates which of the thirty two ring buffers contains the request which is to be serviced next . the third output of logic block rprio ( 0 ) 40 supplies the next request output signal nr & lt ; 7 : 0 & gt ; to the bus 66a forming the lowest eight bits of the thirty - two bit signal nr & lt ; 31 : 0 & gt ; which is found on the bus 66 . the third output of the logic block rprio ( 1 ) 41 supplies the next request output signal nr & lt ; 15 : 8 & gt ; to the bus 66b forming the second byte of the thirty - two bit signal nr & lt ; 31 : 0 & gt ;. the third byte nr & lt ; 23 : 15 & gt ; of the next request output signal nr & lt ; 31 : 0 & gt ; is supplied by the third output of the third logic block rprio ( 2 ) 42 to the bus 66c . the remaining byte nr & lt ; 31 : 24 & gt ; of the next request signal nr & lt ; 31 : 0 & gt ; is supplied to the bus 66d by the third output of the fourth logic block rprio ( 3 ). the fourth output of each of the rprio logic blocks rprio ( 0 ) through rprio ( 3 ) 40 - 43 is coupled by an individual line 68 , 70 , 72 or 74 , to the respective first through fourth inputs of an or gate 74 . thus , the or gate 74 , has the four clear request signals co , c1 , c2 , and c3 , output by the fourth output of each of the respective rprio logic blocks 40 - 43 , as input signals . the output of the or gate 74 is coupled to an input of the logic device 36 by a line 76 . the output of the logic device 36 is a thirty - two bit clear bit signal which corresponds to the next request signal nr & lt ; 31 : 0 & gt ;. the 32 bit output of the logic device 36 is coupled by the bus 34 to the clear input of the bitmap 32 . a bit in the clear bit signal is asserted when one of the clear request signals from the rprio logic blocks 40 - 43 is asserted and there is a bit set in the next request signal nr & lt ; 31 : 0 & gt ;. the next request to be serviced which is indicated by nr & lt ; 31 : 0 & gt ; will be used in combination with the clear request signals co , c1 , c2 and c3 to clear down the appropriate bit in the bitmap 32 . the bus 66 is coupled to the input of an encoder 68 and supplies the next request signal nr & lt ; 31 : 0 & gt ; as an input signal to the encoder 68 . the next request signal nr & lt ; 31 : 0 & gt ; is a value which indicates which of the thirty - two ring buffers contains the request to be serviced next . thus , only one bit in the next request signal nr & lt ; 31 : 0 & gt ; will be set at any given time . the next request signal nr & lt ; 31 : 0 & gt ; is encoded in the encoder 68 from a thirty - two bit signal to a five bit signal referred to as the event code . the five bits will comprise a value representative of the next ring buffer to be polled by the resource 24 . the encoder 68 also generates a one bit signal referred to as event detect signal which indicates that a resource request was actually written to one of the ring buffers in memory . if no resource request occurred , and thus none of the bits in the next request signal nr & lt ; 32 : 0 & gt ; were set , the event detect signal will be low . however , if a resource request occurred , the signal event detect will be high . the signal event detect serves as a sixth bit to indicate the difference between when no request was made , which is indicated by the event determined signal being low and all five bits of the event code being low , and when ring buffer zero contains a request and has been assigned the highest priority as indicated by a high event determined bit and all five bits of the event code being low . the output of the encoder 68 is a six bit signal comprising the encoded five bit event code and the one bit event detect signal . the output of the encoder 68 is coupled by a six bit bus 76 to an input of a latch 78 which therefore has the event code signal and event detect signal as inputs . an enable input of the latch 78 is coupled by a line 82 to the output of an or gate 80 . the or gate 80 has its four inputs coupled by lines 84 , 86 , 88 and 90 to the second outputs of the respective rprio logic blocks rprio ( 0 ) through rprio ( 3 ) 40 - 43 . the second outputs of the rprio logic block 40 - 43 supply the new result signals w0 , w1 , w2 and w3 , which indicate a new result and which block is responsible for the new next request signal . the new result signals serve as inputs to the or gate 80 . only one of the four signals w0 , w1 , w2 , or w3 may be high at any given time . the output of the or gate 80 is supplied as an input signal to the latch enable input of the latch 78 , by the line 82 . thus , the signal from the or gate 80 which indicates a new result enables the latch 78 to load the summary register 32 , via a line 33 and a bus 35 , with the six bit signal provided by the encoder 68 . the latch 78 has two output signals which are supplied to the summary register 32 . the first output of the latch 78 is the one bit event determined signal while the second output of the latch 78 is the five bit event code signal which indicates which ring buffer has been assigned the highest priority and should be serviced next . thus , the common resource can read the summary register 32 to determine if a request must be serviced and which ring buffer is to be polled next . referring now to fig3 the request priority logic blocks rprio 40 - 43 of fig2 are illustrated in greater detail as explained above , each rprio logic block rprio ( 0 ) through rprio ( 3 ) 40 - 43 is supplied with one byte of the thirty - two bit request signal r & lt ; 31 : 0 & gt ;. the rprio logic blocks 40 - 43 proceed to process their assigned eight bit portion of the request signal r & lt ; 31 : 0 & gt ; to determine which request is to be assigned the highest priority . the passing of a token from rprio block to rprio block in a sequential manner , provides each rprio block 40 - 43 with the ability to determine if the next request signal is to be generated from within its eight bit segment of the request signal or whether another rprio block has been assigned the task of determining the next request output signal . the use of four eight bit rprio logic blocks 40 - 43 in this manner , provides an easy to implement and expandable mechanism for determining the next priority signal as opposed to using a single thirty - two bit combinational logic block to determine the request signal with the highest priority . since each of the rprio logic blocks 40 - 43 provide an eight bit portion of the thirty - two bit next request signal nr & lt ; 31 : 0 & gt ;, only one rprio logic block 40 , 41 , 42 or 43 may output a next request signal ro & lt ; 7 : 0 & gt ; with a high bit at any given time . the passing of the token , and the presence of the most recent request signal ro & lt ; 7 : 0 & gt ; which is also the output signal , provides each rprio logic block with the necessary information for the block to determine if it has the authority to determine the next request priority . the first input of the rprio logic block is supplied with an eight bit portion of the request signal r & lt ; 31 : 0 & gt ; as a request - in signal ri & lt ; 7 : 0 & gt ;. the eight bit request - in signal ri & lt ; 7 : 0 & gt ;, supplied by bus 38a , 38b , 38c or 38d , serves as the first input into an eight bit combinational logic block rp8 100 contained within each rprio logic block . the second input , into each rprio logic block 40 - 43 , is supplied with the system clock signal . the system clock signal is thus supplied to a first input of a control state machine 102 and a d - type flip - flop 104 contained within the rprio logic block . the control state machine 102 has a total of five inputs . the third input to each of the rprio logic blocks 40 - 43 is coupled to a second input of the control state machine 102 by the line 42 . the line 42 which is also coupled to the output of the read detect state machine 46 supplies the priority clear pc signal as the second input signal to the control state machine 102 . the pc signal indicates that the common resource 24 has read the summary register 32 . the fourth input of each of the rprio blocks 40 - 43 is coupled to the fourth output of the preceding rprio block . in this manner , the token - in signal ti to each rprio block is supplied by the token - out to signal of the preceding block with the to signal from the last rprio block wrapping around to serve as the ti signal supplied to the first rprio block . the fourth input to each rprio block is coupled to the third input of the control state machine 102 which is contained within the rprio logic block . thus , the third input to each of the state machines 102 is the token - in signal ti . the fourth and fifth inputs to the control state machine 102 are generated within the individual rprio logic block . the fourth input to the control state machine 102 is coupled to the first output of the combinational logic block rp8 100 . the first output of the logic block rp8 100 supplies a signal bne , which symbolically stands for bitmap not equal to zero , to the fourth input of the control state machine 102 . the signal bne indicates that the eight bit portion of the bitmap 32 , associated with the particular rprio logic block , and represented within the rprio logic block by the request - in signal ri & lt ; 7 : 0 & gt ;, has at least one bit set indicating a service request . thus , when the bne signal is high , a service request exists . the signal bne , which is the fourth input signal to the control state machine 102 , is used to determine when the control state machine 102 should send out a token , to . when the signal bne is low , and thus there are no requests present within the eight bit portion of the bitmap represented by the signal ri & lt ; 7 : 0 & gt ;, the control state machine 102 will send out a token to if the previous priority request ro & lt ; 7 : 0 & gt ; had a bit set indicating that the particular rprio block was responsible for selecting the previous priority request ro & lt ; 7 : 0 & gt ;, or if ti =` 1 `, indicating that the rprio block was passed authority to determine the next request priority . the fifth input of the control state machine 102 is coupled by a line 106 , to the output of a d - type flip - flop 104 . the line 106 also couples the output of the d - type flip - flop 104 to a second input of the rp8 logic block 100 and the third output of the respective rprio block . thus , the d - type flip - flop 104 , supplies the eight bit request output signal ro & lt ; 7 : 0 & gt ; as an input signal to the fifth input of the control state machine 102 and the second input of logic block rp8 . the eight bit request output signal ro & lt ; 7 : 0 & gt ; represents the request which has currently been assigned the highest priority by the rprio logic block . the request output signal ro & lt ; 7 : 0 & gt ;, which is supplied to the third output of the rprio logic block , comprises eight bits of the thirty - two bit next request signal nr & lt ; 31 : 0 & gt ;. the four eight bit ro signals , from the four rprio logic blocks 40 - 43 are supplied to the bus 66 by the eight bit lines 66a , 66b , 66c and 66d to form the full thirty - two bit signal nr & lt ; 31 : 0 & gt ;. the control state machine 102 has a total of four outputs . the first output of the control state machine 102 serves as the fourth output of the rprio logic block and is coupled to one of the four lines 68 , 70 , 72 or 74 . the first output of the control state machine 102 is a clear request signal c0 , c1 , c2 , or c3 , which controls when a bit in the bitmap 32 will be cleared . the clear request signal is supplied to the or gate 74 located outside the rprio block , by one of the lines 68 , 70 , 72 or 74 . the second output of the control state machine 102 also serves as the second output of the rprio logic block and is coupled by one of the lines 84 , 86 , 88 or 90 to the input of the or gate 80 . in this manner , the second output of the control state machine 102 supplies the or gate 80 with the new result signal w0 , w1 , w2 , or w3 which corresponds to the corresponding rprio logic block rprio ( 0 ), rprio ( 1 ), rprio ( 2 ) or rprio ( 3 ) respectively . the third output of the control state machine 102 is the token out signal to which serves as the first output of the rprio block . the to signal serves as the token - in ti signal to the next rprio block in the chain of rprio blocks as described previously . the fourth output of the control state machine 102 is a control line 114 , which is coupled to and serves as a select line to a mux 110 . the control line 114 provides the means by which the control state machine 102 chooses between the mux &# 39 ; s two input signals ` 0 `, and rp & lt ; 7 : 0 & gt ; to select the desired output of the mux 110 . the output of the mux 110 is coupled by means of an eight bit bus 118 to the d - type flip flop 104 . the output of the d - type flip - flop 104 is the rprio request output signal ro & lt ; 7 : 0 & gt ; which is supplied by the line 106 , as the third output of the rprio block and as a feedback signal to both the eight bit combinational logic unit rp8 100 and to the control state machine 102 . as previously explained , the series of rprio logic blocks 40 - 43 contained in the access summary device 22 operate as a group to determine the 32 bit next request signal nr & lt ; 31 : 0 & gt ; with each rprio block responsible for one byte of the thirty - two bit signal . following is an explanation of how the individual rprio blocks work individually and together to determine the next request signal nr & lt ; 31 : 0 & gt ;. first , each rprio block 40 , 41 , 42 or 43 must determine if it has authority to assign the next request priority . if the rprio block has such authority , it alone can output an ro signal with a set bit while the outputs of all the other rprio blocks must be low . authority to determine the next request priority is determined by the control state machine 102 . the control state machine 102 determines if the particular rprio block has authority to determine the next request priority by checking if ro & lt ; 7 : 0 & gt ;, which represents the current priority , has a bit set . as described above , the ro signal of the respective rprio logic block is feed back to the control state machine 102 . if a bit is set in ro & lt ; 7 : 0 & gt ;, it indicates that this particular rprio block was responsible for determining the current priority and that it has the authority to determine the next request priority . the rp8 logic block 102 generates the signal bne and the request priority signal rp & lt ; 7 : 0 & gt ;. the signal bne is used by the control state machine 102 in determining when it should send out a token and which signal it should select as the output of the mux 110 . the signal rp & lt ; 7 : 0 & gt ; is the output of the rp8 logic block 102 . the signal rp & lt ; 7 : 0 & gt ; controls what the next request priority will be if that particular rprio block has the authority to determine the next request priority . the combinational logic block rp8 100 of each of the rprio logic blocks functions by determining if there is a more significant bit set in the request - in ri & lt ; 7 : 0 & gt ; signal than is set in the ro & lt ; 7 : 0 & gt ; signal . the logic block rp8 100 does this by finding the first bit position set to ` 1 ` in the request out signal ro & lt ; 7 : 0 & gt ; which indicates the current priority . as detailed above , the ro signal of the respective rprio block is feed back to the rp8 logic block 100 . the rp8 logic block 100 then tests for the first bit set in ri & lt ; 7 : 0 & gt ; above the bit position set in ro & lt ; 7 : 0 & gt ;. the position of the higher bit in ri & lt ; 7 : 0 & gt ; is determined and the corresponding bit in the request priority signal rp & lt ; 7 : 0 & gt ; is set to ` 1 ` and all other bits in rp & lt ; 7 : 0 & gt ; are set to 0 . the signal bne is also set to ` 1 ` indicating that no token should be sent out and that the control state machine 102 should select the request priority signal rp & lt ; 7 : 0 & gt ; as the output of the mux 110 . if there are no bits set in ro & lt ; 7 : 0 & gt ;, the combinational logic block rp8 100 determines the first bit position set to ` 1 ` in the request in signal ri & lt ; 7 : 0 & gt ; and then the corresponding bit in the request priority signal rp & lt ; 7 : 0 & gt ; is set to ` 1 `. all other bits in rp & lt ; 7 : 0 & gt ; are set to 0 . the signal bne is also set to ` 1 ` indicating that no token should be sent out by the control state machine 102 . however , when there are no bits set in ri & lt ; 7 : 0 & gt ; the combinational logic block rp8 100 sets all the bits in rp & lt ; 7 : 0 & gt ; to ` 0 ` and the signal bne to ` 0 ` indicating to the control state machine 102 that a token should be sent out passing the authority to determine the next request priority to the next rprio block in the sequence of rprio blocks . the control state machine 102 is responsible for determining the rprio logic block outputs and whether the particular rprio logic block has authority to determine the next request priority . the output of the mux 110 is selected by the control state machine 102 based on the value of the signals ro & lt ; 7 : 0 & gt ; and bne . furthermore , the same signals ro & lt ; 7 : 0 & gt ; and bne are used to determine when a new result signal w , clear request signal c and a token out signal to should be asserted . upon receiving an asserted priority clear pc signal , the control state machine 102 proceeds to determine the outputs of the particular rprio logic block based on the current value of bne it receives from the logic block rp8 , the value ro & lt ; 7 : 0 & gt ; and the token - in signal to . the control state machine 102 has authority to determine the next request priority if it receives either a token - in signal , ti =` 1 `, or because any bit in the stored value of ro & lt ; 7 : 0 & gt ; equals ` 1 ` indicating that the particular rprio logic block has authority to determine the next request priority , because it determined the current priority . there are several basic sets of conditions or cases which the control state machine 102 uses to determine the outputs of the particular rprio block . in the first case , the signal ro & lt ; 7 : 0 & gt ; has a bit equal to ` 1 ` and the signal bne output by the rp8 logic block 100 is also ` 1 `. this indicates that the particular rprio logic block has authority to determine the next request priority , because it determined the current priority bne =` 1 ` indicates there is a current request ri & lt ; 7 : 0 & gt ; within the particular rprio logic block which has a higher priority than the current priority . given the stated conditions , bne =` 1 ` and a bit in ro & lt ; 7 : 0 & gt ;=` 1 `, the control state machine selects rp & lt ; 7 : 0 & gt ; to be the output of the mux 110 . in this manner , the next request priority signal nr & lt ; 31 : 0 & gt ; is determined . the control state machine also outputs a new result signal w and clear request signal c at this time . the rprio block then waits for a priority clear pc signal before determining the next request priority . since this particular rprio block determined the next request priority it does not assert the token out signal to during this selection cycle . if however , the particular rprio block determined the current priority indicated by ro & lt ; 7 : 0 & gt ; having a bit set , and there are no higher bits set in ri & lt ; 7 : 0 & gt ; than are set in ro & lt ; 7 : 0 & gt ;, bne will be set to ` 0 ` by the logic block rp8 100 . the control state machine 102 will send out a token , to =` 1 `. accordingly , when the value of ro & lt ; 7 : 0 & gt ; has a bit set , ti =` 0 `, and bne =` 0 `, the control state machine 102 will select ` 0 ` as the output of the mux 110 and output a signal to =` 1 ` for that clock cycle indicating that it is passing authority to the next rprio block in the sequence to determine the next request priority . no new result signal w or clear request signal c will be asserted at this time . in the process of selecting ` 0 ` as the output of the mux 110 , the current value of the signal ro & lt ; 7 : 0 & gt ; is set to ` 0 `. the above case describes the situation where the particular rprio logic block has the authority to determine the next priority , because it determined the current priority . the token has not yet passed around the loop of logic blocks since ti = 0 . furthermore , there are no higher bits set in ri & lt ; 7 : 0 & gt ; than ro & lt ; 7 : 0 & gt ; indicating that there are no requests within the particular rprio block to be assigned the next request priority . this condition will always result whenever the current rprio logic block determined the current priority , and bit seven in ro & lt ; 7 : 0 & gt ; is set . in this case , the rprio block sends out a token , to = 1 , to pass authority to determine the next request priority to the next rprio block in the series of rprio logic blocks but doesn &# 39 ; t assert a new result signal w since no new next request priority signal nr & lt ; 31 : 0 & gt ; was generated . another case of conditions occurs when ro & lt ; 7 : 0 & gt ; has no bits set but ti =` 1 `. this indicates that the particular rprio block has authority to determine the next request priority because it was passed a token and not because it determined the current priority . if bne =` 1 `, the control state machine 102 will select the signal rp & lt ; 7 : 0 & gt ; as the output of the mux 110 and thus generate the next request priority signal nr & lt ; 31 : 0 & gt ;. at the same time , the control state machine 102 will output a new result signal w , and a clear request signal c , but no token out signal , i . e ., to =` 0 `. the rprio block will then wait for a priority clear signal pc =` 1 ` before proceeding to determine the next request priority . if ro & lt ; 7 : 0 & gt ; has no bits set , but ti = 1 and bne =` 0 `, this indicates that the rprio block has authority to determine the next request priority because it was passed a token - in ti =` 1 ` but that the particular rprio block contains no resource requests . the control state machine 102 will select ` 0 ` as the output of the mux 110 and set the token - out signal , to =` 1 ` for the duration of one clock cycle . in this way , authority to select the next priority request will be passed on to the next rprio block in the chain of rprio blocks . no new result signal w or clear request signal c will be asserted at that time by the current rprio block . in this manner , a token indicating that the particular rprio logic block has authority to determine the next request priority can be passed from rprio logic block to rprio logic block until one of the blocks determines a new next request priority . following the above logic , it is possible for a token to be passed from rprio block to rprio block or &# 34 ; ripple around &# 34 ; and with it the authority to determine the next request priority . it takes only one clock cycle for the token to be passed from one rprio block to another . therefore , it takes a maximum of four clock cycles for the apparatus to parse the entire bitmap 32 with each rprio block parsing eight bits of the thirty - two bit bitmap 32 . the above approach may be extended to systems having any number of ring buffers which may be represented by bits in a bitmap . to parse a bitmap having more than thirty - two bits , additional rprio blocks may be added to the closed loop of rprio blocks or , alternatively , the number of bits each logic block parses can be increased . each additional rprio block can parse an additional eight bits at an additional time cost of only one clock cycle for each rprio block added . for example , eight rprio blocks could be used to parse a 64 bit bitmap in only eight clock cycles .
| 6 |
fig1 is a schematic diagram of an exemplary fluid moving system 100 such as a residential heating , ventilation and air conditioning ( hvac ) system , a light industrial hvac system , or a clean room filtering system . system 100 may include a characteristic static pressure that may be determined based on the dimensions and configuration of a contained space 102 , a temperature conditioning apparatus 104 , for example an evaporator coil of an air conditioner or a heat pump , or furnace heat exchanger , a position of a flow regulator , such as , damper 106 , and a vent or register 108 . system 100 may include a ductwork channel 110 for directing a flow of fluid , for example , air to an inlet 112 of a blower 114 . channel 110 may include a filter 115 that , over time , may be subject to clogging . a motor 116 may be coupled to blower 114 through a shaft 118 for rotationally driving blower 114 . in the exemplary embodiment , motor 116 is an electronically commutated motor ( ecm ). in various embodiments , motor 116 is coupled to blower 114 through a power transmission device , such as , but not limited to a belt , a chain , and a fluid drive . temperature conditioning apparatus 104 , may be positioned within ductwork channel 110 for conditioning the fluid flowing through blower 114 and into contained space 102 . temperature conditioning apparatus 104 may be in fluid communication with a firebox of a furnace ( not shown ) or evaporator of a heat pump ( not shown ) through a heat exchanger inlet 120 and may discharge gases to a flue ( not shown ) or a heat pump return ( not shown ) through an outlet 122 . dampers 106 and / or registers 108 may selectively be positioned manually and / or automatically in relation to demand for conditioned fluid . the varying positions of dampers 106 and registers 108 or clogging of air filter 115 may cause the static pressure , into which blower 114 is directing a flow of fluid , to change . the change in static pressure may in turn cause a change in fluid flow and speed of rotation of blower 114 and motor 116 . in the exemplary embodiment , motor 116 is configured to generate a selectable level of substantially constant torque . as the static pressure in system 100 increases , a rotational speed of blower 114 and fluid flow through blower 114 decreases . the rotational speed of blower 114 may be detected continuously or intermittently to determine that the static pressure of system 100 and consequently the flow through blower 114 is decreased . the rotational speed may be compared to a predetermined rotational speed threshold for selecting a next level of substantially constant torque at which motor 116 may operate . increasing the level of torque at which motor 116 is operating increases the rotational speed of blower 114 and the fluid flow generated by blower 114 . in the exemplary embodiment , the level of substantially constant torque of motor 116 is selectable by selecting one of a plurality of selection lines 124 that are communicatively coupled to motor 116 through a commutation electronics 126 . in an alternative embodiment , the level of substantially constant torque of motor 116 is selectable through a signal line ( not shown ) communicatively coupled to commutation electronics 126 . the signal line may transmit a digital signal to a processor ( not shown ) programmed to change the level of substantially constant torque of motor 116 . fig2 is a perspective view of an exemplary selectable torque motor 116 , such as for example , an ecm . a stationary assembly 200 includes a core or stator 202 of a ferromagnetic material , and a winding arrangement 204 . in the exemplary embodiment , the windings associated with winding arrangement 204 are configured to be electronically commutated in at least one preselected sequence . in an alternative embodiment , the windings associated with winding arrangement 204 are configured to be selectable separately or in combination to affect different discrete torque operating levels . a rotatable assembly 206 of motor 116 is rotatably associated with stationary assembly 200 and may include a permanent magnet rotor 208 operable generally for rotatably driving blower 114 . rotatable assembly 206 may be associated , in selective magnetic coupling relation , with permanent magnet rotor 208 , so as to be rotatably driven about a longitudinal axis 209 by multistage winding arrangement 204 upon the electronic commutation thereof . permanent magnet rotor 208 includes a plurality of magnet material elements 210 secured to a rotor 212 generally about the circumference thereof , and the rotor is secured about a shaft 214 . rotor shaft 214 may be journaled by one or more bearings ( not shown ) in a pair of opposite end frames ( not shown ) forming a part of stationary assembly 200 , and rotor shaft 214 is configured to be coupled in rotatable driving relation with blower 114 . motor 116 may include a commutation electronics 216 configured to sense a rotational position of rotatable assembly 206 within stationary assembly 200 and to provide signals to the winding stage in a preselected order to magnetically drive rotatable assembly 206 about longitudinal axis 209 . in the exemplary embodiment , commutation electronics 216 may include a plurality of input lines that may be used to transmit selection signals from a user &# 39 ; s control device ( not shown ) to motor 116 . in one embodiment , each of the input lines corresponds to a constant torque configuration of motor 116 . in another embodiment , the input lines may be used in combination to transmit selection signals from a user &# 39 ; s control device to motor 116 . the selection signals may be used to select one of a plurality of constant torque configurations of motor 116 . in an alternative embodiment , a processor 220 may be used to receive a selection signal or message from a user &# 39 ; s control device through a cable 222 . processor 220 may be programmed to control motor 116 to provide one of a plurality of selectable constant torque output levels based on the selection signal or message . in the exemplary embodiment , motor 116 is a permanent magnet electrical machine with magnet material elements 210 spaced substantially circumferentially along an out periphery of permanent magnet rotor 208 and multiple , spatially distributed winding arrangement 204 on stator 202 . current in the windings of winding arrangement 204 interacts with the permanent magnetic field to produce the motor &# 39 ; s torque . to maintain a constant torque as the rotor turns , the current distribution in stator 202 is continually adjusted to maintain a constant spatial relationship with the magnetic field of rotor 208 . the adjustment in current distribution is accomplished by switching (“ commutating ”) current among the various stator winding phases . commutation may be effected electronically by controlling the conduction states of a multiplicity of electronic power devices ( not shown ) electrically coupling the various stator phase windings to a power bus . fig3 is a graph 300 illustrating an exemplary flow versus static pressure relationship for a system that may be used with blower 114 and motor 116 ( shown in fig1 ). graph 300 includes an x - axis 302 graduated in divisions of fluid flow expressed in cubic feet per minute ( cfm ) and a y - axis 304 graduated in divisions of system static pressure expressed in units of inches of water ( in h 2 o ). a plurality of constant torque lines define the operating characteristics for the combination of blower 114 , motor 116 , and system 100 . a first constant torque line 306 defines an fluid flow response of blower 114 for a system static pressure that is defined by the positions of dampers 106 and registers 108 when a first torque operating level for motor 116 is selected . similarly , a second constant torque line 308 , a third constant torque line 310 , a fourth constant torque line 312 , and a fifth constant torque line 314 respectively define an fluid flow response of blower 114 for an associated system static pressure when respective torque operating levels are selected . a line 316 illustrates a desired constant fluid flow through system 100 , a line 318 illustrates a lower limit of fluid flow , and a line 320 illustrates an upper limit of fluid flow for system 100 . together , lines 318 and 320 define a band 321 of desired fluid flows through system 100 that is generally equally spaced about line 316 , although band 321 may be selected to be spaced about line 316 in non - equally . in operation , system 100 may initially be operating at a point 322 , for example , wherein motor 116 is selected to be outputting a first level of torque and blower 114 is outputting the desired fluid flow as indicated by operating point 322 being at the intersection of constant torque line 306 and fluid flow line 316 . if a change in system 100 causes an increase in system static pressure , such as a repositioning of dampers 106 and / or registers 108 , the system operating parameters will change such that system 100 will operate at a new operating point 324 along line 306 . because motor 116 is configured to maintain the selected torque output substantially constant , when system static pressure increases the system operating point changes such that the fluid flow will decrease to a value corresponding to the intersection of line 306 and the value of static pressure the system is operating at . in this example , changes to system 100 caused system static pressure to increase from approximately 0 . 25 in h 2 o to approximately 0 . 31 in h 2 o . the system operating point moves along line 316 to operating point 324 wherein the fluid flow through system 100 and the speed of rotation of motor 116 decreases correspondingly . a further change in the position of dampers 106 and / or registers 108 , or other device that may affect system static pressure may cause the system parameters to change such that the system will operate at another new operating point 326 along line 306 . if at this point the speed of motor 116 reaches a value that corresponds to an fluid flow defined by lower limit 318 , a speed sensor or a sensor configured to sense a parameter that may correspond to the rotational speed of motor 116 , may transmit a signal that causes motor 116 to operate at a second torque level defined by second constant torque line 308 . motor 116 will accelerate rotationally to operating point 328 such that motor 116 speed and fluid flow through blower 114 increases to a value corresponding to the intersection of the value of static pressure and constant torque line 308 . system 100 operates similarly for further increases in system static pressure by stepping to a next higher selectable constant torque level when the speed of motor 116 and correspondingly , the fluid flow through blower 114 decreases to lower a value defined by lower fluid flow limit 318 . fig4 is a graph 400 illustrating another exemplary flow versus static pressure relationship for a system that may be used with blower 114 and motor 116 ( shown in fig1 ). graph 400 includes an x - axis 402 graduated in divisions of fluid flow expressed in cubic feet per minute ( cfm ) and a y - axis 404 graduated in divisions of system static pressure expressed in units of inches of water ( in h 2 o ). a plurality of constant torque lines define the operating characteristics for the combination of blower 114 , motor 116 , and system 100 . a first constant torque line 406 defines an fluid flow response of blower 114 for a system static pressure that is defined by the positions of dampers 106 and registers 108 when a first torque operating level for motor 116 is selected . similarly , a second constant torque line 408 , a third constant torque line 410 , a fourth constant torque line 412 , and a fifth constant torque line 414 respectively define an fluid flow response of blower 114 for an associated system static pressure when respective torque operating levels are selected . a line 416 illustrates a desired constant fluid flow through system 100 , a line 418 illustrates a lower limit of fluid flow , and a line 420 illustrates an upper limit of fluid flow for system 100 . together , lines 418 and 420 define a band 421 of desired fluid flows through system 100 that is generally equally spaced about line 416 , although band 421 may be selected to be spaced about line 416 in non - equally . in operation , system 100 may initially be operating at a point 422 , for example , wherein motor 116 is selected to be outputting a third level of torque and blower 114 is outputting the desired fluid flow as indicated by operating point 422 being at the intersection of constant torque line 410 and fluid flow line 416 . if a change in system 100 causes an decrease in system static pressure , such as a repositioning of dampers 106 and / or registers 108 , the system operating parameters will change such that system 100 will operate at a new operating point 424 along line 410 . because motor 116 is configured to maintain the selected torque output substantially constant , when system static pressure decreases , the system operating point changes such that the fluid flow will increase to a value corresponding to the intersection of line 410 and the value of static pressure the system is operating at . in this example , changes to system 100 caused system static pressure to decrease from approximately 0 . 62 in h 2 o to approximately 0 . 57 in h 2 o . the system operating point moves along line 410 to operating point 424 wherein the fluid flow through system 100 and the speed of rotation of motor 116 increases correspondingly . a further change in the position of dampers 106 and / or registers 108 , or other device that may affect system static pressure may cause the system parameters to change such that the system will operate at another new operating point 426 along line 410 . if at this point the speed of motor 116 reaches a value that corresponds to a fluid flow defined by upper limit 420 , a speed sensor or a sensor configured to sense a parameter that may correspond to the rotational speed of motor 116 , may transmit a signal that causes motor 116 to operate at a different torque level defined by second constant torque line 408 . motor 116 will decelerate rotationally to operating point 428 such that motor 116 speed and fluid flow through blower 114 decreases to a value corresponding to the intersection of the value of static pressure and constant torque line 408 . system 100 operates similarly for further decreases in system static pressure by stepping to a next lower selectable constant torque level when the speed of motor 116 and correspondingly , the fluid flow through blower 114 increases to an upper value defined by upper fluid flow limit 420 . the above - described embodiments of methods and apparatus for discrete speed compensated torque step motor control are cost - effective and highly reliable for maintaining a relatively constant flow through a fluid system using relatively less expensive control components such that a selectable substantially constant torque is generated by the motor in response to an input signal indicative generally of motor speed . while the invention has been described in terms of various specific embodiments , those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the claims .
| 7 |
while the present invention is described herein with reference to illustrative embodiments for particular applications , it should be understood that the invention is not limited thereto . those having ordinary skill in the art and access to the teachings provided herein will recognize additional modifications , applications , and embodiments within the scope thereof and additional fields in which the present invention would be of significant utility . fig1 is a partial view of the housing 10 of an electronic device , which may , for purposes of the following discussion , take the form of a body of a flip phone assembly . housing 10 may be formed of molded plastic or formed / cast metal and include a hollow , sleeve - shaped portion 12 with an indentation 14 formed on the surface thereof . as will be explained below , a hinge clutch mechanism 16 formed in accordance with the present invention is shown in fig2 . the mechanism is specifically designed to be inserted within housing 10 with a portion of the mechanism extending within hollow sleeve 12 . sleeve 12 serves as partial cover for protecting and supporting hinge clutch mechanism 16 . referring now to fig3 an exploded view of the hinge clutch mechanism 16 includes , from top to bottom , an elongated cam - shaft 18 , a face cam member 20 , a separate cam follower 22 , a compression spring 24 and a retaining member 26 . as shown in fig4 and 5 , cam - shaft 18 is substantially of rectangular configuration and includes an end portion 28 having a generally “ y ” shaped configuration . the rotational lid portion 30 of the portable electronic has a compatible , generally “ y ” shaped opening 32 as shown in fig1 . it is to be understood that the end portion 28 and the lid opening 32 could be formed of any conventional , compatible shapes that would allow for transmission of torque . when the hinge clutch mechanism 16 is assembled within housing 10 , the “ y ” shaped end 28 of cam - shaft 18 extends within the “ y ” shaped opening 32 of the lid 30 . as lid 30 is rotated relative to housing 10 , interaction of the end portion 28 with the lid opening 32 causes cam - shaft 18 to rotate in a similar manner . the importance of this rotation will soon become clear . cam - shaft 18 includes a first pair of oppositely disposed , substantially - rectangular lands 34 extending generally less than one half the length of cam - shaft 18 starting from end 28 . cam - shaft 18 also includes a second pair of oppositely disposed , substantially rectangular lands 36 , wherein each land 36 is positioned approximately 90 ° from each land 34 . the second pair of lands 36 also extends from end 28 a distance greater than the length of the first pair of lands 34 . as will be discussed , the lands 34 and 36 serve to lock cam follower 22 for joint rotation with cam - shaft 18 while allowing cam follower 22 to move along the longitudinal axis of cam - shaft 18 . cam - shaft 18 includes a further end 38 oppositely disposed from end 28 and formed with a pair of rectangular protrusions 40 . the protrusions 40 extend outwardly on opposite sides of cam - shaft 18 and are aligned with lands 34 . the protrusions 40 prevent the retaining member 26 from inadvertently separating from cam - shaft 18 in a manner that will become clear . face cam member 20 is shown in fig6 and 7 to be of generally cylindrical configuration with a cylindrically shaped through opening 42 . through opening 42 is of sufficient diameter to allow the elongated cam - shaft 18 , including lands 34 and 36 to freely extend through cam member 20 a distance until cam member 20 abuts cam - shaft end portion 28 . as shown in fig2 and 6 , a curved lip 44 extends both outwardly from the cylindrical surface of cam 20 and beyond the flat end face 46 of cam member 20 . when the hinge clutch mechanism 16 is assembled as shown in fig2 lip 44 overhangs cam shaft end portion 28 . when cam member 20 is disposed within housing 10 as part of hinge clutch mechanism 16 , the lip 44 rests in and engages a compatible opening formed in housing 10 , not shown , preventing cam 20 from rotating about its longitudinal axis . as best shown in fig7 cam member 14 further includes a specially designed , undulating ridge end face 48 confronting cam follower 22 . ridge face 48 is contoured to mate with a confronting ridge end face 50 of cam follower 22 as will be discussed . as shown in fig8 and 9 , respectively , cam follower 22 is of generally cylindrical configuration with a centrally disposed through opening 52 . opening 52 has a generally cross - shaped configuration compatible in size to the lands 34 and 36 extending from cam - shaft 18 . when assembled , the lands 34 and 36 of cam - shaft 18 pass through opening 52 of cam follower 22 . cam follower 22 can be moved along cam - shaft 18 until its ridge end face 50 is adjacent the confronting ridge end face 48 of cam member 20 . because opening 52 is similar in shape to lands 34 and 36 , rotation of cam - shaft 18 causes a similar rotation of cam follower 22 . as shown in fig9 cam follower 22 further includes a flat end face 54 oppositely disposed from ridge end face 50 . when hinge clutch mechanism 16 is assembled , a forward end of compression spring 24 abuts end face 54 , pressing confronting ridge faces of cam follower 22 cam member 20 against each other . spring 24 also functions to press cam member 20 against cam - shaft end 28 . the cylindrically - shaped retaining member 26 , are shown in fig1 and 11 to include an end wall 55 having an opening 56 of substantially rectangular configuration . opening 56 is compatible in size to the size of overall size of cam - shaft end 38 including protrusions 40 . during assembly of hinge clutch mechanism 16 , cam - shaft end 38 is inserted through opening 56 of retaining member 26 , after which retaining member 26 is then rotated approximately 90 °. such rotation brings protrusions 40 out of alignment with the rectangular shape of opening 56 . a rearward end of spring 24 presses against wall 55 of retaining member 26 to maintain wall 55 in contact with protrusions 40 , preventing separation of cam - shaft 18 and retaining member 26 . in the present specific embodiment , the undulating cam ridge end face 48 and the confronting , undulating cam follower ridge end face 50 each have two oppositely disposed peaks and two oppositely disposed valleys . specifically , ridge face 48 has opposite peaks 48 a and 48 b and opposite valleys 48 c and 48 d , respectively . likewise , ridge face 50 has opposite peaks 50 a and 50 b and opposite valleys 50 c and 50 d respectively . when a first peak 48 a rests in a first valley 50 c , cam member 20 assumes a first potential energy state or potential well corresponding to a first stable orientation of the lid portion 30 relative to housing 10 of the electronic device . at the same time the first peak 50 a rests in the first valley 48 c , the second peak 50 b will rest in valley 48 d . when the first peak 48 a rests in the second valley 50 d , the cam member 20 is in a second potential energy state or potential energy well corresponding to second stable orientation of the lid portion 30 relative to the housing 10 of the electronic device . the potential energies of cam member 20 in the first potential energy state and the second potential energy state are approximately equivalent . the relative positions of the valleys 48 c , 48 d and peaks 48 a , 48 b on the ridge 48 of cam member 20 and on the valleys 50 c , 50 d and peaks 50 a , 50 b on the ridge 50 of cam follower 22 are substantially 180 ° apart ; however , open and closed states are only 150 - 155 ° apart . the difference , substantially 25 - 30 °, facilitates the stabilization of the first and second stable orientations , corresponding to open and closed states , respectively , of the lid 30 relative to the housing 10 of the electronic device . when the hinge clutch mechanism 16 is in the first or second potential energy states , the compression spring 24 is in a more decompressed state but remains slightly compressed to maintain a spring - loaded state of the hinge clutch mechanism 16 . the hinge clutch mechanism 16 assumes a third potential energy state when a first peak 48 a rides on a first peak 50 a and a second peak 48 b rides on a second peak 50 b . in the third potential energy state , the position of the lid 30 relative to housing 10 of the electronic device is relatively unstable . similarly , the hinge clutch mechanism 16 is in a fourth potential energy state when a first peak 48 a rides on a second peak 50 b . in the fourth potential energy state , the lid 30 and the housing 10 of the electronic device are relatively unstable . the potential energies of the hinge clutch mechanism 16 in the third and fourth potential energy states are approximately equivalent . when the hinge clutch mechanism 16 is in either the third or fourth potential energy states , the spring 24 is in a more compressed state than when the hinge clutch mechanism 16 is in the first or second potential energy states . when cam - shaft 18 is caused to rotate by rotation of attached lid 30 , the lands 34 , 36 on cam - shaft 18 cause cam follower 22 to rotate in a similar direction . while cam follower 22 may rotate , cam member 20 is restrained from rotation by the engagement of curved lip 44 with the compatible cavity , not shown , in housing 10 . as cam follower 22 starts to rotate , the ridge end face 50 of cam follower 22 rides on ridge end face 48 of fixed position cam member 20 . the only way the undulating ridges 48 and 50 can rotate relative to one another is for cam follower 22 to move away from cam 20 along the longitudinal axis of cam - shaft 18 . this axial movement of cam follower 22 causes spring 24 to first compress as the peaks 48 a and 50 a come into contact with one another and then decompress as the peaks 48 a , 48 b and 50 a , 50 b each move into the valleys 48 c , 48 d and 50 c , 50 d , respectively . when peaks on the ridge 50 of cam follower 22 ride on corresponding peaks of ridge 48 of cam 20 , the spring 24 is maximally compressed and the hinge clutch mechanism 16 assumes its relatively unstable state . in this relatively unstable state , the tangential resistance about the longitudinal axis of cam - shaft 18 is relatively small . when the valleys 48 c and 48 d on the ridge 48 of cam 20 ride on the corresponding peaks 50 a and 50 b of the ridge 50 of cam follower 22 , the hinge clutch mechanism 16 is in a relatively stable state and the spring 24 is minimally compressed . the tangential resistance about the longitudinal axis of cam - shaft 18 is relatively large . when the lid 30 of the electronic device is in its fully closed or fully open position , the peaks of either the cam follower 22 or the cam member 20 are adjacent the valleys of the other component . in order to rotate the lid 30 from its closed to its open or from its open to its closed position , it will be necessary to apply sufficient force to over come the resistance exerted by spring 24 . sufficient force will be needed to move the peaks of cam follower 22 past the peaks of cam member 20 . once facing peaks are passed , the action of the spring 24 actually assists in completing the rotation of the lid 30 to its fully open or closed position , respectively . as shown in fig1 , retaining member 26 is formed with a pair of indentations 60 of sufficient size to insert a small screwdriver or similar tool . during assembly or disassembly of hinge clutch mechanism 16 , retaining member 26 can be moved along the axis of cam - shaft 18 by inserting such a tool into one of the indentations 60 and pressing in the direction of cam follower 22 . this action serves to collapse the hinge clutch mechanism 16 by compressing spring 24 . once the mechanism is sufficiently compressed , it may be easily removed from the housing 10 of the electronic device . to assist in the removal , a buttress 64 may be molded or otherwise mounted in housing 10 , see fig1 and disposed such that a small pair of pliers may have one end applied to buttress 64 and the remaining end inserted into one of the indentations 60 . by squeezing the pliers , spring 24 is compressed , allowing retaining member 26 to slide towards cam follower 22 . as shown in fig1 and 12 - 14 , a separate idler 70 is positioned in housing 10 adjacent to retaining member 26 . idler 70 is preferably formed of plastic or similar cost effective material . spring 24 presses retaining member 26 into frictional contact with idler 70 . idler 70 includes a substantially “ c ” shaped end portion 72 which extends through a portion of housing 10 , see fig1 . because of the non - symmetrical shape of idler 70 , it will not rotate relative to housing 10 . idler 70 includes a dove - tailed opening 80 extending from a central passageway 78 through a side wall to the external surface . when assembled , wire or flexible cable joining housing 10 to lid 30 may pass through slit 76 , passageway 78 and dove - tailed opening 80 . because of the continuous passageway through idler 70 and the fact that idler 70 is fixed against rotation , the wire 70 a will not be pinched or torn when lid 30 is rotated between its fully open and fully closed positions . the dove - tailed opening 80 further serves to prevent any connecting wire 70 a from slipping out of proper alignment during repeated opening and closing of lid 30 . during disassembly , after retaining member 26 is pressed toward cam follower 22 , compressing spring 24 , cam - shaft 18 may be removed from housing 10 . at this point , idler 70 may be separated from housing 10 . all parts of the hinge clutch mechanism 16 of the present invention may be molded or formed or machined by processes well known to one of ordinary skill in the art . thus the present invention has been described herein with reference to a particular embodiment for a particular application . those having ordinary skill in the art and access to the present teachings will recognize additional modifications , applications and embodiments within the scope thereof . it is therefore intended by the appended claims to cover any and all such applications , modifications and embodiments within the scope of the present invention .
| 4 |
fig1 is a block diagram of an exemplary embodiment of a network device 10 in accordance with the present invention . the device 10 can be , for example , a resilient ring processor implemented on one or more integrated circuits or on a circuit board . the network device 10 comprises three , bidirectional ports ( port 1 to port 3 ), for coupling to a host , a mate , and a ring , respectively . the network device 10 generally comprises three peripheral translation blocks 11 - 13 , one for each port , and a core 15 . the core 15 represents the bulk of the functionality and structure of the device 10 . thus , for example , if the device 10 provides rpr / srp layer 2 functionality , the core 15 contains the elements that perform layer 2 functions such as checking , parsing , forwarding and terminating packets . fig1 a shows two network devices 10 . 1 , 10 . 2 coupled together to form a fully functional node 100 in a ring network 1000 . the ring network 1000 comprises an inner ring , in which data is conveyed in a counter - clockwise direction and an outer ring in which data is conveyed in a clockwise direction . as shown , the node 100 comprises two access ports to the ring network 1000 , two access ports to the host and a joint mutual access port between the two “ mate ” devices 10 . 1 , 10 . 2 . as with conventional network devices , the network devices of the present invention can also be used individually in half nodes ( e . g ., for termination functions ). while the implementation of the peripheral translation 11 - 13 is dependent on the communication protocol employed between the device 10 and the external elements ( host , mate and ring ), the implementation of the core 15 is generally independent of any such protocols . as such , the core 15 is isolated from any changes to the communications protocol , thereby minimizing the design shock caused by changes in the communications protocol . fig2 shows an exemplary format of a packet header 20 , such as would be used in accordance with the spatial reuse protocol ( srp ) architecture . table i describes the various fields of the header 20 . fig3 shows an exemplary format of a packet header 30 , such as would be used in accordance with the resilient packet ring ( rpr ) architecture . table ii describes the various fields of the header 30 . table ii field bit positions description remarks time to live [ 15 : 8 ] 8 bits indicating same in srp number of hops ring id [ 7 ] 1 bit indicating same in srp inner or outer ring mode [ 6 : 5 ] 2 bit packet 3 bits in srp type identifier fairness [ 4 ] 1 bit indicating n / a in srp eligible rate control eligibility priority [ 3 : 2 ] 2 bit priority 3 bits in srp identifier wrap eligible [ 1 ] 1 bit indicating n / a in srp eligibility to wrap parity [ 0 ] 1 bit indicating used as parity parity protection only in usage packets ; reserved in other packets as can be seen , the nine most significant bits of the srp and rpr packet headers 20 and 30 , respectively , are identical . of the bits that are different , bit 0 is used for parity in all srp packets whereas in rpr , parity is used only in special types of packets known as “ usage ” packets ( described more fully below ). furthermore , bit 1 is used to indicate wrap eligibility , and bit 4 indicates fairness eligibility in the rpr packet header 30 . the wrap eligibility bit of an rpr packet indicates whether the packet can wrap around at a node with wrap . at a node with wrap , wrap eligible packets that are received on one ring are sent out on the other ring . if a packet that is not wrap eligible ( i . e ., bit 1 = 0 ) arrives at a node with wrap , the packet is discarded . the fairness eligibility bit of an rpr packet indicates whether the packet is subject to rate control . if bit 4 is set , the bytes in the packet are counted towards determining congestion . another difference between the two architectures is that in srp packets , three bits are used for priority whereas only two bits are used in rpr packets ( see fig2 and 3 , tables i and ii ). in the srp architecture , a determination is made as to whether a packet has high or low priority by comparing the numerical value ( i . e ., 0 - 7 ) of the three priority bits to the numerical value of a three - bit priority register . if the numerical value of the priority bits exceeds that of the priority register , the packet is considered to have high priority , otherwise it is considered to have low priority . in the case of rpr packets , the lowest order priority bit , bit 1 , is replaced by the wrap eligibility bit and bits 3 and 2 indicate priority with the values 11 and 10 indicating high priority , 01 indicating medium priority and 00 indicating low priority . in order to use the same logic to determine the priority of both srp and rpr packets , the three - bit priority register in the case of rpr packets is programmed , in an exemplary embodiment of the present invention , to have a value of 011 . by programming the priority register with the value 011 , the value of the wrap eligibility bit becomes irrelevant to the priority determination , and packets with bits 3 and 2 set to 11 or 10 are treated as high priority , in accordance with the 2 - bit priority scheme of the rpr architecture . although the differences in packet header format are seemingly small , they have significant implications for the implementation of each architecture . for the forwarding , termination , and discarding of packets to be carried out correctly , the packets must be correctly identified , and these seemingly minor modifications must be implemented throughout the design , leading to a major re - design and re - verification effort . such efforts are further increased if the old and new architectures are to co - exist . in order to avoid the above - described difficulties , the present invention provides a method of translating or “ mapping ” one packet header format into the other . in accordance with the present invention , two types of peripheral translation blocks are provided , referred to as “ forward ” and “ backward ” translation blocks . a forward translation block maps the new , rpr format to the old , srp format , whereas a backward translation block maps the old , srp format to the new , rpr format . as shown in fig1 , a forward translation block , 11 . 1 , 12 . 1 and 13 . 1 , is provided at each of the three ingress points of the peripheral translation blocks 11 , 12 and 13 of the device 10 , whereas a backward translation block , 11 . 2 , 12 . 2 and 13 . 2 , is provided at each of the three egress points of the peripheral translation blocks 11 , 12 and 13 of the device 10 . fig4 illustrates the translation that is carried out by each of the forward translation blocks 11 . 1 , 12 . 1 , 13 . 1 . as shown in fig4 , the contents of a packet header in the rpr format are rearranged as indicated . as such , the header of an rpr packet flowing through the core 15 of the exemplary embodiment will have the format shown in the lower half of fig4 . in the egress direction , the backward translation blocks 11 . 2 , 12 . 2 , and 13 . 2 carry out a backward translation in which the we and fe bits return to their original positions . this backward mapping is illustrated in fig5 . also if a packet is of the type requiring parity , such as a usage packet , the parity bit ( bit 0 ) is regenerated by the backward translation block 11 . 2 , 12 . 2 , 13 . 2 , otherwise , bit 0 is set to 0 . the translation blocks 11 , 12 , and 13 can be implemented in a variety of ways known to persons of ordinary skill in the art . by thus performing format translation at the ingress and egress points , in accordance with the above - described exemplary embodiment of the present invention , the core 15 is isolated from packet format changes while keeping the function of the device 10 compatible with more than one established standard and thus capable of inter - working with other devices that adhere to those standards . any design shocks are absorbed at the peripheral translation blocks without affecting the core . the forward and backward translation of srp and rpr packet headers is presented herein to illustrate the present invention , which is not limited to these specific formats . the exemplary embodiment shown is only one application of the present invention which can be extended to any network , any protocol , or any port . in addition to the above - discussed packet header format differences , there are additional differences in the data link layers ( or osi layer 2 ) of the srp and rpr architectures . these are addressed by another aspect of the present invention described below . as discussed above , the two architectures have a substantial core functionality that is common to both and which is independent of any changes in packet format . because the packet differences are at layer 2 , substantial adaptation can be done at the periphery of each network device , including adaptation that includes pipe changes such as adding processing logic in the data path for staging and performing error correction related functions ( e . g ., error correction code generation and checking ). the aforementioned differences in layer 2 functions between the srp and rpr architectures will now be discussed with reference to fig6 a and 6b . fig6 a illustrates the general format of an srp packet 61 . as described above in connection with fig2 , the packet header 20 is protected by parity ( bit 0 ). the rest of the packet payload 62 , including the layer 2 addresses 62 a , 62 b following the header , is protected by a cyclic redundancy code ( crc ) 63 . fig6 b shows the general format of an rpr packet 65 . the header 30 , described above in connection with fig3 , the layer 2 addresses 66 a , 66 b , and the two bytes that follow , also referred to as the “ rpr header 2 ” 66 c , are protected by a two - byte header error correction ( hec ) code 67 . the balance of the packet payload 68 is protected by a crc 69 . the header error correction ( hec ) integrity check mechanism used in the rpr architecture ensures greater routing - and addressing - related integrity by isolating the first 16 bytes of the header ( which contains the routing and addressing information ) from the packet payload 68 , which is protected by the crc check mechanism . moreover , the correction capability of hec allows a packet to be forwarded despite the presence of an erroneous bit . as a result , discarding an rpr packet because of single bit errors in the routing information is rare . this feature is desirable in the transport of constant rate voice traffic where an imperfect packet is better than an absent packet for the regeneration of voice at the termination point . because of the real - time nature of voice transmission and tdm - related traffic , the retransmission mechanism available in packets is not possible . the use of hec thus enables the placement of voice , video and packet traffic on the same ring . second , in the rpr architecture , because of the addition of the two - byte rpr header 2 and the hec code which is also two bytes , the position of the layer 2 second level packet type identifiers is shifted by four bytes relative to their position in the srp architecture . the packet type identifiers comprise two bytes at the beginning of the packet payload 62 , 68 which identify the packet type for layer 3 . for packet types that are native to the ring ( e . g ., protection , usage or control packet types ) these two bytes further identify which packet ( e . g ., topology , oam , etc . for control type packets ). the remaining differences between the two architectures are related to packet switching decisions and in the implementation of advanced rate control features through the support of multi - choke algorithms enabled by the addition of various types of usage packets . a usage packet is a rate - controlling packet that conveys the rates between nodes so that congestion and choke points can be identified and appropriate rates adjusted in terms of new traffic on the node . the usage packet links all nodes on a ring for efficient and reliable running of the rate control algorithms , and in particular , the arbitration of forwarded versus new traffic ( i . e ., traffic inserted at each node ) for continued access to the ring . for legacy and backwards compatibility reasons , usage packets are the same in both the rpr and srp architectures . as described above in connection with fig3 , usage packet headers are still parity protected in the rpr architecture . an exemplary embodiment of the present invention will now be described which addresses the above - described changes allowing the adaptation and co - existence of the two incompatible architectures . an aspect of the present invention lies in the clean delineation between the core functionality , which is independent of packet format and error protection differences , and the provision of programmable adaptation at the lines coupling the various ports and the core . in accordance with an exemplary embodiment of the present invention , line adaptation of the two architectures is provided by a bidirectional data path adaptor at each of the three ports of a network device . fig7 is a block diagram of an exemplary embodiment of a network device 70 in accordance with the present invention . the network device 70 has three , bidirectional ports ( port 1 to port 3 ), for coupling to a host , a mate network device , and a ring network , respectively . the network device 70 generally comprises three bidirectional data path adaptors 71 , 72 and 73 , one for each port , and a core 75 . the core 75 represents the bulk of the functionality and structure of the device 70 . the exemplary device 70 incorporates the functionality of the device 10 described above in connection with fig1 and further addresses the additional differences described above between the srp and rpr architectures . while the implementation of the data path adaptors 71 - 73 is dependent on the communication protocol employed between the device 70 and the external elements ( host , mate and ring ), the implementation of the core 75 is generally independent of any such protocols . as such , the core 75 is isolated from any changes to the communications protocol , thereby minimizing the design shock caused by changes in the communications protocol . although the three adaptors 71 - 73 have substantial similarities , because of functional differences due their corresponding ports , the three adaptors are not logically equivalent in all modes . exemplary embodiments for the adaptors 71 - 73 will now be described with reference to fig8 and 9 . fig8 shows a block diagram of an exemplary embodiment of the data path adaptor 73 for the ring port of device 70 . the adaptor 73 interfaces with the network ( ring ) on one side , and the core 75 , which , as discussed , is packet format independent . the adaptor 73 incorporates the translation block 13 for mapping between the different packet header formats at the ingress and egress points , as described above . the adaptor 73 also includes a hec generator 82 and a parity generator 86 in the egress data path and a hec checker 83 and a parity checker 87 in the ingress data path . the hec checker 83 can discard packets containing more than one error and can correct ( or discard ) single - bit hec errors . in an exemplary embodiment , single - bit error correction entails the generation of 128 unique syndromes in order to detect one of 128 correctable errors . the parity blocks 86 , 87 are arranged in bypass paths around the hec blocks 82 , 83 . the bypass paths are used for srp traffic or usage packets in rpr . this feature allows the two architectures to coexist without interfering with each other . the blocks 82 , 83 or the by - pass paths are selected by selectors 84 , 85 , respectively . consistent with the discussion above with reference to fig6 a and 6b , the hec blocks 82 , 83 operate on the first 16 bytes of the rpr packets whereas the parity blocks 86 , 87 operate on the header of the srp , or rpr usage packets . the selectors 84 , 85 can be implemented with 2 : 1 multiplexers , for example and can be controlled , for example , by a programmable bit in a register ( not shown ) and / or logic ( not shown ) that detects the presence of a usage packet . the mate port data path adaptor 72 is similar to the ring data path adaptor 73 . a notable difference is that single - bit error correction and the ability to discard packets is absent in the mate data path adaptor . in the out bound data path ( i . e ., from the core to the port ), the hec is regenerated in the mate port data path adaptor 72 as in the ring port data path adaptor 73 . it should be noted that the crc mechanism is the same for both srp and rpr architectures and can thus be shared ; i . e ., the crc generating and checking functions can be implemented in the core 75 of the network device 70 . as discussed above with reference to fig6 a and 6b , the crc 63 covers the packet payload 62 of an srp packet and the crc 69 covers the packet payload 68 of an rpr packet . since the first 16 bytes of the rpr header are not covered by the crc 69 and the header 20 of the srp packet and the hec 67 of the rpr packet are both two bytes each , the boundaries of the payloads 62 and 68 are similar , thus allowing sharing of the same crc checking and generating blocks . these blocks can be implemented in conventional ways . fig9 shows a block diagram of an exemplary embodiment of the data path adaptor 71 for the host port of the device 70 . the host port is a termination point for layer 2 in the interface between layer 2 and layer 3 . in the pathway from the core to the host port , the hec and the rpr header 2 are stripped from each packet at blocks 93 and 95 , respectively . conversely , in the pathway from the host port to the core , the hec and the rpr header 2 are inserted into each packet at blocks 92 and 94 , respectively . additionally , the adaptor 71 incorporates the translation block 11 for mapping between the different packet header formats at the ingress and egress points , as described above . as with the adaptors for the ring and mate ports , the adaptor 71 also includes , for each data path , a bypass path around the hec blocks 92 - 95 . the bypass paths are used for srp traffic and usage packets . this feature allows the two architectures to coexist without interfering with each other . the hec blocks 92 - 95 or the by - pass paths are selected by selectors 96 , 97 , respectively . the selectors 96 , 97 can be implemented with 2 : 1 multiplexers and can be controlled by a programmable bit in a register ( not shown ) and / or suitable logic ( not shown ) for detecting the processing of a usage packet . the various protection and error detection / correction devices ( e . g ., crc / hec / parity generator / checkers ) described above can be implemented in conventional ways . it is to be understood that while the invention has been described above in conjunction with preferred specific embodiments , the description is intended to illustrate and not to limit the scope of the invention , as defined by the appended claims . indeed , various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures . such modifications are intended to fall within the scope of the appended claims . it is further to be understood that all values are to some degree approximate , and are provided for purposes of description . the disclosures of any patents , patent applications , and publications that may be cited throughout this application are incorporated herein by reference in their entireties .
| 7 |
the inventors have found a novel thermodynamical cycle ( system and process ) can be implements using a working fluid including a mixture of at least two components . the preferred working fluid being a water - ammonia mixture , though other mixtures , such as mixtures of hydrocarbons and / or freons can be used with practically the same results . the systems and methods of this invention are more efficient for converting heat from relatively low temperature fluid such as geothermal source fluids into a more useful form of energy . the systems use a multi - component basic working fluid to extract energy from one or more ( at least one ) geothermal source streams in one or more ( at least one ) heat exchangers or heat exchanges zones . the heat exchanged basic working fluid then transfers its gained thermal energy to one or more ( at least one ) turbines ( or other system for extracting thermal energy from a vapor stream and converting the thermal energy into mechanical and / or electrical energy ) and the turbines convert the gained thermal energy into mechanical energy and / or electrical energy . the systems also include pumps to increase the pressure of the basic working fluid at certain points in the systems and one or more ( at least one ) heat exchangers which bring the basic working fluid in heat exchange relationships with one or more ( at least one ) cool streams . one novel feature of the systems and methods of this invention , and one of the features that increases the efficiency of the systems , is the result of using a two circuit design having a higher pressure circuit and a lower pressure circuit and where a stream comprising spent liquid separated for spent vapor from the higher pressure circuit is combined with a stream comprising the spent lower pressure stream at the pressure of the spent lower pressure stream prior to condensation to from the initial fully condensed liquid stream and where the combined stream is leaner than the initial fully condensed liquid stream . the working fluid used in the systems of this inventions preferably is a multi - component fluid that comprises a lower boiling point component fluid — the low - boiling component — and a higher boiling point component — the high - boiling component . preferred working fluids include an ammonia - water mixture , a mixture of two or more hydrocarbons , a mixture of two or more freon , a mixture of hydrocarbons and freon , or the like . in general , the fluid can comprise mixtures of any number of compounds with favorable thermodynamic characteristics and solubility . in a particularly preferred embodiment , the fluid comprises a mixture of water and ammonia . referring now to fig1 a , a flow diagram , generally 100 , is shown that illustrates a preferred embodiment a system and method of energy conversion of this invention and will be described in terms of its components and its operation . a condensed working fluid having parameters as at a point 1 is divided into two sub streams having parameters as at points 2 and 27 , respectively . the stream having the parameters of the point 2 enters pump p 1 , where the stream is pumped to a desired high pressure and obtains parameters as at a point 3 . thereafter , the stream having the parameters of the point 3 passes through a first heat exchanger he 3 , where it is heated in counter flow with a returning , condensing stream in a condensing step defined by points 9 - 12 ( described below ), and obtains parameters as at a point 4 . the state of the working fluid at the point 4 corresponds to a sub cooled liquid . thereafter , the stream having the parameters of the point 4 passes through a second heat exchanger he2 where it is further heated by an external heat source stream ( e . g ., a geothermal brine stream ) and obtains parameters as at a point 5 , where the parameters at the point 5 correspond to a saturated liquid . next , the stream having the parameters of the point 5 passes through a third heat exchanger he 1 in counter flow with the external heat source stream ( the geothermal brine stream ), where the stream of working liquid is fully evaporated and slightly superheated to obtain parameters as at a point 6 . the vapor stream having the parameters of the point 6 passes through a first high pressure turbine t 1 where the vapor stream expands , producing mechanical work , and obtains parameters as at a point 7 . the stream having the parameters of the point 7 is then divided into two sub streams having parameters as at points 8 and 9 , respectively . the stream having the parameters of the point 9 passes through the first heat exchanger he 3 where it is cooled and condensed providing heat for the 3 - 4 heating step ( described above ) and obtains parameters as at a point 12 . the stream having the parameters of the point 8 is then mixed with a stream having parameters as at a point 20 ( described below ) and obtains parameters as at a point 10 . thereafter , the stream having the parameters of the point 10 passes through a fourth heat exchanger he 6 , where it is cooled and condensed , releasing heat for a heating step 28 - 19 ( described below ), and obtains parameters as at a point 11 . thereafter , streams having the parameters of the points 11 and 12 , respectively , are combined forming a stream the parameters of the point 13 enters a gravity separator s 1 , where it is separated into a rich vapor having parameters as at a point 14 and into a lean liquid having parameters as at a point 15 . the term a rich vapor stream means that the vapor has a higher concentration of the light boiling component than the original basic working fluid as at the point 1 , while the lean liquid stream means that the liquid has a lower concentration of the light boiling component than the original basic working fluid as at the point 1 . the sub - stream of fully condensed working fluid having the parameters of the point 27 ( as described above ) enters into a second pump p 2 , where it is pumped to a desired elevated pressure and obtains parameters as at a point 28 . the pressure at point 28 is substantially lower than the pressure at the point 3 . the stream having the parameters of the point 28 then passes through the fourth heat exchanger he 6 where it is heated by heat released in the process step 10 - 11 ( described above ) and obtains parameters as at a point 19 . thereafter , the stream having the parameters as at the point 19 passes through a fifth heat exchanger he 5 , where it is further heated and evaporated by the external heat source sub - stream ( e . g ., the geothermal brine stream ) and obtains parameters as at point a 18 . usually working fluid having the parameters as at the point 18 is not fully vaporized . a pressure of the working fluid in the process step 19 - 18 is substantially lower than the pressure of the working fluid in the process step 5 - 6 ( described above ). therefore , the stream in the process step 19 - 18 starts to boil at a substantially lower temperature than the stream in the process step 5 - 6 . this allows the use of geothermal brine stream to heat the working fluid in the process step 5 - 6 and thereafter to use a portion of the same brine stream having a lower temperature , to provide heat for the process step 19 - 18 . the geothermal brine stream , which is the heat source for a preferred use of the system of this invention , has initial parameters as at a point 30 . the brine stream having the parameters of the point 30 initially passes though the third heat exchanger he 1 , providing heat for the process step 5 - 6 and obtains parameters as at a point 31 . thereafter , the brine stream having the parameters of the point 31 is divided into two brine sub streams having parameters as at points 32 and 34 , respectively . the stream having the parameters of the point 32 passes through the second heat exchanger he 2 providing heat for the process step 4 - 5 , and obtains parameters as at a point 33 . meanwhile , the stream having the parameters of the point 34 passes through the fifth heat exchanger he 5 , providing heat for the process step 19 - 18 , and obtains parameters as at a point 35 ( described above ). thereafter , the cooled brine sub streams having the parameters of the points 33 and 35 are combined , forming a spent brine stream having parameters as at a point 36 , at which point the brine stream is removed from the system . the stream of working fluid having the parameters of the point 18 ( described above ) enters a second gravity separator s 2 , where it is separated into a rich vapor stream having parameters as at a point 21 ( i . e ., rich means a higher concentration of the low boiling component — ammonia in water - ammonia fluids ) and a relatively lean liquid stream having parameters as at a point 16 ( i . e ., rich means a lower concentration of the low boiling component — ammonia in water - ammonia fluids ). the liquid stream having the parameters of the point 16 passes through a second throttle valve tv 2 , where its pressure is reduced to a pressure equal to the pressure of the stream having the parameters of the point 8 , and obtains parameters as at a point 20 . the stream having the parameters of the point 20 is combined with the stream having the parameters of the point 8 forming a combined stream having parameters of the point 10 ( described above ). the stream having the parameters of the point 20 is substantially leaner ( i . e ., lower concentration of low boiling component ) than the stream having the parameters of the point 8 , and therefore , the combined stream having the parameters of the points 10 and 11 is leaner than the stream having the parameters of the point 8 . the stream having the parameters of the point 11 , is then combined with the stream having the parameters of the point 12 , forming a stream having parameters as at a point 13 , which is likewise leaner than the streams having the parameters of the points 8 and 9 . the vapor stream having the parameters of the point 21 passes though a low pressure turbine t 2 , where the vapor stream having the parameters of the point 21 expands producing mechanical work and obtains parameters as at a point 22 . meanwhile , the liquid stream having the parameters of the point 15 ( described above ) passes through a second throttle value tv 1 , where its pressure is reduced to a pressure equal to the pressure of the stream having the parameters of the point 22 , and obtains parameters as at a point 17 . thereafter , the stream having the parameters of the point 17 is combined with the stream having the parameters of the point 22 forming a stream with parameters as at a point 23 . the stream having the parameters of the point 23 is formed by combining the lean liquid stream having the parameters of the point 15 coming from the separator s 1 with the turbine exhaust stream having the parameters of the point 22 coming from the turbine t 2 . as a result , the concentration of the low boiling component in the stream having the parameters of the point 23 is substantially lower than the concentration of the low boiling component in the working fluid stream having the parameters of the point 1 . this allows the stream having the parameters of the point 23 to be condensed at a lower pressure than the pressure of the stream having the parameters of the point 1 , increasing the power output from the turbine t 2 . the stream having the parameters of the point 23 passes through an air ( or water cooled ) condenser or sixth heat exchanger he 7 , where the stream having the parameters of the point 23 is fully condensed and obtains parameters as at a point 24 . the stream having the parameters of the point 24 , where the parameters correspond to a saturated liquid , enters pump p 3 where its pressure is increased to a pressure equal to the pressure of the stream having parameter of the point 14 , and obtains parameters as at a point 25 . thereafter the streams having the parameters of the points 14 and 25 are combined forming a stream having parameters as at a point 26 . the composition of working fluid at the point 26 is the same as the composition of the working fluid at the point 1 . the stream having the parameters of the point 26 then passes though an air or water cooled condenser or a seventh heat exchanger he 4 where it is fully condensed , obtaining the stream having the parameters of the point 1 . this preferred embodiment is , therefore , a closed cycle . the parameters of all points of the proposed system are presented in table 1 . term concentration is defined as the ratio of the number of pounds of the low boiling component are each pound of working fluid . thus , for an ammonia - water working fluid , a concentration of 0 . 95 means that working fluid comprises 0 . 95 lbs of ammonia and 0 . 5 lbs of water . the term weight represents that number of pounds of material passing through a given point relative to the number of pounds of material passing through the point 6 or the first part of the high temperature circuit defined by points 2 - 7 . the system of this invention comprises two circuits ; one circuit is a high pressure circuit and the other circuit is a lower pressure circuit . the use of two circuits having different pressures makes it possible to utilize heat from the geothermal brine stream for heating the stream of the working fluid in the high pressure circuit , and heat from a portion of a cooled or lower temperature geothermal brine stream for heating the stream of the working fluid in the lower pressure circuit . unlike known two - pressure circuit systems , in the systems of this invention , the liquid produced after the partial condensation of the spent returning stream from the high pressure circuit ( i . e ., the stream having the parameters of the point 15 ) is added to the returning stream from the low pressure circuit . thus the concentration of the returning stream from the low pressure circuit is substantially lowered which in its turn allows this returning stream to be condensed at a pressure lower than the pressure at which it would be condensed if its composition had not been lowered . this results in an increased power output and efficiency of the whole system . the summary of the performance of the entire system is presented in table 2 . the most efficient system previously developed for the same application is described in u . s . pat . no . 4 , 982 , 568 . a comparison of the performance of that system and the system of this invention is presented in table 3 . as shown in table 3 , the system of this invention out performs the prior art by about 18 . 83 %. referring now to fig1 b , a modified system of this invention is shown to include a fourth pump p 4 which is used to increase the pressure of a portion of the stream having the parameters of the point 25 which is combined with the lower pressure liquid stream having the parameter of the point 28 . it should be recognized by persons of ordinary skill in the art that the apparatus of this inventions also includes stream mixer valves and stream splitter valves which are designed to combine stream and split streams , respectively . in the system of fig1 a , the separator s 2 may not be need if the composition of the working fluid is adjusted so that the heated lower pressure stream is fully vaporized in the heat exchanger he 5 , which requires a fluid having a concentration of about 0 . 965 or higher . all references cited herein are incorporated by reference . while this invention has been described fully and completely , it should be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described . although the invention has been disclosed with reference to its preferred embodiments , from reading this description those of skill in the art may appreciate changes and modification that may be made which do not depart from the scope and spirit of the invention as described above and claimed hereafter .
| 8 |
referring now to the drawings , the method of controlling a laser diode is generally illustrated in the graph provided in fig2 while the general schematic structure of the dual loop control system of the present invention is illustrated in fig3 . referring to fig3 there is shown a laser diode 10 and monitoring photodiode 12 . the laser diode 10 and monitoring diode 12 are arranged in such a manner wherein energy emitted from the back facet 14 of the laser diode 10 is directed onto the monitoring diode 12 . circuitry is provided to direct the signal generated by the monitoring diode 12 as a result of stimulation by energy from the back facet 14 of the laser diode 10 back into the automatic power control ( apc ) loop 16 of the present invention thereby providing the feedback necessary for the apc loop 16 to either increase or decrease the drive bias of the laser diode 10 to meet the power output requirements . energy emitted from the front face 18 of the laser diode 10 is directed as the output energy of the laser diode 10 and is utilized for its designated purpose which is not within the scope of this disclosure . the first control loop is an analog apc loop 16 that serves to maintain the laser diode 10 at a constant average power output . the second control loop operates periodically to determine the operational efficiency of the laser diode 10 as represented by the slope of the line ( as a function of the relationship between drive current and power output of the laser 10 ) and calculates the correct modulation of drive current required to maintain the laser 10 at a constant state extinction ratio during modulation of the laser 10 . the method and apparatus of the present invention utilizes a layered arrangement of laser drive current ( bias ) adjustments to provide laser output that remains at a constant average output level in addition to maintaining a constant extinction ratio for modulation of the laser diode 10 . the initial step in configuring the laser module of the present invention is manually setting the initial bias for the base line drive current of the laser diode 10 . in this step the device is attached to an oscilloscope and power is applied to the laser 10 . the laser output is monitored using the oscilloscope and the initial bias is adjusted incrementally until the laser reaches the desired power output for the given environmental conditions . the bias setting is normally done using a digital pot or digital analog converter ( d / a ) 20 as is well known in the art . once this setting is determined and the initial bias is set , the baseline bias is not changed again during the normal operating life of the laser device . once the initial bias for the device is set , the apc loop 16 monitors the feedback form the monitoring diode 12 to determine the laser diode 10 power output . using this feedback , the apc loop 16 applies an overlay adjustment to the initial bias to adjust the drive current of the laser 10 thereby maintaining the required average power output at a constant operational level . the apc loop 16 is an analog loop that compares the input signal from the monitor diode 12 and makes an adjustment to the drive current upwardly if the average output of the laser 10 falls below a preset level or downwardly if the average output increases . the change applied by the apc loop 16 is generally quite small as the operational environment in which the laser devices are operated is controlled . however , since the operation of laser diodes 10 is highly effected by the ambient temperature of the surrounding environment , this apc loop 16 provides important feedback for controlling the laser 10 and maintaining its operation at a constant level average power output . the second control loop 22 is provided to maintain the operation of the laser diode 10 at a constant extinction ratio . in this manner , the second control loop 22 provides an important function in that by maintaining a constant extinction ratio , the quality and integrity of signal that is superimposed onto the modulation of the device can be maintained . as was described above , in addition to a shift in the position of the laser diode 10 performance curve that results from changes in environmental conditions and diode age , the slope of the curve also typically decreases as the ambient temperature increases and the diode ages . as can be seen in fig1 this results in a requirement for higher drive currents , evidenced in the shift required from i ′ to i ″, in order to maintain the same output levels given the same laser diode 10 . it can also be seen that in the control schemes of the prior art , as the drive current increases , the modulation current must also be increased in order to maintain the same modulation amplitude or extinction ratio . this is clearly illustrated by the differences seen between the modulation of pattern 3 versus the modulation of pattern 4 . it is also clear that as the slope of this curve falls , larger incremental increases in current cause much smaller increases in the laser power output . this results in increasingly larger drive currents being applied to the laser diode 10 with smaller and smaller incremental changes in the laser output power p avg , and therefore increasingly smaller feedback values for system evaluation and control . turning to fig2 in conjunction with the schematic diagram in fig3 the operation of the second control loop 22 of the present invention is graphically illustrated . periodically , the controller device 24 in the laser assembly executes a test loop to evaluate the extinction ratio of the laser diode 10 . when the test loop is executed , it determines the current operating state of the laser diode 10 . since the laser 10 is running at a constant output level , the initial power output is known . this output power corresponds to p avg1 as maintained by the apc loop 16 . with the laser diode 10 operating at this state the controller 24 reads the values of a / d1 and a / d2 . by subtracting a / d1 from a / d2 and dividing by the value r of the in line resistor 26 , the controller 24 can calculate bias1 . the controller 24 then adjusts the average power output target requirement for the laser diode 10 from p avg1 to p avg2 by changing the setting of the d / a or digital pot 20 . once the output requirement for the laser 10 is increased , the apc loop 16 then begins to apply additional drive current until the laser output 10 reaches the new p avg2 target output level that corresponds to the new output requirement . with the laser diode 10 operating at this new state , the controller 24 again reads the new values of a / d1 and a / d2 that correspond to operating the laser diode 10 at an output of p avg2 . by subtracting the new values if a / d1 from a / d2 and dividing by the value r of the in line resistor 26 , the controller 24 can calculate bias2 . as can be clearly seen in fig2 the starting point for the second control loop 22 corresponds to the desired constant state output level of the laser diode 10 or p avg1 . the corresponding drive current is illustrated as bias1 ′. this drive current , bias 1 ′, corresponds to the initial manually set bias of the device as modified by the incremental overlay provided by the apc loop 16 . similarly , the second current level , bias2 ′, is the required drive current to drive the laser diode at the incrementally higher output requirement of p avg2 . once the controller completes the above operation to determine all of the required variables , namely the drive current p avg2 , bias 1 ′ and bias2 ′, the algorithm uses the change from bias1 ′ to bias2 ′ ( 6 ) and determines the operational efficiency of the laser diode 10 by solving the following linear algebraic calculation for the slope ( m ): m = p avg2 - p avg1 bias2 ′ - bias 1 ′ this value provides the characteristic operating efficiency of the laser diode 10 at that given point in time in the current environmental conditions . this number can then be utilized to determine the incremental value by which the drive current must be modulated to produce the predetermined required modulation in the laser diode 10 output to maintain a constant extinction ratio . in this manner the second control loop 22 periodically recalibrates itself using the present operational properties of the laser diode 10 to maintain a constant laser modulation having a constant extinction ratio . it can also be seen in fig2 that the present operational temperature and the corresponding apc 16 overlay set point for the initial bias of the laser 10 does not effect the operation of the second control loop 22 . as can be seen , while the operational temperature of the device increases from 25 ° c . to 75 ° c . the operational curve shifts to the right and the efficiency slope begins to fall . however , the apc loop 16 has provided an adjustment overlay that is applied to the initial bias to shift the operational bias from bias1 ′ to bias1 ″. this adjustment overlay applied by the apc loop 16 serves to maintain the operational base line of the laser 10 at the required average power output of p avg1 . consequently , when the second control loop 22 begins its test mode , the baseline output requirement is still p avg1 and the incremental change is still made by adjusting the output requirement to p avg2 . therefore , the slope of the line is simply calculated utilizing the new drive currents , bias1 ″ and bias2 ″ as modified by the apc loop 16 . it should be noted that the application of testing values in the present invention is reversed from the traditional testing methods . more specifically , the prior art methods applied increasing current and monitored the laser output until a constant output level was reached . in these prior art methods , the test used for the second control loop was the actual modulation of the laser itself . in contrast , the method of the present invention sets a higher output drive requirement and monitors the input of current until the newly set target laser output level is reached . the present method therefore only requires adjustments in the drive current relative to a small incremental change in the output requirement before applying a large modification to the drive current as required to maintain the laser 10 at a constant operational extinction ratio thereby reducing the possibility of overdriving the laser 10 . a further advantage that is seen in the present invention is illustrated clearly in fig2 . in particular , the magnitude of the feedback values provided to the controller 24 can be seen to increase as the operational temperature of the device increases . this is evidenced by the spatial relationship illustrated between bias1 ′ and bias2 ′ ( 6 ) relative to the spacing seen between bias1 ″ and bias2 ″ ( 5 ). since operation of the laser diode 10 is extremely sensitive and slope of the operational curve is relatively steep in the lasing mode of operation it can be appreciated that higher feedback values are increasingly valuable at the higher operational ranges . it can also be seen that as higher operational levels are reached in the prior art , the amount of feedback generated decreases providing decreased operational tolerance at critical operational levels . therefore , the present invention provides a feedback signal that increases at higher temperatures where the feedback is most useful . it is therefore a combination of the three biasing factors , the manually set initial bias , the apc loop 16 bias overlay and the slope of the operational curve of the laser 10 as determined by the second control loop 22 that are all factored together to control the operation of the laser 10 . the apc loop 16 bias overlay in conjunction with the manually set bias at the d / a 20 serves to maintain the laser 10 at a constant average operational power while the slope provided by the second control loop 22 is utilized to determine the required current modulation to create a constant extinction ratio during operation of the laser diode 10 . it can therefore be seen that the present invention provides a novel method for operating and controlling a laser diode 10 . in particular , the present invention provides a novel dual - loop control method for controlling a laser diode 10 that is capable of determining the efficiency and operating characteristics of the diode without unduly stressing the laser 10 . further , the present invention provides a novel dual - loop control system that is reliable and provides incrementally higher feedback values at more critical laser operational levels while also being inexpensive to manufacture and implement . for these reasons , the instant invention is believed to represent a significant advancement in the art , which has substantial commercial merit . while there is shown and described herein certain specific structure embodying the invention , it will be manifest to those skilled in the art that various modifications and rearrangements of the parts may be made without departing from the spirit and scope of the underlying inventive concept and that the same is not limited to the particular forms herein shown and described except insofar as indicated by the scope of the appended claims .
| 7 |
referring now to fig1 , a warming system 10 of the present invention may provide for an upwardly open , concave basin 12 having a generally horizontal floor 14 surrounded by upwardly sloping and opposed sidewalls 16 and upwardly sloping and opposed end walls 18 . the end walls 18 join with the sidewalls 16 to provide a continuous watertight surface terminating at an upper rim 20 . generally the basin 12 will be fabricated from a ductile conductive metal such as aluminum to provide a heat spreading feature as will be described below . referring now also to fig2 , basin 12 is sized to receive and substantially fully support a dialysis bag 22 holding , for example , five liters of infusion liquid 23 . the infusion liquid 23 may , for example , be a saline solution for peritoneal dialysis . as is understood in the art , the dialysis bag 22 may be constructed of a flexible transparent plastic material , such as a vinyl , and fabricated by joining two sheets 24 of the material at a peripheral seam 26 to provide within the seam 26 an enclosed pocket into which sterile infusion liquid 23 may be held . the flexible material of the dialysis bag 22 permits the dialysis bag 22 to adopt a variety of different volumetric configurations and the shape of the basin 12 is designed to promote a particular configuration maximizing heat transfer to the contained infusion liquid 23 . in particular , the basin 12 is shaped to support the dialysis bag 22 with one lower sheet 24 of the dialysis bag 22 lying in close abutment to the floor 14 , sidewalls 16 , and end walls 18 of the basin 12 and so that the seams 26 between the sheets 24 lie generally along a horizontal plane displaced to be approximately symmetrically located between the sheets 24 of the dialysis bag 22 to substantially eliminate buckling or wrinkling of the lower sheet 24 and minimizing a vertical thickness of the infusion liquid 23 within this constraint . in this way , contact between the dialysis bag 22 and the heater 28 may be substantially maximized and the thermal path to any volume element of the infusion liquid 23 from the basin 12 reduced . referring momentarily to fig2 and 3 , a heater 28 may be attached to an underside of the basin 12 to attach in the regions of the floor 14 , the sidewalls 16 , and the end walls 18 so that each may conduct heat directly into the supported dialysis bag 22 . the heater 28 may be substantially continuous over the surfaces except for sections near the area of the corners of the basin 12 at the joining of end walls 18 and sidewalls 16 to facilitate manufacturing and except for small openings for basin supporting structure , thermal sensors and the like as will be described below . generally heater 28 contacts the basin 12 over a large area so that a low temperature ( gentle ) heat implemented over the portions of the basin 12 contacting the dialysis bag 22 10 rapidly heat the contained infusion liquid 23 without large temperature differences . for this purpose , the area of the heater 28 will typically be greater than 50 square inches and preferably greater than 100 square inches or more . a suitable heater 28 may be a silicone rubber electric heater . as is understood in the art , a silicone rubber electric heater provides a resistive conductive element , for example an etched foil or wire , embedded in a silicone rubber mat and is broadly commercially available from multiple vendors . referring now to fig2 , the basin 12 may be held within a housing 30 as supported on one or more spring elements 32 , for example helical compression springs . the housing 30 maybe fabricated of an injection molded thermoplastic or the like and may include a lower surface having downwardly extending feet 31 for support on a table or the like . the housing 30 may have vertically extending sidewalls 33 above a horizontally extending base wall 35 and may be open at its upper surface to expose the upper surface of the basin 12 for receipt of the dialysis bag 22 within the basin 12 . the weight of the dialysis bag 22 on the basin 12 compresses the basin downward against the spring elements 32 and into the housing 30 activating a switch 34 indicating a presence of a dialysis bag 22 that may require heating . the switch 34 may be a simple mechanical microswitch , an optical switch , a strain gauge , a magnetic switch or the like providing an electrical signal that may communicate with the controller board 36 held within the housing 30 . the controller board 36 may also communicate with the heater 28 so that the heater 28 may be activated only when a dialysis bag 22 is in place in the basin 12 . this weight - based sensing system provides for robust and positive identification of the placement of a dialysis bag 22 in the basin 12 in contrast , for example , to optical bag sensors which may require more sophisticated processing to detect the dialysis bag 22 and overcome the transparent nature of the dialysis bag 22 and the contained infusion liquid 23 . referring still to fig2 , controller board 36 may also communicate with a temperature sensor pair 38 positioned approximately in the center of the floor 14 to be near a center region of the liquid 23 contained in the dialysis bag 22 . this location provides a good measure of the average temperature of the liquid 23 in the dialysis bag 22 . the temperature sensor pair 38 may be mounted on a heat collector plate 40 that projects upward from a plane of the floor 14 of the basin 12 to provide a mesa - form pushing upward slightly on the lower sheet 24 into the dialysis bag 22 to ensure good contact therewith without substantially decreasing the thermal contact between the dialysis bag 22 and the floor 14 of the basin 12 . the heat collector plate 40 and temperature sensor pair 38 are thermally isolated from the heater 28 and the floor 14 by means of this offset and an aperture cut in the heater 28 and floor 14 and separated from the heat collector plate 40 by a thermally insulating spacer ring 42 . by promoting thermal contact between the temperature sensor pair 38 and the dialysis bag 22 through sheet 24 and distancing thermal proximity of the temperature sensor pair 38 and the heater 28 , a localized sensing region 44 projecting into the infusion liquid 23 may be created allowing better assessment and control of the liquid temperature . t a rear surface of the temperature sensor pair 38 may be embedded in a thermally insulating material 46 reducing the temperature drop between the liquid 23 and the sensor pair 38 promoting the ability to detect internal liquid temperature with an external temperature sensor pair 38 as will be discussed below . referring to fig1 , 3 , and 4 , the end walls 18 of the basin 12 and corresponding regions of the housing 30 may include cutout 50 sized to receive hands 52 of a user when the hands 52 are positioned to grasp the dialysis bag 22 at its ends along its greater length as a user places the dialysis bag 22 down into the basin 12 or lifts it there from . the cutouts 50 expose a portion of an under surface of the dialysis bag 22 in the basin 12 simplifying its gripping by the hands 52 during removal or insertion . referring to fig1 and 4 , the rim 20 of the basin 12 and regions around the cutout 50 may have drip edges 56 formed therein , the drip edges 56 being downwardly extending edges that prevent water overflowing out of the basin 12 from traveling downward along the lower surface of the basin 12 , as adhered thereto by surface tension , into the region of the controller board 36 . referring now to fig1 and 6 , an outer front surface of the housing 30 may provide for a control panel 60 having an alphanumeric display 62 , for example , displaying a current temperature of the infusion liquid 23 or desired setpoint of the infusion liquid 23 , setting switches 64 allowing changing of the setpoint of temperature control of the liquid 23 , a mode switch 66 changing a mode of display 62 , and a ready indicator 68 indicating that the temperature of the liquid 23 is at its proper setpoint , as will be described . the switches 64 and 66 may , for example , be membrane switches of a type known in the art and the ready indicator a light emitting diode . referring now to fig2 and 5 , the controller board 36 may include a microcontroller 70 or similar processor of a type well known in the art and including generally a processor , memory and various i / o circuits . the microcontroller 70 may receive signals from the thermal sensor pair 38 the switch 34 and the switches 64 and 66 and may provide control signals to the display 62 and the ready indicator 68 and the heater 28 . an internal program 72 executed by the microcontroller 70 , as indicated by decision block 74 , may first detect whether a dialysis bag 22 is in place in the basin 12 ( as shown in fig2 ) using the signal from the switch 34 . if not , an internal timer used for determining the age of the dialysis bag 22 ( with respect to how long it has been heated ) is reset , and the ready light 68 and the heater 28 are turned off ( if they are on ) as indicated by process block 76 . if a dialysis bag 22 is in place , the heater 28 may be turned on as indicated by process block 78 , for example , by means of solid - state switches such as an scr on the controller board 36 as controlled by the microcontroller 70 . at this time a bag age timer is started as indicated by process block 80 that will keep track of how long the dialysis bag 22 has been in place and heated . at process block 82 , the temperature of the temperature sensor pair 38 is read and the separate temperature readings compared to see if they are beyond the predetermined range indicating an error at process block 84 . if an error is indicated the heater may be turned off and in error indicated on the display 60 , otherwise the temperature values are averaged and this temperature is corrected for an empirically determined temperature offset representing a difference between the temperature of the contained liquid 23 and the temperature at the sensor pair 38 caused by the thermal resistance therebetween . this temperature difference will generally be added to the temperature read at the temperature sensor pair 38 at process block 84 . at decision block 86 , a determination is made to see whether the temperature of the contained liquid 23 within the dialysis bag 22 is at a desired setpoint , the latter which may be entered by the user through the control panel 60 by conventional data entry routines not shown . this comparison considers the temperature at the temperature sensor pair 38 as corrected by the temperature offset described above . the range of set points entered by the user may be limited to those representing a safe range for the infusion liquid 23 . if at decision block 86 the deduced temperature of the infusion liquid 23 is below a predetermined range with respect to the desired setpoint , the program 72 loops back to decision block 74 , otherwise the program proceeds to process block 87 and the heater is turned off and the ready indicator 68 illuminated indicating that proper temperature has been obtained per process block 88 . at any time during this process , the mode switch 66 may be activated to allow the user to switch display 62 between the temperature of the contained liquid 23 , the desired setpoint and the bag age . the temperature of the contained liquid 23 is corrected with the temperature offset as described above . referring to fig1 and 2 , the controller board 36 may receive power from a line cord 100 passing into the housing 30 and having an associated line switch as is understood in the art . multiple temperature switches 102 may be placed against the under surface of the basin 12 to monitor over temperature of the basin 12 independent of the operation of the controller board 36 to disconnect the heater 28 when over temperature conditions exist . ideally the upper surface of the basin 12 will be substantially bare to provide improved thermal conductivity ; however , it will be understood that a thin protective layer of plastic materials and / or anodization may be provided on the surface without unduly decreasing the effectiveness of the device . by providing a broad area , low - temperature heating of a substantially flattened dialysis bag 22 , rapid and accurate temperature control of the contained liquid 23 may be effected . certain terminology is used herein for purposes of reference only , and thus is not intended to be limiting . for example , terms such as “ upper ”, “ lower ”, “ above ”, “ below ”, “ clockwise ”, and “ counterclockwise ” refer to directions in the drawings to which reference is made . terms such as “ front ”, “ back ”, “ rear ”, “ bottom ” and “ side ”, describe the orientation of portions of the component within a consistent but arbitrary frame of reference which is made clear by reference to the text and the associated drawings describing the component under discussion . such terminology may include the words specifically mentioned above , derivatives thereof , and words of similar import . similarly , the terms “ first ”, “ second ” and other such numerical terms referring to structures do not imply a sequence or order unless clearly indicated by the context . when introducing elements or features of the present disclosure and the exemplary embodiments , the articles “ a ”, “ an ”, “ the ” and “ said ” are intended to mean that there are one or more of such elements or features . the terms “ comprising ”, “ including ” and “ having ” are intended to be inclusive and mean that there may be additional elements or features other than those specifically noted . it is further to be understood that the method steps , processes , and operations described herein are not to be construed as necessarily requiring their performance in the particular order discussed or illustrated , unless specifically identified as an order of performance . it is also to be understood that additional or alternative steps may be employed . references to a controller , computer or processor or its equivalent can be understood to include one or more computational devices including microprocessors , field programmable gate arrays , and application specific integrated circuits that can implement state aware logic and that can communicate in a stand - alone and / or a distributed environment ( s ), and can thus be configured to communicate via wired or wireless communications with other processors , where such one or more processor can be configured to operate on one or more processor - controlled devices that can be similar or different devices . furthermore , references to memory , unless otherwise specified , can include one or more processor - readable and accessible memory elements and / or components that can be internal to the processor - controlled device , external to the processor - controlled device , and can be accessed via a wired or wireless network .
| 0 |
referring to fig1 one embodiment of the present invention includes a plasma generating section 1 , a section 2 for treating a fluorescent substance with active species produced in plasma generating section 1 , a section 3 for supplying gas to plasma generating section 1 , and an exhaust section 4 for reducing the pressure in fluorescent substance treatment section 2 . gas supplying section 3 includes a gas cylinder 5 having a switching valve 5a . a pipe 6 supplies gas from gas cylinder 5 to plasma generating section 1 . the flow rate of gas is adjusted by a flow meter 7 and a needle valve 8 . preferable gasses include ar , he , kr , ne , xe , h 2 , n 2 , o 2 , methane halide ( for example cf 4 ), ccl 4 , ccl 2 f 2 or a mixture thereof . specially , using the mixture of n 2 and h 2 is preferable because this mixture improves the luminous efficacy of the fluorescent substance and the stability against ultraviolet irradiation . also using methane halide gas is preferable because the cohesion and fluidity of the fluorescent substance are improved . plasma generating section 1 includes a microwave ocsillator 9 such as a magnetron . a waveguide 10 transmits microwaves from oscillator 9 to a discharge tube 11 which penetrates waveguide 10 for producing the plasma therein . discharge tube 11 is ordinarily made of quartz and has one end connected to pipe 6 for receiving the gas . waveguide 10 is provided with an impedance matching means comprising a three - stub tuner 12 and plunger 13 . discharge tube 11 is provided with a water - cooling apparatus 14 which cools discharge tube 11 . fluorescent substance treatment section 2 includes a closed and preferably cylindrical shaped vessel 16 into which the other end of discharge tube 11 opens . vessel 16 is axially aligned with the axis of discharge tube 11 . vessel 16 may be made of quartz and formed integrally with discharge tube 11 . otherwise , vessel 16 may be metal , such as stainless steel . a treatment chamber 15 is formed in vessel 16 in which the fluorescent substance is treated with the plasma from discharge tube 11 . a capacitance manometer 17 is mounted to the outer wall of vessel 16 to monitor the pressure in chamber 15 during operation of the apparatus . vessel 16 is also provided with a gas outlet 18 , preferably located near the end of vessel 16 opposite discharge tube 11 to enable the active species in the plasma produced within discharge tube 11 to flow about the fluorescent substance held in the center of chamber 15 before being exhausted . the fluorescent substance is preferably stirred while being treated to ensure uniform treatment . accordingly , a stirring mechanism is provided including a preferably cylindrical container 20 disposed in chamber 15 in an axial alignment with the axis of discharge tube 11 . fluorescent substance 41 is held in container 20 . one end 19 of container 20 is opened and faces discharge tube 11 . the other end of container 20 is covered with a plate 22 having holes 21 as shown in fig3 . plate 22 is fixed to a driving shaft 23 . the inside wall of cylindrical container 20 is provided with a plurality of integral projections 36 for stirring the fluorescent substance 41 . the end of vessel 16 is covered with an annular cover 25 . the center of cover 25 is provided with a cylindrical housing 24 which houses driving shaft 23 and a ferromagnetic substance 23a such as steel combined with the end of driving shaft 23 . o - rings 26 provide an air - tight seal between vessel 16 and cover 25 . the sealing between vessel 16 and cover 25 is aided by a partial vacuum produced in vessel 16 by exhaust section 4 . cover 25 is provided with bearings 28 and 29 . bearing 28 is disposed at the entrance of cylindrical housing 24 and bearing 29 is disposed within cylindrical housing 24 . driving shaft 23 is rotatably supported by bearings 28 and 29 . a cylindrical rotary body 31 is supported around housing 24 , but out of contact with it , by a supporting mechanism ( not shown ). a plurality of ( four , for example ) permanent magnets or electromagnets 30 are mounted at equal distances from one another on the inside wall of body 31 ( see fig4 ). rotary body 31 is rotated by a motor 34 via a belt 35 . driving shaft 23 is rotated with body 31 , because the magnetic field formed by magnets 30 is rotated in response to the rotation of body 31 . cylindrical container 20 is rotated by the rotation of driving shaft 23 . accordingly , the apparatus of the invention can rotate cylindrical container 20 and stir fluorescent substance 41 while cylindrical container 20 is kept air - tight . exhaust section , generally shown at 4 , includes a trap 39 connected to gas outlet 18 by a pipe 37 having a valve 38 . a rotary pump 40 is connected to trap 39 by a pipe 37a . in operation , the fluorescent substance is disposed in cylindrical container 20 . then , pump 40 exhausts vessel 16 to a pressure of less than about 10 - 3 torr . thereafter , switching valve 5a is opened so as to supply gas from gas cylinder 5 into discharge tube 11 through gas flow meter 7 and needle valve 8 . the pressure in chamber 15 is preferably adjusted to between about 10 - 1 and about 5 torr . and the gas flow rate is preferably adjusted to between about 30 and about 300 cc / min . while exhausting continues . the pressure and the gas flow rate are controlled by needle valve 8 while monitoring capacitance manometer 17 and gas flow meter 7 . under the conditions described above , 100 - 500 watt microwaves having a frequency of 2 , 450 mhz are transmitted from oscillator 9 to discharge tube 11 by matching impedances using three - stub tuner 12 and plunger 13 . as a result , the gas flowing in discharge tube 11 is discharged and the plasma is produced . the plasma flows into chamber 15 along with the gas flow . active species in the plasma having a short life cease to exist on their way to chamber 15 . therefore , only active species with a long life contact fluorescent substance 41 held in cylindrical container 20 . fluorescent substance 41 is stirred by rotating cylindrical container 20 . stirring is particularly effective when fluorescent substance 41 is mixed with quartz stir chips 42 . the qualities of fluorescent substance 41 are remarkably impaired when it is mixed with impurities , especially heavy metals . therefore , cylindrical container 20 and stir chips 42 are preferably made of quartz . stir chips 42 in the form of cylinders about 8 to about 15 mm in diameter and about 10 to about 20 mm in length work well to obtain an excellent stirring efficiency . using this method and apparatus the fluorescent substance is treated for usually 10 minutes to 4 hours . the method of the present invention may be applied to the treatment of many kinds of fluorescent substances such as , for example , [ ca 10 ( po 4 ) 6 fcl : sb , mn ], [ sr 10 ( po 4 ) 6 fcl : sb , mn ], [ zn 2 sio 4 : mn ], [ y 2 o 3 : eu ], [ zns : ag , cl ], [ zns : cu , au , al ], [ y 2 o 2 s : eu ], [ y ( pv ) o 4 : eu ], [ y 2 sio 5 : ce , tb ] and [( sr , ca ) 10 ( p0 4 ) 6 cl 2 : eu ]. the fluorescent substance may be treated while it is coated on the surface of a cathode ray tube or an illumination lamp , as well as when it is a powder . fig5 illustrates another embodiment of this invention which is capable of processing fluorescent substances coated on surfaces . in fig5 like reference characters designate similar parts to that of fig1 . the treatment apparatus of this embodiment does not have the cylindrical container for stirring the fluorescent substance in the chamber . a glass tube 51 for a fluorescent lamp , having the fluorescent substance coated on the inside thereof is arranged in chamber 15 such that one open end 52 of it faces discharge tube 11 . the plasma produced in discharge tube 11 flows into glass tube 51 and contacts with the fluorescent substance coated on glass tube 51 to treat the fluorescent substance . as described above , the method and the apparatus of this invention brings the active species in the plasma into contact with the fluorescent substance at a region ( chamber 15 ) separated from the plasma producing region ( discharge tube 11 ) where intense short wavelength ultraviolet irradiation is also produced . therefore , the fluorescent substance is protected from the short wavelength ultraviolet irradiation . the fluorescent substance treated according to the present invention has excellent luminous efficacy and ultraviolet irradiation resistance characteristics . the cohesion between fluorescent substance powder particles is reduced and the fluidity of the fluorescent substance is improved . as a result , the efficiency of the subsequent coating operation with the fluorescent substance is exceedingly improved . the following examples serve to establish the superior qualities of a fluorescent substance treated by the plasma according to the method of the present invention . several kinds of fluorescent substances are treated by the apparatus shown in fig1 . the treated fluorescent substances were excited by ultraviolet irradiation with a wavelength of 254 nm , and their relative luminous efficacy were measured . the conditions during treatment and the luminous efficacy are shown in table 1 , below , in which the luminous efficacy is shown as a value relative to 100 which is the luminous efficacy of the fluorescent substance prior to treatment : table 1__________________________________________________________________________ treatment condition relativefluorescent discharge treating luminoussubstance gas power time efficacy__________________________________________________________________________ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : ar 3 . 5 150 30 101 . 9sb , mn ( torr ) ( w ) ( min ) ar 3 . 5 500 30 102 . 6 he 7 . 6 500 30 101 . 8 n . sub . 2 + h . sub . 2 500 30 102 . 2 0 . 5 0 . 5 n . sub . 2 + h . sub . 2 150 30 102 . 2 1 . 8 0 . 1 n . sub . 2 + h . sub . 2 500 30 102 . 1 3 . 1 0 . 1 n . sub . 2 + h . sub . 2 500 30 101 . 9 1 . 4 20 . 0 ar + h . sub . 2 500 30 102 . 8 3 . 5 0 . 1 n . sub . 2 + h . sub . 2 + cf . sub . 4 500 10 102 . 6 1 . 8 0 . 1 0 . 1 n . sub . 2 + h . sub . 2 + cf . sub . 4 150 30 103 . 9 1 . 8 0 . 1 0 . 1sr . sub . 10 ( po . sub . 4 ). sub . 6 fcl : ar 3 . 5 500 30 103 . 1sb , mn n . sub . 2 + h . sub . 2 500 30 102 . 4 0 . 5 0 . 5 ar + h . sub . 2 500 30 101 . 8 3 . 5 0 . 1zn . sub . 2 sio . sub . 4 : mn ar 3 . 5 500 30 102 . 0 n . sub . 2 + h . sub . 2 500 30 102 . 8 0 . 5 0 . 5y . sub . 2 o . sub . 3 : eu ar 3 . 5 500 30 103 . 0 n . sub . 2 + h . sub . 2 500 30 102 . 2 0 . 5 0 . 5__________________________________________________________________________ thus , the luminous efficacy of the fluorescent substance treated according to the present invention is improved by about 2 - 4 %. several kinds of fluorescent substances were treated by the apparatus shown in fig1 . then , they were irradiated in a vacuum for four hours by ultraviolet irradiation predominantly with a wavelength of 185 nm . thereafter , the fluorescent substances were excited by ultraviolet irradiation with the wavelength of 254 nm , and their luminous efficacy were measured . the conditions during treatment and the luminous efficacy are shown in table 2 , below , in which the luminous efficacy is also shown as a value relative to 100 which is the luminous efficacy of the untreated fluorescent substance which underwent the same irradiation . table 2__________________________________________________________________________ treatment condition relativefluorescent discharge treating luminoussubstance gas power time efficacy__________________________________________________________________________ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : ar 0 . 2 500 30 102 . 8sb , mn ( torr ) ( w ) ( min ) ar 0 . 2 500 240 102 . 9 ar 0 . 5 500 30 102 . 8 ar 0 . 5 300 30 103 . 1 ar 0 . 5 300 120 102 . 3 ar 1 . 5 500 30 103 . 5 ar 2 . 0 500 30 102 . 9 ar 2 . 0 500 60 102 . 4 ar 2 . 0 500 120 102 . 0 ar 3 . 5 500 30 105 . 8 ar 3 . 5 500 120 102 . 3 ar 3 . 5 500 240 102 . 6 ar 3 . 5 150 30 102 . 7 ar 3 . 5 150 120 102 . 4 he 3 . 5 500 30 101 . 8 he 7 . 6 500 180 103 . 1 n . sub . 2 3 . 5 500 30 103 . 6 h . sub . 2 3 . 5 500 30 103 . 1 cf . sub . 4 0 . 2 500 5 102 . 3 cf . sub . 4 0 . 2 500 30 103 . 1 n . sub . 2 + h . sub . 2 500 30 107 . 7 0 . 5 0 . 5 n . sub . 2 + h . sub . 2 500 30 104 . 7 1 . 8 0 . 1 ( w ) ( min ) ( torr ) n . sub . 2 + h . sub . 2 150 30 105 . 9 1 . 8 0 . 1 n . sub . 2 + h . sub . 2 500 30 105 . 1 3 . 1 0 . 1 n . sub . 2 + h . sub . 2 500 30 105 . 4 2 . 6 12 . 0 n . sub . 2 + h . sub . 2 500 30 106 . 1 1 . 4 20 . 0 ar + cf . sub . 4 500 5 102 . 3 3 . 5 0 . 1 ar + cf . sub . 4 500 30 101 . 8 3 . 5 0 . 1 ar + cf . sub . 4 150 15 101 . 8 3 . 5 0 . 1 ar + h . sub . 2 500 30 102 . 6 3 . 5 0 . 1 n . sub . 2 + h . sub . 2 + cf . sub . 4 500 10 102 . 4 1 . 8 0 . 1 0 . 1 n . sub . 2 + h . sub . 2 + cf . sub . 4 150 10 102 . 8 1 . 8 0 . 1 0 . 1sr . sub . 10 ( po . sub . 4 ). sub . 6 fcl : ar 3 . 5 500 30 103 . 1sb , mn ar 0 . 5 500 30 102 . 4 n . sub . 2 + h . sub . 2 500 30 104 . 1 0 . 5 0 . 5zn . sub . 2 sio . sub . 4 : mn ar 3 . 5 500 30 102 . 6 ( torr ) ( w ) ( min ) ar 0 . 5 500 30 103 . 8 n . sub . 2 + h . sub . 2 500 30 104 . 1 0 . 5 0 . 5y . sub . 2 o . sub . 3 : eu ar 3 . 5 500 30 101 . 9 n . sub . 2 + h . sub . 2 500 30 104 . 3 0 . 5 0 . 5ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : o . sub . 2 + cf . sub . 4 500 30 101 . 8sb , mn 0 . 2 0 . 2 o . sub . 2 + cf . sub . 4 500 30 101 . 6 1 . 0 1 . 0__________________________________________________________________________ thus , the stability against short wavelength ultraviolet irradition of fluorescent substances treated according to the present invention is improved by 2 - 6 % in comparison with the conventional fluorescent substances . the luminous efficacy of the fluorescent substance [ ca 10 ( po 4 ) 6 fcl : sb , mn ] treated under the different conditions shown in table 3 , below , was measured by the same method as example 1 : table 3______________________________________ treatment condition dis - treat - sample fluorescent charge ingno . substance gas power time______________________________________1 ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : -- -- -- sb , mn2 ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : ar 3 . 5 500 . sup . ( w ) 15 min .- sb , mn torr 4 hr . 3 ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : n . sub . 2 + h . sub . 2 500 15 min .- sb , mn 0 . 5 0 . 5 4 hr . torr______________________________________ fig6 illustrates the relationship between treatment time and the relative luminous efficacy . thus , fluorescent substances treated for a relatively short time , especially for about 15 minutes to 2 hours , has excellent luminous efficacy . the three samples treated in example 3 were irradiated by ultraviolet irradiation predominantly with a wavelength of 185 nm in the same manner as in example 2 and then the relative luminous efficacy was measured by the same method as example 1 . fig7 illustrates the fluorescent substances treated for a relatively short time , especially for about 15 minutes to 2 hours , have excellent stability against the short wavelength ultraviolet irradiation . the fluorescent substances [ y 2 o 2 s : eu ], [ zns : agcl ] and [ zns : cu , au , al ] were treated under the condition as shown in table 4 : table 4______________________________________ treatment condition dis - treat - sample fluorescent charge ingno . substance gas power time______________________________________4 y . sub . 2 o . sub . 2 s : eu -- -- -- 5 y . sub . 2 o . sub . 2 s : eu ar 1 . 0 500 . sup . ( w ) 30 . sup . ( min ) torr6 y . sub . 2 o . sub . 2 s : eu n . sub . 2 + h . sub . 2 500 30 0 . 5 0 . 57 y . sub . 2 o . sub . 2 s : eu n . sub . 2 500 30 0 . 58 zns : ag , cl -- -- -- 9 zns : ag , cl ar 500 30 1 . 010 zns : ag , cl n . sub . 2 + h . sub . 2 500 30 0 . 5 0 . 511 zns : ag , cl n . sub . 2 500 30 0 . 512 zns : cu , au , al -- -- -- 13 zns : cu , au , al ar 500 30 1 . 014 zns : cu , au , al n . sub . 2 + h . sub . 2 500 30 0 . 5 0 . 515 zns : cu , au , al n . sub . 2 500 30 0 . 5______________________________________ these fluorescent substances were excited by an electron beam and fig8 - 10 illustrate the relationship between the relative luminance efficiency and the accelerating voltage of the electron beam . thus fluorescent substances treated by the present invention exhibit excellent luminous efficacy even when excited by an electron beam . the fluorescent substances [ ca 10 ( po 4 ) 6 fcl : sb , mn ] and [ y ( pv ) o 4 : eu ] were treated under the condition as shown in table 5 : table 5______________________________________ treatment conditionfluorescent discharge treatingsubstance gas power time______________________________________ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : cf . sub . 4 1 . 0 500 . sup . ( w ) 2 . sup . ( hr . ) sb , mn torry ( pv ) o . sub . 4 : eu cf . sub . 4 0 . 5 500 2______________________________________ angle of repose and the time necessary for the fluorescent substance to pass through a mesh were measured . for each fluorescent substance , a sample not treated by the plasma , and a sample to which 3 - 5 % almina ( al 2 o 3 ) was added were also measured . table 6 illustrates the results : table 6______________________________________ time pass angle of throughfluorescent substance repose mesh______________________________________ca . sub . 10 ( po . sub . 4 ). sub . 6 fcl : treated 46 ° 20 . sup . ( sec ) sb , mn added al . sub . 2 o . sub . 3 50 ° ˜ 60 ° 24 not treated 60 ° & lt ; ∞ y ( pv ) o . sub . 4 : eu treated 42 ° 18 added al . sub . 2 o . sub . 3 50 ° ˜ 60 ° 23 not treated 60 ° & lt ; 180 ˜ 300______________________________________ the length of time for the powder to pass through the mesh is a characteristic of the cohesion and the fluidity of the powder , and it was measured in the following manner . 50 grams of fluorescent powder was put on a horizontal wire screen which was vibrating vertically at 50 hz . then , the length of time for the powder to pass through the mesh was measured . therefore , a shorter length of time indicates a lower powder cohesion and a greater fluidity . as apparent from the results , the cohesion and the fluidity of the fluorescent substance treated by the present invention is improved in comparison with the conventional fluorescent substance . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention is not to be limited to the disclosed embodiments but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims which scope is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures .
| 2 |
referring first to fig1 and 2 , the door sizing apparatus 10 of the present invention is shown disposed within a door opening or doorway 12 having left and right side door jambs 14 and a head door jamb 16 . across the foot of the doorway is the conventional threshold 18 . the apparatus includes a support member or plumb guide beam 20 , a centering mechanism generally indicated at 22 , a tracing mechanism 24 and an elongated sheet of markable material 26 extended vertically along the front face of the guide beam and anchored at opposite ends of the guide beam . the plumb guide beam 20 in the disclosed form is a channeled piece of elongated aluminum with the channel opening rearwardly . the upper end of the guide beam has a pair of rearwardly extending brackets 28 which support an upper spool 30 to which the upper end of the markable material 26 is anchored . the spool 30 is preferrably rotatably connected to the brackets 28 and gripped frictionally so that it can be rotated upon application of a predetermined force but otherwise will retain its angular orientation . the lower end of the guide beam has a bracket 32 which extends both forwardly and rearwardly of the guide beam with the rear extent of the bracket supporting a lower spool 34 to which the lower end of the markable material 26 is connected . again , the lower spool 34 is rotatably mounted in such a manner that it is frictionally gripped by the bracket 32 but can be rotated upon application of a predetermined force . the forward extent of the lower bracket 32 defines a horizontal flange 36 through which a vertically extending adjustment screw 38 is received . the adjustment screw 38 has an abuttment head 40 on its lower end adapted to engage the threshold 18 of the doorway and to be selectively disengaged therefrom when desired . a lock nut 42 is threaded onto the upper end of the adjustment screw to lock the screw into position when it has been desirably abutted or engaged with the threshold . the guide beam 20 has a front wall 44 and a pair of rearwardly extending sidewalls 46 . each sidewall 46 along its connection to the front wall is provided with a vertically extending groove 48 for a purpose to be described later . near the upper end of the guide beam , upper and lower vertically spaced pairs of notches 50a and 50b respectively are cut in the sidewalls 46 to facilitate the operation of the centering mechanism 22 . the centering mechanism includes a pair of equal length positioning arms 52 which are pivotally connected to the front wall of the guide beam at 54 and protrude laterally away from the guide beam through the lower pair of notches 50b , a biasing member 56 interconnecting the positioning arms 52 and extending through the upper pair of notches 50a , a horizontal level member 58 also interconnecting the positioning arms , and a pair of adjustment screws 60 passing vertically through the distal ends of the positioning arms . the positioning arms 52 are made , in the disclosed form , from elongated bars of generally rectangular transverse cross - section and have rubber abuttment pads 62 on their distal ends adapted to frictionally engage the side door jambs 14 of the doorway . the adjustment screws 60 which extend through the distal ends of the positioning arms in a generally vertical direction are calibrated at 64 so that their longitudinal position relative to the associated positioning arm is easily determinable . the horizontal level member 58 in the disclosed form is a conventional spirit level having conventional level indicators indicating when the level member is horizontal . at opposite ends of the level member it is provided with horizontal slots 66 which extend along the length of the level member and receive horizontal slide pins 68 which are anchored to each of the positioning arms at a location near the distal ends of the positioning arms . the tracing mechanism 24 consists of a horizontal tracing beam 70 which in the disclosed form is of solid rectangular transverse cross section having a vertical notch 72 cut in the rear face thereof at the longitudinal center adapted to receive the front portion of the guide beam 20 . at opposite sides of the notch 72 , ball bearings 74 are received in appropriate sockets and are biased inwardly toward each other by compression springs ( not shown ). the ball bearings 74 are adapted to be snapped into the grooves 48 running along opposite sides of the guide beam and serve to retain the horizontal tracing beam 70 on the guide beam as it is slid vertically along the length of the guide beam . the horizontal tracing beam can , of course , be removed from the guide beam merely by snapping the ball bearings out of the guide grooves 48 . a pair of tracer arms 76 are mounted on the top of the tracing beam 70 and each has a follower 78 at its outer end adapted to engage the adjacent side door jamb 14 . the follower 78 could be in the form of a ball or roller bearing or could merely be the blunt end of the arm 76 . each tracer arm is slidably supported axially by a pair of spaced brackets 80a and 80b , bracket 80b serving as an abuttment for one of two coaxial compression springs 82 mounted on the tracer arm . the compression springs 82 serves to bias the arms outwardly into engagement with the side door jambs . the inner end of each arm 76 passes through a generally u - shaped curve with one portion of the u - shaped curve running parallel to the longitudinal axis of the tracer arm . this portion of the u - shaped bend is slidably received in a third bracket 84 which serves to prevent the tracer arm from rotating about the longitudinal axis thereof . a marker head 86 is provided at the inner end of each tracer arm and could be in numerous forms , such as , a ball point pen , an adjustable lead , or the like . the marker heads 86 are adapted to engage the markable material 26 disposed on the front face of the guide beam 20 as to place a legible mark on the markable material as the tracing beam 70 is slid vertically along the guide beam . it will be appreciated that each tracer arm is biased against the associated side door jamb 14 so that the follower 78 engages the side door jamb . since the tracer arms are of fixed length , and the tracing beam is moved vertically along the guide beam , a generally vertically extending line will be marked upon the markable material 26 to correspond with the vertical contour of each side door jamb . in this manner , information relating to the contour of the side door jambs is placed upon the markable material which can be used later to cut the side edges of a door for the doorway so that the side edges correspond with the contours of the associated side door jambs . with the horizontal tracing beam 70 at its lowermost position on the guide beam , the distance between each end of the tracing beam and the threshold 18 of the doorway can be measured and manually written upon the markable material so that the lower edge of the door can be made to fit the contour of the threshold of the doorway . the positioning arms 52 are biased outwardly by the biasing member 56 , fig4 which includes a tubular housing 88 from which a pair of oppositely directed pins 90 protrude and are biased outwardly by a common compression spring 92 contained in the housing between the inner ends of the pins . each pin has a sperical head 94 on its distal end which is received in a spherical socket in the associated arm 52 so that it is retained in connected relationship with the positioning arm . the spherical connection allows pivotal movement between the biasing member 56 and the positioning arms 52 so that while the biasing member biases the positioning arms outwardly engaging their distal ends with the side door jambs , they are free to pivot relative to the biasing member . the rubber abuttment pad 62 on the distal end of each arm 52 frictionally engages the associated side door jamb 14 and the spring bias applied thereto by the biasing member is sufficient to suspend the entire apparatus within the doorway . since it is important that the plumb guide beam 20 be vertically oriented during the use of the apparatus so that the markable material 26 extends vertically , the apparatus has been designed so that it is self - plumbing . in other words , the positioning arms 52 are pivotally connected to the guide beam at a location 54 above its longitudinal center , which is the approximate center of gravity of the guide beam and once the positioning arms have been biased against the side door jambs to suspend the guide beam within the doorway , the guide beam will seek a vertical plumb position . after attaining a vertical position , the adjustment screw 38 at the bottom of the guide beam is advanced against the threshold 18 to secure the guide beam in the vertical position . the markable material 26 which is extended along the front face 44 of the guide beam 20 could be any suitable material upon which the desired information can be recorded in some manner , but in the preferred forms , so that the material is useful with the cutting apparatus to be described hereinafter for cutting the doors , the material 26 is a transparent tape which is secured at opposite ends to the spools 30 and 34 at the top and bottom of the guide beam respectively . preferably , the tape is of sufficient length so that information relating to a plurality of doorways can be recorded thereon by advancing the tape from one spool to the other always presenting a clean blank surface for each door opening to be measured . in operation of the apparatus 10 , it is first placed in the doorway so that the positioning arms 52 engage the side door jambs 14 adjacent the tops thereof and so that the plumb guide beam 20 is suspended in the doorway . in order to center the plumb guide beam in the doorway , the positioning arms are pivoted relative to each other until the horizontal level member 58 indicates that it is horizontal . with the horizontal orientation of the level member , the inner pivotally connected ends of the positioning arms are equally spaced from the side door jambs 14 , and the guide beam is centered in the doorway freely pivotal about the pivot connection to the positioning arms . in this orientation , the guide beam will seek a vertical plumb position as discussed before . after it has attained the vertical position , it is secured in this position by advancing the adjustment screw 38 against the threshold . the adjustment screws 60 at the terminal ends of the positioning arms 52 can then be advanced upwardly until they engage the head door jamb 16 and the relative spacing of the terminal ends of the positioning arms as indicated by the calibrated adjustment screws 60 can be recorded on the transparent markable material 26 for later use in cutting the door . with the apparatus so oriented within the doorway , the tracing beam 70 is mounted upon the guide beam so that the marking heads 86 engage the transparent marking material and the tracing beam is advanced vertically along the full length of the guide beam . the followers 78 at the outer ends of the tracing arms 76 will follow the contour of the associated side door jambs and this contour will be marked on the transparent material with the marker heads so that a pair of lines corresponding to the contour of the side door jambs are recorded on the transparent material for use in cutting the side edges of the door . by placing the horizontal tracing beam at its lowermost position on the guide beam , the distance between each end of the tracing beam and the threshold 18 of the doorway can be measured to give the angular variation of the threshold from horizontal . this information can be recorded on the transparent paper so that the lower edge of the door can be cut accordingly to match the threshold . it will be readily appreciated that the appratus is useful in quickly sizing , measuring and recording information relating to the side and head door jambs as well as the threshold of a doorway . since the marking material is long enough to accommodate a number of door measurements , the apparatus can be used over and over , each time recording information on a blank portion of the marking material so that the information relating to a plurality of doorways is recorded on the same roll of material . the information recorded on the tape 26 in accordance with the method of the present invention is used to operate a cutting apparatus 100 , fig6 through 8 , which is adapted to cut the side edges of the door in matching relationship with the lines marked on the tape . referring particularly to fig6 the cutting apparatus 100 can be seen to include a reader mechanism 102 and a pair of laterally spaced cutting blades 104 which in the preferred form are in the form of high speed straight bits each driven by an electric motor 106 similar to a large router or shaper motor . these units are mounted on cutter beds 108 so that their angle of cut is adjustable and also their depth of cut is regulated by sliding the unit toward and away from the opposite unit . each cutter unit is fixed firmly to a hydraulic ram 110 so that it can be advanced toward or away from the opposite unit in response to operation of the hydraulic ram . the hydraulic ram 100 for each cutter unit is controlled by the reader mechanism 102 which is adapted to sense the lines marked on the tape corresponding to each side door jamb of the doorway . referring to fig7 the reader mechanism has a pair of light sources 112 which project beams of light smaller than the width of the lines marked upon the material . directly below each light source , are two photo electric cell compartments 114 and 116 with a slot ( not shown ) the size of the light beam centered over the compartments in such a way that if the tape is not present , half of the light goes into each compartment and strikes each photo cell plate 118 with equal intensity . if the tape is loaded into the reading mechanism and the opaque line on the material is over the slot , then no light will pass into either compartment . the photo cells each activate an amplifier circuit 120 , which in turn activates a hydraulic valve 122 which releases the hydraulic pressure to the hydraulic ram 110 of one of the cutter mechanisms to drive the hydraulic ram toward or away from the opposite hydraulic ram . one photo cell 118 causes the associated hydraulic ram to move one direction and the other photo cell 118 causes the ram to move in the opposite direction . to operate the reader mechanism , the tape is first loaded in the mechanism and the light sources 112 turned on . the photo cells 118 are then neutralized and by manual operation of the hydraulic valve 112 the ram 110 moves with the light source until the light beam is centered on the marking associated therewith so that no light is hitting either photo cell therebeneath . this operation is carried out for the line markings relating to the left and right side door jambs . the photo cells are then activated . a drive mechanism ( not shown ) is then energized to advance the tape 26 through the reader mechanism 102 at the same rate at which a blank door member 124 is advanced between the cutter blades 104 . so long as the line markings on the tape continues to run in a straight line no light will be received by the photo cell 118 and the cutter blades will remain in a fixed position . however , if the line marking moves to the right it will begin to expose a portion of the slot and light will strike the photo cell plate on the left . this will then activate the hydraulic valve and in turn the associated hydraulic ram will move in the direction necessary to cause the light beam to also move to the right . presently , the light beam will catch up with the marking and the light will no longer hit the photo cell plate and the ram will maintain a fixed position again . with the system balanced and adjusted properly , it will follow the side door jamb contour as represented by the line marking causing the side edges of the door to be cut to correspond with the line markings and thus with the side door jambs of the door opening . after the side edges have been cut in accordance with the aforedescribed method , the top and bottom edges of the door are cut to correspond with the head door jamb and threshold of the doorway respectfully as per the instructions written on the tape designating the relationship of the head door jamb and the threshold with horizontal . after the top and bottom edges of the door have been cut , the door will be precisely cut to match the doorway in which it is to be mounted . it will be appreciated that by using the apparatus and method of the present invention , a number of doorways can be measured and sized at a particular location and the information forwarded to a cutting plant where the necessary cutting equipment is installed and ready for use . the doors can then be cut and fowarded to the installation site where they will precisely match the doorways for which they were cut . by properly coding the tape with each doorway being measured , the doors can be labeled and quickly installed once they have been delivered to the installation site . this alleviates the necessity of having a cutting instrument at each installation site and also alleviates the imprecise method previously employed for sizing and cutting doors for selected doorways . although the present invention has been described with a certain degree of particularity , it is understood that the present disclosure has been made by way of example and that changes in details of structure or procedure may be made without departing from the spirit thereof .
| 1 |
the surface of the typical magnetic media hard disk contains a thin diamond like coating of 1 nm or less over the deposition of 10 - 20 nm thick layer of ferromagnetic perpendicular materials cobalt and platinum and chromium ( cr ) over a ˜ 1 μm thick nickel phosphorus ( nip ) layer deposited on an aluminum substrate that has been polished to a roughness of less than 1 å . a focused ion beam , also known as fib , is a technique used particularly in the semiconductor and materials science fields for site - specific analysis , deposition , and ablation of materials . a fib setup is a scientific instrument that resembles a scanning electron microscope ( sem ). however , while the sem uses a focused beam of electrons to image the sample in the chamber , an fib setup instead uses a focused beam of ions . fib can also be incorporated in a system with both electron and ion beam columns , allowing the same feature to be investigated using either of the beams . now some of the preferred embodiments of the device and process under the invention are described with particular reference to the drawings . fig1 is a top view of the fourteen defects fabricated on a 2400 one 31 . 5 mil 95 mm mr disk using a focused ion beam ( fib ). seven bumps of ˜ 1 . 25 μin (˜ 32 nm ) height were deposited , and seven pits ˜ 2 μin (˜ 51 nm ) deep were etched , on a disk 50 mils (˜ 1 . 27 mm ) apart on a radius , as shown . the specified area1 dimensions were 40 × 40 , 20 × 20 , 10 × 10 , 6 × 6 , 4 × 4 , 2 × 2 and 1 × 1 μm 2 respectively . following fabrication the disk was placed on the spindle of an mg250 and erased using a wide track mig inductive head . the disk was then scanned using a 50 % slider with a piezoelectric crystal mounted on the side of one of the sliders ( i . e ., a piezo glide or glide head ) and the disk was measured for mechanical force signal from the piezoelectric glide head . the mg250 read channel was then used with a 50 % slider mr head containing a magnetized mr element . the mr current was optimum at 16 ma , and the linear velocity was maintained at 500 inches per second ( ips ) [ unless otherwise noted ]. both the glide head and the mr head was moved to the approximate location of the defect under analysis , and then stepped on a radius until a signal was detected on a lecroy lc920 oscilloscope . the signal was then optimized for maximum signal level . the maximum signal was then recorded and characterized for signal amplitude and timing characteristics . [ r . d . hemstead , ibm j . res . & amp ; dev ., vol . 18 , p547 , 1974 ]. the maximum signal measured was recorded and characterized for both mr modulation and mass spin - valve signal amplitudes and timing characteristics . the disk was then removed and each individual defect was characterized utilizing a park scientific afm for defect width along the direction of the circumference as reported in table 1 . scaling up the power density based on the read - back signal for a 40 . 9 × 40 . 9 μm 2 nano - bump [ for example ] on the spinning disk produces a 2 volts signal times 16 ma dc current on the mr resistor or 0 . 032 watts of power / 40 . 9 × 40 . 9 μm 2 ; which is equivalent to a novel power density of about 20 megawatts / meter 2 . . in another words , a spinning disk sized large enough [ scaled - up ] to contain sufficient 40 . 9 × 40 . 9 μm 2 nano - bumps to cover a surface area of one square meter would produce about 20 megawatts / meter 2 . fig6 a , 6 b , 6 c , 6 d and 6 e illustrate the mass spin - valve device ; 6 a is a typical head disk assembly ; in 6 b , an afm micrograph from a 10 μm × 10 μm area pit is shown ; in 6 c a mfm micrograph of a written track from a typical hard disk is shown . a mr read back signal from a magnetically erased disk and a certification missing pulse test reading for the same 10 μm × 10 μm area nano - pit are shown in 6 d and 6 e respectively ; fig7 a illustrates a nano - bump &# 39 ; s associate afm micrograph ; fig7 b a typical pzt glide read back signal ; and fig7 c the same nano - bump &# 39 ; s mass - spin valve read back signal . it is shown that the ms signal of bump defects exhibited a negative polarity pulse as shown in fig7 b . fig7 c shows that for a 1 . 25 μin (˜ 32 nm ) 10 μm × 10 μm bump measured with an afm produces a characteristic pzt glide signal [ measured at 890 ips ] of the downward force of the bump on the downward facing head slider and a characteristic mass spin - valve signal of a bump ( labeled as non - contact ms - valve signal ). fig8 a , fig8 b and fig8 c illustrates a nano - pit &# 39 ; s associate afm ; a typical pzt glide read back signal ; and the same nano - pit &# 39 ; s mass - spin valve read back signal respectively . fig8 b illustrates that for ˜ 2 μin 10 μm × 10 μm pit measured with an afm produce a pzt glide signal [ measured at 890 ips ] and the characteristic mass spin - valve signal of a pit . the mass spin valve signal of nano - pit defect exhibited a positive polarity pulse as shown in fig8 c . fig9 illustrates the typical magnetic induction and gravitational induction characteristic for the same nano - bump &# 39 ; s mass - spin valve read back signal . fig9 illustrates that a 10 μm × 10 μm nano - bump exhibits two electromagnetic signals due to electromagnetic induction created by the edges of the bump defect following maxwell &# 39 ; s right hand rule and also exhibits the gravitational induction signal of 0 . 304 volts , or 0 . 304 nnewtons of negative magnetic force . [ maxwell &# 39 ; s right - hand rule ( rhr ): if the conductor is held with the right hand such that the thumb points in the direction of the current flow i , the fingers circling the conductor point in the direction of the magnetic flux lines .] fig1 illustrates the typical magnetic induction and gravitational induction characteristic for the same nano - pit &# 39 ; s mass - spin valve read back signal . fig1 illustrates that a that 40 μm × 40 μm nano - pit exhibits two electromagnetic signals due to electromagnetic induction created by the edges of the pit defect and also exhibits the gravitational induction signal of 0 . 378 volts with an equivalent [ upward ] force of 0 . 378 × 10 − 9 newtons produced by 7 . 69 × 10 − 17 m 3 of missing mass . this novel upward [ anti -] gravitational force [ see table 1 ] is not predicted by any known theory . fig1 illustrates the quantum gravitational characteristics of pit or bump volume versus gravitational force rectification in the mass spin - valve device . in a metallic conductor , current is carried by the flow of electrons . in semiconductors , current is often schematized as being carried either by the flow of electrons or by the flow of positively charged “ holes ” in the electron structure of the material . there exists an equivalent quantum nature to gravity associated with the presence and absence of matter on the spinning disk to the quantum nature in electromagnetism in the semiconductor junction [ or a rectifier ] as a type electromagnetic spin valve device which is based on the spin of conduction energy band electrons in the semiconductor crystal . fig1 illustrates the gravitational induction equivalent of the semiconductor ; as a gravitational rectifier in the mass spin valve device ; whereby the downward gravitational induction force [ n type donor gravitons ] is produced by additional mass ; equivalent to the electrons in the semiconductor rectifier ; and the upward gravitational induction force [ p type acceptor anti - gravitons ] is produced by the absence of mass , equivalent to “ holes ” in the semiconductor rectifier . the relationship of mass to normal gravity is described by the relationship [ additional mass ] bump volume ( μm 3 )= 6 (− g f ) 2 − 7 (− g f )− 0 . 4 [ where g f is the [−] attractive force of gravity ] which is a parabolic force field which has two mathematically real factors . [ see fig1 ] assuming the gravitational induction force (− g f ) is variable x and the volume of additional mass is y . solving for y = 0 , by simplifying the equation by multiplying both sides with 5 , gives two real factors x 1 and x 2 : x 1 = 1 . 221255 x 2 =− 0 . 054589 . repulsive [+] anti - gravity exists in hyperbolic force field with one real part and two imaginary factors [ relative to the mr sensor ] described by the relationship [ missing mass ] pit volume ( μm 3 )=− 3000g f 3 + 1000g f 2 − 200g f + 8 . [ see fig1 ] assuming the anti - gravitational induction force ( g f ) is variable x and the volume of missing mass is y , then y =− 3000x 3 + 1000x 2 − 200x + 8 = 8 (− 375x 3 + 125x 2 − 25x + 1 ) and (− 375x 3 + 125x 2 − 25x + 1 ) the factors are two imaginary one real . solving for y = 0 gives : x 1 = 0 . 0510251 x 2 = 0 . 141154 + 0 . 179826 * i x 3 = 0 . 141154 − 0 . 179826 * i fig1 a and 12b illustrate the magnetic induction is independent from the gravitational induction in the mass spin - valve device . to examine the dependence of the measured mr mass spin - valve signal on dc erase polarity , the two wires connected to the write transducer were disconnected , and re - attached to the head &# 39 ; s paddle board for the opposite polarity to be applied to the write element during erasure . fig1 a illustrates the results at one erase polarity . fig1 b illustrates that at the opposite erase polarity , the two mr modulation read back signals corresponding to the switch in the electro - magnetic field &# 39 ; s direction produced by the edges of the falling and rising edges of the pit induced by a micro - fabricated defect is dependent on the polarity of dc erase on the mr media ; but the mr mass spin - valve signal ( i . e ., the gravitomagnetic force field &# 39 ; s direction ) is independent of the polarity of dc erase . fig1 illustrates the time band gap between gravity and electromagnetism in the mass spin - valve device . fig1 illustrates the time band gap between gravity and electromagnetism ; is about 22 μsec . fig9 illustrates that within the gravitational rectifier device that time has a “ band - gap ”; much like the semiconductor again ; where that time band - gap depends on the nano - feature &# 39 ; s “ gravitomagnetic energy ” or “ mass - energy ” plus “ electromagnetic energy ” relative to the merged head 402 . fig1 a and 14b illustrate current piezoelectric glide defect detection utilized on industrial hard disk certifiers and certifier missing pulse defect detection and correction algorithms ; and the detection of the mass spin - valve signal , labeled as ms signal , in comparison to the certifier missing pulse defect detection and correction algorithms ; on a nano - features disk prototype . fig1 a illustrates that the current piezoelectric glide defect detection utilized on industrial hard disk certifiers is unable to detect pit type defects while certifier missing pulse defect detection and correction algorithms are able to detect both type defects ( i . e ., pits and bumps ) fabricated on a 2400 oe 31 . 5 mil 95 mm mr disk using a fib . fig1 b illustrates a high degree of correlation between in the detection of the mass spin - valve signal , labeled as ms signal , and the certifier missing pulse defect detection and correction algorithms utilized by in industrial hard disk certifiers . fig1 a shows a photograph of a scratch type defect on the prototype hard disk &# 39 ; s surface and 15 b illustrates the typical mass - spin valve read back signal . fig1 a and 15b illustrate the application of the product / device for a scratch type defect on the disk &# 39 ; s surface . the mass spin - valve signal is labeled as non - contact ms - valve signal . the mass spin - valve signal exhibits magnetic transition pulses from the scratch defect &# 39 ; s edges only . fig1 a shows a photograph of a shallow pit type defect on the prototype hard disk &# 39 ; s surface and fig1 b illustrates the typical mass - spin valve read back signal . fig1 a and 16b illustrate the results from a shallow pit type defect on the disk surface . the read back signal exhibits mass spin - valve signal with no mr magnetic modulation signal present from the defect &# 39 ; s edges , but the characteristic polarity mass spin - valve signal of a pit . fig1 a shows a photograph of a short bump type defect on the prototype hard disk &# 39 ; s surface and fig1 b illustrates the typical mass - spin valve read back signal . fig1 a and 17b illustrate the results from a short bump type defect on the disk &# 39 ; s surface . the read back signal exhibits mass - spin valve with no mr magnetic modulation signal present from the defect &# 39 ; s edges , but the characteristic mass spin - valve signal of a bump . fig1 a illustrates a diagram of an atomic force microscope assembly . fig1 b is the afm profile of the calibration pit used to the exact dimensions of the calibration nano - pit in this product / device . atomic force microscopies ( afms ) are a family of instruments used for studying surface properties of materials from the atomic to the micron level . all afms contain the components illustrated in fig1 a illustrates the atomic force microscope ( afm ) probes the surface of a sample with a sharp tip , a couple of microns long and often less than 100 å in diameter . the tip is located at the free end of a cantilever that is 100 to 200 μm long . forces between the tip and the sample surface cause the cantilever to bend , or deflect . a detector measures the cantilever deflection as the tip is scanned over the sample , or the sample is scanned under the tip . the measured cantilever deflections allow a computer to generate a map of surface topography . afms can be used to study insulators and semiconductors as well as electrical conductors . several forces typically contribute to the deflection of an afm cantilever . the force most commonly associated with atomic force microscopy is an inter - atomic force called the van der waals force . fig1 b illustrates the 2 - d cross section of a 10 μm × 10 μm 200 nm deep nano - pit measured with an afm fig1 a illustrates a diagram of a magnetic force microscope cantilever , and fig1 b shows the mfm profile of the calibration pit used to determine the exact gravitomagnetic force magnitude of the calibration nano - pit in this product / device . magnetic force microscopy ( mfm ) provides a 3 - d profile of the spatial variation of magnetic forces on a sample surface . for mfm , the tip is coated with a ferromagnetic thin film . the system operates in non - contact mode , detecting changes in the resonant frequency of the cantilever induced by the magnetic field &# 39 ; s dependence on tip - to - sample separation . ( see fig1 a ) mfm can be used to image naturally occurring and deliberately written domain structures in magnetic materials . fig1 b illustrates the magnetic force microscope ( mfm ) 2 - d cross section used for a control measurement using a ˜ 200 nm deep ˜ 10 μm × 10 μm nano - pit in this product / device as shown . 1 . calibration disk standards for manufacturing purposes traceable to the national institute of standards and technology requirements . quality control for high density recording requires that the computer &# 39 ; s hard disk surface be free of defects larger than 1 μm × 1 μm in a real size or better . current methods for characterizing defects of this size are limited by slow metrology techniques such as atomic force microscopy ( afm ), the associated magnetic force microscopy ( mfm ), or faster techniques like piezoelectric ( pzt ) glide . another faster defect detection technique that uses spin stands such as magnetic certification testers that detect missing pulses at high frequency write and read rates ( i . e . phase metrics mg250 a type of hard disk certifier ). 3 . 5 μin stand and mass spin - valve time band - gap based clocks to set earth gravity standards for time 5 . teleportation devices using mass - spin valve gravity rectification that converts electromagnetism with mass - energy ; using quantum entanglement ; into electromagnetism ; and back into mass - energy ; so as to transport matter and energy to another distant location without alteration . while the invention has been described in connection with what are presently considered to be the most practical and preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments , but rather as intended to cover various modifications and equivalent arrangements which are included within the spirit and scope of the following claims :
| 6 |
before any embodiments of the invention are explained in detail , it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . also , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . fig1 illustrates a perspective view of a lock assembly 4 that includes a latch apparatus or retractor assembly 6 . one embodiment of the retractor assembly 6 includes a retractor or retractor mechanism 8 retained in a retainer apparatus 10 . fig2 illustrates one embodiment of the retainer apparatus 10 for retaining the retractor mechanism 8 . as illustrated in fig2 , the retainer apparatus 10 includes a retainer clip having a back component 15 , a first 20 and a second 25 side component , and a first 30 and a second 35 front component . in one embodiment , the back component 15 , first 20 and second 25 side components , and first 30 and second 35 front components are machined - formed from a single metal plate ( e . g ., steel plate ). in an alternative embodiment , the components of the retainer apparatus 10 can be created separately and inter - connected using any suitable means ( e . g ., spot - welded , soldered , etc .) known to those in the art . as shown in fig2 , one embodiment of the back component 15 is a curvilinear - shaped metal plate . the curvilinear shape is designed to conform to the overall shape of the lock assembly 4 . in alternative embodiments , the back component 15 can include other shapes ( e . g ., bends , flat sides , etc .) suitable for the lock assembly 4 . another embodiment of the back component 15 includes a pair of posts 40 and 45 . as shown in fig2 and 3 , the posts 40 and 45 support the retractor mechanism springs 50 and 55 . one embodiment of the posts 40 and 45 are machined stamped or cut out from the back component 15 and angled in a direction inwardly with respect to or from the back component 15 . in another embodiment , the posts 40 and 45 can be separate components attached to the back component 15 using other suitable means ( e . g ., spot - welded ) known to those in the art . in yet another embodiment , the posts 40 and 45 can be stamped or cut out from a portion of the back component 15 and each side component 20 and 25 . the back component 15 also includes a catch spring base 60 . the catch spring base 60 supports a catch spring biased against a catch of the retractor mechanism 8 ( discussed later ). the first 20 and second 25 sides form the bearing surfaces for sliding the retractor mechanism 8 in a linear direction between an extended and a retracted position . as shown in fig2 , the first 20 and second 25 side components have one end connected to each end of the back component 15 . one embodiment of side components 20 and 25 are flat plates to support the linear sliding of the retained retractor mechanism 8 . of course , the shape of the side components 20 and 25 can vary . the first 20 and the second 25 side components are designed to have some elasticity to enable installation of the retractor mechanism 8 . as shown in fig2 and 3 , the first 30 and second 35 front components constrain the retractor mechanism 8 against the back component 15 and the bias of the springs 50 and 55 . fig2 shows one embodiment of the first 30 and the second 35 front components angled inward with respect to the ends of the first 20 and second 25 side components . the inward - angled front components 30 and 35 form a narrowed gap 65 . the width of the gap 65 is designed to constrain the retractor mechanism 8 , yet allow the extension and retraction of a latch or bolt 70 ( fig1 ) of the retractor mechanism 8 . the first 30 and second 35 front components are also designed with some flexibility for installing the retractor mechanism 8 . fig3 shows a perspective view of the retractor mechanism 8 installed in the retainer apparatus 10 . the retractor mechanism 8 slides along the side components 20 and 25 to extend and retract the bolt 70 ( fig1 ). as shown in fig3 , one embodiment of the retractor - mechanism 8 includes a first 105 and a second carrier 110 , a pair of retractor bars 115 and 120 , and the pair of springs 50 and 55 . the retractor bars 115 and 120 include a pair of lips 125 and 130 that engage the bolt 70 . drive shafts 135 and 140 ( fig1 ) include cams ( not shown ) designed to engage the first 105 and second 110 carriers . when rotating drive shaft 135 to retract the bolt 70 , the cams of the drive shaft 135 engages the first carrier 105 . the rotational force of the drive shaft 135 against the carrier 105 causes the retractor mechanism 8 to slide along the side components 20 and 25 against the bias of the springs 50 and 55 . under the force of the drive shafts 135 and 140 , the retractor mechanism 8 retracts the bolt 70 . upon release of the rotational force on the drive shaft 135 and 140 , the springs 50 and 55 bias the retractor mechanism 8 forward toward its original position . thereby , the retractor mechanism 8 slides to extend the bolt 70 . the drive shaft 140 engages the carrier 110 in a similar manner as the drive shaft 135 . as shown in fig3 , another embodiment of the retractor mechanism 8 further includes a catch 141 . the catch 141 engages a spring 145 compressed against the catch spring base 60 of the back component 15 , thereby biasing the catch 141 toward an extended position . the catch 141 is operable in holding a plunger bar ( not shown ) in a locked position . fig4 illustrates a perspective view of a chassis 200 in support of the retractor mechanism 8 and retainer apparatus 10 . in one embodiment , the chassis 200 includes a first 205 and a second 210 side support for the retainer apparatus 10 . as shown in fig2 and 4 , the retainer apparatus 10 includes a plurality of prongs 240 for receiving the first 205 and second 210 side supports of the chassis 200 . the prongs 240 can be one or more extensions at each end of a component and is not limiting on the invention . in one embodiment , the back component 15 includes two pairs of back prongs 240 b and 240 d that extend past the first 20 and second 25 side components ( fig3 ). each pair of back prongs 240 b and 240 d extends parallel with the ends of the back component 15 . in addition , one embodiment of the front components 30 and 35 include front prongs 240 a ( fig1 ) and 240 c that extend outward in a similar fashion past the first 20 and second 25 side plates . similar to prongs 240 b and 240 d in relation to the back 15 , the front prongs 240 a and 240 c extend parallel with each end of the first 30 and the second 35 front plates . the back prongs 240 b and 240 d and the front prongs 240 a and 240 d are located at opposite ends of the first 20 and second 25 side components and angled inward to receive the first 205 and second 210 side supports of the chassis 200 . one embodiment of the prongs 240 a – d are machine stamped or cutout from the first 20 and second 25 side components . of course , the prongs 240 a – d can be separate components attached using other suitable means ( e . g ., spot - welded , soldered , etc .) known to those in the art . as shown in fig4 , the first 205 and second 210 side supports of the chassis 200 include reliefs 250 to receive the prongs 240 a – d of the retainer apparatus 10 . one embodiment of a relief 250 is a beveled edge at an angle compatible with the angle of the prongs 240 a – d . of course , other shapes ( e . g ., channels ) for a relief 250 in the side supports 205 and 210 of the chassis 200 can be used . as shown in fig2 – 4 , the retainer apparatus 10 allows the retractor mechanism 8 to be assembled individually from the build - up of the chassis 200 that supports the lock assembly 4 . fig2 illustrates one embodiment of the retainer apparatus 10 that is formed from machine pressing a metal plate . an operator pre - assembles the retractor assembly 6 by flexing the side components 20 and 25 , then inserting the retractor mechanism 8 inside the retainer apparatus 10 . upon unflexing the side components 20 and 25 , the retractor mechanism is constrained . once the retractor assembly 6 is pre - assembled , the retractor assembly 6 can be inserted or connected to the chassis 200 as shown in fig1 and 4 . in one embodiment , the chassis 200 is pre - assembled individually from the retractor assembly 6 . upon individual assembly of the retractor assembly 6 and the chassis 200 , an operator can insert or slide the assembled retractor apparatus 6 , as shown by arrow 255 in fig4 , into an aperture 258 formed by the assembled chassis 200 . as described above , the prongs 240 a – d secure the retractor assembly 6 to the chassis 200 . to disassemble the lock assembly 4 , the retractor assembly 6 can be removed from the chassis 200 without disassembling the retractor mechanism 8 and / or chassis 200 similar to the method for assembly described above . in one embodiment , an operator can slidingly remove the retractor assembly 6 from the reliefs 250 of the chassis 200 without disassembling the chassis 200 . thereby , the design of the retractor mechanism 8 and retainer apparatus 10 of the invention is more versatile and less cumbersome to assemble and / or disassemble . in another embodiment , the retractor assembly 6 can be slid along the reliefs 250 when assembling the chassis 200 of the lock assembly 4 . fig1 illustrates an exemplary embodiment of a lock assembly 4 with the retractor assembly 6 interconnected through an aperture 258 with an assembled chassis 200 . the chassis 200 includes a first 260 and a second 265 hub having openings for receiving the drive shafts 135 and 140 . the exemplary first hub 260 and second 265 hubs are mounted using screws 270 . of course , other suitable connection means ( e . g ., spot - weld , cast , etc .) known in the art can be used . one embodiment of the chassis 200 is comprised of cast metal . of course , the chassis 200 can be comprised of cast metal and / or one or more other suitable materials ( e . g ., forged metal , plastic ) known in the art of lock assemblies . thus , the invention provides , among other things , a retractor assembly having a retractor mechanism retained in a retainer apparatus for connection to a chassis of a lock assembly . various features and advantages of the invention are set forth in the following claims .
| 8 |
composite - modified , double - base propellants and composite propellants have enhanced burning rate when heat - expandable beads of discrete particles of thermoplastic styrene or its copolymers which contain about 5 - 8 % of an expanding agent or blowing agent , e . g ., pentane , celogen ot , 4 , 4 &# 39 ;- oxybis ( benzenesulfonyl hydrazide ) etc ., are incorporated into the matrix of the propellant . bead expansion or rupture when exposed to the flame front of burning propellant brings about disruption of the propellant &# 39 ; s surface , and the flame can penetrate into the propellant . this penetration brings about a major increase in burning rate . the incorporation of mechanical burning rate augmenters into ultrahigh burning rate solid propellants is presently considered to be essential to achieve the burning rate regimes of current interest for use in advanced interceptors . a combination of mechanical and chemical rate accelerators results in the following beneficial effects over that of chemical accelerators alone : a . the combination produces a higher burning rate than can be achieved using either accelerator by itself ; b . the combination results in a considerable reduction in the amount of chemical accelerator required to obtain a particular burning rate ; c . any approach that reduces the amount of chemical accelerator that is needed means a major reduction in the cost of the propellant ; d . the problems associated with migration of the liquid chemical accelerator to the surface of the propellant and into the liner - barrier - insulation is reduced ; e . the loss of chemical accelerator because of its volatility is also reduced . the carboranyl - catalyzed , hydroxyl - terminated polybutadiene - based propellant , illustrated in table i , requires about 9 % carborane to produce the ultrahigh - burning rates for advanced interceptors ( 9 - 10 ips @ 2000 psi .) whereas , the carboranyl - catalyzed , composite - modified double - base propellant , illustrated in table ii , containing 2 . 9 % aluminum whiskers , only needs 4 . 7 % carboranylmethyl propionate to produce the same burning rate . since the present price of carborane ranges between $ 1200 -$ 600 per pound , it is understandable why the composite - modified , double - base propellants were selected for further exploitation . since there is a larger production capacity for the manufacture of composite propellants , it is desirable to take advantage of this factor . the incorporation of heat - expandable beads can make this a reality . table i and ii provides a comparison of the composition and characteristics of composite and composite - modified , double - base propellants with and without heat - expandable beads . table i______________________________________composition and characteristics of acomposite propellant without and withheat - expandable beads propellant a b______________________________________compositionaluminum powder ( alcoa 5341 ) 12 . 0 12 . 0ammonium perchlorate ( 70 μm ) 73 . 0 73 . 0 . sub .-- n - hexylcarborane 9 . 0 6 . 0hydroxyl - terminated polybutadiene 6 . 0 6 . 0prepolymertrimethylolpropane ( additive ) 0 . 06 0 . 06ba - 114 * ( additive ) 0 . 3 0 . 3isophorone diisocyanate ( additive ) 0 . 7 0 . 7heat - expandable beads 0 . 0 3 . 0mechanical propertiestensile strength [ psi ] 260 350strain @ max . stress [%] 17 45modulus [ psi ] 1700 1200density [ lb / in . sup . 3 ] 0 . 062 0 . 062ballistic propertiesstrand burning rate [ r . sub . 2000 ] [ ips ] 9 . 00 12 . 2______________________________________ * reaction product of 12hydroxystearic acid and tris [ 2methylaziridinyl ] phosphine oxide table ii______________________________________composition and characteristics of acomposite - modified , double - basepropellant without and withheat - expandable beads propellantcomposition a b c______________________________________casting powdernitrocellulose 16 . 6 16 . 6 16 . 6nitroglycerin 6 . 1 6 . 1 6 . 1carboranylmethyl 4 . 7 4 . 7 3 . 7propionateammonium perchlorate 32 . 8 32 . 8 32 . 8 ( 1 . 0 μm ) aluminum powder 7 . 2 7 . 2 7 . 2aluminum whiskers 2 . 9 0 . 0 0 . 0heat - expandable beads 0 . 0 2 . 9 3 . 9resorcinol 0 . 7 0 . 7 0 . 72 - nitrodiphenylamine 1 . 1 1 . 1 1 . 1casting solventnitroglycerin 25 . 0 25 . 0 25 . 0triacetin 2 . 5 2 . 5 2 . 52 - nitrodiphenylamine 0 . 3 0 . 3 0 . 3hexane diisocyanate 0 . 14 0 . 14 0 . 14triphenylbismuthine 0 . 02 0 . 02 0 . 02mechanical propertiestensile strength [ psi ] 325 - 416 400 - 425 400 - 420strain @ max . stress [%] 35 - 54 40 - 50 45 - 55modulus [ psi ] 900 - 1000 1000 - 1120 1000 - 1500ballistic propertiesstrand burning rate 10 . 1 11 . 7 12 . 4 [ r . sub . 2000 ] [ ips ] ______________________________________ the data relating to mechanical properties and ballistic properties of the propellants in tables i and table ii indicate that the incorporation of heat - expandable beads into propellants results in a substantial increase in the burning rates while achieving a substantial savings in the carborane catalyst required to obtain a desired level of burning rate for advanced interceptors . the mechanical properties as a result of changes in the formulations are enhanced or retained at a level attractive for use in advanced interceptors . the term , expandable bead , is applied to discrete particles of thermoplastic styrene or its copolymers which contain 5 - 8 % by weight of an expanding agent . the capacity to expand to a broad range of densities make expandable polystyrene unique among thermoplastics . examples of styrene and its copolymers which can be employed with the expanding agent or blowing agent to form discrete thermoplastic particles or beads are : copolymers of styrene and methyl methacrylate , copolymers of styrene and vinyl chloride , and copolymers of styrene and vinyl acetate . these expandable beads have a bulk density of 38 - 40 pounds per cubic foot ( pcf ). they are expandable to a pre - expanded end product density of 1 . 0 - 4 . 5 pcf . the beads can be expanded in a stream or vacuum pre - expander . the steam pre - expander consists of an upright , cylindrical , insulated tank with a motor - driven vertical shaft to which several horizontal bars have been attached . stationary horizontal bars are mounted slightly off center across the tank so that they do not interfere with the movement of the moving bars . the procedure for preparing the expandable beads is as follows : the raw materials , styrene and pentane , are fed into the tank through the side at or near the bottom . steam is injected into the tank through a separate port . as the beads are expanded , they float to the top of pre - expander , and overflow into the discharge chute . stirring is necessary during expansion to prevent agglomeration of the beads to occur . while steam expansion is the most efficient , the product requires aging for 6 - 12 hours , depending upon density . minimum density for a single expansion is 0 . 95 pcf . lower densities can be achieved by a second expansion at a substantially lower rate . vacuum pre - expansion yields a dry , stable product having densities as low as 0 . 80 pcf . the density of the pre - expanded beads is controlled by preheat time , jacket temperature , degree of vacuum time . encapsulation of celogen ot in a polystyrene matrix is carried out in the equivalent of a sweetie barrel in which styrene and celogen ot are tumbled together . an organic peroxide , such as , t - butyl peroxide is used to catalyze the polymerization of the styrene and bead formation .
| 8 |
in the drawings , elements that are identical or have the same function are identified by the same reference numerals . in fig1 a and 1 b , a first preferred feature of a heat sink 10 can be seen in perspective ( fig1 a ) and in side view ( fig1 b ). an electrical component 42 mounted on a circuit board 40 is connected to the heat sink 10 for heat dissipation . in the exemplary embodiment shown , a first heat sink portion 12 is embodied as a spring , in that the first heat sink portion 12 is bent at an angle transversely , in particular vertically , from a second heat sink portion 14 . the second heat sink portion 14 is embodied in platelike form and is affixed to the circuit board 40 with securing elements 16 . advantageously , the second heat sink portion 14 can be secured to the circuit board 40 by means of a positive - engagement connection , for instance in this case with so - called crimped feet as securing elements 16 , which engage corresponding recesses , not identified by reference numeral , in the circuit board 40 . the circuit board 40 can be connected for instance to a further circuit , not shown , or may be a portion of a larger circuit board . electrical contacts of the component 42 with the circuit board 40 are extended through suitable openings 36 in the second heat sink portion 14 . for heat dissipation , the component 42 is mechanically connected to the first heat sink portion 12 . the component 42 is spaced apart somewhat from the main face of the second heat sink portion 14 and is seated on a hump 32 of the second heat sink portion 14 . the first heat sink portion 12 is embodied in hooplike form and has a first leg 18 and a second leg 22 , parallel to the first , which are connected by a connecting piece 26 . a contact face 20 between the heat sink 10 and the component 42 that acts in a targeted way as a heat diversion face , is provided in the first heat sink portion 12 . the first heat sink portion 12 includes main faces , not identified by reference numeral , of the component 42 , and these faces are contacted over a large area by the legs 18 , 22 , in that with a clamping force , the two legs 18 , 22 contact the component 42 disposed in the hollow space 28 between the legs 18 , 22 . accordingly , the contact face 20 is disposed on an inner side of the first leg 18 . there , the leg 18 rests over a large area on the component 42 . the second leg 22 rests with its rounded end piece 24 on the opposite side and presses the component against the first leg 18 . the component 42 can be guided and optionally even held by means of guide elements 30 , which are disposed on the heat sink portion 12 and protrude transversely from it . the guide elements 30 are disposed laterally on the first leg 18 , engage side faces of the component 42 , and serve to guide the component 42 . the component 42 may for instance be a capacitor . in a variant , not shown , further components , such as field effect transistors , can be disposed on , in particular screwed to , the outer side of the leg 18 and / or 22 of the first heat sink portion 12 . the foregoing relates to the preferred exemplary embodiments of the invention , it being understood that other variants and embodiments thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims . fig2 a and 2 b show an alternative embodiment in perspective ( fig2 a ) and in a side view ( fig2 b ), in which a contact face 20 intended for targeted heat dissipation is disposed on an outer side of one leg 22 of a heat sink 10 . an electrical component 42 mounted on a circuit board 40 is connected for heat dissipation to the heat sink 10 . a first heat sink portion 12 is embodied as a spring , in that the first heat sink portion 12 is bent at an angle transversely , in particular vertically , from a second heat sink portion 14 . the second heat sink portion 14 is embodied in platelike form and is affixed to the circuit board 40 with securing elements 16 . advantageously , the second heat sink portion 14 can be secured to the circuit board 40 by means of a positive - engagement connection , for instance in this case with so - called crimped feet as securing elements 16 , which engage corresponding recesses , not identified by reference numeral , in the circuit board 40 . the circuit board 40 can be connected for instance to a further circuit , not shown , or may be a portion of a larger circuit board . in the exemplary embodiment shown , in the mounted state , the component 42 can be clamped between the contact face 20 on the outer side of one of the legs 18 , 22 and a further clamping portion 34 . the clamping portion 34 can be stamped out of the second heat sink portion 14 and curved accordingly . the first heat sink portion 12 is designed such that the two legs 18 , 22 are pressed against one another , while the legs 18 , 22 seek to move apart from one another . as a result , a spring force is exerted against the component 42 , which the clamping portion 34 counteracts and thus presses the component 42 firmly against the outer side of the second leg 22 . as a result of the intimate two - dimensional contact , a good heat transfer from the component 42 to the leg 22 and thus into the heat sink portion 12 can be accomplished . here as well , the component 42 is held or guided on the first heat sink portion 12 by means of guide elements 30 . the guide elements 30 are disposed laterally on the first leg 18 , are angled transversely to it , and engage side faces of the component 42 . the component 42 may for instance be a capacitor . in a variant , not shown , further components , such as field effect transistors , can be disposed on , in particular screwed to , the outer side of the leg 18 and / or 22 of the first heat sink portion 12 . the foregoing relates to the preferred exemplary embodiments of the invention , it being understood that other variants and embodiments thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims .
| 7 |
with reference now to the figures , and in particular to fig1 a , a routing flow of outgoing internet protocol ( ip ) packet calls that are to be wiretapped in accordance with the method and system described herein is depicted . a monitored voice over internet protocol ( voip ) unit 102 ( e . g ., telephone , personal digital assistant — pda , computer , etc .) sends a voip packet ( e . g ., containing a header and voice - data ) is sent to a bearer signal switch 104 , which is preferably compliant with signaling system no . 7 ( ss7 ), as defined by international telegraph and telephone consultative committee ( ccitt ), and incorporated by reference herein in its entirety . bearer signal switch 104 sends the voip packet to a digital - to - analog converter ( dac ) 106 , which converts the voip packet into an analog signal that is transmittable across a standard public switched telephone network ( pstn ), including an analog - switched plain old telephone system ( pots ). the analog signal is then directed to a pots switch 108 , which has associated with it the technology required to perform a wiretap ( with listening and recording capability ) of calls that are routed through pots switch 108 . in one embodiment , bearer signal switch 104 is directed to send the voip packet ( and its analog signal descendent ) to pots switch 108 by an application program interface ( api ) overhead program , such as a parlay api from the parlay group . such an api allows a third - party service to control operation of bearer signal switch 104 , including the routing of calls from a telephone that is under a court order to be wiretapped . that is , this api directs bearer signal switch 104 to examine the header of the voip packet to determine what ip address sent the voip packet , and to determine from a lookup table which telephone number is associated with this ip address . if the telephone number matches one of the telephone numbers whose calls are to be wiretapped , then the api directs the bearer signal switch 104 to redirect the voip packet to the pots switch 108 to be wiretapped . if the analog signal is being sent to a pots analog telephone 110 , then the analog signal ( with analog voice information ) is sent directly to analog unit ( e . g ., telephone ) 110 . if pots switch 108 determines that the call is being sent to another voip unit 114 ( telephone , pda , etc . ), then the analog signal must first be converted back into a voip packet by an analog - to - digital converter ( adc ) 112 . referring now to fig1 b , a routing flow of calls incoming to voip unit 102 is depicted . if the call originates from analog unit 110 , then the incoming call signal is routed to a standard pots switch 105 , which is under the ( at least partial ) control of software such as the parlay api described above , such that the incoming call is redirected to the pots switch 108 that has the wiretapping capability . after being monitored / recorded at pots switch 108 , the call continues as an analog signal to an adc 112 ( which may be the same or different from adc 112 shown in fig1 a ), where it is converted into a voip packet for receipt by the receiving voip unit 102 . if the incoming call is from voip unit 114 , then the voip packet is sent to a bearer signal switch 107 ( which is preferably ss7 compliant , and may be the same or different from bearer signal switch 104 described in fig1 a ). bearer signal switch 107 is under ( at least partial ) control of an api as described above for bearer signal switch 104 , such that the voip packet is redirected to the pots switch 108 that can wiretap the call ( after being converted into an analog signal at a dac 109 , which may be the same or different from dac 106 described in fig1 a ). the analog signal is then sent to an adc 113 ( which may be the same or different from adc 112 describe in fig1 a ), and voip unit 102 receives the voip packet . note that the described “ incoming call ” may either be a newly initiated call from a third party unit ( telephone ), or may simply be a reply signal ( under a full duplex system ) from a call that was initiated by voip unit 102 . with reference now to fig2 , another flow diagram 200 as used in the present intention is presented . assume that session initiation protocol ( sip ) client 202 is a voip telephone or similar type unit that is the subject of a court - ordered wiretap . being a sip device , sip client 202 uses the basic format of rfc 2822 , as published by the network working group in april 2001 , and which is herein incorporated by reference in its entirety . sip messages travel as requests from sip client 202 to sip logical server 204 , or as responses from sip logical server 204 to sip client 202 . both request and response messages include a control signal ( information that includes a method name , address and protocol version , one or more header fields that describe how a message packet is to be routed ) and a bearer signal ( message body ). when an outgoing call is made from sip client 202 , the control signal for the call is sent from sip logical server 204 to a telco “ softswitch ” 206 . telco softswitch 206 causes voip packets ( bearer signal ) from sip client 202 to be converted into analog form ( dac voip packets 210 ), which are sent to an ss7 telco circuit switch 208 , which includes analog wiretapping equipment . while tapping the call , ss7 telco circuit switch 208 forwards the analog bearer signal to the third party unit 212 , which may be an analog , digital , or voip telephone as described above in fig1 a - b . return ( or initial ) calls from third party unit 212 are converted back into digital voip format ( if necessary ) as indicated by adc voip packets 214 . referring now to fig3 , a flowchart of the steps described in fig1 - 2 is presented . after initiator block 302 , a ss7 switch receives a telephone call from or to a voip address that corresponds with a telephone number that is under a court - order to have calls wiretapped ( block 304 ). if in voip format ( either incoming or outgoing ), the call is converted into analog form ( block 306 ), in order to be easily monitored and recorded . this analog - converted call is redirected to an analog switching location that has wiretapping ( monitoring and recording ) ability ( block 308 ), where such activities occur ( block 310 ). after being monitored / recorded , if the call is being sent to a voip unit ( query block 312 ), it must be re - converted back into the voip format ( block 314 ) before being transmitted to the receiver ( block 316 ). if the call if finished ( query block 318 ), the process ends at terminator block 320 . otherwise , any call ( to or from the phone that is under court - ordered surveillance ) if converted to analog form ( block 322 ) if necessary , and the process continues at block 308 in an iterative fashion . with reference now to fig4 , there is depicted a block diagram of an exemplary client computer 402 , which may be utilized as telco softswitch 206 described above . client computer 402 includes a processor unit 404 that is coupled to a system bus 406 . a video adapter 408 , which drives / supports a display 410 , is also coupled to system bus 406 . system bus 406 is coupled via a bus bridge 412 to an input / output ( i / o ) bus 414 . an i / o interface 416 is coupled to i / o bus 414 . i / o interface 416 affords communication with various i / o devices , including a keyboard 418 , a mouse 420 , a compact disk - read only memory ( cd - rom ) drive 422 , a floppy disk drive 424 , and a flash drive memory 426 . the format of the ports connected to i / o interface 416 may be any known to those skilled in the art of computer architecture , including but not limited to universal serial bus ( usb ) ports . client computer 402 is able to communicate with a service provider server 502 via a network 428 using a network interface 430 , which is coupled to system bus 406 . network 428 may be an external network such as the internet , or an internal network such as an ethernet or a virtual private network ( vpn ). using network 428 , client computer 402 is able to use the present invention to access service provider server 502 . a hard drive interface 432 is also coupled to system bus 406 . hard drive interface 432 interfaces with a hard drive 434 . in a preferred embodiment , hard drive 434 populates a system memory 436 , which is also coupled to system bus 406 . data that populates system memory 436 includes client computer 402 &# 39 ; s operating system ( os ) 438 and application programs 444 . os 438 includes a shell 440 , for providing transparent user access to resources such as application programs 444 . generally , shell 440 is a program that provides an interpreter and an interface between the user and the operating system . more specifically , shell 440 executes commands that are entered into a command line user interface or from a file . thus , shell 440 ( as it is called in unix ®), also called a command processor in windows ®, is generally the highest level of the operating system software hierarchy and serves as a command interpreter . the shell provides a system prompt , interprets commands entered by keyboard , mouse , or other user input media , and sends the interpreted command ( s ) to the appropriate lower levels of the operating system ( e . g ., a kernel 442 ) for processing . note that while shell 440 is a text - based , line - oriented user interface , the present invention will equally well support other user interface modes , such as graphical , voice , gestural , etc . as depicted , os 438 also includes kernel 442 , which includes lower levels of functionality for os 438 , including providing essential services required by other parts of os 438 and application programs 444 , including memory management , process and task management , disk management , and mouse and keyboard management . application programs 444 include a browser 446 . browser 446 includes program modules and instructions enabling a world wide web ( www ) client ( i . e ., client computer 402 ) to send and receive network messages to the internet using hypertext transfer protocol ( http ) messaging , thus enabling communication with service provider server 502 . application programs 444 in client computer 402 &# 39 ; s system memory also include a voip wiretap software ( vws ) 448 . vws 448 includes code for implementing the processes described in fig1 - 3 . in one embodiment , client computer 402 is able to download vws 448 from service provider server 502 . the hardware elements depicted in client computer 402 are not intended to be exhaustive , but rather are representative to highlight essential components required by the present invention . for instance , client computer 402 may include alternate memory storage devices such as magnetic cassettes , digital versatile disks ( dvds ), bernoulli cartridges , and the like . these and other variations are intended to be within the spirit and scope of the present invention . as noted above , vws 448 can be downloaded to client computer 402 from service provider server 502 , shown in exemplary form in fig5 . service provider server 502 includes a processor unit 504 that is coupled to a system bus 506 . a video adapter 508 is also coupled to system bus 506 . video adapter 508 drives / supports a display 510 . system bus 506 is coupled via a bus bridge 512 to an input / output ( i / o ) bus 514 . an i / o interface 516 is coupled to i / o bus 514 . i / o interface 516 affords communication with various i / o devices , including a keyboard 518 , a mouse 520 , a compact disk - read only memory ( cd - rom ) drive 522 , a floppy disk drive 524 , and a flash drive memory 526 . the format of the ports connected to i / o interface 516 may be any known to those skilled in the art of computer architecture , including but not limited to universal serial bus ( usb ) ports . service provider server 502 is able to communicate with client computer 402 via network 428 using a network interface 530 , which is coupled to system bus 506 . access to network 428 allows service provider server 502 to execute and / or download vws 448 to client computer 402 . system bus 506 is also coupled to a hard drive interface 532 , which interfaces with a hard drive 534 . in a preferred embodiment , hard drive 534 populates a system memory 536 , which is also coupled to system bus 506 . data that populates system memory 536 includes service provider server 502 &# 39 ; s operating system 538 , which includes a shell 540 and a kernel 542 . shell 540 is incorporated in a higher level operating system layer and utilized for providing transparent user access to resources such as application programs 544 , which include a browser 546 , and a copy of vws 448 described above , which can be deployed to client computer 402 . the hardware elements depicted in service provider server 502 are not intended to be exhaustive , but rather are representative to highlight essential components required by the present invention . for instance , service provider server 502 may include alternate memory storage devices such as flash drives , magnetic cassettes , digital versatile disks ( dvds ), bernoulli cartridges , and the like . these and other variations are intended to be within the spirit and scope of the present invention . note further that , in a preferred embodiment of the present invention , service provider server 502 performs all of the functions associated with the present invention ( including execution of vws 448 ), thus freeing client computer 402 from using its resources . it should be understood that at least some aspects of the present invention may alternatively be implemented in a computer - useable medium that contains a program product . programs defining functions on the present invention can be delivered to a data storage system or a computer system via a variety of signal - bearing media , which include , without limitation , non - writable storage media ( e . g ., cd - rom ), writable storage media ( e . g ., hard disk drive , read / write cd rom , optical media ), system memory such as but not limited to random access memory ( ram ), and communication media , such as computer and telephone networks including ethernet , the internet , wireless networks , and like network systems . it should be understood , therefore , that such signal - bearing media when carrying or encoding computer readable instructions that direct method functions in the present invention , represent alternative embodiments of the present invention . further , it is understood that the present invention may be implemented by a system having means in the form of hardware , software , or a combination of software and hardware as described herein or their equivalent . thus , the method described herein , and in particular as shown and described in fig1 - 3 , can be deployed as a process software from service provider server 502 ( shown in fig5 ) to client computer 402 ( shown in fig4 ). referring then to fig6 , step 600 begins the deployment of the process software . the first thing is to determine if there are any programs that will reside on a server or servers when the process software is executed ( query block 602 ). if this is the case , then the servers that will contain the executables are identified ( block 604 ). the process software for the server or servers is transferred directly to the servers &# 39 ; storage via file transfer protocol ( ftp ) or some other protocol or by copying though the use of a shared file system ( block 606 ). the process software is then installed on the servers ( block 608 ). next , a determination is made on whether the process software is to be deployed by having users access the process software on a server or servers ( query block 610 ). if the users are to access the process software on servers , then the server addresses that will store the process software are identified ( block 612 ). a determination is made if a proxy server is to be built ( query block 614 ) to store the process software . a proxy server is a server that sits between a client application , such as a web browser , and a real server . it intercepts all requests to the real server to see if it can fulfill the requests itself . if not , it forwards the request to the real server . the two primary benefits of a proxy server are to improve performance and to filter requests . if a proxy server is required , then the proxy server is installed ( block 616 ). the process software is sent to the servers either via a protocol such as ftp or it is copied directly from the source files to the server files via file sharing ( block 618 ). another embodiment would be to send a transaction to the servers that contained the process software and have the server process the transaction , then receive and copy the process software to the server &# 39 ; s file system . once the process software is stored at the servers , the users , via their client computers , then access the process software on the servers and copy to their client computers file systems ( block 620 ). another embodiment is to have the servers automatically copy the process software to each client and then run the installation program for the process software at each client computer . the user executes the program that installs the process software on his client computer ( block 622 ) then exits the process ( terminator block 624 ). in query step 626 , a determination is made whether the process software is to be deployed by sending the process software to users via e - mail . the set of users where the process software will be deployed are identified together with the addresses of the user client computers ( block 628 ). the process software is sent via e - mail to each of the users &# 39 ; client computers ( block 630 ). the users then receive the e - mail ( block 632 ) and then detach the process software from the e - mail to a directory on their client computers ( block 634 ). the user executes the program that installs the process software on his client computer ( block 622 ) then exits the process ( terminator block 624 ). lastly a determination is made on whether to the process software will be sent directly to user directories on their client computers ( query block 636 ). if so , the user directories are identified ( block 638 ). the process software is transferred directly to the user &# 39 ; s client computer directory ( block 640 ). this can be done in several ways such as , but not limited to , sharing of the file system directories and then copying from the sender &# 39 ; s file system to the recipient user &# 39 ; s file system or alternatively using a transfer protocol such as file transfer protocol ( ftp ). the users access the directories on their client file systems in preparation for installing the process software ( block 642 ). the user executes the program that installs the process software on his client computer ( block 622 ) and then exits the process ( terminator block 624 ). the present software can be deployed to third parties as part of a service wherein a third party vpn service is offered as a secure deployment vehicle or wherein a vpn is built on - demand as required for a specific deployment . a virtual private network ( vpn ) is any combination of technologies that can be used to secure a connection through an otherwise unsecured or untrusted network . vpns improve security and reduce operational costs . the vpn makes use of a public network , usually the internet , to connect remote sites or users together . instead of using a dedicated , real - world connection such as leased line , the vpn uses “ virtual ” connections routed through the internet from the company &# 39 ; s private network to the remote site or employee . access to the software via a vpn can be provided as a service by specifically constructing the vpn for purposes of delivery or execution of the process software ( i . e . the software resides elsewhere ) wherein the lifetime of the vpn is limited to a given period of time or a given number of deployments based on an amount paid . the process software may be deployed , accessed and executed through either a remote - access or a site - to - site vpn . when using the remote - access vpns the process software is deployed , accessed and executed via the secure , encrypted connections between a company &# 39 ; s private network and remote users through a third - party service provider . the enterprise service provider ( esp ) sets a network access server ( nas ) and provides the remote users with desktop client software for their computers . the telecommuters can then dial a toll - bee number or attach directly via a cable or dsl modem to reach the nas and use their vpn client software to access the corporate network and to access , download and execute the process software . when using the site - to - site vpn , the process software is deployed , accessed and executed through the use of dedicated equipment and large - scale encryption that are used to connect a company &# 39 ; s multiple fixed sites over a public network such as the internet . the process software is transported over the vpn via tunneling which is the process of placing an entire packet within another packet and sending it over a network . the protocol of the outer packet is understood by the network and both points , called tunnel interfaces , where the packet enters and exits the network . the process for such vpn deployment is described in fig7 . initiator block 702 begins the virtual private network ( vpn ) process . a determination is made to see if a vpn for remote access is required ( query block 704 ). if it is not required , then proceed to query block 706 . if it is required , then determine if the remote access vpn exists ( query block 708 ). if a vpn does exist , then proceed to block 710 . otherwise identify a third party provider that will provide the secure , encrypted connections between the company &# 39 ; s private network and the company &# 39 ; s remote users ( block 712 ). the company &# 39 ; s remote users are identified ( block 714 ). the third party provider then sets up a network access server ( nas ) ( block 716 ) that allows the remote users to dial a toll free number or attach directly via a broadband modem to access , download and install the desktop client software for the remote - access vpn ( block 718 ). after the remote access vpn has been built or if it has been previously installed , the remote users can access the process software by dialing into the nas or attaching directly via a cable or dsl modem into the nas ( block 710 ). this allows entry into the corporate network where the process software is accessed ( block 720 ). the process software is transported to the remote user &# 39 ; s desktop over the network via tunneling . that is , the process software is divided into packets and each packet including the data and protocol is placed within another packet ( block 722 ). when the process software arrives at the remote user &# 39 ; s desktop , it is removed from the packets , reconstituted and then is executed on the remote user &# 39 ; s desktop ( block 724 ). a determination is then made to see if a vpn for site to site access is required ( query block 706 ). if it is not required , then proceed to exit the process ( terminator block 726 ). otherwise , determine if the site to site vpn exists ( query block 728 ). if it does exist , then proceed to block 730 . otherwise , install the dedicated equipment required to establish a site to site vpn ( block 738 ). then build the large scale encryption into the vpn ( block 740 ). after the site to site vpn has been built or if it had been previously established , the users access the process software via the vpn ( block 730 ). the process software is transported to the site users over the network via tunneling ( block 732 ). that is the process software is divided into packets and each packet including the data and protocol is placed within another packet ( block 734 ). when the process software arrives at the remote user &# 39 ; s desktop , it is removed from the packets , reconstituted and is executed on the site user &# 39 ; s desktop ( block 736 ). the process then ends at terminator block 726 . the process software which consists of code for implementing the process described herein may be integrated into a client , server and network environment by providing for the process software to coexist with applications , operating systems and network operating systems software and then installing the process software on the clients and servers in the environment where the process software will function . the first step is to identify any software on the clients and servers including the network operating system where the process software will be deployed that are required by the process software or that work in conjunction with the process software . this includes the network operating system that is software that enhances a basic operating system by adding networking features . next , the software applications and version numbers will be identified and compared to the list of software applications and version numbers that have been tested to work with the process software . those software applications that are missing or that do not match the correct version will be upgraded with the correct version numbers . program instructions that pass parameters from the process software to the software applications will be checked to ensure the parameter lists matches the parameter lists required by the process software . conversely parameters passed by the software applications to the process software will be checked to ensure the parameters match the parameters required by the process software . the client and server operating systems including the network operating systems will be identified and compared to the list of operating systems , version numbers and network software that have been tested to work with the process software . those operating systems , version numbers and network software that do not match the list of tested operating systems and version numbers will be upgraded on the clients and servers to the required level . after ensuring that the software , where the process software is to be deployed , is at the correct version level that has been tested to work with the process software , the integration is completed by installing the process software on the clients and servers . for a high - level description of this process , reference is now made to fig8 . initiator block 802 begins the integration of the process software . the first tiling is to determine if there are any process software programs that will execute on a server or servers ( block 804 ). if this is not the case , then integration proceeds to query block 806 . if this is the case , then the server addresses are identified ( block 808 ). the servers are checked to see if they contain software that includes the operating system ( os ), applications , and network operating systems ( nos ), together with their version numbers , which have been tested with the process software ( block 810 ). the servers are also checked to determine if there is any missing software that is required by the process software in block 810 . a determination is made if the version numbers match the version numbers of os , applications and nos that have been tested with the process software ( block 812 ). if all of the versions match and there is no missing required software the integration continues in query block 806 . if one or more of the version numbers do not match , then the unmatched versions are updated on the server or servers with the correct versions ( block 814 ). additionally , if there is missing required software , then it is updated on the server or servers in the step shown in block 814 . the server integration is completed by installing the process software ( block 816 ). the step shown in query block 806 , which follows either the steps shown in block 804 , 812 or 816 determines if there are any programs of the process software that will execute on the clients . if no process software programs execute on the clients the integration proceeds to terminator block 818 and exits . if this not the case , then the client addresses are identified as shown in block 820 . the clients are checked to see if they contain software that includes the operating system ( os ), applications , and network operating systems ( nos ), together with their version numbers , which have been tested with the process software ( block 822 ). the clients are also checked to determine if there is any missing software that is required by the process software in the step described by block 822 . a determination is made is the version numbers match the version numbers of os , applications and nos that have been tested with the process software ( query block 824 ). if all of the versions match and there is no missing required software , then the integration proceeds to terminator block 818 and exits . if one or more of the version numbers do not match , then the unmatched versions are updated on the clients with the correct versions ( block 826 ). in addition , if there is missing required software then it is updated on the clients ( also block 826 ). the client integration is completed by installing the process software on the clients ( block 828 ). the integration proceeds to terminator block 818 and exits . the process software is shared , simultaneously serving multiple customers in a flexible , automated fashion . it is standardized , requiring little customization and it is scalable , providing capacity on demand in a pay - as - you - go model . the process software can be stored on a shared file system accessible from one or more servers . the process software is executed via transactions that contain data and server processing requests that use cpu units on the accessed server . cpu units are units of time such as minutes , seconds , hours on the central processor of the server . additionally the assessed server may make requests of other servers that require cpu units . cpu units are an example that represents but one measurement of use . other measurements of use include but are not limited to network bandwidth , memory usage , storage usage , packet transfers , complete transactions etc . when multiple customers use the same process software application , their transactions are differentiated by the parameters included in the transactions that identify the unique customer and the type of service for that customer . all of the cpu units and other measurements of use that are used for the services for each customer are recorded . when the number of transactions to any one server reaches a number that begins to affect the performance of that server , other servers are accessed to increase the capacity and to share the workload . likewise when other measurements of use such as network bandwidth , memory usage , storage usage , etc . approach a capacity so as to affect performance , additional network bandwidth , memory usage , storage etc . are added to share the workload . the measurements of use used for each service and customer are sent to a collecting server that sums the measurements of use for each customer for each service that was processed anywhere in the network of servers that provide the shared execution of the process software . the summed measurements of use units are periodically multiplied by unit costs and the resulting total process software application service costs are alternatively sent to the customer and or indicated on a web site accessed by the customer which then remits payment to the service provider . in another embodiment , the service provider requests payment directly from a customer account at a banking or financial institution . in another embodiment , if the service provider is also a customer of the customer that uses the process software application , the payment owed to the service provider is reconciled to the payment owed by the service provider to minimize the transfer of payments . with reference now to fig9 , initiator block 902 begins the on demand process . a transaction is created than contains the unique customer identification , the requested service type and any service parameters that further , specify the type of service ( block 904 ). the transaction is then sent to the main server ( block 906 ). in an on demand environment the main server can initially be the only server , then as capacity is consumed other servers are added to the on demand environment . the server central processing unit ( cpu ) capacities in the on demand environment are queried ( block 908 ). the cpu requirement of the transaction is estimated , then the servers available cpu capacity in the on demand environment are compared to the transaction cpu requirement to see if there is sufficient cpu available capacity in any server to process the transaction ( query block 910 ). if there is not sufficient server cpu available capacity , then additional server cpu capacity is allocated to process the transaction ( block 912 ). if there was already sufficient available cpu capacity then the transaction is sent to a selected server ( block 914 ). before executing the transaction , a check is made of the remaining on demand environment to determine if the environment has sufficient available capacity for processing the transaction . this environment capacity consists of such things as but not limited to network bandwidth , processor memory , storage etc . ( block 916 ). if there is not sufficient available capacity , then capacity will be added to the on demand environment ( block 918 ). next the required software to process the transaction is accessed , loaded into memory , then the transaction is executed ( block 920 ). the usage measurements are recorded ( block 922 ). the usage measurements consist of the portions of those functions in the on demand environment that are used to process the transaction . the usage of such functions as , but not limited to , network bandwidth , processor memory , storage and cpu cycles are what is recorded . the usage measurements are summed , multiplied by unit costs and then recorded as a charge to the requesting customer ( block 924 ). if the customer has requested that the on demand costs be posted to a web site ( query block 926 ), then they are posted ( block 928 ). if the customer has requested that the on demand costs be sent via e - mail to a customer address ( query block 930 ), then these costs are sent to the customer ( block 932 ). if the customer has requested that the on demand costs be paid directly from a customer account ( query block 934 ), then payment is received directly from the customer account ( block 936 ). the on demand process is then exited at terminator block 938 . while the present invention has been particularly shown and described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention . furthermore , as used in the specification and the appended claims , the term “ computer ” or “ system ” or “ computer system ” or “ computing device ” includes any data processing system including , but not limited to , personal computers , servers , workstations , network computers , main frame computers , routers , switches , personal digital assistants ( pda &# 39 ; s ), telephones , and any other system capable of processing , transmitting , receiving , capturing and / or storing data . similarly , while the term “ switch ” has been used to describe analog switching devices , it is understood that the term “ switch ” also includes like technologies and hardware , including , but not limited to , routers .
| 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.