Datasets:
bio-datasets
/
bigbio-ner-merged

Dataset card Data Studio Files
xet
Community
answer
stringlengths
1
16.1k
id
stringlengths
7
56
instruction
stringlengths
106
72.6k
ner_tags
list
text
stringlengths
5
72.4k
tokens
list
types
list
Resveratrol is a CHEMICAL
23536519_task0
Sentence: Resveratrol inhibits proliferation, angiogenesis and induces apoptosis in colon cancer cells: Calorie restriction is the force to the cytotoxicity. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL
[ "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Resveratrol inhibits proliferation, angiogenesis and induces apoptosis in colon cancer cells: Calorie restriction is the force to the cytotoxicity.
[ "Resveratrol", "inhibits", "proliferation", ",", "angiogenesis", "and", "induces", "apoptosis", "in", "colon", "cancer", "cells", ":", "Calorie", "restriction", "is", "the", "force", "to", "the", "cytotoxicity", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
Resveratrol is a CHEMICAL
23536519_task1
Sentence: Resveratrol inhibits proliferation, angiogenesis and induces apoptosis in colon cancer cells: Calorie restriction is the force to the cytotoxicity. Instructions: please typing these entity words according to sentence: Resveratrol Options: CHEMICAL
[ "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Resveratrol inhibits proliferation, angiogenesis and induces apoptosis in colon cancer cells: Calorie restriction is the force to the cytotoxicity.
[ "Resveratrol", "inhibits", "proliferation", ",", "angiogenesis", "and", "induces", "apoptosis", "in", "colon", "cancer", "cells", ":", "Calorie", "restriction", "is", "the", "force", "to", "the", "cytotoxicity", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
Resveratrol
23536519_task2
Sentence: Resveratrol inhibits proliferation, angiogenesis and induces apoptosis in colon cancer cells: Calorie restriction is the force to the cytotoxicity. Instructions: please extract entity words from the input sentence
[ "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Resveratrol inhibits proliferation, angiogenesis and induces apoptosis in colon cancer cells: Calorie restriction is the force to the cytotoxicity.
[ "Resveratrol", "inhibits", "proliferation", ",", "angiogenesis", "and", "induces", "apoptosis", "in", "colon", "cancer", "cells", ":", "Calorie", "restriction", "is", "the", "force", "to", "the", "cytotoxicity", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
Therapie is an umlsterm, Membranen is an umlsterm, Makuladegeneration is an umlsterm, Laserkoagulation is an umlsterm, Lasertherapie is an umlsterm, Zeit is an umlsterm, Strahlentherapie is an umlsterm, Komplikationen is an umlsterm
DerOpthalmologe.80950760.ger.abstr_task0
Sentence: Hintergrund : Die Therapie der durch subretinale neovaskulaere Membranen bedingten altersabhaengigen Makuladegeneration stellt trotz der Moeglichkeiten der Laserkoagulation noch immer ein grosses Problem dar . Besonders bei subfoveolaer gelegenen Neovaskularisationen kann eine Lasertherapie nur unter Inkaufnahme eines erheblichen sofortigen Visusverlustes durchgefuehrt werden . Als Alternative wird nun seit einiger Zeit wieder die Strahlentherapie genannt . Die Wirksamkeit und die Komplikationen sollten in der vorliegenden randomisierten Studie untersucht werden . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Hintergrund : Die Therapie der durch subretinale neovaskulaere Membranen bedingten altersabhaengigen Makuladegeneration stellt trotz der Moeglichkeiten der Laserkoagulation noch immer ein grosses Problem dar . Besonders bei subfoveolaer gelegenen Neovaskularisationen kann eine Lasertherapie nur unter Inkaufnahme eines erheblichen sofortigen Visusverlustes durchgefuehrt werden . Als Alternative wird nun seit einiger Zeit wieder die Strahlentherapie genannt . Die Wirksamkeit und die Komplikationen sollten in der vorliegenden randomisierten Studie untersucht werden .
[ "Hintergrund", ":", "Die", "Therapie", "der", "durch", "subretinale", "neovaskulaere", "Membranen", "bedingten", "altersabhaengigen", "Makuladegeneration", "stellt", "trotz", "der", "Moeglichkeiten", "der", "Laserkoagulation", "noch", "immer", "ein", "grosses", "Problem", "dar", ".", "Besonders", "bei", "subfoveolaer", "gelegenen", "Neovaskularisationen", "kann", "eine", "Lasertherapie", "nur", "unter", "Inkaufnahme", "eines", "erheblichen", "sofortigen", "Visusverlustes", "durchgefuehrt", "werden", ".", "Als", "Alternative", "wird", "nun", "seit", "einiger", "Zeit", "wieder", "die", "Strahlentherapie", "genannt", ".", "Die", "Wirksamkeit", "und", "die", "Komplikationen", "sollten", "in", "der", "vorliegenden", "randomisierten", "Studie", "untersucht", "werden", "." ]
[ "umlsterm" ]
Therapie is an umlsterm, Membranen is an umlsterm, Makuladegeneration is an umlsterm, Laserkoagulation is an umlsterm, Lasertherapie is an umlsterm, Zeit is an umlsterm, Strahlentherapie is an umlsterm, Komplikationen is an umlsterm
DerOpthalmologe.80950760.ger.abstr_task1
Sentence: Hintergrund : Die Therapie der durch subretinale neovaskulaere Membranen bedingten altersabhaengigen Makuladegeneration stellt trotz der Moeglichkeiten der Laserkoagulation noch immer ein grosses Problem dar . Besonders bei subfoveolaer gelegenen Neovaskularisationen kann eine Lasertherapie nur unter Inkaufnahme eines erheblichen sofortigen Visusverlustes durchgefuehrt werden . Als Alternative wird nun seit einiger Zeit wieder die Strahlentherapie genannt . Die Wirksamkeit und die Komplikationen sollten in der vorliegenden randomisierten Studie untersucht werden . Instructions: please typing these entity words according to sentence: Therapie, Membranen, Makuladegeneration, Laserkoagulation, Lasertherapie, Zeit, Strahlentherapie, Komplikationen Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Hintergrund : Die Therapie der durch subretinale neovaskulaere Membranen bedingten altersabhaengigen Makuladegeneration stellt trotz der Moeglichkeiten der Laserkoagulation noch immer ein grosses Problem dar . Besonders bei subfoveolaer gelegenen Neovaskularisationen kann eine Lasertherapie nur unter Inkaufnahme eines erheblichen sofortigen Visusverlustes durchgefuehrt werden . Als Alternative wird nun seit einiger Zeit wieder die Strahlentherapie genannt . Die Wirksamkeit und die Komplikationen sollten in der vorliegenden randomisierten Studie untersucht werden .
[ "Hintergrund", ":", "Die", "Therapie", "der", "durch", "subretinale", "neovaskulaere", "Membranen", "bedingten", "altersabhaengigen", "Makuladegeneration", "stellt", "trotz", "der", "Moeglichkeiten", "der", "Laserkoagulation", "noch", "immer", "ein", "grosses", "Problem", "dar", ".", "Besonders", "bei", "subfoveolaer", "gelegenen", "Neovaskularisationen", "kann", "eine", "Lasertherapie", "nur", "unter", "Inkaufnahme", "eines", "erheblichen", "sofortigen", "Visusverlustes", "durchgefuehrt", "werden", ".", "Als", "Alternative", "wird", "nun", "seit", "einiger", "Zeit", "wieder", "die", "Strahlentherapie", "genannt", ".", "Die", "Wirksamkeit", "und", "die", "Komplikationen", "sollten", "in", "der", "vorliegenden", "randomisierten", "Studie", "untersucht", "werden", "." ]
[ "umlsterm" ]
Therapie, Membranen, Makuladegeneration, Laserkoagulation, Lasertherapie, Zeit, Strahlentherapie, Komplikationen
DerOpthalmologe.80950760.ger.abstr_task2
Sentence: Hintergrund : Die Therapie der durch subretinale neovaskulaere Membranen bedingten altersabhaengigen Makuladegeneration stellt trotz der Moeglichkeiten der Laserkoagulation noch immer ein grosses Problem dar . Besonders bei subfoveolaer gelegenen Neovaskularisationen kann eine Lasertherapie nur unter Inkaufnahme eines erheblichen sofortigen Visusverlustes durchgefuehrt werden . Als Alternative wird nun seit einiger Zeit wieder die Strahlentherapie genannt . Die Wirksamkeit und die Komplikationen sollten in der vorliegenden randomisierten Studie untersucht werden . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Hintergrund : Die Therapie der durch subretinale neovaskulaere Membranen bedingten altersabhaengigen Makuladegeneration stellt trotz der Moeglichkeiten der Laserkoagulation noch immer ein grosses Problem dar . Besonders bei subfoveolaer gelegenen Neovaskularisationen kann eine Lasertherapie nur unter Inkaufnahme eines erheblichen sofortigen Visusverlustes durchgefuehrt werden . Als Alternative wird nun seit einiger Zeit wieder die Strahlentherapie genannt . Die Wirksamkeit und die Komplikationen sollten in der vorliegenden randomisierten Studie untersucht werden .
[ "Hintergrund", ":", "Die", "Therapie", "der", "durch", "subretinale", "neovaskulaere", "Membranen", "bedingten", "altersabhaengigen", "Makuladegeneration", "stellt", "trotz", "der", "Moeglichkeiten", "der", "Laserkoagulation", "noch", "immer", "ein", "grosses", "Problem", "dar", ".", "Besonders", "bei", "subfoveolaer", "gelegenen", "Neovaskularisationen", "kann", "eine", "Lasertherapie", "nur", "unter", "Inkaufnahme", "eines", "erheblichen", "sofortigen", "Visusverlustes", "durchgefuehrt", "werden", ".", "Als", "Alternative", "wird", "nun", "seit", "einiger", "Zeit", "wieder", "die", "Strahlentherapie", "genannt", ".", "Die", "Wirksamkeit", "und", "die", "Komplikationen", "sollten", "in", "der", "vorliegenden", "randomisierten", "Studie", "untersucht", "werden", "." ]
[ "umlsterm" ]
Naturstoffe is an umlsterm, Forschung is an umlsterm, Arzneimittel is an umlsterm, Methoden is an umlsterm, Naturstoffe is an umlsterm, Meeresorganismen is an umlsterm, Methoden is an umlsterm, Naturstoffen is an umlsterm, Medizin is an umlsterm, Rolle is an umlsterm
DerGynaekologe.00330006.ger.abstr_task0
Sentence: Naturstoffe und von ihnen abgeleitete Derivate oder Analoga haben in der medizinischen Anwendung und Forschung einen festen Platz . Es gibt hervorragende Arzneimittel aus Pflanzen und Mikroorganismen . Rasche Entwicklungen bei den Methoden der Wirkstoffsuche eroeffnen den schnelleren Zugriff auf neue Naturstoffe und ermoeglichen auch die Erschliessung der bis vor kurzem noch schwer zugaenglichen Wirkstoffe aus Meeresorganismen . Auch unter Einbeziehung kombinatorischer Methoden zur Abwandlung von Naturstoffen sind die Nutzungsperspektiven fuer diese so guenstig , dass eine moderne Naturstofforschung auch im naechsten Jahrhundert fuer die Medizin eine bedeutende Rolle spielen wird . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O" ]
Naturstoffe und von ihnen abgeleitete Derivate oder Analoga haben in der medizinischen Anwendung und Forschung einen festen Platz . Es gibt hervorragende Arzneimittel aus Pflanzen und Mikroorganismen . Rasche Entwicklungen bei den Methoden der Wirkstoffsuche eroeffnen den schnelleren Zugriff auf neue Naturstoffe und ermoeglichen auch die Erschliessung der bis vor kurzem noch schwer zugaenglichen Wirkstoffe aus Meeresorganismen . Auch unter Einbeziehung kombinatorischer Methoden zur Abwandlung von Naturstoffen sind die Nutzungsperspektiven fuer diese so guenstig , dass eine moderne Naturstofforschung auch im naechsten Jahrhundert fuer die Medizin eine bedeutende Rolle spielen wird .
[ "Naturstoffe", "und", "von", "ihnen", "abgeleitete", "Derivate", "oder", "Analoga", "haben", "in", "der", "medizinischen", "Anwendung", "und", "Forschung", "einen", "festen", "Platz", ".", "Es", "gibt", "hervorragende", "Arzneimittel", "aus", "Pflanzen", "und", "Mikroorganismen", ".", "Rasche", "Entwicklungen", "bei", "den", "Methoden", "der", "Wirkstoffsuche", "eroeffnen", "den", "schnelleren", "Zugriff", "auf", "neue", "Naturstoffe", "und", "ermoeglichen", "auch", "die", "Erschliessung", "der", "bis", "vor", "kurzem", "noch", "schwer", "zugaenglichen", "Wirkstoffe", "aus", "Meeresorganismen", ".", "Auch", "unter", "Einbeziehung", "kombinatorischer", "Methoden", "zur", "Abwandlung", "von", "Naturstoffen", "sind", "die", "Nutzungsperspektiven", "fuer", "diese", "so", "guenstig", ",", "dass", "eine", "moderne", "Naturstofforschung", "auch", "im", "naechsten", "Jahrhundert", "fuer", "die", "Medizin", "eine", "bedeutende", "Rolle", "spielen", "wird", "." ]
[ "umlsterm" ]
Naturstoffe is an umlsterm, Forschung is an umlsterm, Arzneimittel is an umlsterm, Methoden is an umlsterm, Naturstoffe is an umlsterm, Meeresorganismen is an umlsterm, Methoden is an umlsterm, Naturstoffen is an umlsterm, Medizin is an umlsterm, Rolle is an umlsterm
DerGynaekologe.00330006.ger.abstr_task1
Sentence: Naturstoffe und von ihnen abgeleitete Derivate oder Analoga haben in der medizinischen Anwendung und Forschung einen festen Platz . Es gibt hervorragende Arzneimittel aus Pflanzen und Mikroorganismen . Rasche Entwicklungen bei den Methoden der Wirkstoffsuche eroeffnen den schnelleren Zugriff auf neue Naturstoffe und ermoeglichen auch die Erschliessung der bis vor kurzem noch schwer zugaenglichen Wirkstoffe aus Meeresorganismen . Auch unter Einbeziehung kombinatorischer Methoden zur Abwandlung von Naturstoffen sind die Nutzungsperspektiven fuer diese so guenstig , dass eine moderne Naturstofforschung auch im naechsten Jahrhundert fuer die Medizin eine bedeutende Rolle spielen wird . Instructions: please typing these entity words according to sentence: Naturstoffe, Forschung, Arzneimittel, Methoden, Naturstoffe, Meeresorganismen, Methoden, Naturstoffen, Medizin, Rolle Options: umlsterm
[ "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O" ]
Naturstoffe und von ihnen abgeleitete Derivate oder Analoga haben in der medizinischen Anwendung und Forschung einen festen Platz . Es gibt hervorragende Arzneimittel aus Pflanzen und Mikroorganismen . Rasche Entwicklungen bei den Methoden der Wirkstoffsuche eroeffnen den schnelleren Zugriff auf neue Naturstoffe und ermoeglichen auch die Erschliessung der bis vor kurzem noch schwer zugaenglichen Wirkstoffe aus Meeresorganismen . Auch unter Einbeziehung kombinatorischer Methoden zur Abwandlung von Naturstoffen sind die Nutzungsperspektiven fuer diese so guenstig , dass eine moderne Naturstofforschung auch im naechsten Jahrhundert fuer die Medizin eine bedeutende Rolle spielen wird .
[ "Naturstoffe", "und", "von", "ihnen", "abgeleitete", "Derivate", "oder", "Analoga", "haben", "in", "der", "medizinischen", "Anwendung", "und", "Forschung", "einen", "festen", "Platz", ".", "Es", "gibt", "hervorragende", "Arzneimittel", "aus", "Pflanzen", "und", "Mikroorganismen", ".", "Rasche", "Entwicklungen", "bei", "den", "Methoden", "der", "Wirkstoffsuche", "eroeffnen", "den", "schnelleren", "Zugriff", "auf", "neue", "Naturstoffe", "und", "ermoeglichen", "auch", "die", "Erschliessung", "der", "bis", "vor", "kurzem", "noch", "schwer", "zugaenglichen", "Wirkstoffe", "aus", "Meeresorganismen", ".", "Auch", "unter", "Einbeziehung", "kombinatorischer", "Methoden", "zur", "Abwandlung", "von", "Naturstoffen", "sind", "die", "Nutzungsperspektiven", "fuer", "diese", "so", "guenstig", ",", "dass", "eine", "moderne", "Naturstofforschung", "auch", "im", "naechsten", "Jahrhundert", "fuer", "die", "Medizin", "eine", "bedeutende", "Rolle", "spielen", "wird", "." ]
[ "umlsterm" ]
Naturstoffe, Forschung, Arzneimittel, Methoden, Naturstoffe, Meeresorganismen, Methoden, Naturstoffen, Medizin, Rolle
DerGynaekologe.00330006.ger.abstr_task2
Sentence: Naturstoffe und von ihnen abgeleitete Derivate oder Analoga haben in der medizinischen Anwendung und Forschung einen festen Platz . Es gibt hervorragende Arzneimittel aus Pflanzen und Mikroorganismen . Rasche Entwicklungen bei den Methoden der Wirkstoffsuche eroeffnen den schnelleren Zugriff auf neue Naturstoffe und ermoeglichen auch die Erschliessung der bis vor kurzem noch schwer zugaenglichen Wirkstoffe aus Meeresorganismen . Auch unter Einbeziehung kombinatorischer Methoden zur Abwandlung von Naturstoffen sind die Nutzungsperspektiven fuer diese so guenstig , dass eine moderne Naturstofforschung auch im naechsten Jahrhundert fuer die Medizin eine bedeutende Rolle spielen wird . Instructions: please extract entity words from the input sentence
[ "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O" ]
Naturstoffe und von ihnen abgeleitete Derivate oder Analoga haben in der medizinischen Anwendung und Forschung einen festen Platz . Es gibt hervorragende Arzneimittel aus Pflanzen und Mikroorganismen . Rasche Entwicklungen bei den Methoden der Wirkstoffsuche eroeffnen den schnelleren Zugriff auf neue Naturstoffe und ermoeglichen auch die Erschliessung der bis vor kurzem noch schwer zugaenglichen Wirkstoffe aus Meeresorganismen . Auch unter Einbeziehung kombinatorischer Methoden zur Abwandlung von Naturstoffen sind die Nutzungsperspektiven fuer diese so guenstig , dass eine moderne Naturstofforschung auch im naechsten Jahrhundert fuer die Medizin eine bedeutende Rolle spielen wird .
[ "Naturstoffe", "und", "von", "ihnen", "abgeleitete", "Derivate", "oder", "Analoga", "haben", "in", "der", "medizinischen", "Anwendung", "und", "Forschung", "einen", "festen", "Platz", ".", "Es", "gibt", "hervorragende", "Arzneimittel", "aus", "Pflanzen", "und", "Mikroorganismen", ".", "Rasche", "Entwicklungen", "bei", "den", "Methoden", "der", "Wirkstoffsuche", "eroeffnen", "den", "schnelleren", "Zugriff", "auf", "neue", "Naturstoffe", "und", "ermoeglichen", "auch", "die", "Erschliessung", "der", "bis", "vor", "kurzem", "noch", "schwer", "zugaenglichen", "Wirkstoffe", "aus", "Meeresorganismen", ".", "Auch", "unter", "Einbeziehung", "kombinatorischer", "Methoden", "zur", "Abwandlung", "von", "Naturstoffen", "sind", "die", "Nutzungsperspektiven", "fuer", "diese", "so", "guenstig", ",", "dass", "eine", "moderne", "Naturstofforschung", "auch", "im", "naechsten", "Jahrhundert", "fuer", "die", "Medizin", "eine", "bedeutende", "Rolle", "spielen", "wird", "." ]
[ "umlsterm" ]
tumoración is a MORFOLOGIA_NEOPLASIA, tumoración is a MORFOLOGIA_NEOPLASIA, tumoración is a MORFOLOGIA_NEOPLASIA, tumor del estroma gastrointestinal is a MORFOLOGIA_NEOPLASIA, enfermedad a distancia is a MORFOLOGIA_NEOPLASIA, neoplasia is a MORFOLOGIA_NEOPLASIA, neoplásica is a MORFOLOGIA_NEOPLASIA, GIST is a MORFOLOGIA_NEOPLASIA, tumor is a MORFOLOGIA_NEOPLASIA, tumoración is a MORFOLOGIA_NEOPLASIA, neoplásico is a MORFOLOGIA_NEOPLASIA, neoplasia is a MORFOLOGIA_NEOPLASIA
251_task0
Sentence: Anamnesis Mujer de 62 años, de etnia gitana, con antecedente de diabetes mellitus tipo 2, dislipemia e hipertensión, que consulta en septiembre de 2012 a su médico de Atención Primaria por un cuadro de astenia y palidez. No refería indicios de sangrado digestivo ni de otro tipo. Analíticamente se detecta anemia ferropénica, por lo que se inicia tratamiento con hierro oral. Tras 3 meses de tratamiento, no mejoría de la sintomatología ni recuperación analítica, se deriva a Hematología en enero de 2013, encontrando déficit de vitamina B-12, por lo que se mantiene el tratamiento con hierro oral y se suplementa con vitamina B-12. La paciente continúa sin mejoría y acude a Urgencias en febrero de 2013 por un cuadro de debilidad y deposiciones oscuras de 2 semanas de evolución, a las que no había dado mayor importancia por haber sido atribuidas al tratamiento con hierro. Se diagnostica de hemorragia digestiva alta y se ingresa en el Servicio de Aparato Digestivo para su estudio. Se realizan una gastroscopia, que no mostró hallazgos patológicos, y una colonoscopia hasta el ciego, que mostró abundantes restos melénicos sin lesiones aparentes. Asimismo, se completa el estudio con cápsula endoscópica que mostró asas yeyunales llenas de sangre y coágulos, sin poder encontrar la causa del sangrado. Llegados a este punto, se decide realizar una angio-TC abdominal, que evidencia acúmulo de asas a nivel del yeyuno proximal con presencia de vasos de morfología anómala. Se repite la gastroscopia a los 12 días y se observa a nivel del primer asa yeyunal una tumoración aplanada con zonas excrecentes de unos 2 cm, con sangrado al mínimo roce con el endoscopio, por lo que no se realiza toma de biopsia. Una vez localizada la lesión, se traslada la paciente a Cirugía, realizando laparotomía exploradora en marzo de 2013, que encuentra una tumoración de 6 x 6 cm dependiente del primer asa yeyunal firmemente adherida a la raíz del mesenterio con grandes adenopatías en el territorio de la aortocava. Se realiza resección del asa yeyunal incluyendo a la tumoración, con anastomosis terminoterminal con linfadenectomía del territorio aortocava. La intervención transcurre sin complicaciones y es dada de alta a los 6 días de la intervención. El estudio anatomopatológico de la pieza mostró un tumor del estroma gastrointestinal de alto riesgo (> 5 cm, > 5 mitosis por 50 CGA) con mutación en el exón 9 de c-Kit y linfadenitis reactiva en los 11 ganglios aislados. Se deriva a Oncología, donde se solicita estudio de extensión con TC de tórax, abdomen y pelvis, sin evidencia de enfermedad a distancia. Asimismo, se solicitan ecocardiograma y perfil tiroideo, que no muestran alteraciones. Inicia imatinib 400 mg/día adyuvante en abril de 2013, con buena tolerancia. En la TC de reevaluación en enero de 2014, estando la paciente asintomática salvo por pirosis ocasional, se observa engrosamiento de la pared gástrica marcado y adenopatías locorregionales junto a rarefacción de la grasa perigástrica. En el espesor de la pared gástrica se observa una imagen hiperintensa de unos 3 cm sugerente de cuerpo extraño. Se solicita gastroscopia, que encuentra un pliegue gástrico engrosado y duro a la toma de biopsia. El resultado anatomopatológico fue de gastritis leve con ausencia de neoplasia. Ante estos hallazgos se solicita una PET-TC que informa de una masa de gran tamaño en el espacio gastropancreático, muy heterogénea en cuanto a su comportamiento metabólico, altamente sugerente de neoplásica y, dados el componente mixto mostrado y la región anatómica en la que se presenta, plausible con recaída de GIST. Por tanto, se considera recaída de la enfermedad de base y se decide aumentar la dosis de imatinib a 800 mg/día, dada la buena tolerancia, y posterior cirugía en función de la respuesta. A los 20 días, la paciente consulta por un cuadro de vómitos de contenido alimenticio que en pocos días se habían hecho incoercibles a pesar de los antieméticos, asociado a anemia en rango transfusional y deterioro del estado general. Se decide su ingreso para control de los síntomas y soporte transfusional. Exploración física La paciente se encontraba con regular estado general y con evidentes signos de deshidratación cutaneomucosa y tinte subictérico. A la exploración no presentaba hallazgos patológicos a la auscultación cardíaca ni respiratoria. Asimismo, tenía un abdomen blando, aunque se palpaba una masa dura y dolorosa, de unos 10 cm de tamaño, en el epigastrio, ocupándolo prácticamente en su totalidad. Pruebas complementarias » TC: engrosamiento parietal en la curvatura menor del cuerpo-antro gástrico, con mala definición del límite con el páncreas. Imagen compatible con cuerpo extraño en el espesor de la pared gástrica. Adenopatías locorregionales adyacentes al antro gástrico de hasta 10 mm con marcada rarefacción de la grasa. » Bioquímica: glucosa 204 mg/dl; urea 72,7 mg/dl; creatinina 1,5 mg/dl; bilirrubina total 0,56 mg/dl; GPT 10 UI/l; sodio 135 mEq/l; potasio 2,9 mEq/l; cloro 97 mEq/l; calcio 10 mg/dl; PCR 55,66 mg/l. » Hemograma: Hb 7,8 g/dl; leucocitos 6.200 con 71,2% PMN; plaquetas 387.000/μl. Diagnóstico A la luz de las pruebas realizadas y la clínica de la paciente, se diagnostica de cuadro obstructivo por probable recidiva del tumor primario. Tratamiento Se procede al ingreso de la paciente en Oncología Médica, donde se inicia tratamiento sintomático con colocación de sonda nasogástrica, nutrición parenteral y transfusión de 2 concentrados de hematíes. La paciente no mejora de la sintomatología, por lo que se presenta el caso en el comité multidisciplinar con Cirugía y Radiología y se decide programar laparotomía exploradora. Evolución En la intervención aparece una tumoración inflamatoria crónica que engloba la cara posterior del estómago a modo de coraza, involucrando la vesícula biliar, el colon transverso y el duodeno, además de un absceso retrogástrico, del cual se toman muestras para cultivo. Se realiza gastrectomía 2/3 con gran dificultad por la rigidez del tejido, con reconstrucción en Y de Roux. En el postoperatorio es necesario emplear vasoactivos a altas dosis para mantener la tensión arterial y mantenerla intubada hasta las 48 horas de la intervención. En la TC de control realizada tras la intervención aparece una colección líquida en el lecho quirúrgico en relacion con la intervención, sin otros hallazgos relevantes. El cultivo fue positivo para Actinomyces odontolyticus y Escherichia coli multisensibles, por lo que se mantiene la cobertura antibiótica del postoperatorio con meropenem, linezolid y fluconazol. El resultado anatomopatológico mostró un estómago con importante reacción inflamatoria aguda, alrededor de la que se instaura tejido de granulación en probable relación con perforación por cuerpo extraño, probablemente un palillo de dientes, sin que se evidencie proceso neoplásico. Adenopatías con linfadenitis reactiva inespecífica sin indicios de neoplasia. La paciente evoluciona bien y se da de alta al décimo día de la operación. En la revisión en la consulta de Oncología, se decide retomar el tratamiento con imatinib a 400 mg diarios. A su vez, sigue revisiones en Cirugía, que comprueba que la paciente no tiene problemas para la toma de alimentos y que está recuperando peso a buen ritmo. En la actualidad no muestra evidencia de enfermedad y continúa con imatinib adyuvante con magnífica tolerancia. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: MORFOLOGIA_NEOPLASIA
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anamnesis Mujer de 62 años, de etnia gitana, con antecedente de diabetes mellitus tipo 2, dislipemia e hipertensión, que consulta en septiembre de 2012 a su médico de Atención Primaria por un cuadro de astenia y palidez. No refería indicios de sangrado digestivo ni de otro tipo. Analíticamente se detecta anemia ferropénica, por lo que se inicia tratamiento con hierro oral. Tras 3 meses de tratamiento, no mejoría de la sintomatología ni recuperación analítica, se deriva a Hematología en enero de 2013, encontrando déficit de vitamina B-12, por lo que se mantiene el tratamiento con hierro oral y se suplementa con vitamina B-12. La paciente continúa sin mejoría y acude a Urgencias en febrero de 2013 por un cuadro de debilidad y deposiciones oscuras de 2 semanas de evolución, a las que no había dado mayor importancia por haber sido atribuidas al tratamiento con hierro. Se diagnostica de hemorragia digestiva alta y se ingresa en el Servicio de Aparato Digestivo para su estudio. Se realizan una gastroscopia, que no mostró hallazgos patológicos, y una colonoscopia hasta el ciego, que mostró abundantes restos melénicos sin lesiones aparentes. Asimismo, se completa el estudio con cápsula endoscópica que mostró asas yeyunales llenas de sangre y coágulos, sin poder encontrar la causa del sangrado. Llegados a este punto, se decide realizar una angio-TC abdominal, que evidencia acúmulo de asas a nivel del yeyuno proximal con presencia de vasos de morfología anómala. Se repite la gastroscopia a los 12 días y se observa a nivel del primer asa yeyunal una tumoración aplanada con zonas excrecentes de unos 2 cm, con sangrado al mínimo roce con el endoscopio, por lo que no se realiza toma de biopsia. Una vez localizada la lesión, se traslada la paciente a Cirugía, realizando laparotomía exploradora en marzo de 2013, que encuentra una tumoración de 6 x 6 cm dependiente del primer asa yeyunal firmemente adherida a la raíz del mesenterio con grandes adenopatías en el territorio de la aortocava. Se realiza resección del asa yeyunal incluyendo a la tumoración, con anastomosis terminoterminal con linfadenectomía del territorio aortocava. La intervención transcurre sin complicaciones y es dada de alta a los 6 días de la intervención. El estudio anatomopatológico de la pieza mostró un tumor del estroma gastrointestinal de alto riesgo (> 5 cm, > 5 mitosis por 50 CGA) con mutación en el exón 9 de c-Kit y linfadenitis reactiva en los 11 ganglios aislados. Se deriva a Oncología, donde se solicita estudio de extensión con TC de tórax, abdomen y pelvis, sin evidencia de enfermedad a distancia. Asimismo, se solicitan ecocardiograma y perfil tiroideo, que no muestran alteraciones. Inicia imatinib 400 mg/día adyuvante en abril de 2013, con buena tolerancia. En la TC de reevaluación en enero de 2014, estando la paciente asintomática salvo por pirosis ocasional, se observa engrosamiento de la pared gástrica marcado y adenopatías locorregionales junto a rarefacción de la grasa perigástrica. En el espesor de la pared gástrica se observa una imagen hiperintensa de unos 3 cm sugerente de cuerpo extraño. Se solicita gastroscopia, que encuentra un pliegue gástrico engrosado y duro a la toma de biopsia. El resultado anatomopatológico fue de gastritis leve con ausencia de neoplasia. Ante estos hallazgos se solicita una PET-TC que informa de una masa de gran tamaño en el espacio gastropancreático, muy heterogénea en cuanto a su comportamiento metabólico, altamente sugerente de neoplásica y, dados el componente mixto mostrado y la región anatómica en la que se presenta, plausible con recaída de GIST. Por tanto, se considera recaída de la enfermedad de base y se decide aumentar la dosis de imatinib a 800 mg/día, dada la buena tolerancia, y posterior cirugía en función de la respuesta. A los 20 días, la paciente consulta por un cuadro de vómitos de contenido alimenticio que en pocos días se habían hecho incoercibles a pesar de los antieméticos, asociado a anemia en rango transfusional y deterioro del estado general. Se decide su ingreso para control de los síntomas y soporte transfusional. Exploración física La paciente se encontraba con regular estado general y con evidentes signos de deshidratación cutaneomucosa y tinte subictérico. A la exploración no presentaba hallazgos patológicos a la auscultación cardíaca ni respiratoria. Asimismo, tenía un abdomen blando, aunque se palpaba una masa dura y dolorosa, de unos 10 cm de tamaño, en el epigastrio, ocupándolo prácticamente en su totalidad. Pruebas complementarias » TC: engrosamiento parietal en la curvatura menor del cuerpo-antro gástrico, con mala definición del límite con el páncreas. Imagen compatible con cuerpo extraño en el espesor de la pared gástrica. Adenopatías locorregionales adyacentes al antro gástrico de hasta 10 mm con marcada rarefacción de la grasa. » Bioquímica: glucosa 204 mg/dl; urea 72,7 mg/dl; creatinina 1,5 mg/dl; bilirrubina total 0,56 mg/dl; GPT 10 UI/l; sodio 135 mEq/l; potasio 2,9 mEq/l; cloro 97 mEq/l; calcio 10 mg/dl; PCR 55,66 mg/l. » Hemograma: Hb 7,8 g/dl; leucocitos 6.200 con 71,2% PMN; plaquetas 387.000/μl. Diagnóstico A la luz de las pruebas realizadas y la clínica de la paciente, se diagnostica de cuadro obstructivo por probable recidiva del tumor primario. Tratamiento Se procede al ingreso de la paciente en Oncología Médica, donde se inicia tratamiento sintomático con colocación de sonda nasogástrica, nutrición parenteral y transfusión de 2 concentrados de hematíes. La paciente no mejora de la sintomatología, por lo que se presenta el caso en el comité multidisciplinar con Cirugía y Radiología y se decide programar laparotomía exploradora. Evolución En la intervención aparece una tumoración inflamatoria crónica que engloba la cara posterior del estómago a modo de coraza, involucrando la vesícula biliar, el colon transverso y el duodeno, además de un absceso retrogástrico, del cual se toman muestras para cultivo. Se realiza gastrectomía 2/3 con gran dificultad por la rigidez del tejido, con reconstrucción en Y de Roux. En el postoperatorio es necesario emplear vasoactivos a altas dosis para mantener la tensión arterial y mantenerla intubada hasta las 48 horas de la intervención. En la TC de control realizada tras la intervención aparece una colección líquida en el lecho quirúrgico en relacion con la intervención, sin otros hallazgos relevantes. El cultivo fue positivo para Actinomyces odontolyticus y Escherichia coli multisensibles, por lo que se mantiene la cobertura antibiótica del postoperatorio con meropenem, linezolid y fluconazol. El resultado anatomopatológico mostró un estómago con importante reacción inflamatoria aguda, alrededor de la que se instaura tejido de granulación en probable relación con perforación por cuerpo extraño, probablemente un palillo de dientes, sin que se evidencie proceso neoplásico. Adenopatías con linfadenitis reactiva inespecífica sin indicios de neoplasia. La paciente evoluciona bien y se da de alta al décimo día de la operación. En la revisión en la consulta de Oncología, se decide retomar el tratamiento con imatinib a 400 mg diarios. A su vez, sigue revisiones en Cirugía, que comprueba que la paciente no tiene problemas para la toma de alimentos y que está recuperando peso a buen ritmo. En la actualidad no muestra evidencia de enfermedad y continúa con imatinib adyuvante con magnífica tolerancia.
[ "Anamnesis", "\n", "Mujer", "de", "62", "años", ",", "de", "etnia", "gitana", ",", "con", "antecedente", "de", "diabetes", "mellitus", "tipo", "2", ",", "dislipemia", "e", "hipertensión", ",", "que", "consulta", "en", "septiembre", "de", "2012", "a", "su", "médico", "de", "Atención", "Primaria", "por", "un", "cuadro", "de", "astenia", "y", "palidez", ".", "\n\n", "No", "refería", "indicios", "de", "sangrado", "digestivo", "ni", "de", "otro", "tipo", ".", "Analíticamente", "se", "detecta", "anemia", "ferropénica", ",", "por", "lo", "que", "se", "inicia", "tratamiento", "con", "hierro", "oral", ".", "Tras", "3", "meses", "de", "tratamiento", ",", "no", "mejoría", "de", "la", "sintomatología", "ni", "recuperación", "analítica", ",", "se", "deriva", "a", "Hematología", "en", "enero", "de", "2013", ",", "encontrando", "déficit", "de", "vitamina", "B-12", ",", "por", "lo", "que", "se", "mantiene", "el", "tratamiento", "con", "hierro", "oral", "y", "se", "suplementa", "con", "vitamina", "\n", "B-12", ".", "\n\n", "La", "paciente", "continúa", "sin", "mejoría", "y", "acude", "a", "Urgencias", "en", "febrero", "de", "2013", "por", "un", "cuadro", "de", "debilidad", "y", "deposiciones", "oscuras", "de", "2", "semanas", "de", "evolución", ",", "a", "las", "que", "no", "había", "dado", "mayor", "importancia", "por", "haber", "sido", "atribuidas", "al", "tratamiento", "con", "hierro", ".", "\n\n", "Se", "diagnostica", "de", "hemorragia", "digestiva", "alta", "y", "se", "ingresa", "en", "el", "Servicio", "de", "Aparato", "Digestivo", "para", "su", "estudio", ".", "Se", "realizan", "una", "gastroscopia", ",", "que", "no", "mostró", "hallazgos", "patológicos", ",", "y", "una", "colonoscopia", "hasta", "el", "ciego", ",", "que", "mostró", "abundantes", "restos", "melénicos", "sin", "lesiones", "aparentes", ".", "\n\n", "Asimismo", ",", "se", "completa", "el", "estudio", "con", "cápsula", "endoscópica", "que", "mostró", "asas", "yeyunales", "llenas", "de", "sangre", "y", "coágulos", ",", "sin", "poder", "encontrar", "la", "causa", "del", "sangrado", ".", "Llegados", "a", "este", "punto", ",", "se", "decide", "realizar", "una", "angio", "-", "TC", "abdominal", ",", "que", "evidencia", "acúmulo", "de", "asas", "a", "nivel", "del", "yeyuno", "proximal", "con", "presencia", "de", "vasos", "de", "morfología", "anómala", ".", "\n\n", "Se", "repite", "la", "gastroscopia", "a", "los", "12", "días", "y", "se", "observa", "a", "nivel", "del", "primer", "asa", "yeyunal", "una", "tumoración", "aplanada", "con", "zonas", "excrecentes", "de", "unos", "2", "cm", ",", "con", "sangrado", "al", "mínimo", "roce", "con", "el", "endoscopio", ",", "por", "lo", "que", "no", "se", "realiza", "toma", "de", "biopsia", ".", "\n\n", "Una", "vez", "localizada", "la", "lesión", ",", "se", "traslada", "la", "paciente", "a", "Cirugía", ",", "realizando", "laparotomía", "exploradora", "en", "marzo", "de", "2013", ",", "que", "encuentra", "una", "tumoración", "de", "6", "x", "6", "cm", "dependiente", "del", "primer", "asa", "yeyunal", "firmemente", "adherida", "a", "la", "raíz", "del", "mesenterio", "con", "grandes", "adenopatías", "en", "el", "territorio", "de", "la", "aortocava", ".", "\n\n", "Se", "realiza", "resección", "del", "asa", "yeyunal", "incluyendo", "a", "la", "tumoración", ",", "con", "anastomosis", "terminoterminal", "con", "linfadenectomía", "del", "territorio", "aortocava", ".", "\n\n", "La", "intervención", "transcurre", "sin", "complicaciones", "y", "es", "dada", "de", "alta", "a", "los", "6", "días", "de", "la", "intervención", ".", "\n\n", "El", "estudio", "anatomopatológico", "de", "la", "pieza", "mostró", "un", "tumor", "del", "estroma", "gastrointestinal", "de", "alto", "riesgo", "(", ">", "5", "cm", ",", ">", "5", "mitosis", "por", "50", "CGA", ")", "con", "mutación", "en", "el", "exón", "9", "de", "c", "-", "Kit", "y", "linfadenitis", "reactiva", "en", "los", "11", "ganglios", "aislados", ".", "\n\n", "Se", "deriva", "a", "Oncología", ",", "donde", "se", "solicita", "estudio", "de", "extensión", "con", "TC", "de", "tórax", ",", "abdomen", "y", "pelvis", ",", "sin", "evidencia", "de", "enfermedad", "a", "distancia", ".", "Asimismo", ",", "se", "solicitan", "ecocardiograma", "y", "perfil", "tiroideo", ",", "que", "no", "muestran", "alteraciones", ".", "Inicia", "imatinib", "400", "mg", "/", "día", "adyuvante", "en", "abril", "de", "2013", ",", "con", "buena", "tolerancia", ".", "\n\n", "En", "la", "TC", "de", "reevaluación", "en", "enero", "de", "2014", ",", "estando", "la", "paciente", "asintomática", "salvo", "por", "pirosis", "ocasional", ",", "se", "observa", "engrosamiento", "de", "la", "pared", "gástrica", "marcado", "y", "adenopatías", "locorregionales", "junto", "a", "rarefacción", "de", "la", "grasa", "perigástrica", ".", "En", "el", "espesor", "de", "la", "pared", "gástrica", "se", "observa", "una", "imagen", "hiperintensa", "de", "unos", "3", "cm", "sugerente", "de", "cuerpo", "extraño", ".", "\n\n", "Se", "solicita", "gastroscopia", ",", "que", "encuentra", "un", "pliegue", "gástrico", "engrosado", "y", "duro", "a", "la", "toma", "de", "biopsia", ".", "El", "resultado", "anatomopatológico", "fue", "de", "gastritis", "leve", "con", "ausencia", "de", "neoplasia", ".", "Ante", "estos", "hallazgos", "se", "solicita", "una", "PET", "-", "TC", "que", "informa", "de", "una", "masa", "de", "gran", "tamaño", "en", "el", "espacio", "gastropancreático", ",", "muy", "heterogénea", "en", "cuanto", "a", "su", "comportamiento", "metabólico", ",", "altamente", "sugerente", "de", "neoplásica", "y", ",", "dados", "el", "componente", "mixto", "mostrado", "y", "la", "región", "anatómica", "en", "la", "que", "se", "presenta", ",", "plausible", "con", "recaída", "de", "GIST", ".", "\n\n", "Por", "tanto", ",", "se", "considera", "recaída", "de", "la", "enfermedad", "de", "base", "y", "se", "decide", "aumentar", "la", "dosis", "de", "imatinib", "a", "800", "mg", "/", "día", ",", "dada", "la", "buena", "tolerancia", ",", "y", "posterior", "cirugía", "en", "función", "de", "la", "respuesta", ".", "\n\n", "A", "los", "20", "días", ",", "la", "paciente", "consulta", "por", "un", "cuadro", "de", "vómitos", "de", "contenido", "alimenticio", "que", "en", "pocos", "días", "se", "habían", "hecho", "incoercibles", "a", "pesar", "de", "los", "antieméticos", ",", "asociado", "a", "anemia", "en", "rango", "transfusional", "y", "deterioro", "del", "estado", "general", ".", "\n\n", "Se", "decide", "su", "ingreso", "para", "control", "de", "los", "síntomas", "y", "soporte", "transfusional", ".", "\n\n", "Exploración", "física", "\n", "La", "paciente", "se", "encontraba", "con", "regular", "estado", "general", "y", "con", "evidentes", "signos", "de", "deshidratación", "cutaneomucosa", "y", "tinte", "subictérico", ".", "\n\n", "A", "la", "exploración", "no", "presentaba", "hallazgos", "patológicos", "a", "la", "auscultación", "cardíaca", "ni", "respiratoria", ".", "\n\n", "Asimismo", ",", "tenía", "un", "abdomen", "blando", ",", "aunque", "se", "palpaba", "una", "masa", "dura", "y", "dolorosa", ",", "de", "unos", "10", "cm", "de", "tamaño", ",", "en", "el", "epigastrio", ",", "ocupándolo", "prácticamente", "en", "su", "totalidad", ".", "\n\n\n", "Pruebas", "complementarias", "\n", "»", "TC", ":", "engrosamiento", "parietal", "en", "la", "curvatura", "menor", "del", "cuerpo", "-", "antro", "gástrico", ",", "con", "mala", "definición", "del", "límite", "con", "el", "páncreas", ".", "Imagen", "compatible", "con", "cuerpo", "extraño", "en", "el", "espesor", "de", "la", "pared", "gástrica", ".", "Adenopatías", "locorregionales", "adyacentes", "al", "antro", "gástrico", "de", "hasta", "10", "mm", "con", "marcada", "rarefacción", "de", "la", "grasa", ".", "\n", "»", "Bioquímica", ":", "glucosa", "204", "mg", "/", "dl", ";", "urea", "72,7", "mg", "/", "dl", ";", "creatinina", "1,5", "mg", "/", "dl", ";", "bilirrubina", "total", "0,56", "mg", "/", "dl", ";", "GPT", "10", "UI", "/", "l", ";", "sodio", "135", "mEq", "/", "l", ";", "potasio", "2,9", "mEq", "/", "l", ";", "cloro", "97", "mEq", "/", "l", ";", "calcio", "10", "mg", "/", "dl", ";", "PCR", "55,66", "mg", "/", "l.", "\n", "»", "Hemograma", ":", "Hb", "7,8", "g", "/", "dl", ";", "leucocitos", "6.200", "con", "71,2", "%", "PMN", ";", "plaquetas", "387.000", "/", "μl", ".", "\n\n", "Diagnóstico", "\n", "A", "la", "luz", "de", "las", "pruebas", "realizadas", "y", "la", "clínica", "de", "la", "paciente", ",", "se", "diagnostica", "de", "cuadro", "obstructivo", "por", "probable", "recidiva", "del", "tumor", "primario", ".", "\n\n", "Tratamiento", "\n", "Se", "procede", "al", "ingreso", "de", "la", "paciente", "en", "Oncología", "Médica", ",", "donde", "se", "inicia", "tratamiento", "sintomático", "con", "colocación", "de", "sonda", "nasogástrica", ",", "nutrición", "parenteral", "y", "transfusión", "de", "2", "concentrados", "de", "hematíes", ".", "\n\n", "La", "paciente", "no", "mejora", "de", "la", "sintomatología", ",", "por", "lo", "que", "se", "presenta", "el", "caso", "en", "el", "comité", "multidisciplinar", "con", "Cirugía", "y", "Radiología", "y", "se", "decide", "programar", "laparotomía", "exploradora", ".", "\n\n", "Evolución", "\n", "En", "la", "intervención", "aparece", "una", "tumoración", "inflamatoria", "crónica", "que", "engloba", "la", "cara", "posterior", "del", "estómago", "a", "modo", "de", "coraza", ",", "involucrando", "la", "vesícula", "biliar", ",", "el", "colon", "transverso", "y", "el", "duodeno", ",", "además", "de", "un", "absceso", "retrogástrico", ",", "del", "cual", "se", "toman", "muestras", "para", "cultivo", ".", "\n\n", "Se", "realiza", "gastrectomía", "2/3", "con", "gran", "dificultad", "por", "la", "rigidez", "del", "tejido", ",", "con", "reconstrucción", "en", "Y", "de", "Roux", ".", "\n\n", "En", "el", "postoperatorio", "es", "necesario", "emplear", "vasoactivos", "a", "altas", "dosis", "para", "mantener", "la", "tensión", "arterial", "y", "mantenerla", "intubada", "hasta", "las", "48", "horas", "de", "la", "intervención", ".", "\n\n", "En", "la", "TC", "de", "control", "realizada", "tras", "la", "intervención", "aparece", "una", "colección", "líquida", "en", "el", "lecho", "quirúrgico", "en", "relacion", "con", "la", "intervención", ",", "sin", "otros", "hallazgos", "relevantes", ".", "\n\n", "El", "cultivo", "fue", "positivo", "para", "Actinomyces", "odontolyticus", "y", "Escherichia", "coli", "multisensibles", ",", "por", "lo", "que", "se", "mantiene", "la", "cobertura", "antibiótica", "del", "postoperatorio", "con", "meropenem", ",", "linezolid", "y", "fluconazol", ".", "\n\n", "El", "resultado", "anatomopatológico", "mostró", "un", "estómago", "con", "importante", "reacción", "inflamatoria", "aguda", ",", "alrededor", "de", "la", "que", "se", "instaura", "tejido", "de", "granulación", "en", "probable", "relación", "con", "perforación", "por", "cuerpo", "extraño", ",", "probablemente", "un", "palillo", "de", "dientes", ",", "sin", "que", "se", "evidencie", "proceso", "neoplásico", ".", "Adenopatías", "con", "linfadenitis", "reactiva", "inespecífica", "sin", "indicios", "de", "neoplasia", ".", "\n\n", "La", "paciente", "evoluciona", "bien", "y", "se", "da", "de", "alta", "al", "décimo", "día", "de", "la", "operación", ".", "\n\n", "En", "la", "revisión", "en", "la", "consulta", "de", "Oncología", ",", "se", "decide", "retomar", "el", "tratamiento", "con", "imatinib", "a", "400", "mg", "diarios", ".", "A", "su", "vez", ",", "sigue", "revisiones", "en", "Cirugía", ",", "que", "comprueba", "que", "la", "paciente", "no", "tiene", "problemas", "para", "la", "toma", "de", "alimentos", "y", "que", "está", "recuperando", "peso", "a", "buen", "ritmo", ".", "\n\n", "En", "la", "actualidad", "no", "muestra", "evidencia", "de", "enfermedad", "y", "continúa", "con", "imatinib", "adyuvante", "con", "magnífica", "tolerancia", "." ]
[ "MORFOLOGIA_NEOPLASIA" ]
tumoración is a MORFOLOGIA_NEOPLASIA, tumoración is a MORFOLOGIA_NEOPLASIA, tumoración is a MORFOLOGIA_NEOPLASIA, tumor del estroma gastrointestinal is a MORFOLOGIA_NEOPLASIA, enfermedad a distancia is a MORFOLOGIA_NEOPLASIA, neoplasia is a MORFOLOGIA_NEOPLASIA, neoplásica is a MORFOLOGIA_NEOPLASIA, GIST is a MORFOLOGIA_NEOPLASIA, tumor is a MORFOLOGIA_NEOPLASIA, tumoración is a MORFOLOGIA_NEOPLASIA, neoplásico is a MORFOLOGIA_NEOPLASIA, neoplasia is a MORFOLOGIA_NEOPLASIA
251_task1
Sentence: Anamnesis Mujer de 62 años, de etnia gitana, con antecedente de diabetes mellitus tipo 2, dislipemia e hipertensión, que consulta en septiembre de 2012 a su médico de Atención Primaria por un cuadro de astenia y palidez. No refería indicios de sangrado digestivo ni de otro tipo. Analíticamente se detecta anemia ferropénica, por lo que se inicia tratamiento con hierro oral. Tras 3 meses de tratamiento, no mejoría de la sintomatología ni recuperación analítica, se deriva a Hematología en enero de 2013, encontrando déficit de vitamina B-12, por lo que se mantiene el tratamiento con hierro oral y se suplementa con vitamina B-12. La paciente continúa sin mejoría y acude a Urgencias en febrero de 2013 por un cuadro de debilidad y deposiciones oscuras de 2 semanas de evolución, a las que no había dado mayor importancia por haber sido atribuidas al tratamiento con hierro. Se diagnostica de hemorragia digestiva alta y se ingresa en el Servicio de Aparato Digestivo para su estudio. Se realizan una gastroscopia, que no mostró hallazgos patológicos, y una colonoscopia hasta el ciego, que mostró abundantes restos melénicos sin lesiones aparentes. Asimismo, se completa el estudio con cápsula endoscópica que mostró asas yeyunales llenas de sangre y coágulos, sin poder encontrar la causa del sangrado. Llegados a este punto, se decide realizar una angio-TC abdominal, que evidencia acúmulo de asas a nivel del yeyuno proximal con presencia de vasos de morfología anómala. Se repite la gastroscopia a los 12 días y se observa a nivel del primer asa yeyunal una tumoración aplanada con zonas excrecentes de unos 2 cm, con sangrado al mínimo roce con el endoscopio, por lo que no se realiza toma de biopsia. Una vez localizada la lesión, se traslada la paciente a Cirugía, realizando laparotomía exploradora en marzo de 2013, que encuentra una tumoración de 6 x 6 cm dependiente del primer asa yeyunal firmemente adherida a la raíz del mesenterio con grandes adenopatías en el territorio de la aortocava. Se realiza resección del asa yeyunal incluyendo a la tumoración, con anastomosis terminoterminal con linfadenectomía del territorio aortocava. La intervención transcurre sin complicaciones y es dada de alta a los 6 días de la intervención. El estudio anatomopatológico de la pieza mostró un tumor del estroma gastrointestinal de alto riesgo (> 5 cm, > 5 mitosis por 50 CGA) con mutación en el exón 9 de c-Kit y linfadenitis reactiva en los 11 ganglios aislados. Se deriva a Oncología, donde se solicita estudio de extensión con TC de tórax, abdomen y pelvis, sin evidencia de enfermedad a distancia. Asimismo, se solicitan ecocardiograma y perfil tiroideo, que no muestran alteraciones. Inicia imatinib 400 mg/día adyuvante en abril de 2013, con buena tolerancia. En la TC de reevaluación en enero de 2014, estando la paciente asintomática salvo por pirosis ocasional, se observa engrosamiento de la pared gástrica marcado y adenopatías locorregionales junto a rarefacción de la grasa perigástrica. En el espesor de la pared gástrica se observa una imagen hiperintensa de unos 3 cm sugerente de cuerpo extraño. Se solicita gastroscopia, que encuentra un pliegue gástrico engrosado y duro a la toma de biopsia. El resultado anatomopatológico fue de gastritis leve con ausencia de neoplasia. Ante estos hallazgos se solicita una PET-TC que informa de una masa de gran tamaño en el espacio gastropancreático, muy heterogénea en cuanto a su comportamiento metabólico, altamente sugerente de neoplásica y, dados el componente mixto mostrado y la región anatómica en la que se presenta, plausible con recaída de GIST. Por tanto, se considera recaída de la enfermedad de base y se decide aumentar la dosis de imatinib a 800 mg/día, dada la buena tolerancia, y posterior cirugía en función de la respuesta. A los 20 días, la paciente consulta por un cuadro de vómitos de contenido alimenticio que en pocos días se habían hecho incoercibles a pesar de los antieméticos, asociado a anemia en rango transfusional y deterioro del estado general. Se decide su ingreso para control de los síntomas y soporte transfusional. Exploración física La paciente se encontraba con regular estado general y con evidentes signos de deshidratación cutaneomucosa y tinte subictérico. A la exploración no presentaba hallazgos patológicos a la auscultación cardíaca ni respiratoria. Asimismo, tenía un abdomen blando, aunque se palpaba una masa dura y dolorosa, de unos 10 cm de tamaño, en el epigastrio, ocupándolo prácticamente en su totalidad. Pruebas complementarias » TC: engrosamiento parietal en la curvatura menor del cuerpo-antro gástrico, con mala definición del límite con el páncreas. Imagen compatible con cuerpo extraño en el espesor de la pared gástrica. Adenopatías locorregionales adyacentes al antro gástrico de hasta 10 mm con marcada rarefacción de la grasa. » Bioquímica: glucosa 204 mg/dl; urea 72,7 mg/dl; creatinina 1,5 mg/dl; bilirrubina total 0,56 mg/dl; GPT 10 UI/l; sodio 135 mEq/l; potasio 2,9 mEq/l; cloro 97 mEq/l; calcio 10 mg/dl; PCR 55,66 mg/l. » Hemograma: Hb 7,8 g/dl; leucocitos 6.200 con 71,2% PMN; plaquetas 387.000/μl. Diagnóstico A la luz de las pruebas realizadas y la clínica de la paciente, se diagnostica de cuadro obstructivo por probable recidiva del tumor primario. Tratamiento Se procede al ingreso de la paciente en Oncología Médica, donde se inicia tratamiento sintomático con colocación de sonda nasogástrica, nutrición parenteral y transfusión de 2 concentrados de hematíes. La paciente no mejora de la sintomatología, por lo que se presenta el caso en el comité multidisciplinar con Cirugía y Radiología y se decide programar laparotomía exploradora. Evolución En la intervención aparece una tumoración inflamatoria crónica que engloba la cara posterior del estómago a modo de coraza, involucrando la vesícula biliar, el colon transverso y el duodeno, además de un absceso retrogástrico, del cual se toman muestras para cultivo. Se realiza gastrectomía 2/3 con gran dificultad por la rigidez del tejido, con reconstrucción en Y de Roux. En el postoperatorio es necesario emplear vasoactivos a altas dosis para mantener la tensión arterial y mantenerla intubada hasta las 48 horas de la intervención. En la TC de control realizada tras la intervención aparece una colección líquida en el lecho quirúrgico en relacion con la intervención, sin otros hallazgos relevantes. El cultivo fue positivo para Actinomyces odontolyticus y Escherichia coli multisensibles, por lo que se mantiene la cobertura antibiótica del postoperatorio con meropenem, linezolid y fluconazol. El resultado anatomopatológico mostró un estómago con importante reacción inflamatoria aguda, alrededor de la que se instaura tejido de granulación en probable relación con perforación por cuerpo extraño, probablemente un palillo de dientes, sin que se evidencie proceso neoplásico. Adenopatías con linfadenitis reactiva inespecífica sin indicios de neoplasia. La paciente evoluciona bien y se da de alta al décimo día de la operación. En la revisión en la consulta de Oncología, se decide retomar el tratamiento con imatinib a 400 mg diarios. A su vez, sigue revisiones en Cirugía, que comprueba que la paciente no tiene problemas para la toma de alimentos y que está recuperando peso a buen ritmo. En la actualidad no muestra evidencia de enfermedad y continúa con imatinib adyuvante con magnífica tolerancia. Instructions: please typing these entity words according to sentence: tumoración, tumoración, tumoración, tumor del estroma gastrointestinal, enfermedad a distancia, neoplasia, neoplásica, GIST, tumor, tumoración, neoplásico, neoplasia Options: MORFOLOGIA_NEOPLASIA
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anamnesis Mujer de 62 años, de etnia gitana, con antecedente de diabetes mellitus tipo 2, dislipemia e hipertensión, que consulta en septiembre de 2012 a su médico de Atención Primaria por un cuadro de astenia y palidez. No refería indicios de sangrado digestivo ni de otro tipo. Analíticamente se detecta anemia ferropénica, por lo que se inicia tratamiento con hierro oral. Tras 3 meses de tratamiento, no mejoría de la sintomatología ni recuperación analítica, se deriva a Hematología en enero de 2013, encontrando déficit de vitamina B-12, por lo que se mantiene el tratamiento con hierro oral y se suplementa con vitamina B-12. La paciente continúa sin mejoría y acude a Urgencias en febrero de 2013 por un cuadro de debilidad y deposiciones oscuras de 2 semanas de evolución, a las que no había dado mayor importancia por haber sido atribuidas al tratamiento con hierro. Se diagnostica de hemorragia digestiva alta y se ingresa en el Servicio de Aparato Digestivo para su estudio. Se realizan una gastroscopia, que no mostró hallazgos patológicos, y una colonoscopia hasta el ciego, que mostró abundantes restos melénicos sin lesiones aparentes. Asimismo, se completa el estudio con cápsula endoscópica que mostró asas yeyunales llenas de sangre y coágulos, sin poder encontrar la causa del sangrado. Llegados a este punto, se decide realizar una angio-TC abdominal, que evidencia acúmulo de asas a nivel del yeyuno proximal con presencia de vasos de morfología anómala. Se repite la gastroscopia a los 12 días y se observa a nivel del primer asa yeyunal una tumoración aplanada con zonas excrecentes de unos 2 cm, con sangrado al mínimo roce con el endoscopio, por lo que no se realiza toma de biopsia. Una vez localizada la lesión, se traslada la paciente a Cirugía, realizando laparotomía exploradora en marzo de 2013, que encuentra una tumoración de 6 x 6 cm dependiente del primer asa yeyunal firmemente adherida a la raíz del mesenterio con grandes adenopatías en el territorio de la aortocava. Se realiza resección del asa yeyunal incluyendo a la tumoración, con anastomosis terminoterminal con linfadenectomía del territorio aortocava. La intervención transcurre sin complicaciones y es dada de alta a los 6 días de la intervención. El estudio anatomopatológico de la pieza mostró un tumor del estroma gastrointestinal de alto riesgo (> 5 cm, > 5 mitosis por 50 CGA) con mutación en el exón 9 de c-Kit y linfadenitis reactiva en los 11 ganglios aislados. Se deriva a Oncología, donde se solicita estudio de extensión con TC de tórax, abdomen y pelvis, sin evidencia de enfermedad a distancia. Asimismo, se solicitan ecocardiograma y perfil tiroideo, que no muestran alteraciones. Inicia imatinib 400 mg/día adyuvante en abril de 2013, con buena tolerancia. En la TC de reevaluación en enero de 2014, estando la paciente asintomática salvo por pirosis ocasional, se observa engrosamiento de la pared gástrica marcado y adenopatías locorregionales junto a rarefacción de la grasa perigástrica. En el espesor de la pared gástrica se observa una imagen hiperintensa de unos 3 cm sugerente de cuerpo extraño. Se solicita gastroscopia, que encuentra un pliegue gástrico engrosado y duro a la toma de biopsia. El resultado anatomopatológico fue de gastritis leve con ausencia de neoplasia. Ante estos hallazgos se solicita una PET-TC que informa de una masa de gran tamaño en el espacio gastropancreático, muy heterogénea en cuanto a su comportamiento metabólico, altamente sugerente de neoplásica y, dados el componente mixto mostrado y la región anatómica en la que se presenta, plausible con recaída de GIST. Por tanto, se considera recaída de la enfermedad de base y se decide aumentar la dosis de imatinib a 800 mg/día, dada la buena tolerancia, y posterior cirugía en función de la respuesta. A los 20 días, la paciente consulta por un cuadro de vómitos de contenido alimenticio que en pocos días se habían hecho incoercibles a pesar de los antieméticos, asociado a anemia en rango transfusional y deterioro del estado general. Se decide su ingreso para control de los síntomas y soporte transfusional. Exploración física La paciente se encontraba con regular estado general y con evidentes signos de deshidratación cutaneomucosa y tinte subictérico. A la exploración no presentaba hallazgos patológicos a la auscultación cardíaca ni respiratoria. Asimismo, tenía un abdomen blando, aunque se palpaba una masa dura y dolorosa, de unos 10 cm de tamaño, en el epigastrio, ocupándolo prácticamente en su totalidad. Pruebas complementarias » TC: engrosamiento parietal en la curvatura menor del cuerpo-antro gástrico, con mala definición del límite con el páncreas. Imagen compatible con cuerpo extraño en el espesor de la pared gástrica. Adenopatías locorregionales adyacentes al antro gástrico de hasta 10 mm con marcada rarefacción de la grasa. » Bioquímica: glucosa 204 mg/dl; urea 72,7 mg/dl; creatinina 1,5 mg/dl; bilirrubina total 0,56 mg/dl; GPT 10 UI/l; sodio 135 mEq/l; potasio 2,9 mEq/l; cloro 97 mEq/l; calcio 10 mg/dl; PCR 55,66 mg/l. » Hemograma: Hb 7,8 g/dl; leucocitos 6.200 con 71,2% PMN; plaquetas 387.000/μl. Diagnóstico A la luz de las pruebas realizadas y la clínica de la paciente, se diagnostica de cuadro obstructivo por probable recidiva del tumor primario. Tratamiento Se procede al ingreso de la paciente en Oncología Médica, donde se inicia tratamiento sintomático con colocación de sonda nasogástrica, nutrición parenteral y transfusión de 2 concentrados de hematíes. La paciente no mejora de la sintomatología, por lo que se presenta el caso en el comité multidisciplinar con Cirugía y Radiología y se decide programar laparotomía exploradora. Evolución En la intervención aparece una tumoración inflamatoria crónica que engloba la cara posterior del estómago a modo de coraza, involucrando la vesícula biliar, el colon transverso y el duodeno, además de un absceso retrogástrico, del cual se toman muestras para cultivo. Se realiza gastrectomía 2/3 con gran dificultad por la rigidez del tejido, con reconstrucción en Y de Roux. En el postoperatorio es necesario emplear vasoactivos a altas dosis para mantener la tensión arterial y mantenerla intubada hasta las 48 horas de la intervención. En la TC de control realizada tras la intervención aparece una colección líquida en el lecho quirúrgico en relacion con la intervención, sin otros hallazgos relevantes. El cultivo fue positivo para Actinomyces odontolyticus y Escherichia coli multisensibles, por lo que se mantiene la cobertura antibiótica del postoperatorio con meropenem, linezolid y fluconazol. El resultado anatomopatológico mostró un estómago con importante reacción inflamatoria aguda, alrededor de la que se instaura tejido de granulación en probable relación con perforación por cuerpo extraño, probablemente un palillo de dientes, sin que se evidencie proceso neoplásico. Adenopatías con linfadenitis reactiva inespecífica sin indicios de neoplasia. La paciente evoluciona bien y se da de alta al décimo día de la operación. En la revisión en la consulta de Oncología, se decide retomar el tratamiento con imatinib a 400 mg diarios. A su vez, sigue revisiones en Cirugía, que comprueba que la paciente no tiene problemas para la toma de alimentos y que está recuperando peso a buen ritmo. En la actualidad no muestra evidencia de enfermedad y continúa con imatinib adyuvante con magnífica tolerancia.
[ "Anamnesis", "\n", "Mujer", "de", "62", "años", ",", "de", "etnia", "gitana", ",", "con", "antecedente", "de", "diabetes", "mellitus", "tipo", "2", ",", "dislipemia", "e", "hipertensión", ",", "que", "consulta", "en", "septiembre", "de", "2012", "a", "su", "médico", "de", "Atención", "Primaria", "por", "un", "cuadro", "de", "astenia", "y", "palidez", ".", "\n\n", "No", "refería", "indicios", "de", "sangrado", "digestivo", "ni", "de", "otro", "tipo", ".", "Analíticamente", "se", "detecta", "anemia", "ferropénica", ",", "por", "lo", "que", "se", "inicia", "tratamiento", "con", "hierro", "oral", ".", "Tras", "3", "meses", "de", "tratamiento", ",", "no", "mejoría", "de", "la", "sintomatología", "ni", "recuperación", "analítica", ",", "se", "deriva", "a", "Hematología", "en", "enero", "de", "2013", ",", "encontrando", "déficit", "de", "vitamina", "B-12", ",", "por", "lo", "que", "se", "mantiene", "el", "tratamiento", "con", "hierro", "oral", "y", "se", "suplementa", "con", "vitamina", "\n", "B-12", ".", "\n\n", "La", "paciente", "continúa", "sin", "mejoría", "y", "acude", "a", "Urgencias", "en", "febrero", "de", "2013", "por", "un", "cuadro", "de", "debilidad", "y", "deposiciones", "oscuras", "de", "2", "semanas", "de", "evolución", ",", "a", "las", "que", "no", "había", "dado", "mayor", "importancia", "por", "haber", "sido", "atribuidas", "al", "tratamiento", "con", "hierro", ".", "\n\n", "Se", "diagnostica", "de", "hemorragia", "digestiva", "alta", "y", "se", "ingresa", "en", "el", "Servicio", "de", "Aparato", "Digestivo", "para", "su", "estudio", ".", "Se", "realizan", "una", "gastroscopia", ",", "que", "no", "mostró", "hallazgos", "patológicos", ",", "y", "una", "colonoscopia", "hasta", "el", "ciego", ",", "que", "mostró", "abundantes", "restos", "melénicos", "sin", "lesiones", "aparentes", ".", "\n\n", "Asimismo", ",", "se", "completa", "el", "estudio", "con", "cápsula", "endoscópica", "que", "mostró", "asas", "yeyunales", "llenas", "de", "sangre", "y", "coágulos", ",", "sin", "poder", "encontrar", "la", "causa", "del", "sangrado", ".", "Llegados", "a", "este", "punto", ",", "se", "decide", "realizar", "una", "angio", "-", "TC", "abdominal", ",", "que", "evidencia", "acúmulo", "de", "asas", "a", "nivel", "del", "yeyuno", "proximal", "con", "presencia", "de", "vasos", "de", "morfología", "anómala", ".", "\n\n", "Se", "repite", "la", "gastroscopia", "a", "los", "12", "días", "y", "se", "observa", "a", "nivel", "del", "primer", "asa", "yeyunal", "una", "tumoración", "aplanada", "con", "zonas", "excrecentes", "de", "unos", "2", "cm", ",", "con", "sangrado", "al", "mínimo", "roce", "con", "el", "endoscopio", ",", "por", "lo", "que", "no", "se", "realiza", "toma", "de", "biopsia", ".", "\n\n", "Una", "vez", "localizada", "la", "lesión", ",", "se", "traslada", "la", "paciente", "a", "Cirugía", ",", "realizando", "laparotomía", "exploradora", "en", "marzo", "de", "2013", ",", "que", "encuentra", "una", "tumoración", "de", "6", "x", "6", "cm", "dependiente", "del", "primer", "asa", "yeyunal", "firmemente", "adherida", "a", "la", "raíz", "del", "mesenterio", "con", "grandes", "adenopatías", "en", "el", "territorio", "de", "la", "aortocava", ".", "\n\n", "Se", "realiza", "resección", "del", "asa", "yeyunal", "incluyendo", "a", "la", "tumoración", ",", "con", "anastomosis", "terminoterminal", "con", "linfadenectomía", "del", "territorio", "aortocava", ".", "\n\n", "La", "intervención", "transcurre", "sin", "complicaciones", "y", "es", "dada", "de", "alta", "a", "los", "6", "días", "de", "la", "intervención", ".", "\n\n", "El", "estudio", "anatomopatológico", "de", "la", "pieza", "mostró", "un", "tumor", "del", "estroma", "gastrointestinal", "de", "alto", "riesgo", "(", ">", "5", "cm", ",", ">", "5", "mitosis", "por", "50", "CGA", ")", "con", "mutación", "en", "el", "exón", "9", "de", "c", "-", "Kit", "y", "linfadenitis", "reactiva", "en", "los", "11", "ganglios", "aislados", ".", "\n\n", "Se", "deriva", "a", "Oncología", ",", "donde", "se", "solicita", "estudio", "de", "extensión", "con", "TC", "de", "tórax", ",", "abdomen", "y", "pelvis", ",", "sin", "evidencia", "de", "enfermedad", "a", "distancia", ".", "Asimismo", ",", "se", "solicitan", "ecocardiograma", "y", "perfil", "tiroideo", ",", "que", "no", "muestran", "alteraciones", ".", "Inicia", "imatinib", "400", "mg", "/", "día", "adyuvante", "en", "abril", "de", "2013", ",", "con", "buena", "tolerancia", ".", "\n\n", "En", "la", "TC", "de", "reevaluación", "en", "enero", "de", "2014", ",", "estando", "la", "paciente", "asintomática", "salvo", "por", "pirosis", "ocasional", ",", "se", "observa", "engrosamiento", "de", "la", "pared", "gástrica", "marcado", "y", "adenopatías", "locorregionales", "junto", "a", "rarefacción", "de", "la", "grasa", "perigástrica", ".", "En", "el", "espesor", "de", "la", "pared", "gástrica", "se", "observa", "una", "imagen", "hiperintensa", "de", "unos", "3", "cm", "sugerente", "de", "cuerpo", "extraño", ".", "\n\n", "Se", "solicita", "gastroscopia", ",", "que", "encuentra", "un", "pliegue", "gástrico", "engrosado", "y", "duro", "a", "la", "toma", "de", "biopsia", ".", "El", "resultado", "anatomopatológico", "fue", "de", "gastritis", "leve", "con", "ausencia", "de", "neoplasia", ".", "Ante", "estos", "hallazgos", "se", "solicita", "una", "PET", "-", "TC", "que", "informa", "de", "una", "masa", "de", "gran", "tamaño", "en", "el", "espacio", "gastropancreático", ",", "muy", "heterogénea", "en", "cuanto", "a", "su", "comportamiento", "metabólico", ",", "altamente", "sugerente", "de", "neoplásica", "y", ",", "dados", "el", "componente", "mixto", "mostrado", "y", "la", "región", "anatómica", "en", "la", "que", "se", "presenta", ",", "plausible", "con", "recaída", "de", "GIST", ".", "\n\n", "Por", "tanto", ",", "se", "considera", "recaída", "de", "la", "enfermedad", "de", "base", "y", "se", "decide", "aumentar", "la", "dosis", "de", "imatinib", "a", "800", "mg", "/", "día", ",", "dada", "la", "buena", "tolerancia", ",", "y", "posterior", "cirugía", "en", "función", "de", "la", "respuesta", ".", "\n\n", "A", "los", "20", "días", ",", "la", "paciente", "consulta", "por", "un", "cuadro", "de", "vómitos", "de", "contenido", "alimenticio", "que", "en", "pocos", "días", "se", "habían", "hecho", "incoercibles", "a", "pesar", "de", "los", "antieméticos", ",", "asociado", "a", "anemia", "en", "rango", "transfusional", "y", "deterioro", "del", "estado", "general", ".", "\n\n", "Se", "decide", "su", "ingreso", "para", "control", "de", "los", "síntomas", "y", "soporte", "transfusional", ".", "\n\n", "Exploración", "física", "\n", "La", "paciente", "se", "encontraba", "con", "regular", "estado", "general", "y", "con", "evidentes", "signos", "de", "deshidratación", "cutaneomucosa", "y", "tinte", "subictérico", ".", "\n\n", "A", "la", "exploración", "no", "presentaba", "hallazgos", "patológicos", "a", "la", "auscultación", "cardíaca", "ni", "respiratoria", ".", "\n\n", "Asimismo", ",", "tenía", "un", "abdomen", "blando", ",", "aunque", "se", "palpaba", "una", "masa", "dura", "y", "dolorosa", ",", "de", "unos", "10", "cm", "de", "tamaño", ",", "en", "el", "epigastrio", ",", "ocupándolo", "prácticamente", "en", "su", "totalidad", ".", "\n\n\n", "Pruebas", "complementarias", "\n", "»", "TC", ":", "engrosamiento", "parietal", "en", "la", "curvatura", "menor", "del", "cuerpo", "-", "antro", "gástrico", ",", "con", "mala", "definición", "del", "límite", "con", "el", "páncreas", ".", "Imagen", "compatible", "con", "cuerpo", "extraño", "en", "el", "espesor", "de", "la", "pared", "gástrica", ".", "Adenopatías", "locorregionales", "adyacentes", "al", "antro", "gástrico", "de", "hasta", "10", "mm", "con", "marcada", "rarefacción", "de", "la", "grasa", ".", "\n", "»", "Bioquímica", ":", "glucosa", "204", "mg", "/", "dl", ";", "urea", "72,7", "mg", "/", "dl", ";", "creatinina", "1,5", "mg", "/", "dl", ";", "bilirrubina", "total", "0,56", "mg", "/", "dl", ";", "GPT", "10", "UI", "/", "l", ";", "sodio", "135", "mEq", "/", "l", ";", "potasio", "2,9", "mEq", "/", "l", ";", "cloro", "97", "mEq", "/", "l", ";", "calcio", "10", "mg", "/", "dl", ";", "PCR", "55,66", "mg", "/", "l.", "\n", "»", "Hemograma", ":", "Hb", "7,8", "g", "/", "dl", ";", "leucocitos", "6.200", "con", "71,2", "%", "PMN", ";", "plaquetas", "387.000", "/", "μl", ".", "\n\n", "Diagnóstico", "\n", "A", "la", "luz", "de", "las", "pruebas", "realizadas", "y", "la", "clínica", "de", "la", "paciente", ",", "se", "diagnostica", "de", "cuadro", "obstructivo", "por", "probable", "recidiva", "del", "tumor", "primario", ".", "\n\n", "Tratamiento", "\n", "Se", "procede", "al", "ingreso", "de", "la", "paciente", "en", "Oncología", "Médica", ",", "donde", "se", "inicia", "tratamiento", "sintomático", "con", "colocación", "de", "sonda", "nasogástrica", ",", "nutrición", "parenteral", "y", "transfusión", "de", "2", "concentrados", "de", "hematíes", ".", "\n\n", "La", "paciente", "no", "mejora", "de", "la", "sintomatología", ",", "por", "lo", "que", "se", "presenta", "el", "caso", "en", "el", "comité", "multidisciplinar", "con", "Cirugía", "y", "Radiología", "y", "se", "decide", "programar", "laparotomía", "exploradora", ".", "\n\n", "Evolución", "\n", "En", "la", "intervención", "aparece", "una", "tumoración", "inflamatoria", "crónica", "que", "engloba", "la", "cara", "posterior", "del", "estómago", "a", "modo", "de", "coraza", ",", "involucrando", "la", "vesícula", "biliar", ",", "el", "colon", "transverso", "y", "el", "duodeno", ",", "además", "de", "un", "absceso", "retrogástrico", ",", "del", "cual", "se", "toman", "muestras", "para", "cultivo", ".", "\n\n", "Se", "realiza", "gastrectomía", "2/3", "con", "gran", "dificultad", "por", "la", "rigidez", "del", "tejido", ",", "con", "reconstrucción", "en", "Y", "de", "Roux", ".", "\n\n", "En", "el", "postoperatorio", "es", "necesario", "emplear", "vasoactivos", "a", "altas", "dosis", "para", "mantener", "la", "tensión", "arterial", "y", "mantenerla", "intubada", "hasta", "las", "48", "horas", "de", "la", "intervención", ".", "\n\n", "En", "la", "TC", "de", "control", "realizada", "tras", "la", "intervención", "aparece", "una", "colección", "líquida", "en", "el", "lecho", "quirúrgico", "en", "relacion", "con", "la", "intervención", ",", "sin", "otros", "hallazgos", "relevantes", ".", "\n\n", "El", "cultivo", "fue", "positivo", "para", "Actinomyces", "odontolyticus", "y", "Escherichia", "coli", "multisensibles", ",", "por", "lo", "que", "se", "mantiene", "la", "cobertura", "antibiótica", "del", "postoperatorio", "con", "meropenem", ",", "linezolid", "y", "fluconazol", ".", "\n\n", "El", "resultado", "anatomopatológico", "mostró", "un", "estómago", "con", "importante", "reacción", "inflamatoria", "aguda", ",", "alrededor", "de", "la", "que", "se", "instaura", "tejido", "de", "granulación", "en", "probable", "relación", "con", "perforación", "por", "cuerpo", "extraño", ",", "probablemente", "un", "palillo", "de", "dientes", ",", "sin", "que", "se", "evidencie", "proceso", "neoplásico", ".", "Adenopatías", "con", "linfadenitis", "reactiva", "inespecífica", "sin", "indicios", "de", "neoplasia", ".", "\n\n", "La", "paciente", "evoluciona", "bien", "y", "se", "da", "de", "alta", "al", "décimo", "día", "de", "la", "operación", ".", "\n\n", "En", "la", "revisión", "en", "la", "consulta", "de", "Oncología", ",", "se", "decide", "retomar", "el", "tratamiento", "con", "imatinib", "a", "400", "mg", "diarios", ".", "A", "su", "vez", ",", "sigue", "revisiones", "en", "Cirugía", ",", "que", "comprueba", "que", "la", "paciente", "no", "tiene", "problemas", "para", "la", "toma", "de", "alimentos", "y", "que", "está", "recuperando", "peso", "a", "buen", "ritmo", ".", "\n\n", "En", "la", "actualidad", "no", "muestra", "evidencia", "de", "enfermedad", "y", "continúa", "con", "imatinib", "adyuvante", "con", "magnífica", "tolerancia", "." ]
[ "MORFOLOGIA_NEOPLASIA" ]
tumoración, tumoración, tumoración, tumor del estroma gastrointestinal, enfermedad a distancia, neoplasia, neoplásica, GIST, tumor, tumoración, neoplásico, neoplasia
251_task2
Sentence: Anamnesis Mujer de 62 años, de etnia gitana, con antecedente de diabetes mellitus tipo 2, dislipemia e hipertensión, que consulta en septiembre de 2012 a su médico de Atención Primaria por un cuadro de astenia y palidez. No refería indicios de sangrado digestivo ni de otro tipo. Analíticamente se detecta anemia ferropénica, por lo que se inicia tratamiento con hierro oral. Tras 3 meses de tratamiento, no mejoría de la sintomatología ni recuperación analítica, se deriva a Hematología en enero de 2013, encontrando déficit de vitamina B-12, por lo que se mantiene el tratamiento con hierro oral y se suplementa con vitamina B-12. La paciente continúa sin mejoría y acude a Urgencias en febrero de 2013 por un cuadro de debilidad y deposiciones oscuras de 2 semanas de evolución, a las que no había dado mayor importancia por haber sido atribuidas al tratamiento con hierro. Se diagnostica de hemorragia digestiva alta y se ingresa en el Servicio de Aparato Digestivo para su estudio. Se realizan una gastroscopia, que no mostró hallazgos patológicos, y una colonoscopia hasta el ciego, que mostró abundantes restos melénicos sin lesiones aparentes. Asimismo, se completa el estudio con cápsula endoscópica que mostró asas yeyunales llenas de sangre y coágulos, sin poder encontrar la causa del sangrado. Llegados a este punto, se decide realizar una angio-TC abdominal, que evidencia acúmulo de asas a nivel del yeyuno proximal con presencia de vasos de morfología anómala. Se repite la gastroscopia a los 12 días y se observa a nivel del primer asa yeyunal una tumoración aplanada con zonas excrecentes de unos 2 cm, con sangrado al mínimo roce con el endoscopio, por lo que no se realiza toma de biopsia. Una vez localizada la lesión, se traslada la paciente a Cirugía, realizando laparotomía exploradora en marzo de 2013, que encuentra una tumoración de 6 x 6 cm dependiente del primer asa yeyunal firmemente adherida a la raíz del mesenterio con grandes adenopatías en el territorio de la aortocava. Se realiza resección del asa yeyunal incluyendo a la tumoración, con anastomosis terminoterminal con linfadenectomía del territorio aortocava. La intervención transcurre sin complicaciones y es dada de alta a los 6 días de la intervención. El estudio anatomopatológico de la pieza mostró un tumor del estroma gastrointestinal de alto riesgo (> 5 cm, > 5 mitosis por 50 CGA) con mutación en el exón 9 de c-Kit y linfadenitis reactiva en los 11 ganglios aislados. Se deriva a Oncología, donde se solicita estudio de extensión con TC de tórax, abdomen y pelvis, sin evidencia de enfermedad a distancia. Asimismo, se solicitan ecocardiograma y perfil tiroideo, que no muestran alteraciones. Inicia imatinib 400 mg/día adyuvante en abril de 2013, con buena tolerancia. En la TC de reevaluación en enero de 2014, estando la paciente asintomática salvo por pirosis ocasional, se observa engrosamiento de la pared gástrica marcado y adenopatías locorregionales junto a rarefacción de la grasa perigástrica. En el espesor de la pared gástrica se observa una imagen hiperintensa de unos 3 cm sugerente de cuerpo extraño. Se solicita gastroscopia, que encuentra un pliegue gástrico engrosado y duro a la toma de biopsia. El resultado anatomopatológico fue de gastritis leve con ausencia de neoplasia. Ante estos hallazgos se solicita una PET-TC que informa de una masa de gran tamaño en el espacio gastropancreático, muy heterogénea en cuanto a su comportamiento metabólico, altamente sugerente de neoplásica y, dados el componente mixto mostrado y la región anatómica en la que se presenta, plausible con recaída de GIST. Por tanto, se considera recaída de la enfermedad de base y se decide aumentar la dosis de imatinib a 800 mg/día, dada la buena tolerancia, y posterior cirugía en función de la respuesta. A los 20 días, la paciente consulta por un cuadro de vómitos de contenido alimenticio que en pocos días se habían hecho incoercibles a pesar de los antieméticos, asociado a anemia en rango transfusional y deterioro del estado general. Se decide su ingreso para control de los síntomas y soporte transfusional. Exploración física La paciente se encontraba con regular estado general y con evidentes signos de deshidratación cutaneomucosa y tinte subictérico. A la exploración no presentaba hallazgos patológicos a la auscultación cardíaca ni respiratoria. Asimismo, tenía un abdomen blando, aunque se palpaba una masa dura y dolorosa, de unos 10 cm de tamaño, en el epigastrio, ocupándolo prácticamente en su totalidad. Pruebas complementarias » TC: engrosamiento parietal en la curvatura menor del cuerpo-antro gástrico, con mala definición del límite con el páncreas. Imagen compatible con cuerpo extraño en el espesor de la pared gástrica. Adenopatías locorregionales adyacentes al antro gástrico de hasta 10 mm con marcada rarefacción de la grasa. » Bioquímica: glucosa 204 mg/dl; urea 72,7 mg/dl; creatinina 1,5 mg/dl; bilirrubina total 0,56 mg/dl; GPT 10 UI/l; sodio 135 mEq/l; potasio 2,9 mEq/l; cloro 97 mEq/l; calcio 10 mg/dl; PCR 55,66 mg/l. » Hemograma: Hb 7,8 g/dl; leucocitos 6.200 con 71,2% PMN; plaquetas 387.000/μl. Diagnóstico A la luz de las pruebas realizadas y la clínica de la paciente, se diagnostica de cuadro obstructivo por probable recidiva del tumor primario. Tratamiento Se procede al ingreso de la paciente en Oncología Médica, donde se inicia tratamiento sintomático con colocación de sonda nasogástrica, nutrición parenteral y transfusión de 2 concentrados de hematíes. La paciente no mejora de la sintomatología, por lo que se presenta el caso en el comité multidisciplinar con Cirugía y Radiología y se decide programar laparotomía exploradora. Evolución En la intervención aparece una tumoración inflamatoria crónica que engloba la cara posterior del estómago a modo de coraza, involucrando la vesícula biliar, el colon transverso y el duodeno, además de un absceso retrogástrico, del cual se toman muestras para cultivo. Se realiza gastrectomía 2/3 con gran dificultad por la rigidez del tejido, con reconstrucción en Y de Roux. En el postoperatorio es necesario emplear vasoactivos a altas dosis para mantener la tensión arterial y mantenerla intubada hasta las 48 horas de la intervención. En la TC de control realizada tras la intervención aparece una colección líquida en el lecho quirúrgico en relacion con la intervención, sin otros hallazgos relevantes. El cultivo fue positivo para Actinomyces odontolyticus y Escherichia coli multisensibles, por lo que se mantiene la cobertura antibiótica del postoperatorio con meropenem, linezolid y fluconazol. El resultado anatomopatológico mostró un estómago con importante reacción inflamatoria aguda, alrededor de la que se instaura tejido de granulación en probable relación con perforación por cuerpo extraño, probablemente un palillo de dientes, sin que se evidencie proceso neoplásico. Adenopatías con linfadenitis reactiva inespecífica sin indicios de neoplasia. La paciente evoluciona bien y se da de alta al décimo día de la operación. En la revisión en la consulta de Oncología, se decide retomar el tratamiento con imatinib a 400 mg diarios. A su vez, sigue revisiones en Cirugía, que comprueba que la paciente no tiene problemas para la toma de alimentos y que está recuperando peso a buen ritmo. En la actualidad no muestra evidencia de enfermedad y continúa con imatinib adyuvante con magnífica tolerancia. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anamnesis Mujer de 62 años, de etnia gitana, con antecedente de diabetes mellitus tipo 2, dislipemia e hipertensión, que consulta en septiembre de 2012 a su médico de Atención Primaria por un cuadro de astenia y palidez. No refería indicios de sangrado digestivo ni de otro tipo. Analíticamente se detecta anemia ferropénica, por lo que se inicia tratamiento con hierro oral. Tras 3 meses de tratamiento, no mejoría de la sintomatología ni recuperación analítica, se deriva a Hematología en enero de 2013, encontrando déficit de vitamina B-12, por lo que se mantiene el tratamiento con hierro oral y se suplementa con vitamina B-12. La paciente continúa sin mejoría y acude a Urgencias en febrero de 2013 por un cuadro de debilidad y deposiciones oscuras de 2 semanas de evolución, a las que no había dado mayor importancia por haber sido atribuidas al tratamiento con hierro. Se diagnostica de hemorragia digestiva alta y se ingresa en el Servicio de Aparato Digestivo para su estudio. Se realizan una gastroscopia, que no mostró hallazgos patológicos, y una colonoscopia hasta el ciego, que mostró abundantes restos melénicos sin lesiones aparentes. Asimismo, se completa el estudio con cápsula endoscópica que mostró asas yeyunales llenas de sangre y coágulos, sin poder encontrar la causa del sangrado. Llegados a este punto, se decide realizar una angio-TC abdominal, que evidencia acúmulo de asas a nivel del yeyuno proximal con presencia de vasos de morfología anómala. Se repite la gastroscopia a los 12 días y se observa a nivel del primer asa yeyunal una tumoración aplanada con zonas excrecentes de unos 2 cm, con sangrado al mínimo roce con el endoscopio, por lo que no se realiza toma de biopsia. Una vez localizada la lesión, se traslada la paciente a Cirugía, realizando laparotomía exploradora en marzo de 2013, que encuentra una tumoración de 6 x 6 cm dependiente del primer asa yeyunal firmemente adherida a la raíz del mesenterio con grandes adenopatías en el territorio de la aortocava. Se realiza resección del asa yeyunal incluyendo a la tumoración, con anastomosis terminoterminal con linfadenectomía del territorio aortocava. La intervención transcurre sin complicaciones y es dada de alta a los 6 días de la intervención. El estudio anatomopatológico de la pieza mostró un tumor del estroma gastrointestinal de alto riesgo (> 5 cm, > 5 mitosis por 50 CGA) con mutación en el exón 9 de c-Kit y linfadenitis reactiva en los 11 ganglios aislados. Se deriva a Oncología, donde se solicita estudio de extensión con TC de tórax, abdomen y pelvis, sin evidencia de enfermedad a distancia. Asimismo, se solicitan ecocardiograma y perfil tiroideo, que no muestran alteraciones. Inicia imatinib 400 mg/día adyuvante en abril de 2013, con buena tolerancia. En la TC de reevaluación en enero de 2014, estando la paciente asintomática salvo por pirosis ocasional, se observa engrosamiento de la pared gástrica marcado y adenopatías locorregionales junto a rarefacción de la grasa perigástrica. En el espesor de la pared gástrica se observa una imagen hiperintensa de unos 3 cm sugerente de cuerpo extraño. Se solicita gastroscopia, que encuentra un pliegue gástrico engrosado y duro a la toma de biopsia. El resultado anatomopatológico fue de gastritis leve con ausencia de neoplasia. Ante estos hallazgos se solicita una PET-TC que informa de una masa de gran tamaño en el espacio gastropancreático, muy heterogénea en cuanto a su comportamiento metabólico, altamente sugerente de neoplásica y, dados el componente mixto mostrado y la región anatómica en la que se presenta, plausible con recaída de GIST. Por tanto, se considera recaída de la enfermedad de base y se decide aumentar la dosis de imatinib a 800 mg/día, dada la buena tolerancia, y posterior cirugía en función de la respuesta. A los 20 días, la paciente consulta por un cuadro de vómitos de contenido alimenticio que en pocos días se habían hecho incoercibles a pesar de los antieméticos, asociado a anemia en rango transfusional y deterioro del estado general. Se decide su ingreso para control de los síntomas y soporte transfusional. Exploración física La paciente se encontraba con regular estado general y con evidentes signos de deshidratación cutaneomucosa y tinte subictérico. A la exploración no presentaba hallazgos patológicos a la auscultación cardíaca ni respiratoria. Asimismo, tenía un abdomen blando, aunque se palpaba una masa dura y dolorosa, de unos 10 cm de tamaño, en el epigastrio, ocupándolo prácticamente en su totalidad. Pruebas complementarias » TC: engrosamiento parietal en la curvatura menor del cuerpo-antro gástrico, con mala definición del límite con el páncreas. Imagen compatible con cuerpo extraño en el espesor de la pared gástrica. Adenopatías locorregionales adyacentes al antro gástrico de hasta 10 mm con marcada rarefacción de la grasa. » Bioquímica: glucosa 204 mg/dl; urea 72,7 mg/dl; creatinina 1,5 mg/dl; bilirrubina total 0,56 mg/dl; GPT 10 UI/l; sodio 135 mEq/l; potasio 2,9 mEq/l; cloro 97 mEq/l; calcio 10 mg/dl; PCR 55,66 mg/l. » Hemograma: Hb 7,8 g/dl; leucocitos 6.200 con 71,2% PMN; plaquetas 387.000/μl. Diagnóstico A la luz de las pruebas realizadas y la clínica de la paciente, se diagnostica de cuadro obstructivo por probable recidiva del tumor primario. Tratamiento Se procede al ingreso de la paciente en Oncología Médica, donde se inicia tratamiento sintomático con colocación de sonda nasogástrica, nutrición parenteral y transfusión de 2 concentrados de hematíes. La paciente no mejora de la sintomatología, por lo que se presenta el caso en el comité multidisciplinar con Cirugía y Radiología y se decide programar laparotomía exploradora. Evolución En la intervención aparece una tumoración inflamatoria crónica que engloba la cara posterior del estómago a modo de coraza, involucrando la vesícula biliar, el colon transverso y el duodeno, además de un absceso retrogástrico, del cual se toman muestras para cultivo. Se realiza gastrectomía 2/3 con gran dificultad por la rigidez del tejido, con reconstrucción en Y de Roux. En el postoperatorio es necesario emplear vasoactivos a altas dosis para mantener la tensión arterial y mantenerla intubada hasta las 48 horas de la intervención. En la TC de control realizada tras la intervención aparece una colección líquida en el lecho quirúrgico en relacion con la intervención, sin otros hallazgos relevantes. El cultivo fue positivo para Actinomyces odontolyticus y Escherichia coli multisensibles, por lo que se mantiene la cobertura antibiótica del postoperatorio con meropenem, linezolid y fluconazol. El resultado anatomopatológico mostró un estómago con importante reacción inflamatoria aguda, alrededor de la que se instaura tejido de granulación en probable relación con perforación por cuerpo extraño, probablemente un palillo de dientes, sin que se evidencie proceso neoplásico. Adenopatías con linfadenitis reactiva inespecífica sin indicios de neoplasia. La paciente evoluciona bien y se da de alta al décimo día de la operación. En la revisión en la consulta de Oncología, se decide retomar el tratamiento con imatinib a 400 mg diarios. A su vez, sigue revisiones en Cirugía, que comprueba que la paciente no tiene problemas para la toma de alimentos y que está recuperando peso a buen ritmo. En la actualidad no muestra evidencia de enfermedad y continúa con imatinib adyuvante con magnífica tolerancia.
[ "Anamnesis", "\n", "Mujer", "de", "62", "años", ",", "de", "etnia", "gitana", ",", "con", "antecedente", "de", "diabetes", "mellitus", "tipo", "2", ",", "dislipemia", "e", "hipertensión", ",", "que", "consulta", "en", "septiembre", "de", "2012", "a", "su", "médico", "de", "Atención", "Primaria", "por", "un", "cuadro", "de", "astenia", "y", "palidez", ".", "\n\n", "No", "refería", "indicios", "de", "sangrado", "digestivo", "ni", "de", "otro", "tipo", ".", "Analíticamente", "se", "detecta", "anemia", "ferropénica", ",", "por", "lo", "que", "se", "inicia", "tratamiento", "con", "hierro", "oral", ".", "Tras", "3", "meses", "de", "tratamiento", ",", "no", "mejoría", "de", "la", "sintomatología", "ni", "recuperación", "analítica", ",", "se", "deriva", "a", "Hematología", "en", "enero", "de", "2013", ",", "encontrando", "déficit", "de", "vitamina", "B-12", ",", "por", "lo", "que", "se", "mantiene", "el", "tratamiento", "con", "hierro", "oral", "y", "se", "suplementa", "con", "vitamina", "\n", "B-12", ".", "\n\n", "La", "paciente", "continúa", "sin", "mejoría", "y", "acude", "a", "Urgencias", "en", "febrero", "de", "2013", "por", "un", "cuadro", "de", "debilidad", "y", "deposiciones", "oscuras", "de", "2", "semanas", "de", "evolución", ",", "a", "las", "que", "no", "había", "dado", "mayor", "importancia", "por", "haber", "sido", "atribuidas", "al", "tratamiento", "con", "hierro", ".", "\n\n", "Se", "diagnostica", "de", "hemorragia", "digestiva", "alta", "y", "se", "ingresa", "en", "el", "Servicio", "de", "Aparato", "Digestivo", "para", "su", "estudio", ".", "Se", "realizan", "una", "gastroscopia", ",", "que", "no", "mostró", "hallazgos", "patológicos", ",", "y", "una", "colonoscopia", "hasta", "el", "ciego", ",", "que", "mostró", "abundantes", "restos", "melénicos", "sin", "lesiones", "aparentes", ".", "\n\n", "Asimismo", ",", "se", "completa", "el", "estudio", "con", "cápsula", "endoscópica", "que", "mostró", "asas", "yeyunales", "llenas", "de", "sangre", "y", "coágulos", ",", "sin", "poder", "encontrar", "la", "causa", "del", "sangrado", ".", "Llegados", "a", "este", "punto", ",", "se", "decide", "realizar", "una", "angio", "-", "TC", "abdominal", ",", "que", "evidencia", "acúmulo", "de", "asas", "a", "nivel", "del", "yeyuno", "proximal", "con", "presencia", "de", "vasos", "de", "morfología", "anómala", ".", "\n\n", "Se", "repite", "la", "gastroscopia", "a", "los", "12", "días", "y", "se", "observa", "a", "nivel", "del", "primer", "asa", "yeyunal", "una", "tumoración", "aplanada", "con", "zonas", "excrecentes", "de", "unos", "2", "cm", ",", "con", "sangrado", "al", "mínimo", "roce", "con", "el", "endoscopio", ",", "por", "lo", "que", "no", "se", "realiza", "toma", "de", "biopsia", ".", "\n\n", "Una", "vez", "localizada", "la", "lesión", ",", "se", "traslada", "la", "paciente", "a", "Cirugía", ",", "realizando", "laparotomía", "exploradora", "en", "marzo", "de", "2013", ",", "que", "encuentra", "una", "tumoración", "de", "6", "x", "6", "cm", "dependiente", "del", "primer", "asa", "yeyunal", "firmemente", "adherida", "a", "la", "raíz", "del", "mesenterio", "con", "grandes", "adenopatías", "en", "el", "territorio", "de", "la", "aortocava", ".", "\n\n", "Se", "realiza", "resección", "del", "asa", "yeyunal", "incluyendo", "a", "la", "tumoración", ",", "con", "anastomosis", "terminoterminal", "con", "linfadenectomía", "del", "territorio", "aortocava", ".", "\n\n", "La", "intervención", "transcurre", "sin", "complicaciones", "y", "es", "dada", "de", "alta", "a", "los", "6", "días", "de", "la", "intervención", ".", "\n\n", "El", "estudio", "anatomopatológico", "de", "la", "pieza", "mostró", "un", "tumor", "del", "estroma", "gastrointestinal", "de", "alto", "riesgo", "(", ">", "5", "cm", ",", ">", "5", "mitosis", "por", "50", "CGA", ")", "con", "mutación", "en", "el", "exón", "9", "de", "c", "-", "Kit", "y", "linfadenitis", "reactiva", "en", "los", "11", "ganglios", "aislados", ".", "\n\n", "Se", "deriva", "a", "Oncología", ",", "donde", "se", "solicita", "estudio", "de", "extensión", "con", "TC", "de", "tórax", ",", "abdomen", "y", "pelvis", ",", "sin", "evidencia", "de", "enfermedad", "a", "distancia", ".", "Asimismo", ",", "se", "solicitan", "ecocardiograma", "y", "perfil", "tiroideo", ",", "que", "no", "muestran", "alteraciones", ".", "Inicia", "imatinib", "400", "mg", "/", "día", "adyuvante", "en", "abril", "de", "2013", ",", "con", "buena", "tolerancia", ".", "\n\n", "En", "la", "TC", "de", "reevaluación", "en", "enero", "de", "2014", ",", "estando", "la", "paciente", "asintomática", "salvo", "por", "pirosis", "ocasional", ",", "se", "observa", "engrosamiento", "de", "la", "pared", "gástrica", "marcado", "y", "adenopatías", "locorregionales", "junto", "a", "rarefacción", "de", "la", "grasa", "perigástrica", ".", "En", "el", "espesor", "de", "la", "pared", "gástrica", "se", "observa", "una", "imagen", "hiperintensa", "de", "unos", "3", "cm", "sugerente", "de", "cuerpo", "extraño", ".", "\n\n", "Se", "solicita", "gastroscopia", ",", "que", "encuentra", "un", "pliegue", "gástrico", "engrosado", "y", "duro", "a", "la", "toma", "de", "biopsia", ".", "El", "resultado", "anatomopatológico", "fue", "de", "gastritis", "leve", "con", "ausencia", "de", "neoplasia", ".", "Ante", "estos", "hallazgos", "se", "solicita", "una", "PET", "-", "TC", "que", "informa", "de", "una", "masa", "de", "gran", "tamaño", "en", "el", "espacio", "gastropancreático", ",", "muy", "heterogénea", "en", "cuanto", "a", "su", "comportamiento", "metabólico", ",", "altamente", "sugerente", "de", "neoplásica", "y", ",", "dados", "el", "componente", "mixto", "mostrado", "y", "la", "región", "anatómica", "en", "la", "que", "se", "presenta", ",", "plausible", "con", "recaída", "de", "GIST", ".", "\n\n", "Por", "tanto", ",", "se", "considera", "recaída", "de", "la", "enfermedad", "de", "base", "y", "se", "decide", "aumentar", "la", "dosis", "de", "imatinib", "a", "800", "mg", "/", "día", ",", "dada", "la", "buena", "tolerancia", ",", "y", "posterior", "cirugía", "en", "función", "de", "la", "respuesta", ".", "\n\n", "A", "los", "20", "días", ",", "la", "paciente", "consulta", "por", "un", "cuadro", "de", "vómitos", "de", "contenido", "alimenticio", "que", "en", "pocos", "días", "se", "habían", "hecho", "incoercibles", "a", "pesar", "de", "los", "antieméticos", ",", "asociado", "a", "anemia", "en", "rango", "transfusional", "y", "deterioro", "del", "estado", "general", ".", "\n\n", "Se", "decide", "su", "ingreso", "para", "control", "de", "los", "síntomas", "y", "soporte", "transfusional", ".", "\n\n", "Exploración", "física", "\n", "La", "paciente", "se", "encontraba", "con", "regular", "estado", "general", "y", "con", "evidentes", "signos", "de", "deshidratación", "cutaneomucosa", "y", "tinte", "subictérico", ".", "\n\n", "A", "la", "exploración", "no", "presentaba", "hallazgos", "patológicos", "a", "la", "auscultación", "cardíaca", "ni", "respiratoria", ".", "\n\n", "Asimismo", ",", "tenía", "un", "abdomen", "blando", ",", "aunque", "se", "palpaba", "una", "masa", "dura", "y", "dolorosa", ",", "de", "unos", "10", "cm", "de", "tamaño", ",", "en", "el", "epigastrio", ",", "ocupándolo", "prácticamente", "en", "su", "totalidad", ".", "\n\n\n", "Pruebas", "complementarias", "\n", "»", "TC", ":", "engrosamiento", "parietal", "en", "la", "curvatura", "menor", "del", "cuerpo", "-", "antro", "gástrico", ",", "con", "mala", "definición", "del", "límite", "con", "el", "páncreas", ".", "Imagen", "compatible", "con", "cuerpo", "extraño", "en", "el", "espesor", "de", "la", "pared", "gástrica", ".", "Adenopatías", "locorregionales", "adyacentes", "al", "antro", "gástrico", "de", "hasta", "10", "mm", "con", "marcada", "rarefacción", "de", "la", "grasa", ".", "\n", "»", "Bioquímica", ":", "glucosa", "204", "mg", "/", "dl", ";", "urea", "72,7", "mg", "/", "dl", ";", "creatinina", "1,5", "mg", "/", "dl", ";", "bilirrubina", "total", "0,56", "mg", "/", "dl", ";", "GPT", "10", "UI", "/", "l", ";", "sodio", "135", "mEq", "/", "l", ";", "potasio", "2,9", "mEq", "/", "l", ";", "cloro", "97", "mEq", "/", "l", ";", "calcio", "10", "mg", "/", "dl", ";", "PCR", "55,66", "mg", "/", "l.", "\n", "»", "Hemograma", ":", "Hb", "7,8", "g", "/", "dl", ";", "leucocitos", "6.200", "con", "71,2", "%", "PMN", ";", "plaquetas", "387.000", "/", "μl", ".", "\n\n", "Diagnóstico", "\n", "A", "la", "luz", "de", "las", "pruebas", "realizadas", "y", "la", "clínica", "de", "la", "paciente", ",", "se", "diagnostica", "de", "cuadro", "obstructivo", "por", "probable", "recidiva", "del", "tumor", "primario", ".", "\n\n", "Tratamiento", "\n", "Se", "procede", "al", "ingreso", "de", "la", "paciente", "en", "Oncología", "Médica", ",", "donde", "se", "inicia", "tratamiento", "sintomático", "con", "colocación", "de", "sonda", "nasogástrica", ",", "nutrición", "parenteral", "y", "transfusión", "de", "2", "concentrados", "de", "hematíes", ".", "\n\n", "La", "paciente", "no", "mejora", "de", "la", "sintomatología", ",", "por", "lo", "que", "se", "presenta", "el", "caso", "en", "el", "comité", "multidisciplinar", "con", "Cirugía", "y", "Radiología", "y", "se", "decide", "programar", "laparotomía", "exploradora", ".", "\n\n", "Evolución", "\n", "En", "la", "intervención", "aparece", "una", "tumoración", "inflamatoria", "crónica", "que", "engloba", "la", "cara", "posterior", "del", "estómago", "a", "modo", "de", "coraza", ",", "involucrando", "la", "vesícula", "biliar", ",", "el", "colon", "transverso", "y", "el", "duodeno", ",", "además", "de", "un", "absceso", "retrogástrico", ",", "del", "cual", "se", "toman", "muestras", "para", "cultivo", ".", "\n\n", "Se", "realiza", "gastrectomía", "2/3", "con", "gran", "dificultad", "por", "la", "rigidez", "del", "tejido", ",", "con", "reconstrucción", "en", "Y", "de", "Roux", ".", "\n\n", "En", "el", "postoperatorio", "es", "necesario", "emplear", "vasoactivos", "a", "altas", "dosis", "para", "mantener", "la", "tensión", "arterial", "y", "mantenerla", "intubada", "hasta", "las", "48", "horas", "de", "la", "intervención", ".", "\n\n", "En", "la", "TC", "de", "control", "realizada", "tras", "la", "intervención", "aparece", "una", "colección", "líquida", "en", "el", "lecho", "quirúrgico", "en", "relacion", "con", "la", "intervención", ",", "sin", "otros", "hallazgos", "relevantes", ".", "\n\n", "El", "cultivo", "fue", "positivo", "para", "Actinomyces", "odontolyticus", "y", "Escherichia", "coli", "multisensibles", ",", "por", "lo", "que", "se", "mantiene", "la", "cobertura", "antibiótica", "del", "postoperatorio", "con", "meropenem", ",", "linezolid", "y", "fluconazol", ".", "\n\n", "El", "resultado", "anatomopatológico", "mostró", "un", "estómago", "con", "importante", "reacción", "inflamatoria", "aguda", ",", "alrededor", "de", "la", "que", "se", "instaura", "tejido", "de", "granulación", "en", "probable", "relación", "con", "perforación", "por", "cuerpo", "extraño", ",", "probablemente", "un", "palillo", "de", "dientes", ",", "sin", "que", "se", "evidencie", "proceso", "neoplásico", ".", "Adenopatías", "con", "linfadenitis", "reactiva", "inespecífica", "sin", "indicios", "de", "neoplasia", ".", "\n\n", "La", "paciente", "evoluciona", "bien", "y", "se", "da", "de", "alta", "al", "décimo", "día", "de", "la", "operación", ".", "\n\n", "En", "la", "revisión", "en", "la", "consulta", "de", "Oncología", ",", "se", "decide", "retomar", "el", "tratamiento", "con", "imatinib", "a", "400", "mg", "diarios", ".", "A", "su", "vez", ",", "sigue", "revisiones", "en", "Cirugía", ",", "que", "comprueba", "que", "la", "paciente", "no", "tiene", "problemas", "para", "la", "toma", "de", "alimentos", "y", "que", "está", "recuperando", "peso", "a", "buen", "ritmo", ".", "\n\n", "En", "la", "actualidad", "no", "muestra", "evidencia", "de", "enfermedad", "y", "continúa", "con", "imatinib", "adyuvante", "con", "magnífica", "tolerancia", "." ]
[ "MORFOLOGIA_NEOPLASIA" ]
5-azadC is a compound, Timp3 is a protein, Dusp2 is a protein, FoxJ1 is a protein, Smpd3 is a protein
DS.d1502_task0
Sentence: By conducting this initial screen on EMT6 cells and applying protein function and genomic structure criteria to genes identified as upregulated in response to 5-azadC/TSA, we were able to identify two characterized breast cancer TSGs (Timp3 and Rprm) and four putative TSGs (Atp1B2, Dusp2, FoxJ1 and Smpd3) silenced in this line. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: compound, protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "B-protein", "O", "B-protein", "O", "O", "O", "O", "O", "O" ]
By conducting this initial screen on EMT6 cells and applying protein function and genomic structure criteria to genes identified as upregulated in response to 5-azadC/TSA, we were able to identify two characterized breast cancer TSGs (Timp3 and Rprm) and four putative TSGs (Atp1B2, Dusp2, FoxJ1 and Smpd3) silenced in this line.
[ "By", "conducting", "this", "initial", "screen", "on", "EMT6", "cells", "and", "applying", "protein", "function", "and", "genomic", "structure", "criteria", "to", "genes", "identified", "as", "upregulated", "in", "response", "to", "5-azadC", "/", "TSA", ",", "we", "were", "able", "to", "identify", "two", "characterized", "breast", "cancer", "TSGs", "(", "Timp3", "and", "Rprm", ")", "and", "four", "putative", "TSGs", "(", "Atp1B2", ",", "Dusp2", ",", "FoxJ1", "and", "Smpd3", ")", "silenced", "in", "this", "line", "." ]
[ "compound", "protein" ]
5-azadC is a compound, Timp3 is a protein, Dusp2 is a protein, FoxJ1 is a protein, Smpd3 is a protein
DS.d1502_task1
Sentence: By conducting this initial screen on EMT6 cells and applying protein function and genomic structure criteria to genes identified as upregulated in response to 5-azadC/TSA, we were able to identify two characterized breast cancer TSGs (Timp3 and Rprm) and four putative TSGs (Atp1B2, Dusp2, FoxJ1 and Smpd3) silenced in this line. Instructions: please typing these entity words according to sentence: 5-azadC, Timp3, Dusp2, FoxJ1, Smpd3 Options: compound, protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "B-protein", "O", "B-protein", "O", "O", "O", "O", "O", "O" ]
By conducting this initial screen on EMT6 cells and applying protein function and genomic structure criteria to genes identified as upregulated in response to 5-azadC/TSA, we were able to identify two characterized breast cancer TSGs (Timp3 and Rprm) and four putative TSGs (Atp1B2, Dusp2, FoxJ1 and Smpd3) silenced in this line.
[ "By", "conducting", "this", "initial", "screen", "on", "EMT6", "cells", "and", "applying", "protein", "function", "and", "genomic", "structure", "criteria", "to", "genes", "identified", "as", "upregulated", "in", "response", "to", "5-azadC", "/", "TSA", ",", "we", "were", "able", "to", "identify", "two", "characterized", "breast", "cancer", "TSGs", "(", "Timp3", "and", "Rprm", ")", "and", "four", "putative", "TSGs", "(", "Atp1B2", ",", "Dusp2", ",", "FoxJ1", "and", "Smpd3", ")", "silenced", "in", "this", "line", "." ]
[ "compound", "protein" ]
5-azadC, Timp3, Dusp2, FoxJ1, Smpd3
DS.d1502_task2
Sentence: By conducting this initial screen on EMT6 cells and applying protein function and genomic structure criteria to genes identified as upregulated in response to 5-azadC/TSA, we were able to identify two characterized breast cancer TSGs (Timp3 and Rprm) and four putative TSGs (Atp1B2, Dusp2, FoxJ1 and Smpd3) silenced in this line. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "B-protein", "O", "B-protein", "O", "O", "O", "O", "O", "O" ]
By conducting this initial screen on EMT6 cells and applying protein function and genomic structure criteria to genes identified as upregulated in response to 5-azadC/TSA, we were able to identify two characterized breast cancer TSGs (Timp3 and Rprm) and four putative TSGs (Atp1B2, Dusp2, FoxJ1 and Smpd3) silenced in this line.
[ "By", "conducting", "this", "initial", "screen", "on", "EMT6", "cells", "and", "applying", "protein", "function", "and", "genomic", "structure", "criteria", "to", "genes", "identified", "as", "upregulated", "in", "response", "to", "5-azadC", "/", "TSA", ",", "we", "were", "able", "to", "identify", "two", "characterized", "breast", "cancer", "TSGs", "(", "Timp3", "and", "Rprm", ")", "and", "four", "putative", "TSGs", "(", "Atp1B2", ",", "Dusp2", ",", "FoxJ1", "and", "Smpd3", ")", "silenced", "in", "this", "line", "." ]
[ "compound", "protein" ]
analysis is an umlsterm, motion is an umlsterm, abnormalities is an umlsterm, dobutamine is an umlsterm, stress is an umlsterm, method is an umlsterm, myocardial ischemia is an umlsterm, magnetic resonance is an umlsterm, tomography is an umlsterm, stress is an umlsterm
ZfuerKardiologie.90880622.eng.abstr_task0
Sentence: The analysis of wall motion abnormalities with dobutamine stress echocardiography is an established method for the detection of myocardial ischemia . With ultrafast magnetic resonance tomography , the application of identical stress protocols as used for echocardiography is possible . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O" ]
The analysis of wall motion abnormalities with dobutamine stress echocardiography is an established method for the detection of myocardial ischemia . With ultrafast magnetic resonance tomography , the application of identical stress protocols as used for echocardiography is possible .
[ "The", "analysis", "of", "wall", "motion", "abnormalities", "with", "dobutamine", "stress", "echocardiography", "is", "an", "established", "method", "for", "the", "detection", "of", "myocardial", "ischemia", ".", "With", "ultrafast", "magnetic", "resonance", "tomography", ",", "the", "application", "of", "identical", "stress", "protocols", "as", "used", "for", "echocardiography", "is", "possible", "." ]
[ "umlsterm" ]
analysis is an umlsterm, motion is an umlsterm, abnormalities is an umlsterm, dobutamine is an umlsterm, stress is an umlsterm, method is an umlsterm, myocardial ischemia is an umlsterm, magnetic resonance is an umlsterm, tomography is an umlsterm, stress is an umlsterm
ZfuerKardiologie.90880622.eng.abstr_task1
Sentence: The analysis of wall motion abnormalities with dobutamine stress echocardiography is an established method for the detection of myocardial ischemia . With ultrafast magnetic resonance tomography , the application of identical stress protocols as used for echocardiography is possible . Instructions: please typing these entity words according to sentence: analysis, motion, abnormalities, dobutamine, stress, method, myocardial ischemia, magnetic resonance, tomography, stress Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O" ]
The analysis of wall motion abnormalities with dobutamine stress echocardiography is an established method for the detection of myocardial ischemia . With ultrafast magnetic resonance tomography , the application of identical stress protocols as used for echocardiography is possible .
[ "The", "analysis", "of", "wall", "motion", "abnormalities", "with", "dobutamine", "stress", "echocardiography", "is", "an", "established", "method", "for", "the", "detection", "of", "myocardial", "ischemia", ".", "With", "ultrafast", "magnetic", "resonance", "tomography", ",", "the", "application", "of", "identical", "stress", "protocols", "as", "used", "for", "echocardiography", "is", "possible", "." ]
[ "umlsterm" ]
analysis, motion, abnormalities, dobutamine, stress, method, myocardial ischemia, magnetic resonance, tomography, stress
ZfuerKardiologie.90880622.eng.abstr_task2
Sentence: The analysis of wall motion abnormalities with dobutamine stress echocardiography is an established method for the detection of myocardial ischemia . With ultrafast magnetic resonance tomography , the application of identical stress protocols as used for echocardiography is possible . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O" ]
The analysis of wall motion abnormalities with dobutamine stress echocardiography is an established method for the detection of myocardial ischemia . With ultrafast magnetic resonance tomography , the application of identical stress protocols as used for echocardiography is possible .
[ "The", "analysis", "of", "wall", "motion", "abnormalities", "with", "dobutamine", "stress", "echocardiography", "is", "an", "established", "method", "for", "the", "detection", "of", "myocardial", "ischemia", ".", "With", "ultrafast", "magnetic", "resonance", "tomography", ",", "the", "application", "of", "identical", "stress", "protocols", "as", "used", "for", "echocardiography", "is", "possible", "." ]
[ "umlsterm" ]
Diagnose is an umlsterm, Appendektomie is an umlsterm, Appendektomie is an umlsterm, Differentialdiagnose is an umlsterm
DerChirurg.70680006.ger.abstr_task0
Sentence: Zusammenfassung . Die unter der klinischen Diagnose einer akuten Appendicitis durchgefuehrte Appendektomie zaehlt zu den haeufigsten abdominalchirurgischen Eingriffen . Wegen der Mehrdeutigkeit des klinischen Bildes erlaubt jedoch erst die pathomorphologische Untersuchung eine zuverlaessige Einordnung des zugrunde liegenden Krankheitsprozesses und damit eine kritische Ueberpruefung der Indikationsstellung zur Appendektomie . Im folgenden werden die pathomorphologischen Kriterien der akuten Appendicitis wie auch deren Sonderformen dargestellt und insbesondere die Bedeutung der neurogenen Appendicopathie in der Differentialdiagnose der akuten Appendicitis hervorgehoben . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die unter der klinischen Diagnose einer akuten Appendicitis durchgefuehrte Appendektomie zaehlt zu den haeufigsten abdominalchirurgischen Eingriffen . Wegen der Mehrdeutigkeit des klinischen Bildes erlaubt jedoch erst die pathomorphologische Untersuchung eine zuverlaessige Einordnung des zugrunde liegenden Krankheitsprozesses und damit eine kritische Ueberpruefung der Indikationsstellung zur Appendektomie . Im folgenden werden die pathomorphologischen Kriterien der akuten Appendicitis wie auch deren Sonderformen dargestellt und insbesondere die Bedeutung der neurogenen Appendicopathie in der Differentialdiagnose der akuten Appendicitis hervorgehoben .
[ "Zusammenfassung", ".", "Die", "unter", "der", "klinischen", "Diagnose", "einer", "akuten", "Appendicitis", "durchgefuehrte", "Appendektomie", "zaehlt", "zu", "den", "haeufigsten", "abdominalchirurgischen", "Eingriffen", ".", "Wegen", "der", "Mehrdeutigkeit", "des", "klinischen", "Bildes", "erlaubt", "jedoch", "erst", "die", "pathomorphologische", "Untersuchung", "eine", "zuverlaessige", "Einordnung", "des", "zugrunde", "liegenden", "Krankheitsprozesses", "und", "damit", "eine", "kritische", "Ueberpruefung", "der", "Indikationsstellung", "zur", "Appendektomie", ".", "Im", "folgenden", "werden", "die", "pathomorphologischen", "Kriterien", "der", "akuten", "Appendicitis", "wie", "auch", "deren", "Sonderformen", "dargestellt", "und", "insbesondere", "die", "Bedeutung", "der", "neurogenen", "Appendicopathie", "in", "der", "Differentialdiagnose", "der", "akuten", "Appendicitis", "hervorgehoben", "." ]
[ "umlsterm" ]
Diagnose is an umlsterm, Appendektomie is an umlsterm, Appendektomie is an umlsterm, Differentialdiagnose is an umlsterm
DerChirurg.70680006.ger.abstr_task1
Sentence: Zusammenfassung . Die unter der klinischen Diagnose einer akuten Appendicitis durchgefuehrte Appendektomie zaehlt zu den haeufigsten abdominalchirurgischen Eingriffen . Wegen der Mehrdeutigkeit des klinischen Bildes erlaubt jedoch erst die pathomorphologische Untersuchung eine zuverlaessige Einordnung des zugrunde liegenden Krankheitsprozesses und damit eine kritische Ueberpruefung der Indikationsstellung zur Appendektomie . Im folgenden werden die pathomorphologischen Kriterien der akuten Appendicitis wie auch deren Sonderformen dargestellt und insbesondere die Bedeutung der neurogenen Appendicopathie in der Differentialdiagnose der akuten Appendicitis hervorgehoben . Instructions: please typing these entity words according to sentence: Diagnose, Appendektomie, Appendektomie, Differentialdiagnose Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die unter der klinischen Diagnose einer akuten Appendicitis durchgefuehrte Appendektomie zaehlt zu den haeufigsten abdominalchirurgischen Eingriffen . Wegen der Mehrdeutigkeit des klinischen Bildes erlaubt jedoch erst die pathomorphologische Untersuchung eine zuverlaessige Einordnung des zugrunde liegenden Krankheitsprozesses und damit eine kritische Ueberpruefung der Indikationsstellung zur Appendektomie . Im folgenden werden die pathomorphologischen Kriterien der akuten Appendicitis wie auch deren Sonderformen dargestellt und insbesondere die Bedeutung der neurogenen Appendicopathie in der Differentialdiagnose der akuten Appendicitis hervorgehoben .
[ "Zusammenfassung", ".", "Die", "unter", "der", "klinischen", "Diagnose", "einer", "akuten", "Appendicitis", "durchgefuehrte", "Appendektomie", "zaehlt", "zu", "den", "haeufigsten", "abdominalchirurgischen", "Eingriffen", ".", "Wegen", "der", "Mehrdeutigkeit", "des", "klinischen", "Bildes", "erlaubt", "jedoch", "erst", "die", "pathomorphologische", "Untersuchung", "eine", "zuverlaessige", "Einordnung", "des", "zugrunde", "liegenden", "Krankheitsprozesses", "und", "damit", "eine", "kritische", "Ueberpruefung", "der", "Indikationsstellung", "zur", "Appendektomie", ".", "Im", "folgenden", "werden", "die", "pathomorphologischen", "Kriterien", "der", "akuten", "Appendicitis", "wie", "auch", "deren", "Sonderformen", "dargestellt", "und", "insbesondere", "die", "Bedeutung", "der", "neurogenen", "Appendicopathie", "in", "der", "Differentialdiagnose", "der", "akuten", "Appendicitis", "hervorgehoben", "." ]
[ "umlsterm" ]
Diagnose, Appendektomie, Appendektomie, Differentialdiagnose
DerChirurg.70680006.ger.abstr_task2
Sentence: Zusammenfassung . Die unter der klinischen Diagnose einer akuten Appendicitis durchgefuehrte Appendektomie zaehlt zu den haeufigsten abdominalchirurgischen Eingriffen . Wegen der Mehrdeutigkeit des klinischen Bildes erlaubt jedoch erst die pathomorphologische Untersuchung eine zuverlaessige Einordnung des zugrunde liegenden Krankheitsprozesses und damit eine kritische Ueberpruefung der Indikationsstellung zur Appendektomie . Im folgenden werden die pathomorphologischen Kriterien der akuten Appendicitis wie auch deren Sonderformen dargestellt und insbesondere die Bedeutung der neurogenen Appendicopathie in der Differentialdiagnose der akuten Appendicitis hervorgehoben . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die unter der klinischen Diagnose einer akuten Appendicitis durchgefuehrte Appendektomie zaehlt zu den haeufigsten abdominalchirurgischen Eingriffen . Wegen der Mehrdeutigkeit des klinischen Bildes erlaubt jedoch erst die pathomorphologische Untersuchung eine zuverlaessige Einordnung des zugrunde liegenden Krankheitsprozesses und damit eine kritische Ueberpruefung der Indikationsstellung zur Appendektomie . Im folgenden werden die pathomorphologischen Kriterien der akuten Appendicitis wie auch deren Sonderformen dargestellt und insbesondere die Bedeutung der neurogenen Appendicopathie in der Differentialdiagnose der akuten Appendicitis hervorgehoben .
[ "Zusammenfassung", ".", "Die", "unter", "der", "klinischen", "Diagnose", "einer", "akuten", "Appendicitis", "durchgefuehrte", "Appendektomie", "zaehlt", "zu", "den", "haeufigsten", "abdominalchirurgischen", "Eingriffen", ".", "Wegen", "der", "Mehrdeutigkeit", "des", "klinischen", "Bildes", "erlaubt", "jedoch", "erst", "die", "pathomorphologische", "Untersuchung", "eine", "zuverlaessige", "Einordnung", "des", "zugrunde", "liegenden", "Krankheitsprozesses", "und", "damit", "eine", "kritische", "Ueberpruefung", "der", "Indikationsstellung", "zur", "Appendektomie", ".", "Im", "folgenden", "werden", "die", "pathomorphologischen", "Kriterien", "der", "akuten", "Appendicitis", "wie", "auch", "deren", "Sonderformen", "dargestellt", "und", "insbesondere", "die", "Bedeutung", "der", "neurogenen", "Appendicopathie", "in", "der", "Differentialdiagnose", "der", "akuten", "Appendicitis", "hervorgehoben", "." ]
[ "umlsterm" ]
E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species
30_task0
Sentence: The c1 genes of P1 and P7. Abstract The c1 genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7c1 expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the P1c1 repressor. The c1 regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-turn-helix motif commonly associated with repressor proteins. Two P1c1 amber mutations were localized to the 283-amino acid open reading frame. The P1c1 and P7c1 sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the c1 gene from either phage cause the repression of transcription from a cloned promoter situated upstream of P1c1.Images Volme 7 Nmbe 19198 Nulei Acds eserc The cl genes of P1 and P7 Francis A.Osborne, Sonja R.Stovall and Barbara R.Baumstark* Department of Biology, Georgia State University, Atlanta, GA 30303, USA Received July 11, 1989; Revised and Accepted August 29, 1989 EMBL accession nos X16005, X16006 ABSTRACT The cl genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7cl expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the Plcl repressor. The cl regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-tum-helix motif commonly associated with repressor proteins. Two Plcl amber mutations were localized to the 283-amino acid open reading frame. The Plcl and P7cl sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the cI gene from either phage cause the repression of transcription from a cloned promoter situated upstream of Plcl. INTRODUCTION The cl genes of the plasmid prophages P1 and P7 code for repressor proteins that are required for the establishment and maintenance of lysogeny (reviewed in 1). A protein corresponding to the Plcl repressor has been isolated and shown to be a sequence-specific DNA binding protein that recognizes several widely dispersed sites on the phage DNA (2-7). The consensus DNA sequence recognized by the Plcl repressor (ATTTATTAGAGCA[A/T]T) contains no discernable bilateral symmetry, a feature that is highly unusual among prokaryotic operator sites. P1 and P7 are heteroimmune; that is, each phage is able to establish a lytic infection on a lysogen of the other phage. In this sense, their relationship is analogous to that of phage X and 434, which differ in the DNA specificity of their cI repressor proteins (8). However, genetic studies indicate that Plcl and P7cl can be crossed into the heterologous phage without affecting the immunity specificity of the recipient (9). The basis for P1/P7 heteroimmunity has been localized to a second regulatory gene, c4, that is unlinked to cl. The c4 gene products prevent the expression of antireb, a closely linked gene that interferes with cl-mediated repression (10, 11). According to current models, P1/P7 heteroimmunity results from the inability of the c4 repressor of one phage to prevent antireb expression from the heteroimmune phage genome (10, 11). Because the cl genes of P1 and P7 are genetically interchangeable, it is anticipated that the two gene products carry out similar or identical regulatory functions. The studies presented in this paper were undertaken to investigate the biochemical basis for the apparent genetic identity of the two cl genes. In this paper, we present the DNA sequence of the cl genes of P1 and P7 and the predicted amino acid sequence of the cl repressor proteins. We report that Plcl and P7cl code for proteins of identical size (283 amino acids) and Nucleic Acids Research Volume 17 Number 19 1989 767 1 (r IRL Press Nucleic Acids Research nearly identical sequence. We report further that both repressors prevent the expression of a promoter located immediately upstream of the Plc 1 open reading frame, an observation that confirms their functional similarity and suggests an autoregulatory role for the two proteins. Analysis of the secondary structure predicted by the open reading frames does not reveal the characteristic helix-turn-helix (12) or other motifs commonly associated with DNA binding proteins. MATERIALS AND METHODS Bacterial and phage strains. E. coli K336 is a SuO derivative of K140 (13). E. coli CB454 is a recA-, lacZderivative of K-12 (14). P1 + is described by Scott (13). P7+ is the strain of Smith (15), as described by Scott (16). P7cl. 1 contains a missense mutation in the cl gene (17). The P7 phage strains and the cl amber mutant phage strains PIci .245Cm, Plc1. 169 and P Ic .55 (11) were generously provided by June Scott. Enzymes and reagents. Restriction enzymes, T4 DNA ligase and polymerase, and the Klenow fragment of E. coli DNA polymerase were purchased from Boehringer Biochemicals or New England Biolabs and reactions were carried out according to the manufacturers' instructions. DNA sequencing kits and in vitro transcription-translation kits were purchased from Bethesda Research Laboratories and Amersham Corporation, respectively. Synthetic oligonucleotides to be used as sequencing primers were prepared on an Applied Biosystems DNA synthesizer. Plasmid construction. pBRB7.2. pBRB7.2 (2) contains a 3.2 kb EcoRI/PvuII fragment from the cl region of P1 (Figure 1) inserted into the 2.3 kb EcoRIlPvuII fragment of pBR322 that contains the origin of replication and the f3-lactamase gene. pFA02. P7 plasmid DNA was digested with PvuII, ligated to similarly digested pBR322, and transformed into E. coli K336. Ampicillin-resistant colonies were screened for cl activity by cross-streak complementation analysis against P7cl.1 (18). pFAO2 contains a 3.5 kb insert of P7 DNA. The fragment was localized to the cl region of the P7 genome by Southern hybridization against P1 and P7 DNA that had been digested with BamHI and BglII (data not shown). pBRBJ69. 1 and pBRB55. 1. The PI cI open reading frame was previously localized to a 2.6 kb EcoRlIBamHI fragment derived from PlEcoRI-7 (2). This fragment also contains the wildtype allele for the conditional lethal mutation am43 (19, 20). To clone the cl reading frame from the amber mutant phage Plc1.169 and P Ic .55, we digested phage DNA with EcoRI and BamHI, ligated the digestion products into similarly digested pBR322, and transformed the ligation mixture into E. coli K336. Ampicillin-resistant, tetracyclinesensitive colonies were screened by cross-streak complementation analysis for their ability to support the growth of Plam43. Plasmid DNA isolated from complementation-positive cells was shown by agarose gel electrophoresis to carry plasmids containing the 2.6 kb EcoRIlBamHI fragment from the cl region. The cl mutant open reading frames were placed under the control of normal regulatory signals present in the cI region by digesting the cl.55 and cl. 169-containing plasmids with BamHI and PvuII and inserting a 601 bp BamHI/PvuH fragment containing the cl promoter region (2). The resulting plasmids, pBRB55.1 and pBRB169.1, respectively, contain the 3.2 kb EcoRllPvuIl fragment analogous to that present in pBRB7.2 (Figure 1). pBCB2. 13-2.18. To identify cl-repressible promoters, we introduced selected fragments 7672 Nucleic Acids Research 4 f - - + I 4 P1 4- 4- 4 ECAR H C B R P 4 4.4,~ 4, 1 1 4. I 4, I 11 t t t t t E G R N E B R P 4 4 - 4 1 ' '110z I I I I I I 1 3.2 1.5 1.0 0.5 0 P7 pBRB7.2 -------------------cl1------------- r ~ / >' pFAO2 *-lacZ pBCB2.13 <-lacZ Z pBCB2.16 <-lacZX pBCB2.18 Fig. 1. The cl regions of P1 and P7. A restriction map is indicated by the solid line in the upper part of the figure. Sites for EcoRI (E), Pvul (P), NnrI (N), Bgll (G), BamHI (B), and EcoRV (R) are shown. The sequencing strategy is indicated by the horizontal arrows. Letters and arrows above and below the map refer to sites and sequence analysis for P1 and P7, respectively. The size of this region (in kilobase pairs) is indicated below the map. The DNA fragments present in selected plasmids are illustrated by boxes at the bottom of the figure. The dashed line reveals the approximate position of the cl gene (2). The sites of the -yb mutations introduced into pFA02 are indicated by asterisks. pFA02.16 and pFA02.26 contain insertions located 0.9 kb and 1.4 kb, respectively, from the PvuIl site at the left side of the map. The direction of the lacZ open reading frame in pBCB2.13-18 is indicated by the adjacent arrow. from the cI region of P1 into pCB192, a promoter-probe vector containing promoterless copies of lacZ and galK extending in opposite directions from a multiple cloning site (21). The source of P1 DNA for these constructions was pZHA3, a derivative of pBRB7.2 that contains a HindIlI linker at the single EcoRV site located about 200 bps upstream of the cl open reading frame (Figure 1). pBCB2.13 contains a 460 bp fragment of P1 DNA extending from the EcoRV site to a Bgll site within the cI open reading frame. pBCB2. 16 contains a 130 bp fragment extending from the EcoRV site to a BamHI site located about 100 bps upstream of the cl open reading frame, while pBCB2.18 contains the region extending from this BamHI site to the Bglll site within the open reading frame (Figure 1). The orientation of the P1 DNA fragments within these plasmids was confirmed by restriction mapping and DNA sequencing. To test for the regulation of promoter expression by cl, we transformed pBCB2.13 and its derivatives into CB454(pBRB7.152) and CB454(pFAO2.152), two strains that express P7cl and Pll, respectively, from the pCB192-compatible kanamycin-resistant vector pDPT152 (22). Cells harboring both plasmids were selected by their resistance to both ampicillin and kanamycin. lacZ expression was measured by the procedure of Miller (23). pBRB7.152 was generated by introducing PlEcoRI-7 into pDPT152. pBRB7.152 has sustained a spontaneous deletion within the EcoRI-7 fragment that results in the loss of 2.5 kb of P1 DNA from the far left side of the P1 genetic map, but retains the 3.2 kb PvuHlEcoRI fragment required for cl expression that is present in pBRB7.2 (Figure 1). 7673 z I 011Z I e., Nucleic Acids Research Table 1. Complementation of PIci .245 by plasmids that contain cI genes. Phenotype Efficiency Relative of of Efficiency of Plasmid cI gene Lysogeny Lysogeny pBR322 1.5x 10-6 6.0x 10-6 pBRB7.2 Plcl+ 2.5 x 10-' 1.0 pBRB55.1 Plcl-am 1.4 x 10-6 5.6 x 10-6 pBRB169.1 PlCl-am 2.1 x 10-6 8.4 x 10-6 pFAO2 P7cl+ 8.7 x 10-2 0.35 pFAO2.16 P7c I-, 4.7 x 10-6 1.9 X 10-5 pFAO2.26 P7cI -1 3.1 x 10-6 1.2 x 10-5 Complementation for lysogeny was carried out as described by Devlin et al. (26). The plasmids were carried by E. coli K336. Cells were grown to mid-log phase at 370 in LB containing 50 tig/m1 sodium ampicillin and infected with Plcl.245 at a multiplicity of infection of 5 in the presence of 50 mM CaC12. After 10 minutes, non-absorbed phage were removed by centrifugation and the infection was allowed to proceed for 2 hours at 370. The infected cells were plated on LB plates containing 50 pLg/ml sodium ampicillin, 50 pLg/ml chloramphenicol, and 40 mM sodium citrate. The efficiency of lysogeny is defined as the number of ApRCmR cells at the end of infection divided by the number of ApR cells present at the start of the infection. To construct pFA02.152, we introduced a 2.8 kb EcoRV fragment of P7 DNA containing the cl gene (Figure 1) into the single EcoRI site of pDPT152 after it had been rendered blunt-ended by extension with T4 DNA polymerase. cl expression by cells harboring either pBRB7.152 or pFA02.152 was confirmed by measuring their ability to form chloramphenicol-resistant lysogens when infected with Plcl.245Cm. ,yb insertional mutagenesis. Insertional mutagenesis of P7cl was carried out using the 'yb transposon of F (24) as described by Devlin et al. (25). E. coli W1485(pFA02) was mated with the F- strain MX648 and subsequently plated on ampicillin (to select for the plasmid) and streptomycin sulfate (to select for the recipient strain). Transconjugants which could support only lytic growth upon infection by P7cl .1 (as scored by cross-streak analysis; 18) were assumed to have lost cl-complementing activity and were characterized further. The positions of two cl - insertional mutations, carried by pFA02.16 and pFA02.26, were identified by restriction mapping (Figure 1). DNA sequencing. DNA sequence analysis was carried out using the M13-dideoxy technique of Sanger et al. (26). Selected DNA fragments containing the cl wildtype or mutant genes were introduced into M13 mp8 or mp9. 18-nucleotide oligomers complementary to defined sequences within the cl gene were extended using the Klenow fragment of DNA polymerase in the presence of dideoxynucleotide triphosphates and analyzed by polyacrylamide-urea gel electrophoresis. The sequencing strategy is shown in Figure 1. RESULTS Localization of the P7cJ gene. Initial localization of the P7cl gene was undertaken by subjecting pFA02 to 'yb mutagenesis and determining the map position of inserts which destroy the ability of the plasmids to complement a P7cl - mutation (as determined by cross-streak analysis). pFA02 and the -yb insertion mutants were tested further by comparing their ability to complement a PIcI amber mutation with the complementation activity of plasmids containing cl genes isolated 7674 Nucleic Acids Research B C D E F G *.4 68 43 29- _ - =I = Am~ W _ 18 14 p Fig. 2. In vitro transcription-translation of plasmids carrying the cl region of P1 and P7. Proteins encoded by selected plasmids were labeled with 35S methionine according to the procedure of DeVries and Zubay (27), using a commercial in vitro transcription/tramnslation kit from Amersham Corporation. The reaction mixtures were subjected to electrophoresis on a 12.5% SDS-polyacrylamide gel and the labeled proteins were visualized by autoradiography. The migration of 14C-labeled protein molecular weight standards (Bethesda Research Laboratories) is indicated at the left side of the figure. Plasmids present in each lane are: A. pBRB55.1; B. pBRB169.1; C. pBRB7.2; D. pFAO2; E. pFAO2.16; F. pFAO2.26; G. pBR322. from P1 wildtype and amber mutants. Lysogeny by cells infected with Plcl.245Cm was scored as the growth of infected cells on ampicillin (to select for the resident plasmid) and chloramphenicol (to select for the phage genome). The values observed for the two plasmids containing Plcl and P7cl (pBRB7.2 and pFA02, respectively) are very similar and significantly higher than those obtained for pBR322 or for any of the plasmids carrying Table 2. Assay for lacZ expression from plasmids containing P1 DNA fragments. ,3-galactosidase activity (units) minus cI plus Pici plus P7cl relative activity (pDPT152) (pBB7. 152) (pFA02.152) +PICJ +P7cJ pCB192 0.58 0.55 0.54 0.95 0.93 pBCB2.13 154 15.2 13.6 0.10 0.09 pBCB2.16 1.1 1.2 1.1 1.1 1.0 pBCB2.18 4.0 3.4 3.9 0.9 1.0 Cells containing derivatives of the ApR promoter-probe plasmid pCB192 and the compatible KnR plasmid pDPT152 were grown in LB at 37?. When they reached mid-log phase, the cells were chilled, lysed, and assayed for (3-galactosidase activity according to the procedure of Miller (23). Plasmids derived from pCB192 are indicated at the left side of the Table. Plasmids derived from pDPT152 are indicated in parentheses across the top of the Table. The values reported are the average of two independent experiments. Relative activity is defined as the f3-galactosidase activity measured in cells harboring plasmids expressing cl divided by the activity measured in cells carrying only pDPT152. 7675 Nucleic Acids Research GATATCCAATCAGGAGTACC GCATCACCCAAGACGACCTG GATGATCTCACTGACACAAT CGAATATCTCATGGCCACTA ACCAGCCAGACTCACAATAAATGCA 105 v-- TtgAca TATAATG CTAATAAATCTATTATTTTC GTTGGATCCTTCTATAATGG TGGCCAACAACTCCCAGTGT AATCCGCTGTGAGTTGTTGG CCATGTCAATTCTGGAGGAGGATCA 210 b----- I I GGAGGtG ATG ATA AAT TAT GTC TAC GGC GAA CAA CTG TAC CAG GAG TTC GTC AGC TTC AGG GAT CTC TTT CTA AAA AAA GCT GTT GCA CGC GCC CAA 300 MET lIe Asn Tyr Vat Tyr Gly Glu Gin Leu Tyr Gin Gtu Phe Vat Ser Phe Arg Asp Leu Phe Leu Lys Lys Ala Val Ala Arg Ala Gtn tag(cl .55) CAC GTT GAT GCC GCC AGC GAC GGT CGT CCT GTT CGC CCG GTT GTC GTT CTG CCG TTC AM GM ACG GAC AGC ATT CAG GCT GMA ATT GAT 390 His Val Asp Ala Ala Ser Asp Gly Arg Pro Vat Arg Pro Vat Vat Vat Leu Pro Phe Lys Glu Thr Asp Ser lIe Gin Ala Glu lie Asp T A C A G AAA TGG ACA TTA ATG GCG CGG GAA CTG GAG CAG TAC CCA GAT CTC MT ATC CCA MG ACT ATT TTA TAT CCT GTA CCT AAC ATC CTT CGC 480 9 Lys Trp Thr Leu MET Ala Arg Glu Leu Gtu Gin Tyr Pro Asp Leu Asn lIe Pro Lys Thr lie Leu Tyr Pro Vat Pro Asn lIe Leu Arg A T C GGT GTG CGT AAG GTT ACG ACT TAT CAG ACA GAA GCA GTG MC AGC GTC AAT ATG ACC GCT GGC CGC ATT ATT CAT CTG ATT GAT AAG GAC 570 Gly Vat Arg Lys Vat Thr Thr Tyr Gin Thr Glu Ala Vat Asn Ser Vat Asn MET Thr Ala Gly Arg lIe lIe His Leu lIe Asp Lys Asp G ATT CGC ATC CAA AM AGC GCG GGG ATC MT GAG CAC AGT GCG AAA TAC ATA GAG MC CTG GAA GCA ACA AM GAG CTA ATG AAG CAG TAC 660 lle Arg lIe Gin Lys Ser Ala Gly lIe Asn Gtu His Ser Ala Lys Tyr lIe Gtu Asn Leu Gtu Ala Thr Lys Gtu Leu MET Lys Gin Tyr T T CCG GAG GAT GAA AAA TTC CGT ATG CGC GTA CAC GGC TTT AGC GAA ACA ATG CTG CGC GTC CAT TAC ATT TCC AGT AGC CCT AAC TAC AAT 750 Pro Glu Asp Glu Lys Phe Arg MET Arg Vat His Gly Phe Ser Gtu Thr MET Leu Arg Vat His Tyr lie Ser Ser Ser Pro Asn Tyr Asn Phe T C G T T I ~~~I I II GAT GGC MA TCA GTT AGT TAC CAT GTG CTG CTA TGT GGC GTG TTT ATC TGC GAT GM ACT CTC CGA GAT GGA ATC ATC ATC AAC GGT GAA 840 e.. Asp Gly Lys Ser Vat Ser Tyr His Vat Leu Leu Cys Gly Vat Phe lie Cys Asp Glu Thr Leu Arg Asp Gly lIe lie lIe Asn Gly Gtu Pro C tag(cl .169) TTT GAG AM GCA AAA TTT AGC CTT TAT GAC TCT ATA GM CCG ATC ATC TGC GAC CGC TGG CCG CAG GCA AM ATA TAT CGC CTG GCA GAT 930 Phe Gtu Lys Ala Lys Phe Ser Leu Tyr Asp Ser lIe Glu Pro lie lie Cys Asp Arg Trp Pro Gin Ala Lys lIe Tyr Arg Leu Ala Asp T ATT GM MT GTA AM AM CM ATT GCC ATC ACT CGC GM GAG AAA G GTC AM TCA GCC GCA TCA GTT ACG CGC AGC CGC AAA ACT AAG 1020 n----- lie Glu Asn Vat Lys Lys Gin lIe Ala lie Thr Arg Glu Glu Lys Lys Vat Lys Ser Ala Ala Ser Vat Thr Arg Ser Arg Lys Thr Lys AAG GGG CAG CCA GTA AAC GAC MC CCC GAA AGC GCG CM TAG Lys Gly Gin Pro Val Asn Asp Asn Pro Glu Ser Ala Gin ter Fig. 3. DNA sequence of PIcI and P7cl. The DNA sequence of PIcI is indicated. Positions where the sequence of P7cl differs from that of Plcl are indicated above the P1 sequence. The amino acid sequence predicted by the open reading frame is given below the sequence. The two amino acid substitutions present in P7cl are shown below the open reading frame. The locations of the amber mutant codons in cl.55 and ci. 169 are indicated by small letters above the sequence. Sites for selected restriction enzymes (EcoRV [v]; BamHI [b]; Bgll [g]; EcoRP [e]; and NruI [n]) are illustrated by dashed lines beneath the sequence. The cl repressor binding site is underlined. Inverted arrows beneath the sequence illustrate the inverted repeat sequence upstream of the open reading frame. Predicted promoter ribosome binding sites are indicated by the presence of the consensus sequences above and below the line, respectively. The DNA sequences of Plcl from bp 1-134 and bp 1-434 were reported previously (2,5). mutant cl genes from either P1 or P7 (Table 1). The efficiency with which a cloned P7cl gene complements a PlcI mutation confirms previous genetic studies indicating that these two genes are functionally interchangeable (9). The location of the 'y6 mutations that destroy cl-complementing activity suggests that the P7cl open reading frame occupies a map position similar to that of the P1 open reading frame (Figure 1). 7676 Nucleic Acids Research Proteins produced by fragments containing Plcl. As an initial step in the comparison of the P1 and P7 repressors, we analyzed the gene products expressed from the cloned cl regions. In an in vitro transcription-translation reaction, plasmids coding for the wildtpe alleles of either PIcI or P7cl direct the production of a protein with an estimated molecular weight of 33,000 daltons (Figure 2, Lanes C and D), a size that agrees closely with the predicted molecular weight of the PIcI repressor reported previously (3,28). The loss of the 33,000 dalton protein in the cl - 'ya-induced P7 mutant plasmids (Figure 2, Lanes E and F) is consistent with its designation as the P7cl repressor. As expected, the 33,000 dalton protein is not observed when reaction mixtures contain DNA from Plcl amber mutants (Figure 2, Lanes A and B). DNA sequence analysis of the cl genes. To make a direct comparison between the Plcl and P7cl DNA sequences and to predict the amino acid sequences of the repressor proteins, we carried out M 13-dideoxy sequence analysis of cloned fragments carrying the cl genes. The sequences of about 1 kb of P1 and P7 DNA were determined starting from a common EcoRV site predicted to lie approximately 200 bps upstream of the cl genes. The P1 and P7 sequences (Figure 3) both contain an ATG initiation codon preceded by a putative ribosome binding sequence (29) situated 211 bps downstream of the EcoRV site. In each case, the initiation codon is followed by an open reading reading frame extending for 283 codons. The P1 and P7 open reading frames code for proteins with predicted molecular weights (32,515 and 32,499 daltons, respectively) that agree closely with the values of the proteins expressed from the cloned DNA fragments (Figure 2) and with results predicted independently for the purified PIcI repressor (3-4). The localization of two PIcI amber mutations to the P1 open reading frame confirms its identification as the cI coding sequence. cI. 169 contains an amber mutation that would result in a protein fragment of 26,680 daltons, a value that agrees well with the size of a protein fragment observed under the in vitro transcription/translation reaction conditions (Figure 2, Lane B). The cl.55 amber mutation lies close to the N-terminal region of the protein, resulting in the production of a fragment of 55 amino acids that is apparently too small to resolve under the electrophoretic conditions used for separation of the proteins. Over 60% of the amino acid sequence predicted for the PIcI open reading frame has been verified by amino acid sequence analysis of peptide fragments isolated from the purified repressor protein (see accompanying paper, reference 3). The DNA sequences of P1 and P7 are identical for a 399-bp region that extends from the EcoRV site at the 5' side of the cl gene to a point 188 bps within the open reading frame. The sequences within the Plcl and the P7cl open reading frames differ at only 18 positions, all but two of which occur in the wobble position of the predicted codon. From these results, we conclude that the functional identity of the P1 and P7 cl genes is a consequence of their nearly identical amino acid sequence. Analysis of promoters upstream of the cl open reading frame. Expression of Plcl was shown previously to require sequences on the distal side of a BamHI site (2, 5) located about 100 bps upstream of the open reading frame (Figure 3). A binding site for the cl repressor has also been shown to exist close to this BamHI site (2, 5, 6). To determine whether this region contains a promoter that is detectable in vivo and, further, to determine whether this promoter can be regulated by cl repressor proteins from either P1 or P7, we introduced several DNA fragments from this region into the promoter probe vector pCB192, screened for promoter activity (as monitored by lacZ expression) and checked for repression of this activity in the presence of a compatible 7677 Nucleic Acids Research plasmid expressing Plcl or P7cl. Cells harboring pBCB2.13 (a plasmid which carries a 460 bp fragment of P1 DNA that extends across the BamHI site upstream of cl into the open reading frame) are dark blue in the presence of Xgal and produce significant levels of 3-galactosidase (Table 2). In contrast, pBCB2.16 and pBCB2.18 (which each contain DNA from only one side of the BamHI site located in pBCB2. 13) do not confer a blue color on their host cell in the presence of X-Gal and express negligible amounts of 3-galactosidase (Table 2). These observations suggest that expression from the promoter identified here requires sequences that span the BamHI site upstream of cl. Expression of cl from a compatible plasmid in the presence of pBCB2. 13 results in a 90% reduction in promoter strength (Table 2). This reduction is seen in the presence of either Plcl or P7cl, indicating that the two repressor proteins are both capable of repressing expression from this promoter. DISCUSSION. The DNA sequences of Plcl and P7cl differ at only 18 sites, all but two of which occur at the third position of the affected codon. This observation provides biochemical confirmation of the functional identity predicted on the basis of previous genetic analysis (9). A number of DNA binding proteins exhibit a common structural motif in which two helices are separated by a glycine residue (12). This motif is not observed in the predicted secondary structures (30) of the Plcl and P7cl amino acid sequences. A sequence with some similarity to the XCro helix-turn-helix region was previously reported near the Nterminus of the PIcI protein (5); however, it was noted that the potential for helix formation is disrupted by the presence of several prolines within the region. The secondary structure predicted for the Plcl and P7cl repressor proteins (30) does not reveal other structural characteristics (e.g., Zn fingers (31), leucine zippers (32), or helix-loop-helix motifs (33)) that have been associated with DNA binding activity in other systems. A search of the GenBank and EMBL databases does not reveal any other known regulatory proteins with significant amino acid similarity to the Plcl or the P7cl repressor sequences. Since the Plcl repressor differs from most other repressors in DNA binding specificity (i.e., in its recognition of an asymmetric operator sequence), it is not unexpected to find that the protein does not exhibit common structural motifs at the amino acid level. The cl-repressible promoter described in this report is located in a region just upstream of the cl open reading frame and is oriented in the direction of cl. Because the promoter is present on a multicopy plasmid, it is not possible to make a direct calculation of promoter strength; however, the values observed are about five-fold lower than the levels produced by a derivative of pCB192 that contains the plac promoter from pUC19 (34). Because sequences on both sides of the BamHI site located upstream of cl are required for promoter activity (Table 2), we suggest that the promoter spans this site. Less than 10 bps downstream of this BamHI site is a heptanucleotide sequence (TATAATG) that is identical to the -10 consensus sequence for RNA polymerase (35). If this sequence does indeed correspond to the -10 region of the promoter, the -35 region would be predicted to lie on the other side of the BamHI site in a region that overlaps a known cI repressor binding site (2-5). Analysis of this region does not reveal any sequences with significant similarity to the -35 consensus sequence. The best fit is the sequence TCTATT (Figure 3), which matches only two positions of the -35 consensus (TTGACA). The lack of a strong -35 region is often observed with genes that require an activator. Although a pentanucleotide sequence corresponding to the conserved portion of the CRP protein consensus binding site (36) 7678 Nucleic Acids Research is located just upstream of the predicted -35 region (at position 91; Figure 3), a role for CRP-mediated activation in cl expression has not previously been described. The orientation of the promoter and its cl-repressible character raise the possibility that cl expression is autoregulatory. If this is so, one potential activator would be the cl repressor itself. Expression cannot be absolutely dependent on cl-mediated activation, however, because the cloned promoter exhibits significant activity in the absence of the cl gene (Table 2). Under the conditions reported here, the presence of the cl gene results in a decrease rather than an increase in lacZ expression; however, these observations do not rule out a potential activator role for the cl protein, since the ratios of repressor and operator provided by the multicopy plasmids may not be optimal for activation. Physiologically, the role of additional repressor binding sites in regulating cl expression also cannot be discounted. Three potential operator sites have been identified several hundred bps upstream of the cI open reading frame (2-5); one or more of these could be involved (possibly through a DNA looping mechanism; 37) in the activation or repression of cl expression during phage growth. A cl-repressible promoter oriented in the direction of cl was previously reported (38) to be located entirely within PlBamHI-9, a fragment located upstream of cl which is bracketed by the BamHI site within pBCB2. 13. Because sequences on both sides of this BamHI site are required for the activity of the promoter in pBCB2.13, we suggest that the previously identified promoter is distinct from the one reported here. The promoter from BamHI-9 could correspond to a consensus promoter sequence that is situated about 500 bps upstream of cl and overlaps a cl repressor binding site (2). If so, cl expression is likely to be controlled by more than one promoter. Located between this promoter sequence and the promoter encoded on pBCB2. 13 is an open reading frame whose product (termed coi, or c-one inactivator) has been implicated in the establishment of lytic growth (1, 39; B.R. Baumstark, unpublished results). It has been suggested (2) that the decision to enter lytic or lysogenic growth is influenced by the level of transcription initiated from the distal promoter (which would transcribe coi prior to the transcription of cl) relative to that of the promoter located immediately upstream of the cl gene (which would transcribe only ci). A 32-nucleotide hyphenated inverted repeat sequence is located just upstream of the cl open reading frame (positions 146-188; Figure 3). It is not currently known whether this sequence has any regulatory effect on cl expression. Conceivably, the sequence could serve as a recognition site for an as-yet-unidentified regulatory protein. Alternatively, it may affect the secondary structure of the messenger RNA. A transcript extending from a promoter located upstream of the putative coi open reading frame would be capable of forming a stable stem-loop structure containing 16 bps with a single bp mismatch (AG = -33.6 Kcal) of this inverted repeat sequence. Such a structure could potentially serve as a recognition site for a regulatory factor or, alternatively, could mask such a site. On the other hand, transcription originating from the promoter spanning the BamHI site just upstream of cl would start at a site within the inverted repeat sequence, forming a comparatively less stable stem-loop structure of about 8 bps. The role of the inverted repeat region in the regulation of cl expression is currently under investigation. ACKNOWLEDGEMENTS We thank Heinz Schuster for his review of the manuscript. This work was supported by National Science Foundation grant DMB-8704146. 7679 Nucleic Acids Research Abbreviations: bp, basepairs; kb, kilobase pairs; X-Gal, 5-Bromo-4-Chloro-3-indolylbeta-D-galactopyranoside. *To whom correspondence should be addressed REFERENCES 1. Yarmolinsky, M.B., and Steinberg, N. (1988). In Calendar, R., (ed.), The Bacteriophages, Plenum Publishing Corp., NY, Vol. 1, pp. 291-438. 2. Baumstark, B.R., Stovall, S.R., and Ashkar, S. (1987). Virology 156, 404-413. 3. Dreiseikelmann, B., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 263, 1391-1397. 4. Heinrich, J., Riedel, H.-D., Baumstark, B.R., Kimura, M., and Schuster, H. (1989). Nucleic Acids Res, this volume. 5. Eliason, J.L., and Stemnberg, N. (1987). J. Mol. Biol. 198, 281-293. 6. Velleman, M., Dreiseikelmann, B., and Schuster, H. (1987). Proc. Natl. Acad. Sci. USA 84, 5570-5574. 7. Citron, M., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 264, 3611-3617. 8. Chadwick, P., Pirotta, V., Steinberg, R., Hopkins, N., and Ptashne, M. (1970). Cold Spring Harbor Symp. Quant. Biol. 35, 283-294. 9. Chesney, R.H., and Scott, J.R. (1975). Virology 67, 375-384. 10. Wandersman, C., and Yarmolinsky, M. (1977). Virology 78, 267-276. 11. Scott, J.R., West, B.W., and Laping, J.L. (1978). Virology 85, 587-600. 12. Pabo, C.O., and Sauer, R. A. (1984). Ann. Rev. Biochem. 53, 293-321. 13. Scott, J.R. (1974). Virology 62, 344-349. 14. Schneider, K., and Beck, C.F. (1987). Methods in Enzymol. 153, 452-461. 15. Smith, H.W. (1972). Nature New Biol. 238, 205-206. 16. Scott, J.R. (1975). Virology 65, 173-178. 17. Scott, J.R., Kropf, M.M., and Mendelson, L. (1977). Virology 76, 39-46. 18. Scott, J.R. (1968). Virology 36, 564-574. 19. Walker, D.H., Jr., and Walker, J.T. (1976). J. Virol. 20, 177-187. 20. Stemnberg, N. (1979). Virology 96, 129-142. 21. Schneider, K., and Beck, C.F. (1986). Gene 42, 37-48. 22. Taylor, D.P., and Cohen, S.N. (1979). J. Bacteriol. 137, 92-104. 23. Miller, J.H. (1972). In Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 352-355. 24. Guyer, R.S. (1978). J. Mol. Biol. 126, 347-365. 25. Devlin, B.H., Baumstark, B.R., and Scott, J.R. (1982). Virology 120, 360-375. 26. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). Proc. Natl. Acad. Sci. USA 74, 5463-5467. 27. DeVries, J.K., and Zubay, G. (1967). Proc. Natl. Acad. Sci. USA 57, 1010-1012. 28. Heilmann, H., Reeve, J.R., and Puhler, A. (1980). Mol. Gen. Genet. 178, 149-154. 29. Shine, J., and Dalgarno, L. (1974). Proc. Natl. Acad. Sci. USA 71, 1342-1346. 30. Chou, P.Y., and Fasman, G.D. (1978). Adv. Enzymol. 47, 45-148. 31. Berg, J.M. (1986). Nature 319, 264-265. 32. Landschultz, W.H., Johnson, P.F., and McKnight, S.L. (1988). Science 240, 1759-1764. 33. Murre, C., McCaw, P., and Baltimore, D. Cell 56, 777-783. 34. Anderson, B.E., Baumstark, B.R., and Bellini, W.J. (1988). J. Bacteriol. 170, 4493-4500. 35. Rosenberg, M., and Court, D. (1979). Annu. Rev. Genet. 13, 319-353. 36. Ebright, R.H., Cossart, P., Gicquel-Sanzey, B., and Beckwith, J. (1984). Nature 311, 232-235. 37. Ptashne, M. (1986). Nature 322, 697-701. 38. Stemnberg, N., and Hoess, R. (1983). Annu. Rev. Genet. 17, 123-154. 39. Scott, J.R. (1980). Curr. Top. Microbiol. Immunol. 90, 49-65. 7680 This article, submitted on disc, has been automatically converted into this typeset format by the publisher. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: species
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The c1 genes of P1 and P7. Abstract The c1 genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7c1 expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the P1c1 repressor. The c1 regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-turn-helix motif commonly associated with repressor proteins. Two P1c1 amber mutations were localized to the 283-amino acid open reading frame. The P1c1 and P7c1 sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the c1 gene from either phage cause the repression of transcription from a cloned promoter situated upstream of P1c1.Images Volme 7 Nmbe 19198 Nulei Acds eserc The cl genes of P1 and P7 Francis A.Osborne, Sonja R.Stovall and Barbara R.Baumstark* Department of Biology, Georgia State University, Atlanta, GA 30303, USA Received July 11, 1989; Revised and Accepted August 29, 1989 EMBL accession nos X16005, X16006 ABSTRACT The cl genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7cl expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the Plcl repressor. The cl regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-tum-helix motif commonly associated with repressor proteins. Two Plcl amber mutations were localized to the 283-amino acid open reading frame. The Plcl and P7cl sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the cI gene from either phage cause the repression of transcription from a cloned promoter situated upstream of Plcl. INTRODUCTION The cl genes of the plasmid prophages P1 and P7 code for repressor proteins that are required for the establishment and maintenance of lysogeny (reviewed in 1). A protein corresponding to the Plcl repressor has been isolated and shown to be a sequence-specific DNA binding protein that recognizes several widely dispersed sites on the phage DNA (2-7). The consensus DNA sequence recognized by the Plcl repressor (ATTTATTAGAGCA[A/T]T) contains no discernable bilateral symmetry, a feature that is highly unusual among prokaryotic operator sites. P1 and P7 are heteroimmune; that is, each phage is able to establish a lytic infection on a lysogen of the other phage. In this sense, their relationship is analogous to that of phage X and 434, which differ in the DNA specificity of their cI repressor proteins (8). However, genetic studies indicate that Plcl and P7cl can be crossed into the heterologous phage without affecting the immunity specificity of the recipient (9). The basis for P1/P7 heteroimmunity has been localized to a second regulatory gene, c4, that is unlinked to cl. The c4 gene products prevent the expression of antireb, a closely linked gene that interferes with cl-mediated repression (10, 11). According to current models, P1/P7 heteroimmunity results from the inability of the c4 repressor of one phage to prevent antireb expression from the heteroimmune phage genome (10, 11). Because the cl genes of P1 and P7 are genetically interchangeable, it is anticipated that the two gene products carry out similar or identical regulatory functions. The studies presented in this paper were undertaken to investigate the biochemical basis for the apparent genetic identity of the two cl genes. In this paper, we present the DNA sequence of the cl genes of P1 and P7 and the predicted amino acid sequence of the cl repressor proteins. We report that Plcl and P7cl code for proteins of identical size (283 amino acids) and Nucleic Acids Research Volume 17 Number 19 1989 767 1 (r IRL Press Nucleic Acids Research nearly identical sequence. We report further that both repressors prevent the expression of a promoter located immediately upstream of the Plc 1 open reading frame, an observation that confirms their functional similarity and suggests an autoregulatory role for the two proteins. Analysis of the secondary structure predicted by the open reading frames does not reveal the characteristic helix-turn-helix (12) or other motifs commonly associated with DNA binding proteins. MATERIALS AND METHODS Bacterial and phage strains. E. coli K336 is a SuO derivative of K140 (13). E. coli CB454 is a recA-, lacZderivative of K-12 (14). P1 + is described by Scott (13). P7+ is the strain of Smith (15), as described by Scott (16). P7cl. 1 contains a missense mutation in the cl gene (17). The P7 phage strains and the cl amber mutant phage strains PIci .245Cm, Plc1. 169 and P Ic .55 (11) were generously provided by June Scott. Enzymes and reagents. Restriction enzymes, T4 DNA ligase and polymerase, and the Klenow fragment of E. coli DNA polymerase were purchased from Boehringer Biochemicals or New England Biolabs and reactions were carried out according to the manufacturers' instructions. DNA sequencing kits and in vitro transcription-translation kits were purchased from Bethesda Research Laboratories and Amersham Corporation, respectively. Synthetic oligonucleotides to be used as sequencing primers were prepared on an Applied Biosystems DNA synthesizer. Plasmid construction. pBRB7.2. pBRB7.2 (2) contains a 3.2 kb EcoRI/PvuII fragment from the cl region of P1 (Figure 1) inserted into the 2.3 kb EcoRIlPvuII fragment of pBR322 that contains the origin of replication and the f3-lactamase gene. pFA02. P7 plasmid DNA was digested with PvuII, ligated to similarly digested pBR322, and transformed into E. coli K336. Ampicillin-resistant colonies were screened for cl activity by cross-streak complementation analysis against P7cl.1 (18). pFAO2 contains a 3.5 kb insert of P7 DNA. The fragment was localized to the cl region of the P7 genome by Southern hybridization against P1 and P7 DNA that had been digested with BamHI and BglII (data not shown). pBRBJ69. 1 and pBRB55. 1. The PI cI open reading frame was previously localized to a 2.6 kb EcoRlIBamHI fragment derived from PlEcoRI-7 (2). This fragment also contains the wildtype allele for the conditional lethal mutation am43 (19, 20). To clone the cl reading frame from the amber mutant phage Plc1.169 and P Ic .55, we digested phage DNA with EcoRI and BamHI, ligated the digestion products into similarly digested pBR322, and transformed the ligation mixture into E. coli K336. Ampicillin-resistant, tetracyclinesensitive colonies were screened by cross-streak complementation analysis for their ability to support the growth of Plam43. Plasmid DNA isolated from complementation-positive cells was shown by agarose gel electrophoresis to carry plasmids containing the 2.6 kb EcoRIlBamHI fragment from the cl region. The cl mutant open reading frames were placed under the control of normal regulatory signals present in the cI region by digesting the cl.55 and cl. 169-containing plasmids with BamHI and PvuII and inserting a 601 bp BamHI/PvuH fragment containing the cl promoter region (2). The resulting plasmids, pBRB55.1 and pBRB169.1, respectively, contain the 3.2 kb EcoRllPvuIl fragment analogous to that present in pBRB7.2 (Figure 1). pBCB2. 13-2.18. To identify cl-repressible promoters, we introduced selected fragments 7672 Nucleic Acids Research 4 f - - + I 4 P1 4- 4- 4 ECAR H C B R P 4 4.4,~ 4, 1 1 4. I 4, I 11 t t t t t E G R N E B R P 4 4 - 4 1 ' '110z I I I I I I 1 3.2 1.5 1.0 0.5 0 P7 pBRB7.2 -------------------cl1------------- r ~ / >' pFAO2 *-lacZ pBCB2.13 <-lacZ Z pBCB2.16 <-lacZX pBCB2.18 Fig. 1. The cl regions of P1 and P7. A restriction map is indicated by the solid line in the upper part of the figure. Sites for EcoRI (E), Pvul (P), NnrI (N), Bgll (G), BamHI (B), and EcoRV (R) are shown. The sequencing strategy is indicated by the horizontal arrows. Letters and arrows above and below the map refer to sites and sequence analysis for P1 and P7, respectively. The size of this region (in kilobase pairs) is indicated below the map. The DNA fragments present in selected plasmids are illustrated by boxes at the bottom of the figure. The dashed line reveals the approximate position of the cl gene (2). The sites of the -yb mutations introduced into pFA02 are indicated by asterisks. pFA02.16 and pFA02.26 contain insertions located 0.9 kb and 1.4 kb, respectively, from the PvuIl site at the left side of the map. The direction of the lacZ open reading frame in pBCB2.13-18 is indicated by the adjacent arrow. from the cI region of P1 into pCB192, a promoter-probe vector containing promoterless copies of lacZ and galK extending in opposite directions from a multiple cloning site (21). The source of P1 DNA for these constructions was pZHA3, a derivative of pBRB7.2 that contains a HindIlI linker at the single EcoRV site located about 200 bps upstream of the cl open reading frame (Figure 1). pBCB2.13 contains a 460 bp fragment of P1 DNA extending from the EcoRV site to a Bgll site within the cI open reading frame. pBCB2. 16 contains a 130 bp fragment extending from the EcoRV site to a BamHI site located about 100 bps upstream of the cl open reading frame, while pBCB2.18 contains the region extending from this BamHI site to the Bglll site within the open reading frame (Figure 1). The orientation of the P1 DNA fragments within these plasmids was confirmed by restriction mapping and DNA sequencing. To test for the regulation of promoter expression by cl, we transformed pBCB2.13 and its derivatives into CB454(pBRB7.152) and CB454(pFAO2.152), two strains that express P7cl and Pll, respectively, from the pCB192-compatible kanamycin-resistant vector pDPT152 (22). Cells harboring both plasmids were selected by their resistance to both ampicillin and kanamycin. lacZ expression was measured by the procedure of Miller (23). pBRB7.152 was generated by introducing PlEcoRI-7 into pDPT152. pBRB7.152 has sustained a spontaneous deletion within the EcoRI-7 fragment that results in the loss of 2.5 kb of P1 DNA from the far left side of the P1 genetic map, but retains the 3.2 kb PvuHlEcoRI fragment required for cl expression that is present in pBRB7.2 (Figure 1). 7673 z I 011Z I e., Nucleic Acids Research Table 1. Complementation of PIci .245 by plasmids that contain cI genes. Phenotype Efficiency Relative of of Efficiency of Plasmid cI gene Lysogeny Lysogeny pBR322 1.5x 10-6 6.0x 10-6 pBRB7.2 Plcl+ 2.5 x 10-' 1.0 pBRB55.1 Plcl-am 1.4 x 10-6 5.6 x 10-6 pBRB169.1 PlCl-am 2.1 x 10-6 8.4 x 10-6 pFAO2 P7cl+ 8.7 x 10-2 0.35 pFAO2.16 P7c I-, 4.7 x 10-6 1.9 X 10-5 pFAO2.26 P7cI -1 3.1 x 10-6 1.2 x 10-5 Complementation for lysogeny was carried out as described by Devlin et al. (26). The plasmids were carried by E. coli K336. Cells were grown to mid-log phase at 370 in LB containing 50 tig/m1 sodium ampicillin and infected with Plcl.245 at a multiplicity of infection of 5 in the presence of 50 mM CaC12. After 10 minutes, non-absorbed phage were removed by centrifugation and the infection was allowed to proceed for 2 hours at 370. The infected cells were plated on LB plates containing 50 pLg/ml sodium ampicillin, 50 pLg/ml chloramphenicol, and 40 mM sodium citrate. The efficiency of lysogeny is defined as the number of ApRCmR cells at the end of infection divided by the number of ApR cells present at the start of the infection. To construct pFA02.152, we introduced a 2.8 kb EcoRV fragment of P7 DNA containing the cl gene (Figure 1) into the single EcoRI site of pDPT152 after it had been rendered blunt-ended by extension with T4 DNA polymerase. cl expression by cells harboring either pBRB7.152 or pFA02.152 was confirmed by measuring their ability to form chloramphenicol-resistant lysogens when infected with Plcl.245Cm. ,yb insertional mutagenesis. Insertional mutagenesis of P7cl was carried out using the 'yb transposon of F (24) as described by Devlin et al. (25). E. coli W1485(pFA02) was mated with the F- strain MX648 and subsequently plated on ampicillin (to select for the plasmid) and streptomycin sulfate (to select for the recipient strain). Transconjugants which could support only lytic growth upon infection by P7cl .1 (as scored by cross-streak analysis; 18) were assumed to have lost cl-complementing activity and were characterized further. The positions of two cl - insertional mutations, carried by pFA02.16 and pFA02.26, were identified by restriction mapping (Figure 1). DNA sequencing. DNA sequence analysis was carried out using the M13-dideoxy technique of Sanger et al. (26). Selected DNA fragments containing the cl wildtype or mutant genes were introduced into M13 mp8 or mp9. 18-nucleotide oligomers complementary to defined sequences within the cl gene were extended using the Klenow fragment of DNA polymerase in the presence of dideoxynucleotide triphosphates and analyzed by polyacrylamide-urea gel electrophoresis. The sequencing strategy is shown in Figure 1. RESULTS Localization of the P7cJ gene. Initial localization of the P7cl gene was undertaken by subjecting pFA02 to 'yb mutagenesis and determining the map position of inserts which destroy the ability of the plasmids to complement a P7cl - mutation (as determined by cross-streak analysis). pFA02 and the -yb insertion mutants were tested further by comparing their ability to complement a PIcI amber mutation with the complementation activity of plasmids containing cl genes isolated 7674 Nucleic Acids Research B C D E F G *.4 68 43 29- _ - =I = Am~ W _ 18 14 p Fig. 2. In vitro transcription-translation of plasmids carrying the cl region of P1 and P7. Proteins encoded by selected plasmids were labeled with 35S methionine according to the procedure of DeVries and Zubay (27), using a commercial in vitro transcription/tramnslation kit from Amersham Corporation. The reaction mixtures were subjected to electrophoresis on a 12.5% SDS-polyacrylamide gel and the labeled proteins were visualized by autoradiography. The migration of 14C-labeled protein molecular weight standards (Bethesda Research Laboratories) is indicated at the left side of the figure. Plasmids present in each lane are: A. pBRB55.1; B. pBRB169.1; C. pBRB7.2; D. pFAO2; E. pFAO2.16; F. pFAO2.26; G. pBR322. from P1 wildtype and amber mutants. Lysogeny by cells infected with Plcl.245Cm was scored as the growth of infected cells on ampicillin (to select for the resident plasmid) and chloramphenicol (to select for the phage genome). The values observed for the two plasmids containing Plcl and P7cl (pBRB7.2 and pFA02, respectively) are very similar and significantly higher than those obtained for pBR322 or for any of the plasmids carrying Table 2. Assay for lacZ expression from plasmids containing P1 DNA fragments. ,3-galactosidase activity (units) minus cI plus Pici plus P7cl relative activity (pDPT152) (pBB7. 152) (pFA02.152) +PICJ +P7cJ pCB192 0.58 0.55 0.54 0.95 0.93 pBCB2.13 154 15.2 13.6 0.10 0.09 pBCB2.16 1.1 1.2 1.1 1.1 1.0 pBCB2.18 4.0 3.4 3.9 0.9 1.0 Cells containing derivatives of the ApR promoter-probe plasmid pCB192 and the compatible KnR plasmid pDPT152 were grown in LB at 37?. When they reached mid-log phase, the cells were chilled, lysed, and assayed for (3-galactosidase activity according to the procedure of Miller (23). Plasmids derived from pCB192 are indicated at the left side of the Table. Plasmids derived from pDPT152 are indicated in parentheses across the top of the Table. The values reported are the average of two independent experiments. Relative activity is defined as the f3-galactosidase activity measured in cells harboring plasmids expressing cl divided by the activity measured in cells carrying only pDPT152. 7675 Nucleic Acids Research GATATCCAATCAGGAGTACC GCATCACCCAAGACGACCTG GATGATCTCACTGACACAAT CGAATATCTCATGGCCACTA ACCAGCCAGACTCACAATAAATGCA 105 v-- TtgAca TATAATG CTAATAAATCTATTATTTTC GTTGGATCCTTCTATAATGG TGGCCAACAACTCCCAGTGT AATCCGCTGTGAGTTGTTGG CCATGTCAATTCTGGAGGAGGATCA 210 b----- I I GGAGGtG ATG ATA AAT TAT GTC TAC GGC GAA CAA CTG TAC CAG GAG TTC GTC AGC TTC AGG GAT CTC TTT CTA AAA AAA GCT GTT GCA CGC GCC CAA 300 MET lIe Asn Tyr Vat Tyr Gly Glu Gin Leu Tyr Gin Gtu Phe Vat Ser Phe Arg Asp Leu Phe Leu Lys Lys Ala Val Ala Arg Ala Gtn tag(cl .55) CAC GTT GAT GCC GCC AGC GAC GGT CGT CCT GTT CGC CCG GTT GTC GTT CTG CCG TTC AM GM ACG GAC AGC ATT CAG GCT GMA ATT GAT 390 His Val Asp Ala Ala Ser Asp Gly Arg Pro Vat Arg Pro Vat Vat Vat Leu Pro Phe Lys Glu Thr Asp Ser lIe Gin Ala Glu lie Asp T A C A G AAA TGG ACA TTA ATG GCG CGG GAA CTG GAG CAG TAC CCA GAT CTC MT ATC CCA MG ACT ATT TTA TAT CCT GTA CCT AAC ATC CTT CGC 480 9 Lys Trp Thr Leu MET Ala Arg Glu Leu Gtu Gin Tyr Pro Asp Leu Asn lIe Pro Lys Thr lie Leu Tyr Pro Vat Pro Asn lIe Leu Arg A T C GGT GTG CGT AAG GTT ACG ACT TAT CAG ACA GAA GCA GTG MC AGC GTC AAT ATG ACC GCT GGC CGC ATT ATT CAT CTG ATT GAT AAG GAC 570 Gly Vat Arg Lys Vat Thr Thr Tyr Gin Thr Glu Ala Vat Asn Ser Vat Asn MET Thr Ala Gly Arg lIe lIe His Leu lIe Asp Lys Asp G ATT CGC ATC CAA AM AGC GCG GGG ATC MT GAG CAC AGT GCG AAA TAC ATA GAG MC CTG GAA GCA ACA AM GAG CTA ATG AAG CAG TAC 660 lle Arg lIe Gin Lys Ser Ala Gly lIe Asn Gtu His Ser Ala Lys Tyr lIe Gtu Asn Leu Gtu Ala Thr Lys Gtu Leu MET Lys Gin Tyr T T CCG GAG GAT GAA AAA TTC CGT ATG CGC GTA CAC GGC TTT AGC GAA ACA ATG CTG CGC GTC CAT TAC ATT TCC AGT AGC CCT AAC TAC AAT 750 Pro Glu Asp Glu Lys Phe Arg MET Arg Vat His Gly Phe Ser Gtu Thr MET Leu Arg Vat His Tyr lie Ser Ser Ser Pro Asn Tyr Asn Phe T C G T T I ~~~I I II GAT GGC MA TCA GTT AGT TAC CAT GTG CTG CTA TGT GGC GTG TTT ATC TGC GAT GM ACT CTC CGA GAT GGA ATC ATC ATC AAC GGT GAA 840 e.. Asp Gly Lys Ser Vat Ser Tyr His Vat Leu Leu Cys Gly Vat Phe lie Cys Asp Glu Thr Leu Arg Asp Gly lIe lie lIe Asn Gly Gtu Pro C tag(cl .169) TTT GAG AM GCA AAA TTT AGC CTT TAT GAC TCT ATA GM CCG ATC ATC TGC GAC CGC TGG CCG CAG GCA AM ATA TAT CGC CTG GCA GAT 930 Phe Gtu Lys Ala Lys Phe Ser Leu Tyr Asp Ser lIe Glu Pro lie lie Cys Asp Arg Trp Pro Gin Ala Lys lIe Tyr Arg Leu Ala Asp T ATT GM MT GTA AM AM CM ATT GCC ATC ACT CGC GM GAG AAA G GTC AM TCA GCC GCA TCA GTT ACG CGC AGC CGC AAA ACT AAG 1020 n----- lie Glu Asn Vat Lys Lys Gin lIe Ala lie Thr Arg Glu Glu Lys Lys Vat Lys Ser Ala Ala Ser Vat Thr Arg Ser Arg Lys Thr Lys AAG GGG CAG CCA GTA AAC GAC MC CCC GAA AGC GCG CM TAG Lys Gly Gin Pro Val Asn Asp Asn Pro Glu Ser Ala Gin ter Fig. 3. DNA sequence of PIcI and P7cl. The DNA sequence of PIcI is indicated. Positions where the sequence of P7cl differs from that of Plcl are indicated above the P1 sequence. The amino acid sequence predicted by the open reading frame is given below the sequence. The two amino acid substitutions present in P7cl are shown below the open reading frame. The locations of the amber mutant codons in cl.55 and ci. 169 are indicated by small letters above the sequence. Sites for selected restriction enzymes (EcoRV [v]; BamHI [b]; Bgll [g]; EcoRP [e]; and NruI [n]) are illustrated by dashed lines beneath the sequence. The cl repressor binding site is underlined. Inverted arrows beneath the sequence illustrate the inverted repeat sequence upstream of the open reading frame. Predicted promoter ribosome binding sites are indicated by the presence of the consensus sequences above and below the line, respectively. The DNA sequences of Plcl from bp 1-134 and bp 1-434 were reported previously (2,5). mutant cl genes from either P1 or P7 (Table 1). The efficiency with which a cloned P7cl gene complements a PlcI mutation confirms previous genetic studies indicating that these two genes are functionally interchangeable (9). The location of the 'y6 mutations that destroy cl-complementing activity suggests that the P7cl open reading frame occupies a map position similar to that of the P1 open reading frame (Figure 1). 7676 Nucleic Acids Research Proteins produced by fragments containing Plcl. As an initial step in the comparison of the P1 and P7 repressors, we analyzed the gene products expressed from the cloned cl regions. In an in vitro transcription-translation reaction, plasmids coding for the wildtpe alleles of either PIcI or P7cl direct the production of a protein with an estimated molecular weight of 33,000 daltons (Figure 2, Lanes C and D), a size that agrees closely with the predicted molecular weight of the PIcI repressor reported previously (3,28). The loss of the 33,000 dalton protein in the cl - 'ya-induced P7 mutant plasmids (Figure 2, Lanes E and F) is consistent with its designation as the P7cl repressor. As expected, the 33,000 dalton protein is not observed when reaction mixtures contain DNA from Plcl amber mutants (Figure 2, Lanes A and B). DNA sequence analysis of the cl genes. To make a direct comparison between the Plcl and P7cl DNA sequences and to predict the amino acid sequences of the repressor proteins, we carried out M 13-dideoxy sequence analysis of cloned fragments carrying the cl genes. The sequences of about 1 kb of P1 and P7 DNA were determined starting from a common EcoRV site predicted to lie approximately 200 bps upstream of the cl genes. The P1 and P7 sequences (Figure 3) both contain an ATG initiation codon preceded by a putative ribosome binding sequence (29) situated 211 bps downstream of the EcoRV site. In each case, the initiation codon is followed by an open reading reading frame extending for 283 codons. The P1 and P7 open reading frames code for proteins with predicted molecular weights (32,515 and 32,499 daltons, respectively) that agree closely with the values of the proteins expressed from the cloned DNA fragments (Figure 2) and with results predicted independently for the purified PIcI repressor (3-4). The localization of two PIcI amber mutations to the P1 open reading frame confirms its identification as the cI coding sequence. cI. 169 contains an amber mutation that would result in a protein fragment of 26,680 daltons, a value that agrees well with the size of a protein fragment observed under the in vitro transcription/translation reaction conditions (Figure 2, Lane B). The cl.55 amber mutation lies close to the N-terminal region of the protein, resulting in the production of a fragment of 55 amino acids that is apparently too small to resolve under the electrophoretic conditions used for separation of the proteins. Over 60% of the amino acid sequence predicted for the PIcI open reading frame has been verified by amino acid sequence analysis of peptide fragments isolated from the purified repressor protein (see accompanying paper, reference 3). The DNA sequences of P1 and P7 are identical for a 399-bp region that extends from the EcoRV site at the 5' side of the cl gene to a point 188 bps within the open reading frame. The sequences within the Plcl and the P7cl open reading frames differ at only 18 positions, all but two of which occur in the wobble position of the predicted codon. From these results, we conclude that the functional identity of the P1 and P7 cl genes is a consequence of their nearly identical amino acid sequence. Analysis of promoters upstream of the cl open reading frame. Expression of Plcl was shown previously to require sequences on the distal side of a BamHI site (2, 5) located about 100 bps upstream of the open reading frame (Figure 3). A binding site for the cl repressor has also been shown to exist close to this BamHI site (2, 5, 6). To determine whether this region contains a promoter that is detectable in vivo and, further, to determine whether this promoter can be regulated by cl repressor proteins from either P1 or P7, we introduced several DNA fragments from this region into the promoter probe vector pCB192, screened for promoter activity (as monitored by lacZ expression) and checked for repression of this activity in the presence of a compatible 7677 Nucleic Acids Research plasmid expressing Plcl or P7cl. Cells harboring pBCB2.13 (a plasmid which carries a 460 bp fragment of P1 DNA that extends across the BamHI site upstream of cl into the open reading frame) are dark blue in the presence of Xgal and produce significant levels of 3-galactosidase (Table 2). In contrast, pBCB2.16 and pBCB2.18 (which each contain DNA from only one side of the BamHI site located in pBCB2. 13) do not confer a blue color on their host cell in the presence of X-Gal and express negligible amounts of 3-galactosidase (Table 2). These observations suggest that expression from the promoter identified here requires sequences that span the BamHI site upstream of cl. Expression of cl from a compatible plasmid in the presence of pBCB2. 13 results in a 90% reduction in promoter strength (Table 2). This reduction is seen in the presence of either Plcl or P7cl, indicating that the two repressor proteins are both capable of repressing expression from this promoter. DISCUSSION. The DNA sequences of Plcl and P7cl differ at only 18 sites, all but two of which occur at the third position of the affected codon. This observation provides biochemical confirmation of the functional identity predicted on the basis of previous genetic analysis (9). A number of DNA binding proteins exhibit a common structural motif in which two helices are separated by a glycine residue (12). This motif is not observed in the predicted secondary structures (30) of the Plcl and P7cl amino acid sequences. A sequence with some similarity to the XCro helix-turn-helix region was previously reported near the Nterminus of the PIcI protein (5); however, it was noted that the potential for helix formation is disrupted by the presence of several prolines within the region. The secondary structure predicted for the Plcl and P7cl repressor proteins (30) does not reveal other structural characteristics (e.g., Zn fingers (31), leucine zippers (32), or helix-loop-helix motifs (33)) that have been associated with DNA binding activity in other systems. A search of the GenBank and EMBL databases does not reveal any other known regulatory proteins with significant amino acid similarity to the Plcl or the P7cl repressor sequences. Since the Plcl repressor differs from most other repressors in DNA binding specificity (i.e., in its recognition of an asymmetric operator sequence), it is not unexpected to find that the protein does not exhibit common structural motifs at the amino acid level. The cl-repressible promoter described in this report is located in a region just upstream of the cl open reading frame and is oriented in the direction of cl. Because the promoter is present on a multicopy plasmid, it is not possible to make a direct calculation of promoter strength; however, the values observed are about five-fold lower than the levels produced by a derivative of pCB192 that contains the plac promoter from pUC19 (34). Because sequences on both sides of the BamHI site located upstream of cl are required for promoter activity (Table 2), we suggest that the promoter spans this site. Less than 10 bps downstream of this BamHI site is a heptanucleotide sequence (TATAATG) that is identical to the -10 consensus sequence for RNA polymerase (35). If this sequence does indeed correspond to the -10 region of the promoter, the -35 region would be predicted to lie on the other side of the BamHI site in a region that overlaps a known cI repressor binding site (2-5). Analysis of this region does not reveal any sequences with significant similarity to the -35 consensus sequence. The best fit is the sequence TCTATT (Figure 3), which matches only two positions of the -35 consensus (TTGACA). The lack of a strong -35 region is often observed with genes that require an activator. Although a pentanucleotide sequence corresponding to the conserved portion of the CRP protein consensus binding site (36) 7678 Nucleic Acids Research is located just upstream of the predicted -35 region (at position 91; Figure 3), a role for CRP-mediated activation in cl expression has not previously been described. The orientation of the promoter and its cl-repressible character raise the possibility that cl expression is autoregulatory. If this is so, one potential activator would be the cl repressor itself. Expression cannot be absolutely dependent on cl-mediated activation, however, because the cloned promoter exhibits significant activity in the absence of the cl gene (Table 2). Under the conditions reported here, the presence of the cl gene results in a decrease rather than an increase in lacZ expression; however, these observations do not rule out a potential activator role for the cl protein, since the ratios of repressor and operator provided by the multicopy plasmids may not be optimal for activation. Physiologically, the role of additional repressor binding sites in regulating cl expression also cannot be discounted. Three potential operator sites have been identified several hundred bps upstream of the cI open reading frame (2-5); one or more of these could be involved (possibly through a DNA looping mechanism; 37) in the activation or repression of cl expression during phage growth. A cl-repressible promoter oriented in the direction of cl was previously reported (38) to be located entirely within PlBamHI-9, a fragment located upstream of cl which is bracketed by the BamHI site within pBCB2. 13. Because sequences on both sides of this BamHI site are required for the activity of the promoter in pBCB2.13, we suggest that the previously identified promoter is distinct from the one reported here. The promoter from BamHI-9 could correspond to a consensus promoter sequence that is situated about 500 bps upstream of cl and overlaps a cl repressor binding site (2). If so, cl expression is likely to be controlled by more than one promoter. Located between this promoter sequence and the promoter encoded on pBCB2. 13 is an open reading frame whose product (termed coi, or c-one inactivator) has been implicated in the establishment of lytic growth (1, 39; B.R. Baumstark, unpublished results). It has been suggested (2) that the decision to enter lytic or lysogenic growth is influenced by the level of transcription initiated from the distal promoter (which would transcribe coi prior to the transcription of cl) relative to that of the promoter located immediately upstream of the cl gene (which would transcribe only ci). A 32-nucleotide hyphenated inverted repeat sequence is located just upstream of the cl open reading frame (positions 146-188; Figure 3). It is not currently known whether this sequence has any regulatory effect on cl expression. Conceivably, the sequence could serve as a recognition site for an as-yet-unidentified regulatory protein. Alternatively, it may affect the secondary structure of the messenger RNA. A transcript extending from a promoter located upstream of the putative coi open reading frame would be capable of forming a stable stem-loop structure containing 16 bps with a single bp mismatch (AG = -33.6 Kcal) of this inverted repeat sequence. Such a structure could potentially serve as a recognition site for a regulatory factor or, alternatively, could mask such a site. On the other hand, transcription originating from the promoter spanning the BamHI site just upstream of cl would start at a site within the inverted repeat sequence, forming a comparatively less stable stem-loop structure of about 8 bps. The role of the inverted repeat region in the regulation of cl expression is currently under investigation. ACKNOWLEDGEMENTS We thank Heinz Schuster for his review of the manuscript. This work was supported by National Science Foundation grant DMB-8704146. 7679 Nucleic Acids Research Abbreviations: bp, basepairs; kb, kilobase pairs; X-Gal, 5-Bromo-4-Chloro-3-indolylbeta-D-galactopyranoside. *To whom correspondence should be addressed REFERENCES 1. Yarmolinsky, M.B., and Steinberg, N. (1988). In Calendar, R., (ed.), The Bacteriophages, Plenum Publishing Corp., NY, Vol. 1, pp. 291-438. 2. Baumstark, B.R., Stovall, S.R., and Ashkar, S. (1987). Virology 156, 404-413. 3. Dreiseikelmann, B., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 263, 1391-1397. 4. Heinrich, J., Riedel, H.-D., Baumstark, B.R., Kimura, M., and Schuster, H. (1989). Nucleic Acids Res, this volume. 5. Eliason, J.L., and Stemnberg, N. (1987). J. Mol. Biol. 198, 281-293. 6. Velleman, M., Dreiseikelmann, B., and Schuster, H. (1987). Proc. Natl. Acad. Sci. USA 84, 5570-5574. 7. Citron, M., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 264, 3611-3617. 8. Chadwick, P., Pirotta, V., Steinberg, R., Hopkins, N., and Ptashne, M. (1970). Cold Spring Harbor Symp. Quant. Biol. 35, 283-294. 9. Chesney, R.H., and Scott, J.R. (1975). Virology 67, 375-384. 10. Wandersman, C., and Yarmolinsky, M. (1977). Virology 78, 267-276. 11. Scott, J.R., West, B.W., and Laping, J.L. (1978). Virology 85, 587-600. 12. Pabo, C.O., and Sauer, R. A. (1984). Ann. Rev. Biochem. 53, 293-321. 13. Scott, J.R. (1974). Virology 62, 344-349. 14. Schneider, K., and Beck, C.F. (1987). Methods in Enzymol. 153, 452-461. 15. Smith, H.W. (1972). Nature New Biol. 238, 205-206. 16. Scott, J.R. (1975). Virology 65, 173-178. 17. Scott, J.R., Kropf, M.M., and Mendelson, L. (1977). Virology 76, 39-46. 18. Scott, J.R. (1968). Virology 36, 564-574. 19. Walker, D.H., Jr., and Walker, J.T. (1976). J. Virol. 20, 177-187. 20. Stemnberg, N. (1979). Virology 96, 129-142. 21. Schneider, K., and Beck, C.F. (1986). Gene 42, 37-48. 22. Taylor, D.P., and Cohen, S.N. (1979). J. Bacteriol. 137, 92-104. 23. Miller, J.H. (1972). In Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 352-355. 24. Guyer, R.S. (1978). J. Mol. Biol. 126, 347-365. 25. Devlin, B.H., Baumstark, B.R., and Scott, J.R. (1982). Virology 120, 360-375. 26. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). Proc. Natl. Acad. Sci. USA 74, 5463-5467. 27. DeVries, J.K., and Zubay, G. (1967). Proc. Natl. Acad. Sci. USA 57, 1010-1012. 28. Heilmann, H., Reeve, J.R., and Puhler, A. (1980). Mol. Gen. Genet. 178, 149-154. 29. Shine, J., and Dalgarno, L. (1974). Proc. Natl. Acad. Sci. USA 71, 1342-1346. 30. Chou, P.Y., and Fasman, G.D. (1978). Adv. Enzymol. 47, 45-148. 31. Berg, J.M. (1986). Nature 319, 264-265. 32. Landschultz, W.H., Johnson, P.F., and McKnight, S.L. (1988). Science 240, 1759-1764. 33. Murre, C., McCaw, P., and Baltimore, D. Cell 56, 777-783. 34. Anderson, B.E., Baumstark, B.R., and Bellini, W.J. (1988). J. Bacteriol. 170, 4493-4500. 35. Rosenberg, M., and Court, D. (1979). Annu. Rev. Genet. 13, 319-353. 36. Ebright, R.H., Cossart, P., Gicquel-Sanzey, B., and Beckwith, J. (1984). Nature 311, 232-235. 37. Ptashne, M. (1986). Nature 322, 697-701. 38. Stemnberg, N., and Hoess, R. (1983). Annu. Rev. Genet. 17, 123-154. 39. Scott, J.R. (1980). Curr. Top. Microbiol. Immunol. 90, 49-65. 7680 This article, submitted on disc, has been automatically converted into this typeset format by the publisher.
[ "The", "c1", "genes", "of", "P1", "and", "P7", ".", "\n", "Abstract", "\n", "The", "c1", "genes", "of", "the", "heteroimmune", "phages", "P1", "and", "P7", "were", "sequenced", "and", "their", "products", "were", "compared", ".", "P7c1", "expression", "was", "correlated", "with", "the", "translation", "in", "vitro", "of", "a", "protein", "whose", "predicted", "molecular", "weight", "(", "33,000", "daltons", ")", "is", "indistinguishable", "from", "that", "of", "the", "P1c1", "repressor", ".", "The", "c1", "regions", "from", "both", "P1", "and", "P7", "were", "found", "to", "contain", "open", "reading", "frames", "capable", "of", "coding", "for", "a", "283-amino", "acid", "protein", "whose", "predicted", "secondary", "structure", "lacks", "the", "helix", "-", "turn", "-", "helix", "motif", "commonly", "associated", "with", "repressor", "proteins", ".", "Two", "P1c1", "amber", "mutations", "were", "localized", "to", "the", "283-amino", "acid", "open", "reading", "frame", ".", "The", "P1c1", "and", "P7c1", "sequences", "were", "found", "to", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "alter", "the", "third", "position", "of", "the", "affected", "codon", "and", "do", "not", "alter", "the", "amino", "acid", "sequence", "of", "the", "protein", ".", "Plasmids", "expressing", "the", "c1", "gene", "from", "either", "phage", "cause", "the", "repression", "of", "transcription", "from", "a", "cloned", "promoter", "situated", "upstream", "of", "P1c1.Images", "\n\n\n\n\n\n\n ", "Volme", "7", "Nmbe", "19198", " ", "Nulei", "Acds", " ", "eserc", "\n\n ", "The", "cl", "genes", "of", "P1", "and", "P7", "\n\n ", "Francis", "A.Osborne", ",", "Sonja", "R.Stovall", "and", "Barbara", "R.Baumstark", "*", "\n\n ", "Department", "of", "Biology", ",", "Georgia", "State", "University", ",", "Atlanta", ",", "GA", "30303", ",", "USA", "\n\n ", "Received", "July", "11", ",", "1989", ";", "Revised", "and", "Accepted", "August", "29", ",", "1989", " ", "EMBL", "accession", "nos", "X16005", ",", "X16006", "\n\n ", "ABSTRACT", "\n\n ", "The", "cl", "genes", "of", "the", "heteroimmune", "phages", "P1", "and", "P7", "were", "sequenced", "and", "their", "products", "were", "compared", ".", "P7cl", "expression", "was", "correlated", "with", "the", "translation", "in", "vitro", "of", "a", "protein", "whose", "predicted", "molecular", "weight", "(", "33,000", "daltons", ")", "is", "indistinguishable", "from", "that", "of", "the", "Plcl", "repressor", ".", "The", "cl", "regions", "from", "both", "P1", "and", "P7", "were", "found", "to", "contain", "open", "reading", "frames", "capable", "of", "coding", "for", "a", "283-amino", "acid", "protein", "whose", "predicted", "secondary", "structure", "lacks", "the", "helix", "-", "tum", "-", "helix", "motif", "commonly", "associated", "with", "repressor", "proteins", ".", "Two", "Plcl", "amber", "mutations", "were", "localized", "to", "the", "283-amino", "acid", "open", "reading", "frame", ".", "The", "Plcl", "and", "P7cl", "sequences", "were", "found", "to", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "alter", "the", "third", "position", "of", "the", "affected", "codon", "and", "do", "not", "alter", "the", "amino", "acid", "sequence", "of", "the", "protein", ".", "Plasmids", "expressing", "the", "cI", "gene", "from", "either", "phage", "cause", "the", "repression", "of", "transcription", "from", "a", "cloned", "promoter", "situated", "upstream", "of", "Plcl", ".", "\n\n ", "INTRODUCTION", "\n\n ", "The", "cl", "genes", "of", "the", "plasmid", "prophages", "P1", "and", "P7", "code", "for", "repressor", "proteins", "that", "are", "required", "for", "the", "establishment", "and", "maintenance", "of", "lysogeny", "(", "reviewed", "in", "1", ")", ".", "A", "protein", "corresponding", "to", "the", "Plcl", "repressor", "has", "been", "isolated", "and", "shown", "to", "be", "a", "sequence", "-", "specific", "DNA", "binding", "protein", "that", "recognizes", "several", "widely", "dispersed", "sites", "on", "the", "phage", "DNA", "(", "2", "-", "7", ")", ".", "The", "consensus", "DNA", "sequence", "recognized", "by", "the", "Plcl", "repressor", "(", "ATTTATTAGAGCA[A", "/", "T]T", ")", "contains", "no", "discernable", "bilateral", "symmetry", ",", "a", "feature", "that", "is", "highly", "unusual", "among", "prokaryotic", "operator", "sites", ".", "\n\n ", "P1", "and", "P7", "are", "heteroimmune", ";", "that", "is", ",", "each", "phage", "is", "able", "to", "establish", "a", "lytic", "infection", "on", "a", "lysogen", "of", "the", "other", "phage", ".", "In", "this", "sense", ",", "their", "relationship", "is", "analogous", "to", "that", "of", "phage", "X", "and", "434", ",", "which", "differ", "in", "the", "DNA", "specificity", "of", "their", "cI", "repressor", "proteins", "(", "8)", ".", "However", ",", "genetic", "studies", "indicate", "that", "Plcl", "and", "P7cl", "can", "be", "crossed", "into", "the", "heterologous", "phage", "without", "affecting", "the", "immunity", "specificity", "of", "the", "recipient", "(", "9", ")", ".", "The", "basis", "for", "P1", "/", "P7", "heteroimmunity", "has", "been", "localized", "to", "a", "second", "regulatory", "gene", ",", "c4", ",", "that", "is", "unlinked", "to", "cl", ".", "The", "c4", "gene", "products", "prevent", "the", "expression", "of", "antireb", ",", "a", "closely", "linked", "gene", "that", "interferes", "with", "cl", "-", "mediated", "repression", "(", "10", ",", "11", ")", ".", "According", "to", "current", "models", ",", "P1", "/", "P7", "heteroimmunity", "results", "from", "the", "inability", "of", "the", "c4", "repressor", "of", "one", "phage", "to", "prevent", "antireb", "expression", "from", "the", "heteroimmune", "phage", "genome", "(", "10", ",", "11", ")", ".", "\n\n ", "Because", "the", "cl", "genes", "of", "P1", "and", "P7", "are", "genetically", "interchangeable", ",", "it", "is", "anticipated", "that", "the", "two", "gene", "products", "carry", "out", "similar", "or", "identical", "regulatory", "functions", ".", "The", "studies", "presented", "in", "this", "paper", "were", "undertaken", "to", "investigate", "the", "biochemical", "basis", "for", "the", "apparent", "genetic", "identity", "of", "the", "two", "cl", "genes", ".", "In", "this", "paper", ",", "we", "present", "the", "DNA", "sequence", "of", "the", "cl", "genes", "of", "P1", "and", "P7", "and", "the", "predicted", "amino", "acid", "sequence", "of", "the", "cl", "repressor", "proteins", ".", "We", "report", "that", "Plcl", "and", "P7cl", "code", "for", "proteins", "of", "identical", "size", "(", "283", "amino", "acids", ")", "and", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Volume", "17", "Number", "19", "1989", "\n\n ", "767", "1", "\n\n ", "(", "r", "IRL", "Press", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "nearly", "identical", "sequence", ".", "We", "report", "further", "that", "both", "repressors", "prevent", "the", "expression", "of", "a", "promoter", "located", "immediately", "upstream", "of", "the", "Plc", "1", "open", "reading", "frame", ",", "an", "observation", "that", "confirms", "their", "functional", "similarity", "and", "suggests", "an", "autoregulatory", "role", "for", "the", "two", "proteins", ".", "Analysis", "of", "the", "secondary", "structure", "predicted", "by", "the", "open", "reading", "frames", "does", "not", "reveal", "the", "characteristic", "helix", "-", "turn", "-", "helix", "(", "12", ")", "or", "other", "motifs", "commonly", "associated", "with", "DNA", "binding", "proteins", ".", "\n\n ", "MATERIALS", "AND", "METHODS", "Bacterial", "and", "phage", "strains", ".", "\n\n ", "E.", "coli", "K336", "is", "a", "SuO", "derivative", "of", "K140", "(", "13", ")", ".", "E.", "coli", "CB454", "is", "a", "recA-", ",", "lacZderivative", "of", "K-12", "(", "14", ")", ".", "P1", "+", "is", "described", "by", "Scott", "(", "13", ")", ".", "P7", "+", "is", "the", "strain", "of", "Smith", "(", "15", ")", ",", "as", "described", "by", "Scott", "(", "16", ")", ".", "P7cl", ".", "1", "contains", "a", "missense", "mutation", "in", "the", "cl", "gene", "(", "17", ")", ".", "The", "P7", "phage", "strains", "and", "the", "cl", "amber", "mutant", "phage", "strains", "PIci", ".245Cm", ",", "Plc1", ".", "169", "and", "P", "Ic", ".55", "(", "11", ")", "were", "generously", "provided", "by", "June", "Scott", ".", "Enzymes", "and", "reagents", ".", "\n\n ", "Restriction", "enzymes", ",", "T4", "DNA", "ligase", "and", "polymerase", ",", "and", "the", "Klenow", "fragment", "of", "E.", "coli", "DNA", "polymerase", "were", "purchased", "from", "Boehringer", "Biochemicals", "or", "New", "England", "Biolabs", "and", "reactions", "were", "carried", "out", "according", "to", "the", "manufacturers", "'", "instructions", ".", "DNA", "sequencing", "kits", "and", "in", "vitro", "transcription", "-", "translation", "kits", "were", "purchased", "from", "Bethesda", "Research", "Laboratories", "and", "Amersham", "Corporation", ",", "respectively", ".", "Synthetic", "oligonucleotides", "to", "be", "used", "as", "sequencing", "primers", "were", "prepared", "on", "an", "Applied", "Biosystems", "DNA", "synthesizer", ".", "Plasmid", "construction", ".", "\n\n ", "pBRB7.2", ".", "pBRB7.2", "(", "2", ")", "contains", "a", "3.2", "kb", "EcoRI", "/", "PvuII", "fragment", "from", "the", "cl", "region", "of", "P1", "(", "Figure", "1", ")", "inserted", "into", "the", "2.3", "kb", "EcoRIlPvuII", "fragment", "of", "pBR322", "that", "contains", "the", "origin", "of", "replication", "and", "the", "f3-lactamase", "gene", ".", "\n\n ", "pFA02", ".", "P7", "plasmid", "DNA", "was", "digested", "with", "PvuII", ",", "ligated", "to", "similarly", "digested", "pBR322", ",", "and", "transformed", "into", "E.", "coli", "K336", ".", "Ampicillin", "-", "resistant", "colonies", "were", "screened", "for", "cl", "activity", "by", "cross", "-", "streak", "complementation", "analysis", "against", "P7cl.1", "(", "18", ")", ".", "pFAO2", "contains", "a", "3.5", "kb", "insert", "of", "P7", "DNA", ".", "The", "fragment", "was", "localized", "to", "the", "cl", "region", "of", "the", "P7", "genome", "by", "Southern", "hybridization", "against", "P1", "and", "P7", "DNA", "that", "had", "been", "digested", "with", "BamHI", "and", "BglII", "(", "data", "not", "shown", ")", ".", "\n\n ", "pBRBJ69", ".", "1", "and", "pBRB55", ".", "1", ".", "The", "PI", "cI", "open", "reading", "frame", "was", "previously", "localized", "to", "a", "2.6", "kb", "EcoRlIBamHI", "fragment", "derived", "from", "PlEcoRI-7", "(", "2", ")", ".", "This", "fragment", "also", "contains", "the", "wildtype", "allele", "for", "the", "conditional", "lethal", "mutation", "am43", "(", "19", ",", "20", ")", ".", "To", "clone", "the", "cl", "reading", "frame", "from", "the", "amber", "mutant", "phage", "Plc1.169", "and", "P", "Ic", ".55", ",", "we", "digested", "phage", "DNA", "with", "EcoRI", "and", "BamHI", ",", "ligated", "the", "digestion", "products", "into", "similarly", "digested", "pBR322", ",", "and", "transformed", "the", "ligation", "mixture", "into", "E.", "coli", "K336", ".", "Ampicillin", "-", "resistant", ",", "tetracyclinesensitive", "colonies", "were", "screened", "by", "cross", "-", "streak", "complementation", "analysis", "for", "their", "ability", "to", "support", "the", "growth", "of", "Plam43", ".", "Plasmid", "DNA", "isolated", "from", "complementation", "-", "positive", "cells", "was", "shown", "by", "agarose", "gel", "electrophoresis", "to", "carry", "plasmids", "containing", "the", "2.6", "kb", "EcoRIlBamHI", "fragment", "from", "the", "cl", "region", ".", "The", "cl", "mutant", "open", "reading", "frames", "were", "placed", "under", "the", "control", "of", "normal", "regulatory", "signals", "present", "in", "the", "cI", "region", "by", "digesting", "the", "cl.55", "and", "cl", ".", "169-containing", "plasmids", "with", "BamHI", "and", "PvuII", "and", "inserting", "a", "601", "bp", "BamHI", "/", "PvuH", "fragment", "containing", "the", "cl", "promoter", "region", "(", "2", ")", ".", "The", "resulting", "plasmids", ",", "pBRB55.1", "and", "pBRB169.1", ",", "respectively", ",", "contain", "the", "3.2", "kb", "EcoRllPvuIl", "fragment", "analogous", "to", "that", "present", "in", "pBRB7.2", "(", "Figure", "1", ")", ".", "\n\n ", "pBCB2", ".", "13", "-", "2.18", ".", "To", "identify", "cl", "-", "repressible", "promoters", ",", "we", "introduced", "selected", "fragments", "\n\n ", "7672", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "4", "f", " ", "-", " ", "-", " ", "+", "\n\n ", "I", " ", "4", " ", "P1", "4-", " ", "4-", " ", "4", "\n\n ", "ECAR", " ", "H", " ", "C", " ", "B", " ", "R", " ", "P", "\n\n ", "4", " ", "4.4,~", " ", "4", ",", " ", "1", " ", "1", "4", ".", " ", "I", " ", "4", ",", " ", "I", "11", "\n\n ", "t", " ", "t", " ", "t", " ", "t", " ", "t", "E", "G", "R", " ", "N", " ", "E", " ", "B", " ", "R", " ", "P", "\n\n ", "4", " ", "4", " ", "-", " \n\n ", "4", "\n\n ", "1", "'", " ", "'", "110z", "I", " ", "I", " ", "I", " ", "I", " ", "I", " ", "I", " ", "1", "\n\n ", "3.2", " ", "1.5", " ", "1.0", " ", "0.5", " ", "0", "\n\n ", "P7", "\n\n ", "pBRB7.2", "\n\n ", "-------------------cl1", "-", "------------", "\n\n ", "r", "~", "/", ">", "'", " ", "pFAO2", "\n\n ", "*", "-lacZ", " ", "pBCB2.13", "\n\n ", "<", "-lacZ", "Z", " ", "pBCB2.16", "<", "-lacZX", " ", "pBCB2.18", "\n\n ", "Fig", ".", "1", ".", "The", "cl", "regions", "of", "P1", "and", "P7", ".", "A", "restriction", "map", "is", "indicated", "by", "the", "solid", "line", "in", "the", "upper", "part", "of", "the", "figure", ".", "Sites", "for", "EcoRI", "(", "E", ")", ",", "Pvul", "(", "P", ")", ",", "NnrI", "(", "N", ")", ",", "Bgll", "(", "G", ")", ",", "BamHI", "(", "B", ")", ",", "and", "EcoRV", "(", "R", ")", "are", "shown", ".", "The", "sequencing", "strategy", "is", "indicated", "by", "the", "horizontal", "arrows", ".", "Letters", "and", "arrows", "above", "and", "below", "the", "map", "refer", "to", "sites", "and", "sequence", "analysis", "for", "P1", "and", "P7", ",", "respectively", ".", "The", "size", "of", "this", "region", "(", "in", "kilobase", "pairs", ")", "is", "indicated", "below", "the", "map", ".", "The", "DNA", "fragments", "present", "in", "selected", "plasmids", "are", "illustrated", "by", "boxes", "at", "the", "bottom", "of", "the", "figure", ".", "The", "dashed", "line", "reveals", "the", "approximate", "position", "of", "the", "cl", "gene", "(", "2", ")", ".", "The", "sites", "of", "the", "-yb", "mutations", "introduced", "into", "pFA02", "are", "indicated", "by", "asterisks", ".", "pFA02.16", "and", "pFA02.26", "contain", "insertions", "located", "0.9", "kb", "and", "1.4", "kb", ",", "respectively", ",", "from", "the", "PvuIl", "site", "at", "the", "left", "side", "of", "the", "map", ".", "The", "direction", "of", "the", "lacZ", "open", "reading", "frame", "in", "pBCB2.13", "-", "18", "is", "indicated", "by", "the", "adjacent", "arrow", ".", "\n\n ", "from", "the", "cI", "region", "of", "P1", "into", "pCB192", ",", "a", "promoter", "-", "probe", "vector", "containing", "promoterless", "copies", "of", "lacZ", "and", "galK", "extending", "in", "opposite", "directions", "from", "a", "multiple", "cloning", "site", "(", "21", ")", ".", "The", "source", "of", "P1", "DNA", "for", "these", "constructions", "was", "pZHA3", ",", "a", "derivative", "of", "pBRB7.2", "that", "contains", "a", "HindIlI", "linker", "at", "the", "single", "EcoRV", "site", "located", "about", "200", "bps", "upstream", "of", "the", "cl", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "pBCB2.13", "contains", "a", "460", "bp", "fragment", "of", "P1", "DNA", "extending", "from", "the", "EcoRV", "site", "to", "a", "Bgll", "site", "within", "the", "cI", "open", "reading", "frame", ".", "pBCB2", ".", "16", "contains", "a", "130", "bp", "fragment", "extending", "from", "the", "EcoRV", "site", "to", "a", "BamHI", "site", "located", "about", "100", "bps", "upstream", "of", "the", "cl", "open", "reading", "frame", ",", "while", "pBCB2.18", "contains", "the", "region", "extending", "from", "this", "BamHI", "site", "to", "the", "Bglll", "site", "within", "the", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "The", "orientation", "of", "the", "P1", "DNA", "fragments", "within", "these", "plasmids", "was", "confirmed", "by", "restriction", "mapping", "and", "DNA", "sequencing", ".", "\n\n ", "To", "test", "for", "the", "regulation", "of", "promoter", "expression", "by", "cl", ",", "we", "transformed", "pBCB2.13", "and", "its", "derivatives", "into", "CB454(pBRB7.152", ")", "and", "CB454(pFAO2.152", ")", ",", "two", "strains", "that", "express", "P7cl", "and", "Pll", ",", "respectively", ",", "from", "the", "pCB192-compatible", "kanamycin", "-", "resistant", "vector", "pDPT152", "(", "22", ")", ".", "Cells", "harboring", "both", "plasmids", "were", "selected", "by", "their", "resistance", "to", "both", "ampicillin", "and", "kanamycin", ".", "lacZ", "expression", "was", "measured", "by", "the", "procedure", "of", "Miller", "(", "23", ")", ".", "pBRB7.152", "was", "generated", "by", "introducing", "PlEcoRI-7", "into", "pDPT152", ".", "pBRB7.152", "has", "sustained", "a", "spontaneous", "deletion", "within", "the", "EcoRI-7", "fragment", "that", "results", "in", "the", "loss", "of", "2.5", "kb", "of", "P1", "DNA", "from", "the", "far", "left", "side", "of", "the", "P1", "genetic", "map", ",", "but", "retains", "the", "3.2", "kb", "PvuHlEcoRI", "fragment", "required", "for", "cl", "expression", "that", "is", "present", "in", "pBRB7.2", "(", "Figure", "1", ")", ".", "\n\n ", "7673", "\n\n ", "z", "\n\n ", "I", " ", "011Z", " ", "I", "\n\n ", "e.", ",", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Table", "1", ".", "Complementation", "of", "PIci", ".245", "by", "plasmids", "that", "contain", "cI", "genes", ".", "\n\n ", "Phenotype", " ", "Efficiency", " ", "Relative", "\n\n ", "of", " ", "of", " ", "Efficiency", "of", "Plasmid", " ", "cI", "gene", " ", "Lysogeny", " ", "Lysogeny", "pBR322", " ", "1.5x", "10", "-", "6", " ", "6.0x", "10", "-", "6", "pBRB7.2", " ", "Plcl+", " ", "2.5", "x", "10-", "'", " ", "1.0", "\n\n ", "pBRB55.1", " ", "Plcl", "-", "am", " ", "1.4", "x", "10", "-", "6", " ", "5.6", "x", "10", "-", "6", "pBRB169.1", " ", "PlCl", "-", "am", " ", "2.1", "x", "10", "-", "6", " ", "8.4", "x", "10", "-", "6", "pFAO2", " ", "P7cl+", " ", "8.7", "x", "10", "-", "2", " ", "0.35", "\n\n ", "pFAO2.16", " ", "P7c", "I-", ",", " ", "4.7", "x", "10", "-", "6", " ", "1.9", "X", "10", "-", "5", "pFAO2.26", " ", "P7cI", "-1", " ", "3.1", "x", "10", "-", "6", " ", "1.2", "x", "10", "-", "5", "\n\n ", "Complementation", "for", "lysogeny", "was", "carried", "out", "as", "described", "by", "Devlin", "et", "al", ".", "(", "26", ")", ".", "The", "plasmids", "were", "carried", "by", "E.", "coli", "K336", ".", "Cells", "were", "grown", "to", "mid", "-", "log", "phase", "at", "370", "in", "LB", "containing", "50", "tig", "/", "m1", "sodium", "ampicillin", "and", "infected", "with", "Plcl.245", "at", "a", "multiplicity", "of", "infection", "of", "5", "in", "the", "presence", "of", "50", "mM", "CaC12", ".", "After", "10", "minutes", ",", "non", "-", "absorbed", "phage", "were", "removed", "by", "centrifugation", "and", "the", "infection", "was", "allowed", "to", "proceed", "for", "2", "hours", "at", "370", ".", "The", "infected", "cells", "were", "plated", "on", "LB", "plates", "containing", "50", "pLg", "/", "ml", "sodium", "ampicillin", ",", "50", "pLg", "/", "ml", "chloramphenicol", ",", "and", "40", "mM", "sodium", "citrate", ".", "The", "efficiency", "of", "lysogeny", "is", "defined", "as", "the", "number", "of", "ApRCmR", "cells", "at", "the", "end", "of", "infection", "divided", "by", "the", "number", "of", "ApR", "cells", "present", "at", "the", "start", "of", "the", "infection", ".", "\n\n ", "To", "construct", "pFA02.152", ",", "we", "introduced", "a", "2.8", "kb", "EcoRV", "fragment", "of", "P7", "DNA", "containing", "the", "cl", "gene", "(", "Figure", "1", ")", "into", "the", "single", "EcoRI", "site", "of", "pDPT152", "after", "it", "had", "been", "rendered", "blunt", "-", "ended", "by", "extension", "with", "T4", "DNA", "polymerase", ".", "cl", "expression", "by", "cells", "harboring", "either", "pBRB7.152", " ", "or", "pFA02.152", " ", "was", "confirmed", " ", "by", " ", "measuring", " ", "their", "ability", "to", " ", "form", "chloramphenicol", "-", "resistant", "lysogens", "when", "infected", "with", "Plcl.245Cm", ".", ",", "yb", "insertional", "mutagenesis", ".", "\n\n ", "Insertional", "mutagenesis", "of", "P7cl", "was", "carried", "out", "using", "the", "'", "yb", "transposon", "of", "F", "(", "24", ")", "as", "described", "by", "Devlin", "et", "al", ".", "(", "25", ")", ".", "E.", "coli", "W1485(pFA02", ")", "was", "mated", "with", "the", "F-", "strain", "MX648", "and", "subsequently", "plated", "on", "ampicillin", "(", "to", "select", "for", "the", "plasmid", ")", "and", "streptomycin", "sulfate", "(", "to", "select", "for", "the", "recipient", "strain", ")", ".", "Transconjugants", "which", "could", "support", "only", "lytic", "growth", "upon", "infection", "by", "P7cl", ".1", "(", "as", "scored", "by", "cross", "-", "streak", "analysis", ";", "18", ")", "were", "assumed", "to", "have", "lost", "cl", "-", "complementing", "activity", "and", "were", "characterized", "further", ".", "The", "positions", "of", "two", "cl", "-", "insertional", "mutations", ",", "carried", "by", "pFA02.16", "and", "pFA02.26", ",", "were", "identified", "by", "restriction", "mapping", "(", "Figure", "1", ")", ".", "DNA", "sequencing", ".", "\n\n ", "DNA", "sequence", "analysis", "was", "carried", "out", "using", "the", "M13-dideoxy", "technique", "of", "Sanger", "et", "al", ".", "(", "26", ")", ".", "Selected", "DNA", "fragments", "containing", "the", "cl", "wildtype", "or", "mutant", "genes", "were", "introduced", "into", "M13", "mp8", "or", "mp9", ".", "18-nucleotide", "oligomers", "complementary", "to", "defined", "sequences", "within", "the", "cl", "gene", "were", "extended", "using", "the", "Klenow", "fragment", "of", "DNA", "polymerase", "in", "the", "presence", "of", "dideoxynucleotide", "triphosphates", "and", "analyzed", "by", "polyacrylamide", "-", "urea", "gel", "electrophoresis", ".", "The", "sequencing", "strategy", "is", "shown", "in", "Figure", "1", ".", "RESULTS", "\n\n ", "Localization", "of", "the", "P7cJ", "gene", ".", "\n\n ", "Initial", "localization", "of", "the", "P7cl", "gene", "was", "undertaken", "by", "subjecting", "pFA02", "to", "'", "yb", "mutagenesis", "and", "determining", "the", "map", "position", "of", "inserts", "which", "destroy", "the", "ability", "of", "the", "plasmids", "to", "complement", "a", "P7cl", "-", "mutation", "(", "as", "determined", "by", "cross", "-", "streak", "analysis", ")", ".", "pFA02", "and", "the", "-yb", "insertion", "mutants", "were", "tested", "further", "by", "comparing", "their", "ability", "to", "complement", "a", "PIcI", "amber", "mutation", "with", "the", "complementation", "activity", "of", "plasmids", "containing", "cl", "genes", "isolated", "\n\n ", "7674", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "B", " ", "C", " ", "D", " ", "E", " ", "F", " ", "G", "\n\n ", "*", ".4", " \n\n ", "68", "\n\n ", "43", "\n\n ", "29-", " ", "_", " ", "-", " ", "=", "I", " ", "=", " ", "Am~", " ", "W", " ", "_", "\n\n ", "18", "\n\n ", "14", " ", "p", "\n\n ", "Fig", ".", "2", ".", "In", "vitro", "transcription", "-", "translation", "of", "plasmids", "carrying", "the", "cl", "region", "of", "P1", "and", "P7", ".", "Proteins", "encoded", "by", "selected", "plasmids", "were", "labeled", "with", "35S", "methionine", "according", "to", "the", "procedure", "of", "DeVries", "and", "Zubay", "(", "27", ")", ",", "using", "a", "commercial", "in", "vitro", "transcription", "/", "tramnslation", "kit", "from", "Amersham", "Corporation", ".", "The", "reaction", "mixtures", "were", "subjected", "to", "electrophoresis", "on", "a", "12.5", "%", "SDS", "-", "polyacrylamide", "gel", "and", "the", "labeled", "proteins", "were", "visualized", "by", "autoradiography", ".", "The", "migration", "of", "14C", "-", "labeled", "protein", "molecular", "weight", "standards", "(", "Bethesda", "Research", "Laboratories", ")", "is", "indicated", "at", "the", "left", "side", "of", "the", "figure", ".", "Plasmids", "present", "in", "each", "lane", "are", ":", "A.", "pBRB55.1", ";", "B.", "pBRB169.1", ";", "C.", "pBRB7.2", ";", "D.", "pFAO2", ";", "E.", "pFAO2.16", ";", "F.", "pFAO2.26", ";", "G.", "pBR322", ".", "\n\n ", "from", "P1", "wildtype", "and", "amber", "mutants", ".", "Lysogeny", "by", "cells", "infected", "with", "Plcl.245Cm", "was", "scored", "as", "the", "growth", "of", "infected", "cells", "on", "ampicillin", "(", "to", "select", "for", "the", "resident", "plasmid", ")", "and", "chloramphenicol", "(", "to", "select", "for", "the", "phage", "genome", ")", ".", "The", "values", "observed", "for", "the", "two", "plasmids", "containing", "Plcl", "and", "P7cl", "(", "pBRB7.2", "and", "pFA02", ",", "respectively", ")", "are", "very", "similar", "and", "significantly", "higher", "than", "those", "obtained", "for", "pBR322", "or", "for", "any", "of", "the", "plasmids", "carrying", "\n\n ", "Table", "2", ".", "Assay", "for", "lacZ", "expression", "from", "plasmids", "containing", "P1", "DNA", "fragments", ".", "\n\n ", ",", "3-galactosidase", "activity", "(", "units", ")", "\n\n ", "minus", "cI", " ", "plus", "Pici", " ", "plus", "P7cl", " ", "relative", "activity", "\n\n ", "(", "pDPT152", ")", " ", "(", "pBB7", ".", "152", ")", " ", "(", "pFA02.152", ")", " ", "+", "PICJ", " ", "+", "P7cJ", "\n\n ", "pCB192", " ", "0.58", " ", "0.55", " ", "0.54", " ", "0.95", " ", "0.93", "pBCB2.13", " ", "154", " ", "15.2", " ", "13.6", " ", "0.10", " ", "0.09", "pBCB2.16", " ", "1.1", " ", "1.2", " ", "1.1", " ", "1.1", " ", "1.0", "pBCB2.18", " ", "4.0", " ", "3.4", " ", "3.9", " ", "0.9", " ", "1.0", "\n\n ", "Cells", "containing", "derivatives", "of", "the", "ApR", "promoter", "-", "probe", "plasmid", "pCB192", "and", "the", "compatible", "KnR", "plasmid", "pDPT152", "were", "grown", "in", "LB", "at", "37", "?", ".", "When", "they", "reached", "mid", "-", "log", "phase", ",", "the", "cells", "were", "chilled", ",", "lysed", ",", "and", "assayed", "for", "(", "3-galactosidase", "activity", "according", "to", "the", "procedure", "of", "Miller", "(", "23", ")", ".", "Plasmids", "derived", "from", "pCB192", "are", "indicated", "at", "the", "left", "side", "of", "the", "Table", ".", "Plasmids", "derived", "from", "pDPT152", "are", "indicated", "in", "parentheses", "across", "the", "top", "of", "the", "Table", ".", "The", "values", "reported", "are", "the", "average", "of", "two", "independent", "experiments", ".", "Relative", "activity", "is", "defined", "as", "the", "f3-galactosidase", "activity", "measured", "in", "cells", "harboring", "plasmids", "expressing", "cl", "divided", "by", "the", "activity", "measured", "in", "cells", "carrying", "only", "pDPT152", ".", "\n\n ", "7675", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "GATATCCAATCAGGAGTACC", "GCATCACCCAAGACGACCTG", "GATGATCTCACTGACACAAT", "CGAATATCTCATGGCCACTA", "ACCAGCCAGACTCACAATAAATGCA", " ", "105", "v--", "\n\n ", "TtgAca", " ", "TATAATG", "\n\n ", "CTAATAAATCTATTATTTTC", "GTTGGATCCTTCTATAATGG", "TGGCCAACAACTCCCAGTGT", "AATCCGCTGTGAGTTGTTGG", "CCATGTCAATTCTGGAGGAGGATCA", " ", "210", "\n\n ", "b-----", " ", "I", " ", "I", " ", "GGAGGtG", "\n\n ", "ATG", "ATA", "AAT", "TAT", "GTC", "TAC", "GGC", "GAA", "CAA", "CTG", "TAC", "CAG", "GAG", "TTC", "GTC", "AGC", "TTC", "AGG", "GAT", "CTC", "TTT", "CTA", "AAA", "AAA", "GCT", "GTT", "GCA", "CGC", "GCC", "CAA", " ", "300", "MET", "lIe", "Asn", "Tyr", "Vat", "Tyr", "Gly", "Glu", "Gin", "Leu", "Tyr", "Gin", "Gtu", "Phe", "Vat", "Ser", "Phe", "Arg", "Asp", "Leu", "Phe", "Leu", "Lys", "Lys", "Ala", "Val", "Ala", "Arg", "Ala", "Gtn", "\n\n ", "tag(cl", ".55", ")", "\n\n ", "CAC", "GTT", "GAT", "GCC", "GCC", "AGC", "GAC", "GGT", "CGT", "CCT", "GTT", "CGC", "CCG", "GTT", "GTC", "GTT", "CTG", "CCG", "TTC", "AM", "GM", "ACG", "GAC", "AGC", "ATT", "CAG", "GCT", "GMA", "ATT", "GAT", " ", "390", "His", "Val", "Asp", "Ala", "Ala", "Ser", "Asp", "Gly", "Arg", "Pro", "Vat", "Arg", "Pro", "Vat", "Vat", "Vat", "Leu", "Pro", "Phe", "Lys", "Glu", "Thr", "Asp", "Ser", "lIe", "Gin", "Ala", "Glu", "lie", "Asp", "\n\n ", "T", " ", "A", " ", "C", " ", "A", " ", "G", "\n\n ", "AAA", "TGG", "ACA", "TTA", "ATG", "GCG", "CGG", "GAA", "CTG", "GAG", "CAG", "TAC", "CCA", "GAT", "CTC", "MT", "ATC", "CCA", "MG", "ACT", "ATT", "TTA", "TAT", "CCT", "GTA", "CCT", "AAC", "ATC", "CTT", "CGC", " ", "480", "\n\n ", "9", "\n\n ", "Lys", "Trp", "Thr", "Leu", "MET", "Ala", "Arg", "Glu", "Leu", "Gtu", "Gin", "Tyr", "Pro", "Asp", "Leu", "Asn", "lIe", "Pro", "Lys", "Thr", "lie", "Leu", "Tyr", "Pro", "Vat", "Pro", "Asn", "lIe", "Leu", "Arg", "\n\n ", "A", " ", "T", " ", "C", "\n\n ", "GGT", "GTG", "CGT", "AAG", "GTT", "ACG", "ACT", "TAT", "CAG", "ACA", "GAA", "GCA", "GTG", "MC", "AGC", "GTC", "AAT", "ATG", "ACC", "GCT", "GGC", "CGC", "ATT", "ATT", "CAT", "CTG", "ATT", "GAT", "AAG", "GAC", " ", "570", "Gly", "Vat", "Arg", "Lys", "Vat", "Thr", "Thr", "Tyr", "Gin", "Thr", "Glu", "Ala", "Vat", "Asn", "Ser", "Vat", "Asn", "MET", "Thr", "Ala", "Gly", "Arg", "lIe", "lIe", "His", "Leu", "lIe", "Asp", "Lys", "Asp", "\n\n ", "G", "\n\n ", "ATT", "CGC", "ATC", "CAA", "AM", "AGC", "GCG", "GGG", "ATC", "MT", "GAG", "CAC", "AGT", "GCG", "AAA", "TAC", "ATA", "GAG", "MC", "CTG", "GAA", "GCA", "ACA", "AM", "GAG", "CTA", "ATG", "AAG", "CAG", "TAC", " ", "660", "lle", "Arg", "lIe", "Gin", "Lys", "Ser", "Ala", "Gly", "lIe", "Asn", "Gtu", "His", "Ser", "Ala", "Lys", "Tyr", "lIe", "Gtu", "Asn", "Leu", "Gtu", "Ala", "Thr", "Lys", "Gtu", "Leu", "MET", "Lys", "Gin", "Tyr", "\n\n ", "T", " ", "T", "\n\n ", "CCG", "GAG", "GAT", "GAA", "AAA", "TTC", "CGT", "ATG", "CGC", "GTA", "CAC", "GGC", "TTT", "AGC", "GAA", "ACA", "ATG", "CTG", "CGC", "GTC", "CAT", "TAC", "ATT", "TCC", "AGT", "AGC", "CCT", "AAC", "TAC", "AAT", " ", "750", "Pro", "Glu", "Asp", "Glu", "Lys", "Phe", "Arg", "MET", "Arg", "Vat", "His", "Gly", "Phe", "Ser", "Gtu", "Thr", "MET", "Leu", "Arg", "Vat", "His", "Tyr", "lie", "Ser", "Ser", "Ser", "Pro", "Asn", "Tyr", "Asn", "\n\n ", "Phe", "\n\n ", "T", " ", "C", " ", "G", " ", "T", " ", "T", "\n\n ", "I", " ", "~~~I", " ", "I", " ", "II", "\n\n ", "GAT", "GGC", "MA", "TCA", "GTT", "AGT", "TAC", "CAT", "GTG", "CTG", "CTA", "TGT", "GGC", "GTG", "TTT", "ATC", "TGC", "GAT", "GM", "ACT", "CTC", "CGA", "GAT", "GGA", "ATC", "ATC", "ATC", "AAC", "GGT", "GAA", " ", "840", "\n\n ", "e", "..", "Asp", "Gly", "Lys", "Ser", "Vat", "Ser", "Tyr", "His", "Vat", "Leu", "Leu", "Cys", "Gly", "Vat", "Phe", "lie", "Cys", "Asp", "Glu", "Thr", "Leu", "Arg", "Asp", "Gly", "lIe", "lie", "lIe", "Asn", "Gly", "Gtu", "\n\n ", "Pro", "\n\n ", "C", " ", "tag(cl", ".169", ")", "\n\n ", "TTT", "GAG", "AM", "GCA", "AAA", "TTT", "AGC", "CTT", "TAT", "GAC", "TCT", "ATA", "GM", "CCG", "ATC", "ATC", "TGC", "GAC", "CGC", "TGG", "CCG", "CAG", "GCA", "AM", "ATA", "TAT", "CGC", "CTG", "GCA", "GAT", " ", "930", "Phe", "Gtu", "Lys", "Ala", "Lys", "Phe", "Ser", "Leu", "Tyr", "Asp", "Ser", "lIe", "Glu", "Pro", "lie", "lie", "Cys", "Asp", "Arg", "Trp", "Pro", "Gin", "Ala", "Lys", "lIe", "Tyr", "Arg", "Leu", "Ala", "Asp", "\n\n ", "T", "\n\n ", "ATT", "GM", "MT", "GTA", "AM", "AM", "CM", "ATT", "GCC", "ATC", "ACT", "CGC", "GM", "GAG", "AAA", " ", "G", "GTC", "AM", "TCA", "GCC", "GCA", "TCA", "GTT", "ACG", "CGC", "AGC", "CGC", "AAA", "ACT", "AAG", "1020", "\n\n ", "n-----", "\n\n ", "lie", "Glu", "Asn", "Vat", "Lys", "Lys", "Gin", "lIe", "Ala", "lie", "Thr", "Arg", "Glu", "Glu", "Lys", "Lys", "Vat", "Lys", "Ser", "Ala", "Ala", "Ser", "Vat", "Thr", "Arg", "Ser", "Arg", "Lys", "Thr", "Lys", "\n\n ", "AAG", "GGG", "CAG", "CCA", "GTA", "AAC", "GAC", "MC", "CCC", "GAA", "AGC", "GCG", "CM", "TAG", "Lys", "Gly", "Gin", "Pro", "Val", "Asn", "Asp", "Asn", "Pro", "Glu", "Ser", "Ala", "Gin", "ter", "\n\n ", "Fig", ".", "3", ".", "DNA", "sequence", "of", "PIcI", "and", "P7cl", ".", "The", "DNA", "sequence", "of", "PIcI", "is", "indicated", ".", "Positions", "where", "the", "sequence", "of", "P7cl", "differs", "from", "that", "of", "Plcl", "are", "indicated", "above", "the", "P1", "sequence", ".", "The", "amino", "acid", "sequence", "predicted", "by", "the", "open", "reading", "frame", "is", "given", "below", "the", "sequence", ".", "The", "two", "amino", "acid", "substitutions", "present", "in", "P7cl", "are", "shown", "below", "the", "open", "reading", "frame", ".", "The", "locations", "of", "the", "amber", "mutant", "codons", "in", "cl.55", "and", "ci", ".", "169", "are", "indicated", "by", "small", "letters", "above", "the", "sequence", ".", "Sites", "for", "selected", "restriction", "enzymes", "(", "EcoRV", "[", "v", "]", ";", "BamHI", "[", "b", "]", ";", "Bgll", "[", "g", "]", ";", "EcoRP", "[", "e", "]", ";", "and", "NruI", "[", "n", "]", ")", "are", "illustrated", "by", "dashed", "lines", "beneath", "the", "sequence", ".", "The", "cl", "repressor", "binding", "site", "is", "underlined", ".", "Inverted", "arrows", "beneath", "the", "sequence", "illustrate", "the", "inverted", "repeat", "sequence", "upstream", "of", "the", "open", "reading", "frame", ".", "Predicted", "promoter", "ribosome", "binding", "sites", "are", "indicated", "by", "the", "presence", "of", "the", "consensus", "sequences", "above", "and", "below", "the", "line", ",", "respectively", ".", "The", "DNA", "sequences", "of", "Plcl", "from", "bp", "1", "-", "134", "and", "bp", "1", "-", "434", "were", "reported", "previously", "(", "2,5", ")", ".", "\n\n ", "mutant", "cl", "genes", "from", "either", "P1", "or", "P7", "(", "Table", "1", ")", ".", "The", "efficiency", "with", "which", "a", "cloned", "P7cl", "gene", "complements", "a", "PlcI", "mutation", "confirms", "previous", "genetic", "studies", "indicating", "that", "these", "two", "genes", "are", "functionally", "interchangeable", "(", "9", ")", ".", "The", "location", "of", "the", "'", "y6", "mutations", "that", "destroy", "cl", "-", "complementing", "activity", "suggests", "that", "the", "P7cl", "open", "reading", "frame", "occupies", "a", "map", "position", "similar", "to", "that", "of", "the", "P1", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "7676", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Proteins", "produced", "by", "fragments", "containing", "Plcl", ".", "\n\n ", "As", "an", "initial", "step", "in", "the", "comparison", "of", "the", "P1", "and", "P7", "repressors", ",", "we", "analyzed", "the", "gene", "products", "expressed", "from", "the", "cloned", "cl", "regions", ".", "In", "an", "in", "vitro", "transcription", "-", "translation", "reaction", ",", "plasmids", "coding", "for", "the", "wildtpe", "alleles", "of", "either", "PIcI", "or", "P7cl", "direct", "the", "production", "of", "a", "protein", "with", "an", "estimated", "molecular", "weight", "of", "33,000", "daltons", "(", "Figure", "2", ",", "Lanes", "C", "and", "D", ")", ",", "a", "size", "that", "agrees", "closely", "with", "the", "predicted", "molecular", "weight", "of", "the", "PIcI", "repressor", "reported", "previously", "(", "3,28", ")", ".", "The", "loss", "of", "the", "33,000", "dalton", "protein", "in", "the", "cl", "-", "'", "ya", "-", "induced", "P7", "mutant", "plasmids", "(", "Figure", "2", ",", "Lanes", "E", "and", "F", ")", "is", "consistent", "with", "its", "designation", "as", "the", "P7cl", "repressor", ".", "As", "expected", ",", "the", "33,000", "dalton", "protein", "is", "not", "observed", "when", "reaction", "mixtures", "contain", "DNA", "from", "Plcl", "amber", "mutants", "(", "Figure", "2", ",", "Lanes", "A", "and", "B", ")", ".", "DNA", "sequence", "analysis", "of", "the", "cl", "genes", ".", "\n\n ", "To", "make", "a", "direct", "comparison", "between", "the", "Plcl", "and", "P7cl", "DNA", "sequences", "and", "to", "predict", "the", "amino", "acid", "sequences", "of", "the", "repressor", "proteins", ",", "we", "carried", "out", "M", "13-dideoxy", "sequence", "analysis", "of", "cloned", "fragments", "carrying", "the", "cl", "genes", ".", "The", "sequences", "of", "about", "1", "kb", "of", "P1", "and", "P7", "DNA", "were", "determined", "starting", "from", "a", "common", "EcoRV", "site", "predicted", "to", "lie", "approximately", "200", "bps", "upstream", "of", "the", "cl", "genes", ".", "The", "P1", "and", "P7", "sequences", "(", "Figure", "3", ")", "both", "contain", "an", "ATG", "initiation", "codon", "preceded", "by", "a", "putative", "ribosome", "binding", "sequence", "(", "29", ")", "situated", "211", "bps", "downstream", "of", "the", "EcoRV", "site", ".", "In", "each", "case", ",", "the", "initiation", "codon", "is", "followed", "by", "an", "open", "reading", "reading", "frame", "extending", "for", "283", "codons", ".", "The", "P1", "and", "P7", "open", "reading", "frames", "code", "for", "proteins", "with", "predicted", "molecular", "weights", "(", "32,515", "and", "32,499", "daltons", ",", "respectively", ")", "that", "agree", "closely", "with", "the", "values", "of", "the", "proteins", "expressed", "from", "the", "cloned", "DNA", "fragments", "(", "Figure", "2", ")", "and", "with", "results", "predicted", "independently", "for", "the", "purified", "PIcI", "repressor", "(", "3", "-", "4", ")", ".", "The", "localization", "of", "two", "PIcI", "amber", "mutations", "to", "the", "P1", "open", "reading", "frame", "confirms", "its", "identification", "as", "the", "cI", "coding", "sequence", ".", "cI.", "169", "contains", "an", "amber", "mutation", "that", "would", "result", "in", "a", "protein", "fragment", "of", "26,680", "daltons", ",", "a", "value", "that", "agrees", "well", "with", "the", "size", "of", "a", "protein", "fragment", "observed", "under", "the", "in", "vitro", "transcription", "/", "translation", "reaction", "conditions", "(", "Figure", "2", ",", "Lane", "B", ")", ".", "The", "cl.55", "amber", "mutation", "lies", "close", "to", "the", "N", "-", "terminal", "region", "of", "the", "protein", ",", "resulting", "in", "the", "production", "of", "a", "fragment", "of", "55", "amino", "acids", "that", "is", "apparently", "too", "small", "to", "resolve", "under", "the", "electrophoretic", "conditions", "used", "for", "separation", "of", "the", "proteins", ".", "Over", "60", "%", "of", "the", "amino", "acid", "sequence", "predicted", "for", "the", "PIcI", "open", "reading", "frame", "has", "been", "verified", "by", "amino", "acid", "sequence", "analysis", "of", "peptide", "fragments", "isolated", "from", "the", "purified", "repressor", "protein", "(", "see", "accompanying", "paper", ",", "reference", "3", ")", ".", "\n\n ", "The", "DNA", "sequences", "of", "P1", "and", "P7", "are", "identical", "for", "a", "399-bp", "region", "that", "extends", "from", "the", "EcoRV", "site", "at", "the", "5", "'", "side", "of", "the", "cl", "gene", "to", "a", "point", "188", "bps", "within", "the", "open", "reading", "frame", ".", "The", "sequences", "within", "the", "Plcl", "and", "the", "P7cl", "open", "reading", "frames", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "occur", "in", "the", "wobble", "position", "of", "the", "predicted", "codon", ".", "From", "these", "results", ",", "we", "conclude", "that", "the", "functional", "identity", "of", "the", "P1", "and", "P7", "cl", "genes", "is", "a", "consequence", "of", "their", "nearly", "identical", "amino", "acid", "sequence", ".", "Analysis", "of", "promoters", "upstream", "of", "the", "cl", "open", "reading", "frame", ".", "\n\n ", "Expression", "of", "Plcl", "was", "shown", "previously", "to", "require", "sequences", "on", "the", "distal", "side", "of", "a", "BamHI", "site", "(", "2", ",", "5", ")", "located", "about", "100", "bps", "upstream", "of", "the", "open", "reading", "frame", "(", "Figure", "3", ")", ".", "A", "binding", "site", "for", "the", "cl", "repressor", "has", "also", "been", "shown", "to", "exist", "close", "to", "this", "BamHI", "site", "(", "2", ",", "5", ",", "6", ")", ".", "To", "determine", "whether", "this", "region", "contains", "a", "promoter", "that", "is", "detectable", "in", "vivo", "and", ",", "further", ",", "to", "determine", "whether", "this", "promoter", "can", "be", "regulated", "by", "cl", "repressor", "proteins", "from", "either", "P1", "or", "P7", ",", "we", "introduced", "several", "DNA", "fragments", "from", "this", "region", "into", "the", "promoter", "probe", "vector", "pCB192", ",", "screened", "for", "promoter", "activity", "(", "as", "monitored", "by", "lacZ", "expression", ")", "and", "checked", "for", "repression", "of", "this", "activity", "in", "the", "presence", "of", "a", "compatible", "\n\n ", "7677", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "plasmid", "expressing", "Plcl", "or", "P7cl", ".", "Cells", "harboring", "pBCB2.13", "(", "a", "plasmid", "which", "carries", "a", "460", "bp", "fragment", "of", "P1", "DNA", "that", "extends", "across", "the", "BamHI", "site", "upstream", "of", "cl", "into", "the", "open", "reading", "frame", ")", "are", "dark", "blue", "in", "the", "presence", "of", "Xgal", "and", "produce", "significant", "levels", "of", "3-galactosidase", "(", "Table", "2", ")", ".", "In", "contrast", ",", "pBCB2.16", "and", "pBCB2.18", "(", "which", "each", "contain", "DNA", "from", "only", "one", "side", "of", "the", "BamHI", "site", "located", "in", "pBCB2", ".", "13", ")", "do", "not", "confer", "a", "blue", "color", "on", "their", "host", "cell", "in", "the", "presence", "of", "X", "-", "Gal", "and", "express", "negligible", "amounts", "of", "3-galactosidase", "(", "Table", "2", ")", ".", "These", "observations", "suggest", "that", "expression", "from", "the", "promoter", "identified", "here", "requires", "sequences", "that", "span", "the", "BamHI", "site", "upstream", "of", "cl", ".", "Expression", "of", "cl", "from", "a", "compatible", "plasmid", "in", "the", "presence", "of", "pBCB2", ".", "13", "results", "in", "a", "90", "%", "reduction", "in", "promoter", "strength", "(", "Table", "2", ")", ".", "This", "reduction", "is", "seen", "in", "the", "presence", "of", "either", "Plcl", "or", "P7cl", ",", "indicating", "that", "the", "two", "repressor", "proteins", "are", "both", "capable", "of", "repressing", "expression", "from", "this", "promoter", ".", "DISCUSSION", ".", "\n\n ", "The", "DNA", "sequences", "of", "Plcl", "and", "P7cl", "differ", "at", "only", "18", "sites", ",", "all", "but", "two", "of", "which", "occur", "at", "the", "third", "position", "of", "the", "affected", "codon", ".", "This", "observation", "provides", "biochemical", "confirmation", "of", "the", "functional", "identity", "predicted", "on", "the", "basis", "of", "previous", "genetic", "analysis", "(", "9", ")", ".", "A", "number", "of", "DNA", "binding", "proteins", "exhibit", "a", "common", "structural", "motif", "in", "which", "two", "helices", "are", "separated", "by", "a", "glycine", "residue", "(", "12", ")", ".", "This", "motif", "is", "not", "observed", "in", "the", "predicted", "secondary", "structures", "(", "30", ")", "of", "the", "Plcl", "and", "P7cl", "amino", "acid", "sequences", ".", "A", "sequence", "with", "some", "similarity", "to", "the", "XCro", "helix", "-", "turn", "-", "helix", "region", "was", "previously", "reported", "near", "the", "Nterminus", "of", "the", "PIcI", "protein", "(", "5", ")", ";", "however", ",", "it", "was", "noted", "that", "the", "potential", "for", "helix", "formation", "is", "disrupted", "by", "the", "presence", "of", "several", "prolines", "within", "the", "region", ".", "The", "secondary", "structure", "predicted", "for", "the", "Plcl", "and", "P7cl", "repressor", "proteins", "(", "30", ")", "does", "not", "reveal", "other", "structural", "characteristics", "(", "e.g", ".", ",", "Zn", "fingers", "(", "31", ")", ",", "leucine", "zippers", "(", "32", ")", ",", "or", "helix", "-", "loop", "-", "helix", "motifs", "(", "33", ")", ")", "that", "have", "been", "associated", "with", "DNA", "binding", "activity", "in", "other", "systems", ".", "A", "search", "of", "the", "GenBank", "and", "EMBL", "databases", "does", "not", "reveal", "any", "other", "known", "regulatory", "proteins", "with", "significant", "amino", "acid", "similarity", "to", "the", "Plcl", "or", "the", "P7cl", "repressor", "sequences", ".", "Since", "the", "Plcl", "repressor", "differs", "from", "most", "other", "repressors", "in", "DNA", "binding", "specificity", "(", "i.e", ".", ",", "in", "its", "recognition", "of", "an", "asymmetric", "operator", "sequence", ")", ",", "it", "is", "not", "unexpected", "to", "find", "that", "the", "protein", "does", "not", "exhibit", "common", "structural", "motifs", "at", "the", "amino", "acid", "level", ".", "\n\n ", "The", "cl", "-", "repressible", "promoter", "described", "in", "this", "report", "is", "located", "in", "a", "region", "just", "upstream", "of", "the", "cl", "open", "reading", "frame", "and", "is", "oriented", "in", "the", "direction", "of", "cl", ".", "Because", "the", "promoter", "is", "present", "on", "a", "multicopy", "plasmid", ",", "it", "is", "not", "possible", "to", "make", "a", "direct", "calculation", "of", "promoter", "strength", ";", "however", ",", "the", "values", "observed", "are", "about", "five", "-", "fold", "lower", "than", "the", "levels", "produced", "by", "a", "derivative", "of", "pCB192", "that", "contains", "the", "plac", "promoter", "from", "pUC19", "(", "34", ")", ".", "Because", "sequences", "on", "both", "sides", "of", "the", "BamHI", "site", "located", "upstream", "of", "cl", "are", "required", "for", "promoter", "activity", "(", "Table", "2", ")", ",", "we", "suggest", "that", "the", "promoter", "spans", "this", "site", ".", "Less", "than", "10", "bps", "downstream", "of", "this", "BamHI", "site", "is", "a", "heptanucleotide", "sequence", "(", "TATAATG", ")", "that", "is", "identical", "to", "the", "-10", "consensus", "sequence", "for", "RNA", "polymerase", "(", "35", ")", ".", "If", "this", "sequence", "does", "indeed", "correspond", "to", "the", "-10", "region", "of", "the", "promoter", ",", "the", "-35", "region", "would", "be", "predicted", "to", "lie", "on", "the", "other", "side", "of", "the", "BamHI", "site", "in", "a", "region", "that", "overlaps", "a", "known", "cI", "repressor", "binding", "site", "(", "2", "-", "5", ")", ".", "Analysis", "of", "this", "region", "does", "not", "reveal", "any", "sequences", "with", "significant", "similarity", "to", "the", "-35", "consensus", "sequence", ".", "The", "best", "fit", "is", "the", "sequence", "TCTATT", "(", "Figure", "3", ")", ",", "which", "matches", "only", "two", "positions", "of", "the", "-35", "consensus", "(", "TTGACA", ")", ".", "The", "lack", "of", "a", "strong", "-35", "region", "is", "often", "observed", "with", "genes", "that", "require", "an", "activator", ".", "Although", "a", "pentanucleotide", "sequence", "corresponding", "to", "the", "conserved", "portion", "of", "the", "CRP", "protein", "consensus", "binding", "site", "(", "36", ")", "\n\n ", "7678", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "is", "located", "just", "upstream", "of", "the", "predicted", "-35", "region", "(", "at", "position", "91", ";", "Figure", "3", ")", ",", "a", "role", "for", "CRP", "-", "mediated", "activation", "in", "cl", "expression", "has", "not", "previously", "been", "described", ".", "The", "orientation", "of", "the", "promoter", "and", "its", "cl", "-", "repressible", "character", "raise", "the", "possibility", "that", "cl", "expression", "is", "autoregulatory", ".", "If", "this", "is", "so", ",", "one", "potential", "activator", "would", "be", "the", "cl", "repressor", "itself", ".", "Expression", "cannot", "be", "absolutely", "dependent", "on", "cl", "-", "mediated", "activation", ",", "however", ",", "because", "the", "cloned", "promoter", "exhibits", "significant", "activity", "in", "the", "absence", "of", "the", "cl", "gene", "(", "Table", "2", ")", ".", "Under", "the", "conditions", "reported", "here", ",", "the", "presence", "of", "the", "cl", "gene", "results", "in", "a", "decrease", "rather", "than", "an", "increase", "in", "lacZ", "expression", ";", "however", ",", "these", "observations", "do", "not", "rule", "out", "a", "potential", "activator", "role", "for", "the", "cl", "protein", ",", "since", "the", "ratios", "of", "repressor", "and", "operator", "provided", "by", "the", "multicopy", "plasmids", "may", "not", "be", "optimal", "for", "activation", ".", "Physiologically", ",", "the", "role", "of", "additional", "repressor", "binding", "sites", "in", "regulating", "cl", "expression", "also", "cannot", "be", "discounted", ".", "Three", "potential", "operator", "sites", "have", "been", "identified", "several", "hundred", "bps", "upstream", "of", "the", "cI", "open", "reading", "frame", "(", "2", "-", "5", ")", ";", "one", "or", "more", "of", "these", "could", "be", "involved", "(", "possibly", "through", "a", "DNA", "looping", "mechanism", ";", "37", ")", "in", "the", "activation", "or", "repression", "of", "cl", "expression", "during", "phage", "growth", ".", "\n\n ", "A", "cl", "-", "repressible", "promoter", "oriented", "in", "the", "direction", "of", "cl", "was", "previously", "reported", "(", "38", ")", "to", "be", "located", "entirely", "within", "PlBamHI-9", ",", "a", "fragment", "located", "upstream", "of", "cl", "which", "is", "bracketed", "by", "the", "BamHI", "site", "within", "pBCB2", ".", "13", ".", "Because", "sequences", "on", "both", "sides", "of", "this", "BamHI", "site", "are", "required", "for", "the", "activity", "of", "the", "promoter", "in", "pBCB2.13", ",", "we", "suggest", "that", "the", "previously", "identified", "promoter", "is", "distinct", "from", "the", "one", "reported", "here", ".", "The", "promoter", "from", "BamHI-9", "could", "correspond", "to", "a", "consensus", "promoter", "sequence", "that", "is", "situated", "about", "500", "bps", "upstream", "of", "cl", "and", "overlaps", "a", "cl", "repressor", "binding", "site", "(", "2", ")", ".", "If", "so", ",", "cl", "expression", "is", "likely", "to", "be", "controlled", "by", "more", "than", "one", "promoter", ".", "Located", "between", "this", "promoter", "sequence", "and", "the", "promoter", "encoded", "on", "pBCB2", ".", "13", "is", "an", "open", "reading", "frame", "whose", "product", "(", "termed", "coi", ",", "or", "c", "-", "one", "inactivator", ")", "has", "been", "implicated", "in", "the", "establishment", "of", "lytic", "growth", "(", "1", ",", "39", ";", "B.R.", "Baumstark", ",", "unpublished", "results", ")", ".", "It", "has", "been", "suggested", "(", "2", ")", "that", "the", "decision", "to", "enter", "lytic", "or", "lysogenic", "growth", "is", "influenced", "by", "the", "level", "of", "transcription", "initiated", "from", "the", "distal", "promoter", "(", "which", "would", "transcribe", "coi", "prior", "to", "the", "transcription", "of", "cl", ")", "relative", "to", "that", "of", "the", "promoter", "located", "immediately", "upstream", "of", "the", "cl", "gene", "(", "which", "would", "transcribe", "only", "ci", ")", ".", "\n\n ", "A", "32-nucleotide", "hyphenated", "inverted", "repeat", "sequence", "is", "located", "just", "upstream", "of", "the", "cl", "open", "reading", "frame", "(", "positions", "146", "-", "188", ";", "Figure", "3", ")", ".", "It", "is", "not", "currently", "known", "whether", "this", "sequence", "has", "any", "regulatory", "effect", "on", "cl", "expression", ".", "Conceivably", ",", "the", "sequence", "could", "serve", "as", "a", "recognition", "site", "for", "an", "as", "-", "yet", "-", "unidentified", "regulatory", "protein", ".", "Alternatively", ",", "it", "may", "affect", "the", "secondary", "structure", "of", "the", "messenger", "RNA", ".", "A", "transcript", "extending", "from", "a", "promoter", "located", "upstream", "of", "the", "putative", "coi", "open", "reading", "frame", "would", "be", "capable", "of", "forming", "a", "stable", "stem", "-", "loop", "structure", "containing", "16", "bps", "with", "a", "single", "bp", "mismatch", "(", "AG", "=", "-33.6", "Kcal", ")", "of", "this", "inverted", "repeat", "sequence", ".", "Such", "a", "structure", "could", "potentially", "serve", "as", "a", "recognition", "site", "for", "a", "regulatory", "factor", "or", ",", "alternatively", ",", "could", "mask", "such", "a", "site", ".", "On", "the", "other", "hand", ",", "transcription", "originating", "from", "the", "promoter", "spanning", "the", "BamHI", "site", "just", "upstream", "of", "cl", "would", "start", "at", "a", "site", "within", "the", "inverted", "repeat", "sequence", ",", "forming", "a", "comparatively", "less", "stable", "stem", "-", "loop", "structure", "of", "about", "8", "bps", ".", "The", "role", "of", "the", "inverted", "repeat", "region", "in", "the", "regulation", "of", "cl", "expression", "is", "currently", "under", "investigation", ".", "\n\n ", "ACKNOWLEDGEMENTS", "\n\n ", "We", "thank", "Heinz", "Schuster", "for", "his", "review", "of", "the", "manuscript", ".", "This", "work", "was", "supported", "by", "National", "Science", "Foundation", "grant", "DMB-8704146", ".", "\n\n ", "7679", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Abbreviations", ":", "bp", ",", "basepairs", ";", "kb", ",", "kilobase", "pairs", ";", "X", "-", "Gal", ",", "5-Bromo-4-Chloro-3-indolylbeta", "-", "D", "-", "galactopyranoside", ".", "\n\n ", "*", "To", "whom", "correspondence", "should", "be", "addressed", "\n\n ", "REFERENCES", "\n\n ", "1", ".", "Yarmolinsky", ",", "M.B.", ",", "and", "Steinberg", ",", "N.", "(", "1988", ")", ".", "In", "Calendar", ",", "R.", ",", "(", "ed", ".", ")", ",", "The", "Bacteriophages", ",", "Plenum", "Publishing", "\n\n ", "Corp", ".", ",", "NY", ",", "Vol", ".", "1", ",", "pp", ".", "291", "-", "438", ".", "\n\n ", "2", ".", "Baumstark", ",", "B.R.", ",", "Stovall", ",", "S.R.", ",", "and", "Ashkar", ",", "S.", "(", "1987", ")", ".", "Virology", "156", ",", "404", "-", "413", ".", "\n\n ", "3", ".", "Dreiseikelmann", ",", "B.", ",", "Velleman", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1988", ")", ".", "J.", "Biol", ".", "Chem", ".", "263", ",", "1391", "-", "1397", ".", "\n\n ", "4", ".", "Heinrich", ",", "J.", ",", "Riedel", ",", "H.-D.", ",", "Baumstark", ",", "B.R.", ",", "Kimura", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1989", ")", ".", "Nucleic", "Acids", "Res", ",", "\n\n ", "this", "volume", ".", "\n\n ", "5", ".", "Eliason", ",", "J.L.", ",", "and", "Stemnberg", ",", "N.", "(", "1987", ")", ".", "J.", "Mol", ".", "Biol", ".", "198", ",", "281", "-", "293", ".", "\n\n ", "6", ".", "Velleman", ",", "M.", ",", "Dreiseikelmann", ",", "B.", ",", "and", "Schuster", ",", "H.", "(", "1987", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "84", ",", "5570", "-", "5574", ".", "7", ".", "Citron", ",", "M.", ",", "Velleman", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1988", ")", ".", "J.", "Biol", ".", "Chem", ".", "264", ",", "3611", "-", "3617", ".", "\n\n ", "8", ".", "Chadwick", ",", "P.", ",", "Pirotta", ",", "V.", ",", "Steinberg", ",", "R.", ",", "Hopkins", ",", "N.", ",", "and", "Ptashne", ",", "M.", "(", "1970", ")", ".", "Cold", "Spring", "Harbor", "Symp", ".", "\n\n ", "Quant", ".", "Biol", ".", "35", ",", "283", "-", "294", ".", "\n\n ", "9", ".", "Chesney", ",", "R.H.", ",", "and", "Scott", ",", "J.R.", "(", "1975", ")", ".", "Virology", "67", ",", "375", "-", "384", ".", "\n\n ", "10", ".", "Wandersman", ",", "C.", ",", "and", "Yarmolinsky", ",", "M.", "(", "1977", ")", ".", "Virology", "78", ",", "267", "-", "276", ".", "\n\n ", "11", ".", "Scott", ",", "J.R.", ",", "West", ",", "B.W.", ",", "and", "Laping", ",", "J.L.", "(", "1978", ")", ".", "Virology", "85", ",", "587", "-", "600", ".", "12", ".", "Pabo", ",", "C.O.", ",", "and", "Sauer", ",", "R.", "A.", "(", "1984", ")", ".", "Ann", ".", "Rev", ".", "Biochem", ".", "53", ",", "293", "-", "321", ".", "13", ".", "Scott", ",", "J.R.", "(", "1974", ")", ".", "Virology", "62", ",", "344", "-", "349", ".", "\n\n ", "14", ".", "Schneider", ",", "K.", ",", "and", "Beck", ",", "C.F.", "(", "1987", ")", ".", "Methods", "in", "Enzymol", ".", "153", ",", "452", "-", "461", ".", "15", ".", "Smith", ",", "H.W.", "(", "1972", ")", ".", "Nature", "New", "Biol", ".", "238", ",", "205", "-", "206", ".", "16", ".", "Scott", ",", "J.R.", "(", "1975", ")", ".", "Virology", "65", ",", "173", "-", "178", ".", "\n\n ", "17", ".", "Scott", ",", "J.R.", ",", "Kropf", ",", "M.M.", ",", "and", "Mendelson", ",", "L.", "(", "1977", ")", ".", "Virology", "76", ",", "39", "-", "46", ".", "18", ".", "Scott", ",", "J.R.", "(", "1968", ")", ".", "Virology", "36", ",", "564", "-", "574", ".", "\n\n ", "19", ".", "Walker", ",", "D.H.", ",", "Jr", ".", ",", "and", "Walker", ",", "J.T.", "(", "1976", ")", ".", "J.", "Virol", ".", "20", ",", "177", "-", "187", ".", "20", ".", "Stemnberg", ",", "N.", "(", "1979", ")", ".", "Virology", "96", ",", "129", "-", "142", ".", "\n\n ", "21", ".", "Schneider", ",", "K.", ",", "and", "Beck", ",", "C.F.", "(", "1986", ")", ".", "Gene", "42", ",", "37", "-", "48", ".", "\n\n ", "22", ".", "Taylor", ",", "D.P.", ",", "and", "Cohen", ",", "S.N.", "(", "1979", ")", ".", "J.", "Bacteriol", ".", "137", ",", "92", "-", "104", ".", "\n\n ", "23", ".", "Miller", ",", "J.H.", "(", "1972", ")", ".", "In", "Experiments", "in", "Molecular", "Genetics", ",", "Cold", "Spring", "Harbor", "Laboratory", ",", "Cold", "Spring", "\n\n ", "Harbor", ",", "N.Y.", "352", "-", "355", ".", "\n\n ", "24", ".", "Guyer", ",", "R.S.", "(", "1978", ")", ".", "J.", "Mol", ".", "Biol", ".", "126", ",", "347", "-", "365", ".", "\n\n ", "25", ".", "Devlin", ",", "B.H.", ",", "Baumstark", ",", "B.R.", ",", "and", "Scott", ",", "J.R.", "(", "1982", ")", ".", "Virology", "120", ",", "360", "-", "375", ".", "\n\n ", "26", ".", "Sanger", ",", "F.", ",", "Nicklen", ",", "S.", ",", "and", "Coulson", ",", "A.R.", "(", "1977", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "74", ",", "5463", "-", "5467", ".", "27", ".", "DeVries", ",", "J.K.", ",", "and", "Zubay", ",", "G.", "(", "1967", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "57", ",", "1010", "-", "1012", ".", "\n\n ", "28", ".", "Heilmann", ",", "H.", ",", "Reeve", ",", "J.R.", ",", "and", "Puhler", ",", "A.", "(", "1980", ")", ".", "Mol", ".", "Gen", ".", "Genet", ".", "178", ",", "149", "-", "154", ".", "29", ".", "Shine", ",", "J.", ",", "and", "Dalgarno", ",", "L.", "(", "1974", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "71", ",", "1342", "-", "1346", ".", "30", ".", "Chou", ",", "P.Y.", ",", "and", "Fasman", ",", "G.D.", "(", "1978", ")", ".", "Adv", ".", "Enzymol", ".", "47", ",", "45", "-", "148", ".", "31", ".", "Berg", ",", "J.M.", "(", "1986", ")", ".", "Nature", "319", ",", "264", "-", "265", ".", "\n\n ", "32", ".", "Landschultz", ",", "W.H.", ",", "Johnson", ",", "P.F.", ",", "and", "McKnight", ",", "S.L.", "(", "1988", ")", ".", "Science", "240", ",", "1759", "-", "1764", ".", "33", ".", "Murre", ",", "C.", ",", "McCaw", ",", "P.", ",", "and", "Baltimore", ",", "D.", "Cell", "56", ",", "777", "-", "783", ".", "\n\n ", "34", ".", "Anderson", ",", "B.E.", ",", "Baumstark", ",", "B.R.", ",", "and", "Bellini", ",", "W.J.", "(", "1988", ")", ".", "J.", "Bacteriol", ".", "170", ",", "4493", "-", "4500", ".", "35", ".", "Rosenberg", ",", "M.", ",", "and", "Court", ",", "D.", "(", "1979", ")", ".", "Annu", ".", "Rev", ".", "Genet", ".", "13", ",", "319", "-", "353", ".", "\n\n ", "36", ".", "Ebright", ",", "R.H.", ",", "Cossart", ",", "P.", ",", "Gicquel", "-", "Sanzey", ",", "B.", ",", "and", "Beckwith", ",", "J.", "(", "1984", ")", ".", "Nature", "311", ",", "232", "-", "235", ".", "37", ".", "Ptashne", ",", "M.", "(", "1986", ")", ".", "Nature", "322", ",", "697", "-", "701", ".", "\n\n ", "38", ".", "Stemnberg", ",", "N.", ",", "and", "Hoess", ",", "R.", "(", "1983", ")", ".", "Annu", ".", "Rev", ".", "Genet", ".", "17", ",", "123", "-", "154", ".", "39", ".", "Scott", ",", "J.R.", "(", "1980", ")", ".", "Curr", ".", "Top", ".", "Microbiol", ".", "Immunol", ".", "90", ",", "49", "-", "65", ".", "\n\n ", "7680", "\n\n ", "This", "article", ",", "submitted", "on", "disc", ",", "has", "been", "automatically", "\n\n ", "converted", "into", "this", "typeset", "format", "by", "the", "publisher", "." ]
[ "species" ]
E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species, E. coli is a species
30_task1
Sentence: The c1 genes of P1 and P7. Abstract The c1 genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7c1 expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the P1c1 repressor. The c1 regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-turn-helix motif commonly associated with repressor proteins. Two P1c1 amber mutations were localized to the 283-amino acid open reading frame. The P1c1 and P7c1 sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the c1 gene from either phage cause the repression of transcription from a cloned promoter situated upstream of P1c1.Images Volme 7 Nmbe 19198 Nulei Acds eserc The cl genes of P1 and P7 Francis A.Osborne, Sonja R.Stovall and Barbara R.Baumstark* Department of Biology, Georgia State University, Atlanta, GA 30303, USA Received July 11, 1989; Revised and Accepted August 29, 1989 EMBL accession nos X16005, X16006 ABSTRACT The cl genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7cl expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the Plcl repressor. The cl regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-tum-helix motif commonly associated with repressor proteins. Two Plcl amber mutations were localized to the 283-amino acid open reading frame. The Plcl and P7cl sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the cI gene from either phage cause the repression of transcription from a cloned promoter situated upstream of Plcl. INTRODUCTION The cl genes of the plasmid prophages P1 and P7 code for repressor proteins that are required for the establishment and maintenance of lysogeny (reviewed in 1). A protein corresponding to the Plcl repressor has been isolated and shown to be a sequence-specific DNA binding protein that recognizes several widely dispersed sites on the phage DNA (2-7). The consensus DNA sequence recognized by the Plcl repressor (ATTTATTAGAGCA[A/T]T) contains no discernable bilateral symmetry, a feature that is highly unusual among prokaryotic operator sites. P1 and P7 are heteroimmune; that is, each phage is able to establish a lytic infection on a lysogen of the other phage. In this sense, their relationship is analogous to that of phage X and 434, which differ in the DNA specificity of their cI repressor proteins (8). However, genetic studies indicate that Plcl and P7cl can be crossed into the heterologous phage without affecting the immunity specificity of the recipient (9). The basis for P1/P7 heteroimmunity has been localized to a second regulatory gene, c4, that is unlinked to cl. The c4 gene products prevent the expression of antireb, a closely linked gene that interferes with cl-mediated repression (10, 11). According to current models, P1/P7 heteroimmunity results from the inability of the c4 repressor of one phage to prevent antireb expression from the heteroimmune phage genome (10, 11). Because the cl genes of P1 and P7 are genetically interchangeable, it is anticipated that the two gene products carry out similar or identical regulatory functions. The studies presented in this paper were undertaken to investigate the biochemical basis for the apparent genetic identity of the two cl genes. In this paper, we present the DNA sequence of the cl genes of P1 and P7 and the predicted amino acid sequence of the cl repressor proteins. We report that Plcl and P7cl code for proteins of identical size (283 amino acids) and Nucleic Acids Research Volume 17 Number 19 1989 767 1 (r IRL Press Nucleic Acids Research nearly identical sequence. We report further that both repressors prevent the expression of a promoter located immediately upstream of the Plc 1 open reading frame, an observation that confirms their functional similarity and suggests an autoregulatory role for the two proteins. Analysis of the secondary structure predicted by the open reading frames does not reveal the characteristic helix-turn-helix (12) or other motifs commonly associated with DNA binding proteins. MATERIALS AND METHODS Bacterial and phage strains. E. coli K336 is a SuO derivative of K140 (13). E. coli CB454 is a recA-, lacZderivative of K-12 (14). P1 + is described by Scott (13). P7+ is the strain of Smith (15), as described by Scott (16). P7cl. 1 contains a missense mutation in the cl gene (17). The P7 phage strains and the cl amber mutant phage strains PIci .245Cm, Plc1. 169 and P Ic .55 (11) were generously provided by June Scott. Enzymes and reagents. Restriction enzymes, T4 DNA ligase and polymerase, and the Klenow fragment of E. coli DNA polymerase were purchased from Boehringer Biochemicals or New England Biolabs and reactions were carried out according to the manufacturers' instructions. DNA sequencing kits and in vitro transcription-translation kits were purchased from Bethesda Research Laboratories and Amersham Corporation, respectively. Synthetic oligonucleotides to be used as sequencing primers were prepared on an Applied Biosystems DNA synthesizer. Plasmid construction. pBRB7.2. pBRB7.2 (2) contains a 3.2 kb EcoRI/PvuII fragment from the cl region of P1 (Figure 1) inserted into the 2.3 kb EcoRIlPvuII fragment of pBR322 that contains the origin of replication and the f3-lactamase gene. pFA02. P7 plasmid DNA was digested with PvuII, ligated to similarly digested pBR322, and transformed into E. coli K336. Ampicillin-resistant colonies were screened for cl activity by cross-streak complementation analysis against P7cl.1 (18). pFAO2 contains a 3.5 kb insert of P7 DNA. The fragment was localized to the cl region of the P7 genome by Southern hybridization against P1 and P7 DNA that had been digested with BamHI and BglII (data not shown). pBRBJ69. 1 and pBRB55. 1. The PI cI open reading frame was previously localized to a 2.6 kb EcoRlIBamHI fragment derived from PlEcoRI-7 (2). This fragment also contains the wildtype allele for the conditional lethal mutation am43 (19, 20). To clone the cl reading frame from the amber mutant phage Plc1.169 and P Ic .55, we digested phage DNA with EcoRI and BamHI, ligated the digestion products into similarly digested pBR322, and transformed the ligation mixture into E. coli K336. Ampicillin-resistant, tetracyclinesensitive colonies were screened by cross-streak complementation analysis for their ability to support the growth of Plam43. Plasmid DNA isolated from complementation-positive cells was shown by agarose gel electrophoresis to carry plasmids containing the 2.6 kb EcoRIlBamHI fragment from the cl region. The cl mutant open reading frames were placed under the control of normal regulatory signals present in the cI region by digesting the cl.55 and cl. 169-containing plasmids with BamHI and PvuII and inserting a 601 bp BamHI/PvuH fragment containing the cl promoter region (2). The resulting plasmids, pBRB55.1 and pBRB169.1, respectively, contain the 3.2 kb EcoRllPvuIl fragment analogous to that present in pBRB7.2 (Figure 1). pBCB2. 13-2.18. To identify cl-repressible promoters, we introduced selected fragments 7672 Nucleic Acids Research 4 f - - + I 4 P1 4- 4- 4 ECAR H C B R P 4 4.4,~ 4, 1 1 4. I 4, I 11 t t t t t E G R N E B R P 4 4 - 4 1 ' '110z I I I I I I 1 3.2 1.5 1.0 0.5 0 P7 pBRB7.2 -------------------cl1------------- r ~ / >' pFAO2 *-lacZ pBCB2.13 <-lacZ Z pBCB2.16 <-lacZX pBCB2.18 Fig. 1. The cl regions of P1 and P7. A restriction map is indicated by the solid line in the upper part of the figure. Sites for EcoRI (E), Pvul (P), NnrI (N), Bgll (G), BamHI (B), and EcoRV (R) are shown. The sequencing strategy is indicated by the horizontal arrows. Letters and arrows above and below the map refer to sites and sequence analysis for P1 and P7, respectively. The size of this region (in kilobase pairs) is indicated below the map. The DNA fragments present in selected plasmids are illustrated by boxes at the bottom of the figure. The dashed line reveals the approximate position of the cl gene (2). The sites of the -yb mutations introduced into pFA02 are indicated by asterisks. pFA02.16 and pFA02.26 contain insertions located 0.9 kb and 1.4 kb, respectively, from the PvuIl site at the left side of the map. The direction of the lacZ open reading frame in pBCB2.13-18 is indicated by the adjacent arrow. from the cI region of P1 into pCB192, a promoter-probe vector containing promoterless copies of lacZ and galK extending in opposite directions from a multiple cloning site (21). The source of P1 DNA for these constructions was pZHA3, a derivative of pBRB7.2 that contains a HindIlI linker at the single EcoRV site located about 200 bps upstream of the cl open reading frame (Figure 1). pBCB2.13 contains a 460 bp fragment of P1 DNA extending from the EcoRV site to a Bgll site within the cI open reading frame. pBCB2. 16 contains a 130 bp fragment extending from the EcoRV site to a BamHI site located about 100 bps upstream of the cl open reading frame, while pBCB2.18 contains the region extending from this BamHI site to the Bglll site within the open reading frame (Figure 1). The orientation of the P1 DNA fragments within these plasmids was confirmed by restriction mapping and DNA sequencing. To test for the regulation of promoter expression by cl, we transformed pBCB2.13 and its derivatives into CB454(pBRB7.152) and CB454(pFAO2.152), two strains that express P7cl and Pll, respectively, from the pCB192-compatible kanamycin-resistant vector pDPT152 (22). Cells harboring both plasmids were selected by their resistance to both ampicillin and kanamycin. lacZ expression was measured by the procedure of Miller (23). pBRB7.152 was generated by introducing PlEcoRI-7 into pDPT152. pBRB7.152 has sustained a spontaneous deletion within the EcoRI-7 fragment that results in the loss of 2.5 kb of P1 DNA from the far left side of the P1 genetic map, but retains the 3.2 kb PvuHlEcoRI fragment required for cl expression that is present in pBRB7.2 (Figure 1). 7673 z I 011Z I e., Nucleic Acids Research Table 1. Complementation of PIci .245 by plasmids that contain cI genes. Phenotype Efficiency Relative of of Efficiency of Plasmid cI gene Lysogeny Lysogeny pBR322 1.5x 10-6 6.0x 10-6 pBRB7.2 Plcl+ 2.5 x 10-' 1.0 pBRB55.1 Plcl-am 1.4 x 10-6 5.6 x 10-6 pBRB169.1 PlCl-am 2.1 x 10-6 8.4 x 10-6 pFAO2 P7cl+ 8.7 x 10-2 0.35 pFAO2.16 P7c I-, 4.7 x 10-6 1.9 X 10-5 pFAO2.26 P7cI -1 3.1 x 10-6 1.2 x 10-5 Complementation for lysogeny was carried out as described by Devlin et al. (26). The plasmids were carried by E. coli K336. Cells were grown to mid-log phase at 370 in LB containing 50 tig/m1 sodium ampicillin and infected with Plcl.245 at a multiplicity of infection of 5 in the presence of 50 mM CaC12. After 10 minutes, non-absorbed phage were removed by centrifugation and the infection was allowed to proceed for 2 hours at 370. The infected cells were plated on LB plates containing 50 pLg/ml sodium ampicillin, 50 pLg/ml chloramphenicol, and 40 mM sodium citrate. The efficiency of lysogeny is defined as the number of ApRCmR cells at the end of infection divided by the number of ApR cells present at the start of the infection. To construct pFA02.152, we introduced a 2.8 kb EcoRV fragment of P7 DNA containing the cl gene (Figure 1) into the single EcoRI site of pDPT152 after it had been rendered blunt-ended by extension with T4 DNA polymerase. cl expression by cells harboring either pBRB7.152 or pFA02.152 was confirmed by measuring their ability to form chloramphenicol-resistant lysogens when infected with Plcl.245Cm. ,yb insertional mutagenesis. Insertional mutagenesis of P7cl was carried out using the 'yb transposon of F (24) as described by Devlin et al. (25). E. coli W1485(pFA02) was mated with the F- strain MX648 and subsequently plated on ampicillin (to select for the plasmid) and streptomycin sulfate (to select for the recipient strain). Transconjugants which could support only lytic growth upon infection by P7cl .1 (as scored by cross-streak analysis; 18) were assumed to have lost cl-complementing activity and were characterized further. The positions of two cl - insertional mutations, carried by pFA02.16 and pFA02.26, were identified by restriction mapping (Figure 1). DNA sequencing. DNA sequence analysis was carried out using the M13-dideoxy technique of Sanger et al. (26). Selected DNA fragments containing the cl wildtype or mutant genes were introduced into M13 mp8 or mp9. 18-nucleotide oligomers complementary to defined sequences within the cl gene were extended using the Klenow fragment of DNA polymerase in the presence of dideoxynucleotide triphosphates and analyzed by polyacrylamide-urea gel electrophoresis. The sequencing strategy is shown in Figure 1. RESULTS Localization of the P7cJ gene. Initial localization of the P7cl gene was undertaken by subjecting pFA02 to 'yb mutagenesis and determining the map position of inserts which destroy the ability of the plasmids to complement a P7cl - mutation (as determined by cross-streak analysis). pFA02 and the -yb insertion mutants were tested further by comparing their ability to complement a PIcI amber mutation with the complementation activity of plasmids containing cl genes isolated 7674 Nucleic Acids Research B C D E F G *.4 68 43 29- _ - =I = Am~ W _ 18 14 p Fig. 2. In vitro transcription-translation of plasmids carrying the cl region of P1 and P7. Proteins encoded by selected plasmids were labeled with 35S methionine according to the procedure of DeVries and Zubay (27), using a commercial in vitro transcription/tramnslation kit from Amersham Corporation. The reaction mixtures were subjected to electrophoresis on a 12.5% SDS-polyacrylamide gel and the labeled proteins were visualized by autoradiography. The migration of 14C-labeled protein molecular weight standards (Bethesda Research Laboratories) is indicated at the left side of the figure. Plasmids present in each lane are: A. pBRB55.1; B. pBRB169.1; C. pBRB7.2; D. pFAO2; E. pFAO2.16; F. pFAO2.26; G. pBR322. from P1 wildtype and amber mutants. Lysogeny by cells infected with Plcl.245Cm was scored as the growth of infected cells on ampicillin (to select for the resident plasmid) and chloramphenicol (to select for the phage genome). The values observed for the two plasmids containing Plcl and P7cl (pBRB7.2 and pFA02, respectively) are very similar and significantly higher than those obtained for pBR322 or for any of the plasmids carrying Table 2. Assay for lacZ expression from plasmids containing P1 DNA fragments. ,3-galactosidase activity (units) minus cI plus Pici plus P7cl relative activity (pDPT152) (pBB7. 152) (pFA02.152) +PICJ +P7cJ pCB192 0.58 0.55 0.54 0.95 0.93 pBCB2.13 154 15.2 13.6 0.10 0.09 pBCB2.16 1.1 1.2 1.1 1.1 1.0 pBCB2.18 4.0 3.4 3.9 0.9 1.0 Cells containing derivatives of the ApR promoter-probe plasmid pCB192 and the compatible KnR plasmid pDPT152 were grown in LB at 37?. When they reached mid-log phase, the cells were chilled, lysed, and assayed for (3-galactosidase activity according to the procedure of Miller (23). Plasmids derived from pCB192 are indicated at the left side of the Table. Plasmids derived from pDPT152 are indicated in parentheses across the top of the Table. The values reported are the average of two independent experiments. Relative activity is defined as the f3-galactosidase activity measured in cells harboring plasmids expressing cl divided by the activity measured in cells carrying only pDPT152. 7675 Nucleic Acids Research GATATCCAATCAGGAGTACC GCATCACCCAAGACGACCTG GATGATCTCACTGACACAAT CGAATATCTCATGGCCACTA ACCAGCCAGACTCACAATAAATGCA 105 v-- TtgAca TATAATG CTAATAAATCTATTATTTTC GTTGGATCCTTCTATAATGG TGGCCAACAACTCCCAGTGT AATCCGCTGTGAGTTGTTGG CCATGTCAATTCTGGAGGAGGATCA 210 b----- I I GGAGGtG ATG ATA AAT TAT GTC TAC GGC GAA CAA CTG TAC CAG GAG TTC GTC AGC TTC AGG GAT CTC TTT CTA AAA AAA GCT GTT GCA CGC GCC CAA 300 MET lIe Asn Tyr Vat Tyr Gly Glu Gin Leu Tyr Gin Gtu Phe Vat Ser Phe Arg Asp Leu Phe Leu Lys Lys Ala Val Ala Arg Ala Gtn tag(cl .55) CAC GTT GAT GCC GCC AGC GAC GGT CGT CCT GTT CGC CCG GTT GTC GTT CTG CCG TTC AM GM ACG GAC AGC ATT CAG GCT GMA ATT GAT 390 His Val Asp Ala Ala Ser Asp Gly Arg Pro Vat Arg Pro Vat Vat Vat Leu Pro Phe Lys Glu Thr Asp Ser lIe Gin Ala Glu lie Asp T A C A G AAA TGG ACA TTA ATG GCG CGG GAA CTG GAG CAG TAC CCA GAT CTC MT ATC CCA MG ACT ATT TTA TAT CCT GTA CCT AAC ATC CTT CGC 480 9 Lys Trp Thr Leu MET Ala Arg Glu Leu Gtu Gin Tyr Pro Asp Leu Asn lIe Pro Lys Thr lie Leu Tyr Pro Vat Pro Asn lIe Leu Arg A T C GGT GTG CGT AAG GTT ACG ACT TAT CAG ACA GAA GCA GTG MC AGC GTC AAT ATG ACC GCT GGC CGC ATT ATT CAT CTG ATT GAT AAG GAC 570 Gly Vat Arg Lys Vat Thr Thr Tyr Gin Thr Glu Ala Vat Asn Ser Vat Asn MET Thr Ala Gly Arg lIe lIe His Leu lIe Asp Lys Asp G ATT CGC ATC CAA AM AGC GCG GGG ATC MT GAG CAC AGT GCG AAA TAC ATA GAG MC CTG GAA GCA ACA AM GAG CTA ATG AAG CAG TAC 660 lle Arg lIe Gin Lys Ser Ala Gly lIe Asn Gtu His Ser Ala Lys Tyr lIe Gtu Asn Leu Gtu Ala Thr Lys Gtu Leu MET Lys Gin Tyr T T CCG GAG GAT GAA AAA TTC CGT ATG CGC GTA CAC GGC TTT AGC GAA ACA ATG CTG CGC GTC CAT TAC ATT TCC AGT AGC CCT AAC TAC AAT 750 Pro Glu Asp Glu Lys Phe Arg MET Arg Vat His Gly Phe Ser Gtu Thr MET Leu Arg Vat His Tyr lie Ser Ser Ser Pro Asn Tyr Asn Phe T C G T T I ~~~I I II GAT GGC MA TCA GTT AGT TAC CAT GTG CTG CTA TGT GGC GTG TTT ATC TGC GAT GM ACT CTC CGA GAT GGA ATC ATC ATC AAC GGT GAA 840 e.. Asp Gly Lys Ser Vat Ser Tyr His Vat Leu Leu Cys Gly Vat Phe lie Cys Asp Glu Thr Leu Arg Asp Gly lIe lie lIe Asn Gly Gtu Pro C tag(cl .169) TTT GAG AM GCA AAA TTT AGC CTT TAT GAC TCT ATA GM CCG ATC ATC TGC GAC CGC TGG CCG CAG GCA AM ATA TAT CGC CTG GCA GAT 930 Phe Gtu Lys Ala Lys Phe Ser Leu Tyr Asp Ser lIe Glu Pro lie lie Cys Asp Arg Trp Pro Gin Ala Lys lIe Tyr Arg Leu Ala Asp T ATT GM MT GTA AM AM CM ATT GCC ATC ACT CGC GM GAG AAA G GTC AM TCA GCC GCA TCA GTT ACG CGC AGC CGC AAA ACT AAG 1020 n----- lie Glu Asn Vat Lys Lys Gin lIe Ala lie Thr Arg Glu Glu Lys Lys Vat Lys Ser Ala Ala Ser Vat Thr Arg Ser Arg Lys Thr Lys AAG GGG CAG CCA GTA AAC GAC MC CCC GAA AGC GCG CM TAG Lys Gly Gin Pro Val Asn Asp Asn Pro Glu Ser Ala Gin ter Fig. 3. DNA sequence of PIcI and P7cl. The DNA sequence of PIcI is indicated. Positions where the sequence of P7cl differs from that of Plcl are indicated above the P1 sequence. The amino acid sequence predicted by the open reading frame is given below the sequence. The two amino acid substitutions present in P7cl are shown below the open reading frame. The locations of the amber mutant codons in cl.55 and ci. 169 are indicated by small letters above the sequence. Sites for selected restriction enzymes (EcoRV [v]; BamHI [b]; Bgll [g]; EcoRP [e]; and NruI [n]) are illustrated by dashed lines beneath the sequence. The cl repressor binding site is underlined. Inverted arrows beneath the sequence illustrate the inverted repeat sequence upstream of the open reading frame. Predicted promoter ribosome binding sites are indicated by the presence of the consensus sequences above and below the line, respectively. The DNA sequences of Plcl from bp 1-134 and bp 1-434 were reported previously (2,5). mutant cl genes from either P1 or P7 (Table 1). The efficiency with which a cloned P7cl gene complements a PlcI mutation confirms previous genetic studies indicating that these two genes are functionally interchangeable (9). The location of the 'y6 mutations that destroy cl-complementing activity suggests that the P7cl open reading frame occupies a map position similar to that of the P1 open reading frame (Figure 1). 7676 Nucleic Acids Research Proteins produced by fragments containing Plcl. As an initial step in the comparison of the P1 and P7 repressors, we analyzed the gene products expressed from the cloned cl regions. In an in vitro transcription-translation reaction, plasmids coding for the wildtpe alleles of either PIcI or P7cl direct the production of a protein with an estimated molecular weight of 33,000 daltons (Figure 2, Lanes C and D), a size that agrees closely with the predicted molecular weight of the PIcI repressor reported previously (3,28). The loss of the 33,000 dalton protein in the cl - 'ya-induced P7 mutant plasmids (Figure 2, Lanes E and F) is consistent with its designation as the P7cl repressor. As expected, the 33,000 dalton protein is not observed when reaction mixtures contain DNA from Plcl amber mutants (Figure 2, Lanes A and B). DNA sequence analysis of the cl genes. To make a direct comparison between the Plcl and P7cl DNA sequences and to predict the amino acid sequences of the repressor proteins, we carried out M 13-dideoxy sequence analysis of cloned fragments carrying the cl genes. The sequences of about 1 kb of P1 and P7 DNA were determined starting from a common EcoRV site predicted to lie approximately 200 bps upstream of the cl genes. The P1 and P7 sequences (Figure 3) both contain an ATG initiation codon preceded by a putative ribosome binding sequence (29) situated 211 bps downstream of the EcoRV site. In each case, the initiation codon is followed by an open reading reading frame extending for 283 codons. The P1 and P7 open reading frames code for proteins with predicted molecular weights (32,515 and 32,499 daltons, respectively) that agree closely with the values of the proteins expressed from the cloned DNA fragments (Figure 2) and with results predicted independently for the purified PIcI repressor (3-4). The localization of two PIcI amber mutations to the P1 open reading frame confirms its identification as the cI coding sequence. cI. 169 contains an amber mutation that would result in a protein fragment of 26,680 daltons, a value that agrees well with the size of a protein fragment observed under the in vitro transcription/translation reaction conditions (Figure 2, Lane B). The cl.55 amber mutation lies close to the N-terminal region of the protein, resulting in the production of a fragment of 55 amino acids that is apparently too small to resolve under the electrophoretic conditions used for separation of the proteins. Over 60% of the amino acid sequence predicted for the PIcI open reading frame has been verified by amino acid sequence analysis of peptide fragments isolated from the purified repressor protein (see accompanying paper, reference 3). The DNA sequences of P1 and P7 are identical for a 399-bp region that extends from the EcoRV site at the 5' side of the cl gene to a point 188 bps within the open reading frame. The sequences within the Plcl and the P7cl open reading frames differ at only 18 positions, all but two of which occur in the wobble position of the predicted codon. From these results, we conclude that the functional identity of the P1 and P7 cl genes is a consequence of their nearly identical amino acid sequence. Analysis of promoters upstream of the cl open reading frame. Expression of Plcl was shown previously to require sequences on the distal side of a BamHI site (2, 5) located about 100 bps upstream of the open reading frame (Figure 3). A binding site for the cl repressor has also been shown to exist close to this BamHI site (2, 5, 6). To determine whether this region contains a promoter that is detectable in vivo and, further, to determine whether this promoter can be regulated by cl repressor proteins from either P1 or P7, we introduced several DNA fragments from this region into the promoter probe vector pCB192, screened for promoter activity (as monitored by lacZ expression) and checked for repression of this activity in the presence of a compatible 7677 Nucleic Acids Research plasmid expressing Plcl or P7cl. Cells harboring pBCB2.13 (a plasmid which carries a 460 bp fragment of P1 DNA that extends across the BamHI site upstream of cl into the open reading frame) are dark blue in the presence of Xgal and produce significant levels of 3-galactosidase (Table 2). In contrast, pBCB2.16 and pBCB2.18 (which each contain DNA from only one side of the BamHI site located in pBCB2. 13) do not confer a blue color on their host cell in the presence of X-Gal and express negligible amounts of 3-galactosidase (Table 2). These observations suggest that expression from the promoter identified here requires sequences that span the BamHI site upstream of cl. Expression of cl from a compatible plasmid in the presence of pBCB2. 13 results in a 90% reduction in promoter strength (Table 2). This reduction is seen in the presence of either Plcl or P7cl, indicating that the two repressor proteins are both capable of repressing expression from this promoter. DISCUSSION. The DNA sequences of Plcl and P7cl differ at only 18 sites, all but two of which occur at the third position of the affected codon. This observation provides biochemical confirmation of the functional identity predicted on the basis of previous genetic analysis (9). A number of DNA binding proteins exhibit a common structural motif in which two helices are separated by a glycine residue (12). This motif is not observed in the predicted secondary structures (30) of the Plcl and P7cl amino acid sequences. A sequence with some similarity to the XCro helix-turn-helix region was previously reported near the Nterminus of the PIcI protein (5); however, it was noted that the potential for helix formation is disrupted by the presence of several prolines within the region. The secondary structure predicted for the Plcl and P7cl repressor proteins (30) does not reveal other structural characteristics (e.g., Zn fingers (31), leucine zippers (32), or helix-loop-helix motifs (33)) that have been associated with DNA binding activity in other systems. A search of the GenBank and EMBL databases does not reveal any other known regulatory proteins with significant amino acid similarity to the Plcl or the P7cl repressor sequences. Since the Plcl repressor differs from most other repressors in DNA binding specificity (i.e., in its recognition of an asymmetric operator sequence), it is not unexpected to find that the protein does not exhibit common structural motifs at the amino acid level. The cl-repressible promoter described in this report is located in a region just upstream of the cl open reading frame and is oriented in the direction of cl. Because the promoter is present on a multicopy plasmid, it is not possible to make a direct calculation of promoter strength; however, the values observed are about five-fold lower than the levels produced by a derivative of pCB192 that contains the plac promoter from pUC19 (34). Because sequences on both sides of the BamHI site located upstream of cl are required for promoter activity (Table 2), we suggest that the promoter spans this site. Less than 10 bps downstream of this BamHI site is a heptanucleotide sequence (TATAATG) that is identical to the -10 consensus sequence for RNA polymerase (35). If this sequence does indeed correspond to the -10 region of the promoter, the -35 region would be predicted to lie on the other side of the BamHI site in a region that overlaps a known cI repressor binding site (2-5). Analysis of this region does not reveal any sequences with significant similarity to the -35 consensus sequence. The best fit is the sequence TCTATT (Figure 3), which matches only two positions of the -35 consensus (TTGACA). The lack of a strong -35 region is often observed with genes that require an activator. Although a pentanucleotide sequence corresponding to the conserved portion of the CRP protein consensus binding site (36) 7678 Nucleic Acids Research is located just upstream of the predicted -35 region (at position 91; Figure 3), a role for CRP-mediated activation in cl expression has not previously been described. The orientation of the promoter and its cl-repressible character raise the possibility that cl expression is autoregulatory. If this is so, one potential activator would be the cl repressor itself. Expression cannot be absolutely dependent on cl-mediated activation, however, because the cloned promoter exhibits significant activity in the absence of the cl gene (Table 2). Under the conditions reported here, the presence of the cl gene results in a decrease rather than an increase in lacZ expression; however, these observations do not rule out a potential activator role for the cl protein, since the ratios of repressor and operator provided by the multicopy plasmids may not be optimal for activation. Physiologically, the role of additional repressor binding sites in regulating cl expression also cannot be discounted. Three potential operator sites have been identified several hundred bps upstream of the cI open reading frame (2-5); one or more of these could be involved (possibly through a DNA looping mechanism; 37) in the activation or repression of cl expression during phage growth. A cl-repressible promoter oriented in the direction of cl was previously reported (38) to be located entirely within PlBamHI-9, a fragment located upstream of cl which is bracketed by the BamHI site within pBCB2. 13. Because sequences on both sides of this BamHI site are required for the activity of the promoter in pBCB2.13, we suggest that the previously identified promoter is distinct from the one reported here. The promoter from BamHI-9 could correspond to a consensus promoter sequence that is situated about 500 bps upstream of cl and overlaps a cl repressor binding site (2). If so, cl expression is likely to be controlled by more than one promoter. Located between this promoter sequence and the promoter encoded on pBCB2. 13 is an open reading frame whose product (termed coi, or c-one inactivator) has been implicated in the establishment of lytic growth (1, 39; B.R. Baumstark, unpublished results). It has been suggested (2) that the decision to enter lytic or lysogenic growth is influenced by the level of transcription initiated from the distal promoter (which would transcribe coi prior to the transcription of cl) relative to that of the promoter located immediately upstream of the cl gene (which would transcribe only ci). A 32-nucleotide hyphenated inverted repeat sequence is located just upstream of the cl open reading frame (positions 146-188; Figure 3). It is not currently known whether this sequence has any regulatory effect on cl expression. Conceivably, the sequence could serve as a recognition site for an as-yet-unidentified regulatory protein. Alternatively, it may affect the secondary structure of the messenger RNA. A transcript extending from a promoter located upstream of the putative coi open reading frame would be capable of forming a stable stem-loop structure containing 16 bps with a single bp mismatch (AG = -33.6 Kcal) of this inverted repeat sequence. Such a structure could potentially serve as a recognition site for a regulatory factor or, alternatively, could mask such a site. On the other hand, transcription originating from the promoter spanning the BamHI site just upstream of cl would start at a site within the inverted repeat sequence, forming a comparatively less stable stem-loop structure of about 8 bps. The role of the inverted repeat region in the regulation of cl expression is currently under investigation. ACKNOWLEDGEMENTS We thank Heinz Schuster for his review of the manuscript. This work was supported by National Science Foundation grant DMB-8704146. 7679 Nucleic Acids Research Abbreviations: bp, basepairs; kb, kilobase pairs; X-Gal, 5-Bromo-4-Chloro-3-indolylbeta-D-galactopyranoside. *To whom correspondence should be addressed REFERENCES 1. Yarmolinsky, M.B., and Steinberg, N. (1988). In Calendar, R., (ed.), The Bacteriophages, Plenum Publishing Corp., NY, Vol. 1, pp. 291-438. 2. Baumstark, B.R., Stovall, S.R., and Ashkar, S. (1987). Virology 156, 404-413. 3. Dreiseikelmann, B., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 263, 1391-1397. 4. Heinrich, J., Riedel, H.-D., Baumstark, B.R., Kimura, M., and Schuster, H. (1989). Nucleic Acids Res, this volume. 5. Eliason, J.L., and Stemnberg, N. (1987). J. Mol. Biol. 198, 281-293. 6. Velleman, M., Dreiseikelmann, B., and Schuster, H. (1987). Proc. Natl. Acad. Sci. USA 84, 5570-5574. 7. Citron, M., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 264, 3611-3617. 8. Chadwick, P., Pirotta, V., Steinberg, R., Hopkins, N., and Ptashne, M. (1970). Cold Spring Harbor Symp. Quant. Biol. 35, 283-294. 9. Chesney, R.H., and Scott, J.R. (1975). Virology 67, 375-384. 10. Wandersman, C., and Yarmolinsky, M. (1977). Virology 78, 267-276. 11. Scott, J.R., West, B.W., and Laping, J.L. (1978). Virology 85, 587-600. 12. Pabo, C.O., and Sauer, R. A. (1984). Ann. Rev. Biochem. 53, 293-321. 13. Scott, J.R. (1974). Virology 62, 344-349. 14. Schneider, K., and Beck, C.F. (1987). Methods in Enzymol. 153, 452-461. 15. Smith, H.W. (1972). Nature New Biol. 238, 205-206. 16. Scott, J.R. (1975). Virology 65, 173-178. 17. Scott, J.R., Kropf, M.M., and Mendelson, L. (1977). Virology 76, 39-46. 18. Scott, J.R. (1968). Virology 36, 564-574. 19. Walker, D.H., Jr., and Walker, J.T. (1976). J. Virol. 20, 177-187. 20. Stemnberg, N. (1979). Virology 96, 129-142. 21. Schneider, K., and Beck, C.F. (1986). Gene 42, 37-48. 22. Taylor, D.P., and Cohen, S.N. (1979). J. Bacteriol. 137, 92-104. 23. Miller, J.H. (1972). In Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 352-355. 24. Guyer, R.S. (1978). J. Mol. Biol. 126, 347-365. 25. Devlin, B.H., Baumstark, B.R., and Scott, J.R. (1982). Virology 120, 360-375. 26. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). Proc. Natl. Acad. Sci. USA 74, 5463-5467. 27. DeVries, J.K., and Zubay, G. (1967). Proc. Natl. Acad. Sci. USA 57, 1010-1012. 28. Heilmann, H., Reeve, J.R., and Puhler, A. (1980). Mol. Gen. Genet. 178, 149-154. 29. Shine, J., and Dalgarno, L. (1974). Proc. Natl. Acad. Sci. USA 71, 1342-1346. 30. Chou, P.Y., and Fasman, G.D. (1978). Adv. Enzymol. 47, 45-148. 31. Berg, J.M. (1986). Nature 319, 264-265. 32. Landschultz, W.H., Johnson, P.F., and McKnight, S.L. (1988). Science 240, 1759-1764. 33. Murre, C., McCaw, P., and Baltimore, D. Cell 56, 777-783. 34. Anderson, B.E., Baumstark, B.R., and Bellini, W.J. (1988). J. Bacteriol. 170, 4493-4500. 35. Rosenberg, M., and Court, D. (1979). Annu. Rev. Genet. 13, 319-353. 36. Ebright, R.H., Cossart, P., Gicquel-Sanzey, B., and Beckwith, J. (1984). Nature 311, 232-235. 37. Ptashne, M. (1986). Nature 322, 697-701. 38. Stemnberg, N., and Hoess, R. (1983). Annu. Rev. Genet. 17, 123-154. 39. Scott, J.R. (1980). Curr. Top. Microbiol. Immunol. 90, 49-65. 7680 This article, submitted on disc, has been automatically converted into this typeset format by the publisher. Instructions: please typing these entity words according to sentence: E. coli, E. coli, E. coli, E. coli, E. coli, E. coli, E. coli Options: species
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The c1 genes of P1 and P7. Abstract The c1 genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7c1 expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the P1c1 repressor. The c1 regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-turn-helix motif commonly associated with repressor proteins. Two P1c1 amber mutations were localized to the 283-amino acid open reading frame. The P1c1 and P7c1 sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the c1 gene from either phage cause the repression of transcription from a cloned promoter situated upstream of P1c1.Images Volme 7 Nmbe 19198 Nulei Acds eserc The cl genes of P1 and P7 Francis A.Osborne, Sonja R.Stovall and Barbara R.Baumstark* Department of Biology, Georgia State University, Atlanta, GA 30303, USA Received July 11, 1989; Revised and Accepted August 29, 1989 EMBL accession nos X16005, X16006 ABSTRACT The cl genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7cl expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the Plcl repressor. The cl regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-tum-helix motif commonly associated with repressor proteins. Two Plcl amber mutations were localized to the 283-amino acid open reading frame. The Plcl and P7cl sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the cI gene from either phage cause the repression of transcription from a cloned promoter situated upstream of Plcl. INTRODUCTION The cl genes of the plasmid prophages P1 and P7 code for repressor proteins that are required for the establishment and maintenance of lysogeny (reviewed in 1). A protein corresponding to the Plcl repressor has been isolated and shown to be a sequence-specific DNA binding protein that recognizes several widely dispersed sites on the phage DNA (2-7). The consensus DNA sequence recognized by the Plcl repressor (ATTTATTAGAGCA[A/T]T) contains no discernable bilateral symmetry, a feature that is highly unusual among prokaryotic operator sites. P1 and P7 are heteroimmune; that is, each phage is able to establish a lytic infection on a lysogen of the other phage. In this sense, their relationship is analogous to that of phage X and 434, which differ in the DNA specificity of their cI repressor proteins (8). However, genetic studies indicate that Plcl and P7cl can be crossed into the heterologous phage without affecting the immunity specificity of the recipient (9). The basis for P1/P7 heteroimmunity has been localized to a second regulatory gene, c4, that is unlinked to cl. The c4 gene products prevent the expression of antireb, a closely linked gene that interferes with cl-mediated repression (10, 11). According to current models, P1/P7 heteroimmunity results from the inability of the c4 repressor of one phage to prevent antireb expression from the heteroimmune phage genome (10, 11). Because the cl genes of P1 and P7 are genetically interchangeable, it is anticipated that the two gene products carry out similar or identical regulatory functions. The studies presented in this paper were undertaken to investigate the biochemical basis for the apparent genetic identity of the two cl genes. In this paper, we present the DNA sequence of the cl genes of P1 and P7 and the predicted amino acid sequence of the cl repressor proteins. We report that Plcl and P7cl code for proteins of identical size (283 amino acids) and Nucleic Acids Research Volume 17 Number 19 1989 767 1 (r IRL Press Nucleic Acids Research nearly identical sequence. We report further that both repressors prevent the expression of a promoter located immediately upstream of the Plc 1 open reading frame, an observation that confirms their functional similarity and suggests an autoregulatory role for the two proteins. Analysis of the secondary structure predicted by the open reading frames does not reveal the characteristic helix-turn-helix (12) or other motifs commonly associated with DNA binding proteins. MATERIALS AND METHODS Bacterial and phage strains. E. coli K336 is a SuO derivative of K140 (13). E. coli CB454 is a recA-, lacZderivative of K-12 (14). P1 + is described by Scott (13). P7+ is the strain of Smith (15), as described by Scott (16). P7cl. 1 contains a missense mutation in the cl gene (17). The P7 phage strains and the cl amber mutant phage strains PIci .245Cm, Plc1. 169 and P Ic .55 (11) were generously provided by June Scott. Enzymes and reagents. Restriction enzymes, T4 DNA ligase and polymerase, and the Klenow fragment of E. coli DNA polymerase were purchased from Boehringer Biochemicals or New England Biolabs and reactions were carried out according to the manufacturers' instructions. DNA sequencing kits and in vitro transcription-translation kits were purchased from Bethesda Research Laboratories and Amersham Corporation, respectively. Synthetic oligonucleotides to be used as sequencing primers were prepared on an Applied Biosystems DNA synthesizer. Plasmid construction. pBRB7.2. pBRB7.2 (2) contains a 3.2 kb EcoRI/PvuII fragment from the cl region of P1 (Figure 1) inserted into the 2.3 kb EcoRIlPvuII fragment of pBR322 that contains the origin of replication and the f3-lactamase gene. pFA02. P7 plasmid DNA was digested with PvuII, ligated to similarly digested pBR322, and transformed into E. coli K336. Ampicillin-resistant colonies were screened for cl activity by cross-streak complementation analysis against P7cl.1 (18). pFAO2 contains a 3.5 kb insert of P7 DNA. The fragment was localized to the cl region of the P7 genome by Southern hybridization against P1 and P7 DNA that had been digested with BamHI and BglII (data not shown). pBRBJ69. 1 and pBRB55. 1. The PI cI open reading frame was previously localized to a 2.6 kb EcoRlIBamHI fragment derived from PlEcoRI-7 (2). This fragment also contains the wildtype allele for the conditional lethal mutation am43 (19, 20). To clone the cl reading frame from the amber mutant phage Plc1.169 and P Ic .55, we digested phage DNA with EcoRI and BamHI, ligated the digestion products into similarly digested pBR322, and transformed the ligation mixture into E. coli K336. Ampicillin-resistant, tetracyclinesensitive colonies were screened by cross-streak complementation analysis for their ability to support the growth of Plam43. Plasmid DNA isolated from complementation-positive cells was shown by agarose gel electrophoresis to carry plasmids containing the 2.6 kb EcoRIlBamHI fragment from the cl region. The cl mutant open reading frames were placed under the control of normal regulatory signals present in the cI region by digesting the cl.55 and cl. 169-containing plasmids with BamHI and PvuII and inserting a 601 bp BamHI/PvuH fragment containing the cl promoter region (2). The resulting plasmids, pBRB55.1 and pBRB169.1, respectively, contain the 3.2 kb EcoRllPvuIl fragment analogous to that present in pBRB7.2 (Figure 1). pBCB2. 13-2.18. To identify cl-repressible promoters, we introduced selected fragments 7672 Nucleic Acids Research 4 f - - + I 4 P1 4- 4- 4 ECAR H C B R P 4 4.4,~ 4, 1 1 4. I 4, I 11 t t t t t E G R N E B R P 4 4 - 4 1 ' '110z I I I I I I 1 3.2 1.5 1.0 0.5 0 P7 pBRB7.2 -------------------cl1------------- r ~ / >' pFAO2 *-lacZ pBCB2.13 <-lacZ Z pBCB2.16 <-lacZX pBCB2.18 Fig. 1. The cl regions of P1 and P7. A restriction map is indicated by the solid line in the upper part of the figure. Sites for EcoRI (E), Pvul (P), NnrI (N), Bgll (G), BamHI (B), and EcoRV (R) are shown. The sequencing strategy is indicated by the horizontal arrows. Letters and arrows above and below the map refer to sites and sequence analysis for P1 and P7, respectively. The size of this region (in kilobase pairs) is indicated below the map. The DNA fragments present in selected plasmids are illustrated by boxes at the bottom of the figure. The dashed line reveals the approximate position of the cl gene (2). The sites of the -yb mutations introduced into pFA02 are indicated by asterisks. pFA02.16 and pFA02.26 contain insertions located 0.9 kb and 1.4 kb, respectively, from the PvuIl site at the left side of the map. The direction of the lacZ open reading frame in pBCB2.13-18 is indicated by the adjacent arrow. from the cI region of P1 into pCB192, a promoter-probe vector containing promoterless copies of lacZ and galK extending in opposite directions from a multiple cloning site (21). The source of P1 DNA for these constructions was pZHA3, a derivative of pBRB7.2 that contains a HindIlI linker at the single EcoRV site located about 200 bps upstream of the cl open reading frame (Figure 1). pBCB2.13 contains a 460 bp fragment of P1 DNA extending from the EcoRV site to a Bgll site within the cI open reading frame. pBCB2. 16 contains a 130 bp fragment extending from the EcoRV site to a BamHI site located about 100 bps upstream of the cl open reading frame, while pBCB2.18 contains the region extending from this BamHI site to the Bglll site within the open reading frame (Figure 1). The orientation of the P1 DNA fragments within these plasmids was confirmed by restriction mapping and DNA sequencing. To test for the regulation of promoter expression by cl, we transformed pBCB2.13 and its derivatives into CB454(pBRB7.152) and CB454(pFAO2.152), two strains that express P7cl and Pll, respectively, from the pCB192-compatible kanamycin-resistant vector pDPT152 (22). Cells harboring both plasmids were selected by their resistance to both ampicillin and kanamycin. lacZ expression was measured by the procedure of Miller (23). pBRB7.152 was generated by introducing PlEcoRI-7 into pDPT152. pBRB7.152 has sustained a spontaneous deletion within the EcoRI-7 fragment that results in the loss of 2.5 kb of P1 DNA from the far left side of the P1 genetic map, but retains the 3.2 kb PvuHlEcoRI fragment required for cl expression that is present in pBRB7.2 (Figure 1). 7673 z I 011Z I e., Nucleic Acids Research Table 1. Complementation of PIci .245 by plasmids that contain cI genes. Phenotype Efficiency Relative of of Efficiency of Plasmid cI gene Lysogeny Lysogeny pBR322 1.5x 10-6 6.0x 10-6 pBRB7.2 Plcl+ 2.5 x 10-' 1.0 pBRB55.1 Plcl-am 1.4 x 10-6 5.6 x 10-6 pBRB169.1 PlCl-am 2.1 x 10-6 8.4 x 10-6 pFAO2 P7cl+ 8.7 x 10-2 0.35 pFAO2.16 P7c I-, 4.7 x 10-6 1.9 X 10-5 pFAO2.26 P7cI -1 3.1 x 10-6 1.2 x 10-5 Complementation for lysogeny was carried out as described by Devlin et al. (26). The plasmids were carried by E. coli K336. Cells were grown to mid-log phase at 370 in LB containing 50 tig/m1 sodium ampicillin and infected with Plcl.245 at a multiplicity of infection of 5 in the presence of 50 mM CaC12. After 10 minutes, non-absorbed phage were removed by centrifugation and the infection was allowed to proceed for 2 hours at 370. The infected cells were plated on LB plates containing 50 pLg/ml sodium ampicillin, 50 pLg/ml chloramphenicol, and 40 mM sodium citrate. The efficiency of lysogeny is defined as the number of ApRCmR cells at the end of infection divided by the number of ApR cells present at the start of the infection. To construct pFA02.152, we introduced a 2.8 kb EcoRV fragment of P7 DNA containing the cl gene (Figure 1) into the single EcoRI site of pDPT152 after it had been rendered blunt-ended by extension with T4 DNA polymerase. cl expression by cells harboring either pBRB7.152 or pFA02.152 was confirmed by measuring their ability to form chloramphenicol-resistant lysogens when infected with Plcl.245Cm. ,yb insertional mutagenesis. Insertional mutagenesis of P7cl was carried out using the 'yb transposon of F (24) as described by Devlin et al. (25). E. coli W1485(pFA02) was mated with the F- strain MX648 and subsequently plated on ampicillin (to select for the plasmid) and streptomycin sulfate (to select for the recipient strain). Transconjugants which could support only lytic growth upon infection by P7cl .1 (as scored by cross-streak analysis; 18) were assumed to have lost cl-complementing activity and were characterized further. The positions of two cl - insertional mutations, carried by pFA02.16 and pFA02.26, were identified by restriction mapping (Figure 1). DNA sequencing. DNA sequence analysis was carried out using the M13-dideoxy technique of Sanger et al. (26). Selected DNA fragments containing the cl wildtype or mutant genes were introduced into M13 mp8 or mp9. 18-nucleotide oligomers complementary to defined sequences within the cl gene were extended using the Klenow fragment of DNA polymerase in the presence of dideoxynucleotide triphosphates and analyzed by polyacrylamide-urea gel electrophoresis. The sequencing strategy is shown in Figure 1. RESULTS Localization of the P7cJ gene. Initial localization of the P7cl gene was undertaken by subjecting pFA02 to 'yb mutagenesis and determining the map position of inserts which destroy the ability of the plasmids to complement a P7cl - mutation (as determined by cross-streak analysis). pFA02 and the -yb insertion mutants were tested further by comparing their ability to complement a PIcI amber mutation with the complementation activity of plasmids containing cl genes isolated 7674 Nucleic Acids Research B C D E F G *.4 68 43 29- _ - =I = Am~ W _ 18 14 p Fig. 2. In vitro transcription-translation of plasmids carrying the cl region of P1 and P7. Proteins encoded by selected plasmids were labeled with 35S methionine according to the procedure of DeVries and Zubay (27), using a commercial in vitro transcription/tramnslation kit from Amersham Corporation. The reaction mixtures were subjected to electrophoresis on a 12.5% SDS-polyacrylamide gel and the labeled proteins were visualized by autoradiography. The migration of 14C-labeled protein molecular weight standards (Bethesda Research Laboratories) is indicated at the left side of the figure. Plasmids present in each lane are: A. pBRB55.1; B. pBRB169.1; C. pBRB7.2; D. pFAO2; E. pFAO2.16; F. pFAO2.26; G. pBR322. from P1 wildtype and amber mutants. Lysogeny by cells infected with Plcl.245Cm was scored as the growth of infected cells on ampicillin (to select for the resident plasmid) and chloramphenicol (to select for the phage genome). The values observed for the two plasmids containing Plcl and P7cl (pBRB7.2 and pFA02, respectively) are very similar and significantly higher than those obtained for pBR322 or for any of the plasmids carrying Table 2. Assay for lacZ expression from plasmids containing P1 DNA fragments. ,3-galactosidase activity (units) minus cI plus Pici plus P7cl relative activity (pDPT152) (pBB7. 152) (pFA02.152) +PICJ +P7cJ pCB192 0.58 0.55 0.54 0.95 0.93 pBCB2.13 154 15.2 13.6 0.10 0.09 pBCB2.16 1.1 1.2 1.1 1.1 1.0 pBCB2.18 4.0 3.4 3.9 0.9 1.0 Cells containing derivatives of the ApR promoter-probe plasmid pCB192 and the compatible KnR plasmid pDPT152 were grown in LB at 37?. When they reached mid-log phase, the cells were chilled, lysed, and assayed for (3-galactosidase activity according to the procedure of Miller (23). Plasmids derived from pCB192 are indicated at the left side of the Table. Plasmids derived from pDPT152 are indicated in parentheses across the top of the Table. The values reported are the average of two independent experiments. Relative activity is defined as the f3-galactosidase activity measured in cells harboring plasmids expressing cl divided by the activity measured in cells carrying only pDPT152. 7675 Nucleic Acids Research GATATCCAATCAGGAGTACC GCATCACCCAAGACGACCTG GATGATCTCACTGACACAAT CGAATATCTCATGGCCACTA ACCAGCCAGACTCACAATAAATGCA 105 v-- TtgAca TATAATG CTAATAAATCTATTATTTTC GTTGGATCCTTCTATAATGG TGGCCAACAACTCCCAGTGT AATCCGCTGTGAGTTGTTGG CCATGTCAATTCTGGAGGAGGATCA 210 b----- I I GGAGGtG ATG ATA AAT TAT GTC TAC GGC GAA CAA CTG TAC CAG GAG TTC GTC AGC TTC AGG GAT CTC TTT CTA AAA AAA GCT GTT GCA CGC GCC CAA 300 MET lIe Asn Tyr Vat Tyr Gly Glu Gin Leu Tyr Gin Gtu Phe Vat Ser Phe Arg Asp Leu Phe Leu Lys Lys Ala Val Ala Arg Ala Gtn tag(cl .55) CAC GTT GAT GCC GCC AGC GAC GGT CGT CCT GTT CGC CCG GTT GTC GTT CTG CCG TTC AM GM ACG GAC AGC ATT CAG GCT GMA ATT GAT 390 His Val Asp Ala Ala Ser Asp Gly Arg Pro Vat Arg Pro Vat Vat Vat Leu Pro Phe Lys Glu Thr Asp Ser lIe Gin Ala Glu lie Asp T A C A G AAA TGG ACA TTA ATG GCG CGG GAA CTG GAG CAG TAC CCA GAT CTC MT ATC CCA MG ACT ATT TTA TAT CCT GTA CCT AAC ATC CTT CGC 480 9 Lys Trp Thr Leu MET Ala Arg Glu Leu Gtu Gin Tyr Pro Asp Leu Asn lIe Pro Lys Thr lie Leu Tyr Pro Vat Pro Asn lIe Leu Arg A T C GGT GTG CGT AAG GTT ACG ACT TAT CAG ACA GAA GCA GTG MC AGC GTC AAT ATG ACC GCT GGC CGC ATT ATT CAT CTG ATT GAT AAG GAC 570 Gly Vat Arg Lys Vat Thr Thr Tyr Gin Thr Glu Ala Vat Asn Ser Vat Asn MET Thr Ala Gly Arg lIe lIe His Leu lIe Asp Lys Asp G ATT CGC ATC CAA AM AGC GCG GGG ATC MT GAG CAC AGT GCG AAA TAC ATA GAG MC CTG GAA GCA ACA AM GAG CTA ATG AAG CAG TAC 660 lle Arg lIe Gin Lys Ser Ala Gly lIe Asn Gtu His Ser Ala Lys Tyr lIe Gtu Asn Leu Gtu Ala Thr Lys Gtu Leu MET Lys Gin Tyr T T CCG GAG GAT GAA AAA TTC CGT ATG CGC GTA CAC GGC TTT AGC GAA ACA ATG CTG CGC GTC CAT TAC ATT TCC AGT AGC CCT AAC TAC AAT 750 Pro Glu Asp Glu Lys Phe Arg MET Arg Vat His Gly Phe Ser Gtu Thr MET Leu Arg Vat His Tyr lie Ser Ser Ser Pro Asn Tyr Asn Phe T C G T T I ~~~I I II GAT GGC MA TCA GTT AGT TAC CAT GTG CTG CTA TGT GGC GTG TTT ATC TGC GAT GM ACT CTC CGA GAT GGA ATC ATC ATC AAC GGT GAA 840 e.. Asp Gly Lys Ser Vat Ser Tyr His Vat Leu Leu Cys Gly Vat Phe lie Cys Asp Glu Thr Leu Arg Asp Gly lIe lie lIe Asn Gly Gtu Pro C tag(cl .169) TTT GAG AM GCA AAA TTT AGC CTT TAT GAC TCT ATA GM CCG ATC ATC TGC GAC CGC TGG CCG CAG GCA AM ATA TAT CGC CTG GCA GAT 930 Phe Gtu Lys Ala Lys Phe Ser Leu Tyr Asp Ser lIe Glu Pro lie lie Cys Asp Arg Trp Pro Gin Ala Lys lIe Tyr Arg Leu Ala Asp T ATT GM MT GTA AM AM CM ATT GCC ATC ACT CGC GM GAG AAA G GTC AM TCA GCC GCA TCA GTT ACG CGC AGC CGC AAA ACT AAG 1020 n----- lie Glu Asn Vat Lys Lys Gin lIe Ala lie Thr Arg Glu Glu Lys Lys Vat Lys Ser Ala Ala Ser Vat Thr Arg Ser Arg Lys Thr Lys AAG GGG CAG CCA GTA AAC GAC MC CCC GAA AGC GCG CM TAG Lys Gly Gin Pro Val Asn Asp Asn Pro Glu Ser Ala Gin ter Fig. 3. DNA sequence of PIcI and P7cl. The DNA sequence of PIcI is indicated. Positions where the sequence of P7cl differs from that of Plcl are indicated above the P1 sequence. The amino acid sequence predicted by the open reading frame is given below the sequence. The two amino acid substitutions present in P7cl are shown below the open reading frame. The locations of the amber mutant codons in cl.55 and ci. 169 are indicated by small letters above the sequence. Sites for selected restriction enzymes (EcoRV [v]; BamHI [b]; Bgll [g]; EcoRP [e]; and NruI [n]) are illustrated by dashed lines beneath the sequence. The cl repressor binding site is underlined. Inverted arrows beneath the sequence illustrate the inverted repeat sequence upstream of the open reading frame. Predicted promoter ribosome binding sites are indicated by the presence of the consensus sequences above and below the line, respectively. The DNA sequences of Plcl from bp 1-134 and bp 1-434 were reported previously (2,5). mutant cl genes from either P1 or P7 (Table 1). The efficiency with which a cloned P7cl gene complements a PlcI mutation confirms previous genetic studies indicating that these two genes are functionally interchangeable (9). The location of the 'y6 mutations that destroy cl-complementing activity suggests that the P7cl open reading frame occupies a map position similar to that of the P1 open reading frame (Figure 1). 7676 Nucleic Acids Research Proteins produced by fragments containing Plcl. As an initial step in the comparison of the P1 and P7 repressors, we analyzed the gene products expressed from the cloned cl regions. In an in vitro transcription-translation reaction, plasmids coding for the wildtpe alleles of either PIcI or P7cl direct the production of a protein with an estimated molecular weight of 33,000 daltons (Figure 2, Lanes C and D), a size that agrees closely with the predicted molecular weight of the PIcI repressor reported previously (3,28). The loss of the 33,000 dalton protein in the cl - 'ya-induced P7 mutant plasmids (Figure 2, Lanes E and F) is consistent with its designation as the P7cl repressor. As expected, the 33,000 dalton protein is not observed when reaction mixtures contain DNA from Plcl amber mutants (Figure 2, Lanes A and B). DNA sequence analysis of the cl genes. To make a direct comparison between the Plcl and P7cl DNA sequences and to predict the amino acid sequences of the repressor proteins, we carried out M 13-dideoxy sequence analysis of cloned fragments carrying the cl genes. The sequences of about 1 kb of P1 and P7 DNA were determined starting from a common EcoRV site predicted to lie approximately 200 bps upstream of the cl genes. The P1 and P7 sequences (Figure 3) both contain an ATG initiation codon preceded by a putative ribosome binding sequence (29) situated 211 bps downstream of the EcoRV site. In each case, the initiation codon is followed by an open reading reading frame extending for 283 codons. The P1 and P7 open reading frames code for proteins with predicted molecular weights (32,515 and 32,499 daltons, respectively) that agree closely with the values of the proteins expressed from the cloned DNA fragments (Figure 2) and with results predicted independently for the purified PIcI repressor (3-4). The localization of two PIcI amber mutations to the P1 open reading frame confirms its identification as the cI coding sequence. cI. 169 contains an amber mutation that would result in a protein fragment of 26,680 daltons, a value that agrees well with the size of a protein fragment observed under the in vitro transcription/translation reaction conditions (Figure 2, Lane B). The cl.55 amber mutation lies close to the N-terminal region of the protein, resulting in the production of a fragment of 55 amino acids that is apparently too small to resolve under the electrophoretic conditions used for separation of the proteins. Over 60% of the amino acid sequence predicted for the PIcI open reading frame has been verified by amino acid sequence analysis of peptide fragments isolated from the purified repressor protein (see accompanying paper, reference 3). The DNA sequences of P1 and P7 are identical for a 399-bp region that extends from the EcoRV site at the 5' side of the cl gene to a point 188 bps within the open reading frame. The sequences within the Plcl and the P7cl open reading frames differ at only 18 positions, all but two of which occur in the wobble position of the predicted codon. From these results, we conclude that the functional identity of the P1 and P7 cl genes is a consequence of their nearly identical amino acid sequence. Analysis of promoters upstream of the cl open reading frame. Expression of Plcl was shown previously to require sequences on the distal side of a BamHI site (2, 5) located about 100 bps upstream of the open reading frame (Figure 3). A binding site for the cl repressor has also been shown to exist close to this BamHI site (2, 5, 6). To determine whether this region contains a promoter that is detectable in vivo and, further, to determine whether this promoter can be regulated by cl repressor proteins from either P1 or P7, we introduced several DNA fragments from this region into the promoter probe vector pCB192, screened for promoter activity (as monitored by lacZ expression) and checked for repression of this activity in the presence of a compatible 7677 Nucleic Acids Research plasmid expressing Plcl or P7cl. Cells harboring pBCB2.13 (a plasmid which carries a 460 bp fragment of P1 DNA that extends across the BamHI site upstream of cl into the open reading frame) are dark blue in the presence of Xgal and produce significant levels of 3-galactosidase (Table 2). In contrast, pBCB2.16 and pBCB2.18 (which each contain DNA from only one side of the BamHI site located in pBCB2. 13) do not confer a blue color on their host cell in the presence of X-Gal and express negligible amounts of 3-galactosidase (Table 2). These observations suggest that expression from the promoter identified here requires sequences that span the BamHI site upstream of cl. Expression of cl from a compatible plasmid in the presence of pBCB2. 13 results in a 90% reduction in promoter strength (Table 2). This reduction is seen in the presence of either Plcl or P7cl, indicating that the two repressor proteins are both capable of repressing expression from this promoter. DISCUSSION. The DNA sequences of Plcl and P7cl differ at only 18 sites, all but two of which occur at the third position of the affected codon. This observation provides biochemical confirmation of the functional identity predicted on the basis of previous genetic analysis (9). A number of DNA binding proteins exhibit a common structural motif in which two helices are separated by a glycine residue (12). This motif is not observed in the predicted secondary structures (30) of the Plcl and P7cl amino acid sequences. A sequence with some similarity to the XCro helix-turn-helix region was previously reported near the Nterminus of the PIcI protein (5); however, it was noted that the potential for helix formation is disrupted by the presence of several prolines within the region. The secondary structure predicted for the Plcl and P7cl repressor proteins (30) does not reveal other structural characteristics (e.g., Zn fingers (31), leucine zippers (32), or helix-loop-helix motifs (33)) that have been associated with DNA binding activity in other systems. A search of the GenBank and EMBL databases does not reveal any other known regulatory proteins with significant amino acid similarity to the Plcl or the P7cl repressor sequences. Since the Plcl repressor differs from most other repressors in DNA binding specificity (i.e., in its recognition of an asymmetric operator sequence), it is not unexpected to find that the protein does not exhibit common structural motifs at the amino acid level. The cl-repressible promoter described in this report is located in a region just upstream of the cl open reading frame and is oriented in the direction of cl. Because the promoter is present on a multicopy plasmid, it is not possible to make a direct calculation of promoter strength; however, the values observed are about five-fold lower than the levels produced by a derivative of pCB192 that contains the plac promoter from pUC19 (34). Because sequences on both sides of the BamHI site located upstream of cl are required for promoter activity (Table 2), we suggest that the promoter spans this site. Less than 10 bps downstream of this BamHI site is a heptanucleotide sequence (TATAATG) that is identical to the -10 consensus sequence for RNA polymerase (35). If this sequence does indeed correspond to the -10 region of the promoter, the -35 region would be predicted to lie on the other side of the BamHI site in a region that overlaps a known cI repressor binding site (2-5). Analysis of this region does not reveal any sequences with significant similarity to the -35 consensus sequence. The best fit is the sequence TCTATT (Figure 3), which matches only two positions of the -35 consensus (TTGACA). The lack of a strong -35 region is often observed with genes that require an activator. Although a pentanucleotide sequence corresponding to the conserved portion of the CRP protein consensus binding site (36) 7678 Nucleic Acids Research is located just upstream of the predicted -35 region (at position 91; Figure 3), a role for CRP-mediated activation in cl expression has not previously been described. The orientation of the promoter and its cl-repressible character raise the possibility that cl expression is autoregulatory. If this is so, one potential activator would be the cl repressor itself. Expression cannot be absolutely dependent on cl-mediated activation, however, because the cloned promoter exhibits significant activity in the absence of the cl gene (Table 2). Under the conditions reported here, the presence of the cl gene results in a decrease rather than an increase in lacZ expression; however, these observations do not rule out a potential activator role for the cl protein, since the ratios of repressor and operator provided by the multicopy plasmids may not be optimal for activation. Physiologically, the role of additional repressor binding sites in regulating cl expression also cannot be discounted. Three potential operator sites have been identified several hundred bps upstream of the cI open reading frame (2-5); one or more of these could be involved (possibly through a DNA looping mechanism; 37) in the activation or repression of cl expression during phage growth. A cl-repressible promoter oriented in the direction of cl was previously reported (38) to be located entirely within PlBamHI-9, a fragment located upstream of cl which is bracketed by the BamHI site within pBCB2. 13. Because sequences on both sides of this BamHI site are required for the activity of the promoter in pBCB2.13, we suggest that the previously identified promoter is distinct from the one reported here. The promoter from BamHI-9 could correspond to a consensus promoter sequence that is situated about 500 bps upstream of cl and overlaps a cl repressor binding site (2). If so, cl expression is likely to be controlled by more than one promoter. Located between this promoter sequence and the promoter encoded on pBCB2. 13 is an open reading frame whose product (termed coi, or c-one inactivator) has been implicated in the establishment of lytic growth (1, 39; B.R. Baumstark, unpublished results). It has been suggested (2) that the decision to enter lytic or lysogenic growth is influenced by the level of transcription initiated from the distal promoter (which would transcribe coi prior to the transcription of cl) relative to that of the promoter located immediately upstream of the cl gene (which would transcribe only ci). A 32-nucleotide hyphenated inverted repeat sequence is located just upstream of the cl open reading frame (positions 146-188; Figure 3). It is not currently known whether this sequence has any regulatory effect on cl expression. Conceivably, the sequence could serve as a recognition site for an as-yet-unidentified regulatory protein. Alternatively, it may affect the secondary structure of the messenger RNA. A transcript extending from a promoter located upstream of the putative coi open reading frame would be capable of forming a stable stem-loop structure containing 16 bps with a single bp mismatch (AG = -33.6 Kcal) of this inverted repeat sequence. Such a structure could potentially serve as a recognition site for a regulatory factor or, alternatively, could mask such a site. On the other hand, transcription originating from the promoter spanning the BamHI site just upstream of cl would start at a site within the inverted repeat sequence, forming a comparatively less stable stem-loop structure of about 8 bps. The role of the inverted repeat region in the regulation of cl expression is currently under investigation. ACKNOWLEDGEMENTS We thank Heinz Schuster for his review of the manuscript. This work was supported by National Science Foundation grant DMB-8704146. 7679 Nucleic Acids Research Abbreviations: bp, basepairs; kb, kilobase pairs; X-Gal, 5-Bromo-4-Chloro-3-indolylbeta-D-galactopyranoside. *To whom correspondence should be addressed REFERENCES 1. Yarmolinsky, M.B., and Steinberg, N. (1988). In Calendar, R., (ed.), The Bacteriophages, Plenum Publishing Corp., NY, Vol. 1, pp. 291-438. 2. Baumstark, B.R., Stovall, S.R., and Ashkar, S. (1987). Virology 156, 404-413. 3. Dreiseikelmann, B., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 263, 1391-1397. 4. Heinrich, J., Riedel, H.-D., Baumstark, B.R., Kimura, M., and Schuster, H. (1989). Nucleic Acids Res, this volume. 5. Eliason, J.L., and Stemnberg, N. (1987). J. Mol. Biol. 198, 281-293. 6. Velleman, M., Dreiseikelmann, B., and Schuster, H. (1987). Proc. Natl. Acad. Sci. USA 84, 5570-5574. 7. Citron, M., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 264, 3611-3617. 8. Chadwick, P., Pirotta, V., Steinberg, R., Hopkins, N., and Ptashne, M. (1970). Cold Spring Harbor Symp. Quant. Biol. 35, 283-294. 9. Chesney, R.H., and Scott, J.R. (1975). Virology 67, 375-384. 10. Wandersman, C., and Yarmolinsky, M. (1977). Virology 78, 267-276. 11. Scott, J.R., West, B.W., and Laping, J.L. (1978). Virology 85, 587-600. 12. Pabo, C.O., and Sauer, R. A. (1984). Ann. Rev. Biochem. 53, 293-321. 13. Scott, J.R. (1974). Virology 62, 344-349. 14. Schneider, K., and Beck, C.F. (1987). Methods in Enzymol. 153, 452-461. 15. Smith, H.W. (1972). Nature New Biol. 238, 205-206. 16. Scott, J.R. (1975). Virology 65, 173-178. 17. Scott, J.R., Kropf, M.M., and Mendelson, L. (1977). Virology 76, 39-46. 18. Scott, J.R. (1968). Virology 36, 564-574. 19. Walker, D.H., Jr., and Walker, J.T. (1976). J. Virol. 20, 177-187. 20. Stemnberg, N. (1979). Virology 96, 129-142. 21. Schneider, K., and Beck, C.F. (1986). Gene 42, 37-48. 22. Taylor, D.P., and Cohen, S.N. (1979). J. Bacteriol. 137, 92-104. 23. Miller, J.H. (1972). In Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 352-355. 24. Guyer, R.S. (1978). J. Mol. Biol. 126, 347-365. 25. Devlin, B.H., Baumstark, B.R., and Scott, J.R. (1982). Virology 120, 360-375. 26. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). Proc. Natl. Acad. Sci. USA 74, 5463-5467. 27. DeVries, J.K., and Zubay, G. (1967). Proc. Natl. Acad. Sci. USA 57, 1010-1012. 28. Heilmann, H., Reeve, J.R., and Puhler, A. (1980). Mol. Gen. Genet. 178, 149-154. 29. Shine, J., and Dalgarno, L. (1974). Proc. Natl. Acad. Sci. USA 71, 1342-1346. 30. Chou, P.Y., and Fasman, G.D. (1978). Adv. Enzymol. 47, 45-148. 31. Berg, J.M. (1986). Nature 319, 264-265. 32. Landschultz, W.H., Johnson, P.F., and McKnight, S.L. (1988). Science 240, 1759-1764. 33. Murre, C., McCaw, P., and Baltimore, D. Cell 56, 777-783. 34. Anderson, B.E., Baumstark, B.R., and Bellini, W.J. (1988). J. Bacteriol. 170, 4493-4500. 35. Rosenberg, M., and Court, D. (1979). Annu. Rev. Genet. 13, 319-353. 36. Ebright, R.H., Cossart, P., Gicquel-Sanzey, B., and Beckwith, J. (1984). Nature 311, 232-235. 37. Ptashne, M. (1986). Nature 322, 697-701. 38. Stemnberg, N., and Hoess, R. (1983). Annu. Rev. Genet. 17, 123-154. 39. Scott, J.R. (1980). Curr. Top. Microbiol. Immunol. 90, 49-65. 7680 This article, submitted on disc, has been automatically converted into this typeset format by the publisher.
[ "The", "c1", "genes", "of", "P1", "and", "P7", ".", "\n", "Abstract", "\n", "The", "c1", "genes", "of", "the", "heteroimmune", "phages", "P1", "and", "P7", "were", "sequenced", "and", "their", "products", "were", "compared", ".", "P7c1", "expression", "was", "correlated", "with", "the", "translation", "in", "vitro", "of", "a", "protein", "whose", "predicted", "molecular", "weight", "(", "33,000", "daltons", ")", "is", "indistinguishable", "from", "that", "of", "the", "P1c1", "repressor", ".", "The", "c1", "regions", "from", "both", "P1", "and", "P7", "were", "found", "to", "contain", "open", "reading", "frames", "capable", "of", "coding", "for", "a", "283-amino", "acid", "protein", "whose", "predicted", "secondary", "structure", "lacks", "the", "helix", "-", "turn", "-", "helix", "motif", "commonly", "associated", "with", "repressor", "proteins", ".", "Two", "P1c1", "amber", "mutations", "were", "localized", "to", "the", "283-amino", "acid", "open", "reading", "frame", ".", "The", "P1c1", "and", "P7c1", "sequences", "were", "found", "to", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "alter", "the", "third", "position", "of", "the", "affected", "codon", "and", "do", "not", "alter", "the", "amino", "acid", "sequence", "of", "the", "protein", ".", "Plasmids", "expressing", "the", "c1", "gene", "from", "either", "phage", "cause", "the", "repression", "of", "transcription", "from", "a", "cloned", "promoter", "situated", "upstream", "of", "P1c1.Images", "\n\n\n\n\n\n\n ", "Volme", "7", "Nmbe", "19198", " ", "Nulei", "Acds", " ", "eserc", "\n\n ", "The", "cl", "genes", "of", "P1", "and", "P7", "\n\n ", "Francis", "A.Osborne", ",", "Sonja", "R.Stovall", "and", "Barbara", "R.Baumstark", "*", "\n\n ", "Department", "of", "Biology", ",", "Georgia", "State", "University", ",", "Atlanta", ",", "GA", "30303", ",", "USA", "\n\n ", "Received", "July", "11", ",", "1989", ";", "Revised", "and", "Accepted", "August", "29", ",", "1989", " ", "EMBL", "accession", "nos", "X16005", ",", "X16006", "\n\n ", "ABSTRACT", "\n\n ", "The", "cl", "genes", "of", "the", "heteroimmune", "phages", "P1", "and", "P7", "were", "sequenced", "and", "their", "products", "were", "compared", ".", "P7cl", "expression", "was", "correlated", "with", "the", "translation", "in", "vitro", "of", "a", "protein", "whose", "predicted", "molecular", "weight", "(", "33,000", "daltons", ")", "is", "indistinguishable", "from", "that", "of", "the", "Plcl", "repressor", ".", "The", "cl", "regions", "from", "both", "P1", "and", "P7", "were", "found", "to", "contain", "open", "reading", "frames", "capable", "of", "coding", "for", "a", "283-amino", "acid", "protein", "whose", "predicted", "secondary", "structure", "lacks", "the", "helix", "-", "tum", "-", "helix", "motif", "commonly", "associated", "with", "repressor", "proteins", ".", "Two", "Plcl", "amber", "mutations", "were", "localized", "to", "the", "283-amino", "acid", "open", "reading", "frame", ".", "The", "Plcl", "and", "P7cl", "sequences", "were", "found", "to", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "alter", "the", "third", "position", "of", "the", "affected", "codon", "and", "do", "not", "alter", "the", "amino", "acid", "sequence", "of", "the", "protein", ".", "Plasmids", "expressing", "the", "cI", "gene", "from", "either", "phage", "cause", "the", "repression", "of", "transcription", "from", "a", "cloned", "promoter", "situated", "upstream", "of", "Plcl", ".", "\n\n ", "INTRODUCTION", "\n\n ", "The", "cl", "genes", "of", "the", "plasmid", "prophages", "P1", "and", "P7", "code", "for", "repressor", "proteins", "that", "are", "required", "for", "the", "establishment", "and", "maintenance", "of", "lysogeny", "(", "reviewed", "in", "1", ")", ".", "A", "protein", "corresponding", "to", "the", "Plcl", "repressor", "has", "been", "isolated", "and", "shown", "to", "be", "a", "sequence", "-", "specific", "DNA", "binding", "protein", "that", "recognizes", "several", "widely", "dispersed", "sites", "on", "the", "phage", "DNA", "(", "2", "-", "7", ")", ".", "The", "consensus", "DNA", "sequence", "recognized", "by", "the", "Plcl", "repressor", "(", "ATTTATTAGAGCA[A", "/", "T]T", ")", "contains", "no", "discernable", "bilateral", "symmetry", ",", "a", "feature", "that", "is", "highly", "unusual", "among", "prokaryotic", "operator", "sites", ".", "\n\n ", "P1", "and", "P7", "are", "heteroimmune", ";", "that", "is", ",", "each", "phage", "is", "able", "to", "establish", "a", "lytic", "infection", "on", "a", "lysogen", "of", "the", "other", "phage", ".", "In", "this", "sense", ",", "their", "relationship", "is", "analogous", "to", "that", "of", "phage", "X", "and", "434", ",", "which", "differ", "in", "the", "DNA", "specificity", "of", "their", "cI", "repressor", "proteins", "(", "8)", ".", "However", ",", "genetic", "studies", "indicate", "that", "Plcl", "and", "P7cl", "can", "be", "crossed", "into", "the", "heterologous", "phage", "without", "affecting", "the", "immunity", "specificity", "of", "the", "recipient", "(", "9", ")", ".", "The", "basis", "for", "P1", "/", "P7", "heteroimmunity", "has", "been", "localized", "to", "a", "second", "regulatory", "gene", ",", "c4", ",", "that", "is", "unlinked", "to", "cl", ".", "The", "c4", "gene", "products", "prevent", "the", "expression", "of", "antireb", ",", "a", "closely", "linked", "gene", "that", "interferes", "with", "cl", "-", "mediated", "repression", "(", "10", ",", "11", ")", ".", "According", "to", "current", "models", ",", "P1", "/", "P7", "heteroimmunity", "results", "from", "the", "inability", "of", "the", "c4", "repressor", "of", "one", "phage", "to", "prevent", "antireb", "expression", "from", "the", "heteroimmune", "phage", "genome", "(", "10", ",", "11", ")", ".", "\n\n ", "Because", "the", "cl", "genes", "of", "P1", "and", "P7", "are", "genetically", "interchangeable", ",", "it", "is", "anticipated", "that", "the", "two", "gene", "products", "carry", "out", "similar", "or", "identical", "regulatory", "functions", ".", "The", "studies", "presented", "in", "this", "paper", "were", "undertaken", "to", "investigate", "the", "biochemical", "basis", "for", "the", "apparent", "genetic", "identity", "of", "the", "two", "cl", "genes", ".", "In", "this", "paper", ",", "we", "present", "the", "DNA", "sequence", "of", "the", "cl", "genes", "of", "P1", "and", "P7", "and", "the", "predicted", "amino", "acid", "sequence", "of", "the", "cl", "repressor", "proteins", ".", "We", "report", "that", "Plcl", "and", "P7cl", "code", "for", "proteins", "of", "identical", "size", "(", "283", "amino", "acids", ")", "and", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Volume", "17", "Number", "19", "1989", "\n\n ", "767", "1", "\n\n ", "(", "r", "IRL", "Press", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "nearly", "identical", "sequence", ".", "We", "report", "further", "that", "both", "repressors", "prevent", "the", "expression", "of", "a", "promoter", "located", "immediately", "upstream", "of", "the", "Plc", "1", "open", "reading", "frame", ",", "an", "observation", "that", "confirms", "their", "functional", "similarity", "and", "suggests", "an", "autoregulatory", "role", "for", "the", "two", "proteins", ".", "Analysis", "of", "the", "secondary", "structure", "predicted", "by", "the", "open", "reading", "frames", "does", "not", "reveal", "the", "characteristic", "helix", "-", "turn", "-", "helix", "(", "12", ")", "or", "other", "motifs", "commonly", "associated", "with", "DNA", "binding", "proteins", ".", "\n\n ", "MATERIALS", "AND", "METHODS", "Bacterial", "and", "phage", "strains", ".", "\n\n ", "E.", "coli", "K336", "is", "a", "SuO", "derivative", "of", "K140", "(", "13", ")", ".", "E.", "coli", "CB454", "is", "a", "recA-", ",", "lacZderivative", "of", "K-12", "(", "14", ")", ".", "P1", "+", "is", "described", "by", "Scott", "(", "13", ")", ".", "P7", "+", "is", "the", "strain", "of", "Smith", "(", "15", ")", ",", "as", "described", "by", "Scott", "(", "16", ")", ".", "P7cl", ".", "1", "contains", "a", "missense", "mutation", "in", "the", "cl", "gene", "(", "17", ")", ".", "The", "P7", "phage", "strains", "and", "the", "cl", "amber", "mutant", "phage", "strains", "PIci", ".245Cm", ",", "Plc1", ".", "169", "and", "P", "Ic", ".55", "(", "11", ")", "were", "generously", "provided", "by", "June", "Scott", ".", "Enzymes", "and", "reagents", ".", "\n\n ", "Restriction", "enzymes", ",", "T4", "DNA", "ligase", "and", "polymerase", ",", "and", "the", "Klenow", "fragment", "of", "E.", "coli", "DNA", "polymerase", "were", "purchased", "from", "Boehringer", "Biochemicals", "or", "New", "England", "Biolabs", "and", "reactions", "were", "carried", "out", "according", "to", "the", "manufacturers", "'", "instructions", ".", "DNA", "sequencing", "kits", "and", "in", "vitro", "transcription", "-", "translation", "kits", "were", "purchased", "from", "Bethesda", "Research", "Laboratories", "and", "Amersham", "Corporation", ",", "respectively", ".", "Synthetic", "oligonucleotides", "to", "be", "used", "as", "sequencing", "primers", "were", "prepared", "on", "an", "Applied", "Biosystems", "DNA", "synthesizer", ".", "Plasmid", "construction", ".", "\n\n ", "pBRB7.2", ".", "pBRB7.2", "(", "2", ")", "contains", "a", "3.2", "kb", "EcoRI", "/", "PvuII", "fragment", "from", "the", "cl", "region", "of", "P1", "(", "Figure", "1", ")", "inserted", "into", "the", "2.3", "kb", "EcoRIlPvuII", "fragment", "of", "pBR322", "that", "contains", "the", "origin", "of", "replication", "and", "the", "f3-lactamase", "gene", ".", "\n\n ", "pFA02", ".", "P7", "plasmid", "DNA", "was", "digested", "with", "PvuII", ",", "ligated", "to", "similarly", "digested", "pBR322", ",", "and", "transformed", "into", "E.", "coli", "K336", ".", "Ampicillin", "-", "resistant", "colonies", "were", "screened", "for", "cl", "activity", "by", "cross", "-", "streak", "complementation", "analysis", "against", "P7cl.1", "(", "18", ")", ".", "pFAO2", "contains", "a", "3.5", "kb", "insert", "of", "P7", "DNA", ".", "The", "fragment", "was", "localized", "to", "the", "cl", "region", "of", "the", "P7", "genome", "by", "Southern", "hybridization", "against", "P1", "and", "P7", "DNA", "that", "had", "been", "digested", "with", "BamHI", "and", "BglII", "(", "data", "not", "shown", ")", ".", "\n\n ", "pBRBJ69", ".", "1", "and", "pBRB55", ".", "1", ".", "The", "PI", "cI", "open", "reading", "frame", "was", "previously", "localized", "to", "a", "2.6", "kb", "EcoRlIBamHI", "fragment", "derived", "from", "PlEcoRI-7", "(", "2", ")", ".", "This", "fragment", "also", "contains", "the", "wildtype", "allele", "for", "the", "conditional", "lethal", "mutation", "am43", "(", "19", ",", "20", ")", ".", "To", "clone", "the", "cl", "reading", "frame", "from", "the", "amber", "mutant", "phage", "Plc1.169", "and", "P", "Ic", ".55", ",", "we", "digested", "phage", "DNA", "with", "EcoRI", "and", "BamHI", ",", "ligated", "the", "digestion", "products", "into", "similarly", "digested", "pBR322", ",", "and", "transformed", "the", "ligation", "mixture", "into", "E.", "coli", "K336", ".", "Ampicillin", "-", "resistant", ",", "tetracyclinesensitive", "colonies", "were", "screened", "by", "cross", "-", "streak", "complementation", "analysis", "for", "their", "ability", "to", "support", "the", "growth", "of", "Plam43", ".", "Plasmid", "DNA", "isolated", "from", "complementation", "-", "positive", "cells", "was", "shown", "by", "agarose", "gel", "electrophoresis", "to", "carry", "plasmids", "containing", "the", "2.6", "kb", "EcoRIlBamHI", "fragment", "from", "the", "cl", "region", ".", "The", "cl", "mutant", "open", "reading", "frames", "were", "placed", "under", "the", "control", "of", "normal", "regulatory", "signals", "present", "in", "the", "cI", "region", "by", "digesting", "the", "cl.55", "and", "cl", ".", "169-containing", "plasmids", "with", "BamHI", "and", "PvuII", "and", "inserting", "a", "601", "bp", "BamHI", "/", "PvuH", "fragment", "containing", "the", "cl", "promoter", "region", "(", "2", ")", ".", "The", "resulting", "plasmids", ",", "pBRB55.1", "and", "pBRB169.1", ",", "respectively", ",", "contain", "the", "3.2", "kb", "EcoRllPvuIl", "fragment", "analogous", "to", "that", "present", "in", "pBRB7.2", "(", "Figure", "1", ")", ".", "\n\n ", "pBCB2", ".", "13", "-", "2.18", ".", "To", "identify", "cl", "-", "repressible", "promoters", ",", "we", "introduced", "selected", "fragments", "\n\n ", "7672", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "4", "f", " ", "-", " ", "-", " ", "+", "\n\n ", "I", " ", "4", " ", "P1", "4-", " ", "4-", " ", "4", "\n\n ", "ECAR", " ", "H", " ", "C", " ", "B", " ", "R", " ", "P", "\n\n ", "4", " ", "4.4,~", " ", "4", ",", " ", "1", " ", "1", "4", ".", " ", "I", " ", "4", ",", " ", "I", "11", "\n\n ", "t", " ", "t", " ", "t", " ", "t", " ", "t", "E", "G", "R", " ", "N", " ", "E", " ", "B", " ", "R", " ", "P", "\n\n ", "4", " ", "4", " ", "-", " \n\n ", "4", "\n\n ", "1", "'", " ", "'", "110z", "I", " ", "I", " ", "I", " ", "I", " ", "I", " ", "I", " ", "1", "\n\n ", "3.2", " ", "1.5", " ", "1.0", " ", "0.5", " ", "0", "\n\n ", "P7", "\n\n ", "pBRB7.2", "\n\n ", "-------------------cl1", "-", "------------", "\n\n ", "r", "~", "/", ">", "'", " ", "pFAO2", "\n\n ", "*", "-lacZ", " ", "pBCB2.13", "\n\n ", "<", "-lacZ", "Z", " ", "pBCB2.16", "<", "-lacZX", " ", "pBCB2.18", "\n\n ", "Fig", ".", "1", ".", "The", "cl", "regions", "of", "P1", "and", "P7", ".", "A", "restriction", "map", "is", "indicated", "by", "the", "solid", "line", "in", "the", "upper", "part", "of", "the", "figure", ".", "Sites", "for", "EcoRI", "(", "E", ")", ",", "Pvul", "(", "P", ")", ",", "NnrI", "(", "N", ")", ",", "Bgll", "(", "G", ")", ",", "BamHI", "(", "B", ")", ",", "and", "EcoRV", "(", "R", ")", "are", "shown", ".", "The", "sequencing", "strategy", "is", "indicated", "by", "the", "horizontal", "arrows", ".", "Letters", "and", "arrows", "above", "and", "below", "the", "map", "refer", "to", "sites", "and", "sequence", "analysis", "for", "P1", "and", "P7", ",", "respectively", ".", "The", "size", "of", "this", "region", "(", "in", "kilobase", "pairs", ")", "is", "indicated", "below", "the", "map", ".", "The", "DNA", "fragments", "present", "in", "selected", "plasmids", "are", "illustrated", "by", "boxes", "at", "the", "bottom", "of", "the", "figure", ".", "The", "dashed", "line", "reveals", "the", "approximate", "position", "of", "the", "cl", "gene", "(", "2", ")", ".", "The", "sites", "of", "the", "-yb", "mutations", "introduced", "into", "pFA02", "are", "indicated", "by", "asterisks", ".", "pFA02.16", "and", "pFA02.26", "contain", "insertions", "located", "0.9", "kb", "and", "1.4", "kb", ",", "respectively", ",", "from", "the", "PvuIl", "site", "at", "the", "left", "side", "of", "the", "map", ".", "The", "direction", "of", "the", "lacZ", "open", "reading", "frame", "in", "pBCB2.13", "-", "18", "is", "indicated", "by", "the", "adjacent", "arrow", ".", "\n\n ", "from", "the", "cI", "region", "of", "P1", "into", "pCB192", ",", "a", "promoter", "-", "probe", "vector", "containing", "promoterless", "copies", "of", "lacZ", "and", "galK", "extending", "in", "opposite", "directions", "from", "a", "multiple", "cloning", "site", "(", "21", ")", ".", "The", "source", "of", "P1", "DNA", "for", "these", "constructions", "was", "pZHA3", ",", "a", "derivative", "of", "pBRB7.2", "that", "contains", "a", "HindIlI", "linker", "at", "the", "single", "EcoRV", "site", "located", "about", "200", "bps", "upstream", "of", "the", "cl", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "pBCB2.13", "contains", "a", "460", "bp", "fragment", "of", "P1", "DNA", "extending", "from", "the", "EcoRV", "site", "to", "a", "Bgll", "site", "within", "the", "cI", "open", "reading", "frame", ".", "pBCB2", ".", "16", "contains", "a", "130", "bp", "fragment", "extending", "from", "the", "EcoRV", "site", "to", "a", "BamHI", "site", "located", "about", "100", "bps", "upstream", "of", "the", "cl", "open", "reading", "frame", ",", "while", "pBCB2.18", "contains", "the", "region", "extending", "from", "this", "BamHI", "site", "to", "the", "Bglll", "site", "within", "the", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "The", "orientation", "of", "the", "P1", "DNA", "fragments", "within", "these", "plasmids", "was", "confirmed", "by", "restriction", "mapping", "and", "DNA", "sequencing", ".", "\n\n ", "To", "test", "for", "the", "regulation", "of", "promoter", "expression", "by", "cl", ",", "we", "transformed", "pBCB2.13", "and", "its", "derivatives", "into", "CB454(pBRB7.152", ")", "and", "CB454(pFAO2.152", ")", ",", "two", "strains", "that", "express", "P7cl", "and", "Pll", ",", "respectively", ",", "from", "the", "pCB192-compatible", "kanamycin", "-", "resistant", "vector", "pDPT152", "(", "22", ")", ".", "Cells", "harboring", "both", "plasmids", "were", "selected", "by", "their", "resistance", "to", "both", "ampicillin", "and", "kanamycin", ".", "lacZ", "expression", "was", "measured", "by", "the", "procedure", "of", "Miller", "(", "23", ")", ".", "pBRB7.152", "was", "generated", "by", "introducing", "PlEcoRI-7", "into", "pDPT152", ".", "pBRB7.152", "has", "sustained", "a", "spontaneous", "deletion", "within", "the", "EcoRI-7", "fragment", "that", "results", "in", "the", "loss", "of", "2.5", "kb", "of", "P1", "DNA", "from", "the", "far", "left", "side", "of", "the", "P1", "genetic", "map", ",", "but", "retains", "the", "3.2", "kb", "PvuHlEcoRI", "fragment", "required", "for", "cl", "expression", "that", "is", "present", "in", "pBRB7.2", "(", "Figure", "1", ")", ".", "\n\n ", "7673", "\n\n ", "z", "\n\n ", "I", " ", "011Z", " ", "I", "\n\n ", "e.", ",", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Table", "1", ".", "Complementation", "of", "PIci", ".245", "by", "plasmids", "that", "contain", "cI", "genes", ".", "\n\n ", "Phenotype", " ", "Efficiency", " ", "Relative", "\n\n ", "of", " ", "of", " ", "Efficiency", "of", "Plasmid", " ", "cI", "gene", " ", "Lysogeny", " ", "Lysogeny", "pBR322", " ", "1.5x", "10", "-", "6", " ", "6.0x", "10", "-", "6", "pBRB7.2", " ", "Plcl+", " ", "2.5", "x", "10-", "'", " ", "1.0", "\n\n ", "pBRB55.1", " ", "Plcl", "-", "am", " ", "1.4", "x", "10", "-", "6", " ", "5.6", "x", "10", "-", "6", "pBRB169.1", " ", "PlCl", "-", "am", " ", "2.1", "x", "10", "-", "6", " ", "8.4", "x", "10", "-", "6", "pFAO2", " ", "P7cl+", " ", "8.7", "x", "10", "-", "2", " ", "0.35", "\n\n ", "pFAO2.16", " ", "P7c", "I-", ",", " ", "4.7", "x", "10", "-", "6", " ", "1.9", "X", "10", "-", "5", "pFAO2.26", " ", "P7cI", "-1", " ", "3.1", "x", "10", "-", "6", " ", "1.2", "x", "10", "-", "5", "\n\n ", "Complementation", "for", "lysogeny", "was", "carried", "out", "as", "described", "by", "Devlin", "et", "al", ".", "(", "26", ")", ".", "The", "plasmids", "were", "carried", "by", "E.", "coli", "K336", ".", "Cells", "were", "grown", "to", "mid", "-", "log", "phase", "at", "370", "in", "LB", "containing", "50", "tig", "/", "m1", "sodium", "ampicillin", "and", "infected", "with", "Plcl.245", "at", "a", "multiplicity", "of", "infection", "of", "5", "in", "the", "presence", "of", "50", "mM", "CaC12", ".", "After", "10", "minutes", ",", "non", "-", "absorbed", "phage", "were", "removed", "by", "centrifugation", "and", "the", "infection", "was", "allowed", "to", "proceed", "for", "2", "hours", "at", "370", ".", "The", "infected", "cells", "were", "plated", "on", "LB", "plates", "containing", "50", "pLg", "/", "ml", "sodium", "ampicillin", ",", "50", "pLg", "/", "ml", "chloramphenicol", ",", "and", "40", "mM", "sodium", "citrate", ".", "The", "efficiency", "of", "lysogeny", "is", "defined", "as", "the", "number", "of", "ApRCmR", "cells", "at", "the", "end", "of", "infection", "divided", "by", "the", "number", "of", "ApR", "cells", "present", "at", "the", "start", "of", "the", "infection", ".", "\n\n ", "To", "construct", "pFA02.152", ",", "we", "introduced", "a", "2.8", "kb", "EcoRV", "fragment", "of", "P7", "DNA", "containing", "the", "cl", "gene", "(", "Figure", "1", ")", "into", "the", "single", "EcoRI", "site", "of", "pDPT152", "after", "it", "had", "been", "rendered", "blunt", "-", "ended", "by", "extension", "with", "T4", "DNA", "polymerase", ".", "cl", "expression", "by", "cells", "harboring", "either", "pBRB7.152", " ", "or", "pFA02.152", " ", "was", "confirmed", " ", "by", " ", "measuring", " ", "their", "ability", "to", " ", "form", "chloramphenicol", "-", "resistant", "lysogens", "when", "infected", "with", "Plcl.245Cm", ".", ",", "yb", "insertional", "mutagenesis", ".", "\n\n ", "Insertional", "mutagenesis", "of", "P7cl", "was", "carried", "out", "using", "the", "'", "yb", "transposon", "of", "F", "(", "24", ")", "as", "described", "by", "Devlin", "et", "al", ".", "(", "25", ")", ".", "E.", "coli", "W1485(pFA02", ")", "was", "mated", "with", "the", "F-", "strain", "MX648", "and", "subsequently", "plated", "on", "ampicillin", "(", "to", "select", "for", "the", "plasmid", ")", "and", "streptomycin", "sulfate", "(", "to", "select", "for", "the", "recipient", "strain", ")", ".", "Transconjugants", "which", "could", "support", "only", "lytic", "growth", "upon", "infection", "by", "P7cl", ".1", "(", "as", "scored", "by", "cross", "-", "streak", "analysis", ";", "18", ")", "were", "assumed", "to", "have", "lost", "cl", "-", "complementing", "activity", "and", "were", "characterized", "further", ".", "The", "positions", "of", "two", "cl", "-", "insertional", "mutations", ",", "carried", "by", "pFA02.16", "and", "pFA02.26", ",", "were", "identified", "by", "restriction", "mapping", "(", "Figure", "1", ")", ".", "DNA", "sequencing", ".", "\n\n ", "DNA", "sequence", "analysis", "was", "carried", "out", "using", "the", "M13-dideoxy", "technique", "of", "Sanger", "et", "al", ".", "(", "26", ")", ".", "Selected", "DNA", "fragments", "containing", "the", "cl", "wildtype", "or", "mutant", "genes", "were", "introduced", "into", "M13", "mp8", "or", "mp9", ".", "18-nucleotide", "oligomers", "complementary", "to", "defined", "sequences", "within", "the", "cl", "gene", "were", "extended", "using", "the", "Klenow", "fragment", "of", "DNA", "polymerase", "in", "the", "presence", "of", "dideoxynucleotide", "triphosphates", "and", "analyzed", "by", "polyacrylamide", "-", "urea", "gel", "electrophoresis", ".", "The", "sequencing", "strategy", "is", "shown", "in", "Figure", "1", ".", "RESULTS", "\n\n ", "Localization", "of", "the", "P7cJ", "gene", ".", "\n\n ", "Initial", "localization", "of", "the", "P7cl", "gene", "was", "undertaken", "by", "subjecting", "pFA02", "to", "'", "yb", "mutagenesis", "and", "determining", "the", "map", "position", "of", "inserts", "which", "destroy", "the", "ability", "of", "the", "plasmids", "to", "complement", "a", "P7cl", "-", "mutation", "(", "as", "determined", "by", "cross", "-", "streak", "analysis", ")", ".", "pFA02", "and", "the", "-yb", "insertion", "mutants", "were", "tested", "further", "by", "comparing", "their", "ability", "to", "complement", "a", "PIcI", "amber", "mutation", "with", "the", "complementation", "activity", "of", "plasmids", "containing", "cl", "genes", "isolated", "\n\n ", "7674", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "B", " ", "C", " ", "D", " ", "E", " ", "F", " ", "G", "\n\n ", "*", ".4", " \n\n ", "68", "\n\n ", "43", "\n\n ", "29-", " ", "_", " ", "-", " ", "=", "I", " ", "=", " ", "Am~", " ", "W", " ", "_", "\n\n ", "18", "\n\n ", "14", " ", "p", "\n\n ", "Fig", ".", "2", ".", "In", "vitro", "transcription", "-", "translation", "of", "plasmids", "carrying", "the", "cl", "region", "of", "P1", "and", "P7", ".", "Proteins", "encoded", "by", "selected", "plasmids", "were", "labeled", "with", "35S", "methionine", "according", "to", "the", "procedure", "of", "DeVries", "and", "Zubay", "(", "27", ")", ",", "using", "a", "commercial", "in", "vitro", "transcription", "/", "tramnslation", "kit", "from", "Amersham", "Corporation", ".", "The", "reaction", "mixtures", "were", "subjected", "to", "electrophoresis", "on", "a", "12.5", "%", "SDS", "-", "polyacrylamide", "gel", "and", "the", "labeled", "proteins", "were", "visualized", "by", "autoradiography", ".", "The", "migration", "of", "14C", "-", "labeled", "protein", "molecular", "weight", "standards", "(", "Bethesda", "Research", "Laboratories", ")", "is", "indicated", "at", "the", "left", "side", "of", "the", "figure", ".", "Plasmids", "present", "in", "each", "lane", "are", ":", "A.", "pBRB55.1", ";", "B.", "pBRB169.1", ";", "C.", "pBRB7.2", ";", "D.", "pFAO2", ";", "E.", "pFAO2.16", ";", "F.", "pFAO2.26", ";", "G.", "pBR322", ".", "\n\n ", "from", "P1", "wildtype", "and", "amber", "mutants", ".", "Lysogeny", "by", "cells", "infected", "with", "Plcl.245Cm", "was", "scored", "as", "the", "growth", "of", "infected", "cells", "on", "ampicillin", "(", "to", "select", "for", "the", "resident", "plasmid", ")", "and", "chloramphenicol", "(", "to", "select", "for", "the", "phage", "genome", ")", ".", "The", "values", "observed", "for", "the", "two", "plasmids", "containing", "Plcl", "and", "P7cl", "(", "pBRB7.2", "and", "pFA02", ",", "respectively", ")", "are", "very", "similar", "and", "significantly", "higher", "than", "those", "obtained", "for", "pBR322", "or", "for", "any", "of", "the", "plasmids", "carrying", "\n\n ", "Table", "2", ".", "Assay", "for", "lacZ", "expression", "from", "plasmids", "containing", "P1", "DNA", "fragments", ".", "\n\n ", ",", "3-galactosidase", "activity", "(", "units", ")", "\n\n ", "minus", "cI", " ", "plus", "Pici", " ", "plus", "P7cl", " ", "relative", "activity", "\n\n ", "(", "pDPT152", ")", " ", "(", "pBB7", ".", "152", ")", " ", "(", "pFA02.152", ")", " ", "+", "PICJ", " ", "+", "P7cJ", "\n\n ", "pCB192", " ", "0.58", " ", "0.55", " ", "0.54", " ", "0.95", " ", "0.93", "pBCB2.13", " ", "154", " ", "15.2", " ", "13.6", " ", "0.10", " ", "0.09", "pBCB2.16", " ", "1.1", " ", "1.2", " ", "1.1", " ", "1.1", " ", "1.0", "pBCB2.18", " ", "4.0", " ", "3.4", " ", "3.9", " ", "0.9", " ", "1.0", "\n\n ", "Cells", "containing", "derivatives", "of", "the", "ApR", "promoter", "-", "probe", "plasmid", "pCB192", "and", "the", "compatible", "KnR", "plasmid", "pDPT152", "were", "grown", "in", "LB", "at", "37", "?", ".", "When", "they", "reached", "mid", "-", "log", "phase", ",", "the", "cells", "were", "chilled", ",", "lysed", ",", "and", "assayed", "for", "(", "3-galactosidase", "activity", "according", "to", "the", "procedure", "of", "Miller", "(", "23", ")", ".", "Plasmids", "derived", "from", "pCB192", "are", "indicated", "at", "the", "left", "side", "of", "the", "Table", ".", "Plasmids", "derived", "from", "pDPT152", "are", "indicated", "in", "parentheses", "across", "the", "top", "of", "the", "Table", ".", "The", "values", "reported", "are", "the", "average", "of", "two", "independent", "experiments", ".", "Relative", "activity", "is", "defined", "as", "the", "f3-galactosidase", "activity", "measured", "in", "cells", "harboring", "plasmids", "expressing", "cl", "divided", "by", "the", "activity", "measured", "in", "cells", "carrying", "only", "pDPT152", ".", "\n\n ", "7675", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "GATATCCAATCAGGAGTACC", "GCATCACCCAAGACGACCTG", "GATGATCTCACTGACACAAT", "CGAATATCTCATGGCCACTA", "ACCAGCCAGACTCACAATAAATGCA", " ", "105", "v--", "\n\n ", "TtgAca", " ", "TATAATG", "\n\n ", "CTAATAAATCTATTATTTTC", "GTTGGATCCTTCTATAATGG", "TGGCCAACAACTCCCAGTGT", "AATCCGCTGTGAGTTGTTGG", "CCATGTCAATTCTGGAGGAGGATCA", " ", "210", "\n\n ", "b-----", " ", "I", " ", "I", " ", "GGAGGtG", "\n\n ", "ATG", "ATA", "AAT", "TAT", "GTC", "TAC", "GGC", "GAA", "CAA", "CTG", "TAC", "CAG", "GAG", "TTC", "GTC", "AGC", "TTC", "AGG", "GAT", "CTC", "TTT", "CTA", "AAA", "AAA", "GCT", "GTT", "GCA", "CGC", "GCC", "CAA", " ", "300", "MET", "lIe", "Asn", "Tyr", "Vat", "Tyr", "Gly", "Glu", "Gin", "Leu", "Tyr", "Gin", "Gtu", "Phe", "Vat", "Ser", "Phe", "Arg", "Asp", "Leu", "Phe", "Leu", "Lys", "Lys", "Ala", "Val", "Ala", "Arg", "Ala", "Gtn", "\n\n ", "tag(cl", ".55", ")", "\n\n ", "CAC", "GTT", "GAT", "GCC", "GCC", "AGC", "GAC", "GGT", "CGT", "CCT", "GTT", "CGC", "CCG", "GTT", "GTC", "GTT", "CTG", "CCG", "TTC", "AM", "GM", "ACG", "GAC", "AGC", "ATT", "CAG", "GCT", "GMA", "ATT", "GAT", " ", "390", "His", "Val", "Asp", "Ala", "Ala", "Ser", "Asp", "Gly", "Arg", "Pro", "Vat", "Arg", "Pro", "Vat", "Vat", "Vat", "Leu", "Pro", "Phe", "Lys", "Glu", "Thr", "Asp", "Ser", "lIe", "Gin", "Ala", "Glu", "lie", "Asp", "\n\n ", "T", " ", "A", " ", "C", " ", "A", " ", "G", "\n\n ", "AAA", "TGG", "ACA", "TTA", "ATG", "GCG", "CGG", "GAA", "CTG", "GAG", "CAG", "TAC", "CCA", "GAT", "CTC", "MT", "ATC", "CCA", "MG", "ACT", "ATT", "TTA", "TAT", "CCT", "GTA", "CCT", "AAC", "ATC", "CTT", "CGC", " ", "480", "\n\n ", "9", "\n\n ", "Lys", "Trp", "Thr", "Leu", "MET", "Ala", "Arg", "Glu", "Leu", "Gtu", "Gin", "Tyr", "Pro", "Asp", "Leu", "Asn", "lIe", "Pro", "Lys", "Thr", "lie", "Leu", "Tyr", "Pro", "Vat", "Pro", "Asn", "lIe", "Leu", "Arg", "\n\n ", "A", " ", "T", " ", "C", "\n\n ", "GGT", "GTG", "CGT", "AAG", "GTT", "ACG", "ACT", "TAT", "CAG", "ACA", "GAA", "GCA", "GTG", "MC", "AGC", "GTC", "AAT", "ATG", "ACC", "GCT", "GGC", "CGC", "ATT", "ATT", "CAT", "CTG", "ATT", "GAT", "AAG", "GAC", " ", "570", "Gly", "Vat", "Arg", "Lys", "Vat", "Thr", "Thr", "Tyr", "Gin", "Thr", "Glu", "Ala", "Vat", "Asn", "Ser", "Vat", "Asn", "MET", "Thr", "Ala", "Gly", "Arg", "lIe", "lIe", "His", "Leu", "lIe", "Asp", "Lys", "Asp", "\n\n ", "G", "\n\n ", "ATT", "CGC", "ATC", "CAA", "AM", "AGC", "GCG", "GGG", "ATC", "MT", "GAG", "CAC", "AGT", "GCG", "AAA", "TAC", "ATA", "GAG", "MC", "CTG", "GAA", "GCA", "ACA", "AM", "GAG", "CTA", "ATG", "AAG", "CAG", "TAC", " ", "660", "lle", "Arg", "lIe", "Gin", "Lys", "Ser", "Ala", "Gly", "lIe", "Asn", "Gtu", "His", "Ser", "Ala", "Lys", "Tyr", "lIe", "Gtu", "Asn", "Leu", "Gtu", "Ala", "Thr", "Lys", "Gtu", "Leu", "MET", "Lys", "Gin", "Tyr", "\n\n ", "T", " ", "T", "\n\n ", "CCG", "GAG", "GAT", "GAA", "AAA", "TTC", "CGT", "ATG", "CGC", "GTA", "CAC", "GGC", "TTT", "AGC", "GAA", "ACA", "ATG", "CTG", "CGC", "GTC", "CAT", "TAC", "ATT", "TCC", "AGT", "AGC", "CCT", "AAC", "TAC", "AAT", " ", "750", "Pro", "Glu", "Asp", "Glu", "Lys", "Phe", "Arg", "MET", "Arg", "Vat", "His", "Gly", "Phe", "Ser", "Gtu", "Thr", "MET", "Leu", "Arg", "Vat", "His", "Tyr", "lie", "Ser", "Ser", "Ser", "Pro", "Asn", "Tyr", "Asn", "\n\n ", "Phe", "\n\n ", "T", " ", "C", " ", "G", " ", "T", " ", "T", "\n\n ", "I", " ", "~~~I", " ", "I", " ", "II", "\n\n ", "GAT", "GGC", "MA", "TCA", "GTT", "AGT", "TAC", "CAT", "GTG", "CTG", "CTA", "TGT", "GGC", "GTG", "TTT", "ATC", "TGC", "GAT", "GM", "ACT", "CTC", "CGA", "GAT", "GGA", "ATC", "ATC", "ATC", "AAC", "GGT", "GAA", " ", "840", "\n\n ", "e", "..", "Asp", "Gly", "Lys", "Ser", "Vat", "Ser", "Tyr", "His", "Vat", "Leu", "Leu", "Cys", "Gly", "Vat", "Phe", "lie", "Cys", "Asp", "Glu", "Thr", "Leu", "Arg", "Asp", "Gly", "lIe", "lie", "lIe", "Asn", "Gly", "Gtu", "\n\n ", "Pro", "\n\n ", "C", " ", "tag(cl", ".169", ")", "\n\n ", "TTT", "GAG", "AM", "GCA", "AAA", "TTT", "AGC", "CTT", "TAT", "GAC", "TCT", "ATA", "GM", "CCG", "ATC", "ATC", "TGC", "GAC", "CGC", "TGG", "CCG", "CAG", "GCA", "AM", "ATA", "TAT", "CGC", "CTG", "GCA", "GAT", " ", "930", "Phe", "Gtu", "Lys", "Ala", "Lys", "Phe", "Ser", "Leu", "Tyr", "Asp", "Ser", "lIe", "Glu", "Pro", "lie", "lie", "Cys", "Asp", "Arg", "Trp", "Pro", "Gin", "Ala", "Lys", "lIe", "Tyr", "Arg", "Leu", "Ala", "Asp", "\n\n ", "T", "\n\n ", "ATT", "GM", "MT", "GTA", "AM", "AM", "CM", "ATT", "GCC", "ATC", "ACT", "CGC", "GM", "GAG", "AAA", " ", "G", "GTC", "AM", "TCA", "GCC", "GCA", "TCA", "GTT", "ACG", "CGC", "AGC", "CGC", "AAA", "ACT", "AAG", "1020", "\n\n ", "n-----", "\n\n ", "lie", "Glu", "Asn", "Vat", "Lys", "Lys", "Gin", "lIe", "Ala", "lie", "Thr", "Arg", "Glu", "Glu", "Lys", "Lys", "Vat", "Lys", "Ser", "Ala", "Ala", "Ser", "Vat", "Thr", "Arg", "Ser", "Arg", "Lys", "Thr", "Lys", "\n\n ", "AAG", "GGG", "CAG", "CCA", "GTA", "AAC", "GAC", "MC", "CCC", "GAA", "AGC", "GCG", "CM", "TAG", "Lys", "Gly", "Gin", "Pro", "Val", "Asn", "Asp", "Asn", "Pro", "Glu", "Ser", "Ala", "Gin", "ter", "\n\n ", "Fig", ".", "3", ".", "DNA", "sequence", "of", "PIcI", "and", "P7cl", ".", "The", "DNA", "sequence", "of", "PIcI", "is", "indicated", ".", "Positions", "where", "the", "sequence", "of", "P7cl", "differs", "from", "that", "of", "Plcl", "are", "indicated", "above", "the", "P1", "sequence", ".", "The", "amino", "acid", "sequence", "predicted", "by", "the", "open", "reading", "frame", "is", "given", "below", "the", "sequence", ".", "The", "two", "amino", "acid", "substitutions", "present", "in", "P7cl", "are", "shown", "below", "the", "open", "reading", "frame", ".", "The", "locations", "of", "the", "amber", "mutant", "codons", "in", "cl.55", "and", "ci", ".", "169", "are", "indicated", "by", "small", "letters", "above", "the", "sequence", ".", "Sites", "for", "selected", "restriction", "enzymes", "(", "EcoRV", "[", "v", "]", ";", "BamHI", "[", "b", "]", ";", "Bgll", "[", "g", "]", ";", "EcoRP", "[", "e", "]", ";", "and", "NruI", "[", "n", "]", ")", "are", "illustrated", "by", "dashed", "lines", "beneath", "the", "sequence", ".", "The", "cl", "repressor", "binding", "site", "is", "underlined", ".", "Inverted", "arrows", "beneath", "the", "sequence", "illustrate", "the", "inverted", "repeat", "sequence", "upstream", "of", "the", "open", "reading", "frame", ".", "Predicted", "promoter", "ribosome", "binding", "sites", "are", "indicated", "by", "the", "presence", "of", "the", "consensus", "sequences", "above", "and", "below", "the", "line", ",", "respectively", ".", "The", "DNA", "sequences", "of", "Plcl", "from", "bp", "1", "-", "134", "and", "bp", "1", "-", "434", "were", "reported", "previously", "(", "2,5", ")", ".", "\n\n ", "mutant", "cl", "genes", "from", "either", "P1", "or", "P7", "(", "Table", "1", ")", ".", "The", "efficiency", "with", "which", "a", "cloned", "P7cl", "gene", "complements", "a", "PlcI", "mutation", "confirms", "previous", "genetic", "studies", "indicating", "that", "these", "two", "genes", "are", "functionally", "interchangeable", "(", "9", ")", ".", "The", "location", "of", "the", "'", "y6", "mutations", "that", "destroy", "cl", "-", "complementing", "activity", "suggests", "that", "the", "P7cl", "open", "reading", "frame", "occupies", "a", "map", "position", "similar", "to", "that", "of", "the", "P1", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "7676", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Proteins", "produced", "by", "fragments", "containing", "Plcl", ".", "\n\n ", "As", "an", "initial", "step", "in", "the", "comparison", "of", "the", "P1", "and", "P7", "repressors", ",", "we", "analyzed", "the", "gene", "products", "expressed", "from", "the", "cloned", "cl", "regions", ".", "In", "an", "in", "vitro", "transcription", "-", "translation", "reaction", ",", "plasmids", "coding", "for", "the", "wildtpe", "alleles", "of", "either", "PIcI", "or", "P7cl", "direct", "the", "production", "of", "a", "protein", "with", "an", "estimated", "molecular", "weight", "of", "33,000", "daltons", "(", "Figure", "2", ",", "Lanes", "C", "and", "D", ")", ",", "a", "size", "that", "agrees", "closely", "with", "the", "predicted", "molecular", "weight", "of", "the", "PIcI", "repressor", "reported", "previously", "(", "3,28", ")", ".", "The", "loss", "of", "the", "33,000", "dalton", "protein", "in", "the", "cl", "-", "'", "ya", "-", "induced", "P7", "mutant", "plasmids", "(", "Figure", "2", ",", "Lanes", "E", "and", "F", ")", "is", "consistent", "with", "its", "designation", "as", "the", "P7cl", "repressor", ".", "As", "expected", ",", "the", "33,000", "dalton", "protein", "is", "not", "observed", "when", "reaction", "mixtures", "contain", "DNA", "from", "Plcl", "amber", "mutants", "(", "Figure", "2", ",", "Lanes", "A", "and", "B", ")", ".", "DNA", "sequence", "analysis", "of", "the", "cl", "genes", ".", "\n\n ", "To", "make", "a", "direct", "comparison", "between", "the", "Plcl", "and", "P7cl", "DNA", "sequences", "and", "to", "predict", "the", "amino", "acid", "sequences", "of", "the", "repressor", "proteins", ",", "we", "carried", "out", "M", "13-dideoxy", "sequence", "analysis", "of", "cloned", "fragments", "carrying", "the", "cl", "genes", ".", "The", "sequences", "of", "about", "1", "kb", "of", "P1", "and", "P7", "DNA", "were", "determined", "starting", "from", "a", "common", "EcoRV", "site", "predicted", "to", "lie", "approximately", "200", "bps", "upstream", "of", "the", "cl", "genes", ".", "The", "P1", "and", "P7", "sequences", "(", "Figure", "3", ")", "both", "contain", "an", "ATG", "initiation", "codon", "preceded", "by", "a", "putative", "ribosome", "binding", "sequence", "(", "29", ")", "situated", "211", "bps", "downstream", "of", "the", "EcoRV", "site", ".", "In", "each", "case", ",", "the", "initiation", "codon", "is", "followed", "by", "an", "open", "reading", "reading", "frame", "extending", "for", "283", "codons", ".", "The", "P1", "and", "P7", "open", "reading", "frames", "code", "for", "proteins", "with", "predicted", "molecular", "weights", "(", "32,515", "and", "32,499", "daltons", ",", "respectively", ")", "that", "agree", "closely", "with", "the", "values", "of", "the", "proteins", "expressed", "from", "the", "cloned", "DNA", "fragments", "(", "Figure", "2", ")", "and", "with", "results", "predicted", "independently", "for", "the", "purified", "PIcI", "repressor", "(", "3", "-", "4", ")", ".", "The", "localization", "of", "two", "PIcI", "amber", "mutations", "to", "the", "P1", "open", "reading", "frame", "confirms", "its", "identification", "as", "the", "cI", "coding", "sequence", ".", "cI.", "169", "contains", "an", "amber", "mutation", "that", "would", "result", "in", "a", "protein", "fragment", "of", "26,680", "daltons", ",", "a", "value", "that", "agrees", "well", "with", "the", "size", "of", "a", "protein", "fragment", "observed", "under", "the", "in", "vitro", "transcription", "/", "translation", "reaction", "conditions", "(", "Figure", "2", ",", "Lane", "B", ")", ".", "The", "cl.55", "amber", "mutation", "lies", "close", "to", "the", "N", "-", "terminal", "region", "of", "the", "protein", ",", "resulting", "in", "the", "production", "of", "a", "fragment", "of", "55", "amino", "acids", "that", "is", "apparently", "too", "small", "to", "resolve", "under", "the", "electrophoretic", "conditions", "used", "for", "separation", "of", "the", "proteins", ".", "Over", "60", "%", "of", "the", "amino", "acid", "sequence", "predicted", "for", "the", "PIcI", "open", "reading", "frame", "has", "been", "verified", "by", "amino", "acid", "sequence", "analysis", "of", "peptide", "fragments", "isolated", "from", "the", "purified", "repressor", "protein", "(", "see", "accompanying", "paper", ",", "reference", "3", ")", ".", "\n\n ", "The", "DNA", "sequences", "of", "P1", "and", "P7", "are", "identical", "for", "a", "399-bp", "region", "that", "extends", "from", "the", "EcoRV", "site", "at", "the", "5", "'", "side", "of", "the", "cl", "gene", "to", "a", "point", "188", "bps", "within", "the", "open", "reading", "frame", ".", "The", "sequences", "within", "the", "Plcl", "and", "the", "P7cl", "open", "reading", "frames", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "occur", "in", "the", "wobble", "position", "of", "the", "predicted", "codon", ".", "From", "these", "results", ",", "we", "conclude", "that", "the", "functional", "identity", "of", "the", "P1", "and", "P7", "cl", "genes", "is", "a", "consequence", "of", "their", "nearly", "identical", "amino", "acid", "sequence", ".", "Analysis", "of", "promoters", "upstream", "of", "the", "cl", "open", "reading", "frame", ".", "\n\n ", "Expression", "of", "Plcl", "was", "shown", "previously", "to", "require", "sequences", "on", "the", "distal", "side", "of", "a", "BamHI", "site", "(", "2", ",", "5", ")", "located", "about", "100", "bps", "upstream", "of", "the", "open", "reading", "frame", "(", "Figure", "3", ")", ".", "A", "binding", "site", "for", "the", "cl", "repressor", "has", "also", "been", "shown", "to", "exist", "close", "to", "this", "BamHI", "site", "(", "2", ",", "5", ",", "6", ")", ".", "To", "determine", "whether", "this", "region", "contains", "a", "promoter", "that", "is", "detectable", "in", "vivo", "and", ",", "further", ",", "to", "determine", "whether", "this", "promoter", "can", "be", "regulated", "by", "cl", "repressor", "proteins", "from", "either", "P1", "or", "P7", ",", "we", "introduced", "several", "DNA", "fragments", "from", "this", "region", "into", "the", "promoter", "probe", "vector", "pCB192", ",", "screened", "for", "promoter", "activity", "(", "as", "monitored", "by", "lacZ", "expression", ")", "and", "checked", "for", "repression", "of", "this", "activity", "in", "the", "presence", "of", "a", "compatible", "\n\n ", "7677", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "plasmid", "expressing", "Plcl", "or", "P7cl", ".", "Cells", "harboring", "pBCB2.13", "(", "a", "plasmid", "which", "carries", "a", "460", "bp", "fragment", "of", "P1", "DNA", "that", "extends", "across", "the", "BamHI", "site", "upstream", "of", "cl", "into", "the", "open", "reading", "frame", ")", "are", "dark", "blue", "in", "the", "presence", "of", "Xgal", "and", "produce", "significant", "levels", "of", "3-galactosidase", "(", "Table", "2", ")", ".", "In", "contrast", ",", "pBCB2.16", "and", "pBCB2.18", "(", "which", "each", "contain", "DNA", "from", "only", "one", "side", "of", "the", "BamHI", "site", "located", "in", "pBCB2", ".", "13", ")", "do", "not", "confer", "a", "blue", "color", "on", "their", "host", "cell", "in", "the", "presence", "of", "X", "-", "Gal", "and", "express", "negligible", "amounts", "of", "3-galactosidase", "(", "Table", "2", ")", ".", "These", "observations", "suggest", "that", "expression", "from", "the", "promoter", "identified", "here", "requires", "sequences", "that", "span", "the", "BamHI", "site", "upstream", "of", "cl", ".", "Expression", "of", "cl", "from", "a", "compatible", "plasmid", "in", "the", "presence", "of", "pBCB2", ".", "13", "results", "in", "a", "90", "%", "reduction", "in", "promoter", "strength", "(", "Table", "2", ")", ".", "This", "reduction", "is", "seen", "in", "the", "presence", "of", "either", "Plcl", "or", "P7cl", ",", "indicating", "that", "the", "two", "repressor", "proteins", "are", "both", "capable", "of", "repressing", "expression", "from", "this", "promoter", ".", "DISCUSSION", ".", "\n\n ", "The", "DNA", "sequences", "of", "Plcl", "and", "P7cl", "differ", "at", "only", "18", "sites", ",", "all", "but", "two", "of", "which", "occur", "at", "the", "third", "position", "of", "the", "affected", "codon", ".", "This", "observation", "provides", "biochemical", "confirmation", "of", "the", "functional", "identity", "predicted", "on", "the", "basis", "of", "previous", "genetic", "analysis", "(", "9", ")", ".", "A", "number", "of", "DNA", "binding", "proteins", "exhibit", "a", "common", "structural", "motif", "in", "which", "two", "helices", "are", "separated", "by", "a", "glycine", "residue", "(", "12", ")", ".", "This", "motif", "is", "not", "observed", "in", "the", "predicted", "secondary", "structures", "(", "30", ")", "of", "the", "Plcl", "and", "P7cl", "amino", "acid", "sequences", ".", "A", "sequence", "with", "some", "similarity", "to", "the", "XCro", "helix", "-", "turn", "-", "helix", "region", "was", "previously", "reported", "near", "the", "Nterminus", "of", "the", "PIcI", "protein", "(", "5", ")", ";", "however", ",", "it", "was", "noted", "that", "the", "potential", "for", "helix", "formation", "is", "disrupted", "by", "the", "presence", "of", "several", "prolines", "within", "the", "region", ".", "The", "secondary", "structure", "predicted", "for", "the", "Plcl", "and", "P7cl", "repressor", "proteins", "(", "30", ")", "does", "not", "reveal", "other", "structural", "characteristics", "(", "e.g", ".", ",", "Zn", "fingers", "(", "31", ")", ",", "leucine", "zippers", "(", "32", ")", ",", "or", "helix", "-", "loop", "-", "helix", "motifs", "(", "33", ")", ")", "that", "have", "been", "associated", "with", "DNA", "binding", "activity", "in", "other", "systems", ".", "A", "search", "of", "the", "GenBank", "and", "EMBL", "databases", "does", "not", "reveal", "any", "other", "known", "regulatory", "proteins", "with", "significant", "amino", "acid", "similarity", "to", "the", "Plcl", "or", "the", "P7cl", "repressor", "sequences", ".", "Since", "the", "Plcl", "repressor", "differs", "from", "most", "other", "repressors", "in", "DNA", "binding", "specificity", "(", "i.e", ".", ",", "in", "its", "recognition", "of", "an", "asymmetric", "operator", "sequence", ")", ",", "it", "is", "not", "unexpected", "to", "find", "that", "the", "protein", "does", "not", "exhibit", "common", "structural", "motifs", "at", "the", "amino", "acid", "level", ".", "\n\n ", "The", "cl", "-", "repressible", "promoter", "described", "in", "this", "report", "is", "located", "in", "a", "region", "just", "upstream", "of", "the", "cl", "open", "reading", "frame", "and", "is", "oriented", "in", "the", "direction", "of", "cl", ".", "Because", "the", "promoter", "is", "present", "on", "a", "multicopy", "plasmid", ",", "it", "is", "not", "possible", "to", "make", "a", "direct", "calculation", "of", "promoter", "strength", ";", "however", ",", "the", "values", "observed", "are", "about", "five", "-", "fold", "lower", "than", "the", "levels", "produced", "by", "a", "derivative", "of", "pCB192", "that", "contains", "the", "plac", "promoter", "from", "pUC19", "(", "34", ")", ".", "Because", "sequences", "on", "both", "sides", "of", "the", "BamHI", "site", "located", "upstream", "of", "cl", "are", "required", "for", "promoter", "activity", "(", "Table", "2", ")", ",", "we", "suggest", "that", "the", "promoter", "spans", "this", "site", ".", "Less", "than", "10", "bps", "downstream", "of", "this", "BamHI", "site", "is", "a", "heptanucleotide", "sequence", "(", "TATAATG", ")", "that", "is", "identical", "to", "the", "-10", "consensus", "sequence", "for", "RNA", "polymerase", "(", "35", ")", ".", "If", "this", "sequence", "does", "indeed", "correspond", "to", "the", "-10", "region", "of", "the", "promoter", ",", "the", "-35", "region", "would", "be", "predicted", "to", "lie", "on", "the", "other", "side", "of", "the", "BamHI", "site", "in", "a", "region", "that", "overlaps", "a", "known", "cI", "repressor", "binding", "site", "(", "2", "-", "5", ")", ".", "Analysis", "of", "this", "region", "does", "not", "reveal", "any", "sequences", "with", "significant", "similarity", "to", "the", "-35", "consensus", "sequence", ".", "The", "best", "fit", "is", "the", "sequence", "TCTATT", "(", "Figure", "3", ")", ",", "which", "matches", "only", "two", "positions", "of", "the", "-35", "consensus", "(", "TTGACA", ")", ".", "The", "lack", "of", "a", "strong", "-35", "region", "is", "often", "observed", "with", "genes", "that", "require", "an", "activator", ".", "Although", "a", "pentanucleotide", "sequence", "corresponding", "to", "the", "conserved", "portion", "of", "the", "CRP", "protein", "consensus", "binding", "site", "(", "36", ")", "\n\n ", "7678", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "is", "located", "just", "upstream", "of", "the", "predicted", "-35", "region", "(", "at", "position", "91", ";", "Figure", "3", ")", ",", "a", "role", "for", "CRP", "-", "mediated", "activation", "in", "cl", "expression", "has", "not", "previously", "been", "described", ".", "The", "orientation", "of", "the", "promoter", "and", "its", "cl", "-", "repressible", "character", "raise", "the", "possibility", "that", "cl", "expression", "is", "autoregulatory", ".", "If", "this", "is", "so", ",", "one", "potential", "activator", "would", "be", "the", "cl", "repressor", "itself", ".", "Expression", "cannot", "be", "absolutely", "dependent", "on", "cl", "-", "mediated", "activation", ",", "however", ",", "because", "the", "cloned", "promoter", "exhibits", "significant", "activity", "in", "the", "absence", "of", "the", "cl", "gene", "(", "Table", "2", ")", ".", "Under", "the", "conditions", "reported", "here", ",", "the", "presence", "of", "the", "cl", "gene", "results", "in", "a", "decrease", "rather", "than", "an", "increase", "in", "lacZ", "expression", ";", "however", ",", "these", "observations", "do", "not", "rule", "out", "a", "potential", "activator", "role", "for", "the", "cl", "protein", ",", "since", "the", "ratios", "of", "repressor", "and", "operator", "provided", "by", "the", "multicopy", "plasmids", "may", "not", "be", "optimal", "for", "activation", ".", "Physiologically", ",", "the", "role", "of", "additional", "repressor", "binding", "sites", "in", "regulating", "cl", "expression", "also", "cannot", "be", "discounted", ".", "Three", "potential", "operator", "sites", "have", "been", "identified", "several", "hundred", "bps", "upstream", "of", "the", "cI", "open", "reading", "frame", "(", "2", "-", "5", ")", ";", "one", "or", "more", "of", "these", "could", "be", "involved", "(", "possibly", "through", "a", "DNA", "looping", "mechanism", ";", "37", ")", "in", "the", "activation", "or", "repression", "of", "cl", "expression", "during", "phage", "growth", ".", "\n\n ", "A", "cl", "-", "repressible", "promoter", "oriented", "in", "the", "direction", "of", "cl", "was", "previously", "reported", "(", "38", ")", "to", "be", "located", "entirely", "within", "PlBamHI-9", ",", "a", "fragment", "located", "upstream", "of", "cl", "which", "is", "bracketed", "by", "the", "BamHI", "site", "within", "pBCB2", ".", "13", ".", "Because", "sequences", "on", "both", "sides", "of", "this", "BamHI", "site", "are", "required", "for", "the", "activity", "of", "the", "promoter", "in", "pBCB2.13", ",", "we", "suggest", "that", "the", "previously", "identified", "promoter", "is", "distinct", "from", "the", "one", "reported", "here", ".", "The", "promoter", "from", "BamHI-9", "could", "correspond", "to", "a", "consensus", "promoter", "sequence", "that", "is", "situated", "about", "500", "bps", "upstream", "of", "cl", "and", "overlaps", "a", "cl", "repressor", "binding", "site", "(", "2", ")", ".", "If", "so", ",", "cl", "expression", "is", "likely", "to", "be", "controlled", "by", "more", "than", "one", "promoter", ".", "Located", "between", "this", "promoter", "sequence", "and", "the", "promoter", "encoded", "on", "pBCB2", ".", "13", "is", "an", "open", "reading", "frame", "whose", "product", "(", "termed", "coi", ",", "or", "c", "-", "one", "inactivator", ")", "has", "been", "implicated", "in", "the", "establishment", "of", "lytic", "growth", "(", "1", ",", "39", ";", "B.R.", "Baumstark", ",", "unpublished", "results", ")", ".", "It", "has", "been", "suggested", "(", "2", ")", "that", "the", "decision", "to", "enter", "lytic", "or", "lysogenic", "growth", "is", "influenced", "by", "the", "level", "of", "transcription", "initiated", "from", "the", "distal", "promoter", "(", "which", "would", "transcribe", "coi", "prior", "to", "the", "transcription", "of", "cl", ")", "relative", "to", "that", "of", "the", "promoter", "located", "immediately", "upstream", "of", "the", "cl", "gene", "(", "which", "would", "transcribe", "only", "ci", ")", ".", "\n\n ", "A", "32-nucleotide", "hyphenated", "inverted", "repeat", "sequence", "is", "located", "just", "upstream", "of", "the", "cl", "open", "reading", "frame", "(", "positions", "146", "-", "188", ";", "Figure", "3", ")", ".", "It", "is", "not", "currently", "known", "whether", "this", "sequence", "has", "any", "regulatory", "effect", "on", "cl", "expression", ".", "Conceivably", ",", "the", "sequence", "could", "serve", "as", "a", "recognition", "site", "for", "an", "as", "-", "yet", "-", "unidentified", "regulatory", "protein", ".", "Alternatively", ",", "it", "may", "affect", "the", "secondary", "structure", "of", "the", "messenger", "RNA", ".", "A", "transcript", "extending", "from", "a", "promoter", "located", "upstream", "of", "the", "putative", "coi", "open", "reading", "frame", "would", "be", "capable", "of", "forming", "a", "stable", "stem", "-", "loop", "structure", "containing", "16", "bps", "with", "a", "single", "bp", "mismatch", "(", "AG", "=", "-33.6", "Kcal", ")", "of", "this", "inverted", "repeat", "sequence", ".", "Such", "a", "structure", "could", "potentially", "serve", "as", "a", "recognition", "site", "for", "a", "regulatory", "factor", "or", ",", "alternatively", ",", "could", "mask", "such", "a", "site", ".", "On", "the", "other", "hand", ",", "transcription", "originating", "from", "the", "promoter", "spanning", "the", "BamHI", "site", "just", "upstream", "of", "cl", "would", "start", "at", "a", "site", "within", "the", "inverted", "repeat", "sequence", ",", "forming", "a", "comparatively", "less", "stable", "stem", "-", "loop", "structure", "of", "about", "8", "bps", ".", "The", "role", "of", "the", "inverted", "repeat", "region", "in", "the", "regulation", "of", "cl", "expression", "is", "currently", "under", "investigation", ".", "\n\n ", "ACKNOWLEDGEMENTS", "\n\n ", "We", "thank", "Heinz", "Schuster", "for", "his", "review", "of", "the", "manuscript", ".", "This", "work", "was", "supported", "by", "National", "Science", "Foundation", "grant", "DMB-8704146", ".", "\n\n ", "7679", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Abbreviations", ":", "bp", ",", "basepairs", ";", "kb", ",", "kilobase", "pairs", ";", "X", "-", "Gal", ",", "5-Bromo-4-Chloro-3-indolylbeta", "-", "D", "-", "galactopyranoside", ".", "\n\n ", "*", "To", "whom", "correspondence", "should", "be", "addressed", "\n\n ", "REFERENCES", "\n\n ", "1", ".", "Yarmolinsky", ",", "M.B.", ",", "and", "Steinberg", ",", "N.", "(", "1988", ")", ".", "In", "Calendar", ",", "R.", ",", "(", "ed", ".", ")", ",", "The", "Bacteriophages", ",", "Plenum", "Publishing", "\n\n ", "Corp", ".", ",", "NY", ",", "Vol", ".", "1", ",", "pp", ".", "291", "-", "438", ".", "\n\n ", "2", ".", "Baumstark", ",", "B.R.", ",", "Stovall", ",", "S.R.", ",", "and", "Ashkar", ",", "S.", "(", "1987", ")", ".", "Virology", "156", ",", "404", "-", "413", ".", "\n\n ", "3", ".", "Dreiseikelmann", ",", "B.", ",", "Velleman", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1988", ")", ".", "J.", "Biol", ".", "Chem", ".", "263", ",", "1391", "-", "1397", ".", "\n\n ", "4", ".", "Heinrich", ",", "J.", ",", "Riedel", ",", "H.-D.", ",", "Baumstark", ",", "B.R.", ",", "Kimura", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1989", ")", ".", "Nucleic", "Acids", "Res", ",", "\n\n ", "this", "volume", ".", "\n\n ", "5", ".", "Eliason", ",", "J.L.", ",", "and", "Stemnberg", ",", "N.", "(", "1987", ")", ".", "J.", "Mol", ".", "Biol", ".", "198", ",", "281", "-", "293", ".", "\n\n ", "6", ".", "Velleman", ",", "M.", ",", "Dreiseikelmann", ",", "B.", ",", "and", "Schuster", ",", "H.", "(", "1987", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "84", ",", "5570", "-", "5574", ".", "7", ".", "Citron", ",", "M.", ",", "Velleman", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1988", ")", ".", "J.", "Biol", ".", "Chem", ".", "264", ",", "3611", "-", "3617", ".", "\n\n ", "8", ".", "Chadwick", ",", "P.", ",", "Pirotta", ",", "V.", ",", "Steinberg", ",", "R.", ",", "Hopkins", ",", "N.", ",", "and", "Ptashne", ",", "M.", "(", "1970", ")", ".", "Cold", "Spring", "Harbor", "Symp", ".", "\n\n ", "Quant", ".", "Biol", ".", "35", ",", "283", "-", "294", ".", "\n\n ", "9", ".", "Chesney", ",", "R.H.", ",", "and", "Scott", ",", "J.R.", "(", "1975", ")", ".", "Virology", "67", ",", "375", "-", "384", ".", "\n\n ", "10", ".", "Wandersman", ",", "C.", ",", "and", "Yarmolinsky", ",", "M.", "(", "1977", ")", ".", "Virology", "78", ",", "267", "-", "276", ".", "\n\n ", "11", ".", "Scott", ",", "J.R.", ",", "West", ",", "B.W.", ",", "and", "Laping", ",", "J.L.", "(", "1978", ")", ".", "Virology", "85", ",", "587", "-", "600", ".", "12", ".", "Pabo", ",", "C.O.", ",", "and", "Sauer", ",", "R.", "A.", "(", "1984", ")", ".", "Ann", ".", "Rev", ".", "Biochem", ".", "53", ",", "293", "-", "321", ".", "13", ".", "Scott", ",", "J.R.", "(", "1974", ")", ".", "Virology", "62", ",", "344", "-", "349", ".", "\n\n ", "14", ".", "Schneider", ",", "K.", ",", "and", "Beck", ",", "C.F.", "(", "1987", ")", ".", "Methods", "in", "Enzymol", ".", "153", ",", "452", "-", "461", ".", "15", ".", "Smith", ",", "H.W.", "(", "1972", ")", ".", "Nature", "New", "Biol", ".", "238", ",", "205", "-", "206", ".", "16", ".", "Scott", ",", "J.R.", "(", "1975", ")", ".", "Virology", "65", ",", "173", "-", "178", ".", "\n\n ", "17", ".", "Scott", ",", "J.R.", ",", "Kropf", ",", "M.M.", ",", "and", "Mendelson", ",", "L.", "(", "1977", ")", ".", "Virology", "76", ",", "39", "-", "46", ".", "18", ".", "Scott", ",", "J.R.", "(", "1968", ")", ".", "Virology", "36", ",", "564", "-", "574", ".", "\n\n ", "19", ".", "Walker", ",", "D.H.", ",", "Jr", ".", ",", "and", "Walker", ",", "J.T.", "(", "1976", ")", ".", "J.", "Virol", ".", "20", ",", "177", "-", "187", ".", "20", ".", "Stemnberg", ",", "N.", "(", "1979", ")", ".", "Virology", "96", ",", "129", "-", "142", ".", "\n\n ", "21", ".", "Schneider", ",", "K.", ",", "and", "Beck", ",", "C.F.", "(", "1986", ")", ".", "Gene", "42", ",", "37", "-", "48", ".", "\n\n ", "22", ".", "Taylor", ",", "D.P.", ",", "and", "Cohen", ",", "S.N.", "(", "1979", ")", ".", "J.", "Bacteriol", ".", "137", ",", "92", "-", "104", ".", "\n\n ", "23", ".", "Miller", ",", "J.H.", "(", "1972", ")", ".", "In", "Experiments", "in", "Molecular", "Genetics", ",", "Cold", "Spring", "Harbor", "Laboratory", ",", "Cold", "Spring", "\n\n ", "Harbor", ",", "N.Y.", "352", "-", "355", ".", "\n\n ", "24", ".", "Guyer", ",", "R.S.", "(", "1978", ")", ".", "J.", "Mol", ".", "Biol", ".", "126", ",", "347", "-", "365", ".", "\n\n ", "25", ".", "Devlin", ",", "B.H.", ",", "Baumstark", ",", "B.R.", ",", "and", "Scott", ",", "J.R.", "(", "1982", ")", ".", "Virology", "120", ",", "360", "-", "375", ".", "\n\n ", "26", ".", "Sanger", ",", "F.", ",", "Nicklen", ",", "S.", ",", "and", "Coulson", ",", "A.R.", "(", "1977", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "74", ",", "5463", "-", "5467", ".", "27", ".", "DeVries", ",", "J.K.", ",", "and", "Zubay", ",", "G.", "(", "1967", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "57", ",", "1010", "-", "1012", ".", "\n\n ", "28", ".", "Heilmann", ",", "H.", ",", "Reeve", ",", "J.R.", ",", "and", "Puhler", ",", "A.", "(", "1980", ")", ".", "Mol", ".", "Gen", ".", "Genet", ".", "178", ",", "149", "-", "154", ".", "29", ".", "Shine", ",", "J.", ",", "and", "Dalgarno", ",", "L.", "(", "1974", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "71", ",", "1342", "-", "1346", ".", "30", ".", "Chou", ",", "P.Y.", ",", "and", "Fasman", ",", "G.D.", "(", "1978", ")", ".", "Adv", ".", "Enzymol", ".", "47", ",", "45", "-", "148", ".", "31", ".", "Berg", ",", "J.M.", "(", "1986", ")", ".", "Nature", "319", ",", "264", "-", "265", ".", "\n\n ", "32", ".", "Landschultz", ",", "W.H.", ",", "Johnson", ",", "P.F.", ",", "and", "McKnight", ",", "S.L.", "(", "1988", ")", ".", "Science", "240", ",", "1759", "-", "1764", ".", "33", ".", "Murre", ",", "C.", ",", "McCaw", ",", "P.", ",", "and", "Baltimore", ",", "D.", "Cell", "56", ",", "777", "-", "783", ".", "\n\n ", "34", ".", "Anderson", ",", "B.E.", ",", "Baumstark", ",", "B.R.", ",", "and", "Bellini", ",", "W.J.", "(", "1988", ")", ".", "J.", "Bacteriol", ".", "170", ",", "4493", "-", "4500", ".", "35", ".", "Rosenberg", ",", "M.", ",", "and", "Court", ",", "D.", "(", "1979", ")", ".", "Annu", ".", "Rev", ".", "Genet", ".", "13", ",", "319", "-", "353", ".", "\n\n ", "36", ".", "Ebright", ",", "R.H.", ",", "Cossart", ",", "P.", ",", "Gicquel", "-", "Sanzey", ",", "B.", ",", "and", "Beckwith", ",", "J.", "(", "1984", ")", ".", "Nature", "311", ",", "232", "-", "235", ".", "37", ".", "Ptashne", ",", "M.", "(", "1986", ")", ".", "Nature", "322", ",", "697", "-", "701", ".", "\n\n ", "38", ".", "Stemnberg", ",", "N.", ",", "and", "Hoess", ",", "R.", "(", "1983", ")", ".", "Annu", ".", "Rev", ".", "Genet", ".", "17", ",", "123", "-", "154", ".", "39", ".", "Scott", ",", "J.R.", "(", "1980", ")", ".", "Curr", ".", "Top", ".", "Microbiol", ".", "Immunol", ".", "90", ",", "49", "-", "65", ".", "\n\n ", "7680", "\n\n ", "This", "article", ",", "submitted", "on", "disc", ",", "has", "been", "automatically", "\n\n ", "converted", "into", "this", "typeset", "format", "by", "the", "publisher", "." ]
[ "species" ]
E. coli, E. coli, E. coli, E. coli, E. coli, E. coli, E. coli
30_task2
Sentence: The c1 genes of P1 and P7. Abstract The c1 genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7c1 expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the P1c1 repressor. The c1 regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-turn-helix motif commonly associated with repressor proteins. Two P1c1 amber mutations were localized to the 283-amino acid open reading frame. The P1c1 and P7c1 sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the c1 gene from either phage cause the repression of transcription from a cloned promoter situated upstream of P1c1.Images Volme 7 Nmbe 19198 Nulei Acds eserc The cl genes of P1 and P7 Francis A.Osborne, Sonja R.Stovall and Barbara R.Baumstark* Department of Biology, Georgia State University, Atlanta, GA 30303, USA Received July 11, 1989; Revised and Accepted August 29, 1989 EMBL accession nos X16005, X16006 ABSTRACT The cl genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7cl expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the Plcl repressor. The cl regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-tum-helix motif commonly associated with repressor proteins. Two Plcl amber mutations were localized to the 283-amino acid open reading frame. The Plcl and P7cl sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the cI gene from either phage cause the repression of transcription from a cloned promoter situated upstream of Plcl. INTRODUCTION The cl genes of the plasmid prophages P1 and P7 code for repressor proteins that are required for the establishment and maintenance of lysogeny (reviewed in 1). A protein corresponding to the Plcl repressor has been isolated and shown to be a sequence-specific DNA binding protein that recognizes several widely dispersed sites on the phage DNA (2-7). The consensus DNA sequence recognized by the Plcl repressor (ATTTATTAGAGCA[A/T]T) contains no discernable bilateral symmetry, a feature that is highly unusual among prokaryotic operator sites. P1 and P7 are heteroimmune; that is, each phage is able to establish a lytic infection on a lysogen of the other phage. In this sense, their relationship is analogous to that of phage X and 434, which differ in the DNA specificity of their cI repressor proteins (8). However, genetic studies indicate that Plcl and P7cl can be crossed into the heterologous phage without affecting the immunity specificity of the recipient (9). The basis for P1/P7 heteroimmunity has been localized to a second regulatory gene, c4, that is unlinked to cl. The c4 gene products prevent the expression of antireb, a closely linked gene that interferes with cl-mediated repression (10, 11). According to current models, P1/P7 heteroimmunity results from the inability of the c4 repressor of one phage to prevent antireb expression from the heteroimmune phage genome (10, 11). Because the cl genes of P1 and P7 are genetically interchangeable, it is anticipated that the two gene products carry out similar or identical regulatory functions. The studies presented in this paper were undertaken to investigate the biochemical basis for the apparent genetic identity of the two cl genes. In this paper, we present the DNA sequence of the cl genes of P1 and P7 and the predicted amino acid sequence of the cl repressor proteins. We report that Plcl and P7cl code for proteins of identical size (283 amino acids) and Nucleic Acids Research Volume 17 Number 19 1989 767 1 (r IRL Press Nucleic Acids Research nearly identical sequence. We report further that both repressors prevent the expression of a promoter located immediately upstream of the Plc 1 open reading frame, an observation that confirms their functional similarity and suggests an autoregulatory role for the two proteins. Analysis of the secondary structure predicted by the open reading frames does not reveal the characteristic helix-turn-helix (12) or other motifs commonly associated with DNA binding proteins. MATERIALS AND METHODS Bacterial and phage strains. E. coli K336 is a SuO derivative of K140 (13). E. coli CB454 is a recA-, lacZderivative of K-12 (14). P1 + is described by Scott (13). P7+ is the strain of Smith (15), as described by Scott (16). P7cl. 1 contains a missense mutation in the cl gene (17). The P7 phage strains and the cl amber mutant phage strains PIci .245Cm, Plc1. 169 and P Ic .55 (11) were generously provided by June Scott. Enzymes and reagents. Restriction enzymes, T4 DNA ligase and polymerase, and the Klenow fragment of E. coli DNA polymerase were purchased from Boehringer Biochemicals or New England Biolabs and reactions were carried out according to the manufacturers' instructions. DNA sequencing kits and in vitro transcription-translation kits were purchased from Bethesda Research Laboratories and Amersham Corporation, respectively. Synthetic oligonucleotides to be used as sequencing primers were prepared on an Applied Biosystems DNA synthesizer. Plasmid construction. pBRB7.2. pBRB7.2 (2) contains a 3.2 kb EcoRI/PvuII fragment from the cl region of P1 (Figure 1) inserted into the 2.3 kb EcoRIlPvuII fragment of pBR322 that contains the origin of replication and the f3-lactamase gene. pFA02. P7 plasmid DNA was digested with PvuII, ligated to similarly digested pBR322, and transformed into E. coli K336. Ampicillin-resistant colonies were screened for cl activity by cross-streak complementation analysis against P7cl.1 (18). pFAO2 contains a 3.5 kb insert of P7 DNA. The fragment was localized to the cl region of the P7 genome by Southern hybridization against P1 and P7 DNA that had been digested with BamHI and BglII (data not shown). pBRBJ69. 1 and pBRB55. 1. The PI cI open reading frame was previously localized to a 2.6 kb EcoRlIBamHI fragment derived from PlEcoRI-7 (2). This fragment also contains the wildtype allele for the conditional lethal mutation am43 (19, 20). To clone the cl reading frame from the amber mutant phage Plc1.169 and P Ic .55, we digested phage DNA with EcoRI and BamHI, ligated the digestion products into similarly digested pBR322, and transformed the ligation mixture into E. coli K336. Ampicillin-resistant, tetracyclinesensitive colonies were screened by cross-streak complementation analysis for their ability to support the growth of Plam43. Plasmid DNA isolated from complementation-positive cells was shown by agarose gel electrophoresis to carry plasmids containing the 2.6 kb EcoRIlBamHI fragment from the cl region. The cl mutant open reading frames were placed under the control of normal regulatory signals present in the cI region by digesting the cl.55 and cl. 169-containing plasmids with BamHI and PvuII and inserting a 601 bp BamHI/PvuH fragment containing the cl promoter region (2). The resulting plasmids, pBRB55.1 and pBRB169.1, respectively, contain the 3.2 kb EcoRllPvuIl fragment analogous to that present in pBRB7.2 (Figure 1). pBCB2. 13-2.18. To identify cl-repressible promoters, we introduced selected fragments 7672 Nucleic Acids Research 4 f - - + I 4 P1 4- 4- 4 ECAR H C B R P 4 4.4,~ 4, 1 1 4. I 4, I 11 t t t t t E G R N E B R P 4 4 - 4 1 ' '110z I I I I I I 1 3.2 1.5 1.0 0.5 0 P7 pBRB7.2 -------------------cl1------------- r ~ / >' pFAO2 *-lacZ pBCB2.13 <-lacZ Z pBCB2.16 <-lacZX pBCB2.18 Fig. 1. The cl regions of P1 and P7. A restriction map is indicated by the solid line in the upper part of the figure. Sites for EcoRI (E), Pvul (P), NnrI (N), Bgll (G), BamHI (B), and EcoRV (R) are shown. The sequencing strategy is indicated by the horizontal arrows. Letters and arrows above and below the map refer to sites and sequence analysis for P1 and P7, respectively. The size of this region (in kilobase pairs) is indicated below the map. The DNA fragments present in selected plasmids are illustrated by boxes at the bottom of the figure. The dashed line reveals the approximate position of the cl gene (2). The sites of the -yb mutations introduced into pFA02 are indicated by asterisks. pFA02.16 and pFA02.26 contain insertions located 0.9 kb and 1.4 kb, respectively, from the PvuIl site at the left side of the map. The direction of the lacZ open reading frame in pBCB2.13-18 is indicated by the adjacent arrow. from the cI region of P1 into pCB192, a promoter-probe vector containing promoterless copies of lacZ and galK extending in opposite directions from a multiple cloning site (21). The source of P1 DNA for these constructions was pZHA3, a derivative of pBRB7.2 that contains a HindIlI linker at the single EcoRV site located about 200 bps upstream of the cl open reading frame (Figure 1). pBCB2.13 contains a 460 bp fragment of P1 DNA extending from the EcoRV site to a Bgll site within the cI open reading frame. pBCB2. 16 contains a 130 bp fragment extending from the EcoRV site to a BamHI site located about 100 bps upstream of the cl open reading frame, while pBCB2.18 contains the region extending from this BamHI site to the Bglll site within the open reading frame (Figure 1). The orientation of the P1 DNA fragments within these plasmids was confirmed by restriction mapping and DNA sequencing. To test for the regulation of promoter expression by cl, we transformed pBCB2.13 and its derivatives into CB454(pBRB7.152) and CB454(pFAO2.152), two strains that express P7cl and Pll, respectively, from the pCB192-compatible kanamycin-resistant vector pDPT152 (22). Cells harboring both plasmids were selected by their resistance to both ampicillin and kanamycin. lacZ expression was measured by the procedure of Miller (23). pBRB7.152 was generated by introducing PlEcoRI-7 into pDPT152. pBRB7.152 has sustained a spontaneous deletion within the EcoRI-7 fragment that results in the loss of 2.5 kb of P1 DNA from the far left side of the P1 genetic map, but retains the 3.2 kb PvuHlEcoRI fragment required for cl expression that is present in pBRB7.2 (Figure 1). 7673 z I 011Z I e., Nucleic Acids Research Table 1. Complementation of PIci .245 by plasmids that contain cI genes. Phenotype Efficiency Relative of of Efficiency of Plasmid cI gene Lysogeny Lysogeny pBR322 1.5x 10-6 6.0x 10-6 pBRB7.2 Plcl+ 2.5 x 10-' 1.0 pBRB55.1 Plcl-am 1.4 x 10-6 5.6 x 10-6 pBRB169.1 PlCl-am 2.1 x 10-6 8.4 x 10-6 pFAO2 P7cl+ 8.7 x 10-2 0.35 pFAO2.16 P7c I-, 4.7 x 10-6 1.9 X 10-5 pFAO2.26 P7cI -1 3.1 x 10-6 1.2 x 10-5 Complementation for lysogeny was carried out as described by Devlin et al. (26). The plasmids were carried by E. coli K336. Cells were grown to mid-log phase at 370 in LB containing 50 tig/m1 sodium ampicillin and infected with Plcl.245 at a multiplicity of infection of 5 in the presence of 50 mM CaC12. After 10 minutes, non-absorbed phage were removed by centrifugation and the infection was allowed to proceed for 2 hours at 370. The infected cells were plated on LB plates containing 50 pLg/ml sodium ampicillin, 50 pLg/ml chloramphenicol, and 40 mM sodium citrate. The efficiency of lysogeny is defined as the number of ApRCmR cells at the end of infection divided by the number of ApR cells present at the start of the infection. To construct pFA02.152, we introduced a 2.8 kb EcoRV fragment of P7 DNA containing the cl gene (Figure 1) into the single EcoRI site of pDPT152 after it had been rendered blunt-ended by extension with T4 DNA polymerase. cl expression by cells harboring either pBRB7.152 or pFA02.152 was confirmed by measuring their ability to form chloramphenicol-resistant lysogens when infected with Plcl.245Cm. ,yb insertional mutagenesis. Insertional mutagenesis of P7cl was carried out using the 'yb transposon of F (24) as described by Devlin et al. (25). E. coli W1485(pFA02) was mated with the F- strain MX648 and subsequently plated on ampicillin (to select for the plasmid) and streptomycin sulfate (to select for the recipient strain). Transconjugants which could support only lytic growth upon infection by P7cl .1 (as scored by cross-streak analysis; 18) were assumed to have lost cl-complementing activity and were characterized further. The positions of two cl - insertional mutations, carried by pFA02.16 and pFA02.26, were identified by restriction mapping (Figure 1). DNA sequencing. DNA sequence analysis was carried out using the M13-dideoxy technique of Sanger et al. (26). Selected DNA fragments containing the cl wildtype or mutant genes were introduced into M13 mp8 or mp9. 18-nucleotide oligomers complementary to defined sequences within the cl gene were extended using the Klenow fragment of DNA polymerase in the presence of dideoxynucleotide triphosphates and analyzed by polyacrylamide-urea gel electrophoresis. The sequencing strategy is shown in Figure 1. RESULTS Localization of the P7cJ gene. Initial localization of the P7cl gene was undertaken by subjecting pFA02 to 'yb mutagenesis and determining the map position of inserts which destroy the ability of the plasmids to complement a P7cl - mutation (as determined by cross-streak analysis). pFA02 and the -yb insertion mutants were tested further by comparing their ability to complement a PIcI amber mutation with the complementation activity of plasmids containing cl genes isolated 7674 Nucleic Acids Research B C D E F G *.4 68 43 29- _ - =I = Am~ W _ 18 14 p Fig. 2. In vitro transcription-translation of plasmids carrying the cl region of P1 and P7. Proteins encoded by selected plasmids were labeled with 35S methionine according to the procedure of DeVries and Zubay (27), using a commercial in vitro transcription/tramnslation kit from Amersham Corporation. The reaction mixtures were subjected to electrophoresis on a 12.5% SDS-polyacrylamide gel and the labeled proteins were visualized by autoradiography. The migration of 14C-labeled protein molecular weight standards (Bethesda Research Laboratories) is indicated at the left side of the figure. Plasmids present in each lane are: A. pBRB55.1; B. pBRB169.1; C. pBRB7.2; D. pFAO2; E. pFAO2.16; F. pFAO2.26; G. pBR322. from P1 wildtype and amber mutants. Lysogeny by cells infected with Plcl.245Cm was scored as the growth of infected cells on ampicillin (to select for the resident plasmid) and chloramphenicol (to select for the phage genome). The values observed for the two plasmids containing Plcl and P7cl (pBRB7.2 and pFA02, respectively) are very similar and significantly higher than those obtained for pBR322 or for any of the plasmids carrying Table 2. Assay for lacZ expression from plasmids containing P1 DNA fragments. ,3-galactosidase activity (units) minus cI plus Pici plus P7cl relative activity (pDPT152) (pBB7. 152) (pFA02.152) +PICJ +P7cJ pCB192 0.58 0.55 0.54 0.95 0.93 pBCB2.13 154 15.2 13.6 0.10 0.09 pBCB2.16 1.1 1.2 1.1 1.1 1.0 pBCB2.18 4.0 3.4 3.9 0.9 1.0 Cells containing derivatives of the ApR promoter-probe plasmid pCB192 and the compatible KnR plasmid pDPT152 were grown in LB at 37?. When they reached mid-log phase, the cells were chilled, lysed, and assayed for (3-galactosidase activity according to the procedure of Miller (23). Plasmids derived from pCB192 are indicated at the left side of the Table. Plasmids derived from pDPT152 are indicated in parentheses across the top of the Table. The values reported are the average of two independent experiments. Relative activity is defined as the f3-galactosidase activity measured in cells harboring plasmids expressing cl divided by the activity measured in cells carrying only pDPT152. 7675 Nucleic Acids Research GATATCCAATCAGGAGTACC GCATCACCCAAGACGACCTG GATGATCTCACTGACACAAT CGAATATCTCATGGCCACTA ACCAGCCAGACTCACAATAAATGCA 105 v-- TtgAca TATAATG CTAATAAATCTATTATTTTC GTTGGATCCTTCTATAATGG TGGCCAACAACTCCCAGTGT AATCCGCTGTGAGTTGTTGG CCATGTCAATTCTGGAGGAGGATCA 210 b----- I I GGAGGtG ATG ATA AAT TAT GTC TAC GGC GAA CAA CTG TAC CAG GAG TTC GTC AGC TTC AGG GAT CTC TTT CTA AAA AAA GCT GTT GCA CGC GCC CAA 300 MET lIe Asn Tyr Vat Tyr Gly Glu Gin Leu Tyr Gin Gtu Phe Vat Ser Phe Arg Asp Leu Phe Leu Lys Lys Ala Val Ala Arg Ala Gtn tag(cl .55) CAC GTT GAT GCC GCC AGC GAC GGT CGT CCT GTT CGC CCG GTT GTC GTT CTG CCG TTC AM GM ACG GAC AGC ATT CAG GCT GMA ATT GAT 390 His Val Asp Ala Ala Ser Asp Gly Arg Pro Vat Arg Pro Vat Vat Vat Leu Pro Phe Lys Glu Thr Asp Ser lIe Gin Ala Glu lie Asp T A C A G AAA TGG ACA TTA ATG GCG CGG GAA CTG GAG CAG TAC CCA GAT CTC MT ATC CCA MG ACT ATT TTA TAT CCT GTA CCT AAC ATC CTT CGC 480 9 Lys Trp Thr Leu MET Ala Arg Glu Leu Gtu Gin Tyr Pro Asp Leu Asn lIe Pro Lys Thr lie Leu Tyr Pro Vat Pro Asn lIe Leu Arg A T C GGT GTG CGT AAG GTT ACG ACT TAT CAG ACA GAA GCA GTG MC AGC GTC AAT ATG ACC GCT GGC CGC ATT ATT CAT CTG ATT GAT AAG GAC 570 Gly Vat Arg Lys Vat Thr Thr Tyr Gin Thr Glu Ala Vat Asn Ser Vat Asn MET Thr Ala Gly Arg lIe lIe His Leu lIe Asp Lys Asp G ATT CGC ATC CAA AM AGC GCG GGG ATC MT GAG CAC AGT GCG AAA TAC ATA GAG MC CTG GAA GCA ACA AM GAG CTA ATG AAG CAG TAC 660 lle Arg lIe Gin Lys Ser Ala Gly lIe Asn Gtu His Ser Ala Lys Tyr lIe Gtu Asn Leu Gtu Ala Thr Lys Gtu Leu MET Lys Gin Tyr T T CCG GAG GAT GAA AAA TTC CGT ATG CGC GTA CAC GGC TTT AGC GAA ACA ATG CTG CGC GTC CAT TAC ATT TCC AGT AGC CCT AAC TAC AAT 750 Pro Glu Asp Glu Lys Phe Arg MET Arg Vat His Gly Phe Ser Gtu Thr MET Leu Arg Vat His Tyr lie Ser Ser Ser Pro Asn Tyr Asn Phe T C G T T I ~~~I I II GAT GGC MA TCA GTT AGT TAC CAT GTG CTG CTA TGT GGC GTG TTT ATC TGC GAT GM ACT CTC CGA GAT GGA ATC ATC ATC AAC GGT GAA 840 e.. Asp Gly Lys Ser Vat Ser Tyr His Vat Leu Leu Cys Gly Vat Phe lie Cys Asp Glu Thr Leu Arg Asp Gly lIe lie lIe Asn Gly Gtu Pro C tag(cl .169) TTT GAG AM GCA AAA TTT AGC CTT TAT GAC TCT ATA GM CCG ATC ATC TGC GAC CGC TGG CCG CAG GCA AM ATA TAT CGC CTG GCA GAT 930 Phe Gtu Lys Ala Lys Phe Ser Leu Tyr Asp Ser lIe Glu Pro lie lie Cys Asp Arg Trp Pro Gin Ala Lys lIe Tyr Arg Leu Ala Asp T ATT GM MT GTA AM AM CM ATT GCC ATC ACT CGC GM GAG AAA G GTC AM TCA GCC GCA TCA GTT ACG CGC AGC CGC AAA ACT AAG 1020 n----- lie Glu Asn Vat Lys Lys Gin lIe Ala lie Thr Arg Glu Glu Lys Lys Vat Lys Ser Ala Ala Ser Vat Thr Arg Ser Arg Lys Thr Lys AAG GGG CAG CCA GTA AAC GAC MC CCC GAA AGC GCG CM TAG Lys Gly Gin Pro Val Asn Asp Asn Pro Glu Ser Ala Gin ter Fig. 3. DNA sequence of PIcI and P7cl. The DNA sequence of PIcI is indicated. Positions where the sequence of P7cl differs from that of Plcl are indicated above the P1 sequence. The amino acid sequence predicted by the open reading frame is given below the sequence. The two amino acid substitutions present in P7cl are shown below the open reading frame. The locations of the amber mutant codons in cl.55 and ci. 169 are indicated by small letters above the sequence. Sites for selected restriction enzymes (EcoRV [v]; BamHI [b]; Bgll [g]; EcoRP [e]; and NruI [n]) are illustrated by dashed lines beneath the sequence. The cl repressor binding site is underlined. Inverted arrows beneath the sequence illustrate the inverted repeat sequence upstream of the open reading frame. Predicted promoter ribosome binding sites are indicated by the presence of the consensus sequences above and below the line, respectively. The DNA sequences of Plcl from bp 1-134 and bp 1-434 were reported previously (2,5). mutant cl genes from either P1 or P7 (Table 1). The efficiency with which a cloned P7cl gene complements a PlcI mutation confirms previous genetic studies indicating that these two genes are functionally interchangeable (9). The location of the 'y6 mutations that destroy cl-complementing activity suggests that the P7cl open reading frame occupies a map position similar to that of the P1 open reading frame (Figure 1). 7676 Nucleic Acids Research Proteins produced by fragments containing Plcl. As an initial step in the comparison of the P1 and P7 repressors, we analyzed the gene products expressed from the cloned cl regions. In an in vitro transcription-translation reaction, plasmids coding for the wildtpe alleles of either PIcI or P7cl direct the production of a protein with an estimated molecular weight of 33,000 daltons (Figure 2, Lanes C and D), a size that agrees closely with the predicted molecular weight of the PIcI repressor reported previously (3,28). The loss of the 33,000 dalton protein in the cl - 'ya-induced P7 mutant plasmids (Figure 2, Lanes E and F) is consistent with its designation as the P7cl repressor. As expected, the 33,000 dalton protein is not observed when reaction mixtures contain DNA from Plcl amber mutants (Figure 2, Lanes A and B). DNA sequence analysis of the cl genes. To make a direct comparison between the Plcl and P7cl DNA sequences and to predict the amino acid sequences of the repressor proteins, we carried out M 13-dideoxy sequence analysis of cloned fragments carrying the cl genes. The sequences of about 1 kb of P1 and P7 DNA were determined starting from a common EcoRV site predicted to lie approximately 200 bps upstream of the cl genes. The P1 and P7 sequences (Figure 3) both contain an ATG initiation codon preceded by a putative ribosome binding sequence (29) situated 211 bps downstream of the EcoRV site. In each case, the initiation codon is followed by an open reading reading frame extending for 283 codons. The P1 and P7 open reading frames code for proteins with predicted molecular weights (32,515 and 32,499 daltons, respectively) that agree closely with the values of the proteins expressed from the cloned DNA fragments (Figure 2) and with results predicted independently for the purified PIcI repressor (3-4). The localization of two PIcI amber mutations to the P1 open reading frame confirms its identification as the cI coding sequence. cI. 169 contains an amber mutation that would result in a protein fragment of 26,680 daltons, a value that agrees well with the size of a protein fragment observed under the in vitro transcription/translation reaction conditions (Figure 2, Lane B). The cl.55 amber mutation lies close to the N-terminal region of the protein, resulting in the production of a fragment of 55 amino acids that is apparently too small to resolve under the electrophoretic conditions used for separation of the proteins. Over 60% of the amino acid sequence predicted for the PIcI open reading frame has been verified by amino acid sequence analysis of peptide fragments isolated from the purified repressor protein (see accompanying paper, reference 3). The DNA sequences of P1 and P7 are identical for a 399-bp region that extends from the EcoRV site at the 5' side of the cl gene to a point 188 bps within the open reading frame. The sequences within the Plcl and the P7cl open reading frames differ at only 18 positions, all but two of which occur in the wobble position of the predicted codon. From these results, we conclude that the functional identity of the P1 and P7 cl genes is a consequence of their nearly identical amino acid sequence. Analysis of promoters upstream of the cl open reading frame. Expression of Plcl was shown previously to require sequences on the distal side of a BamHI site (2, 5) located about 100 bps upstream of the open reading frame (Figure 3). A binding site for the cl repressor has also been shown to exist close to this BamHI site (2, 5, 6). To determine whether this region contains a promoter that is detectable in vivo and, further, to determine whether this promoter can be regulated by cl repressor proteins from either P1 or P7, we introduced several DNA fragments from this region into the promoter probe vector pCB192, screened for promoter activity (as monitored by lacZ expression) and checked for repression of this activity in the presence of a compatible 7677 Nucleic Acids Research plasmid expressing Plcl or P7cl. Cells harboring pBCB2.13 (a plasmid which carries a 460 bp fragment of P1 DNA that extends across the BamHI site upstream of cl into the open reading frame) are dark blue in the presence of Xgal and produce significant levels of 3-galactosidase (Table 2). In contrast, pBCB2.16 and pBCB2.18 (which each contain DNA from only one side of the BamHI site located in pBCB2. 13) do not confer a blue color on their host cell in the presence of X-Gal and express negligible amounts of 3-galactosidase (Table 2). These observations suggest that expression from the promoter identified here requires sequences that span the BamHI site upstream of cl. Expression of cl from a compatible plasmid in the presence of pBCB2. 13 results in a 90% reduction in promoter strength (Table 2). This reduction is seen in the presence of either Plcl or P7cl, indicating that the two repressor proteins are both capable of repressing expression from this promoter. DISCUSSION. The DNA sequences of Plcl and P7cl differ at only 18 sites, all but two of which occur at the third position of the affected codon. This observation provides biochemical confirmation of the functional identity predicted on the basis of previous genetic analysis (9). A number of DNA binding proteins exhibit a common structural motif in which two helices are separated by a glycine residue (12). This motif is not observed in the predicted secondary structures (30) of the Plcl and P7cl amino acid sequences. A sequence with some similarity to the XCro helix-turn-helix region was previously reported near the Nterminus of the PIcI protein (5); however, it was noted that the potential for helix formation is disrupted by the presence of several prolines within the region. The secondary structure predicted for the Plcl and P7cl repressor proteins (30) does not reveal other structural characteristics (e.g., Zn fingers (31), leucine zippers (32), or helix-loop-helix motifs (33)) that have been associated with DNA binding activity in other systems. A search of the GenBank and EMBL databases does not reveal any other known regulatory proteins with significant amino acid similarity to the Plcl or the P7cl repressor sequences. Since the Plcl repressor differs from most other repressors in DNA binding specificity (i.e., in its recognition of an asymmetric operator sequence), it is not unexpected to find that the protein does not exhibit common structural motifs at the amino acid level. The cl-repressible promoter described in this report is located in a region just upstream of the cl open reading frame and is oriented in the direction of cl. Because the promoter is present on a multicopy plasmid, it is not possible to make a direct calculation of promoter strength; however, the values observed are about five-fold lower than the levels produced by a derivative of pCB192 that contains the plac promoter from pUC19 (34). Because sequences on both sides of the BamHI site located upstream of cl are required for promoter activity (Table 2), we suggest that the promoter spans this site. Less than 10 bps downstream of this BamHI site is a heptanucleotide sequence (TATAATG) that is identical to the -10 consensus sequence for RNA polymerase (35). If this sequence does indeed correspond to the -10 region of the promoter, the -35 region would be predicted to lie on the other side of the BamHI site in a region that overlaps a known cI repressor binding site (2-5). Analysis of this region does not reveal any sequences with significant similarity to the -35 consensus sequence. The best fit is the sequence TCTATT (Figure 3), which matches only two positions of the -35 consensus (TTGACA). The lack of a strong -35 region is often observed with genes that require an activator. Although a pentanucleotide sequence corresponding to the conserved portion of the CRP protein consensus binding site (36) 7678 Nucleic Acids Research is located just upstream of the predicted -35 region (at position 91; Figure 3), a role for CRP-mediated activation in cl expression has not previously been described. The orientation of the promoter and its cl-repressible character raise the possibility that cl expression is autoregulatory. If this is so, one potential activator would be the cl repressor itself. Expression cannot be absolutely dependent on cl-mediated activation, however, because the cloned promoter exhibits significant activity in the absence of the cl gene (Table 2). Under the conditions reported here, the presence of the cl gene results in a decrease rather than an increase in lacZ expression; however, these observations do not rule out a potential activator role for the cl protein, since the ratios of repressor and operator provided by the multicopy plasmids may not be optimal for activation. Physiologically, the role of additional repressor binding sites in regulating cl expression also cannot be discounted. Three potential operator sites have been identified several hundred bps upstream of the cI open reading frame (2-5); one or more of these could be involved (possibly through a DNA looping mechanism; 37) in the activation or repression of cl expression during phage growth. A cl-repressible promoter oriented in the direction of cl was previously reported (38) to be located entirely within PlBamHI-9, a fragment located upstream of cl which is bracketed by the BamHI site within pBCB2. 13. Because sequences on both sides of this BamHI site are required for the activity of the promoter in pBCB2.13, we suggest that the previously identified promoter is distinct from the one reported here. The promoter from BamHI-9 could correspond to a consensus promoter sequence that is situated about 500 bps upstream of cl and overlaps a cl repressor binding site (2). If so, cl expression is likely to be controlled by more than one promoter. Located between this promoter sequence and the promoter encoded on pBCB2. 13 is an open reading frame whose product (termed coi, or c-one inactivator) has been implicated in the establishment of lytic growth (1, 39; B.R. Baumstark, unpublished results). It has been suggested (2) that the decision to enter lytic or lysogenic growth is influenced by the level of transcription initiated from the distal promoter (which would transcribe coi prior to the transcription of cl) relative to that of the promoter located immediately upstream of the cl gene (which would transcribe only ci). A 32-nucleotide hyphenated inverted repeat sequence is located just upstream of the cl open reading frame (positions 146-188; Figure 3). It is not currently known whether this sequence has any regulatory effect on cl expression. Conceivably, the sequence could serve as a recognition site for an as-yet-unidentified regulatory protein. Alternatively, it may affect the secondary structure of the messenger RNA. A transcript extending from a promoter located upstream of the putative coi open reading frame would be capable of forming a stable stem-loop structure containing 16 bps with a single bp mismatch (AG = -33.6 Kcal) of this inverted repeat sequence. Such a structure could potentially serve as a recognition site for a regulatory factor or, alternatively, could mask such a site. On the other hand, transcription originating from the promoter spanning the BamHI site just upstream of cl would start at a site within the inverted repeat sequence, forming a comparatively less stable stem-loop structure of about 8 bps. The role of the inverted repeat region in the regulation of cl expression is currently under investigation. ACKNOWLEDGEMENTS We thank Heinz Schuster for his review of the manuscript. This work was supported by National Science Foundation grant DMB-8704146. 7679 Nucleic Acids Research Abbreviations: bp, basepairs; kb, kilobase pairs; X-Gal, 5-Bromo-4-Chloro-3-indolylbeta-D-galactopyranoside. *To whom correspondence should be addressed REFERENCES 1. Yarmolinsky, M.B., and Steinberg, N. (1988). In Calendar, R., (ed.), The Bacteriophages, Plenum Publishing Corp., NY, Vol. 1, pp. 291-438. 2. Baumstark, B.R., Stovall, S.R., and Ashkar, S. (1987). Virology 156, 404-413. 3. Dreiseikelmann, B., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 263, 1391-1397. 4. Heinrich, J., Riedel, H.-D., Baumstark, B.R., Kimura, M., and Schuster, H. (1989). Nucleic Acids Res, this volume. 5. Eliason, J.L., and Stemnberg, N. (1987). J. Mol. Biol. 198, 281-293. 6. Velleman, M., Dreiseikelmann, B., and Schuster, H. (1987). Proc. Natl. Acad. Sci. USA 84, 5570-5574. 7. Citron, M., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 264, 3611-3617. 8. Chadwick, P., Pirotta, V., Steinberg, R., Hopkins, N., and Ptashne, M. (1970). Cold Spring Harbor Symp. Quant. Biol. 35, 283-294. 9. Chesney, R.H., and Scott, J.R. (1975). Virology 67, 375-384. 10. Wandersman, C., and Yarmolinsky, M. (1977). Virology 78, 267-276. 11. Scott, J.R., West, B.W., and Laping, J.L. (1978). Virology 85, 587-600. 12. Pabo, C.O., and Sauer, R. A. (1984). Ann. Rev. Biochem. 53, 293-321. 13. Scott, J.R. (1974). Virology 62, 344-349. 14. Schneider, K., and Beck, C.F. (1987). Methods in Enzymol. 153, 452-461. 15. Smith, H.W. (1972). Nature New Biol. 238, 205-206. 16. Scott, J.R. (1975). Virology 65, 173-178. 17. Scott, J.R., Kropf, M.M., and Mendelson, L. (1977). Virology 76, 39-46. 18. Scott, J.R. (1968). Virology 36, 564-574. 19. Walker, D.H., Jr., and Walker, J.T. (1976). J. Virol. 20, 177-187. 20. Stemnberg, N. (1979). Virology 96, 129-142. 21. Schneider, K., and Beck, C.F. (1986). Gene 42, 37-48. 22. Taylor, D.P., and Cohen, S.N. (1979). J. Bacteriol. 137, 92-104. 23. Miller, J.H. (1972). In Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 352-355. 24. Guyer, R.S. (1978). J. Mol. Biol. 126, 347-365. 25. Devlin, B.H., Baumstark, B.R., and Scott, J.R. (1982). Virology 120, 360-375. 26. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). Proc. Natl. Acad. Sci. USA 74, 5463-5467. 27. DeVries, J.K., and Zubay, G. (1967). Proc. Natl. Acad. Sci. USA 57, 1010-1012. 28. Heilmann, H., Reeve, J.R., and Puhler, A. (1980). Mol. Gen. Genet. 178, 149-154. 29. Shine, J., and Dalgarno, L. (1974). Proc. Natl. Acad. Sci. USA 71, 1342-1346. 30. Chou, P.Y., and Fasman, G.D. (1978). Adv. Enzymol. 47, 45-148. 31. Berg, J.M. (1986). Nature 319, 264-265. 32. Landschultz, W.H., Johnson, P.F., and McKnight, S.L. (1988). Science 240, 1759-1764. 33. Murre, C., McCaw, P., and Baltimore, D. Cell 56, 777-783. 34. Anderson, B.E., Baumstark, B.R., and Bellini, W.J. (1988). J. Bacteriol. 170, 4493-4500. 35. Rosenberg, M., and Court, D. (1979). Annu. Rev. Genet. 13, 319-353. 36. Ebright, R.H., Cossart, P., Gicquel-Sanzey, B., and Beckwith, J. (1984). Nature 311, 232-235. 37. Ptashne, M. (1986). Nature 322, 697-701. 38. Stemnberg, N., and Hoess, R. (1983). Annu. Rev. Genet. 17, 123-154. 39. Scott, J.R. (1980). Curr. Top. Microbiol. Immunol. 90, 49-65. 7680 This article, submitted on disc, has been automatically converted into this typeset format by the publisher. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The c1 genes of P1 and P7. Abstract The c1 genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7c1 expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the P1c1 repressor. The c1 regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-turn-helix motif commonly associated with repressor proteins. Two P1c1 amber mutations were localized to the 283-amino acid open reading frame. The P1c1 and P7c1 sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the c1 gene from either phage cause the repression of transcription from a cloned promoter situated upstream of P1c1.Images Volme 7 Nmbe 19198 Nulei Acds eserc The cl genes of P1 and P7 Francis A.Osborne, Sonja R.Stovall and Barbara R.Baumstark* Department of Biology, Georgia State University, Atlanta, GA 30303, USA Received July 11, 1989; Revised and Accepted August 29, 1989 EMBL accession nos X16005, X16006 ABSTRACT The cl genes of the heteroimmune phages P1 and P7 were sequenced and their products were compared. P7cl expression was correlated with the translation in vitro of a protein whose predicted molecular weight (33,000 daltons) is indistinguishable from that of the Plcl repressor. The cl regions from both P1 and P7 were found to contain open reading frames capable of coding for a 283-amino acid protein whose predicted secondary structure lacks the helix-tum-helix motif commonly associated with repressor proteins. Two Plcl amber mutations were localized to the 283-amino acid open reading frame. The Plcl and P7cl sequences were found to differ at only 18 positions, all but two of which alter the third position of the affected codon and do not alter the amino acid sequence of the protein. Plasmids expressing the cI gene from either phage cause the repression of transcription from a cloned promoter situated upstream of Plcl. INTRODUCTION The cl genes of the plasmid prophages P1 and P7 code for repressor proteins that are required for the establishment and maintenance of lysogeny (reviewed in 1). A protein corresponding to the Plcl repressor has been isolated and shown to be a sequence-specific DNA binding protein that recognizes several widely dispersed sites on the phage DNA (2-7). The consensus DNA sequence recognized by the Plcl repressor (ATTTATTAGAGCA[A/T]T) contains no discernable bilateral symmetry, a feature that is highly unusual among prokaryotic operator sites. P1 and P7 are heteroimmune; that is, each phage is able to establish a lytic infection on a lysogen of the other phage. In this sense, their relationship is analogous to that of phage X and 434, which differ in the DNA specificity of their cI repressor proteins (8). However, genetic studies indicate that Plcl and P7cl can be crossed into the heterologous phage without affecting the immunity specificity of the recipient (9). The basis for P1/P7 heteroimmunity has been localized to a second regulatory gene, c4, that is unlinked to cl. The c4 gene products prevent the expression of antireb, a closely linked gene that interferes with cl-mediated repression (10, 11). According to current models, P1/P7 heteroimmunity results from the inability of the c4 repressor of one phage to prevent antireb expression from the heteroimmune phage genome (10, 11). Because the cl genes of P1 and P7 are genetically interchangeable, it is anticipated that the two gene products carry out similar or identical regulatory functions. The studies presented in this paper were undertaken to investigate the biochemical basis for the apparent genetic identity of the two cl genes. In this paper, we present the DNA sequence of the cl genes of P1 and P7 and the predicted amino acid sequence of the cl repressor proteins. We report that Plcl and P7cl code for proteins of identical size (283 amino acids) and Nucleic Acids Research Volume 17 Number 19 1989 767 1 (r IRL Press Nucleic Acids Research nearly identical sequence. We report further that both repressors prevent the expression of a promoter located immediately upstream of the Plc 1 open reading frame, an observation that confirms their functional similarity and suggests an autoregulatory role for the two proteins. Analysis of the secondary structure predicted by the open reading frames does not reveal the characteristic helix-turn-helix (12) or other motifs commonly associated with DNA binding proteins. MATERIALS AND METHODS Bacterial and phage strains. E. coli K336 is a SuO derivative of K140 (13). E. coli CB454 is a recA-, lacZderivative of K-12 (14). P1 + is described by Scott (13). P7+ is the strain of Smith (15), as described by Scott (16). P7cl. 1 contains a missense mutation in the cl gene (17). The P7 phage strains and the cl amber mutant phage strains PIci .245Cm, Plc1. 169 and P Ic .55 (11) were generously provided by June Scott. Enzymes and reagents. Restriction enzymes, T4 DNA ligase and polymerase, and the Klenow fragment of E. coli DNA polymerase were purchased from Boehringer Biochemicals or New England Biolabs and reactions were carried out according to the manufacturers' instructions. DNA sequencing kits and in vitro transcription-translation kits were purchased from Bethesda Research Laboratories and Amersham Corporation, respectively. Synthetic oligonucleotides to be used as sequencing primers were prepared on an Applied Biosystems DNA synthesizer. Plasmid construction. pBRB7.2. pBRB7.2 (2) contains a 3.2 kb EcoRI/PvuII fragment from the cl region of P1 (Figure 1) inserted into the 2.3 kb EcoRIlPvuII fragment of pBR322 that contains the origin of replication and the f3-lactamase gene. pFA02. P7 plasmid DNA was digested with PvuII, ligated to similarly digested pBR322, and transformed into E. coli K336. Ampicillin-resistant colonies were screened for cl activity by cross-streak complementation analysis against P7cl.1 (18). pFAO2 contains a 3.5 kb insert of P7 DNA. The fragment was localized to the cl region of the P7 genome by Southern hybridization against P1 and P7 DNA that had been digested with BamHI and BglII (data not shown). pBRBJ69. 1 and pBRB55. 1. The PI cI open reading frame was previously localized to a 2.6 kb EcoRlIBamHI fragment derived from PlEcoRI-7 (2). This fragment also contains the wildtype allele for the conditional lethal mutation am43 (19, 20). To clone the cl reading frame from the amber mutant phage Plc1.169 and P Ic .55, we digested phage DNA with EcoRI and BamHI, ligated the digestion products into similarly digested pBR322, and transformed the ligation mixture into E. coli K336. Ampicillin-resistant, tetracyclinesensitive colonies were screened by cross-streak complementation analysis for their ability to support the growth of Plam43. Plasmid DNA isolated from complementation-positive cells was shown by agarose gel electrophoresis to carry plasmids containing the 2.6 kb EcoRIlBamHI fragment from the cl region. The cl mutant open reading frames were placed under the control of normal regulatory signals present in the cI region by digesting the cl.55 and cl. 169-containing plasmids with BamHI and PvuII and inserting a 601 bp BamHI/PvuH fragment containing the cl promoter region (2). The resulting plasmids, pBRB55.1 and pBRB169.1, respectively, contain the 3.2 kb EcoRllPvuIl fragment analogous to that present in pBRB7.2 (Figure 1). pBCB2. 13-2.18. To identify cl-repressible promoters, we introduced selected fragments 7672 Nucleic Acids Research 4 f - - + I 4 P1 4- 4- 4 ECAR H C B R P 4 4.4,~ 4, 1 1 4. I 4, I 11 t t t t t E G R N E B R P 4 4 - 4 1 ' '110z I I I I I I 1 3.2 1.5 1.0 0.5 0 P7 pBRB7.2 -------------------cl1------------- r ~ / >' pFAO2 *-lacZ pBCB2.13 <-lacZ Z pBCB2.16 <-lacZX pBCB2.18 Fig. 1. The cl regions of P1 and P7. A restriction map is indicated by the solid line in the upper part of the figure. Sites for EcoRI (E), Pvul (P), NnrI (N), Bgll (G), BamHI (B), and EcoRV (R) are shown. The sequencing strategy is indicated by the horizontal arrows. Letters and arrows above and below the map refer to sites and sequence analysis for P1 and P7, respectively. The size of this region (in kilobase pairs) is indicated below the map. The DNA fragments present in selected plasmids are illustrated by boxes at the bottom of the figure. The dashed line reveals the approximate position of the cl gene (2). The sites of the -yb mutations introduced into pFA02 are indicated by asterisks. pFA02.16 and pFA02.26 contain insertions located 0.9 kb and 1.4 kb, respectively, from the PvuIl site at the left side of the map. The direction of the lacZ open reading frame in pBCB2.13-18 is indicated by the adjacent arrow. from the cI region of P1 into pCB192, a promoter-probe vector containing promoterless copies of lacZ and galK extending in opposite directions from a multiple cloning site (21). The source of P1 DNA for these constructions was pZHA3, a derivative of pBRB7.2 that contains a HindIlI linker at the single EcoRV site located about 200 bps upstream of the cl open reading frame (Figure 1). pBCB2.13 contains a 460 bp fragment of P1 DNA extending from the EcoRV site to a Bgll site within the cI open reading frame. pBCB2. 16 contains a 130 bp fragment extending from the EcoRV site to a BamHI site located about 100 bps upstream of the cl open reading frame, while pBCB2.18 contains the region extending from this BamHI site to the Bglll site within the open reading frame (Figure 1). The orientation of the P1 DNA fragments within these plasmids was confirmed by restriction mapping and DNA sequencing. To test for the regulation of promoter expression by cl, we transformed pBCB2.13 and its derivatives into CB454(pBRB7.152) and CB454(pFAO2.152), two strains that express P7cl and Pll, respectively, from the pCB192-compatible kanamycin-resistant vector pDPT152 (22). Cells harboring both plasmids were selected by their resistance to both ampicillin and kanamycin. lacZ expression was measured by the procedure of Miller (23). pBRB7.152 was generated by introducing PlEcoRI-7 into pDPT152. pBRB7.152 has sustained a spontaneous deletion within the EcoRI-7 fragment that results in the loss of 2.5 kb of P1 DNA from the far left side of the P1 genetic map, but retains the 3.2 kb PvuHlEcoRI fragment required for cl expression that is present in pBRB7.2 (Figure 1). 7673 z I 011Z I e., Nucleic Acids Research Table 1. Complementation of PIci .245 by plasmids that contain cI genes. Phenotype Efficiency Relative of of Efficiency of Plasmid cI gene Lysogeny Lysogeny pBR322 1.5x 10-6 6.0x 10-6 pBRB7.2 Plcl+ 2.5 x 10-' 1.0 pBRB55.1 Plcl-am 1.4 x 10-6 5.6 x 10-6 pBRB169.1 PlCl-am 2.1 x 10-6 8.4 x 10-6 pFAO2 P7cl+ 8.7 x 10-2 0.35 pFAO2.16 P7c I-, 4.7 x 10-6 1.9 X 10-5 pFAO2.26 P7cI -1 3.1 x 10-6 1.2 x 10-5 Complementation for lysogeny was carried out as described by Devlin et al. (26). The plasmids were carried by E. coli K336. Cells were grown to mid-log phase at 370 in LB containing 50 tig/m1 sodium ampicillin and infected with Plcl.245 at a multiplicity of infection of 5 in the presence of 50 mM CaC12. After 10 minutes, non-absorbed phage were removed by centrifugation and the infection was allowed to proceed for 2 hours at 370. The infected cells were plated on LB plates containing 50 pLg/ml sodium ampicillin, 50 pLg/ml chloramphenicol, and 40 mM sodium citrate. The efficiency of lysogeny is defined as the number of ApRCmR cells at the end of infection divided by the number of ApR cells present at the start of the infection. To construct pFA02.152, we introduced a 2.8 kb EcoRV fragment of P7 DNA containing the cl gene (Figure 1) into the single EcoRI site of pDPT152 after it had been rendered blunt-ended by extension with T4 DNA polymerase. cl expression by cells harboring either pBRB7.152 or pFA02.152 was confirmed by measuring their ability to form chloramphenicol-resistant lysogens when infected with Plcl.245Cm. ,yb insertional mutagenesis. Insertional mutagenesis of P7cl was carried out using the 'yb transposon of F (24) as described by Devlin et al. (25). E. coli W1485(pFA02) was mated with the F- strain MX648 and subsequently plated on ampicillin (to select for the plasmid) and streptomycin sulfate (to select for the recipient strain). Transconjugants which could support only lytic growth upon infection by P7cl .1 (as scored by cross-streak analysis; 18) were assumed to have lost cl-complementing activity and were characterized further. The positions of two cl - insertional mutations, carried by pFA02.16 and pFA02.26, were identified by restriction mapping (Figure 1). DNA sequencing. DNA sequence analysis was carried out using the M13-dideoxy technique of Sanger et al. (26). Selected DNA fragments containing the cl wildtype or mutant genes were introduced into M13 mp8 or mp9. 18-nucleotide oligomers complementary to defined sequences within the cl gene were extended using the Klenow fragment of DNA polymerase in the presence of dideoxynucleotide triphosphates and analyzed by polyacrylamide-urea gel electrophoresis. The sequencing strategy is shown in Figure 1. RESULTS Localization of the P7cJ gene. Initial localization of the P7cl gene was undertaken by subjecting pFA02 to 'yb mutagenesis and determining the map position of inserts which destroy the ability of the plasmids to complement a P7cl - mutation (as determined by cross-streak analysis). pFA02 and the -yb insertion mutants were tested further by comparing their ability to complement a PIcI amber mutation with the complementation activity of plasmids containing cl genes isolated 7674 Nucleic Acids Research B C D E F G *.4 68 43 29- _ - =I = Am~ W _ 18 14 p Fig. 2. In vitro transcription-translation of plasmids carrying the cl region of P1 and P7. Proteins encoded by selected plasmids were labeled with 35S methionine according to the procedure of DeVries and Zubay (27), using a commercial in vitro transcription/tramnslation kit from Amersham Corporation. The reaction mixtures were subjected to electrophoresis on a 12.5% SDS-polyacrylamide gel and the labeled proteins were visualized by autoradiography. The migration of 14C-labeled protein molecular weight standards (Bethesda Research Laboratories) is indicated at the left side of the figure. Plasmids present in each lane are: A. pBRB55.1; B. pBRB169.1; C. pBRB7.2; D. pFAO2; E. pFAO2.16; F. pFAO2.26; G. pBR322. from P1 wildtype and amber mutants. Lysogeny by cells infected with Plcl.245Cm was scored as the growth of infected cells on ampicillin (to select for the resident plasmid) and chloramphenicol (to select for the phage genome). The values observed for the two plasmids containing Plcl and P7cl (pBRB7.2 and pFA02, respectively) are very similar and significantly higher than those obtained for pBR322 or for any of the plasmids carrying Table 2. Assay for lacZ expression from plasmids containing P1 DNA fragments. ,3-galactosidase activity (units) minus cI plus Pici plus P7cl relative activity (pDPT152) (pBB7. 152) (pFA02.152) +PICJ +P7cJ pCB192 0.58 0.55 0.54 0.95 0.93 pBCB2.13 154 15.2 13.6 0.10 0.09 pBCB2.16 1.1 1.2 1.1 1.1 1.0 pBCB2.18 4.0 3.4 3.9 0.9 1.0 Cells containing derivatives of the ApR promoter-probe plasmid pCB192 and the compatible KnR plasmid pDPT152 were grown in LB at 37?. When they reached mid-log phase, the cells were chilled, lysed, and assayed for (3-galactosidase activity according to the procedure of Miller (23). Plasmids derived from pCB192 are indicated at the left side of the Table. Plasmids derived from pDPT152 are indicated in parentheses across the top of the Table. The values reported are the average of two independent experiments. Relative activity is defined as the f3-galactosidase activity measured in cells harboring plasmids expressing cl divided by the activity measured in cells carrying only pDPT152. 7675 Nucleic Acids Research GATATCCAATCAGGAGTACC GCATCACCCAAGACGACCTG GATGATCTCACTGACACAAT CGAATATCTCATGGCCACTA ACCAGCCAGACTCACAATAAATGCA 105 v-- TtgAca TATAATG CTAATAAATCTATTATTTTC GTTGGATCCTTCTATAATGG TGGCCAACAACTCCCAGTGT AATCCGCTGTGAGTTGTTGG CCATGTCAATTCTGGAGGAGGATCA 210 b----- I I GGAGGtG ATG ATA AAT TAT GTC TAC GGC GAA CAA CTG TAC CAG GAG TTC GTC AGC TTC AGG GAT CTC TTT CTA AAA AAA GCT GTT GCA CGC GCC CAA 300 MET lIe Asn Tyr Vat Tyr Gly Glu Gin Leu Tyr Gin Gtu Phe Vat Ser Phe Arg Asp Leu Phe Leu Lys Lys Ala Val Ala Arg Ala Gtn tag(cl .55) CAC GTT GAT GCC GCC AGC GAC GGT CGT CCT GTT CGC CCG GTT GTC GTT CTG CCG TTC AM GM ACG GAC AGC ATT CAG GCT GMA ATT GAT 390 His Val Asp Ala Ala Ser Asp Gly Arg Pro Vat Arg Pro Vat Vat Vat Leu Pro Phe Lys Glu Thr Asp Ser lIe Gin Ala Glu lie Asp T A C A G AAA TGG ACA TTA ATG GCG CGG GAA CTG GAG CAG TAC CCA GAT CTC MT ATC CCA MG ACT ATT TTA TAT CCT GTA CCT AAC ATC CTT CGC 480 9 Lys Trp Thr Leu MET Ala Arg Glu Leu Gtu Gin Tyr Pro Asp Leu Asn lIe Pro Lys Thr lie Leu Tyr Pro Vat Pro Asn lIe Leu Arg A T C GGT GTG CGT AAG GTT ACG ACT TAT CAG ACA GAA GCA GTG MC AGC GTC AAT ATG ACC GCT GGC CGC ATT ATT CAT CTG ATT GAT AAG GAC 570 Gly Vat Arg Lys Vat Thr Thr Tyr Gin Thr Glu Ala Vat Asn Ser Vat Asn MET Thr Ala Gly Arg lIe lIe His Leu lIe Asp Lys Asp G ATT CGC ATC CAA AM AGC GCG GGG ATC MT GAG CAC AGT GCG AAA TAC ATA GAG MC CTG GAA GCA ACA AM GAG CTA ATG AAG CAG TAC 660 lle Arg lIe Gin Lys Ser Ala Gly lIe Asn Gtu His Ser Ala Lys Tyr lIe Gtu Asn Leu Gtu Ala Thr Lys Gtu Leu MET Lys Gin Tyr T T CCG GAG GAT GAA AAA TTC CGT ATG CGC GTA CAC GGC TTT AGC GAA ACA ATG CTG CGC GTC CAT TAC ATT TCC AGT AGC CCT AAC TAC AAT 750 Pro Glu Asp Glu Lys Phe Arg MET Arg Vat His Gly Phe Ser Gtu Thr MET Leu Arg Vat His Tyr lie Ser Ser Ser Pro Asn Tyr Asn Phe T C G T T I ~~~I I II GAT GGC MA TCA GTT AGT TAC CAT GTG CTG CTA TGT GGC GTG TTT ATC TGC GAT GM ACT CTC CGA GAT GGA ATC ATC ATC AAC GGT GAA 840 e.. Asp Gly Lys Ser Vat Ser Tyr His Vat Leu Leu Cys Gly Vat Phe lie Cys Asp Glu Thr Leu Arg Asp Gly lIe lie lIe Asn Gly Gtu Pro C tag(cl .169) TTT GAG AM GCA AAA TTT AGC CTT TAT GAC TCT ATA GM CCG ATC ATC TGC GAC CGC TGG CCG CAG GCA AM ATA TAT CGC CTG GCA GAT 930 Phe Gtu Lys Ala Lys Phe Ser Leu Tyr Asp Ser lIe Glu Pro lie lie Cys Asp Arg Trp Pro Gin Ala Lys lIe Tyr Arg Leu Ala Asp T ATT GM MT GTA AM AM CM ATT GCC ATC ACT CGC GM GAG AAA G GTC AM TCA GCC GCA TCA GTT ACG CGC AGC CGC AAA ACT AAG 1020 n----- lie Glu Asn Vat Lys Lys Gin lIe Ala lie Thr Arg Glu Glu Lys Lys Vat Lys Ser Ala Ala Ser Vat Thr Arg Ser Arg Lys Thr Lys AAG GGG CAG CCA GTA AAC GAC MC CCC GAA AGC GCG CM TAG Lys Gly Gin Pro Val Asn Asp Asn Pro Glu Ser Ala Gin ter Fig. 3. DNA sequence of PIcI and P7cl. The DNA sequence of PIcI is indicated. Positions where the sequence of P7cl differs from that of Plcl are indicated above the P1 sequence. The amino acid sequence predicted by the open reading frame is given below the sequence. The two amino acid substitutions present in P7cl are shown below the open reading frame. The locations of the amber mutant codons in cl.55 and ci. 169 are indicated by small letters above the sequence. Sites for selected restriction enzymes (EcoRV [v]; BamHI [b]; Bgll [g]; EcoRP [e]; and NruI [n]) are illustrated by dashed lines beneath the sequence. The cl repressor binding site is underlined. Inverted arrows beneath the sequence illustrate the inverted repeat sequence upstream of the open reading frame. Predicted promoter ribosome binding sites are indicated by the presence of the consensus sequences above and below the line, respectively. The DNA sequences of Plcl from bp 1-134 and bp 1-434 were reported previously (2,5). mutant cl genes from either P1 or P7 (Table 1). The efficiency with which a cloned P7cl gene complements a PlcI mutation confirms previous genetic studies indicating that these two genes are functionally interchangeable (9). The location of the 'y6 mutations that destroy cl-complementing activity suggests that the P7cl open reading frame occupies a map position similar to that of the P1 open reading frame (Figure 1). 7676 Nucleic Acids Research Proteins produced by fragments containing Plcl. As an initial step in the comparison of the P1 and P7 repressors, we analyzed the gene products expressed from the cloned cl regions. In an in vitro transcription-translation reaction, plasmids coding for the wildtpe alleles of either PIcI or P7cl direct the production of a protein with an estimated molecular weight of 33,000 daltons (Figure 2, Lanes C and D), a size that agrees closely with the predicted molecular weight of the PIcI repressor reported previously (3,28). The loss of the 33,000 dalton protein in the cl - 'ya-induced P7 mutant plasmids (Figure 2, Lanes E and F) is consistent with its designation as the P7cl repressor. As expected, the 33,000 dalton protein is not observed when reaction mixtures contain DNA from Plcl amber mutants (Figure 2, Lanes A and B). DNA sequence analysis of the cl genes. To make a direct comparison between the Plcl and P7cl DNA sequences and to predict the amino acid sequences of the repressor proteins, we carried out M 13-dideoxy sequence analysis of cloned fragments carrying the cl genes. The sequences of about 1 kb of P1 and P7 DNA were determined starting from a common EcoRV site predicted to lie approximately 200 bps upstream of the cl genes. The P1 and P7 sequences (Figure 3) both contain an ATG initiation codon preceded by a putative ribosome binding sequence (29) situated 211 bps downstream of the EcoRV site. In each case, the initiation codon is followed by an open reading reading frame extending for 283 codons. The P1 and P7 open reading frames code for proteins with predicted molecular weights (32,515 and 32,499 daltons, respectively) that agree closely with the values of the proteins expressed from the cloned DNA fragments (Figure 2) and with results predicted independently for the purified PIcI repressor (3-4). The localization of two PIcI amber mutations to the P1 open reading frame confirms its identification as the cI coding sequence. cI. 169 contains an amber mutation that would result in a protein fragment of 26,680 daltons, a value that agrees well with the size of a protein fragment observed under the in vitro transcription/translation reaction conditions (Figure 2, Lane B). The cl.55 amber mutation lies close to the N-terminal region of the protein, resulting in the production of a fragment of 55 amino acids that is apparently too small to resolve under the electrophoretic conditions used for separation of the proteins. Over 60% of the amino acid sequence predicted for the PIcI open reading frame has been verified by amino acid sequence analysis of peptide fragments isolated from the purified repressor protein (see accompanying paper, reference 3). The DNA sequences of P1 and P7 are identical for a 399-bp region that extends from the EcoRV site at the 5' side of the cl gene to a point 188 bps within the open reading frame. The sequences within the Plcl and the P7cl open reading frames differ at only 18 positions, all but two of which occur in the wobble position of the predicted codon. From these results, we conclude that the functional identity of the P1 and P7 cl genes is a consequence of their nearly identical amino acid sequence. Analysis of promoters upstream of the cl open reading frame. Expression of Plcl was shown previously to require sequences on the distal side of a BamHI site (2, 5) located about 100 bps upstream of the open reading frame (Figure 3). A binding site for the cl repressor has also been shown to exist close to this BamHI site (2, 5, 6). To determine whether this region contains a promoter that is detectable in vivo and, further, to determine whether this promoter can be regulated by cl repressor proteins from either P1 or P7, we introduced several DNA fragments from this region into the promoter probe vector pCB192, screened for promoter activity (as monitored by lacZ expression) and checked for repression of this activity in the presence of a compatible 7677 Nucleic Acids Research plasmid expressing Plcl or P7cl. Cells harboring pBCB2.13 (a plasmid which carries a 460 bp fragment of P1 DNA that extends across the BamHI site upstream of cl into the open reading frame) are dark blue in the presence of Xgal and produce significant levels of 3-galactosidase (Table 2). In contrast, pBCB2.16 and pBCB2.18 (which each contain DNA from only one side of the BamHI site located in pBCB2. 13) do not confer a blue color on their host cell in the presence of X-Gal and express negligible amounts of 3-galactosidase (Table 2). These observations suggest that expression from the promoter identified here requires sequences that span the BamHI site upstream of cl. Expression of cl from a compatible plasmid in the presence of pBCB2. 13 results in a 90% reduction in promoter strength (Table 2). This reduction is seen in the presence of either Plcl or P7cl, indicating that the two repressor proteins are both capable of repressing expression from this promoter. DISCUSSION. The DNA sequences of Plcl and P7cl differ at only 18 sites, all but two of which occur at the third position of the affected codon. This observation provides biochemical confirmation of the functional identity predicted on the basis of previous genetic analysis (9). A number of DNA binding proteins exhibit a common structural motif in which two helices are separated by a glycine residue (12). This motif is not observed in the predicted secondary structures (30) of the Plcl and P7cl amino acid sequences. A sequence with some similarity to the XCro helix-turn-helix region was previously reported near the Nterminus of the PIcI protein (5); however, it was noted that the potential for helix formation is disrupted by the presence of several prolines within the region. The secondary structure predicted for the Plcl and P7cl repressor proteins (30) does not reveal other structural characteristics (e.g., Zn fingers (31), leucine zippers (32), or helix-loop-helix motifs (33)) that have been associated with DNA binding activity in other systems. A search of the GenBank and EMBL databases does not reveal any other known regulatory proteins with significant amino acid similarity to the Plcl or the P7cl repressor sequences. Since the Plcl repressor differs from most other repressors in DNA binding specificity (i.e., in its recognition of an asymmetric operator sequence), it is not unexpected to find that the protein does not exhibit common structural motifs at the amino acid level. The cl-repressible promoter described in this report is located in a region just upstream of the cl open reading frame and is oriented in the direction of cl. Because the promoter is present on a multicopy plasmid, it is not possible to make a direct calculation of promoter strength; however, the values observed are about five-fold lower than the levels produced by a derivative of pCB192 that contains the plac promoter from pUC19 (34). Because sequences on both sides of the BamHI site located upstream of cl are required for promoter activity (Table 2), we suggest that the promoter spans this site. Less than 10 bps downstream of this BamHI site is a heptanucleotide sequence (TATAATG) that is identical to the -10 consensus sequence for RNA polymerase (35). If this sequence does indeed correspond to the -10 region of the promoter, the -35 region would be predicted to lie on the other side of the BamHI site in a region that overlaps a known cI repressor binding site (2-5). Analysis of this region does not reveal any sequences with significant similarity to the -35 consensus sequence. The best fit is the sequence TCTATT (Figure 3), which matches only two positions of the -35 consensus (TTGACA). The lack of a strong -35 region is often observed with genes that require an activator. Although a pentanucleotide sequence corresponding to the conserved portion of the CRP protein consensus binding site (36) 7678 Nucleic Acids Research is located just upstream of the predicted -35 region (at position 91; Figure 3), a role for CRP-mediated activation in cl expression has not previously been described. The orientation of the promoter and its cl-repressible character raise the possibility that cl expression is autoregulatory. If this is so, one potential activator would be the cl repressor itself. Expression cannot be absolutely dependent on cl-mediated activation, however, because the cloned promoter exhibits significant activity in the absence of the cl gene (Table 2). Under the conditions reported here, the presence of the cl gene results in a decrease rather than an increase in lacZ expression; however, these observations do not rule out a potential activator role for the cl protein, since the ratios of repressor and operator provided by the multicopy plasmids may not be optimal for activation. Physiologically, the role of additional repressor binding sites in regulating cl expression also cannot be discounted. Three potential operator sites have been identified several hundred bps upstream of the cI open reading frame (2-5); one or more of these could be involved (possibly through a DNA looping mechanism; 37) in the activation or repression of cl expression during phage growth. A cl-repressible promoter oriented in the direction of cl was previously reported (38) to be located entirely within PlBamHI-9, a fragment located upstream of cl which is bracketed by the BamHI site within pBCB2. 13. Because sequences on both sides of this BamHI site are required for the activity of the promoter in pBCB2.13, we suggest that the previously identified promoter is distinct from the one reported here. The promoter from BamHI-9 could correspond to a consensus promoter sequence that is situated about 500 bps upstream of cl and overlaps a cl repressor binding site (2). If so, cl expression is likely to be controlled by more than one promoter. Located between this promoter sequence and the promoter encoded on pBCB2. 13 is an open reading frame whose product (termed coi, or c-one inactivator) has been implicated in the establishment of lytic growth (1, 39; B.R. Baumstark, unpublished results). It has been suggested (2) that the decision to enter lytic or lysogenic growth is influenced by the level of transcription initiated from the distal promoter (which would transcribe coi prior to the transcription of cl) relative to that of the promoter located immediately upstream of the cl gene (which would transcribe only ci). A 32-nucleotide hyphenated inverted repeat sequence is located just upstream of the cl open reading frame (positions 146-188; Figure 3). It is not currently known whether this sequence has any regulatory effect on cl expression. Conceivably, the sequence could serve as a recognition site for an as-yet-unidentified regulatory protein. Alternatively, it may affect the secondary structure of the messenger RNA. A transcript extending from a promoter located upstream of the putative coi open reading frame would be capable of forming a stable stem-loop structure containing 16 bps with a single bp mismatch (AG = -33.6 Kcal) of this inverted repeat sequence. Such a structure could potentially serve as a recognition site for a regulatory factor or, alternatively, could mask such a site. On the other hand, transcription originating from the promoter spanning the BamHI site just upstream of cl would start at a site within the inverted repeat sequence, forming a comparatively less stable stem-loop structure of about 8 bps. The role of the inverted repeat region in the regulation of cl expression is currently under investigation. ACKNOWLEDGEMENTS We thank Heinz Schuster for his review of the manuscript. This work was supported by National Science Foundation grant DMB-8704146. 7679 Nucleic Acids Research Abbreviations: bp, basepairs; kb, kilobase pairs; X-Gal, 5-Bromo-4-Chloro-3-indolylbeta-D-galactopyranoside. *To whom correspondence should be addressed REFERENCES 1. Yarmolinsky, M.B., and Steinberg, N. (1988). In Calendar, R., (ed.), The Bacteriophages, Plenum Publishing Corp., NY, Vol. 1, pp. 291-438. 2. Baumstark, B.R., Stovall, S.R., and Ashkar, S. (1987). Virology 156, 404-413. 3. Dreiseikelmann, B., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 263, 1391-1397. 4. Heinrich, J., Riedel, H.-D., Baumstark, B.R., Kimura, M., and Schuster, H. (1989). Nucleic Acids Res, this volume. 5. Eliason, J.L., and Stemnberg, N. (1987). J. Mol. Biol. 198, 281-293. 6. Velleman, M., Dreiseikelmann, B., and Schuster, H. (1987). Proc. Natl. Acad. Sci. USA 84, 5570-5574. 7. Citron, M., Velleman, M., and Schuster, H. (1988). J. Biol. Chem. 264, 3611-3617. 8. Chadwick, P., Pirotta, V., Steinberg, R., Hopkins, N., and Ptashne, M. (1970). Cold Spring Harbor Symp. Quant. Biol. 35, 283-294. 9. Chesney, R.H., and Scott, J.R. (1975). Virology 67, 375-384. 10. Wandersman, C., and Yarmolinsky, M. (1977). Virology 78, 267-276. 11. Scott, J.R., West, B.W., and Laping, J.L. (1978). Virology 85, 587-600. 12. Pabo, C.O., and Sauer, R. A. (1984). Ann. Rev. Biochem. 53, 293-321. 13. Scott, J.R. (1974). Virology 62, 344-349. 14. Schneider, K., and Beck, C.F. (1987). Methods in Enzymol. 153, 452-461. 15. Smith, H.W. (1972). Nature New Biol. 238, 205-206. 16. Scott, J.R. (1975). Virology 65, 173-178. 17. Scott, J.R., Kropf, M.M., and Mendelson, L. (1977). Virology 76, 39-46. 18. Scott, J.R. (1968). Virology 36, 564-574. 19. Walker, D.H., Jr., and Walker, J.T. (1976). J. Virol. 20, 177-187. 20. Stemnberg, N. (1979). Virology 96, 129-142. 21. Schneider, K., and Beck, C.F. (1986). Gene 42, 37-48. 22. Taylor, D.P., and Cohen, S.N. (1979). J. Bacteriol. 137, 92-104. 23. Miller, J.H. (1972). In Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 352-355. 24. Guyer, R.S. (1978). J. Mol. Biol. 126, 347-365. 25. Devlin, B.H., Baumstark, B.R., and Scott, J.R. (1982). Virology 120, 360-375. 26. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). Proc. Natl. Acad. Sci. USA 74, 5463-5467. 27. DeVries, J.K., and Zubay, G. (1967). Proc. Natl. Acad. Sci. USA 57, 1010-1012. 28. Heilmann, H., Reeve, J.R., and Puhler, A. (1980). Mol. Gen. Genet. 178, 149-154. 29. Shine, J., and Dalgarno, L. (1974). Proc. Natl. Acad. Sci. USA 71, 1342-1346. 30. Chou, P.Y., and Fasman, G.D. (1978). Adv. Enzymol. 47, 45-148. 31. Berg, J.M. (1986). Nature 319, 264-265. 32. Landschultz, W.H., Johnson, P.F., and McKnight, S.L. (1988). Science 240, 1759-1764. 33. Murre, C., McCaw, P., and Baltimore, D. Cell 56, 777-783. 34. Anderson, B.E., Baumstark, B.R., and Bellini, W.J. (1988). J. Bacteriol. 170, 4493-4500. 35. Rosenberg, M., and Court, D. (1979). Annu. Rev. Genet. 13, 319-353. 36. Ebright, R.H., Cossart, P., Gicquel-Sanzey, B., and Beckwith, J. (1984). Nature 311, 232-235. 37. Ptashne, M. (1986). Nature 322, 697-701. 38. Stemnberg, N., and Hoess, R. (1983). Annu. Rev. Genet. 17, 123-154. 39. Scott, J.R. (1980). Curr. Top. Microbiol. Immunol. 90, 49-65. 7680 This article, submitted on disc, has been automatically converted into this typeset format by the publisher.
[ "The", "c1", "genes", "of", "P1", "and", "P7", ".", "\n", "Abstract", "\n", "The", "c1", "genes", "of", "the", "heteroimmune", "phages", "P1", "and", "P7", "were", "sequenced", "and", "their", "products", "were", "compared", ".", "P7c1", "expression", "was", "correlated", "with", "the", "translation", "in", "vitro", "of", "a", "protein", "whose", "predicted", "molecular", "weight", "(", "33,000", "daltons", ")", "is", "indistinguishable", "from", "that", "of", "the", "P1c1", "repressor", ".", "The", "c1", "regions", "from", "both", "P1", "and", "P7", "were", "found", "to", "contain", "open", "reading", "frames", "capable", "of", "coding", "for", "a", "283-amino", "acid", "protein", "whose", "predicted", "secondary", "structure", "lacks", "the", "helix", "-", "turn", "-", "helix", "motif", "commonly", "associated", "with", "repressor", "proteins", ".", "Two", "P1c1", "amber", "mutations", "were", "localized", "to", "the", "283-amino", "acid", "open", "reading", "frame", ".", "The", "P1c1", "and", "P7c1", "sequences", "were", "found", "to", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "alter", "the", "third", "position", "of", "the", "affected", "codon", "and", "do", "not", "alter", "the", "amino", "acid", "sequence", "of", "the", "protein", ".", "Plasmids", "expressing", "the", "c1", "gene", "from", "either", "phage", "cause", "the", "repression", "of", "transcription", "from", "a", "cloned", "promoter", "situated", "upstream", "of", "P1c1.Images", "\n\n\n\n\n\n\n ", "Volme", "7", "Nmbe", "19198", " ", "Nulei", "Acds", " ", "eserc", "\n\n ", "The", "cl", "genes", "of", "P1", "and", "P7", "\n\n ", "Francis", "A.Osborne", ",", "Sonja", "R.Stovall", "and", "Barbara", "R.Baumstark", "*", "\n\n ", "Department", "of", "Biology", ",", "Georgia", "State", "University", ",", "Atlanta", ",", "GA", "30303", ",", "USA", "\n\n ", "Received", "July", "11", ",", "1989", ";", "Revised", "and", "Accepted", "August", "29", ",", "1989", " ", "EMBL", "accession", "nos", "X16005", ",", "X16006", "\n\n ", "ABSTRACT", "\n\n ", "The", "cl", "genes", "of", "the", "heteroimmune", "phages", "P1", "and", "P7", "were", "sequenced", "and", "their", "products", "were", "compared", ".", "P7cl", "expression", "was", "correlated", "with", "the", "translation", "in", "vitro", "of", "a", "protein", "whose", "predicted", "molecular", "weight", "(", "33,000", "daltons", ")", "is", "indistinguishable", "from", "that", "of", "the", "Plcl", "repressor", ".", "The", "cl", "regions", "from", "both", "P1", "and", "P7", "were", "found", "to", "contain", "open", "reading", "frames", "capable", "of", "coding", "for", "a", "283-amino", "acid", "protein", "whose", "predicted", "secondary", "structure", "lacks", "the", "helix", "-", "tum", "-", "helix", "motif", "commonly", "associated", "with", "repressor", "proteins", ".", "Two", "Plcl", "amber", "mutations", "were", "localized", "to", "the", "283-amino", "acid", "open", "reading", "frame", ".", "The", "Plcl", "and", "P7cl", "sequences", "were", "found", "to", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "alter", "the", "third", "position", "of", "the", "affected", "codon", "and", "do", "not", "alter", "the", "amino", "acid", "sequence", "of", "the", "protein", ".", "Plasmids", "expressing", "the", "cI", "gene", "from", "either", "phage", "cause", "the", "repression", "of", "transcription", "from", "a", "cloned", "promoter", "situated", "upstream", "of", "Plcl", ".", "\n\n ", "INTRODUCTION", "\n\n ", "The", "cl", "genes", "of", "the", "plasmid", "prophages", "P1", "and", "P7", "code", "for", "repressor", "proteins", "that", "are", "required", "for", "the", "establishment", "and", "maintenance", "of", "lysogeny", "(", "reviewed", "in", "1", ")", ".", "A", "protein", "corresponding", "to", "the", "Plcl", "repressor", "has", "been", "isolated", "and", "shown", "to", "be", "a", "sequence", "-", "specific", "DNA", "binding", "protein", "that", "recognizes", "several", "widely", "dispersed", "sites", "on", "the", "phage", "DNA", "(", "2", "-", "7", ")", ".", "The", "consensus", "DNA", "sequence", "recognized", "by", "the", "Plcl", "repressor", "(", "ATTTATTAGAGCA[A", "/", "T]T", ")", "contains", "no", "discernable", "bilateral", "symmetry", ",", "a", "feature", "that", "is", "highly", "unusual", "among", "prokaryotic", "operator", "sites", ".", "\n\n ", "P1", "and", "P7", "are", "heteroimmune", ";", "that", "is", ",", "each", "phage", "is", "able", "to", "establish", "a", "lytic", "infection", "on", "a", "lysogen", "of", "the", "other", "phage", ".", "In", "this", "sense", ",", "their", "relationship", "is", "analogous", "to", "that", "of", "phage", "X", "and", "434", ",", "which", "differ", "in", "the", "DNA", "specificity", "of", "their", "cI", "repressor", "proteins", "(", "8)", ".", "However", ",", "genetic", "studies", "indicate", "that", "Plcl", "and", "P7cl", "can", "be", "crossed", "into", "the", "heterologous", "phage", "without", "affecting", "the", "immunity", "specificity", "of", "the", "recipient", "(", "9", ")", ".", "The", "basis", "for", "P1", "/", "P7", "heteroimmunity", "has", "been", "localized", "to", "a", "second", "regulatory", "gene", ",", "c4", ",", "that", "is", "unlinked", "to", "cl", ".", "The", "c4", "gene", "products", "prevent", "the", "expression", "of", "antireb", ",", "a", "closely", "linked", "gene", "that", "interferes", "with", "cl", "-", "mediated", "repression", "(", "10", ",", "11", ")", ".", "According", "to", "current", "models", ",", "P1", "/", "P7", "heteroimmunity", "results", "from", "the", "inability", "of", "the", "c4", "repressor", "of", "one", "phage", "to", "prevent", "antireb", "expression", "from", "the", "heteroimmune", "phage", "genome", "(", "10", ",", "11", ")", ".", "\n\n ", "Because", "the", "cl", "genes", "of", "P1", "and", "P7", "are", "genetically", "interchangeable", ",", "it", "is", "anticipated", "that", "the", "two", "gene", "products", "carry", "out", "similar", "or", "identical", "regulatory", "functions", ".", "The", "studies", "presented", "in", "this", "paper", "were", "undertaken", "to", "investigate", "the", "biochemical", "basis", "for", "the", "apparent", "genetic", "identity", "of", "the", "two", "cl", "genes", ".", "In", "this", "paper", ",", "we", "present", "the", "DNA", "sequence", "of", "the", "cl", "genes", "of", "P1", "and", "P7", "and", "the", "predicted", "amino", "acid", "sequence", "of", "the", "cl", "repressor", "proteins", ".", "We", "report", "that", "Plcl", "and", "P7cl", "code", "for", "proteins", "of", "identical", "size", "(", "283", "amino", "acids", ")", "and", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Volume", "17", "Number", "19", "1989", "\n\n ", "767", "1", "\n\n ", "(", "r", "IRL", "Press", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "nearly", "identical", "sequence", ".", "We", "report", "further", "that", "both", "repressors", "prevent", "the", "expression", "of", "a", "promoter", "located", "immediately", "upstream", "of", "the", "Plc", "1", "open", "reading", "frame", ",", "an", "observation", "that", "confirms", "their", "functional", "similarity", "and", "suggests", "an", "autoregulatory", "role", "for", "the", "two", "proteins", ".", "Analysis", "of", "the", "secondary", "structure", "predicted", "by", "the", "open", "reading", "frames", "does", "not", "reveal", "the", "characteristic", "helix", "-", "turn", "-", "helix", "(", "12", ")", "or", "other", "motifs", "commonly", "associated", "with", "DNA", "binding", "proteins", ".", "\n\n ", "MATERIALS", "AND", "METHODS", "Bacterial", "and", "phage", "strains", ".", "\n\n ", "E.", "coli", "K336", "is", "a", "SuO", "derivative", "of", "K140", "(", "13", ")", ".", "E.", "coli", "CB454", "is", "a", "recA-", ",", "lacZderivative", "of", "K-12", "(", "14", ")", ".", "P1", "+", "is", "described", "by", "Scott", "(", "13", ")", ".", "P7", "+", "is", "the", "strain", "of", "Smith", "(", "15", ")", ",", "as", "described", "by", "Scott", "(", "16", ")", ".", "P7cl", ".", "1", "contains", "a", "missense", "mutation", "in", "the", "cl", "gene", "(", "17", ")", ".", "The", "P7", "phage", "strains", "and", "the", "cl", "amber", "mutant", "phage", "strains", "PIci", ".245Cm", ",", "Plc1", ".", "169", "and", "P", "Ic", ".55", "(", "11", ")", "were", "generously", "provided", "by", "June", "Scott", ".", "Enzymes", "and", "reagents", ".", "\n\n ", "Restriction", "enzymes", ",", "T4", "DNA", "ligase", "and", "polymerase", ",", "and", "the", "Klenow", "fragment", "of", "E.", "coli", "DNA", "polymerase", "were", "purchased", "from", "Boehringer", "Biochemicals", "or", "New", "England", "Biolabs", "and", "reactions", "were", "carried", "out", "according", "to", "the", "manufacturers", "'", "instructions", ".", "DNA", "sequencing", "kits", "and", "in", "vitro", "transcription", "-", "translation", "kits", "were", "purchased", "from", "Bethesda", "Research", "Laboratories", "and", "Amersham", "Corporation", ",", "respectively", ".", "Synthetic", "oligonucleotides", "to", "be", "used", "as", "sequencing", "primers", "were", "prepared", "on", "an", "Applied", "Biosystems", "DNA", "synthesizer", ".", "Plasmid", "construction", ".", "\n\n ", "pBRB7.2", ".", "pBRB7.2", "(", "2", ")", "contains", "a", "3.2", "kb", "EcoRI", "/", "PvuII", "fragment", "from", "the", "cl", "region", "of", "P1", "(", "Figure", "1", ")", "inserted", "into", "the", "2.3", "kb", "EcoRIlPvuII", "fragment", "of", "pBR322", "that", "contains", "the", "origin", "of", "replication", "and", "the", "f3-lactamase", "gene", ".", "\n\n ", "pFA02", ".", "P7", "plasmid", "DNA", "was", "digested", "with", "PvuII", ",", "ligated", "to", "similarly", "digested", "pBR322", ",", "and", "transformed", "into", "E.", "coli", "K336", ".", "Ampicillin", "-", "resistant", "colonies", "were", "screened", "for", "cl", "activity", "by", "cross", "-", "streak", "complementation", "analysis", "against", "P7cl.1", "(", "18", ")", ".", "pFAO2", "contains", "a", "3.5", "kb", "insert", "of", "P7", "DNA", ".", "The", "fragment", "was", "localized", "to", "the", "cl", "region", "of", "the", "P7", "genome", "by", "Southern", "hybridization", "against", "P1", "and", "P7", "DNA", "that", "had", "been", "digested", "with", "BamHI", "and", "BglII", "(", "data", "not", "shown", ")", ".", "\n\n ", "pBRBJ69", ".", "1", "and", "pBRB55", ".", "1", ".", "The", "PI", "cI", "open", "reading", "frame", "was", "previously", "localized", "to", "a", "2.6", "kb", "EcoRlIBamHI", "fragment", "derived", "from", "PlEcoRI-7", "(", "2", ")", ".", "This", "fragment", "also", "contains", "the", "wildtype", "allele", "for", "the", "conditional", "lethal", "mutation", "am43", "(", "19", ",", "20", ")", ".", "To", "clone", "the", "cl", "reading", "frame", "from", "the", "amber", "mutant", "phage", "Plc1.169", "and", "P", "Ic", ".55", ",", "we", "digested", "phage", "DNA", "with", "EcoRI", "and", "BamHI", ",", "ligated", "the", "digestion", "products", "into", "similarly", "digested", "pBR322", ",", "and", "transformed", "the", "ligation", "mixture", "into", "E.", "coli", "K336", ".", "Ampicillin", "-", "resistant", ",", "tetracyclinesensitive", "colonies", "were", "screened", "by", "cross", "-", "streak", "complementation", "analysis", "for", "their", "ability", "to", "support", "the", "growth", "of", "Plam43", ".", "Plasmid", "DNA", "isolated", "from", "complementation", "-", "positive", "cells", "was", "shown", "by", "agarose", "gel", "electrophoresis", "to", "carry", "plasmids", "containing", "the", "2.6", "kb", "EcoRIlBamHI", "fragment", "from", "the", "cl", "region", ".", "The", "cl", "mutant", "open", "reading", "frames", "were", "placed", "under", "the", "control", "of", "normal", "regulatory", "signals", "present", "in", "the", "cI", "region", "by", "digesting", "the", "cl.55", "and", "cl", ".", "169-containing", "plasmids", "with", "BamHI", "and", "PvuII", "and", "inserting", "a", "601", "bp", "BamHI", "/", "PvuH", "fragment", "containing", "the", "cl", "promoter", "region", "(", "2", ")", ".", "The", "resulting", "plasmids", ",", "pBRB55.1", "and", "pBRB169.1", ",", "respectively", ",", "contain", "the", "3.2", "kb", "EcoRllPvuIl", "fragment", "analogous", "to", "that", "present", "in", "pBRB7.2", "(", "Figure", "1", ")", ".", "\n\n ", "pBCB2", ".", "13", "-", "2.18", ".", "To", "identify", "cl", "-", "repressible", "promoters", ",", "we", "introduced", "selected", "fragments", "\n\n ", "7672", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "4", "f", " ", "-", " ", "-", " ", "+", "\n\n ", "I", " ", "4", " ", "P1", "4-", " ", "4-", " ", "4", "\n\n ", "ECAR", " ", "H", " ", "C", " ", "B", " ", "R", " ", "P", "\n\n ", "4", " ", "4.4,~", " ", "4", ",", " ", "1", " ", "1", "4", ".", " ", "I", " ", "4", ",", " ", "I", "11", "\n\n ", "t", " ", "t", " ", "t", " ", "t", " ", "t", "E", "G", "R", " ", "N", " ", "E", " ", "B", " ", "R", " ", "P", "\n\n ", "4", " ", "4", " ", "-", " \n\n ", "4", "\n\n ", "1", "'", " ", "'", "110z", "I", " ", "I", " ", "I", " ", "I", " ", "I", " ", "I", " ", "1", "\n\n ", "3.2", " ", "1.5", " ", "1.0", " ", "0.5", " ", "0", "\n\n ", "P7", "\n\n ", "pBRB7.2", "\n\n ", "-------------------cl1", "-", "------------", "\n\n ", "r", "~", "/", ">", "'", " ", "pFAO2", "\n\n ", "*", "-lacZ", " ", "pBCB2.13", "\n\n ", "<", "-lacZ", "Z", " ", "pBCB2.16", "<", "-lacZX", " ", "pBCB2.18", "\n\n ", "Fig", ".", "1", ".", "The", "cl", "regions", "of", "P1", "and", "P7", ".", "A", "restriction", "map", "is", "indicated", "by", "the", "solid", "line", "in", "the", "upper", "part", "of", "the", "figure", ".", "Sites", "for", "EcoRI", "(", "E", ")", ",", "Pvul", "(", "P", ")", ",", "NnrI", "(", "N", ")", ",", "Bgll", "(", "G", ")", ",", "BamHI", "(", "B", ")", ",", "and", "EcoRV", "(", "R", ")", "are", "shown", ".", "The", "sequencing", "strategy", "is", "indicated", "by", "the", "horizontal", "arrows", ".", "Letters", "and", "arrows", "above", "and", "below", "the", "map", "refer", "to", "sites", "and", "sequence", "analysis", "for", "P1", "and", "P7", ",", "respectively", ".", "The", "size", "of", "this", "region", "(", "in", "kilobase", "pairs", ")", "is", "indicated", "below", "the", "map", ".", "The", "DNA", "fragments", "present", "in", "selected", "plasmids", "are", "illustrated", "by", "boxes", "at", "the", "bottom", "of", "the", "figure", ".", "The", "dashed", "line", "reveals", "the", "approximate", "position", "of", "the", "cl", "gene", "(", "2", ")", ".", "The", "sites", "of", "the", "-yb", "mutations", "introduced", "into", "pFA02", "are", "indicated", "by", "asterisks", ".", "pFA02.16", "and", "pFA02.26", "contain", "insertions", "located", "0.9", "kb", "and", "1.4", "kb", ",", "respectively", ",", "from", "the", "PvuIl", "site", "at", "the", "left", "side", "of", "the", "map", ".", "The", "direction", "of", "the", "lacZ", "open", "reading", "frame", "in", "pBCB2.13", "-", "18", "is", "indicated", "by", "the", "adjacent", "arrow", ".", "\n\n ", "from", "the", "cI", "region", "of", "P1", "into", "pCB192", ",", "a", "promoter", "-", "probe", "vector", "containing", "promoterless", "copies", "of", "lacZ", "and", "galK", "extending", "in", "opposite", "directions", "from", "a", "multiple", "cloning", "site", "(", "21", ")", ".", "The", "source", "of", "P1", "DNA", "for", "these", "constructions", "was", "pZHA3", ",", "a", "derivative", "of", "pBRB7.2", "that", "contains", "a", "HindIlI", "linker", "at", "the", "single", "EcoRV", "site", "located", "about", "200", "bps", "upstream", "of", "the", "cl", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "pBCB2.13", "contains", "a", "460", "bp", "fragment", "of", "P1", "DNA", "extending", "from", "the", "EcoRV", "site", "to", "a", "Bgll", "site", "within", "the", "cI", "open", "reading", "frame", ".", "pBCB2", ".", "16", "contains", "a", "130", "bp", "fragment", "extending", "from", "the", "EcoRV", "site", "to", "a", "BamHI", "site", "located", "about", "100", "bps", "upstream", "of", "the", "cl", "open", "reading", "frame", ",", "while", "pBCB2.18", "contains", "the", "region", "extending", "from", "this", "BamHI", "site", "to", "the", "Bglll", "site", "within", "the", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "The", "orientation", "of", "the", "P1", "DNA", "fragments", "within", "these", "plasmids", "was", "confirmed", "by", "restriction", "mapping", "and", "DNA", "sequencing", ".", "\n\n ", "To", "test", "for", "the", "regulation", "of", "promoter", "expression", "by", "cl", ",", "we", "transformed", "pBCB2.13", "and", "its", "derivatives", "into", "CB454(pBRB7.152", ")", "and", "CB454(pFAO2.152", ")", ",", "two", "strains", "that", "express", "P7cl", "and", "Pll", ",", "respectively", ",", "from", "the", "pCB192-compatible", "kanamycin", "-", "resistant", "vector", "pDPT152", "(", "22", ")", ".", "Cells", "harboring", "both", "plasmids", "were", "selected", "by", "their", "resistance", "to", "both", "ampicillin", "and", "kanamycin", ".", "lacZ", "expression", "was", "measured", "by", "the", "procedure", "of", "Miller", "(", "23", ")", ".", "pBRB7.152", "was", "generated", "by", "introducing", "PlEcoRI-7", "into", "pDPT152", ".", "pBRB7.152", "has", "sustained", "a", "spontaneous", "deletion", "within", "the", "EcoRI-7", "fragment", "that", "results", "in", "the", "loss", "of", "2.5", "kb", "of", "P1", "DNA", "from", "the", "far", "left", "side", "of", "the", "P1", "genetic", "map", ",", "but", "retains", "the", "3.2", "kb", "PvuHlEcoRI", "fragment", "required", "for", "cl", "expression", "that", "is", "present", "in", "pBRB7.2", "(", "Figure", "1", ")", ".", "\n\n ", "7673", "\n\n ", "z", "\n\n ", "I", " ", "011Z", " ", "I", "\n\n ", "e.", ",", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Table", "1", ".", "Complementation", "of", "PIci", ".245", "by", "plasmids", "that", "contain", "cI", "genes", ".", "\n\n ", "Phenotype", " ", "Efficiency", " ", "Relative", "\n\n ", "of", " ", "of", " ", "Efficiency", "of", "Plasmid", " ", "cI", "gene", " ", "Lysogeny", " ", "Lysogeny", "pBR322", " ", "1.5x", "10", "-", "6", " ", "6.0x", "10", "-", "6", "pBRB7.2", " ", "Plcl+", " ", "2.5", "x", "10-", "'", " ", "1.0", "\n\n ", "pBRB55.1", " ", "Plcl", "-", "am", " ", "1.4", "x", "10", "-", "6", " ", "5.6", "x", "10", "-", "6", "pBRB169.1", " ", "PlCl", "-", "am", " ", "2.1", "x", "10", "-", "6", " ", "8.4", "x", "10", "-", "6", "pFAO2", " ", "P7cl+", " ", "8.7", "x", "10", "-", "2", " ", "0.35", "\n\n ", "pFAO2.16", " ", "P7c", "I-", ",", " ", "4.7", "x", "10", "-", "6", " ", "1.9", "X", "10", "-", "5", "pFAO2.26", " ", "P7cI", "-1", " ", "3.1", "x", "10", "-", "6", " ", "1.2", "x", "10", "-", "5", "\n\n ", "Complementation", "for", "lysogeny", "was", "carried", "out", "as", "described", "by", "Devlin", "et", "al", ".", "(", "26", ")", ".", "The", "plasmids", "were", "carried", "by", "E.", "coli", "K336", ".", "Cells", "were", "grown", "to", "mid", "-", "log", "phase", "at", "370", "in", "LB", "containing", "50", "tig", "/", "m1", "sodium", "ampicillin", "and", "infected", "with", "Plcl.245", "at", "a", "multiplicity", "of", "infection", "of", "5", "in", "the", "presence", "of", "50", "mM", "CaC12", ".", "After", "10", "minutes", ",", "non", "-", "absorbed", "phage", "were", "removed", "by", "centrifugation", "and", "the", "infection", "was", "allowed", "to", "proceed", "for", "2", "hours", "at", "370", ".", "The", "infected", "cells", "were", "plated", "on", "LB", "plates", "containing", "50", "pLg", "/", "ml", "sodium", "ampicillin", ",", "50", "pLg", "/", "ml", "chloramphenicol", ",", "and", "40", "mM", "sodium", "citrate", ".", "The", "efficiency", "of", "lysogeny", "is", "defined", "as", "the", "number", "of", "ApRCmR", "cells", "at", "the", "end", "of", "infection", "divided", "by", "the", "number", "of", "ApR", "cells", "present", "at", "the", "start", "of", "the", "infection", ".", "\n\n ", "To", "construct", "pFA02.152", ",", "we", "introduced", "a", "2.8", "kb", "EcoRV", "fragment", "of", "P7", "DNA", "containing", "the", "cl", "gene", "(", "Figure", "1", ")", "into", "the", "single", "EcoRI", "site", "of", "pDPT152", "after", "it", "had", "been", "rendered", "blunt", "-", "ended", "by", "extension", "with", "T4", "DNA", "polymerase", ".", "cl", "expression", "by", "cells", "harboring", "either", "pBRB7.152", " ", "or", "pFA02.152", " ", "was", "confirmed", " ", "by", " ", "measuring", " ", "their", "ability", "to", " ", "form", "chloramphenicol", "-", "resistant", "lysogens", "when", "infected", "with", "Plcl.245Cm", ".", ",", "yb", "insertional", "mutagenesis", ".", "\n\n ", "Insertional", "mutagenesis", "of", "P7cl", "was", "carried", "out", "using", "the", "'", "yb", "transposon", "of", "F", "(", "24", ")", "as", "described", "by", "Devlin", "et", "al", ".", "(", "25", ")", ".", "E.", "coli", "W1485(pFA02", ")", "was", "mated", "with", "the", "F-", "strain", "MX648", "and", "subsequently", "plated", "on", "ampicillin", "(", "to", "select", "for", "the", "plasmid", ")", "and", "streptomycin", "sulfate", "(", "to", "select", "for", "the", "recipient", "strain", ")", ".", "Transconjugants", "which", "could", "support", "only", "lytic", "growth", "upon", "infection", "by", "P7cl", ".1", "(", "as", "scored", "by", "cross", "-", "streak", "analysis", ";", "18", ")", "were", "assumed", "to", "have", "lost", "cl", "-", "complementing", "activity", "and", "were", "characterized", "further", ".", "The", "positions", "of", "two", "cl", "-", "insertional", "mutations", ",", "carried", "by", "pFA02.16", "and", "pFA02.26", ",", "were", "identified", "by", "restriction", "mapping", "(", "Figure", "1", ")", ".", "DNA", "sequencing", ".", "\n\n ", "DNA", "sequence", "analysis", "was", "carried", "out", "using", "the", "M13-dideoxy", "technique", "of", "Sanger", "et", "al", ".", "(", "26", ")", ".", "Selected", "DNA", "fragments", "containing", "the", "cl", "wildtype", "or", "mutant", "genes", "were", "introduced", "into", "M13", "mp8", "or", "mp9", ".", "18-nucleotide", "oligomers", "complementary", "to", "defined", "sequences", "within", "the", "cl", "gene", "were", "extended", "using", "the", "Klenow", "fragment", "of", "DNA", "polymerase", "in", "the", "presence", "of", "dideoxynucleotide", "triphosphates", "and", "analyzed", "by", "polyacrylamide", "-", "urea", "gel", "electrophoresis", ".", "The", "sequencing", "strategy", "is", "shown", "in", "Figure", "1", ".", "RESULTS", "\n\n ", "Localization", "of", "the", "P7cJ", "gene", ".", "\n\n ", "Initial", "localization", "of", "the", "P7cl", "gene", "was", "undertaken", "by", "subjecting", "pFA02", "to", "'", "yb", "mutagenesis", "and", "determining", "the", "map", "position", "of", "inserts", "which", "destroy", "the", "ability", "of", "the", "plasmids", "to", "complement", "a", "P7cl", "-", "mutation", "(", "as", "determined", "by", "cross", "-", "streak", "analysis", ")", ".", "pFA02", "and", "the", "-yb", "insertion", "mutants", "were", "tested", "further", "by", "comparing", "their", "ability", "to", "complement", "a", "PIcI", "amber", "mutation", "with", "the", "complementation", "activity", "of", "plasmids", "containing", "cl", "genes", "isolated", "\n\n ", "7674", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "B", " ", "C", " ", "D", " ", "E", " ", "F", " ", "G", "\n\n ", "*", ".4", " \n\n ", "68", "\n\n ", "43", "\n\n ", "29-", " ", "_", " ", "-", " ", "=", "I", " ", "=", " ", "Am~", " ", "W", " ", "_", "\n\n ", "18", "\n\n ", "14", " ", "p", "\n\n ", "Fig", ".", "2", ".", "In", "vitro", "transcription", "-", "translation", "of", "plasmids", "carrying", "the", "cl", "region", "of", "P1", "and", "P7", ".", "Proteins", "encoded", "by", "selected", "plasmids", "were", "labeled", "with", "35S", "methionine", "according", "to", "the", "procedure", "of", "DeVries", "and", "Zubay", "(", "27", ")", ",", "using", "a", "commercial", "in", "vitro", "transcription", "/", "tramnslation", "kit", "from", "Amersham", "Corporation", ".", "The", "reaction", "mixtures", "were", "subjected", "to", "electrophoresis", "on", "a", "12.5", "%", "SDS", "-", "polyacrylamide", "gel", "and", "the", "labeled", "proteins", "were", "visualized", "by", "autoradiography", ".", "The", "migration", "of", "14C", "-", "labeled", "protein", "molecular", "weight", "standards", "(", "Bethesda", "Research", "Laboratories", ")", "is", "indicated", "at", "the", "left", "side", "of", "the", "figure", ".", "Plasmids", "present", "in", "each", "lane", "are", ":", "A.", "pBRB55.1", ";", "B.", "pBRB169.1", ";", "C.", "pBRB7.2", ";", "D.", "pFAO2", ";", "E.", "pFAO2.16", ";", "F.", "pFAO2.26", ";", "G.", "pBR322", ".", "\n\n ", "from", "P1", "wildtype", "and", "amber", "mutants", ".", "Lysogeny", "by", "cells", "infected", "with", "Plcl.245Cm", "was", "scored", "as", "the", "growth", "of", "infected", "cells", "on", "ampicillin", "(", "to", "select", "for", "the", "resident", "plasmid", ")", "and", "chloramphenicol", "(", "to", "select", "for", "the", "phage", "genome", ")", ".", "The", "values", "observed", "for", "the", "two", "plasmids", "containing", "Plcl", "and", "P7cl", "(", "pBRB7.2", "and", "pFA02", ",", "respectively", ")", "are", "very", "similar", "and", "significantly", "higher", "than", "those", "obtained", "for", "pBR322", "or", "for", "any", "of", "the", "plasmids", "carrying", "\n\n ", "Table", "2", ".", "Assay", "for", "lacZ", "expression", "from", "plasmids", "containing", "P1", "DNA", "fragments", ".", "\n\n ", ",", "3-galactosidase", "activity", "(", "units", ")", "\n\n ", "minus", "cI", " ", "plus", "Pici", " ", "plus", "P7cl", " ", "relative", "activity", "\n\n ", "(", "pDPT152", ")", " ", "(", "pBB7", ".", "152", ")", " ", "(", "pFA02.152", ")", " ", "+", "PICJ", " ", "+", "P7cJ", "\n\n ", "pCB192", " ", "0.58", " ", "0.55", " ", "0.54", " ", "0.95", " ", "0.93", "pBCB2.13", " ", "154", " ", "15.2", " ", "13.6", " ", "0.10", " ", "0.09", "pBCB2.16", " ", "1.1", " ", "1.2", " ", "1.1", " ", "1.1", " ", "1.0", "pBCB2.18", " ", "4.0", " ", "3.4", " ", "3.9", " ", "0.9", " ", "1.0", "\n\n ", "Cells", "containing", "derivatives", "of", "the", "ApR", "promoter", "-", "probe", "plasmid", "pCB192", "and", "the", "compatible", "KnR", "plasmid", "pDPT152", "were", "grown", "in", "LB", "at", "37", "?", ".", "When", "they", "reached", "mid", "-", "log", "phase", ",", "the", "cells", "were", "chilled", ",", "lysed", ",", "and", "assayed", "for", "(", "3-galactosidase", "activity", "according", "to", "the", "procedure", "of", "Miller", "(", "23", ")", ".", "Plasmids", "derived", "from", "pCB192", "are", "indicated", "at", "the", "left", "side", "of", "the", "Table", ".", "Plasmids", "derived", "from", "pDPT152", "are", "indicated", "in", "parentheses", "across", "the", "top", "of", "the", "Table", ".", "The", "values", "reported", "are", "the", "average", "of", "two", "independent", "experiments", ".", "Relative", "activity", "is", "defined", "as", "the", "f3-galactosidase", "activity", "measured", "in", "cells", "harboring", "plasmids", "expressing", "cl", "divided", "by", "the", "activity", "measured", "in", "cells", "carrying", "only", "pDPT152", ".", "\n\n ", "7675", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "GATATCCAATCAGGAGTACC", "GCATCACCCAAGACGACCTG", "GATGATCTCACTGACACAAT", "CGAATATCTCATGGCCACTA", "ACCAGCCAGACTCACAATAAATGCA", " ", "105", "v--", "\n\n ", "TtgAca", " ", "TATAATG", "\n\n ", "CTAATAAATCTATTATTTTC", "GTTGGATCCTTCTATAATGG", "TGGCCAACAACTCCCAGTGT", "AATCCGCTGTGAGTTGTTGG", "CCATGTCAATTCTGGAGGAGGATCA", " ", "210", "\n\n ", "b-----", " ", "I", " ", "I", " ", "GGAGGtG", "\n\n ", "ATG", "ATA", "AAT", "TAT", "GTC", "TAC", "GGC", "GAA", "CAA", "CTG", "TAC", "CAG", "GAG", "TTC", "GTC", "AGC", "TTC", "AGG", "GAT", "CTC", "TTT", "CTA", "AAA", "AAA", "GCT", "GTT", "GCA", "CGC", "GCC", "CAA", " ", "300", "MET", "lIe", "Asn", "Tyr", "Vat", "Tyr", "Gly", "Glu", "Gin", "Leu", "Tyr", "Gin", "Gtu", "Phe", "Vat", "Ser", "Phe", "Arg", "Asp", "Leu", "Phe", "Leu", "Lys", "Lys", "Ala", "Val", "Ala", "Arg", "Ala", "Gtn", "\n\n ", "tag(cl", ".55", ")", "\n\n ", "CAC", "GTT", "GAT", "GCC", "GCC", "AGC", "GAC", "GGT", "CGT", "CCT", "GTT", "CGC", "CCG", "GTT", "GTC", "GTT", "CTG", "CCG", "TTC", "AM", "GM", "ACG", "GAC", "AGC", "ATT", "CAG", "GCT", "GMA", "ATT", "GAT", " ", "390", "His", "Val", "Asp", "Ala", "Ala", "Ser", "Asp", "Gly", "Arg", "Pro", "Vat", "Arg", "Pro", "Vat", "Vat", "Vat", "Leu", "Pro", "Phe", "Lys", "Glu", "Thr", "Asp", "Ser", "lIe", "Gin", "Ala", "Glu", "lie", "Asp", "\n\n ", "T", " ", "A", " ", "C", " ", "A", " ", "G", "\n\n ", "AAA", "TGG", "ACA", "TTA", "ATG", "GCG", "CGG", "GAA", "CTG", "GAG", "CAG", "TAC", "CCA", "GAT", "CTC", "MT", "ATC", "CCA", "MG", "ACT", "ATT", "TTA", "TAT", "CCT", "GTA", "CCT", "AAC", "ATC", "CTT", "CGC", " ", "480", "\n\n ", "9", "\n\n ", "Lys", "Trp", "Thr", "Leu", "MET", "Ala", "Arg", "Glu", "Leu", "Gtu", "Gin", "Tyr", "Pro", "Asp", "Leu", "Asn", "lIe", "Pro", "Lys", "Thr", "lie", "Leu", "Tyr", "Pro", "Vat", "Pro", "Asn", "lIe", "Leu", "Arg", "\n\n ", "A", " ", "T", " ", "C", "\n\n ", "GGT", "GTG", "CGT", "AAG", "GTT", "ACG", "ACT", "TAT", "CAG", "ACA", "GAA", "GCA", "GTG", "MC", "AGC", "GTC", "AAT", "ATG", "ACC", "GCT", "GGC", "CGC", "ATT", "ATT", "CAT", "CTG", "ATT", "GAT", "AAG", "GAC", " ", "570", "Gly", "Vat", "Arg", "Lys", "Vat", "Thr", "Thr", "Tyr", "Gin", "Thr", "Glu", "Ala", "Vat", "Asn", "Ser", "Vat", "Asn", "MET", "Thr", "Ala", "Gly", "Arg", "lIe", "lIe", "His", "Leu", "lIe", "Asp", "Lys", "Asp", "\n\n ", "G", "\n\n ", "ATT", "CGC", "ATC", "CAA", "AM", "AGC", "GCG", "GGG", "ATC", "MT", "GAG", "CAC", "AGT", "GCG", "AAA", "TAC", "ATA", "GAG", "MC", "CTG", "GAA", "GCA", "ACA", "AM", "GAG", "CTA", "ATG", "AAG", "CAG", "TAC", " ", "660", "lle", "Arg", "lIe", "Gin", "Lys", "Ser", "Ala", "Gly", "lIe", "Asn", "Gtu", "His", "Ser", "Ala", "Lys", "Tyr", "lIe", "Gtu", "Asn", "Leu", "Gtu", "Ala", "Thr", "Lys", "Gtu", "Leu", "MET", "Lys", "Gin", "Tyr", "\n\n ", "T", " ", "T", "\n\n ", "CCG", "GAG", "GAT", "GAA", "AAA", "TTC", "CGT", "ATG", "CGC", "GTA", "CAC", "GGC", "TTT", "AGC", "GAA", "ACA", "ATG", "CTG", "CGC", "GTC", "CAT", "TAC", "ATT", "TCC", "AGT", "AGC", "CCT", "AAC", "TAC", "AAT", " ", "750", "Pro", "Glu", "Asp", "Glu", "Lys", "Phe", "Arg", "MET", "Arg", "Vat", "His", "Gly", "Phe", "Ser", "Gtu", "Thr", "MET", "Leu", "Arg", "Vat", "His", "Tyr", "lie", "Ser", "Ser", "Ser", "Pro", "Asn", "Tyr", "Asn", "\n\n ", "Phe", "\n\n ", "T", " ", "C", " ", "G", " ", "T", " ", "T", "\n\n ", "I", " ", "~~~I", " ", "I", " ", "II", "\n\n ", "GAT", "GGC", "MA", "TCA", "GTT", "AGT", "TAC", "CAT", "GTG", "CTG", "CTA", "TGT", "GGC", "GTG", "TTT", "ATC", "TGC", "GAT", "GM", "ACT", "CTC", "CGA", "GAT", "GGA", "ATC", "ATC", "ATC", "AAC", "GGT", "GAA", " ", "840", "\n\n ", "e", "..", "Asp", "Gly", "Lys", "Ser", "Vat", "Ser", "Tyr", "His", "Vat", "Leu", "Leu", "Cys", "Gly", "Vat", "Phe", "lie", "Cys", "Asp", "Glu", "Thr", "Leu", "Arg", "Asp", "Gly", "lIe", "lie", "lIe", "Asn", "Gly", "Gtu", "\n\n ", "Pro", "\n\n ", "C", " ", "tag(cl", ".169", ")", "\n\n ", "TTT", "GAG", "AM", "GCA", "AAA", "TTT", "AGC", "CTT", "TAT", "GAC", "TCT", "ATA", "GM", "CCG", "ATC", "ATC", "TGC", "GAC", "CGC", "TGG", "CCG", "CAG", "GCA", "AM", "ATA", "TAT", "CGC", "CTG", "GCA", "GAT", " ", "930", "Phe", "Gtu", "Lys", "Ala", "Lys", "Phe", "Ser", "Leu", "Tyr", "Asp", "Ser", "lIe", "Glu", "Pro", "lie", "lie", "Cys", "Asp", "Arg", "Trp", "Pro", "Gin", "Ala", "Lys", "lIe", "Tyr", "Arg", "Leu", "Ala", "Asp", "\n\n ", "T", "\n\n ", "ATT", "GM", "MT", "GTA", "AM", "AM", "CM", "ATT", "GCC", "ATC", "ACT", "CGC", "GM", "GAG", "AAA", " ", "G", "GTC", "AM", "TCA", "GCC", "GCA", "TCA", "GTT", "ACG", "CGC", "AGC", "CGC", "AAA", "ACT", "AAG", "1020", "\n\n ", "n-----", "\n\n ", "lie", "Glu", "Asn", "Vat", "Lys", "Lys", "Gin", "lIe", "Ala", "lie", "Thr", "Arg", "Glu", "Glu", "Lys", "Lys", "Vat", "Lys", "Ser", "Ala", "Ala", "Ser", "Vat", "Thr", "Arg", "Ser", "Arg", "Lys", "Thr", "Lys", "\n\n ", "AAG", "GGG", "CAG", "CCA", "GTA", "AAC", "GAC", "MC", "CCC", "GAA", "AGC", "GCG", "CM", "TAG", "Lys", "Gly", "Gin", "Pro", "Val", "Asn", "Asp", "Asn", "Pro", "Glu", "Ser", "Ala", "Gin", "ter", "\n\n ", "Fig", ".", "3", ".", "DNA", "sequence", "of", "PIcI", "and", "P7cl", ".", "The", "DNA", "sequence", "of", "PIcI", "is", "indicated", ".", "Positions", "where", "the", "sequence", "of", "P7cl", "differs", "from", "that", "of", "Plcl", "are", "indicated", "above", "the", "P1", "sequence", ".", "The", "amino", "acid", "sequence", "predicted", "by", "the", "open", "reading", "frame", "is", "given", "below", "the", "sequence", ".", "The", "two", "amino", "acid", "substitutions", "present", "in", "P7cl", "are", "shown", "below", "the", "open", "reading", "frame", ".", "The", "locations", "of", "the", "amber", "mutant", "codons", "in", "cl.55", "and", "ci", ".", "169", "are", "indicated", "by", "small", "letters", "above", "the", "sequence", ".", "Sites", "for", "selected", "restriction", "enzymes", "(", "EcoRV", "[", "v", "]", ";", "BamHI", "[", "b", "]", ";", "Bgll", "[", "g", "]", ";", "EcoRP", "[", "e", "]", ";", "and", "NruI", "[", "n", "]", ")", "are", "illustrated", "by", "dashed", "lines", "beneath", "the", "sequence", ".", "The", "cl", "repressor", "binding", "site", "is", "underlined", ".", "Inverted", "arrows", "beneath", "the", "sequence", "illustrate", "the", "inverted", "repeat", "sequence", "upstream", "of", "the", "open", "reading", "frame", ".", "Predicted", "promoter", "ribosome", "binding", "sites", "are", "indicated", "by", "the", "presence", "of", "the", "consensus", "sequences", "above", "and", "below", "the", "line", ",", "respectively", ".", "The", "DNA", "sequences", "of", "Plcl", "from", "bp", "1", "-", "134", "and", "bp", "1", "-", "434", "were", "reported", "previously", "(", "2,5", ")", ".", "\n\n ", "mutant", "cl", "genes", "from", "either", "P1", "or", "P7", "(", "Table", "1", ")", ".", "The", "efficiency", "with", "which", "a", "cloned", "P7cl", "gene", "complements", "a", "PlcI", "mutation", "confirms", "previous", "genetic", "studies", "indicating", "that", "these", "two", "genes", "are", "functionally", "interchangeable", "(", "9", ")", ".", "The", "location", "of", "the", "'", "y6", "mutations", "that", "destroy", "cl", "-", "complementing", "activity", "suggests", "that", "the", "P7cl", "open", "reading", "frame", "occupies", "a", "map", "position", "similar", "to", "that", "of", "the", "P1", "open", "reading", "frame", "(", "Figure", "1", ")", ".", "7676", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Proteins", "produced", "by", "fragments", "containing", "Plcl", ".", "\n\n ", "As", "an", "initial", "step", "in", "the", "comparison", "of", "the", "P1", "and", "P7", "repressors", ",", "we", "analyzed", "the", "gene", "products", "expressed", "from", "the", "cloned", "cl", "regions", ".", "In", "an", "in", "vitro", "transcription", "-", "translation", "reaction", ",", "plasmids", "coding", "for", "the", "wildtpe", "alleles", "of", "either", "PIcI", "or", "P7cl", "direct", "the", "production", "of", "a", "protein", "with", "an", "estimated", "molecular", "weight", "of", "33,000", "daltons", "(", "Figure", "2", ",", "Lanes", "C", "and", "D", ")", ",", "a", "size", "that", "agrees", "closely", "with", "the", "predicted", "molecular", "weight", "of", "the", "PIcI", "repressor", "reported", "previously", "(", "3,28", ")", ".", "The", "loss", "of", "the", "33,000", "dalton", "protein", "in", "the", "cl", "-", "'", "ya", "-", "induced", "P7", "mutant", "plasmids", "(", "Figure", "2", ",", "Lanes", "E", "and", "F", ")", "is", "consistent", "with", "its", "designation", "as", "the", "P7cl", "repressor", ".", "As", "expected", ",", "the", "33,000", "dalton", "protein", "is", "not", "observed", "when", "reaction", "mixtures", "contain", "DNA", "from", "Plcl", "amber", "mutants", "(", "Figure", "2", ",", "Lanes", "A", "and", "B", ")", ".", "DNA", "sequence", "analysis", "of", "the", "cl", "genes", ".", "\n\n ", "To", "make", "a", "direct", "comparison", "between", "the", "Plcl", "and", "P7cl", "DNA", "sequences", "and", "to", "predict", "the", "amino", "acid", "sequences", "of", "the", "repressor", "proteins", ",", "we", "carried", "out", "M", "13-dideoxy", "sequence", "analysis", "of", "cloned", "fragments", "carrying", "the", "cl", "genes", ".", "The", "sequences", "of", "about", "1", "kb", "of", "P1", "and", "P7", "DNA", "were", "determined", "starting", "from", "a", "common", "EcoRV", "site", "predicted", "to", "lie", "approximately", "200", "bps", "upstream", "of", "the", "cl", "genes", ".", "The", "P1", "and", "P7", "sequences", "(", "Figure", "3", ")", "both", "contain", "an", "ATG", "initiation", "codon", "preceded", "by", "a", "putative", "ribosome", "binding", "sequence", "(", "29", ")", "situated", "211", "bps", "downstream", "of", "the", "EcoRV", "site", ".", "In", "each", "case", ",", "the", "initiation", "codon", "is", "followed", "by", "an", "open", "reading", "reading", "frame", "extending", "for", "283", "codons", ".", "The", "P1", "and", "P7", "open", "reading", "frames", "code", "for", "proteins", "with", "predicted", "molecular", "weights", "(", "32,515", "and", "32,499", "daltons", ",", "respectively", ")", "that", "agree", "closely", "with", "the", "values", "of", "the", "proteins", "expressed", "from", "the", "cloned", "DNA", "fragments", "(", "Figure", "2", ")", "and", "with", "results", "predicted", "independently", "for", "the", "purified", "PIcI", "repressor", "(", "3", "-", "4", ")", ".", "The", "localization", "of", "two", "PIcI", "amber", "mutations", "to", "the", "P1", "open", "reading", "frame", "confirms", "its", "identification", "as", "the", "cI", "coding", "sequence", ".", "cI.", "169", "contains", "an", "amber", "mutation", "that", "would", "result", "in", "a", "protein", "fragment", "of", "26,680", "daltons", ",", "a", "value", "that", "agrees", "well", "with", "the", "size", "of", "a", "protein", "fragment", "observed", "under", "the", "in", "vitro", "transcription", "/", "translation", "reaction", "conditions", "(", "Figure", "2", ",", "Lane", "B", ")", ".", "The", "cl.55", "amber", "mutation", "lies", "close", "to", "the", "N", "-", "terminal", "region", "of", "the", "protein", ",", "resulting", "in", "the", "production", "of", "a", "fragment", "of", "55", "amino", "acids", "that", "is", "apparently", "too", "small", "to", "resolve", "under", "the", "electrophoretic", "conditions", "used", "for", "separation", "of", "the", "proteins", ".", "Over", "60", "%", "of", "the", "amino", "acid", "sequence", "predicted", "for", "the", "PIcI", "open", "reading", "frame", "has", "been", "verified", "by", "amino", "acid", "sequence", "analysis", "of", "peptide", "fragments", "isolated", "from", "the", "purified", "repressor", "protein", "(", "see", "accompanying", "paper", ",", "reference", "3", ")", ".", "\n\n ", "The", "DNA", "sequences", "of", "P1", "and", "P7", "are", "identical", "for", "a", "399-bp", "region", "that", "extends", "from", "the", "EcoRV", "site", "at", "the", "5", "'", "side", "of", "the", "cl", "gene", "to", "a", "point", "188", "bps", "within", "the", "open", "reading", "frame", ".", "The", "sequences", "within", "the", "Plcl", "and", "the", "P7cl", "open", "reading", "frames", "differ", "at", "only", "18", "positions", ",", "all", "but", "two", "of", "which", "occur", "in", "the", "wobble", "position", "of", "the", "predicted", "codon", ".", "From", "these", "results", ",", "we", "conclude", "that", "the", "functional", "identity", "of", "the", "P1", "and", "P7", "cl", "genes", "is", "a", "consequence", "of", "their", "nearly", "identical", "amino", "acid", "sequence", ".", "Analysis", "of", "promoters", "upstream", "of", "the", "cl", "open", "reading", "frame", ".", "\n\n ", "Expression", "of", "Plcl", "was", "shown", "previously", "to", "require", "sequences", "on", "the", "distal", "side", "of", "a", "BamHI", "site", "(", "2", ",", "5", ")", "located", "about", "100", "bps", "upstream", "of", "the", "open", "reading", "frame", "(", "Figure", "3", ")", ".", "A", "binding", "site", "for", "the", "cl", "repressor", "has", "also", "been", "shown", "to", "exist", "close", "to", "this", "BamHI", "site", "(", "2", ",", "5", ",", "6", ")", ".", "To", "determine", "whether", "this", "region", "contains", "a", "promoter", "that", "is", "detectable", "in", "vivo", "and", ",", "further", ",", "to", "determine", "whether", "this", "promoter", "can", "be", "regulated", "by", "cl", "repressor", "proteins", "from", "either", "P1", "or", "P7", ",", "we", "introduced", "several", "DNA", "fragments", "from", "this", "region", "into", "the", "promoter", "probe", "vector", "pCB192", ",", "screened", "for", "promoter", "activity", "(", "as", "monitored", "by", "lacZ", "expression", ")", "and", "checked", "for", "repression", "of", "this", "activity", "in", "the", "presence", "of", "a", "compatible", "\n\n ", "7677", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "plasmid", "expressing", "Plcl", "or", "P7cl", ".", "Cells", "harboring", "pBCB2.13", "(", "a", "plasmid", "which", "carries", "a", "460", "bp", "fragment", "of", "P1", "DNA", "that", "extends", "across", "the", "BamHI", "site", "upstream", "of", "cl", "into", "the", "open", "reading", "frame", ")", "are", "dark", "blue", "in", "the", "presence", "of", "Xgal", "and", "produce", "significant", "levels", "of", "3-galactosidase", "(", "Table", "2", ")", ".", "In", "contrast", ",", "pBCB2.16", "and", "pBCB2.18", "(", "which", "each", "contain", "DNA", "from", "only", "one", "side", "of", "the", "BamHI", "site", "located", "in", "pBCB2", ".", "13", ")", "do", "not", "confer", "a", "blue", "color", "on", "their", "host", "cell", "in", "the", "presence", "of", "X", "-", "Gal", "and", "express", "negligible", "amounts", "of", "3-galactosidase", "(", "Table", "2", ")", ".", "These", "observations", "suggest", "that", "expression", "from", "the", "promoter", "identified", "here", "requires", "sequences", "that", "span", "the", "BamHI", "site", "upstream", "of", "cl", ".", "Expression", "of", "cl", "from", "a", "compatible", "plasmid", "in", "the", "presence", "of", "pBCB2", ".", "13", "results", "in", "a", "90", "%", "reduction", "in", "promoter", "strength", "(", "Table", "2", ")", ".", "This", "reduction", "is", "seen", "in", "the", "presence", "of", "either", "Plcl", "or", "P7cl", ",", "indicating", "that", "the", "two", "repressor", "proteins", "are", "both", "capable", "of", "repressing", "expression", "from", "this", "promoter", ".", "DISCUSSION", ".", "\n\n ", "The", "DNA", "sequences", "of", "Plcl", "and", "P7cl", "differ", "at", "only", "18", "sites", ",", "all", "but", "two", "of", "which", "occur", "at", "the", "third", "position", "of", "the", "affected", "codon", ".", "This", "observation", "provides", "biochemical", "confirmation", "of", "the", "functional", "identity", "predicted", "on", "the", "basis", "of", "previous", "genetic", "analysis", "(", "9", ")", ".", "A", "number", "of", "DNA", "binding", "proteins", "exhibit", "a", "common", "structural", "motif", "in", "which", "two", "helices", "are", "separated", "by", "a", "glycine", "residue", "(", "12", ")", ".", "This", "motif", "is", "not", "observed", "in", "the", "predicted", "secondary", "structures", "(", "30", ")", "of", "the", "Plcl", "and", "P7cl", "amino", "acid", "sequences", ".", "A", "sequence", "with", "some", "similarity", "to", "the", "XCro", "helix", "-", "turn", "-", "helix", "region", "was", "previously", "reported", "near", "the", "Nterminus", "of", "the", "PIcI", "protein", "(", "5", ")", ";", "however", ",", "it", "was", "noted", "that", "the", "potential", "for", "helix", "formation", "is", "disrupted", "by", "the", "presence", "of", "several", "prolines", "within", "the", "region", ".", "The", "secondary", "structure", "predicted", "for", "the", "Plcl", "and", "P7cl", "repressor", "proteins", "(", "30", ")", "does", "not", "reveal", "other", "structural", "characteristics", "(", "e.g", ".", ",", "Zn", "fingers", "(", "31", ")", ",", "leucine", "zippers", "(", "32", ")", ",", "or", "helix", "-", "loop", "-", "helix", "motifs", "(", "33", ")", ")", "that", "have", "been", "associated", "with", "DNA", "binding", "activity", "in", "other", "systems", ".", "A", "search", "of", "the", "GenBank", "and", "EMBL", "databases", "does", "not", "reveal", "any", "other", "known", "regulatory", "proteins", "with", "significant", "amino", "acid", "similarity", "to", "the", "Plcl", "or", "the", "P7cl", "repressor", "sequences", ".", "Since", "the", "Plcl", "repressor", "differs", "from", "most", "other", "repressors", "in", "DNA", "binding", "specificity", "(", "i.e", ".", ",", "in", "its", "recognition", "of", "an", "asymmetric", "operator", "sequence", ")", ",", "it", "is", "not", "unexpected", "to", "find", "that", "the", "protein", "does", "not", "exhibit", "common", "structural", "motifs", "at", "the", "amino", "acid", "level", ".", "\n\n ", "The", "cl", "-", "repressible", "promoter", "described", "in", "this", "report", "is", "located", "in", "a", "region", "just", "upstream", "of", "the", "cl", "open", "reading", "frame", "and", "is", "oriented", "in", "the", "direction", "of", "cl", ".", "Because", "the", "promoter", "is", "present", "on", "a", "multicopy", "plasmid", ",", "it", "is", "not", "possible", "to", "make", "a", "direct", "calculation", "of", "promoter", "strength", ";", "however", ",", "the", "values", "observed", "are", "about", "five", "-", "fold", "lower", "than", "the", "levels", "produced", "by", "a", "derivative", "of", "pCB192", "that", "contains", "the", "plac", "promoter", "from", "pUC19", "(", "34", ")", ".", "Because", "sequences", "on", "both", "sides", "of", "the", "BamHI", "site", "located", "upstream", "of", "cl", "are", "required", "for", "promoter", "activity", "(", "Table", "2", ")", ",", "we", "suggest", "that", "the", "promoter", "spans", "this", "site", ".", "Less", "than", "10", "bps", "downstream", "of", "this", "BamHI", "site", "is", "a", "heptanucleotide", "sequence", "(", "TATAATG", ")", "that", "is", "identical", "to", "the", "-10", "consensus", "sequence", "for", "RNA", "polymerase", "(", "35", ")", ".", "If", "this", "sequence", "does", "indeed", "correspond", "to", "the", "-10", "region", "of", "the", "promoter", ",", "the", "-35", "region", "would", "be", "predicted", "to", "lie", "on", "the", "other", "side", "of", "the", "BamHI", "site", "in", "a", "region", "that", "overlaps", "a", "known", "cI", "repressor", "binding", "site", "(", "2", "-", "5", ")", ".", "Analysis", "of", "this", "region", "does", "not", "reveal", "any", "sequences", "with", "significant", "similarity", "to", "the", "-35", "consensus", "sequence", ".", "The", "best", "fit", "is", "the", "sequence", "TCTATT", "(", "Figure", "3", ")", ",", "which", "matches", "only", "two", "positions", "of", "the", "-35", "consensus", "(", "TTGACA", ")", ".", "The", "lack", "of", "a", "strong", "-35", "region", "is", "often", "observed", "with", "genes", "that", "require", "an", "activator", ".", "Although", "a", "pentanucleotide", "sequence", "corresponding", "to", "the", "conserved", "portion", "of", "the", "CRP", "protein", "consensus", "binding", "site", "(", "36", ")", "\n\n ", "7678", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "is", "located", "just", "upstream", "of", "the", "predicted", "-35", "region", "(", "at", "position", "91", ";", "Figure", "3", ")", ",", "a", "role", "for", "CRP", "-", "mediated", "activation", "in", "cl", "expression", "has", "not", "previously", "been", "described", ".", "The", "orientation", "of", "the", "promoter", "and", "its", "cl", "-", "repressible", "character", "raise", "the", "possibility", "that", "cl", "expression", "is", "autoregulatory", ".", "If", "this", "is", "so", ",", "one", "potential", "activator", "would", "be", "the", "cl", "repressor", "itself", ".", "Expression", "cannot", "be", "absolutely", "dependent", "on", "cl", "-", "mediated", "activation", ",", "however", ",", "because", "the", "cloned", "promoter", "exhibits", "significant", "activity", "in", "the", "absence", "of", "the", "cl", "gene", "(", "Table", "2", ")", ".", "Under", "the", "conditions", "reported", "here", ",", "the", "presence", "of", "the", "cl", "gene", "results", "in", "a", "decrease", "rather", "than", "an", "increase", "in", "lacZ", "expression", ";", "however", ",", "these", "observations", "do", "not", "rule", "out", "a", "potential", "activator", "role", "for", "the", "cl", "protein", ",", "since", "the", "ratios", "of", "repressor", "and", "operator", "provided", "by", "the", "multicopy", "plasmids", "may", "not", "be", "optimal", "for", "activation", ".", "Physiologically", ",", "the", "role", "of", "additional", "repressor", "binding", "sites", "in", "regulating", "cl", "expression", "also", "cannot", "be", "discounted", ".", "Three", "potential", "operator", "sites", "have", "been", "identified", "several", "hundred", "bps", "upstream", "of", "the", "cI", "open", "reading", "frame", "(", "2", "-", "5", ")", ";", "one", "or", "more", "of", "these", "could", "be", "involved", "(", "possibly", "through", "a", "DNA", "looping", "mechanism", ";", "37", ")", "in", "the", "activation", "or", "repression", "of", "cl", "expression", "during", "phage", "growth", ".", "\n\n ", "A", "cl", "-", "repressible", "promoter", "oriented", "in", "the", "direction", "of", "cl", "was", "previously", "reported", "(", "38", ")", "to", "be", "located", "entirely", "within", "PlBamHI-9", ",", "a", "fragment", "located", "upstream", "of", "cl", "which", "is", "bracketed", "by", "the", "BamHI", "site", "within", "pBCB2", ".", "13", ".", "Because", "sequences", "on", "both", "sides", "of", "this", "BamHI", "site", "are", "required", "for", "the", "activity", "of", "the", "promoter", "in", "pBCB2.13", ",", "we", "suggest", "that", "the", "previously", "identified", "promoter", "is", "distinct", "from", "the", "one", "reported", "here", ".", "The", "promoter", "from", "BamHI-9", "could", "correspond", "to", "a", "consensus", "promoter", "sequence", "that", "is", "situated", "about", "500", "bps", "upstream", "of", "cl", "and", "overlaps", "a", "cl", "repressor", "binding", "site", "(", "2", ")", ".", "If", "so", ",", "cl", "expression", "is", "likely", "to", "be", "controlled", "by", "more", "than", "one", "promoter", ".", "Located", "between", "this", "promoter", "sequence", "and", "the", "promoter", "encoded", "on", "pBCB2", ".", "13", "is", "an", "open", "reading", "frame", "whose", "product", "(", "termed", "coi", ",", "or", "c", "-", "one", "inactivator", ")", "has", "been", "implicated", "in", "the", "establishment", "of", "lytic", "growth", "(", "1", ",", "39", ";", "B.R.", "Baumstark", ",", "unpublished", "results", ")", ".", "It", "has", "been", "suggested", "(", "2", ")", "that", "the", "decision", "to", "enter", "lytic", "or", "lysogenic", "growth", "is", "influenced", "by", "the", "level", "of", "transcription", "initiated", "from", "the", "distal", "promoter", "(", "which", "would", "transcribe", "coi", "prior", "to", "the", "transcription", "of", "cl", ")", "relative", "to", "that", "of", "the", "promoter", "located", "immediately", "upstream", "of", "the", "cl", "gene", "(", "which", "would", "transcribe", "only", "ci", ")", ".", "\n\n ", "A", "32-nucleotide", "hyphenated", "inverted", "repeat", "sequence", "is", "located", "just", "upstream", "of", "the", "cl", "open", "reading", "frame", "(", "positions", "146", "-", "188", ";", "Figure", "3", ")", ".", "It", "is", "not", "currently", "known", "whether", "this", "sequence", "has", "any", "regulatory", "effect", "on", "cl", "expression", ".", "Conceivably", ",", "the", "sequence", "could", "serve", "as", "a", "recognition", "site", "for", "an", "as", "-", "yet", "-", "unidentified", "regulatory", "protein", ".", "Alternatively", ",", "it", "may", "affect", "the", "secondary", "structure", "of", "the", "messenger", "RNA", ".", "A", "transcript", "extending", "from", "a", "promoter", "located", "upstream", "of", "the", "putative", "coi", "open", "reading", "frame", "would", "be", "capable", "of", "forming", "a", "stable", "stem", "-", "loop", "structure", "containing", "16", "bps", "with", "a", "single", "bp", "mismatch", "(", "AG", "=", "-33.6", "Kcal", ")", "of", "this", "inverted", "repeat", "sequence", ".", "Such", "a", "structure", "could", "potentially", "serve", "as", "a", "recognition", "site", "for", "a", "regulatory", "factor", "or", ",", "alternatively", ",", "could", "mask", "such", "a", "site", ".", "On", "the", "other", "hand", ",", "transcription", "originating", "from", "the", "promoter", "spanning", "the", "BamHI", "site", "just", "upstream", "of", "cl", "would", "start", "at", "a", "site", "within", "the", "inverted", "repeat", "sequence", ",", "forming", "a", "comparatively", "less", "stable", "stem", "-", "loop", "structure", "of", "about", "8", "bps", ".", "The", "role", "of", "the", "inverted", "repeat", "region", "in", "the", "regulation", "of", "cl", "expression", "is", "currently", "under", "investigation", ".", "\n\n ", "ACKNOWLEDGEMENTS", "\n\n ", "We", "thank", "Heinz", "Schuster", "for", "his", "review", "of", "the", "manuscript", ".", "This", "work", "was", "supported", "by", "National", "Science", "Foundation", "grant", "DMB-8704146", ".", "\n\n ", "7679", "\n\n ", "Nucleic", "Acids", "Research", "\n\n ", "Abbreviations", ":", "bp", ",", "basepairs", ";", "kb", ",", "kilobase", "pairs", ";", "X", "-", "Gal", ",", "5-Bromo-4-Chloro-3-indolylbeta", "-", "D", "-", "galactopyranoside", ".", "\n\n ", "*", "To", "whom", "correspondence", "should", "be", "addressed", "\n\n ", "REFERENCES", "\n\n ", "1", ".", "Yarmolinsky", ",", "M.B.", ",", "and", "Steinberg", ",", "N.", "(", "1988", ")", ".", "In", "Calendar", ",", "R.", ",", "(", "ed", ".", ")", ",", "The", "Bacteriophages", ",", "Plenum", "Publishing", "\n\n ", "Corp", ".", ",", "NY", ",", "Vol", ".", "1", ",", "pp", ".", "291", "-", "438", ".", "\n\n ", "2", ".", "Baumstark", ",", "B.R.", ",", "Stovall", ",", "S.R.", ",", "and", "Ashkar", ",", "S.", "(", "1987", ")", ".", "Virology", "156", ",", "404", "-", "413", ".", "\n\n ", "3", ".", "Dreiseikelmann", ",", "B.", ",", "Velleman", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1988", ")", ".", "J.", "Biol", ".", "Chem", ".", "263", ",", "1391", "-", "1397", ".", "\n\n ", "4", ".", "Heinrich", ",", "J.", ",", "Riedel", ",", "H.-D.", ",", "Baumstark", ",", "B.R.", ",", "Kimura", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1989", ")", ".", "Nucleic", "Acids", "Res", ",", "\n\n ", "this", "volume", ".", "\n\n ", "5", ".", "Eliason", ",", "J.L.", ",", "and", "Stemnberg", ",", "N.", "(", "1987", ")", ".", "J.", "Mol", ".", "Biol", ".", "198", ",", "281", "-", "293", ".", "\n\n ", "6", ".", "Velleman", ",", "M.", ",", "Dreiseikelmann", ",", "B.", ",", "and", "Schuster", ",", "H.", "(", "1987", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "84", ",", "5570", "-", "5574", ".", "7", ".", "Citron", ",", "M.", ",", "Velleman", ",", "M.", ",", "and", "Schuster", ",", "H.", "(", "1988", ")", ".", "J.", "Biol", ".", "Chem", ".", "264", ",", "3611", "-", "3617", ".", "\n\n ", "8", ".", "Chadwick", ",", "P.", ",", "Pirotta", ",", "V.", ",", "Steinberg", ",", "R.", ",", "Hopkins", ",", "N.", ",", "and", "Ptashne", ",", "M.", "(", "1970", ")", ".", "Cold", "Spring", "Harbor", "Symp", ".", "\n\n ", "Quant", ".", "Biol", ".", "35", ",", "283", "-", "294", ".", "\n\n ", "9", ".", "Chesney", ",", "R.H.", ",", "and", "Scott", ",", "J.R.", "(", "1975", ")", ".", "Virology", "67", ",", "375", "-", "384", ".", "\n\n ", "10", ".", "Wandersman", ",", "C.", ",", "and", "Yarmolinsky", ",", "M.", "(", "1977", ")", ".", "Virology", "78", ",", "267", "-", "276", ".", "\n\n ", "11", ".", "Scott", ",", "J.R.", ",", "West", ",", "B.W.", ",", "and", "Laping", ",", "J.L.", "(", "1978", ")", ".", "Virology", "85", ",", "587", "-", "600", ".", "12", ".", "Pabo", ",", "C.O.", ",", "and", "Sauer", ",", "R.", "A.", "(", "1984", ")", ".", "Ann", ".", "Rev", ".", "Biochem", ".", "53", ",", "293", "-", "321", ".", "13", ".", "Scott", ",", "J.R.", "(", "1974", ")", ".", "Virology", "62", ",", "344", "-", "349", ".", "\n\n ", "14", ".", "Schneider", ",", "K.", ",", "and", "Beck", ",", "C.F.", "(", "1987", ")", ".", "Methods", "in", "Enzymol", ".", "153", ",", "452", "-", "461", ".", "15", ".", "Smith", ",", "H.W.", "(", "1972", ")", ".", "Nature", "New", "Biol", ".", "238", ",", "205", "-", "206", ".", "16", ".", "Scott", ",", "J.R.", "(", "1975", ")", ".", "Virology", "65", ",", "173", "-", "178", ".", "\n\n ", "17", ".", "Scott", ",", "J.R.", ",", "Kropf", ",", "M.M.", ",", "and", "Mendelson", ",", "L.", "(", "1977", ")", ".", "Virology", "76", ",", "39", "-", "46", ".", "18", ".", "Scott", ",", "J.R.", "(", "1968", ")", ".", "Virology", "36", ",", "564", "-", "574", ".", "\n\n ", "19", ".", "Walker", ",", "D.H.", ",", "Jr", ".", ",", "and", "Walker", ",", "J.T.", "(", "1976", ")", ".", "J.", "Virol", ".", "20", ",", "177", "-", "187", ".", "20", ".", "Stemnberg", ",", "N.", "(", "1979", ")", ".", "Virology", "96", ",", "129", "-", "142", ".", "\n\n ", "21", ".", "Schneider", ",", "K.", ",", "and", "Beck", ",", "C.F.", "(", "1986", ")", ".", "Gene", "42", ",", "37", "-", "48", ".", "\n\n ", "22", ".", "Taylor", ",", "D.P.", ",", "and", "Cohen", ",", "S.N.", "(", "1979", ")", ".", "J.", "Bacteriol", ".", "137", ",", "92", "-", "104", ".", "\n\n ", "23", ".", "Miller", ",", "J.H.", "(", "1972", ")", ".", "In", "Experiments", "in", "Molecular", "Genetics", ",", "Cold", "Spring", "Harbor", "Laboratory", ",", "Cold", "Spring", "\n\n ", "Harbor", ",", "N.Y.", "352", "-", "355", ".", "\n\n ", "24", ".", "Guyer", ",", "R.S.", "(", "1978", ")", ".", "J.", "Mol", ".", "Biol", ".", "126", ",", "347", "-", "365", ".", "\n\n ", "25", ".", "Devlin", ",", "B.H.", ",", "Baumstark", ",", "B.R.", ",", "and", "Scott", ",", "J.R.", "(", "1982", ")", ".", "Virology", "120", ",", "360", "-", "375", ".", "\n\n ", "26", ".", "Sanger", ",", "F.", ",", "Nicklen", ",", "S.", ",", "and", "Coulson", ",", "A.R.", "(", "1977", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "74", ",", "5463", "-", "5467", ".", "27", ".", "DeVries", ",", "J.K.", ",", "and", "Zubay", ",", "G.", "(", "1967", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "57", ",", "1010", "-", "1012", ".", "\n\n ", "28", ".", "Heilmann", ",", "H.", ",", "Reeve", ",", "J.R.", ",", "and", "Puhler", ",", "A.", "(", "1980", ")", ".", "Mol", ".", "Gen", ".", "Genet", ".", "178", ",", "149", "-", "154", ".", "29", ".", "Shine", ",", "J.", ",", "and", "Dalgarno", ",", "L.", "(", "1974", ")", ".", "Proc", ".", "Natl", ".", "Acad", ".", "Sci", ".", "USA", "71", ",", "1342", "-", "1346", ".", "30", ".", "Chou", ",", "P.Y.", ",", "and", "Fasman", ",", "G.D.", "(", "1978", ")", ".", "Adv", ".", "Enzymol", ".", "47", ",", "45", "-", "148", ".", "31", ".", "Berg", ",", "J.M.", "(", "1986", ")", ".", "Nature", "319", ",", "264", "-", "265", ".", "\n\n ", "32", ".", "Landschultz", ",", "W.H.", ",", "Johnson", ",", "P.F.", ",", "and", "McKnight", ",", "S.L.", "(", "1988", ")", ".", "Science", "240", ",", "1759", "-", "1764", ".", "33", ".", "Murre", ",", "C.", ",", "McCaw", ",", "P.", ",", "and", "Baltimore", ",", "D.", "Cell", "56", ",", "777", "-", "783", ".", "\n\n ", "34", ".", "Anderson", ",", "B.E.", ",", "Baumstark", ",", "B.R.", ",", "and", "Bellini", ",", "W.J.", "(", "1988", ")", ".", "J.", "Bacteriol", ".", "170", ",", "4493", "-", "4500", ".", "35", ".", "Rosenberg", ",", "M.", ",", "and", "Court", ",", "D.", "(", "1979", ")", ".", "Annu", ".", "Rev", ".", "Genet", ".", "13", ",", "319", "-", "353", ".", "\n\n ", "36", ".", "Ebright", ",", "R.H.", ",", "Cossart", ",", "P.", ",", "Gicquel", "-", "Sanzey", ",", "B.", ",", "and", "Beckwith", ",", "J.", "(", "1984", ")", ".", "Nature", "311", ",", "232", "-", "235", ".", "37", ".", "Ptashne", ",", "M.", "(", "1986", ")", ".", "Nature", "322", ",", "697", "-", "701", ".", "\n\n ", "38", ".", "Stemnberg", ",", "N.", ",", "and", "Hoess", ",", "R.", "(", "1983", ")", ".", "Annu", ".", "Rev", ".", "Genet", ".", "17", ",", "123", "-", "154", ".", "39", ".", "Scott", ",", "J.R.", "(", "1980", ")", ".", "Curr", ".", "Top", ".", "Microbiol", ".", "Immunol", ".", "90", ",", "49", "-", "65", ".", "\n\n ", "7680", "\n\n ", "This", "article", ",", "submitted", "on", "disc", ",", "has", "been", "automatically", "\n\n ", "converted", "into", "this", "typeset", "format", "by", "the", "publisher", "." ]
[ "species" ]
Abstract is an umlsterm, Xeroderma pigmentosum is an umlsterm, hereditary diseases is an umlsterm, DNA repair is an umlsterm, Patients is an umlsterm, frequency is an umlsterm, malignant tumours is an umlsterm, squamous cell carcinomas is an umlsterm, basal cell carcinomas is an umlsterm, patient is an umlsterm, malignant melanomas is an umlsterm, squamous cell carcinoma is an umlsterm, lymph node is an umlsterm, metastasis is an umlsterm, malignant melanoma is an umlsterm, diagnosis is an umlsterm, xeroderma pigmentosum is an umlsterm, analysis is an umlsterm, patient is an umlsterm, xeroderma pigmentosum is an umlsterm
DerHautarzt.40450554.eng.abstr_task0
Sentence: Abstract . Xeroderma pigmentosum comprises a heterogeneous group of autosomal recessive hereditary diseases , which are characterized by a number of clinical characteristics and an abnormal DNA repair mechanism . Patients affected show a high frequency of mucocutaneous malignant tumours , especially squamous cell carcinomas and basal cell carcinomas . We report on a 65-year-old patient who successively developed a total of 15 malignant melanomas , 1 squamous cell carcinoma and 1 lymph node metastasis of a malignant melanoma . The clinical diagnosis of xeroderma pigmentosum was confirmed by the complementation analysis , which defined our patient as xeroderma pigmentosum of the complementation group D. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O" ]
Abstract . Xeroderma pigmentosum comprises a heterogeneous group of autosomal recessive hereditary diseases , which are characterized by a number of clinical characteristics and an abnormal DNA repair mechanism . Patients affected show a high frequency of mucocutaneous malignant tumours , especially squamous cell carcinomas and basal cell carcinomas . We report on a 65-year-old patient who successively developed a total of 15 malignant melanomas , 1 squamous cell carcinoma and 1 lymph node metastasis of a malignant melanoma . The clinical diagnosis of xeroderma pigmentosum was confirmed by the complementation analysis , which defined our patient as xeroderma pigmentosum of the complementation group D.
[ "Abstract", ".", "Xeroderma", "pigmentosum", "comprises", "a", "heterogeneous", "group", "of", "autosomal", "recessive", "hereditary", "diseases", ",", "which", "are", "characterized", "by", "a", "number", "of", "clinical", "characteristics", "and", "an", "abnormal", "DNA", "repair", "mechanism", ".", "Patients", "affected", "show", "a", "high", "frequency", "of", "mucocutaneous", "malignant", "tumours", ",", "especially", "squamous", "cell", "carcinomas", "and", "basal", "cell", "carcinomas", ".", "We", "report", "on", "a", "65-year", "-", "old", "patient", "who", "successively", "developed", "a", "total", "of", "15", "malignant", "melanomas", ",", "1", "squamous", "cell", "carcinoma", "and", "1", "lymph", "node", "metastasis", "of", "a", "malignant", "melanoma", ".", "The", "clinical", "diagnosis", "of", "xeroderma", "pigmentosum", "was", "confirmed", "by", "the", "complementation", "analysis", ",", "which", "defined", "our", "patient", "as", "xeroderma", "pigmentosum", "of", "the", "complementation", "group", "D." ]
[ "umlsterm" ]
Abstract is an umlsterm, Xeroderma pigmentosum is an umlsterm, hereditary diseases is an umlsterm, DNA repair is an umlsterm, Patients is an umlsterm, frequency is an umlsterm, malignant tumours is an umlsterm, squamous cell carcinomas is an umlsterm, basal cell carcinomas is an umlsterm, patient is an umlsterm, malignant melanomas is an umlsterm, squamous cell carcinoma is an umlsterm, lymph node is an umlsterm, metastasis is an umlsterm, malignant melanoma is an umlsterm, diagnosis is an umlsterm, xeroderma pigmentosum is an umlsterm, analysis is an umlsterm, patient is an umlsterm, xeroderma pigmentosum is an umlsterm
DerHautarzt.40450554.eng.abstr_task1
Sentence: Abstract . Xeroderma pigmentosum comprises a heterogeneous group of autosomal recessive hereditary diseases , which are characterized by a number of clinical characteristics and an abnormal DNA repair mechanism . Patients affected show a high frequency of mucocutaneous malignant tumours , especially squamous cell carcinomas and basal cell carcinomas . We report on a 65-year-old patient who successively developed a total of 15 malignant melanomas , 1 squamous cell carcinoma and 1 lymph node metastasis of a malignant melanoma . The clinical diagnosis of xeroderma pigmentosum was confirmed by the complementation analysis , which defined our patient as xeroderma pigmentosum of the complementation group D. Instructions: please typing these entity words according to sentence: Abstract, Xeroderma pigmentosum, hereditary diseases, DNA repair, Patients, frequency, malignant tumours, squamous cell carcinomas, basal cell carcinomas, patient, malignant melanomas, squamous cell carcinoma, lymph node, metastasis, malignant melanoma, diagnosis, xeroderma pigmentosum, analysis, patient, xeroderma pigmentosum Options: umlsterm
[ "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O" ]
Abstract . Xeroderma pigmentosum comprises a heterogeneous group of autosomal recessive hereditary diseases , which are characterized by a number of clinical characteristics and an abnormal DNA repair mechanism . Patients affected show a high frequency of mucocutaneous malignant tumours , especially squamous cell carcinomas and basal cell carcinomas . We report on a 65-year-old patient who successively developed a total of 15 malignant melanomas , 1 squamous cell carcinoma and 1 lymph node metastasis of a malignant melanoma . The clinical diagnosis of xeroderma pigmentosum was confirmed by the complementation analysis , which defined our patient as xeroderma pigmentosum of the complementation group D.
[ "Abstract", ".", "Xeroderma", "pigmentosum", "comprises", "a", "heterogeneous", "group", "of", "autosomal", "recessive", "hereditary", "diseases", ",", "which", "are", "characterized", "by", "a", "number", "of", "clinical", "characteristics", "and", "an", "abnormal", "DNA", "repair", "mechanism", ".", "Patients", "affected", "show", "a", "high", "frequency", "of", "mucocutaneous", "malignant", "tumours", ",", "especially", "squamous", "cell", "carcinomas", "and", "basal", "cell", "carcinomas", ".", "We", "report", "on", "a", "65-year", "-", "old", "patient", "who", "successively", "developed", "a", "total", "of", "15", "malignant", "melanomas", ",", "1", "squamous", "cell", "carcinoma", "and", "1", "lymph", "node", "metastasis", "of", "a", "malignant", "melanoma", ".", "The", "clinical", "diagnosis", "of", "xeroderma", "pigmentosum", "was", "confirmed", "by", "the", "complementation", "analysis", ",", "which", "defined", "our", "patient", "as", "xeroderma", "pigmentosum", "of", "the", "complementation", "group", "D." ]
[ "umlsterm" ]
Abstract, Xeroderma pigmentosum, hereditary diseases, DNA repair, Patients, frequency, malignant tumours, squamous cell carcinomas, basal cell carcinomas, patient, malignant melanomas, squamous cell carcinoma, lymph node, metastasis, malignant melanoma, diagnosis, xeroderma pigmentosum, analysis, patient, xeroderma pigmentosum
DerHautarzt.40450554.eng.abstr_task2
Sentence: Abstract . Xeroderma pigmentosum comprises a heterogeneous group of autosomal recessive hereditary diseases , which are characterized by a number of clinical characteristics and an abnormal DNA repair mechanism . Patients affected show a high frequency of mucocutaneous malignant tumours , especially squamous cell carcinomas and basal cell carcinomas . We report on a 65-year-old patient who successively developed a total of 15 malignant melanomas , 1 squamous cell carcinoma and 1 lymph node metastasis of a malignant melanoma . The clinical diagnosis of xeroderma pigmentosum was confirmed by the complementation analysis , which defined our patient as xeroderma pigmentosum of the complementation group D. Instructions: please extract entity words from the input sentence
[ "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O" ]
Abstract . Xeroderma pigmentosum comprises a heterogeneous group of autosomal recessive hereditary diseases , which are characterized by a number of clinical characteristics and an abnormal DNA repair mechanism . Patients affected show a high frequency of mucocutaneous malignant tumours , especially squamous cell carcinomas and basal cell carcinomas . We report on a 65-year-old patient who successively developed a total of 15 malignant melanomas , 1 squamous cell carcinoma and 1 lymph node metastasis of a malignant melanoma . The clinical diagnosis of xeroderma pigmentosum was confirmed by the complementation analysis , which defined our patient as xeroderma pigmentosum of the complementation group D.
[ "Abstract", ".", "Xeroderma", "pigmentosum", "comprises", "a", "heterogeneous", "group", "of", "autosomal", "recessive", "hereditary", "diseases", ",", "which", "are", "characterized", "by", "a", "number", "of", "clinical", "characteristics", "and", "an", "abnormal", "DNA", "repair", "mechanism", ".", "Patients", "affected", "show", "a", "high", "frequency", "of", "mucocutaneous", "malignant", "tumours", ",", "especially", "squamous", "cell", "carcinomas", "and", "basal", "cell", "carcinomas", ".", "We", "report", "on", "a", "65-year", "-", "old", "patient", "who", "successively", "developed", "a", "total", "of", "15", "malignant", "melanomas", ",", "1", "squamous", "cell", "carcinoma", "and", "1", "lymph", "node", "metastasis", "of", "a", "malignant", "melanoma", ".", "The", "clinical", "diagnosis", "of", "xeroderma", "pigmentosum", "was", "confirmed", "by", "the", "complementation", "analysis", ",", "which", "defined", "our", "patient", "as", "xeroderma", "pigmentosum", "of", "the", "complementation", "group", "D." ]
[ "umlsterm" ]
Exophthalmus is an umlsterm, Doppelbilder is an umlsterm
DerOpthalmologe.00970038.ger.abstr_task0
Sentence: Hintergrund : Wir berichten ueber den Fall einer 18-jaehrigen Patientin die sich mit hyperthyreoter Symptomatik , rechtsseitiger Lidretraktion und Exophthalmus vorstellte . Sie klagte bei Seitenblick ueber Doppelbilder . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
Hintergrund : Wir berichten ueber den Fall einer 18-jaehrigen Patientin die sich mit hyperthyreoter Symptomatik , rechtsseitiger Lidretraktion und Exophthalmus vorstellte . Sie klagte bei Seitenblick ueber Doppelbilder .
[ "Hintergrund", ":", "Wir", "berichten", "ueber", "den", "Fall", "einer", "18-jaehrigen", "Patientin", "die", "sich", "mit", "hyperthyreoter", "Symptomatik", ",", "rechtsseitiger", "Lidretraktion", "und", "Exophthalmus", "vorstellte", ".", "Sie", "klagte", "bei", "Seitenblick", "ueber", "Doppelbilder", "." ]
[ "umlsterm" ]
Exophthalmus is an umlsterm, Doppelbilder is an umlsterm
DerOpthalmologe.00970038.ger.abstr_task1
Sentence: Hintergrund : Wir berichten ueber den Fall einer 18-jaehrigen Patientin die sich mit hyperthyreoter Symptomatik , rechtsseitiger Lidretraktion und Exophthalmus vorstellte . Sie klagte bei Seitenblick ueber Doppelbilder . Instructions: please typing these entity words according to sentence: Exophthalmus, Doppelbilder Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
Hintergrund : Wir berichten ueber den Fall einer 18-jaehrigen Patientin die sich mit hyperthyreoter Symptomatik , rechtsseitiger Lidretraktion und Exophthalmus vorstellte . Sie klagte bei Seitenblick ueber Doppelbilder .
[ "Hintergrund", ":", "Wir", "berichten", "ueber", "den", "Fall", "einer", "18-jaehrigen", "Patientin", "die", "sich", "mit", "hyperthyreoter", "Symptomatik", ",", "rechtsseitiger", "Lidretraktion", "und", "Exophthalmus", "vorstellte", ".", "Sie", "klagte", "bei", "Seitenblick", "ueber", "Doppelbilder", "." ]
[ "umlsterm" ]
Exophthalmus, Doppelbilder
DerOpthalmologe.00970038.ger.abstr_task2
Sentence: Hintergrund : Wir berichten ueber den Fall einer 18-jaehrigen Patientin die sich mit hyperthyreoter Symptomatik , rechtsseitiger Lidretraktion und Exophthalmus vorstellte . Sie klagte bei Seitenblick ueber Doppelbilder . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
Hintergrund : Wir berichten ueber den Fall einer 18-jaehrigen Patientin die sich mit hyperthyreoter Symptomatik , rechtsseitiger Lidretraktion und Exophthalmus vorstellte . Sie klagte bei Seitenblick ueber Doppelbilder .
[ "Hintergrund", ":", "Wir", "berichten", "ueber", "den", "Fall", "einer", "18-jaehrigen", "Patientin", "die", "sich", "mit", "hyperthyreoter", "Symptomatik", ",", "rechtsseitiger", "Lidretraktion", "und", "Exophthalmus", "vorstellte", ".", "Sie", "klagte", "bei", "Seitenblick", "ueber", "Doppelbilder", "." ]
[ "umlsterm" ]
l - carnitine is a CHEMICAL, cylindrospermopsin is a CHEMICAL
23501490_task0
Sentence: The protective role of l-carnitine against cylindrospermopsin-induced oxidative stress in tilapia (Oreochromis niloticus). Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL
[ "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The protective role of l-carnitine against cylindrospermopsin-induced oxidative stress in tilapia (Oreochromis niloticus).
[ "The", "protective", "role", "of", "l", "-", "carnitine", "against", "cylindrospermopsin", "-", "induced", "oxidative", "stress", "in", "tilapia", "(", "Oreochromis", "niloticus", ")", "." ]
[ "GENE-Y", "CHEMICAL", "GENE-N" ]
l - carnitine is a CHEMICAL, cylindrospermopsin is a CHEMICAL
23501490_task1
Sentence: The protective role of l-carnitine against cylindrospermopsin-induced oxidative stress in tilapia (Oreochromis niloticus). Instructions: please typing these entity words according to sentence: l - carnitine, cylindrospermopsin Options: CHEMICAL
[ "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The protective role of l-carnitine against cylindrospermopsin-induced oxidative stress in tilapia (Oreochromis niloticus).
[ "The", "protective", "role", "of", "l", "-", "carnitine", "against", "cylindrospermopsin", "-", "induced", "oxidative", "stress", "in", "tilapia", "(", "Oreochromis", "niloticus", ")", "." ]
[ "GENE-Y", "CHEMICAL", "GENE-N" ]
l - carnitine, cylindrospermopsin
23501490_task2
Sentence: The protective role of l-carnitine against cylindrospermopsin-induced oxidative stress in tilapia (Oreochromis niloticus). Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The protective role of l-carnitine against cylindrospermopsin-induced oxidative stress in tilapia (Oreochromis niloticus).
[ "The", "protective", "role", "of", "l", "-", "carnitine", "against", "cylindrospermopsin", "-", "induced", "oxidative", "stress", "in", "tilapia", "(", "Oreochromis", "niloticus", ")", "." ]
[ "GENE-Y", "CHEMICAL", "GENE-N" ]
Pedro is a NOMBRE_SUJETO_ASISTENCIA, Chavero Garcia is a NOMBRE_SUJETO_ASISTENCIA, 33254784 is a ID_SUJETO_ASISTENCIA, 99 00154744 02 is a ID_ASEGURAMIENTO, Avenida príncipe de asturias 62 , 4 der is a CALLE, Murcia is a TERRITORIO, España is a PAIS, 50 años is a EDAD_SUJETO_ASISTENCIA, 19/08/2010 is a FECHAS, Ramón Baños Madrid is a NOMBRE_PERSONAL_SANITARIO, 30 30 45714 is a ID_TITULACION_PERSONAL_SANITARIO, Varón is a SEXO_SUJETO_ASISTENCIA, 50 años is a EDAD_SUJETO_ASISTENCIA, 25 años is a EDAD_SUJETO_ASISTENCIA, Ramón Baños Madrid is a NOMBRE_PERSONAL_SANITARIO, Av . Alameda de San Antón,38 - 1º B is a CALLE, 30205 is a TERRITORIO, Cartagena is a TERRITORIO, Murcia is a TERRITORIO, rbmadrid71@yahoo.es is a CORREO_ELECTRONICO
167_task0
Sentence: Nombre: Pedro . Apellidos:Chavero Garcia. NHC: 33254784. NASS: 99 00154744 02. Domicilio: Avenida príncipe de asturias 62, 4 der.. Localidad/ Provincia: Murcia. CP:30205. Datos asistenciales. Fecha de nacimiento:08/05/1960. País: España. Edad: 50 años Sexo: H. Fecha de Ingreso: 19/08/2010. Médico: Ramón Baños Madrid NºCol: 30 30 45714. Motivo de ingreso: Varón de 50 años, consulta por epigastralgia, melenas y astenia desde hacía quince días. No refería disfagia, pirosis ni alteración del hábito intestinal. Antecedentes: hipertensión arterial en tratamiento y apendicectomía a los 25 años Exploración física: La exploración física fue normal, no se palpaban masas ni visceromegalias en abdomen, ni existían signos de desnutrición. Resumen de pruebas complementarias: En la analítica destacaba la presencia de anemia microcítica hipocroma con Hgb de 10 gr/dl y Hto del 33%. Las radiografías de tórax y abdomen no mostraron alteraciones de interés. En la endoscopia digestiva alta se apreció un esófago normal, una cavidad gástrica sin restos hemáticos con una mucosa normal y erosiones sobre una mucosa edematosa en bulbo duodenal, se realizó toma de biopsias en antro y cuerpo informándose las biopsias como gastritis crónica sin actividad no detectándose helicobacter pylori. En la ecografía abdominal el hígado, la vesícula biliar y el páncreas eran de características normales. Evolución y comentarios: on el diagnóstico de hemorragia digestiva alta por duodenitis erosiva y anemia secundaria a perdidas digestivas es dado de alta para control ambulatorio con tratamiento con antisecretores. El paciente reingresa a las tres semanas por nuevo episodio de melenas, se realiza una nueva endoscopia digestiva alta apreciando un esófago, mucosa de cavidad gástrica y bulbo duodenal normal, con restos hemáticos aislados a nivel de la segunda porción de duodeno, por lo que se decide la realización de enteroscopia de pulsión apreciando en yeyuno proximal una tumoración, friable y ulcerada que estenosa parcialmente la luz de yeyuno y no permite el paso del endoscopio, pero si la toma de múltiples biopsias en los bordes del tumor. Se procedió a la realización de un tránsito intestinal en el que se evidenció en yeyuno proximal una estenosis corta, que permitía el paso del contraste. Se completa el estudio de extensión realizando un TAC abdominal en el que se puso de manifiesto la presencia de una masa en yeyuno proximal sin objetivarse adenopatías locoregionales ni retroperitoneales de tamaño significativo, no se observaron lesiones focales hepáticas sugerentes de metástasis, ni otras alteraciones radiológicas valorables. Con el diagnóstico de leiomiosarcoma de bajo grado de intestino delgado y tras descartar extensión tumoral a distancia o invasión local en los estudios de imagen, se decide tratamiento quirúrgico con resección del tumor y posterior anastomosis duodeno-yeyunal. La evolución de la paciente fue satisfactoria no precisando tratamiento coadyuvante. Remitido por: DR: Ramón Baños Madrid. Av. Alameda de San Antón,38-1º B 30205 Cartagena. Murcia. Correo electrónico: rbmadrid71@yahoo.es Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: TERRITORIO, SEXO_SUJETO_ASISTENCIA, ID_SUJETO_ASISTENCIA, FECHAS, CALLE, CORREO_ELECTRONICO, PAIS, EDAD_SUJETO_ASISTENCIA, ID_ASEGURAMIENTO, ID_TITULACION_PERSONAL_SANITARIO, NOMBRE_SUJETO_ASISTENCIA, NOMBRE_PERSONAL_SANITARIO
[ "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "I-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "O", "O", "O", "O", "B-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "O", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-PAIS", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "B-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "B-SEXO_SUJETO_ASISTENCIA", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "B-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "B-TERRITORIO", "B-TERRITORIO", "O", "B-TERRITORIO", "O", "O", "O", "O", "B-CORREO_ELECTRONICO", "O" ]
Nombre: Pedro . Apellidos:Chavero Garcia. NHC: 33254784. NASS: 99 00154744 02. Domicilio: Avenida príncipe de asturias 62, 4 der.. Localidad/ Provincia: Murcia. CP:30205. Datos asistenciales. Fecha de nacimiento:08/05/1960. País: España. Edad: 50 años Sexo: H. Fecha de Ingreso: 19/08/2010. Médico: Ramón Baños Madrid NºCol: 30 30 45714. Motivo de ingreso: Varón de 50 años, consulta por epigastralgia, melenas y astenia desde hacía quince días. No refería disfagia, pirosis ni alteración del hábito intestinal. Antecedentes: hipertensión arterial en tratamiento y apendicectomía a los 25 años Exploración física: La exploración física fue normal, no se palpaban masas ni visceromegalias en abdomen, ni existían signos de desnutrición. Resumen de pruebas complementarias: En la analítica destacaba la presencia de anemia microcítica hipocroma con Hgb de 10 gr/dl y Hto del 33%. Las radiografías de tórax y abdomen no mostraron alteraciones de interés. En la endoscopia digestiva alta se apreció un esófago normal, una cavidad gástrica sin restos hemáticos con una mucosa normal y erosiones sobre una mucosa edematosa en bulbo duodenal, se realizó toma de biopsias en antro y cuerpo informándose las biopsias como gastritis crónica sin actividad no detectándose helicobacter pylori. En la ecografía abdominal el hígado, la vesícula biliar y el páncreas eran de características normales. Evolución y comentarios: on el diagnóstico de hemorragia digestiva alta por duodenitis erosiva y anemia secundaria a perdidas digestivas es dado de alta para control ambulatorio con tratamiento con antisecretores. El paciente reingresa a las tres semanas por nuevo episodio de melenas, se realiza una nueva endoscopia digestiva alta apreciando un esófago, mucosa de cavidad gástrica y bulbo duodenal normal, con restos hemáticos aislados a nivel de la segunda porción de duodeno, por lo que se decide la realización de enteroscopia de pulsión apreciando en yeyuno proximal una tumoración, friable y ulcerada que estenosa parcialmente la luz de yeyuno y no permite el paso del endoscopio, pero si la toma de múltiples biopsias en los bordes del tumor. Se procedió a la realización de un tránsito intestinal en el que se evidenció en yeyuno proximal una estenosis corta, que permitía el paso del contraste. Se completa el estudio de extensión realizando un TAC abdominal en el que se puso de manifiesto la presencia de una masa en yeyuno proximal sin objetivarse adenopatías locoregionales ni retroperitoneales de tamaño significativo, no se observaron lesiones focales hepáticas sugerentes de metástasis, ni otras alteraciones radiológicas valorables. Con el diagnóstico de leiomiosarcoma de bajo grado de intestino delgado y tras descartar extensión tumoral a distancia o invasión local en los estudios de imagen, se decide tratamiento quirúrgico con resección del tumor y posterior anastomosis duodeno-yeyunal. La evolución de la paciente fue satisfactoria no precisando tratamiento coadyuvante. Remitido por: DR: Ramón Baños Madrid. Av. Alameda de San Antón,38-1º B 30205 Cartagena. Murcia. Correo electrónico: rbmadrid71@yahoo.es
[ "Nombre", ":", "Pedro", ".", "\n", "Apellidos", ":", "Chavero", "Garcia", ".", "\n", "NHC", ":", "33254784", ".", "\n", "NASS", ":", "99", "00154744", "02", ".", "\n", "Domicilio", ":", "Avenida", "príncipe", "de", "asturias", "62", ",", "4", "der", "..", "\n", "Localidad/", "Provincia", ":", "Murcia", ".", "\n", "CP:30205", ".", "\n", "Datos", "asistenciales", ".", "\n", "Fecha", "de", "nacimiento:08/05/1960", ".", "\n", "País", ":", "España", ".", "\n", "Edad", ":", "50", "años", "Sexo", ":", "H.", "\n", "Fecha", "de", "Ingreso", ":", "19/08/2010", ".", "\n", "Médico", ":", "Ramón", "Baños", "Madrid", "NºCol", ":", "30", "30", "45714", ".", "\n", "Motivo", "de", "ingreso", ":", "Varón", "de", "50", "años", ",", "consulta", "por", "epigastralgia", ",", "melenas", "y", "astenia", "desde", "hacía", "quince", "días", ".", "No", "refería", "disfagia", ",", "pirosis", "ni", "alteración", "del", "hábito", "intestinal", ".", "\n", "Antecedentes", ":", "hipertensión", "arterial", "en", "tratamiento", "y", "apendicectomía", "a", "los", "25", "años", "\n", "Exploración", "física", ":", "La", "exploración", "física", "fue", "normal", ",", "no", "se", "palpaban", "masas", "ni", "visceromegalias", "en", "abdomen", ",", "ni", "existían", "signos", "de", "desnutrición", ".", "\n", "Resumen", "de", "pruebas", "complementarias", ":", "En", "la", "analítica", "destacaba", "la", "presencia", "de", "anemia", "microcítica", "hipocroma", "con", "Hgb", "de", "10", "gr", "/", "dl", "y", "Hto", "del", "33", "%", ".", "Las", "radiografías", "de", "tórax", "y", "abdomen", "no", "mostraron", "alteraciones", "de", "interés", ".", "En", "la", "endoscopia", "digestiva", "alta", "se", "apreció", "un", "esófago", "normal", ",", "una", "cavidad", "gástrica", "sin", "restos", "hemáticos", "con", "una", "mucosa", "normal", "y", "erosiones", "sobre", "una", "mucosa", "edematosa", "en", "bulbo", "duodenal", ",", "se", "realizó", "toma", "de", "biopsias", "en", "antro", "y", "cuerpo", "informándose", "las", "biopsias", "como", "gastritis", "crónica", "sin", "actividad", "no", "detectándose", "helicobacter", "pylori", ".", "En", "la", "ecografía", "abdominal", "el", "hígado", ",", "la", "vesícula", "biliar", "y", "el", "páncreas", "eran", "de", "características", "normales", ".", "\n", "Evolución", "y", "comentarios", ":", "on", "el", "diagnóstico", "de", "hemorragia", "digestiva", "alta", "por", "duodenitis", "erosiva", "y", "anemia", "secundaria", "a", "perdidas", "digestivas", "es", "dado", "de", "alta", "para", "control", "ambulatorio", "con", "tratamiento", "con", "antisecretores", ".", "El", "paciente", "reingresa", "a", "las", "tres", "semanas", "por", "nuevo", "episodio", "de", "melenas", ",", "se", "realiza", "una", "nueva", "endoscopia", "digestiva", "alta", "apreciando", "un", "esófago", ",", "mucosa", "de", "cavidad", "gástrica", "y", "bulbo", "duodenal", "normal", ",", "con", "restos", "hemáticos", "aislados", "a", "nivel", "de", "la", "segunda", "porción", "de", "duodeno", ",", "por", "lo", "que", "se", "decide", "la", "realización", "de", "enteroscopia", "de", "pulsión", "apreciando", "en", "yeyuno", "proximal", "una", "tumoración", ",", "friable", "y", "ulcerada", "que", "estenosa", "parcialmente", "la", "luz", "de", "yeyuno", "y", "no", "permite", "el", "paso", "del", "endoscopio", ",", "pero", "si", "la", "toma", "de", "múltiples", "biopsias", "en", "los", "bordes", "del", "tumor", ".", "Se", "procedió", "a", "la", "realización", "de", "un", "tránsito", "intestinal", "en", "el", "que", "se", "evidenció", "en", "yeyuno", "proximal", "una", "estenosis", "corta", ",", "que", "permitía", "el", "paso", "del", "contraste", ".", "\n", "Se", "completa", "el", "estudio", "de", "extensión", "realizando", "un", "TAC", "abdominal", "en", "el", "que", "se", "puso", "de", "manifiesto", "la", "presencia", "de", "una", "masa", "en", "yeyuno", "proximal", "sin", "objetivarse", "adenopatías", "locoregionales", "ni", "retroperitoneales", "de", "tamaño", "significativo", ",", "no", "se", "observaron", "lesiones", "focales", "hepáticas", "sugerentes", "de", "metástasis", ",", "ni", "otras", "alteraciones", "radiológicas", "valorables", ".", "Con", "el", "diagnóstico", "de", "leiomiosarcoma", "de", "bajo", "grado", "de", "intestino", "delgado", "y", "tras", "descartar", "extensión", "tumoral", "a", "distancia", "o", "invasión", "local", "en", "los", "estudios", "de", "imagen", ",", "se", "decide", "tratamiento", "quirúrgico", "con", "resección", "del", "tumor", "y", "posterior", "anastomosis", "duodeno", "-", "yeyunal", ".", "\n", "La", "evolución", "de", "la", "paciente", "fue", "satisfactoria", "no", "precisando", "tratamiento", "coadyuvante", ".", "\n", "Remitido", "por", ":", "DR", ":", "Ramón", "Baños", "Madrid", ".", "Av", ".", "Alameda", "de", "San", "Antón,38", "-", "1º", "B", "30205", "Cartagena", ".", "Murcia", ".", "Correo", "electrónico", ":", "rbmadrid71@yahoo.es", "\n" ]
[ "CALLE", "CORREO_ELECTRONICO", "NOMBRE_PERSONAL_SANITARIO", "ID_ASEGURAMIENTO", "NOMBRE_SUJETO_ASISTENCIA", "ID_TITULACION_PERSONAL_SANITARIO", "FECHAS", "TERRITORIO", "ID_SUJETO_ASISTENCIA", "EDAD_SUJETO_ASISTENCIA", "PAIS", "SEXO_SUJETO_ASISTENCIA" ]
Pedro is a NOMBRE_SUJETO_ASISTENCIA, Chavero Garcia is a NOMBRE_SUJETO_ASISTENCIA, 33254784 is a ID_SUJETO_ASISTENCIA, 99 00154744 02 is a ID_ASEGURAMIENTO, Avenida príncipe de asturias 62 , 4 der is a CALLE, Murcia is a TERRITORIO, España is a PAIS, 50 años is a EDAD_SUJETO_ASISTENCIA, 19/08/2010 is a FECHAS, Ramón Baños Madrid is a NOMBRE_PERSONAL_SANITARIO, 30 30 45714 is a ID_TITULACION_PERSONAL_SANITARIO, Varón is a SEXO_SUJETO_ASISTENCIA, 50 años is a EDAD_SUJETO_ASISTENCIA, 25 años is a EDAD_SUJETO_ASISTENCIA, Ramón Baños Madrid is a NOMBRE_PERSONAL_SANITARIO, Av . Alameda de San Antón,38 - 1º B is a CALLE, 30205 is a TERRITORIO, Cartagena is a TERRITORIO, Murcia is a TERRITORIO, rbmadrid71@yahoo.es is a CORREO_ELECTRONICO
167_task1
Sentence: Nombre: Pedro . Apellidos:Chavero Garcia. NHC: 33254784. NASS: 99 00154744 02. Domicilio: Avenida príncipe de asturias 62, 4 der.. Localidad/ Provincia: Murcia. CP:30205. Datos asistenciales. Fecha de nacimiento:08/05/1960. País: España. Edad: 50 años Sexo: H. Fecha de Ingreso: 19/08/2010. Médico: Ramón Baños Madrid NºCol: 30 30 45714. Motivo de ingreso: Varón de 50 años, consulta por epigastralgia, melenas y astenia desde hacía quince días. No refería disfagia, pirosis ni alteración del hábito intestinal. Antecedentes: hipertensión arterial en tratamiento y apendicectomía a los 25 años Exploración física: La exploración física fue normal, no se palpaban masas ni visceromegalias en abdomen, ni existían signos de desnutrición. Resumen de pruebas complementarias: En la analítica destacaba la presencia de anemia microcítica hipocroma con Hgb de 10 gr/dl y Hto del 33%. Las radiografías de tórax y abdomen no mostraron alteraciones de interés. En la endoscopia digestiva alta se apreció un esófago normal, una cavidad gástrica sin restos hemáticos con una mucosa normal y erosiones sobre una mucosa edematosa en bulbo duodenal, se realizó toma de biopsias en antro y cuerpo informándose las biopsias como gastritis crónica sin actividad no detectándose helicobacter pylori. En la ecografía abdominal el hígado, la vesícula biliar y el páncreas eran de características normales. Evolución y comentarios: on el diagnóstico de hemorragia digestiva alta por duodenitis erosiva y anemia secundaria a perdidas digestivas es dado de alta para control ambulatorio con tratamiento con antisecretores. El paciente reingresa a las tres semanas por nuevo episodio de melenas, se realiza una nueva endoscopia digestiva alta apreciando un esófago, mucosa de cavidad gástrica y bulbo duodenal normal, con restos hemáticos aislados a nivel de la segunda porción de duodeno, por lo que se decide la realización de enteroscopia de pulsión apreciando en yeyuno proximal una tumoración, friable y ulcerada que estenosa parcialmente la luz de yeyuno y no permite el paso del endoscopio, pero si la toma de múltiples biopsias en los bordes del tumor. Se procedió a la realización de un tránsito intestinal en el que se evidenció en yeyuno proximal una estenosis corta, que permitía el paso del contraste. Se completa el estudio de extensión realizando un TAC abdominal en el que se puso de manifiesto la presencia de una masa en yeyuno proximal sin objetivarse adenopatías locoregionales ni retroperitoneales de tamaño significativo, no se observaron lesiones focales hepáticas sugerentes de metástasis, ni otras alteraciones radiológicas valorables. Con el diagnóstico de leiomiosarcoma de bajo grado de intestino delgado y tras descartar extensión tumoral a distancia o invasión local en los estudios de imagen, se decide tratamiento quirúrgico con resección del tumor y posterior anastomosis duodeno-yeyunal. La evolución de la paciente fue satisfactoria no precisando tratamiento coadyuvante. Remitido por: DR: Ramón Baños Madrid. Av. Alameda de San Antón,38-1º B 30205 Cartagena. Murcia. Correo electrónico: rbmadrid71@yahoo.es Instructions: please typing these entity words according to sentence: Pedro, Chavero Garcia, 33254784, 99 00154744 02, Avenida príncipe de asturias 62 , 4 der, Murcia, España, 50 años, 19/08/2010, Ramón Baños Madrid, 30 30 45714, Varón, 50 años, 25 años, Ramón Baños Madrid, Av . Alameda de San Antón,38 - 1º B, 30205, Cartagena, Murcia, rbmadrid71@yahoo.es Options: TERRITORIO, SEXO_SUJETO_ASISTENCIA, ID_SUJETO_ASISTENCIA, FECHAS, CALLE, CORREO_ELECTRONICO, PAIS, EDAD_SUJETO_ASISTENCIA, ID_ASEGURAMIENTO, ID_TITULACION_PERSONAL_SANITARIO, NOMBRE_SUJETO_ASISTENCIA, NOMBRE_PERSONAL_SANITARIO
[ "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "I-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "O", "O", "O", "O", "B-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "O", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-PAIS", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "B-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "B-SEXO_SUJETO_ASISTENCIA", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "B-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "B-TERRITORIO", "B-TERRITORIO", "O", "B-TERRITORIO", "O", "O", "O", "O", "B-CORREO_ELECTRONICO", "O" ]
Nombre: Pedro . Apellidos:Chavero Garcia. NHC: 33254784. NASS: 99 00154744 02. Domicilio: Avenida príncipe de asturias 62, 4 der.. Localidad/ Provincia: Murcia. CP:30205. Datos asistenciales. Fecha de nacimiento:08/05/1960. País: España. Edad: 50 años Sexo: H. Fecha de Ingreso: 19/08/2010. Médico: Ramón Baños Madrid NºCol: 30 30 45714. Motivo de ingreso: Varón de 50 años, consulta por epigastralgia, melenas y astenia desde hacía quince días. No refería disfagia, pirosis ni alteración del hábito intestinal. Antecedentes: hipertensión arterial en tratamiento y apendicectomía a los 25 años Exploración física: La exploración física fue normal, no se palpaban masas ni visceromegalias en abdomen, ni existían signos de desnutrición. Resumen de pruebas complementarias: En la analítica destacaba la presencia de anemia microcítica hipocroma con Hgb de 10 gr/dl y Hto del 33%. Las radiografías de tórax y abdomen no mostraron alteraciones de interés. En la endoscopia digestiva alta se apreció un esófago normal, una cavidad gástrica sin restos hemáticos con una mucosa normal y erosiones sobre una mucosa edematosa en bulbo duodenal, se realizó toma de biopsias en antro y cuerpo informándose las biopsias como gastritis crónica sin actividad no detectándose helicobacter pylori. En la ecografía abdominal el hígado, la vesícula biliar y el páncreas eran de características normales. Evolución y comentarios: on el diagnóstico de hemorragia digestiva alta por duodenitis erosiva y anemia secundaria a perdidas digestivas es dado de alta para control ambulatorio con tratamiento con antisecretores. El paciente reingresa a las tres semanas por nuevo episodio de melenas, se realiza una nueva endoscopia digestiva alta apreciando un esófago, mucosa de cavidad gástrica y bulbo duodenal normal, con restos hemáticos aislados a nivel de la segunda porción de duodeno, por lo que se decide la realización de enteroscopia de pulsión apreciando en yeyuno proximal una tumoración, friable y ulcerada que estenosa parcialmente la luz de yeyuno y no permite el paso del endoscopio, pero si la toma de múltiples biopsias en los bordes del tumor. Se procedió a la realización de un tránsito intestinal en el que se evidenció en yeyuno proximal una estenosis corta, que permitía el paso del contraste. Se completa el estudio de extensión realizando un TAC abdominal en el que se puso de manifiesto la presencia de una masa en yeyuno proximal sin objetivarse adenopatías locoregionales ni retroperitoneales de tamaño significativo, no se observaron lesiones focales hepáticas sugerentes de metástasis, ni otras alteraciones radiológicas valorables. Con el diagnóstico de leiomiosarcoma de bajo grado de intestino delgado y tras descartar extensión tumoral a distancia o invasión local en los estudios de imagen, se decide tratamiento quirúrgico con resección del tumor y posterior anastomosis duodeno-yeyunal. La evolución de la paciente fue satisfactoria no precisando tratamiento coadyuvante. Remitido por: DR: Ramón Baños Madrid. Av. Alameda de San Antón,38-1º B 30205 Cartagena. Murcia. Correo electrónico: rbmadrid71@yahoo.es
[ "Nombre", ":", "Pedro", ".", "\n", "Apellidos", ":", "Chavero", "Garcia", ".", "\n", "NHC", ":", "33254784", ".", "\n", "NASS", ":", "99", "00154744", "02", ".", "\n", "Domicilio", ":", "Avenida", "príncipe", "de", "asturias", "62", ",", "4", "der", "..", "\n", "Localidad/", "Provincia", ":", "Murcia", ".", "\n", "CP:30205", ".", "\n", "Datos", "asistenciales", ".", "\n", "Fecha", "de", "nacimiento:08/05/1960", ".", "\n", "País", ":", "España", ".", "\n", "Edad", ":", "50", "años", "Sexo", ":", "H.", "\n", "Fecha", "de", "Ingreso", ":", "19/08/2010", ".", "\n", "Médico", ":", "Ramón", "Baños", "Madrid", "NºCol", ":", "30", "30", "45714", ".", "\n", "Motivo", "de", "ingreso", ":", "Varón", "de", "50", "años", ",", "consulta", "por", "epigastralgia", ",", "melenas", "y", "astenia", "desde", "hacía", "quince", "días", ".", "No", "refería", "disfagia", ",", "pirosis", "ni", "alteración", "del", "hábito", "intestinal", ".", "\n", "Antecedentes", ":", "hipertensión", "arterial", "en", "tratamiento", "y", "apendicectomía", "a", "los", "25", "años", "\n", "Exploración", "física", ":", "La", "exploración", "física", "fue", "normal", ",", "no", "se", "palpaban", "masas", "ni", "visceromegalias", "en", "abdomen", ",", "ni", "existían", "signos", "de", "desnutrición", ".", "\n", "Resumen", "de", "pruebas", "complementarias", ":", "En", "la", "analítica", "destacaba", "la", "presencia", "de", "anemia", "microcítica", "hipocroma", "con", "Hgb", "de", "10", "gr", "/", "dl", "y", "Hto", "del", "33", "%", ".", "Las", "radiografías", "de", "tórax", "y", "abdomen", "no", "mostraron", "alteraciones", "de", "interés", ".", "En", "la", "endoscopia", "digestiva", "alta", "se", "apreció", "un", "esófago", "normal", ",", "una", "cavidad", "gástrica", "sin", "restos", "hemáticos", "con", "una", "mucosa", "normal", "y", "erosiones", "sobre", "una", "mucosa", "edematosa", "en", "bulbo", "duodenal", ",", "se", "realizó", "toma", "de", "biopsias", "en", "antro", "y", "cuerpo", "informándose", "las", "biopsias", "como", "gastritis", "crónica", "sin", "actividad", "no", "detectándose", "helicobacter", "pylori", ".", "En", "la", "ecografía", "abdominal", "el", "hígado", ",", "la", "vesícula", "biliar", "y", "el", "páncreas", "eran", "de", "características", "normales", ".", "\n", "Evolución", "y", "comentarios", ":", "on", "el", "diagnóstico", "de", "hemorragia", "digestiva", "alta", "por", "duodenitis", "erosiva", "y", "anemia", "secundaria", "a", "perdidas", "digestivas", "es", "dado", "de", "alta", "para", "control", "ambulatorio", "con", "tratamiento", "con", "antisecretores", ".", "El", "paciente", "reingresa", "a", "las", "tres", "semanas", "por", "nuevo", "episodio", "de", "melenas", ",", "se", "realiza", "una", "nueva", "endoscopia", "digestiva", "alta", "apreciando", "un", "esófago", ",", "mucosa", "de", "cavidad", "gástrica", "y", "bulbo", "duodenal", "normal", ",", "con", "restos", "hemáticos", "aislados", "a", "nivel", "de", "la", "segunda", "porción", "de", "duodeno", ",", "por", "lo", "que", "se", "decide", "la", "realización", "de", "enteroscopia", "de", "pulsión", "apreciando", "en", "yeyuno", "proximal", "una", "tumoración", ",", "friable", "y", "ulcerada", "que", "estenosa", "parcialmente", "la", "luz", "de", "yeyuno", "y", "no", "permite", "el", "paso", "del", "endoscopio", ",", "pero", "si", "la", "toma", "de", "múltiples", "biopsias", "en", "los", "bordes", "del", "tumor", ".", "Se", "procedió", "a", "la", "realización", "de", "un", "tránsito", "intestinal", "en", "el", "que", "se", "evidenció", "en", "yeyuno", "proximal", "una", "estenosis", "corta", ",", "que", "permitía", "el", "paso", "del", "contraste", ".", "\n", "Se", "completa", "el", "estudio", "de", "extensión", "realizando", "un", "TAC", "abdominal", "en", "el", "que", "se", "puso", "de", "manifiesto", "la", "presencia", "de", "una", "masa", "en", "yeyuno", "proximal", "sin", "objetivarse", "adenopatías", "locoregionales", "ni", "retroperitoneales", "de", "tamaño", "significativo", ",", "no", "se", "observaron", "lesiones", "focales", "hepáticas", "sugerentes", "de", "metástasis", ",", "ni", "otras", "alteraciones", "radiológicas", "valorables", ".", "Con", "el", "diagnóstico", "de", "leiomiosarcoma", "de", "bajo", "grado", "de", "intestino", "delgado", "y", "tras", "descartar", "extensión", "tumoral", "a", "distancia", "o", "invasión", "local", "en", "los", "estudios", "de", "imagen", ",", "se", "decide", "tratamiento", "quirúrgico", "con", "resección", "del", "tumor", "y", "posterior", "anastomosis", "duodeno", "-", "yeyunal", ".", "\n", "La", "evolución", "de", "la", "paciente", "fue", "satisfactoria", "no", "precisando", "tratamiento", "coadyuvante", ".", "\n", "Remitido", "por", ":", "DR", ":", "Ramón", "Baños", "Madrid", ".", "Av", ".", "Alameda", "de", "San", "Antón,38", "-", "1º", "B", "30205", "Cartagena", ".", "Murcia", ".", "Correo", "electrónico", ":", "rbmadrid71@yahoo.es", "\n" ]
[ "CALLE", "CORREO_ELECTRONICO", "NOMBRE_PERSONAL_SANITARIO", "ID_ASEGURAMIENTO", "NOMBRE_SUJETO_ASISTENCIA", "ID_TITULACION_PERSONAL_SANITARIO", "FECHAS", "TERRITORIO", "ID_SUJETO_ASISTENCIA", "EDAD_SUJETO_ASISTENCIA", "PAIS", "SEXO_SUJETO_ASISTENCIA" ]
Pedro, Chavero Garcia, 33254784, 99 00154744 02, Avenida príncipe de asturias 62 , 4 der, Murcia, España, 50 años, 19/08/2010, Ramón Baños Madrid, 30 30 45714, Varón, 50 años, 25 años, Ramón Baños Madrid, Av . Alameda de San Antón,38 - 1º B, 30205, Cartagena, Murcia, rbmadrid71@yahoo.es
167_task2
Sentence: Nombre: Pedro . Apellidos:Chavero Garcia. NHC: 33254784. NASS: 99 00154744 02. Domicilio: Avenida príncipe de asturias 62, 4 der.. Localidad/ Provincia: Murcia. CP:30205. Datos asistenciales. Fecha de nacimiento:08/05/1960. País: España. Edad: 50 años Sexo: H. Fecha de Ingreso: 19/08/2010. Médico: Ramón Baños Madrid NºCol: 30 30 45714. Motivo de ingreso: Varón de 50 años, consulta por epigastralgia, melenas y astenia desde hacía quince días. No refería disfagia, pirosis ni alteración del hábito intestinal. Antecedentes: hipertensión arterial en tratamiento y apendicectomía a los 25 años Exploración física: La exploración física fue normal, no se palpaban masas ni visceromegalias en abdomen, ni existían signos de desnutrición. Resumen de pruebas complementarias: En la analítica destacaba la presencia de anemia microcítica hipocroma con Hgb de 10 gr/dl y Hto del 33%. Las radiografías de tórax y abdomen no mostraron alteraciones de interés. En la endoscopia digestiva alta se apreció un esófago normal, una cavidad gástrica sin restos hemáticos con una mucosa normal y erosiones sobre una mucosa edematosa en bulbo duodenal, se realizó toma de biopsias en antro y cuerpo informándose las biopsias como gastritis crónica sin actividad no detectándose helicobacter pylori. En la ecografía abdominal el hígado, la vesícula biliar y el páncreas eran de características normales. Evolución y comentarios: on el diagnóstico de hemorragia digestiva alta por duodenitis erosiva y anemia secundaria a perdidas digestivas es dado de alta para control ambulatorio con tratamiento con antisecretores. El paciente reingresa a las tres semanas por nuevo episodio de melenas, se realiza una nueva endoscopia digestiva alta apreciando un esófago, mucosa de cavidad gástrica y bulbo duodenal normal, con restos hemáticos aislados a nivel de la segunda porción de duodeno, por lo que se decide la realización de enteroscopia de pulsión apreciando en yeyuno proximal una tumoración, friable y ulcerada que estenosa parcialmente la luz de yeyuno y no permite el paso del endoscopio, pero si la toma de múltiples biopsias en los bordes del tumor. Se procedió a la realización de un tránsito intestinal en el que se evidenció en yeyuno proximal una estenosis corta, que permitía el paso del contraste. Se completa el estudio de extensión realizando un TAC abdominal en el que se puso de manifiesto la presencia de una masa en yeyuno proximal sin objetivarse adenopatías locoregionales ni retroperitoneales de tamaño significativo, no se observaron lesiones focales hepáticas sugerentes de metástasis, ni otras alteraciones radiológicas valorables. Con el diagnóstico de leiomiosarcoma de bajo grado de intestino delgado y tras descartar extensión tumoral a distancia o invasión local en los estudios de imagen, se decide tratamiento quirúrgico con resección del tumor y posterior anastomosis duodeno-yeyunal. La evolución de la paciente fue satisfactoria no precisando tratamiento coadyuvante. Remitido por: DR: Ramón Baños Madrid. Av. Alameda de San Antón,38-1º B 30205 Cartagena. Murcia. Correo electrónico: rbmadrid71@yahoo.es Instructions: please extract entity words from the input sentence
[ "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "I-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "O", "O", "O", "O", "B-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "O", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-PAIS", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "B-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "B-SEXO_SUJETO_ASISTENCIA", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "B-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "I-CALLE", "B-TERRITORIO", "B-TERRITORIO", "O", "B-TERRITORIO", "O", "O", "O", "O", "B-CORREO_ELECTRONICO", "O" ]
Nombre: Pedro . Apellidos:Chavero Garcia. NHC: 33254784. NASS: 99 00154744 02. Domicilio: Avenida príncipe de asturias 62, 4 der.. Localidad/ Provincia: Murcia. CP:30205. Datos asistenciales. Fecha de nacimiento:08/05/1960. País: España. Edad: 50 años Sexo: H. Fecha de Ingreso: 19/08/2010. Médico: Ramón Baños Madrid NºCol: 30 30 45714. Motivo de ingreso: Varón de 50 años, consulta por epigastralgia, melenas y astenia desde hacía quince días. No refería disfagia, pirosis ni alteración del hábito intestinal. Antecedentes: hipertensión arterial en tratamiento y apendicectomía a los 25 años Exploración física: La exploración física fue normal, no se palpaban masas ni visceromegalias en abdomen, ni existían signos de desnutrición. Resumen de pruebas complementarias: En la analítica destacaba la presencia de anemia microcítica hipocroma con Hgb de 10 gr/dl y Hto del 33%. Las radiografías de tórax y abdomen no mostraron alteraciones de interés. En la endoscopia digestiva alta se apreció un esófago normal, una cavidad gástrica sin restos hemáticos con una mucosa normal y erosiones sobre una mucosa edematosa en bulbo duodenal, se realizó toma de biopsias en antro y cuerpo informándose las biopsias como gastritis crónica sin actividad no detectándose helicobacter pylori. En la ecografía abdominal el hígado, la vesícula biliar y el páncreas eran de características normales. Evolución y comentarios: on el diagnóstico de hemorragia digestiva alta por duodenitis erosiva y anemia secundaria a perdidas digestivas es dado de alta para control ambulatorio con tratamiento con antisecretores. El paciente reingresa a las tres semanas por nuevo episodio de melenas, se realiza una nueva endoscopia digestiva alta apreciando un esófago, mucosa de cavidad gástrica y bulbo duodenal normal, con restos hemáticos aislados a nivel de la segunda porción de duodeno, por lo que se decide la realización de enteroscopia de pulsión apreciando en yeyuno proximal una tumoración, friable y ulcerada que estenosa parcialmente la luz de yeyuno y no permite el paso del endoscopio, pero si la toma de múltiples biopsias en los bordes del tumor. Se procedió a la realización de un tránsito intestinal en el que se evidenció en yeyuno proximal una estenosis corta, que permitía el paso del contraste. Se completa el estudio de extensión realizando un TAC abdominal en el que se puso de manifiesto la presencia de una masa en yeyuno proximal sin objetivarse adenopatías locoregionales ni retroperitoneales de tamaño significativo, no se observaron lesiones focales hepáticas sugerentes de metástasis, ni otras alteraciones radiológicas valorables. Con el diagnóstico de leiomiosarcoma de bajo grado de intestino delgado y tras descartar extensión tumoral a distancia o invasión local en los estudios de imagen, se decide tratamiento quirúrgico con resección del tumor y posterior anastomosis duodeno-yeyunal. La evolución de la paciente fue satisfactoria no precisando tratamiento coadyuvante. Remitido por: DR: Ramón Baños Madrid. Av. Alameda de San Antón,38-1º B 30205 Cartagena. Murcia. Correo electrónico: rbmadrid71@yahoo.es
[ "Nombre", ":", "Pedro", ".", "\n", "Apellidos", ":", "Chavero", "Garcia", ".", "\n", "NHC", ":", "33254784", ".", "\n", "NASS", ":", "99", "00154744", "02", ".", "\n", "Domicilio", ":", "Avenida", "príncipe", "de", "asturias", "62", ",", "4", "der", "..", "\n", "Localidad/", "Provincia", ":", "Murcia", ".", "\n", "CP:30205", ".", "\n", "Datos", "asistenciales", ".", "\n", "Fecha", "de", "nacimiento:08/05/1960", ".", "\n", "País", ":", "España", ".", "\n", "Edad", ":", "50", "años", "Sexo", ":", "H.", "\n", "Fecha", "de", "Ingreso", ":", "19/08/2010", ".", "\n", "Médico", ":", "Ramón", "Baños", "Madrid", "NºCol", ":", "30", "30", "45714", ".", "\n", "Motivo", "de", "ingreso", ":", "Varón", "de", "50", "años", ",", "consulta", "por", "epigastralgia", ",", "melenas", "y", "astenia", "desde", "hacía", "quince", "días", ".", "No", "refería", "disfagia", ",", "pirosis", "ni", "alteración", "del", "hábito", "intestinal", ".", "\n", "Antecedentes", ":", "hipertensión", "arterial", "en", "tratamiento", "y", "apendicectomía", "a", "los", "25", "años", "\n", "Exploración", "física", ":", "La", "exploración", "física", "fue", "normal", ",", "no", "se", "palpaban", "masas", "ni", "visceromegalias", "en", "abdomen", ",", "ni", "existían", "signos", "de", "desnutrición", ".", "\n", "Resumen", "de", "pruebas", "complementarias", ":", "En", "la", "analítica", "destacaba", "la", "presencia", "de", "anemia", "microcítica", "hipocroma", "con", "Hgb", "de", "10", "gr", "/", "dl", "y", "Hto", "del", "33", "%", ".", "Las", "radiografías", "de", "tórax", "y", "abdomen", "no", "mostraron", "alteraciones", "de", "interés", ".", "En", "la", "endoscopia", "digestiva", "alta", "se", "apreció", "un", "esófago", "normal", ",", "una", "cavidad", "gástrica", "sin", "restos", "hemáticos", "con", "una", "mucosa", "normal", "y", "erosiones", "sobre", "una", "mucosa", "edematosa", "en", "bulbo", "duodenal", ",", "se", "realizó", "toma", "de", "biopsias", "en", "antro", "y", "cuerpo", "informándose", "las", "biopsias", "como", "gastritis", "crónica", "sin", "actividad", "no", "detectándose", "helicobacter", "pylori", ".", "En", "la", "ecografía", "abdominal", "el", "hígado", ",", "la", "vesícula", "biliar", "y", "el", "páncreas", "eran", "de", "características", "normales", ".", "\n", "Evolución", "y", "comentarios", ":", "on", "el", "diagnóstico", "de", "hemorragia", "digestiva", "alta", "por", "duodenitis", "erosiva", "y", "anemia", "secundaria", "a", "perdidas", "digestivas", "es", "dado", "de", "alta", "para", "control", "ambulatorio", "con", "tratamiento", "con", "antisecretores", ".", "El", "paciente", "reingresa", "a", "las", "tres", "semanas", "por", "nuevo", "episodio", "de", "melenas", ",", "se", "realiza", "una", "nueva", "endoscopia", "digestiva", "alta", "apreciando", "un", "esófago", ",", "mucosa", "de", "cavidad", "gástrica", "y", "bulbo", "duodenal", "normal", ",", "con", "restos", "hemáticos", "aislados", "a", "nivel", "de", "la", "segunda", "porción", "de", "duodeno", ",", "por", "lo", "que", "se", "decide", "la", "realización", "de", "enteroscopia", "de", "pulsión", "apreciando", "en", "yeyuno", "proximal", "una", "tumoración", ",", "friable", "y", "ulcerada", "que", "estenosa", "parcialmente", "la", "luz", "de", "yeyuno", "y", "no", "permite", "el", "paso", "del", "endoscopio", ",", "pero", "si", "la", "toma", "de", "múltiples", "biopsias", "en", "los", "bordes", "del", "tumor", ".", "Se", "procedió", "a", "la", "realización", "de", "un", "tránsito", "intestinal", "en", "el", "que", "se", "evidenció", "en", "yeyuno", "proximal", "una", "estenosis", "corta", ",", "que", "permitía", "el", "paso", "del", "contraste", ".", "\n", "Se", "completa", "el", "estudio", "de", "extensión", "realizando", "un", "TAC", "abdominal", "en", "el", "que", "se", "puso", "de", "manifiesto", "la", "presencia", "de", "una", "masa", "en", "yeyuno", "proximal", "sin", "objetivarse", "adenopatías", "locoregionales", "ni", "retroperitoneales", "de", "tamaño", "significativo", ",", "no", "se", "observaron", "lesiones", "focales", "hepáticas", "sugerentes", "de", "metástasis", ",", "ni", "otras", "alteraciones", "radiológicas", "valorables", ".", "Con", "el", "diagnóstico", "de", "leiomiosarcoma", "de", "bajo", "grado", "de", "intestino", "delgado", "y", "tras", "descartar", "extensión", "tumoral", "a", "distancia", "o", "invasión", "local", "en", "los", "estudios", "de", "imagen", ",", "se", "decide", "tratamiento", "quirúrgico", "con", "resección", "del", "tumor", "y", "posterior", "anastomosis", "duodeno", "-", "yeyunal", ".", "\n", "La", "evolución", "de", "la", "paciente", "fue", "satisfactoria", "no", "precisando", "tratamiento", "coadyuvante", ".", "\n", "Remitido", "por", ":", "DR", ":", "Ramón", "Baños", "Madrid", ".", "Av", ".", "Alameda", "de", "San", "Antón,38", "-", "1º", "B", "30205", "Cartagena", ".", "Murcia", ".", "Correo", "electrónico", ":", "rbmadrid71@yahoo.es", "\n" ]
[ "CALLE", "CORREO_ELECTRONICO", "NOMBRE_PERSONAL_SANITARIO", "ID_ASEGURAMIENTO", "NOMBRE_SUJETO_ASISTENCIA", "ID_TITULACION_PERSONAL_SANITARIO", "FECHAS", "TERRITORIO", "ID_SUJETO_ASISTENCIA", "EDAD_SUJETO_ASISTENCIA", "PAIS", "SEXO_SUJETO_ASISTENCIA" ]
neuroleptic is a Outcome_Physical, response is a Outcome_Other, schizophrenic is a Participant_Condition, children is a Participant_Age, Positive and Negative Syndrome Scales is a Outcome_Physical, 19 is a Participant_Sample-size, 16 is a Participant_Sample-size, males is a Participant_Sex, 3 is a Participant_Sample-size, females is a Participant_Sex, mean age 8.9 years is a Participant_Age, 5.5 - 11.7 is a Participant_Age, placebo - controlled is a Intervention_Control, haloperidol is a Intervention_Pharmacological, Schizophrenic is a Participant_Condition, positive and negative signs and symptoms is a Outcome_Physical, neuroleptic treatment is a Outcome_Physical
82549_task0
Sentence: Scales for the assessment of neuroleptic response in schizophrenic children : specific measures derived from the CPRS . This article reports the psychometric properties of two scales for rating positive and negative schizophrenic signs and symptoms . These Positive and Negative Syndrome Scales consist of items selected from the Children 's Psychiatric Rating Scale ( CPRS ) , which contains items covering a wide range of childhood psychopathology . CPRS rating data were analyzed for 19 schizophrenic children , 16 males and 3 females , mean age 8.9 years ( range 5.5-11.7 ) , evaluated in a double-blind , placebo-controlled crossover study of haloperidol . We describe the item composition and coherence of each scale , the interrater reliabilities of clinicians using the scales , and the sensitivity of the scales for resolving treatment response . Schizophrenic children showed both positive and negative signs and symptoms , and both improved with neuroleptic treatment . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Pharmacological, Participant_Condition, Participant_Sex, Intervention_Control, Participant_Age, Outcome_Physical, Participant_Sample-size, Outcome_Other
[ "O", "O", "O", "O", "O", "B-Outcome_Physical", "B-Outcome_Other", "O", "B-Participant_Condition", "B-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "B-Participant_Sample-size", "B-Participant_Sex", "O", "B-Participant_Sample-size", "B-Participant_Sex", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O" ]
Scales for the assessment of neuroleptic response in schizophrenic children : specific measures derived from the CPRS . This article reports the psychometric properties of two scales for rating positive and negative schizophrenic signs and symptoms . These Positive and Negative Syndrome Scales consist of items selected from the Children 's Psychiatric Rating Scale ( CPRS ) , which contains items covering a wide range of childhood psychopathology . CPRS rating data were analyzed for 19 schizophrenic children , 16 males and 3 females , mean age 8.9 years ( range 5.5-11.7 ) , evaluated in a double-blind , placebo-controlled crossover study of haloperidol . We describe the item composition and coherence of each scale , the interrater reliabilities of clinicians using the scales , and the sensitivity of the scales for resolving treatment response . Schizophrenic children showed both positive and negative signs and symptoms , and both improved with neuroleptic treatment .
[ "Scales", "for", "the", "assessment", "of", "neuroleptic", "response", "in", "schizophrenic", "children", ":", "specific", "measures", "derived", "from", "the", "CPRS", ".", "This", "article", "reports", "the", "psychometric", "properties", "of", "two", "scales", "for", "rating", "positive", "and", "negative", "schizophrenic", "signs", "and", "symptoms", ".", "These", "Positive", "and", "Negative", "Syndrome", "Scales", "consist", "of", "items", "selected", "from", "the", "Children", "'", "s", "Psychiatric", "Rating", "Scale", "(", "CPRS", ")", ",", "which", "contains", "items", "covering", "a", "wide", "range", "of", "childhood", "psychopathology", ".", "CPRS", "rating", "data", "were", "analyzed", "for", "19", "schizophrenic", "children", ",", "16", "males", "and", "3", "females", ",", "mean", "age", "8.9", "years", "(", "range", "5.5", "-", "11.7", ")", ",", "evaluated", "in", "a", "double", "-", "blind", ",", "placebo", "-", "controlled", "crossover", "study", "of", "haloperidol", ".", "We", "describe", "the", "item", "composition", "and", "coherence", "of", "each", "scale", ",", "the", "interrater", "reliabilities", "of", "clinicians", "using", "the", "scales", ",", "and", "the", "sensitivity", "of", "the", "scales", "for", "resolving", "treatment", "response", ".", "Schizophrenic", "children", "showed", "both", "positive", "and", "negative", "signs", "and", "symptoms", ",", "and", "both", "improved", "with", "neuroleptic", "treatment", "." ]
[ "Outcome_Physical", "Intervention_Control", "Participant_Age", "Participant_Condition", "Intervention_Pharmacological", "Outcome_Other", "Participant_Sex", "Participant_Sample-size" ]
neuroleptic is a Outcome_Physical, response is a Outcome_Other, schizophrenic is a Participant_Condition, children is a Participant_Age, Positive and Negative Syndrome Scales is a Outcome_Physical, 19 is a Participant_Sample-size, 16 is a Participant_Sample-size, males is a Participant_Sex, 3 is a Participant_Sample-size, females is a Participant_Sex, mean age 8.9 years is a Participant_Age, 5.5 - 11.7 is a Participant_Age, placebo - controlled is a Intervention_Control, haloperidol is a Intervention_Pharmacological, Schizophrenic is a Participant_Condition, positive and negative signs and symptoms is a Outcome_Physical, neuroleptic treatment is a Outcome_Physical
82549_task1
Sentence: Scales for the assessment of neuroleptic response in schizophrenic children : specific measures derived from the CPRS . This article reports the psychometric properties of two scales for rating positive and negative schizophrenic signs and symptoms . These Positive and Negative Syndrome Scales consist of items selected from the Children 's Psychiatric Rating Scale ( CPRS ) , which contains items covering a wide range of childhood psychopathology . CPRS rating data were analyzed for 19 schizophrenic children , 16 males and 3 females , mean age 8.9 years ( range 5.5-11.7 ) , evaluated in a double-blind , placebo-controlled crossover study of haloperidol . We describe the item composition and coherence of each scale , the interrater reliabilities of clinicians using the scales , and the sensitivity of the scales for resolving treatment response . Schizophrenic children showed both positive and negative signs and symptoms , and both improved with neuroleptic treatment . Instructions: please typing these entity words according to sentence: neuroleptic, response, schizophrenic, children, Positive and Negative Syndrome Scales, 19, 16, males, 3, females, mean age 8.9 years, 5.5 - 11.7, placebo - controlled, haloperidol, Schizophrenic, positive and negative signs and symptoms, neuroleptic treatment Options: Intervention_Pharmacological, Participant_Condition, Participant_Sex, Intervention_Control, Participant_Age, Outcome_Physical, Participant_Sample-size, Outcome_Other
[ "O", "O", "O", "O", "O", "B-Outcome_Physical", "B-Outcome_Other", "O", "B-Participant_Condition", "B-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "B-Participant_Sample-size", "B-Participant_Sex", "O", "B-Participant_Sample-size", "B-Participant_Sex", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O" ]
Scales for the assessment of neuroleptic response in schizophrenic children : specific measures derived from the CPRS . This article reports the psychometric properties of two scales for rating positive and negative schizophrenic signs and symptoms . These Positive and Negative Syndrome Scales consist of items selected from the Children 's Psychiatric Rating Scale ( CPRS ) , which contains items covering a wide range of childhood psychopathology . CPRS rating data were analyzed for 19 schizophrenic children , 16 males and 3 females , mean age 8.9 years ( range 5.5-11.7 ) , evaluated in a double-blind , placebo-controlled crossover study of haloperidol . We describe the item composition and coherence of each scale , the interrater reliabilities of clinicians using the scales , and the sensitivity of the scales for resolving treatment response . Schizophrenic children showed both positive and negative signs and symptoms , and both improved with neuroleptic treatment .
[ "Scales", "for", "the", "assessment", "of", "neuroleptic", "response", "in", "schizophrenic", "children", ":", "specific", "measures", "derived", "from", "the", "CPRS", ".", "This", "article", "reports", "the", "psychometric", "properties", "of", "two", "scales", "for", "rating", "positive", "and", "negative", "schizophrenic", "signs", "and", "symptoms", ".", "These", "Positive", "and", "Negative", "Syndrome", "Scales", "consist", "of", "items", "selected", "from", "the", "Children", "'", "s", "Psychiatric", "Rating", "Scale", "(", "CPRS", ")", ",", "which", "contains", "items", "covering", "a", "wide", "range", "of", "childhood", "psychopathology", ".", "CPRS", "rating", "data", "were", "analyzed", "for", "19", "schizophrenic", "children", ",", "16", "males", "and", "3", "females", ",", "mean", "age", "8.9", "years", "(", "range", "5.5", "-", "11.7", ")", ",", "evaluated", "in", "a", "double", "-", "blind", ",", "placebo", "-", "controlled", "crossover", "study", "of", "haloperidol", ".", "We", "describe", "the", "item", "composition", "and", "coherence", "of", "each", "scale", ",", "the", "interrater", "reliabilities", "of", "clinicians", "using", "the", "scales", ",", "and", "the", "sensitivity", "of", "the", "scales", "for", "resolving", "treatment", "response", ".", "Schizophrenic", "children", "showed", "both", "positive", "and", "negative", "signs", "and", "symptoms", ",", "and", "both", "improved", "with", "neuroleptic", "treatment", "." ]
[ "Outcome_Physical", "Intervention_Control", "Participant_Age", "Participant_Condition", "Intervention_Pharmacological", "Outcome_Other", "Participant_Sex", "Participant_Sample-size" ]
neuroleptic, response, schizophrenic, children, Positive and Negative Syndrome Scales, 19, 16, males, 3, females, mean age 8.9 years, 5.5 - 11.7, placebo - controlled, haloperidol, Schizophrenic, positive and negative signs and symptoms, neuroleptic treatment
82549_task2
Sentence: Scales for the assessment of neuroleptic response in schizophrenic children : specific measures derived from the CPRS . This article reports the psychometric properties of two scales for rating positive and negative schizophrenic signs and symptoms . These Positive and Negative Syndrome Scales consist of items selected from the Children 's Psychiatric Rating Scale ( CPRS ) , which contains items covering a wide range of childhood psychopathology . CPRS rating data were analyzed for 19 schizophrenic children , 16 males and 3 females , mean age 8.9 years ( range 5.5-11.7 ) , evaluated in a double-blind , placebo-controlled crossover study of haloperidol . We describe the item composition and coherence of each scale , the interrater reliabilities of clinicians using the scales , and the sensitivity of the scales for resolving treatment response . Schizophrenic children showed both positive and negative signs and symptoms , and both improved with neuroleptic treatment . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "B-Outcome_Physical", "B-Outcome_Other", "O", "B-Participant_Condition", "B-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "B-Participant_Sample-size", "B-Participant_Sex", "O", "B-Participant_Sample-size", "B-Participant_Sex", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O" ]
Scales for the assessment of neuroleptic response in schizophrenic children : specific measures derived from the CPRS . This article reports the psychometric properties of two scales for rating positive and negative schizophrenic signs and symptoms . These Positive and Negative Syndrome Scales consist of items selected from the Children 's Psychiatric Rating Scale ( CPRS ) , which contains items covering a wide range of childhood psychopathology . CPRS rating data were analyzed for 19 schizophrenic children , 16 males and 3 females , mean age 8.9 years ( range 5.5-11.7 ) , evaluated in a double-blind , placebo-controlled crossover study of haloperidol . We describe the item composition and coherence of each scale , the interrater reliabilities of clinicians using the scales , and the sensitivity of the scales for resolving treatment response . Schizophrenic children showed both positive and negative signs and symptoms , and both improved with neuroleptic treatment .
[ "Scales", "for", "the", "assessment", "of", "neuroleptic", "response", "in", "schizophrenic", "children", ":", "specific", "measures", "derived", "from", "the", "CPRS", ".", "This", "article", "reports", "the", "psychometric", "properties", "of", "two", "scales", "for", "rating", "positive", "and", "negative", "schizophrenic", "signs", "and", "symptoms", ".", "These", "Positive", "and", "Negative", "Syndrome", "Scales", "consist", "of", "items", "selected", "from", "the", "Children", "'", "s", "Psychiatric", "Rating", "Scale", "(", "CPRS", ")", ",", "which", "contains", "items", "covering", "a", "wide", "range", "of", "childhood", "psychopathology", ".", "CPRS", "rating", "data", "were", "analyzed", "for", "19", "schizophrenic", "children", ",", "16", "males", "and", "3", "females", ",", "mean", "age", "8.9", "years", "(", "range", "5.5", "-", "11.7", ")", ",", "evaluated", "in", "a", "double", "-", "blind", ",", "placebo", "-", "controlled", "crossover", "study", "of", "haloperidol", ".", "We", "describe", "the", "item", "composition", "and", "coherence", "of", "each", "scale", ",", "the", "interrater", "reliabilities", "of", "clinicians", "using", "the", "scales", ",", "and", "the", "sensitivity", "of", "the", "scales", "for", "resolving", "treatment", "response", ".", "Schizophrenic", "children", "showed", "both", "positive", "and", "negative", "signs", "and", "symptoms", ",", "and", "both", "improved", "with", "neuroleptic", "treatment", "." ]
[ "Outcome_Physical", "Intervention_Control", "Participant_Age", "Participant_Condition", "Intervention_Pharmacological", "Outcome_Other", "Participant_Sex", "Participant_Sample-size" ]
histamine H1- , H2- , and H3-receptor is a GENE-N, human histamine H4 receptor is a GENE-Y, 4-methylhistamine is a CHEMICAL, H4 receptor is a GENE-Y
15947036_task0
Sentence: Evaluation of histamine H1-, H2-, and H3-receptor ligands at the human histamine H4 receptor: identification of 4-methylhistamine as the first potent and selective H4 receptor agonist. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: GENE-Y, GENE-N, CHEMICAL
[ "O", "O", "B-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "O" ]
Evaluation of histamine H1-, H2-, and H3-receptor ligands at the human histamine H4 receptor: identification of 4-methylhistamine as the first potent and selective H4 receptor agonist.
[ "Evaluation", "of", "histamine", "H1-", ",", "H2-", ",", "and", "H3-receptor", "ligands", "at", "the", "human", "histamine", "H4", "receptor", ":", "identification", "of", "4-methylhistamine", "as", "the", "first", "potent", "and", "selective", "H4", "receptor", "agonist", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
histamine H1- , H2- , and H3-receptor is a GENE-N, human histamine H4 receptor is a GENE-Y, 4-methylhistamine is a CHEMICAL, H4 receptor is a GENE-Y
15947036_task1
Sentence: Evaluation of histamine H1-, H2-, and H3-receptor ligands at the human histamine H4 receptor: identification of 4-methylhistamine as the first potent and selective H4 receptor agonist. Instructions: please typing these entity words according to sentence: histamine H1- , H2- , and H3-receptor, human histamine H4 receptor, 4-methylhistamine, H4 receptor Options: GENE-Y, GENE-N, CHEMICAL
[ "O", "O", "B-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "O" ]
Evaluation of histamine H1-, H2-, and H3-receptor ligands at the human histamine H4 receptor: identification of 4-methylhistamine as the first potent and selective H4 receptor agonist.
[ "Evaluation", "of", "histamine", "H1-", ",", "H2-", ",", "and", "H3-receptor", "ligands", "at", "the", "human", "histamine", "H4", "receptor", ":", "identification", "of", "4-methylhistamine", "as", "the", "first", "potent", "and", "selective", "H4", "receptor", "agonist", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
histamine H1- , H2- , and H3-receptor, human histamine H4 receptor, 4-methylhistamine, H4 receptor
15947036_task2
Sentence: Evaluation of histamine H1-, H2-, and H3-receptor ligands at the human histamine H4 receptor: identification of 4-methylhistamine as the first potent and selective H4 receptor agonist. Instructions: please extract entity words from the input sentence
[ "O", "O", "B-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "O" ]
Evaluation of histamine H1-, H2-, and H3-receptor ligands at the human histamine H4 receptor: identification of 4-methylhistamine as the first potent and selective H4 receptor agonist.
[ "Evaluation", "of", "histamine", "H1-", ",", "H2-", ",", "and", "H3-receptor", "ligands", "at", "the", "human", "histamine", "H4", "receptor", ":", "identification", "of", "4-methylhistamine", "as", "the", "first", "potent", "and", "selective", "H4", "receptor", "agonist", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
Salmonella Paratyphi A is a Microorganism, israeli travelers is a Habitat, Salmonella Paratyphi A is a Microorganism, travelers is a Habitat, S. Paratyphi A is a Microorganism, Israeli travelers is a Habitat, patients is a Habitat, antimicrobial susceptibility is a Phenotype, Israeli travelers is a Habitat, S. Paratyphi A is a Microorganism, nalidixic acid resistant is a Phenotype, food venue is a Habitat, patients is a Habitat, patients treated with ceftriaxone and azithromycin combination is a Habitat, cases treated with ceftriaxone monotherapy is a Habitat, Israeli travelers is a Habitat
38_task0
Sentence: A large outbreak of Salmonella Paratyphi A infection among israeli travelers to Nepal. In Asia, Salmonella Paratyphi A is an emerging infection, and travelers are increasingly at risk. During October 2009-November 2009, an outbreak in S. Paratyphi A infection was noted in Israeli travelers returning from Nepal. An outbreak investigation included a standardized exposure questionnaire admitted to all patients and medical chart abstraction. Isolates were tested for antimicrobial susceptibility and pulsed-field gel electrophoresis (PFGE). During 1 October 2009-30 November 2009, 37 Israeli travelers returning from Nepal were diagnosed with S. Paratyphi A bacteremia. All 37 case isolates had an identical pattern on PFGE, and all were nalidixic acid resistant. Only 1 food venue was frequented by all the outbreak cases, with the largest number of exposures occurring around the Jewish New Year. All patients recovered without complications. Time to defervescence in 17 patients treated with ceftriaxone and azithromycin combination was 3.2 days (± 1.7), whereas in 13 cases treated with ceftriaxone monotherapy, the time to defervescence was 6.6 days (± 1.8; P < .001). A point-source, "Paratyphoid Mary"-like outbreak was identified among Israeli travelers to Nepal. Combination Ceftriaxone-Azithromycin therapy may provide a therapeutic advantage over monotherapy, and merits further clinical trials. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Microorganism, Phenotype, Habitat
[ "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Phenotype", "I-Phenotype", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Phenotype", "I-Phenotype", "I-Phenotype", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
A large outbreak of Salmonella Paratyphi A infection among israeli travelers to Nepal. In Asia, Salmonella Paratyphi A is an emerging infection, and travelers are increasingly at risk. During October 2009-November 2009, an outbreak in S. Paratyphi A infection was noted in Israeli travelers returning from Nepal. An outbreak investigation included a standardized exposure questionnaire admitted to all patients and medical chart abstraction. Isolates were tested for antimicrobial susceptibility and pulsed-field gel electrophoresis (PFGE). During 1 October 2009-30 November 2009, 37 Israeli travelers returning from Nepal were diagnosed with S. Paratyphi A bacteremia. All 37 case isolates had an identical pattern on PFGE, and all were nalidixic acid resistant. Only 1 food venue was frequented by all the outbreak cases, with the largest number of exposures occurring around the Jewish New Year. All patients recovered without complications. Time to defervescence in 17 patients treated with ceftriaxone and azithromycin combination was 3.2 days (± 1.7), whereas in 13 cases treated with ceftriaxone monotherapy, the time to defervescence was 6.6 days (± 1.8; P < .001). A point-source, "Paratyphoid Mary"-like outbreak was identified among Israeli travelers to Nepal. Combination Ceftriaxone-Azithromycin therapy may provide a therapeutic advantage over monotherapy, and merits further clinical trials.
[ "A", "large", "outbreak", "of", "Salmonella", "Paratyphi", "A", "infection", "among", "israeli", "travelers", "to", "Nepal", ".", "In", "Asia", ",", "Salmonella", "Paratyphi", "A", "is", "an", "emerging", "infection", ",", "and", "travelers", "are", "increasingly", "at", "risk", ".", "During", "October", "2009-November", "2009", ",", "an", "outbreak", "in", "S.", "Paratyphi", "A", "infection", "was", "noted", "in", "Israeli", "travelers", "returning", "from", "Nepal", ".", "An", "outbreak", "investigation", "included", "a", "standardized", "exposure", "questionnaire", "admitted", "to", "all", "patients", "and", "medical", "chart", "abstraction", ".", "Isolates", "were", "tested", "for", "antimicrobial", "susceptibility", "and", "pulsed", "-", "field", "gel", "electrophoresis", "(", "PFGE", ")", ".", "During", "1", "October", "2009", "-", "30", "November", "2009", ",", "37", "Israeli", "travelers", "returning", "from", "Nepal", "were", "diagnosed", "with", "S.", "Paratyphi", "A", "bacteremia", ".", "All", "37", "case", "isolates", "had", "an", "identical", "pattern", "on", "PFGE", ",", "and", "all", "were", "nalidixic", "acid", "resistant", ".", "Only", "1", "food", "venue", "was", "frequented", "by", "all", "the", "outbreak", "cases", ",", "with", "the", "largest", "number", "of", "exposures", "occurring", "around", "the", "Jewish", "New", "Year", ".", "All", "patients", "recovered", "without", "complications", ".", "Time", "to", "defervescence", "in", "17", "patients", "treated", "with", "ceftriaxone", "and", "azithromycin", "combination", "was", "3.2", "days", "(", "±", "1.7", ")", ",", "whereas", "in", "13", "cases", "treated", "with", "ceftriaxone", "monotherapy", ",", "the", "time", "to", "defervescence", "was", "6.6", "days", "(", "±", "1.8", ";", "P", "<", ".001", ")", ".", "A", "point", "-", "source", ",", "\"", "Paratyphoid", "Mary\"-like", "outbreak", "was", "identified", "among", "Israeli", "travelers", "to", "Nepal", ".", "Combination", "Ceftriaxone", "-", "Azithromycin", "therapy", "may", "provide", "a", "therapeutic", "advantage", "over", "monotherapy", ",", "and", "merits", "further", "clinical", "trials", ".", " " ]
[ "Habitat", "Phenotype", "Microorganism" ]
Salmonella Paratyphi A is a Microorganism, israeli travelers is a Habitat, Salmonella Paratyphi A is a Microorganism, travelers is a Habitat, S. Paratyphi A is a Microorganism, Israeli travelers is a Habitat, patients is a Habitat, antimicrobial susceptibility is a Phenotype, Israeli travelers is a Habitat, S. Paratyphi A is a Microorganism, nalidixic acid resistant is a Phenotype, food venue is a Habitat, patients is a Habitat, patients treated with ceftriaxone and azithromycin combination is a Habitat, cases treated with ceftriaxone monotherapy is a Habitat, Israeli travelers is a Habitat
38_task1
Sentence: A large outbreak of Salmonella Paratyphi A infection among israeli travelers to Nepal. In Asia, Salmonella Paratyphi A is an emerging infection, and travelers are increasingly at risk. During October 2009-November 2009, an outbreak in S. Paratyphi A infection was noted in Israeli travelers returning from Nepal. An outbreak investigation included a standardized exposure questionnaire admitted to all patients and medical chart abstraction. Isolates were tested for antimicrobial susceptibility and pulsed-field gel electrophoresis (PFGE). During 1 October 2009-30 November 2009, 37 Israeli travelers returning from Nepal were diagnosed with S. Paratyphi A bacteremia. All 37 case isolates had an identical pattern on PFGE, and all were nalidixic acid resistant. Only 1 food venue was frequented by all the outbreak cases, with the largest number of exposures occurring around the Jewish New Year. All patients recovered without complications. Time to defervescence in 17 patients treated with ceftriaxone and azithromycin combination was 3.2 days (± 1.7), whereas in 13 cases treated with ceftriaxone monotherapy, the time to defervescence was 6.6 days (± 1.8; P < .001). A point-source, "Paratyphoid Mary"-like outbreak was identified among Israeli travelers to Nepal. Combination Ceftriaxone-Azithromycin therapy may provide a therapeutic advantage over monotherapy, and merits further clinical trials. Instructions: please typing these entity words according to sentence: Salmonella Paratyphi A, israeli travelers, Salmonella Paratyphi A, travelers, S. Paratyphi A, Israeli travelers, patients, antimicrobial susceptibility, Israeli travelers, S. Paratyphi A, nalidixic acid resistant, food venue, patients, patients treated with ceftriaxone and azithromycin combination, cases treated with ceftriaxone monotherapy, Israeli travelers Options: Microorganism, Phenotype, Habitat
[ "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Phenotype", "I-Phenotype", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Phenotype", "I-Phenotype", "I-Phenotype", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
A large outbreak of Salmonella Paratyphi A infection among israeli travelers to Nepal. In Asia, Salmonella Paratyphi A is an emerging infection, and travelers are increasingly at risk. During October 2009-November 2009, an outbreak in S. Paratyphi A infection was noted in Israeli travelers returning from Nepal. An outbreak investigation included a standardized exposure questionnaire admitted to all patients and medical chart abstraction. Isolates were tested for antimicrobial susceptibility and pulsed-field gel electrophoresis (PFGE). During 1 October 2009-30 November 2009, 37 Israeli travelers returning from Nepal were diagnosed with S. Paratyphi A bacteremia. All 37 case isolates had an identical pattern on PFGE, and all were nalidixic acid resistant. Only 1 food venue was frequented by all the outbreak cases, with the largest number of exposures occurring around the Jewish New Year. All patients recovered without complications. Time to defervescence in 17 patients treated with ceftriaxone and azithromycin combination was 3.2 days (± 1.7), whereas in 13 cases treated with ceftriaxone monotherapy, the time to defervescence was 6.6 days (± 1.8; P < .001). A point-source, "Paratyphoid Mary"-like outbreak was identified among Israeli travelers to Nepal. Combination Ceftriaxone-Azithromycin therapy may provide a therapeutic advantage over monotherapy, and merits further clinical trials.
[ "A", "large", "outbreak", "of", "Salmonella", "Paratyphi", "A", "infection", "among", "israeli", "travelers", "to", "Nepal", ".", "In", "Asia", ",", "Salmonella", "Paratyphi", "A", "is", "an", "emerging", "infection", ",", "and", "travelers", "are", "increasingly", "at", "risk", ".", "During", "October", "2009-November", "2009", ",", "an", "outbreak", "in", "S.", "Paratyphi", "A", "infection", "was", "noted", "in", "Israeli", "travelers", "returning", "from", "Nepal", ".", "An", "outbreak", "investigation", "included", "a", "standardized", "exposure", "questionnaire", "admitted", "to", "all", "patients", "and", "medical", "chart", "abstraction", ".", "Isolates", "were", "tested", "for", "antimicrobial", "susceptibility", "and", "pulsed", "-", "field", "gel", "electrophoresis", "(", "PFGE", ")", ".", "During", "1", "October", "2009", "-", "30", "November", "2009", ",", "37", "Israeli", "travelers", "returning", "from", "Nepal", "were", "diagnosed", "with", "S.", "Paratyphi", "A", "bacteremia", ".", "All", "37", "case", "isolates", "had", "an", "identical", "pattern", "on", "PFGE", ",", "and", "all", "were", "nalidixic", "acid", "resistant", ".", "Only", "1", "food", "venue", "was", "frequented", "by", "all", "the", "outbreak", "cases", ",", "with", "the", "largest", "number", "of", "exposures", "occurring", "around", "the", "Jewish", "New", "Year", ".", "All", "patients", "recovered", "without", "complications", ".", "Time", "to", "defervescence", "in", "17", "patients", "treated", "with", "ceftriaxone", "and", "azithromycin", "combination", "was", "3.2", "days", "(", "±", "1.7", ")", ",", "whereas", "in", "13", "cases", "treated", "with", "ceftriaxone", "monotherapy", ",", "the", "time", "to", "defervescence", "was", "6.6", "days", "(", "±", "1.8", ";", "P", "<", ".001", ")", ".", "A", "point", "-", "source", ",", "\"", "Paratyphoid", "Mary\"-like", "outbreak", "was", "identified", "among", "Israeli", "travelers", "to", "Nepal", ".", "Combination", "Ceftriaxone", "-", "Azithromycin", "therapy", "may", "provide", "a", "therapeutic", "advantage", "over", "monotherapy", ",", "and", "merits", "further", "clinical", "trials", ".", " " ]
[ "Habitat", "Phenotype", "Microorganism" ]
Salmonella Paratyphi A, israeli travelers, Salmonella Paratyphi A, travelers, S. Paratyphi A, Israeli travelers, patients, antimicrobial susceptibility, Israeli travelers, S. Paratyphi A, nalidixic acid resistant, food venue, patients, patients treated with ceftriaxone and azithromycin combination, cases treated with ceftriaxone monotherapy, Israeli travelers
38_task2
Sentence: A large outbreak of Salmonella Paratyphi A infection among israeli travelers to Nepal. In Asia, Salmonella Paratyphi A is an emerging infection, and travelers are increasingly at risk. During October 2009-November 2009, an outbreak in S. Paratyphi A infection was noted in Israeli travelers returning from Nepal. An outbreak investigation included a standardized exposure questionnaire admitted to all patients and medical chart abstraction. Isolates were tested for antimicrobial susceptibility and pulsed-field gel electrophoresis (PFGE). During 1 October 2009-30 November 2009, 37 Israeli travelers returning from Nepal were diagnosed with S. Paratyphi A bacteremia. All 37 case isolates had an identical pattern on PFGE, and all were nalidixic acid resistant. Only 1 food venue was frequented by all the outbreak cases, with the largest number of exposures occurring around the Jewish New Year. All patients recovered without complications. Time to defervescence in 17 patients treated with ceftriaxone and azithromycin combination was 3.2 days (± 1.7), whereas in 13 cases treated with ceftriaxone monotherapy, the time to defervescence was 6.6 days (± 1.8; P < .001). A point-source, "Paratyphoid Mary"-like outbreak was identified among Israeli travelers to Nepal. Combination Ceftriaxone-Azithromycin therapy may provide a therapeutic advantage over monotherapy, and merits further clinical trials. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Phenotype", "I-Phenotype", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "B-Microorganism", "I-Microorganism", "I-Microorganism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Phenotype", "I-Phenotype", "I-Phenotype", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Habitat", "I-Habitat", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
A large outbreak of Salmonella Paratyphi A infection among israeli travelers to Nepal. In Asia, Salmonella Paratyphi A is an emerging infection, and travelers are increasingly at risk. During October 2009-November 2009, an outbreak in S. Paratyphi A infection was noted in Israeli travelers returning from Nepal. An outbreak investigation included a standardized exposure questionnaire admitted to all patients and medical chart abstraction. Isolates were tested for antimicrobial susceptibility and pulsed-field gel electrophoresis (PFGE). During 1 October 2009-30 November 2009, 37 Israeli travelers returning from Nepal were diagnosed with S. Paratyphi A bacteremia. All 37 case isolates had an identical pattern on PFGE, and all were nalidixic acid resistant. Only 1 food venue was frequented by all the outbreak cases, with the largest number of exposures occurring around the Jewish New Year. All patients recovered without complications. Time to defervescence in 17 patients treated with ceftriaxone and azithromycin combination was 3.2 days (± 1.7), whereas in 13 cases treated with ceftriaxone monotherapy, the time to defervescence was 6.6 days (± 1.8; P < .001). A point-source, "Paratyphoid Mary"-like outbreak was identified among Israeli travelers to Nepal. Combination Ceftriaxone-Azithromycin therapy may provide a therapeutic advantage over monotherapy, and merits further clinical trials.
[ "A", "large", "outbreak", "of", "Salmonella", "Paratyphi", "A", "infection", "among", "israeli", "travelers", "to", "Nepal", ".", "In", "Asia", ",", "Salmonella", "Paratyphi", "A", "is", "an", "emerging", "infection", ",", "and", "travelers", "are", "increasingly", "at", "risk", ".", "During", "October", "2009-November", "2009", ",", "an", "outbreak", "in", "S.", "Paratyphi", "A", "infection", "was", "noted", "in", "Israeli", "travelers", "returning", "from", "Nepal", ".", "An", "outbreak", "investigation", "included", "a", "standardized", "exposure", "questionnaire", "admitted", "to", "all", "patients", "and", "medical", "chart", "abstraction", ".", "Isolates", "were", "tested", "for", "antimicrobial", "susceptibility", "and", "pulsed", "-", "field", "gel", "electrophoresis", "(", "PFGE", ")", ".", "During", "1", "October", "2009", "-", "30", "November", "2009", ",", "37", "Israeli", "travelers", "returning", "from", "Nepal", "were", "diagnosed", "with", "S.", "Paratyphi", "A", "bacteremia", ".", "All", "37", "case", "isolates", "had", "an", "identical", "pattern", "on", "PFGE", ",", "and", "all", "were", "nalidixic", "acid", "resistant", ".", "Only", "1", "food", "venue", "was", "frequented", "by", "all", "the", "outbreak", "cases", ",", "with", "the", "largest", "number", "of", "exposures", "occurring", "around", "the", "Jewish", "New", "Year", ".", "All", "patients", "recovered", "without", "complications", ".", "Time", "to", "defervescence", "in", "17", "patients", "treated", "with", "ceftriaxone", "and", "azithromycin", "combination", "was", "3.2", "days", "(", "±", "1.7", ")", ",", "whereas", "in", "13", "cases", "treated", "with", "ceftriaxone", "monotherapy", ",", "the", "time", "to", "defervescence", "was", "6.6", "days", "(", "±", "1.8", ";", "P", "<", ".001", ")", ".", "A", "point", "-", "source", ",", "\"", "Paratyphoid", "Mary\"-like", "outbreak", "was", "identified", "among", "Israeli", "travelers", "to", "Nepal", ".", "Combination", "Ceftriaxone", "-", "Azithromycin", "therapy", "may", "provide", "a", "therapeutic", "advantage", "over", "monotherapy", ",", "and", "merits", "further", "clinical", "trials", ".", " " ]
[ "Habitat", "Phenotype", "Microorganism" ]
toxicity is a Outcome_Adverse-effects, lymphoblastoid interferon . is a Intervention_Pharmacological, high- or a low - dose interferon is a Intervention_Pharmacological, main toxic effects is a Outcome_Adverse-effects, fever , fatigue , and anorexia . is a Outcome_Adverse-effects, significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity is a Outcome_Adverse-effects, changes in serum electrolytes is a Outcome_Adverse-effects, Coagulation studies is a Outcome_Physical, myelosuppression is a Outcome_Adverse-effects, maximum tolerated dose is a Outcome_Other, relatively well - tolerated . is a Outcome_Other, tolerance is a Outcome_Other
77543_task0
Sentence: Prospectively randomized toxicity study of high-dose versus low-dose treatment strategies for lymphoblastoid interferon . It is unclear from preliminary laboratory studies whether a high- or a low-dose interferon treatment strategy is optimal . As part of an ongoing study of mechanisms of interferon action , we have evaluated toxicity in a two-arm protocol in which patients were randomly assigned to receive lymphoblastoid interferon by either a low-dose treatment strategy ( 2 X 10 ( 6 ) units/m2 daily X 28 days then daily X 5 days every other week by im injection ) or a high-dose treatment strategy ( 5 X 10 ( 6 ) units/m2 by continuous iv infusion over 24 hours , escalating by 5 X 10 ( 6 ) units/m2/day as tolerated over 10 days , repeated every 28 days ) . The main toxic effects in both arms were fever , fatigue , and anorexia . Marked interpatient differences within each dose arm were greater than differences between arms . Additional significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity . Minor changes in serum electrolytes were noted . Coagulation studies were normal . The dose-limiting toxic effect for the high-dose arm was myelosuppression . Median maximum tolerated dose among high-dose strategy patients was 18 X 10 ( 6 ) units/m2 , but there was marked interpatient variation . We conclude that both dose schedules were relatively well-tolerated . Because of individual variation in tolerance , high-dose treatment should include a dose escalation strategy . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Pharmacological, Outcome_Other, Outcome_Adverse-effects, Outcome_Physical
[ "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "B-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Prospectively randomized toxicity study of high-dose versus low-dose treatment strategies for lymphoblastoid interferon . It is unclear from preliminary laboratory studies whether a high- or a low-dose interferon treatment strategy is optimal . As part of an ongoing study of mechanisms of interferon action , we have evaluated toxicity in a two-arm protocol in which patients were randomly assigned to receive lymphoblastoid interferon by either a low-dose treatment strategy ( 2 X 10 ( 6 ) units/m2 daily X 28 days then daily X 5 days every other week by im injection ) or a high-dose treatment strategy ( 5 X 10 ( 6 ) units/m2 by continuous iv infusion over 24 hours , escalating by 5 X 10 ( 6 ) units/m2/day as tolerated over 10 days , repeated every 28 days ) . The main toxic effects in both arms were fever , fatigue , and anorexia . Marked interpatient differences within each dose arm were greater than differences between arms . Additional significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity . Minor changes in serum electrolytes were noted . Coagulation studies were normal . The dose-limiting toxic effect for the high-dose arm was myelosuppression . Median maximum tolerated dose among high-dose strategy patients was 18 X 10 ( 6 ) units/m2 , but there was marked interpatient variation . We conclude that both dose schedules were relatively well-tolerated . Because of individual variation in tolerance , high-dose treatment should include a dose escalation strategy .
[ "Prospectively", "randomized", "toxicity", "study", "of", "high", "-", "dose", "versus", "low", "-", "dose", "treatment", "strategies", "for", "lymphoblastoid", "interferon", ".", "It", "is", "unclear", "from", "preliminary", "laboratory", "studies", "whether", "a", "high-", "or", "a", "low", "-", "dose", "interferon", "treatment", "strategy", "is", "optimal", ".", "As", "part", "of", "an", "ongoing", "study", "of", "mechanisms", "of", "interferon", "action", ",", "we", "have", "evaluated", "toxicity", "in", "a", "two", "-", "arm", "protocol", "in", "which", "patients", "were", "randomly", "assigned", "to", "receive", "lymphoblastoid", "interferon", "by", "either", "a", "low", "-", "dose", "treatment", "strategy", "(", "2", "X", "10", "(", "6", ")", "units", "/", "m2", "daily", "X", "28", "days", "then", "daily", "X", "5", "days", "every", "other", "week", "by", "im", "injection", ")", "or", "a", "high", "-", "dose", "treatment", "strategy", "(", "5", "X", "10", "(", "6", ")", "units", "/", "m2", "by", "continuous", "iv", "infusion", "over", "24", "hours", ",", "escalating", "by", "5", "X", "10", "(", "6", ")", "units", "/", "m2", "/", "day", "as", "tolerated", "over", "10", "days", ",", "repeated", "every", "28", "days", ")", ".", "The", "main", "toxic", "effects", "in", "both", "arms", "were", "fever", ",", "fatigue", ",", "and", "anorexia", ".", "Marked", "interpatient", "differences", "within", "each", "dose", "arm", "were", "greater", "than", "differences", "between", "arms", ".", "Additional", "significant", "toxic", "effects", "included", "nausea", "and", "vomiting", ",", "hypotension", ",", "leukopenia", ",", "thrombocytopenia", ",", "and", "evidence", "of", "hepatic", "toxicity", ".", "Minor", "changes", "in", "serum", "electrolytes", "were", "noted", ".", "Coagulation", "studies", "were", "normal", ".", "The", "dose", "-", "limiting", "toxic", "effect", "for", "the", "high", "-", "dose", "arm", "was", "myelosuppression", ".", "Median", "maximum", "tolerated", "dose", "among", "high", "-", "dose", "strategy", "patients", "was", "18", "X", "10", "(", "6", ")", "units", "/", "m2", ",", "but", "there", "was", "marked", "interpatient", "variation", ".", "We", "conclude", "that", "both", "dose", "schedules", "were", "relatively", "well", "-", "tolerated", ".", "Because", "of", "individual", "variation", "in", "tolerance", ",", "high", "-", "dose", "treatment", "should", "include", "a", "dose", "escalation", "strategy", "." ]
[ "Outcome_Adverse-effects", "Intervention_Pharmacological", "Outcome_Other", "Participant_Condition", "Outcome_Physical" ]
toxicity is a Outcome_Adverse-effects, lymphoblastoid interferon . is a Intervention_Pharmacological, high- or a low - dose interferon is a Intervention_Pharmacological, main toxic effects is a Outcome_Adverse-effects, fever , fatigue , and anorexia . is a Outcome_Adverse-effects, significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity is a Outcome_Adverse-effects, changes in serum electrolytes is a Outcome_Adverse-effects, Coagulation studies is a Outcome_Physical, myelosuppression is a Outcome_Adverse-effects, maximum tolerated dose is a Outcome_Other, relatively well - tolerated . is a Outcome_Other, tolerance is a Outcome_Other
77543_task1
Sentence: Prospectively randomized toxicity study of high-dose versus low-dose treatment strategies for lymphoblastoid interferon . It is unclear from preliminary laboratory studies whether a high- or a low-dose interferon treatment strategy is optimal . As part of an ongoing study of mechanisms of interferon action , we have evaluated toxicity in a two-arm protocol in which patients were randomly assigned to receive lymphoblastoid interferon by either a low-dose treatment strategy ( 2 X 10 ( 6 ) units/m2 daily X 28 days then daily X 5 days every other week by im injection ) or a high-dose treatment strategy ( 5 X 10 ( 6 ) units/m2 by continuous iv infusion over 24 hours , escalating by 5 X 10 ( 6 ) units/m2/day as tolerated over 10 days , repeated every 28 days ) . The main toxic effects in both arms were fever , fatigue , and anorexia . Marked interpatient differences within each dose arm were greater than differences between arms . Additional significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity . Minor changes in serum electrolytes were noted . Coagulation studies were normal . The dose-limiting toxic effect for the high-dose arm was myelosuppression . Median maximum tolerated dose among high-dose strategy patients was 18 X 10 ( 6 ) units/m2 , but there was marked interpatient variation . We conclude that both dose schedules were relatively well-tolerated . Because of individual variation in tolerance , high-dose treatment should include a dose escalation strategy . Instructions: please typing these entity words according to sentence: toxicity, lymphoblastoid interferon ., high- or a low - dose interferon, main toxic effects, fever , fatigue , and anorexia ., significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity, changes in serum electrolytes, Coagulation studies, myelosuppression, maximum tolerated dose, relatively well - tolerated ., tolerance Options: Intervention_Pharmacological, Outcome_Other, Outcome_Adverse-effects, Outcome_Physical
[ "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "B-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Prospectively randomized toxicity study of high-dose versus low-dose treatment strategies for lymphoblastoid interferon . It is unclear from preliminary laboratory studies whether a high- or a low-dose interferon treatment strategy is optimal . As part of an ongoing study of mechanisms of interferon action , we have evaluated toxicity in a two-arm protocol in which patients were randomly assigned to receive lymphoblastoid interferon by either a low-dose treatment strategy ( 2 X 10 ( 6 ) units/m2 daily X 28 days then daily X 5 days every other week by im injection ) or a high-dose treatment strategy ( 5 X 10 ( 6 ) units/m2 by continuous iv infusion over 24 hours , escalating by 5 X 10 ( 6 ) units/m2/day as tolerated over 10 days , repeated every 28 days ) . The main toxic effects in both arms were fever , fatigue , and anorexia . Marked interpatient differences within each dose arm were greater than differences between arms . Additional significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity . Minor changes in serum electrolytes were noted . Coagulation studies were normal . The dose-limiting toxic effect for the high-dose arm was myelosuppression . Median maximum tolerated dose among high-dose strategy patients was 18 X 10 ( 6 ) units/m2 , but there was marked interpatient variation . We conclude that both dose schedules were relatively well-tolerated . Because of individual variation in tolerance , high-dose treatment should include a dose escalation strategy .
[ "Prospectively", "randomized", "toxicity", "study", "of", "high", "-", "dose", "versus", "low", "-", "dose", "treatment", "strategies", "for", "lymphoblastoid", "interferon", ".", "It", "is", "unclear", "from", "preliminary", "laboratory", "studies", "whether", "a", "high-", "or", "a", "low", "-", "dose", "interferon", "treatment", "strategy", "is", "optimal", ".", "As", "part", "of", "an", "ongoing", "study", "of", "mechanisms", "of", "interferon", "action", ",", "we", "have", "evaluated", "toxicity", "in", "a", "two", "-", "arm", "protocol", "in", "which", "patients", "were", "randomly", "assigned", "to", "receive", "lymphoblastoid", "interferon", "by", "either", "a", "low", "-", "dose", "treatment", "strategy", "(", "2", "X", "10", "(", "6", ")", "units", "/", "m2", "daily", "X", "28", "days", "then", "daily", "X", "5", "days", "every", "other", "week", "by", "im", "injection", ")", "or", "a", "high", "-", "dose", "treatment", "strategy", "(", "5", "X", "10", "(", "6", ")", "units", "/", "m2", "by", "continuous", "iv", "infusion", "over", "24", "hours", ",", "escalating", "by", "5", "X", "10", "(", "6", ")", "units", "/", "m2", "/", "day", "as", "tolerated", "over", "10", "days", ",", "repeated", "every", "28", "days", ")", ".", "The", "main", "toxic", "effects", "in", "both", "arms", "were", "fever", ",", "fatigue", ",", "and", "anorexia", ".", "Marked", "interpatient", "differences", "within", "each", "dose", "arm", "were", "greater", "than", "differences", "between", "arms", ".", "Additional", "significant", "toxic", "effects", "included", "nausea", "and", "vomiting", ",", "hypotension", ",", "leukopenia", ",", "thrombocytopenia", ",", "and", "evidence", "of", "hepatic", "toxicity", ".", "Minor", "changes", "in", "serum", "electrolytes", "were", "noted", ".", "Coagulation", "studies", "were", "normal", ".", "The", "dose", "-", "limiting", "toxic", "effect", "for", "the", "high", "-", "dose", "arm", "was", "myelosuppression", ".", "Median", "maximum", "tolerated", "dose", "among", "high", "-", "dose", "strategy", "patients", "was", "18", "X", "10", "(", "6", ")", "units", "/", "m2", ",", "but", "there", "was", "marked", "interpatient", "variation", ".", "We", "conclude", "that", "both", "dose", "schedules", "were", "relatively", "well", "-", "tolerated", ".", "Because", "of", "individual", "variation", "in", "tolerance", ",", "high", "-", "dose", "treatment", "should", "include", "a", "dose", "escalation", "strategy", "." ]
[ "Outcome_Adverse-effects", "Intervention_Pharmacological", "Outcome_Other", "Participant_Condition", "Outcome_Physical" ]
toxicity, lymphoblastoid interferon ., high- or a low - dose interferon, main toxic effects, fever , fatigue , and anorexia ., significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity, changes in serum electrolytes, Coagulation studies, myelosuppression, maximum tolerated dose, relatively well - tolerated ., tolerance
77543_task2
Sentence: Prospectively randomized toxicity study of high-dose versus low-dose treatment strategies for lymphoblastoid interferon . It is unclear from preliminary laboratory studies whether a high- or a low-dose interferon treatment strategy is optimal . As part of an ongoing study of mechanisms of interferon action , we have evaluated toxicity in a two-arm protocol in which patients were randomly assigned to receive lymphoblastoid interferon by either a low-dose treatment strategy ( 2 X 10 ( 6 ) units/m2 daily X 28 days then daily X 5 days every other week by im injection ) or a high-dose treatment strategy ( 5 X 10 ( 6 ) units/m2 by continuous iv infusion over 24 hours , escalating by 5 X 10 ( 6 ) units/m2/day as tolerated over 10 days , repeated every 28 days ) . The main toxic effects in both arms were fever , fatigue , and anorexia . Marked interpatient differences within each dose arm were greater than differences between arms . Additional significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity . Minor changes in serum electrolytes were noted . Coagulation studies were normal . The dose-limiting toxic effect for the high-dose arm was myelosuppression . Median maximum tolerated dose among high-dose strategy patients was 18 X 10 ( 6 ) units/m2 , but there was marked interpatient variation . We conclude that both dose schedules were relatively well-tolerated . Because of individual variation in tolerance , high-dose treatment should include a dose escalation strategy . Instructions: please extract entity words from the input sentence
[ "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "B-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Prospectively randomized toxicity study of high-dose versus low-dose treatment strategies for lymphoblastoid interferon . It is unclear from preliminary laboratory studies whether a high- or a low-dose interferon treatment strategy is optimal . As part of an ongoing study of mechanisms of interferon action , we have evaluated toxicity in a two-arm protocol in which patients were randomly assigned to receive lymphoblastoid interferon by either a low-dose treatment strategy ( 2 X 10 ( 6 ) units/m2 daily X 28 days then daily X 5 days every other week by im injection ) or a high-dose treatment strategy ( 5 X 10 ( 6 ) units/m2 by continuous iv infusion over 24 hours , escalating by 5 X 10 ( 6 ) units/m2/day as tolerated over 10 days , repeated every 28 days ) . The main toxic effects in both arms were fever , fatigue , and anorexia . Marked interpatient differences within each dose arm were greater than differences between arms . Additional significant toxic effects included nausea and vomiting , hypotension , leukopenia , thrombocytopenia , and evidence of hepatic toxicity . Minor changes in serum electrolytes were noted . Coagulation studies were normal . The dose-limiting toxic effect for the high-dose arm was myelosuppression . Median maximum tolerated dose among high-dose strategy patients was 18 X 10 ( 6 ) units/m2 , but there was marked interpatient variation . We conclude that both dose schedules were relatively well-tolerated . Because of individual variation in tolerance , high-dose treatment should include a dose escalation strategy .
[ "Prospectively", "randomized", "toxicity", "study", "of", "high", "-", "dose", "versus", "low", "-", "dose", "treatment", "strategies", "for", "lymphoblastoid", "interferon", ".", "It", "is", "unclear", "from", "preliminary", "laboratory", "studies", "whether", "a", "high-", "or", "a", "low", "-", "dose", "interferon", "treatment", "strategy", "is", "optimal", ".", "As", "part", "of", "an", "ongoing", "study", "of", "mechanisms", "of", "interferon", "action", ",", "we", "have", "evaluated", "toxicity", "in", "a", "two", "-", "arm", "protocol", "in", "which", "patients", "were", "randomly", "assigned", "to", "receive", "lymphoblastoid", "interferon", "by", "either", "a", "low", "-", "dose", "treatment", "strategy", "(", "2", "X", "10", "(", "6", ")", "units", "/", "m2", "daily", "X", "28", "days", "then", "daily", "X", "5", "days", "every", "other", "week", "by", "im", "injection", ")", "or", "a", "high", "-", "dose", "treatment", "strategy", "(", "5", "X", "10", "(", "6", ")", "units", "/", "m2", "by", "continuous", "iv", "infusion", "over", "24", "hours", ",", "escalating", "by", "5", "X", "10", "(", "6", ")", "units", "/", "m2", "/", "day", "as", "tolerated", "over", "10", "days", ",", "repeated", "every", "28", "days", ")", ".", "The", "main", "toxic", "effects", "in", "both", "arms", "were", "fever", ",", "fatigue", ",", "and", "anorexia", ".", "Marked", "interpatient", "differences", "within", "each", "dose", "arm", "were", "greater", "than", "differences", "between", "arms", ".", "Additional", "significant", "toxic", "effects", "included", "nausea", "and", "vomiting", ",", "hypotension", ",", "leukopenia", ",", "thrombocytopenia", ",", "and", "evidence", "of", "hepatic", "toxicity", ".", "Minor", "changes", "in", "serum", "electrolytes", "were", "noted", ".", "Coagulation", "studies", "were", "normal", ".", "The", "dose", "-", "limiting", "toxic", "effect", "for", "the", "high", "-", "dose", "arm", "was", "myelosuppression", ".", "Median", "maximum", "tolerated", "dose", "among", "high", "-", "dose", "strategy", "patients", "was", "18", "X", "10", "(", "6", ")", "units", "/", "m2", ",", "but", "there", "was", "marked", "interpatient", "variation", ".", "We", "conclude", "that", "both", "dose", "schedules", "were", "relatively", "well", "-", "tolerated", ".", "Because", "of", "individual", "variation", "in", "tolerance", ",", "high", "-", "dose", "treatment", "should", "include", "a", "dose", "escalation", "strategy", "." ]
[ "Outcome_Adverse-effects", "Intervention_Pharmacological", "Outcome_Other", "Participant_Condition", "Outcome_Physical" ]
uterine bleeding is an umlsterm, women is an umlsterm, adolescence is an umlsterm, postmenopausal period is an umlsterm, patients is an umlsterm, postmenopausal period is an umlsterm, uterine bleeding is an umlsterm
DerGynaekologe.00330634.eng.abstr_task0
Sentence: Abnormal uterine bleeding is a gynecological problem frequently seen in women from adolescence to the postmenopausal period . Nearly 70% of patients ' visits to the gynecologist in the peri- and postmenopausal period are due to abnormal uterine bleeding . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O" ]
Abnormal uterine bleeding is a gynecological problem frequently seen in women from adolescence to the postmenopausal period . Nearly 70% of patients ' visits to the gynecologist in the peri- and postmenopausal period are due to abnormal uterine bleeding .
[ "Abnormal", "uterine", "bleeding", "is", "a", "gynecological", "problem", "frequently", "seen", "in", "women", "from", "adolescence", "to", "the", "postmenopausal", "period", ".", "Nearly", "70", "%", "of", "patients", "'", "visits", "to", "the", "gynecologist", "in", "the", "peri-", "and", "postmenopausal", "period", "are", "due", "to", "abnormal", "uterine", "bleeding", "." ]
[ "umlsterm" ]
uterine bleeding is an umlsterm, women is an umlsterm, adolescence is an umlsterm, postmenopausal period is an umlsterm, patients is an umlsterm, postmenopausal period is an umlsterm, uterine bleeding is an umlsterm
DerGynaekologe.00330634.eng.abstr_task1
Sentence: Abnormal uterine bleeding is a gynecological problem frequently seen in women from adolescence to the postmenopausal period . Nearly 70% of patients ' visits to the gynecologist in the peri- and postmenopausal period are due to abnormal uterine bleeding . Instructions: please typing these entity words according to sentence: uterine bleeding, women, adolescence, postmenopausal period, patients, postmenopausal period, uterine bleeding Options: umlsterm
[ "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O" ]
Abnormal uterine bleeding is a gynecological problem frequently seen in women from adolescence to the postmenopausal period . Nearly 70% of patients ' visits to the gynecologist in the peri- and postmenopausal period are due to abnormal uterine bleeding .
[ "Abnormal", "uterine", "bleeding", "is", "a", "gynecological", "problem", "frequently", "seen", "in", "women", "from", "adolescence", "to", "the", "postmenopausal", "period", ".", "Nearly", "70", "%", "of", "patients", "'", "visits", "to", "the", "gynecologist", "in", "the", "peri-", "and", "postmenopausal", "period", "are", "due", "to", "abnormal", "uterine", "bleeding", "." ]
[ "umlsterm" ]
uterine bleeding, women, adolescence, postmenopausal period, patients, postmenopausal period, uterine bleeding
DerGynaekologe.00330634.eng.abstr_task2
Sentence: Abnormal uterine bleeding is a gynecological problem frequently seen in women from adolescence to the postmenopausal period . Nearly 70% of patients ' visits to the gynecologist in the peri- and postmenopausal period are due to abnormal uterine bleeding . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O" ]
Abnormal uterine bleeding is a gynecological problem frequently seen in women from adolescence to the postmenopausal period . Nearly 70% of patients ' visits to the gynecologist in the peri- and postmenopausal period are due to abnormal uterine bleeding .
[ "Abnormal", "uterine", "bleeding", "is", "a", "gynecological", "problem", "frequently", "seen", "in", "women", "from", "adolescence", "to", "the", "postmenopausal", "period", ".", "Nearly", "70", "%", "of", "patients", "'", "visits", "to", "the", "gynecologist", "in", "the", "peri-", "and", "postmenopausal", "period", "are", "due", "to", "abnormal", "uterine", "bleeding", "." ]
[ "umlsterm" ]
man is an umlsterm, lung tumor is an umlsterm, bronchus is an umlsterm, bronchus is an umlsterm, laser is an umlsterm, therapy is an umlsterm, Complications is an umlsterm, surgery is an umlsterm, rest is an umlsterm, lung is an umlsterm, thoracoplasty is an umlsterm, findings is an umlsterm, tumor is an umlsterm, malignant melanoma is an umlsterm, history is an umlsterm, mucous membrane is an umlsterm, skin is an umlsterm, eyes is an umlsterm, tumor is an umlsterm, malignant melanoma is an umlsterm, respiratory tract is an umlsterm, neoplasm is an umlsterm, patient is an umlsterm, tumor is an umlsterm, period is an umlsterm
DerPathologe.80190299.eng.abstr_task0
Sentence: A 53-year-old man presented a melanotic lung tumor which was based in the bronchus of the left lower lobe and closed the left main bronchus . After laser therapy , left lobectomy with sleeve resection was carried out . Complications after the surgery required resection of the rest of the left lung and thoracoplasty . Based on the histological and immunohistochemical findings , the tumor was classified as a malignant melanoma . There was no past history of an excision or a fulguration of a cutaneous , mucous membrane , or ocular lesion . Examination of the skin and the eyes did not yield any evidence of another primary tumor . We conclude that the lesion represents a primary malignant melanoma of the respiratory tract , a rare neoplasm of which only 21 cases have been confirmed . The patient does not have any evidence of tumor in the relatively short follow-up period of 10 months . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
A 53-year-old man presented a melanotic lung tumor which was based in the bronchus of the left lower lobe and closed the left main bronchus . After laser therapy , left lobectomy with sleeve resection was carried out . Complications after the surgery required resection of the rest of the left lung and thoracoplasty . Based on the histological and immunohistochemical findings , the tumor was classified as a malignant melanoma . There was no past history of an excision or a fulguration of a cutaneous , mucous membrane , or ocular lesion . Examination of the skin and the eyes did not yield any evidence of another primary tumor . We conclude that the lesion represents a primary malignant melanoma of the respiratory tract , a rare neoplasm of which only 21 cases have been confirmed . The patient does not have any evidence of tumor in the relatively short follow-up period of 10 months .
[ "A", "53-year", "-", "old", "man", "presented", "a", "melanotic", "lung", "tumor", "which", "was", "based", "in", "the", "bronchus", "of", "the", "left", "lower", "lobe", "and", "closed", "the", "left", "main", "bronchus", ".", "After", "laser", "therapy", ",", "left", "lobectomy", "with", "sleeve", "resection", "was", "carried", "out", ".", "Complications", "after", "the", "surgery", "required", "resection", "of", "the", "rest", "of", "the", "left", "lung", "and", "thoracoplasty", ".", "Based", "on", "the", "histological", "and", "immunohistochemical", "findings", ",", "the", "tumor", "was", "classified", "as", "a", "malignant", "melanoma", ".", "There", "was", "no", "past", "history", "of", "an", "excision", "or", "a", "fulguration", "of", "a", "cutaneous", ",", "mucous", "membrane", ",", "or", "ocular", "lesion", ".", "Examination", "of", "the", "skin", "and", "the", "eyes", "did", "not", "yield", "any", "evidence", "of", "another", "primary", "tumor", ".", "We", "conclude", "that", "the", "lesion", "represents", "a", "primary", "malignant", "melanoma", "of", "the", "respiratory", "tract", ",", "a", "rare", "neoplasm", "of", "which", "only", "21", "cases", "have", "been", "confirmed", ".", "The", "patient", "does", "not", "have", "any", "evidence", "of", "tumor", "in", "the", "relatively", "short", "follow", "-", "up", "period", "of", "10", "months", "." ]
[ "umlsterm" ]
man is an umlsterm, lung tumor is an umlsterm, bronchus is an umlsterm, bronchus is an umlsterm, laser is an umlsterm, therapy is an umlsterm, Complications is an umlsterm, surgery is an umlsterm, rest is an umlsterm, lung is an umlsterm, thoracoplasty is an umlsterm, findings is an umlsterm, tumor is an umlsterm, malignant melanoma is an umlsterm, history is an umlsterm, mucous membrane is an umlsterm, skin is an umlsterm, eyes is an umlsterm, tumor is an umlsterm, malignant melanoma is an umlsterm, respiratory tract is an umlsterm, neoplasm is an umlsterm, patient is an umlsterm, tumor is an umlsterm, period is an umlsterm
DerPathologe.80190299.eng.abstr_task1
Sentence: A 53-year-old man presented a melanotic lung tumor which was based in the bronchus of the left lower lobe and closed the left main bronchus . After laser therapy , left lobectomy with sleeve resection was carried out . Complications after the surgery required resection of the rest of the left lung and thoracoplasty . Based on the histological and immunohistochemical findings , the tumor was classified as a malignant melanoma . There was no past history of an excision or a fulguration of a cutaneous , mucous membrane , or ocular lesion . Examination of the skin and the eyes did not yield any evidence of another primary tumor . We conclude that the lesion represents a primary malignant melanoma of the respiratory tract , a rare neoplasm of which only 21 cases have been confirmed . The patient does not have any evidence of tumor in the relatively short follow-up period of 10 months . Instructions: please typing these entity words according to sentence: man, lung tumor, bronchus, bronchus, laser, therapy, Complications, surgery, rest, lung, thoracoplasty, findings, tumor, malignant melanoma, history, mucous membrane, skin, eyes, tumor, malignant melanoma, respiratory tract, neoplasm, patient, tumor, period Options: umlsterm
[ "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
A 53-year-old man presented a melanotic lung tumor which was based in the bronchus of the left lower lobe and closed the left main bronchus . After laser therapy , left lobectomy with sleeve resection was carried out . Complications after the surgery required resection of the rest of the left lung and thoracoplasty . Based on the histological and immunohistochemical findings , the tumor was classified as a malignant melanoma . There was no past history of an excision or a fulguration of a cutaneous , mucous membrane , or ocular lesion . Examination of the skin and the eyes did not yield any evidence of another primary tumor . We conclude that the lesion represents a primary malignant melanoma of the respiratory tract , a rare neoplasm of which only 21 cases have been confirmed . The patient does not have any evidence of tumor in the relatively short follow-up period of 10 months .
[ "A", "53-year", "-", "old", "man", "presented", "a", "melanotic", "lung", "tumor", "which", "was", "based", "in", "the", "bronchus", "of", "the", "left", "lower", "lobe", "and", "closed", "the", "left", "main", "bronchus", ".", "After", "laser", "therapy", ",", "left", "lobectomy", "with", "sleeve", "resection", "was", "carried", "out", ".", "Complications", "after", "the", "surgery", "required", "resection", "of", "the", "rest", "of", "the", "left", "lung", "and", "thoracoplasty", ".", "Based", "on", "the", "histological", "and", "immunohistochemical", "findings", ",", "the", "tumor", "was", "classified", "as", "a", "malignant", "melanoma", ".", "There", "was", "no", "past", "history", "of", "an", "excision", "or", "a", "fulguration", "of", "a", "cutaneous", ",", "mucous", "membrane", ",", "or", "ocular", "lesion", ".", "Examination", "of", "the", "skin", "and", "the", "eyes", "did", "not", "yield", "any", "evidence", "of", "another", "primary", "tumor", ".", "We", "conclude", "that", "the", "lesion", "represents", "a", "primary", "malignant", "melanoma", "of", "the", "respiratory", "tract", ",", "a", "rare", "neoplasm", "of", "which", "only", "21", "cases", "have", "been", "confirmed", ".", "The", "patient", "does", "not", "have", "any", "evidence", "of", "tumor", "in", "the", "relatively", "short", "follow", "-", "up", "period", "of", "10", "months", "." ]
[ "umlsterm" ]
man, lung tumor, bronchus, bronchus, laser, therapy, Complications, surgery, rest, lung, thoracoplasty, findings, tumor, malignant melanoma, history, mucous membrane, skin, eyes, tumor, malignant melanoma, respiratory tract, neoplasm, patient, tumor, period
DerPathologe.80190299.eng.abstr_task2
Sentence: A 53-year-old man presented a melanotic lung tumor which was based in the bronchus of the left lower lobe and closed the left main bronchus . After laser therapy , left lobectomy with sleeve resection was carried out . Complications after the surgery required resection of the rest of the left lung and thoracoplasty . Based on the histological and immunohistochemical findings , the tumor was classified as a malignant melanoma . There was no past history of an excision or a fulguration of a cutaneous , mucous membrane , or ocular lesion . Examination of the skin and the eyes did not yield any evidence of another primary tumor . We conclude that the lesion represents a primary malignant melanoma of the respiratory tract , a rare neoplasm of which only 21 cases have been confirmed . The patient does not have any evidence of tumor in the relatively short follow-up period of 10 months . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
A 53-year-old man presented a melanotic lung tumor which was based in the bronchus of the left lower lobe and closed the left main bronchus . After laser therapy , left lobectomy with sleeve resection was carried out . Complications after the surgery required resection of the rest of the left lung and thoracoplasty . Based on the histological and immunohistochemical findings , the tumor was classified as a malignant melanoma . There was no past history of an excision or a fulguration of a cutaneous , mucous membrane , or ocular lesion . Examination of the skin and the eyes did not yield any evidence of another primary tumor . We conclude that the lesion represents a primary malignant melanoma of the respiratory tract , a rare neoplasm of which only 21 cases have been confirmed . The patient does not have any evidence of tumor in the relatively short follow-up period of 10 months .
[ "A", "53-year", "-", "old", "man", "presented", "a", "melanotic", "lung", "tumor", "which", "was", "based", "in", "the", "bronchus", "of", "the", "left", "lower", "lobe", "and", "closed", "the", "left", "main", "bronchus", ".", "After", "laser", "therapy", ",", "left", "lobectomy", "with", "sleeve", "resection", "was", "carried", "out", ".", "Complications", "after", "the", "surgery", "required", "resection", "of", "the", "rest", "of", "the", "left", "lung", "and", "thoracoplasty", ".", "Based", "on", "the", "histological", "and", "immunohistochemical", "findings", ",", "the", "tumor", "was", "classified", "as", "a", "malignant", "melanoma", ".", "There", "was", "no", "past", "history", "of", "an", "excision", "or", "a", "fulguration", "of", "a", "cutaneous", ",", "mucous", "membrane", ",", "or", "ocular", "lesion", ".", "Examination", "of", "the", "skin", "and", "the", "eyes", "did", "not", "yield", "any", "evidence", "of", "another", "primary", "tumor", ".", "We", "conclude", "that", "the", "lesion", "represents", "a", "primary", "malignant", "melanoma", "of", "the", "respiratory", "tract", ",", "a", "rare", "neoplasm", "of", "which", "only", "21", "cases", "have", "been", "confirmed", ".", "The", "patient", "does", "not", "have", "any", "evidence", "of", "tumor", "in", "the", "relatively", "short", "follow", "-", "up", "period", "of", "10", "months", "." ]
[ "umlsterm" ]
Crohn ' s disease is a Participant_Condition, intestinal resection is a Intervention_Physical, patients with Crohn ' s disease is a Participant_Condition, recurrence is a Outcome_Physical, metronidazole is a Intervention_Pharmacological, Patients at high risk of recurrence is a Participant_Condition, thiopurine is a Intervention_Pharmacological, adalimumab is a Intervention_Pharmacological, colonoscopy at 6 months is a Intervention_Surgical, ( active care ) is a Intervention_Physical, no colonoscopy ( standard care ) is a Intervention_Physical, endoscopic recurrence is a Outcome_Mental, The primary endpoint was endoscopic recurrence is a Outcome_Mental, 122 patients in the active care group is a Participant_Sample-size, p=0.03 is a Outcome_Other, Complete mucosal normality is a Outcome_Physical, months recurrence is a Outcome_Physical, in remission is a Outcome_Other, The incidence and type of adverse and severe adverse events is a Outcome_Adverse-effects, clinical risk of recurrence is a Outcome_Mental, postoperative Crohn ' s disease recurrence is a Outcome_Physical, disease control is a Outcome_Physical, predict recurrence is a Outcome_Other, need monitoring is a Outcome_Mental, Early remission is a Outcome_Physical
69455_task0
Sentence: Crohn 's disease management after intestinal resection : a randomised trial . BACKGROUND Most patients with Crohn 's disease need an intestinal resection , but a majority will subsequently experience disease recurrence and require further surgery . This study aimed to identify the optimal strategy to prevent postoperative disease recurrence . METHODS In this randomised trial , consecutive patients from 17 centres in Australia and New Zealand undergoing intestinal resection of all macroscopic Crohn 's disease , with an endoscopically accessible anastomosis , received 3 months of metronidazole therapy . Patients at high risk of recurrence also received a thiopurine , or adalimumab if they were intolerant to thiopurines . Patients were randomly assigned to parallel groups : colonoscopy at 6 months ( active care ) or no colonoscopy ( standard care ) . We used computer-generated block randomisation to allocate patients in each centre to active or standard care in a 2:1 ratio . For endoscopic recurrence ( Rutgeerts score ≥i2 ) at 6 months , patients stepped-up to thiopurine , fortnightly adalimumab with thiopurine , or weekly adalimumab . The primary endpoint was endoscopic recurrence at 18 months . Patients and treating physicians were aware of the patient 's study group and treatment , but central reading of the endoscopic findings was undertaken blind to the study group and treatment . Analysis included all patients who received at least one dose of study drug . This trial is registered with ClinicalTrials.gov , number NCT00989560 . FINDINGS Between Oct 13 , 2009 , and Sept 28 , 2011 , 174 ( 83 % high risk across both active and standard care groups ) patients were enrolled and received at least one dose of study drug . Of 122 patients in the active care group , 47 ( 39 % ) stepped-up treatment . At 18 months , endoscopic recurrence occurred in 60 ( 49 % ) patients in the active care group and 35 ( 67 % ) patients in the standard care group ( p=0.03 ) . Complete mucosal normality was maintained in 27 ( 22 % ) of 122 patients in the active care group versus four ( 8 % ) in the standard care group ( p=0.03 ) . In the active care arm , of those with 6 months recurrence who stepped up treatment , 18 ( 38 % ) of 47 patients were in remission 12 months later ; conversely , of those in remission at 6 months who did not change therapy recurrence occurred in 31 ( 41 % ) of 75 patients 12 months later . Smoking ( odds ratio [ OR ] 2.4 , 95 % CI 1.2-4.8 , p=0.02 ) and the presence of two or more clinical risk factors including smoking ( OR 2.8 , 95 % CI 1.01-7.7 , p=0.05 ) increased the risk of endoscopic recurrence . The incidence and type of adverse and severe adverse events did not differ significantly between patients in the active care and standard care groups ( 100 [ 82 % ] of 122 vs 45 [ 87 % ] of 52 ; p=0.51 ) and ( 33 [ 27 % ] of 122 vs 18 [ 35 % ] of 52 ; p=0.36 ) , respectively . INTERPRETATION Treatment according to clinical risk of recurrence , with early colonoscopy and treatment step-up for recurrence , is better than conventional drug therapy alone for prevention of postoperative Crohn 's disease recurrence . Selective immune suppression , adjusted for early recurrence , rather than routine use , leads to disease control in most patients . Clinical risk factors predict recurrence , but patients at low risk also need monitoring . Early remission does not preclude the need for ongoing monitoring . FUNDING AbbVie , Gutsy Group , Gandel Philanthropy , Angior Foundation , Crohn 's Colitis Australia , and the National Health and Medical Research Council . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Pharmacological, Outcome_Adverse-effects, Intervention_Physical, Participant_Condition, Outcome_Physical, Participant_Sample-size, Outcome_Other, Intervention_Surgical, Outcome_Mental
[ "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Surgical", "I-Intervention_Surgical", "I-Intervention_Surgical", "I-Intervention_Surgical", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Crohn 's disease management after intestinal resection : a randomised trial . BACKGROUND Most patients with Crohn 's disease need an intestinal resection , but a majority will subsequently experience disease recurrence and require further surgery . This study aimed to identify the optimal strategy to prevent postoperative disease recurrence . METHODS In this randomised trial , consecutive patients from 17 centres in Australia and New Zealand undergoing intestinal resection of all macroscopic Crohn 's disease , with an endoscopically accessible anastomosis , received 3 months of metronidazole therapy . Patients at high risk of recurrence also received a thiopurine , or adalimumab if they were intolerant to thiopurines . Patients were randomly assigned to parallel groups : colonoscopy at 6 months ( active care ) or no colonoscopy ( standard care ) . We used computer-generated block randomisation to allocate patients in each centre to active or standard care in a 2:1 ratio . For endoscopic recurrence ( Rutgeerts score ≥i2 ) at 6 months , patients stepped-up to thiopurine , fortnightly adalimumab with thiopurine , or weekly adalimumab . The primary endpoint was endoscopic recurrence at 18 months . Patients and treating physicians were aware of the patient 's study group and treatment , but central reading of the endoscopic findings was undertaken blind to the study group and treatment . Analysis included all patients who received at least one dose of study drug . This trial is registered with ClinicalTrials.gov , number NCT00989560 . FINDINGS Between Oct 13 , 2009 , and Sept 28 , 2011 , 174 ( 83 % high risk across both active and standard care groups ) patients were enrolled and received at least one dose of study drug . Of 122 patients in the active care group , 47 ( 39 % ) stepped-up treatment . At 18 months , endoscopic recurrence occurred in 60 ( 49 % ) patients in the active care group and 35 ( 67 % ) patients in the standard care group ( p=0.03 ) . Complete mucosal normality was maintained in 27 ( 22 % ) of 122 patients in the active care group versus four ( 8 % ) in the standard care group ( p=0.03 ) . In the active care arm , of those with 6 months recurrence who stepped up treatment , 18 ( 38 % ) of 47 patients were in remission 12 months later ; conversely , of those in remission at 6 months who did not change therapy recurrence occurred in 31 ( 41 % ) of 75 patients 12 months later . Smoking ( odds ratio [ OR ] 2.4 , 95 % CI 1.2-4.8 , p=0.02 ) and the presence of two or more clinical risk factors including smoking ( OR 2.8 , 95 % CI 1.01-7.7 , p=0.05 ) increased the risk of endoscopic recurrence . The incidence and type of adverse and severe adverse events did not differ significantly between patients in the active care and standard care groups ( 100 [ 82 % ] of 122 vs 45 [ 87 % ] of 52 ; p=0.51 ) and ( 33 [ 27 % ] of 122 vs 18 [ 35 % ] of 52 ; p=0.36 ) , respectively . INTERPRETATION Treatment according to clinical risk of recurrence , with early colonoscopy and treatment step-up for recurrence , is better than conventional drug therapy alone for prevention of postoperative Crohn 's disease recurrence . Selective immune suppression , adjusted for early recurrence , rather than routine use , leads to disease control in most patients . Clinical risk factors predict recurrence , but patients at low risk also need monitoring . Early remission does not preclude the need for ongoing monitoring . FUNDING AbbVie , Gutsy Group , Gandel Philanthropy , Angior Foundation , Crohn 's Colitis Australia , and the National Health and Medical Research Council .
[ "Crohn", "'", "s", "disease", "management", "after", "intestinal", "resection", ":", "a", "randomised", "trial", ".", "BACKGROUND", "Most", "patients", "with", "Crohn", "'", "s", "disease", "need", "an", "intestinal", "resection", ",", "but", "a", "majority", "will", "subsequently", "experience", "disease", "recurrence", "and", "require", "further", "surgery", ".", "This", "study", "aimed", "to", "identify", "the", "optimal", "strategy", "to", "prevent", "postoperative", "disease", "recurrence", ".", "METHODS", "In", "this", "randomised", "trial", ",", "consecutive", "patients", "from", "17", "centres", "in", "Australia", "and", "New", "Zealand", "undergoing", "intestinal", "resection", "of", "all", "macroscopic", "Crohn", "'", "s", "disease", ",", "with", "an", "endoscopically", "accessible", "anastomosis", ",", "received", "3", "months", "of", "metronidazole", "therapy", ".", "Patients", "at", "high", "risk", "of", "recurrence", "also", "received", "a", "thiopurine", ",", "or", "adalimumab", "if", "they", "were", "intolerant", "to", "thiopurines", ".", "Patients", "were", "randomly", "assigned", "to", "parallel", "groups", ":", "colonoscopy", "at", "6", "months", "(", "active", "care", ")", "or", "no", "colonoscopy", "(", "standard", "care", ")", ".", "We", "used", "computer", "-", "generated", "block", "randomisation", "to", "allocate", "patients", "in", "each", "centre", "to", "active", "or", "standard", "care", "in", "a", "2:1", "ratio", ".", "For", "endoscopic", "recurrence", "(", "Rutgeerts", "score", "≥i2", ")", "at", "6", "months", ",", "patients", "stepped", "-", "up", "to", "thiopurine", ",", "fortnightly", "adalimumab", "with", "thiopurine", ",", "or", "weekly", "adalimumab", ".", "The", "primary", "endpoint", "was", "endoscopic", "recurrence", "at", "18", "months", ".", "Patients", "and", "treating", "physicians", "were", "aware", "of", "the", "patient", "'", "s", "study", "group", "and", "treatment", ",", "but", "central", "reading", "of", "the", "endoscopic", "findings", "was", "undertaken", "blind", "to", "the", "study", "group", "and", "treatment", ".", "Analysis", "included", "all", "patients", "who", "received", "at", "least", "one", "dose", "of", "study", "drug", ".", "This", "trial", "is", "registered", "with", "ClinicalTrials.gov", ",", "number", "NCT00989560", ".", "FINDINGS", "Between", "Oct", "13", ",", "2009", ",", "and", "Sept", "28", ",", "2011", ",", "174", "(", "83", "%", "high", "risk", "across", "both", "active", "and", "standard", "care", "groups", ")", "patients", "were", "enrolled", "and", "received", "at", "least", "one", "dose", "of", "study", "drug", ".", "Of", "122", "patients", "in", "the", "active", "care", "group", ",", "47", "(", "39", "%", ")", "stepped", "-", "up", "treatment", ".", "At", "18", "months", ",", "endoscopic", "recurrence", "occurred", "in", "60", "(", "49", "%", ")", "patients", "in", "the", "active", "care", "group", "and", "35", "(", "67", "%", ")", "patients", "in", "the", "standard", "care", "group", "(", "p=0.03", ")", ".", "Complete", "mucosal", "normality", "was", "maintained", "in", "27", "(", "22", "%", ")", "of", "122", "patients", "in", "the", "active", "care", "group", "versus", "four", "(", "8", "%", ")", "in", "the", "standard", "care", "group", "(", "p=0.03", ")", ".", "In", "the", "active", "care", "arm", ",", "of", "those", "with", "6", "months", "recurrence", "who", "stepped", "up", "treatment", ",", "18", "(", "38", "%", ")", "of", "47", "patients", "were", "in", "remission", "12", "months", "later", ";", "conversely", ",", "of", "those", "in", "remission", "at", "6", "months", "who", "did", "not", "change", "therapy", "recurrence", "occurred", "in", "31", "(", "41", "%", ")", "of", "75", "patients", "12", "months", "later", ".", "Smoking", "(", "odds", "ratio", "[", "OR", "]", "2.4", ",", "95", "%", "CI", "1.2", "-", "4.8", ",", "p=0.02", ")", "and", "the", "presence", "of", "two", "or", "more", "clinical", "risk", "factors", "including", "smoking", "(", "OR", "2.8", ",", "95", "%", "CI", "1.01", "-", "7.7", ",", "p=0.05", ")", "increased", "the", "risk", "of", "endoscopic", "recurrence", ".", "The", "incidence", "and", "type", "of", "adverse", "and", "severe", "adverse", "events", "did", "not", "differ", "significantly", "between", "patients", "in", "the", "active", "care", "and", "standard", "care", "groups", "(", "100", "[", "82", "%", "]", "of", "122", "vs", "45", "[", "87", "%", "]", "of", "52", ";", "p=0.51", ")", "and", "(", "33", "[", "27", "%", "]", "of", "122", "vs", "18", "[", "35", "%", "]", "of", "52", ";", "p=0.36", ")", ",", "respectively", ".", "INTERPRETATION", "Treatment", "according", "to", "clinical", "risk", "of", "recurrence", ",", "with", "early", "colonoscopy", "and", "treatment", "step", "-", "up", "for", "recurrence", ",", "is", "better", "than", "conventional", "drug", "therapy", "alone", "for", "prevention", "of", "postoperative", "Crohn", "'", "s", "disease", "recurrence", ".", "Selective", "immune", "suppression", ",", "adjusted", "for", "early", "recurrence", ",", "rather", "than", "routine", "use", ",", "leads", "to", "disease", "control", "in", "most", "patients", ".", "Clinical", "risk", "factors", "predict", "recurrence", ",", "but", "patients", "at", "low", "risk", "also", "need", "monitoring", ".", "Early", "remission", "does", "not", "preclude", "the", "need", "for", "ongoing", "monitoring", ".", "FUNDING", "AbbVie", ",", "Gutsy", "Group", ",", "Gandel", "Philanthropy", ",", "Angior", "Foundation", ",", "Crohn", "'", "s", "Colitis", "Australia", ",", "and", "the", "National", "Health", "and", "Medical", "Research", "Council", "." ]
[ "Outcome_Adverse-effects", "Outcome_Mental", "Outcome_Physical", "Participant_Sample-size", "Participant_Condition", "Intervention_Physical", "Intervention_Surgical", "Outcome_Other", "Intervention_Pharmacological" ]
Crohn ' s disease is a Participant_Condition, intestinal resection is a Intervention_Physical, patients with Crohn ' s disease is a Participant_Condition, recurrence is a Outcome_Physical, metronidazole is a Intervention_Pharmacological, Patients at high risk of recurrence is a Participant_Condition, thiopurine is a Intervention_Pharmacological, adalimumab is a Intervention_Pharmacological, colonoscopy at 6 months is a Intervention_Surgical, ( active care ) is a Intervention_Physical, no colonoscopy ( standard care ) is a Intervention_Physical, endoscopic recurrence is a Outcome_Mental, The primary endpoint was endoscopic recurrence is a Outcome_Mental, 122 patients in the active care group is a Participant_Sample-size, p=0.03 is a Outcome_Other, Complete mucosal normality is a Outcome_Physical, months recurrence is a Outcome_Physical, in remission is a Outcome_Other, The incidence and type of adverse and severe adverse events is a Outcome_Adverse-effects, clinical risk of recurrence is a Outcome_Mental, postoperative Crohn ' s disease recurrence is a Outcome_Physical, disease control is a Outcome_Physical, predict recurrence is a Outcome_Other, need monitoring is a Outcome_Mental, Early remission is a Outcome_Physical
69455_task1
Sentence: Crohn 's disease management after intestinal resection : a randomised trial . BACKGROUND Most patients with Crohn 's disease need an intestinal resection , but a majority will subsequently experience disease recurrence and require further surgery . This study aimed to identify the optimal strategy to prevent postoperative disease recurrence . METHODS In this randomised trial , consecutive patients from 17 centres in Australia and New Zealand undergoing intestinal resection of all macroscopic Crohn 's disease , with an endoscopically accessible anastomosis , received 3 months of metronidazole therapy . Patients at high risk of recurrence also received a thiopurine , or adalimumab if they were intolerant to thiopurines . Patients were randomly assigned to parallel groups : colonoscopy at 6 months ( active care ) or no colonoscopy ( standard care ) . We used computer-generated block randomisation to allocate patients in each centre to active or standard care in a 2:1 ratio . For endoscopic recurrence ( Rutgeerts score ≥i2 ) at 6 months , patients stepped-up to thiopurine , fortnightly adalimumab with thiopurine , or weekly adalimumab . The primary endpoint was endoscopic recurrence at 18 months . Patients and treating physicians were aware of the patient 's study group and treatment , but central reading of the endoscopic findings was undertaken blind to the study group and treatment . Analysis included all patients who received at least one dose of study drug . This trial is registered with ClinicalTrials.gov , number NCT00989560 . FINDINGS Between Oct 13 , 2009 , and Sept 28 , 2011 , 174 ( 83 % high risk across both active and standard care groups ) patients were enrolled and received at least one dose of study drug . Of 122 patients in the active care group , 47 ( 39 % ) stepped-up treatment . At 18 months , endoscopic recurrence occurred in 60 ( 49 % ) patients in the active care group and 35 ( 67 % ) patients in the standard care group ( p=0.03 ) . Complete mucosal normality was maintained in 27 ( 22 % ) of 122 patients in the active care group versus four ( 8 % ) in the standard care group ( p=0.03 ) . In the active care arm , of those with 6 months recurrence who stepped up treatment , 18 ( 38 % ) of 47 patients were in remission 12 months later ; conversely , of those in remission at 6 months who did not change therapy recurrence occurred in 31 ( 41 % ) of 75 patients 12 months later . Smoking ( odds ratio [ OR ] 2.4 , 95 % CI 1.2-4.8 , p=0.02 ) and the presence of two or more clinical risk factors including smoking ( OR 2.8 , 95 % CI 1.01-7.7 , p=0.05 ) increased the risk of endoscopic recurrence . The incidence and type of adverse and severe adverse events did not differ significantly between patients in the active care and standard care groups ( 100 [ 82 % ] of 122 vs 45 [ 87 % ] of 52 ; p=0.51 ) and ( 33 [ 27 % ] of 122 vs 18 [ 35 % ] of 52 ; p=0.36 ) , respectively . INTERPRETATION Treatment according to clinical risk of recurrence , with early colonoscopy and treatment step-up for recurrence , is better than conventional drug therapy alone for prevention of postoperative Crohn 's disease recurrence . Selective immune suppression , adjusted for early recurrence , rather than routine use , leads to disease control in most patients . Clinical risk factors predict recurrence , but patients at low risk also need monitoring . Early remission does not preclude the need for ongoing monitoring . FUNDING AbbVie , Gutsy Group , Gandel Philanthropy , Angior Foundation , Crohn 's Colitis Australia , and the National Health and Medical Research Council . Instructions: please typing these entity words according to sentence: Crohn ' s disease, intestinal resection, patients with Crohn ' s disease, recurrence, metronidazole, Patients at high risk of recurrence, thiopurine, adalimumab, colonoscopy at 6 months, ( active care ), no colonoscopy ( standard care ), endoscopic recurrence, The primary endpoint was endoscopic recurrence, 122 patients in the active care group, p=0.03, Complete mucosal normality, months recurrence, in remission, The incidence and type of adverse and severe adverse events, clinical risk of recurrence, postoperative Crohn ' s disease recurrence, disease control, predict recurrence, need monitoring, Early remission Options: Intervention_Pharmacological, Outcome_Adverse-effects, Intervention_Physical, Participant_Condition, Outcome_Physical, Participant_Sample-size, Outcome_Other, Intervention_Surgical, Outcome_Mental
[ "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Surgical", "I-Intervention_Surgical", "I-Intervention_Surgical", "I-Intervention_Surgical", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Crohn 's disease management after intestinal resection : a randomised trial . BACKGROUND Most patients with Crohn 's disease need an intestinal resection , but a majority will subsequently experience disease recurrence and require further surgery . This study aimed to identify the optimal strategy to prevent postoperative disease recurrence . METHODS In this randomised trial , consecutive patients from 17 centres in Australia and New Zealand undergoing intestinal resection of all macroscopic Crohn 's disease , with an endoscopically accessible anastomosis , received 3 months of metronidazole therapy . Patients at high risk of recurrence also received a thiopurine , or adalimumab if they were intolerant to thiopurines . Patients were randomly assigned to parallel groups : colonoscopy at 6 months ( active care ) or no colonoscopy ( standard care ) . We used computer-generated block randomisation to allocate patients in each centre to active or standard care in a 2:1 ratio . For endoscopic recurrence ( Rutgeerts score ≥i2 ) at 6 months , patients stepped-up to thiopurine , fortnightly adalimumab with thiopurine , or weekly adalimumab . The primary endpoint was endoscopic recurrence at 18 months . Patients and treating physicians were aware of the patient 's study group and treatment , but central reading of the endoscopic findings was undertaken blind to the study group and treatment . Analysis included all patients who received at least one dose of study drug . This trial is registered with ClinicalTrials.gov , number NCT00989560 . FINDINGS Between Oct 13 , 2009 , and Sept 28 , 2011 , 174 ( 83 % high risk across both active and standard care groups ) patients were enrolled and received at least one dose of study drug . Of 122 patients in the active care group , 47 ( 39 % ) stepped-up treatment . At 18 months , endoscopic recurrence occurred in 60 ( 49 % ) patients in the active care group and 35 ( 67 % ) patients in the standard care group ( p=0.03 ) . Complete mucosal normality was maintained in 27 ( 22 % ) of 122 patients in the active care group versus four ( 8 % ) in the standard care group ( p=0.03 ) . In the active care arm , of those with 6 months recurrence who stepped up treatment , 18 ( 38 % ) of 47 patients were in remission 12 months later ; conversely , of those in remission at 6 months who did not change therapy recurrence occurred in 31 ( 41 % ) of 75 patients 12 months later . Smoking ( odds ratio [ OR ] 2.4 , 95 % CI 1.2-4.8 , p=0.02 ) and the presence of two or more clinical risk factors including smoking ( OR 2.8 , 95 % CI 1.01-7.7 , p=0.05 ) increased the risk of endoscopic recurrence . The incidence and type of adverse and severe adverse events did not differ significantly between patients in the active care and standard care groups ( 100 [ 82 % ] of 122 vs 45 [ 87 % ] of 52 ; p=0.51 ) and ( 33 [ 27 % ] of 122 vs 18 [ 35 % ] of 52 ; p=0.36 ) , respectively . INTERPRETATION Treatment according to clinical risk of recurrence , with early colonoscopy and treatment step-up for recurrence , is better than conventional drug therapy alone for prevention of postoperative Crohn 's disease recurrence . Selective immune suppression , adjusted for early recurrence , rather than routine use , leads to disease control in most patients . Clinical risk factors predict recurrence , but patients at low risk also need monitoring . Early remission does not preclude the need for ongoing monitoring . FUNDING AbbVie , Gutsy Group , Gandel Philanthropy , Angior Foundation , Crohn 's Colitis Australia , and the National Health and Medical Research Council .
[ "Crohn", "'", "s", "disease", "management", "after", "intestinal", "resection", ":", "a", "randomised", "trial", ".", "BACKGROUND", "Most", "patients", "with", "Crohn", "'", "s", "disease", "need", "an", "intestinal", "resection", ",", "but", "a", "majority", "will", "subsequently", "experience", "disease", "recurrence", "and", "require", "further", "surgery", ".", "This", "study", "aimed", "to", "identify", "the", "optimal", "strategy", "to", "prevent", "postoperative", "disease", "recurrence", ".", "METHODS", "In", "this", "randomised", "trial", ",", "consecutive", "patients", "from", "17", "centres", "in", "Australia", "and", "New", "Zealand", "undergoing", "intestinal", "resection", "of", "all", "macroscopic", "Crohn", "'", "s", "disease", ",", "with", "an", "endoscopically", "accessible", "anastomosis", ",", "received", "3", "months", "of", "metronidazole", "therapy", ".", "Patients", "at", "high", "risk", "of", "recurrence", "also", "received", "a", "thiopurine", ",", "or", "adalimumab", "if", "they", "were", "intolerant", "to", "thiopurines", ".", "Patients", "were", "randomly", "assigned", "to", "parallel", "groups", ":", "colonoscopy", "at", "6", "months", "(", "active", "care", ")", "or", "no", "colonoscopy", "(", "standard", "care", ")", ".", "We", "used", "computer", "-", "generated", "block", "randomisation", "to", "allocate", "patients", "in", "each", "centre", "to", "active", "or", "standard", "care", "in", "a", "2:1", "ratio", ".", "For", "endoscopic", "recurrence", "(", "Rutgeerts", "score", "≥i2", ")", "at", "6", "months", ",", "patients", "stepped", "-", "up", "to", "thiopurine", ",", "fortnightly", "adalimumab", "with", "thiopurine", ",", "or", "weekly", "adalimumab", ".", "The", "primary", "endpoint", "was", "endoscopic", "recurrence", "at", "18", "months", ".", "Patients", "and", "treating", "physicians", "were", "aware", "of", "the", "patient", "'", "s", "study", "group", "and", "treatment", ",", "but", "central", "reading", "of", "the", "endoscopic", "findings", "was", "undertaken", "blind", "to", "the", "study", "group", "and", "treatment", ".", "Analysis", "included", "all", "patients", "who", "received", "at", "least", "one", "dose", "of", "study", "drug", ".", "This", "trial", "is", "registered", "with", "ClinicalTrials.gov", ",", "number", "NCT00989560", ".", "FINDINGS", "Between", "Oct", "13", ",", "2009", ",", "and", "Sept", "28", ",", "2011", ",", "174", "(", "83", "%", "high", "risk", "across", "both", "active", "and", "standard", "care", "groups", ")", "patients", "were", "enrolled", "and", "received", "at", "least", "one", "dose", "of", "study", "drug", ".", "Of", "122", "patients", "in", "the", "active", "care", "group", ",", "47", "(", "39", "%", ")", "stepped", "-", "up", "treatment", ".", "At", "18", "months", ",", "endoscopic", "recurrence", "occurred", "in", "60", "(", "49", "%", ")", "patients", "in", "the", "active", "care", "group", "and", "35", "(", "67", "%", ")", "patients", "in", "the", "standard", "care", "group", "(", "p=0.03", ")", ".", "Complete", "mucosal", "normality", "was", "maintained", "in", "27", "(", "22", "%", ")", "of", "122", "patients", "in", "the", "active", "care", "group", "versus", "four", "(", "8", "%", ")", "in", "the", "standard", "care", "group", "(", "p=0.03", ")", ".", "In", "the", "active", "care", "arm", ",", "of", "those", "with", "6", "months", "recurrence", "who", "stepped", "up", "treatment", ",", "18", "(", "38", "%", ")", "of", "47", "patients", "were", "in", "remission", "12", "months", "later", ";", "conversely", ",", "of", "those", "in", "remission", "at", "6", "months", "who", "did", "not", "change", "therapy", "recurrence", "occurred", "in", "31", "(", "41", "%", ")", "of", "75", "patients", "12", "months", "later", ".", "Smoking", "(", "odds", "ratio", "[", "OR", "]", "2.4", ",", "95", "%", "CI", "1.2", "-", "4.8", ",", "p=0.02", ")", "and", "the", "presence", "of", "two", "or", "more", "clinical", "risk", "factors", "including", "smoking", "(", "OR", "2.8", ",", "95", "%", "CI", "1.01", "-", "7.7", ",", "p=0.05", ")", "increased", "the", "risk", "of", "endoscopic", "recurrence", ".", "The", "incidence", "and", "type", "of", "adverse", "and", "severe", "adverse", "events", "did", "not", "differ", "significantly", "between", "patients", "in", "the", "active", "care", "and", "standard", "care", "groups", "(", "100", "[", "82", "%", "]", "of", "122", "vs", "45", "[", "87", "%", "]", "of", "52", ";", "p=0.51", ")", "and", "(", "33", "[", "27", "%", "]", "of", "122", "vs", "18", "[", "35", "%", "]", "of", "52", ";", "p=0.36", ")", ",", "respectively", ".", "INTERPRETATION", "Treatment", "according", "to", "clinical", "risk", "of", "recurrence", ",", "with", "early", "colonoscopy", "and", "treatment", "step", "-", "up", "for", "recurrence", ",", "is", "better", "than", "conventional", "drug", "therapy", "alone", "for", "prevention", "of", "postoperative", "Crohn", "'", "s", "disease", "recurrence", ".", "Selective", "immune", "suppression", ",", "adjusted", "for", "early", "recurrence", ",", "rather", "than", "routine", "use", ",", "leads", "to", "disease", "control", "in", "most", "patients", ".", "Clinical", "risk", "factors", "predict", "recurrence", ",", "but", "patients", "at", "low", "risk", "also", "need", "monitoring", ".", "Early", "remission", "does", "not", "preclude", "the", "need", "for", "ongoing", "monitoring", ".", "FUNDING", "AbbVie", ",", "Gutsy", "Group", ",", "Gandel", "Philanthropy", ",", "Angior", "Foundation", ",", "Crohn", "'", "s", "Colitis", "Australia", ",", "and", "the", "National", "Health", "and", "Medical", "Research", "Council", "." ]
[ "Outcome_Adverse-effects", "Outcome_Mental", "Outcome_Physical", "Participant_Sample-size", "Participant_Condition", "Intervention_Physical", "Intervention_Surgical", "Outcome_Other", "Intervention_Pharmacological" ]
Crohn ' s disease, intestinal resection, patients with Crohn ' s disease, recurrence, metronidazole, Patients at high risk of recurrence, thiopurine, adalimumab, colonoscopy at 6 months, ( active care ), no colonoscopy ( standard care ), endoscopic recurrence, The primary endpoint was endoscopic recurrence, 122 patients in the active care group, p=0.03, Complete mucosal normality, months recurrence, in remission, The incidence and type of adverse and severe adverse events, clinical risk of recurrence, postoperative Crohn ' s disease recurrence, disease control, predict recurrence, need monitoring, Early remission
69455_task2
Sentence: Crohn 's disease management after intestinal resection : a randomised trial . BACKGROUND Most patients with Crohn 's disease need an intestinal resection , but a majority will subsequently experience disease recurrence and require further surgery . This study aimed to identify the optimal strategy to prevent postoperative disease recurrence . METHODS In this randomised trial , consecutive patients from 17 centres in Australia and New Zealand undergoing intestinal resection of all macroscopic Crohn 's disease , with an endoscopically accessible anastomosis , received 3 months of metronidazole therapy . Patients at high risk of recurrence also received a thiopurine , or adalimumab if they were intolerant to thiopurines . Patients were randomly assigned to parallel groups : colonoscopy at 6 months ( active care ) or no colonoscopy ( standard care ) . We used computer-generated block randomisation to allocate patients in each centre to active or standard care in a 2:1 ratio . For endoscopic recurrence ( Rutgeerts score ≥i2 ) at 6 months , patients stepped-up to thiopurine , fortnightly adalimumab with thiopurine , or weekly adalimumab . The primary endpoint was endoscopic recurrence at 18 months . Patients and treating physicians were aware of the patient 's study group and treatment , but central reading of the endoscopic findings was undertaken blind to the study group and treatment . Analysis included all patients who received at least one dose of study drug . This trial is registered with ClinicalTrials.gov , number NCT00989560 . FINDINGS Between Oct 13 , 2009 , and Sept 28 , 2011 , 174 ( 83 % high risk across both active and standard care groups ) patients were enrolled and received at least one dose of study drug . Of 122 patients in the active care group , 47 ( 39 % ) stepped-up treatment . At 18 months , endoscopic recurrence occurred in 60 ( 49 % ) patients in the active care group and 35 ( 67 % ) patients in the standard care group ( p=0.03 ) . Complete mucosal normality was maintained in 27 ( 22 % ) of 122 patients in the active care group versus four ( 8 % ) in the standard care group ( p=0.03 ) . In the active care arm , of those with 6 months recurrence who stepped up treatment , 18 ( 38 % ) of 47 patients were in remission 12 months later ; conversely , of those in remission at 6 months who did not change therapy recurrence occurred in 31 ( 41 % ) of 75 patients 12 months later . Smoking ( odds ratio [ OR ] 2.4 , 95 % CI 1.2-4.8 , p=0.02 ) and the presence of two or more clinical risk factors including smoking ( OR 2.8 , 95 % CI 1.01-7.7 , p=0.05 ) increased the risk of endoscopic recurrence . The incidence and type of adverse and severe adverse events did not differ significantly between patients in the active care and standard care groups ( 100 [ 82 % ] of 122 vs 45 [ 87 % ] of 52 ; p=0.51 ) and ( 33 [ 27 % ] of 122 vs 18 [ 35 % ] of 52 ; p=0.36 ) , respectively . INTERPRETATION Treatment according to clinical risk of recurrence , with early colonoscopy and treatment step-up for recurrence , is better than conventional drug therapy alone for prevention of postoperative Crohn 's disease recurrence . Selective immune suppression , adjusted for early recurrence , rather than routine use , leads to disease control in most patients . Clinical risk factors predict recurrence , but patients at low risk also need monitoring . Early remission does not preclude the need for ongoing monitoring . FUNDING AbbVie , Gutsy Group , Gandel Philanthropy , Angior Foundation , Crohn 's Colitis Australia , and the National Health and Medical Research Council . Instructions: please extract entity words from the input sentence
[ "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Surgical", "I-Intervention_Surgical", "I-Intervention_Surgical", "I-Intervention_Surgical", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Crohn 's disease management after intestinal resection : a randomised trial . BACKGROUND Most patients with Crohn 's disease need an intestinal resection , but a majority will subsequently experience disease recurrence and require further surgery . This study aimed to identify the optimal strategy to prevent postoperative disease recurrence . METHODS In this randomised trial , consecutive patients from 17 centres in Australia and New Zealand undergoing intestinal resection of all macroscopic Crohn 's disease , with an endoscopically accessible anastomosis , received 3 months of metronidazole therapy . Patients at high risk of recurrence also received a thiopurine , or adalimumab if they were intolerant to thiopurines . Patients were randomly assigned to parallel groups : colonoscopy at 6 months ( active care ) or no colonoscopy ( standard care ) . We used computer-generated block randomisation to allocate patients in each centre to active or standard care in a 2:1 ratio . For endoscopic recurrence ( Rutgeerts score ≥i2 ) at 6 months , patients stepped-up to thiopurine , fortnightly adalimumab with thiopurine , or weekly adalimumab . The primary endpoint was endoscopic recurrence at 18 months . Patients and treating physicians were aware of the patient 's study group and treatment , but central reading of the endoscopic findings was undertaken blind to the study group and treatment . Analysis included all patients who received at least one dose of study drug . This trial is registered with ClinicalTrials.gov , number NCT00989560 . FINDINGS Between Oct 13 , 2009 , and Sept 28 , 2011 , 174 ( 83 % high risk across both active and standard care groups ) patients were enrolled and received at least one dose of study drug . Of 122 patients in the active care group , 47 ( 39 % ) stepped-up treatment . At 18 months , endoscopic recurrence occurred in 60 ( 49 % ) patients in the active care group and 35 ( 67 % ) patients in the standard care group ( p=0.03 ) . Complete mucosal normality was maintained in 27 ( 22 % ) of 122 patients in the active care group versus four ( 8 % ) in the standard care group ( p=0.03 ) . In the active care arm , of those with 6 months recurrence who stepped up treatment , 18 ( 38 % ) of 47 patients were in remission 12 months later ; conversely , of those in remission at 6 months who did not change therapy recurrence occurred in 31 ( 41 % ) of 75 patients 12 months later . Smoking ( odds ratio [ OR ] 2.4 , 95 % CI 1.2-4.8 , p=0.02 ) and the presence of two or more clinical risk factors including smoking ( OR 2.8 , 95 % CI 1.01-7.7 , p=0.05 ) increased the risk of endoscopic recurrence . The incidence and type of adverse and severe adverse events did not differ significantly between patients in the active care and standard care groups ( 100 [ 82 % ] of 122 vs 45 [ 87 % ] of 52 ; p=0.51 ) and ( 33 [ 27 % ] of 122 vs 18 [ 35 % ] of 52 ; p=0.36 ) , respectively . INTERPRETATION Treatment according to clinical risk of recurrence , with early colonoscopy and treatment step-up for recurrence , is better than conventional drug therapy alone for prevention of postoperative Crohn 's disease recurrence . Selective immune suppression , adjusted for early recurrence , rather than routine use , leads to disease control in most patients . Clinical risk factors predict recurrence , but patients at low risk also need monitoring . Early remission does not preclude the need for ongoing monitoring . FUNDING AbbVie , Gutsy Group , Gandel Philanthropy , Angior Foundation , Crohn 's Colitis Australia , and the National Health and Medical Research Council .
[ "Crohn", "'", "s", "disease", "management", "after", "intestinal", "resection", ":", "a", "randomised", "trial", ".", "BACKGROUND", "Most", "patients", "with", "Crohn", "'", "s", "disease", "need", "an", "intestinal", "resection", ",", "but", "a", "majority", "will", "subsequently", "experience", "disease", "recurrence", "and", "require", "further", "surgery", ".", "This", "study", "aimed", "to", "identify", "the", "optimal", "strategy", "to", "prevent", "postoperative", "disease", "recurrence", ".", "METHODS", "In", "this", "randomised", "trial", ",", "consecutive", "patients", "from", "17", "centres", "in", "Australia", "and", "New", "Zealand", "undergoing", "intestinal", "resection", "of", "all", "macroscopic", "Crohn", "'", "s", "disease", ",", "with", "an", "endoscopically", "accessible", "anastomosis", ",", "received", "3", "months", "of", "metronidazole", "therapy", ".", "Patients", "at", "high", "risk", "of", "recurrence", "also", "received", "a", "thiopurine", ",", "or", "adalimumab", "if", "they", "were", "intolerant", "to", "thiopurines", ".", "Patients", "were", "randomly", "assigned", "to", "parallel", "groups", ":", "colonoscopy", "at", "6", "months", "(", "active", "care", ")", "or", "no", "colonoscopy", "(", "standard", "care", ")", ".", "We", "used", "computer", "-", "generated", "block", "randomisation", "to", "allocate", "patients", "in", "each", "centre", "to", "active", "or", "standard", "care", "in", "a", "2:1", "ratio", ".", "For", "endoscopic", "recurrence", "(", "Rutgeerts", "score", "≥i2", ")", "at", "6", "months", ",", "patients", "stepped", "-", "up", "to", "thiopurine", ",", "fortnightly", "adalimumab", "with", "thiopurine", ",", "or", "weekly", "adalimumab", ".", "The", "primary", "endpoint", "was", "endoscopic", "recurrence", "at", "18", "months", ".", "Patients", "and", "treating", "physicians", "were", "aware", "of", "the", "patient", "'", "s", "study", "group", "and", "treatment", ",", "but", "central", "reading", "of", "the", "endoscopic", "findings", "was", "undertaken", "blind", "to", "the", "study", "group", "and", "treatment", ".", "Analysis", "included", "all", "patients", "who", "received", "at", "least", "one", "dose", "of", "study", "drug", ".", "This", "trial", "is", "registered", "with", "ClinicalTrials.gov", ",", "number", "NCT00989560", ".", "FINDINGS", "Between", "Oct", "13", ",", "2009", ",", "and", "Sept", "28", ",", "2011", ",", "174", "(", "83", "%", "high", "risk", "across", "both", "active", "and", "standard", "care", "groups", ")", "patients", "were", "enrolled", "and", "received", "at", "least", "one", "dose", "of", "study", "drug", ".", "Of", "122", "patients", "in", "the", "active", "care", "group", ",", "47", "(", "39", "%", ")", "stepped", "-", "up", "treatment", ".", "At", "18", "months", ",", "endoscopic", "recurrence", "occurred", "in", "60", "(", "49", "%", ")", "patients", "in", "the", "active", "care", "group", "and", "35", "(", "67", "%", ")", "patients", "in", "the", "standard", "care", "group", "(", "p=0.03", ")", ".", "Complete", "mucosal", "normality", "was", "maintained", "in", "27", "(", "22", "%", ")", "of", "122", "patients", "in", "the", "active", "care", "group", "versus", "four", "(", "8", "%", ")", "in", "the", "standard", "care", "group", "(", "p=0.03", ")", ".", "In", "the", "active", "care", "arm", ",", "of", "those", "with", "6", "months", "recurrence", "who", "stepped", "up", "treatment", ",", "18", "(", "38", "%", ")", "of", "47", "patients", "were", "in", "remission", "12", "months", "later", ";", "conversely", ",", "of", "those", "in", "remission", "at", "6", "months", "who", "did", "not", "change", "therapy", "recurrence", "occurred", "in", "31", "(", "41", "%", ")", "of", "75", "patients", "12", "months", "later", ".", "Smoking", "(", "odds", "ratio", "[", "OR", "]", "2.4", ",", "95", "%", "CI", "1.2", "-", "4.8", ",", "p=0.02", ")", "and", "the", "presence", "of", "two", "or", "more", "clinical", "risk", "factors", "including", "smoking", "(", "OR", "2.8", ",", "95", "%", "CI", "1.01", "-", "7.7", ",", "p=0.05", ")", "increased", "the", "risk", "of", "endoscopic", "recurrence", ".", "The", "incidence", "and", "type", "of", "adverse", "and", "severe", "adverse", "events", "did", "not", "differ", "significantly", "between", "patients", "in", "the", "active", "care", "and", "standard", "care", "groups", "(", "100", "[", "82", "%", "]", "of", "122", "vs", "45", "[", "87", "%", "]", "of", "52", ";", "p=0.51", ")", "and", "(", "33", "[", "27", "%", "]", "of", "122", "vs", "18", "[", "35", "%", "]", "of", "52", ";", "p=0.36", ")", ",", "respectively", ".", "INTERPRETATION", "Treatment", "according", "to", "clinical", "risk", "of", "recurrence", ",", "with", "early", "colonoscopy", "and", "treatment", "step", "-", "up", "for", "recurrence", ",", "is", "better", "than", "conventional", "drug", "therapy", "alone", "for", "prevention", "of", "postoperative", "Crohn", "'", "s", "disease", "recurrence", ".", "Selective", "immune", "suppression", ",", "adjusted", "for", "early", "recurrence", ",", "rather", "than", "routine", "use", ",", "leads", "to", "disease", "control", "in", "most", "patients", ".", "Clinical", "risk", "factors", "predict", "recurrence", ",", "but", "patients", "at", "low", "risk", "also", "need", "monitoring", ".", "Early", "remission", "does", "not", "preclude", "the", "need", "for", "ongoing", "monitoring", ".", "FUNDING", "AbbVie", ",", "Gutsy", "Group", ",", "Gandel", "Philanthropy", ",", "Angior", "Foundation", ",", "Crohn", "'", "s", "Colitis", "Australia", ",", "and", "the", "National", "Health", "and", "Medical", "Research", "Council", "." ]
[ "Outcome_Adverse-effects", "Outcome_Mental", "Outcome_Physical", "Participant_Sample-size", "Participant_Condition", "Intervention_Physical", "Intervention_Surgical", "Outcome_Other", "Intervention_Pharmacological" ]
acne is an umlsterm, dermatosis is an umlsterm, skin is an umlsterm, radiation is an umlsterm, patient is an umlsterm, carcinoma is an umlsterm, acne is an umlsterm, cysts is an umlsterm, skin is an umlsterm, photon is an umlsterm, drugs is an umlsterm, disease is an umlsterm, patient is an umlsterm, therapy is an umlsterm, carbamazepine is an umlsterm, testosterone is an umlsterm, glucocorticoids is an umlsterm, Treatment is an umlsterm, acne is an umlsterm, retinoids is an umlsterm
DerHautarzt.00510187.eng.abstr_task0
Sentence: Radiation-induced acne is a rare , clinically and pathogenetically ill-defined acneiform dermatosis with special features that may occur in irradiated skin areas especially after high doses of deeply penetrating radiation . We report on a patient with an oropharyngeal carcinoma who developed severe radiation-induced acne including comedones and cysts as well as few inflammatory papules and pustules in a skin area irradiated with up to 63 gray of a 6 MeV photon beam . Acnegenic drugs may precipitate the disease ; our patient was on longterm therapy with carbamazepine whose acnegenic potency is less well documented than that of testosterone or glucocorticoids . Treatment of radiation-induced acne is comedolytic ; topical retinoids are especially valuable . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Radiation-induced acne is a rare , clinically and pathogenetically ill-defined acneiform dermatosis with special features that may occur in irradiated skin areas especially after high doses of deeply penetrating radiation . We report on a patient with an oropharyngeal carcinoma who developed severe radiation-induced acne including comedones and cysts as well as few inflammatory papules and pustules in a skin area irradiated with up to 63 gray of a 6 MeV photon beam . Acnegenic drugs may precipitate the disease ; our patient was on longterm therapy with carbamazepine whose acnegenic potency is less well documented than that of testosterone or glucocorticoids . Treatment of radiation-induced acne is comedolytic ; topical retinoids are especially valuable .
[ "Radiation", "-", "induced", "acne", "is", "a", "rare", ",", "clinically", "and", "pathogenetically", "ill", "-", "defined", "acneiform", "dermatosis", "with", "special", "features", "that", "may", "occur", "in", "irradiated", "skin", "areas", "especially", "after", "high", "doses", "of", "deeply", "penetrating", "radiation", ".", "We", "report", "on", "a", "patient", "with", "an", "oropharyngeal", "carcinoma", "who", "developed", "severe", "radiation", "-", "induced", "acne", "including", "comedones", "and", "cysts", "as", "well", "as", "few", "inflammatory", "papules", "and", "pustules", "in", "a", "skin", "area", "irradiated", "with", "up", "to", "63", "gray", "of", "a", "6", "MeV", "photon", "beam", ".", "Acnegenic", "drugs", "may", "precipitate", "the", "disease", ";", "our", "patient", "was", "on", "longterm", "therapy", "with", "carbamazepine", "whose", "acnegenic", "potency", "is", "less", "well", "documented", "than", "that", "of", "testosterone", "or", "glucocorticoids", ".", "Treatment", "of", "radiation", "-", "induced", "acne", "is", "comedolytic", ";", "topical", "retinoids", "are", "especially", "valuable", "." ]
[ "umlsterm" ]
acne is an umlsterm, dermatosis is an umlsterm, skin is an umlsterm, radiation is an umlsterm, patient is an umlsterm, carcinoma is an umlsterm, acne is an umlsterm, cysts is an umlsterm, skin is an umlsterm, photon is an umlsterm, drugs is an umlsterm, disease is an umlsterm, patient is an umlsterm, therapy is an umlsterm, carbamazepine is an umlsterm, testosterone is an umlsterm, glucocorticoids is an umlsterm, Treatment is an umlsterm, acne is an umlsterm, retinoids is an umlsterm
DerHautarzt.00510187.eng.abstr_task1
Sentence: Radiation-induced acne is a rare , clinically and pathogenetically ill-defined acneiform dermatosis with special features that may occur in irradiated skin areas especially after high doses of deeply penetrating radiation . We report on a patient with an oropharyngeal carcinoma who developed severe radiation-induced acne including comedones and cysts as well as few inflammatory papules and pustules in a skin area irradiated with up to 63 gray of a 6 MeV photon beam . Acnegenic drugs may precipitate the disease ; our patient was on longterm therapy with carbamazepine whose acnegenic potency is less well documented than that of testosterone or glucocorticoids . Treatment of radiation-induced acne is comedolytic ; topical retinoids are especially valuable . Instructions: please typing these entity words according to sentence: acne, dermatosis, skin, radiation, patient, carcinoma, acne, cysts, skin, photon, drugs, disease, patient, therapy, carbamazepine, testosterone, glucocorticoids, Treatment, acne, retinoids Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Radiation-induced acne is a rare , clinically and pathogenetically ill-defined acneiform dermatosis with special features that may occur in irradiated skin areas especially after high doses of deeply penetrating radiation . We report on a patient with an oropharyngeal carcinoma who developed severe radiation-induced acne including comedones and cysts as well as few inflammatory papules and pustules in a skin area irradiated with up to 63 gray of a 6 MeV photon beam . Acnegenic drugs may precipitate the disease ; our patient was on longterm therapy with carbamazepine whose acnegenic potency is less well documented than that of testosterone or glucocorticoids . Treatment of radiation-induced acne is comedolytic ; topical retinoids are especially valuable .
[ "Radiation", "-", "induced", "acne", "is", "a", "rare", ",", "clinically", "and", "pathogenetically", "ill", "-", "defined", "acneiform", "dermatosis", "with", "special", "features", "that", "may", "occur", "in", "irradiated", "skin", "areas", "especially", "after", "high", "doses", "of", "deeply", "penetrating", "radiation", ".", "We", "report", "on", "a", "patient", "with", "an", "oropharyngeal", "carcinoma", "who", "developed", "severe", "radiation", "-", "induced", "acne", "including", "comedones", "and", "cysts", "as", "well", "as", "few", "inflammatory", "papules", "and", "pustules", "in", "a", "skin", "area", "irradiated", "with", "up", "to", "63", "gray", "of", "a", "6", "MeV", "photon", "beam", ".", "Acnegenic", "drugs", "may", "precipitate", "the", "disease", ";", "our", "patient", "was", "on", "longterm", "therapy", "with", "carbamazepine", "whose", "acnegenic", "potency", "is", "less", "well", "documented", "than", "that", "of", "testosterone", "or", "glucocorticoids", ".", "Treatment", "of", "radiation", "-", "induced", "acne", "is", "comedolytic", ";", "topical", "retinoids", "are", "especially", "valuable", "." ]
[ "umlsterm" ]
acne, dermatosis, skin, radiation, patient, carcinoma, acne, cysts, skin, photon, drugs, disease, patient, therapy, carbamazepine, testosterone, glucocorticoids, Treatment, acne, retinoids
DerHautarzt.00510187.eng.abstr_task2
Sentence: Radiation-induced acne is a rare , clinically and pathogenetically ill-defined acneiform dermatosis with special features that may occur in irradiated skin areas especially after high doses of deeply penetrating radiation . We report on a patient with an oropharyngeal carcinoma who developed severe radiation-induced acne including comedones and cysts as well as few inflammatory papules and pustules in a skin area irradiated with up to 63 gray of a 6 MeV photon beam . Acnegenic drugs may precipitate the disease ; our patient was on longterm therapy with carbamazepine whose acnegenic potency is less well documented than that of testosterone or glucocorticoids . Treatment of radiation-induced acne is comedolytic ; topical retinoids are especially valuable . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Radiation-induced acne is a rare , clinically and pathogenetically ill-defined acneiform dermatosis with special features that may occur in irradiated skin areas especially after high doses of deeply penetrating radiation . We report on a patient with an oropharyngeal carcinoma who developed severe radiation-induced acne including comedones and cysts as well as few inflammatory papules and pustules in a skin area irradiated with up to 63 gray of a 6 MeV photon beam . Acnegenic drugs may precipitate the disease ; our patient was on longterm therapy with carbamazepine whose acnegenic potency is less well documented than that of testosterone or glucocorticoids . Treatment of radiation-induced acne is comedolytic ; topical retinoids are especially valuable .
[ "Radiation", "-", "induced", "acne", "is", "a", "rare", ",", "clinically", "and", "pathogenetically", "ill", "-", "defined", "acneiform", "dermatosis", "with", "special", "features", "that", "may", "occur", "in", "irradiated", "skin", "areas", "especially", "after", "high", "doses", "of", "deeply", "penetrating", "radiation", ".", "We", "report", "on", "a", "patient", "with", "an", "oropharyngeal", "carcinoma", "who", "developed", "severe", "radiation", "-", "induced", "acne", "including", "comedones", "and", "cysts", "as", "well", "as", "few", "inflammatory", "papules", "and", "pustules", "in", "a", "skin", "area", "irradiated", "with", "up", "to", "63", "gray", "of", "a", "6", "MeV", "photon", "beam", ".", "Acnegenic", "drugs", "may", "precipitate", "the", "disease", ";", "our", "patient", "was", "on", "longterm", "therapy", "with", "carbamazepine", "whose", "acnegenic", "potency", "is", "less", "well", "documented", "than", "that", "of", "testosterone", "or", "glucocorticoids", ".", "Treatment", "of", "radiation", "-", "induced", "acne", "is", "comedolytic", ";", "topical", "retinoids", "are", "especially", "valuable", "." ]
[ "umlsterm" ]
Tumoren is an umlsterm, Hauttumoren is an umlsterm, Frau is an umlsterm, Literatur is an umlsterm, Tumore is an umlsterm, Klassifikation is an umlsterm
DerHautarzt.70480417.ger.abstr_task0
Sentence: Die Tumoren des Haarkeims sind eine Gruppe von Hauttumoren , in denen man teilweise oder vollstaendig den Entstehungsprozess des Haarfollikels beobachten kann . Das Trichoblastom stellt das benigne , epitheliale Extrem des Spektrums dar . Wir berichten von einem Fall einer 32jaehrigen Frau mit adenozystischem Trichoblastom als auschliesslich adenoid-zystisch aufgebauter Laesion , einer in der Literatur sehr selten beschriebenen Variante . Ausserdem wird ein geschichtlicher Ueberblick ueber die Tumore des Haarfollikels und die damit verbundenen Probleme ihrer Klassifikation gegeben . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die Tumoren des Haarkeims sind eine Gruppe von Hauttumoren , in denen man teilweise oder vollstaendig den Entstehungsprozess des Haarfollikels beobachten kann . Das Trichoblastom stellt das benigne , epitheliale Extrem des Spektrums dar . Wir berichten von einem Fall einer 32jaehrigen Frau mit adenozystischem Trichoblastom als auschliesslich adenoid-zystisch aufgebauter Laesion , einer in der Literatur sehr selten beschriebenen Variante . Ausserdem wird ein geschichtlicher Ueberblick ueber die Tumore des Haarfollikels und die damit verbundenen Probleme ihrer Klassifikation gegeben .
[ "Die", "Tumoren", "des", "Haarkeims", "sind", "eine", "Gruppe", "von", "Hauttumoren", ",", "in", "denen", "man", "teilweise", "oder", "vollstaendig", "den", "Entstehungsprozess", "des", "Haarfollikels", "beobachten", "kann", ".", "Das", "Trichoblastom", "stellt", "das", "benigne", ",", "epitheliale", "Extrem", "des", "Spektrums", "dar", ".", "Wir", "berichten", "von", "einem", "Fall", "einer", "32jaehrigen", "Frau", "mit", "adenozystischem", "Trichoblastom", "als", "auschliesslich", "adenoid", "-", "zystisch", "aufgebauter", "Laesion", ",", "einer", "in", "der", "Literatur", "sehr", "selten", "beschriebenen", "Variante", ".", "Ausserdem", "wird", "ein", "geschichtlicher", "Ueberblick", "ueber", "die", "Tumore", "des", "Haarfollikels", "und", "die", "damit", "verbundenen", "Probleme", "ihrer", "Klassifikation", "gegeben", "." ]
[ "umlsterm" ]
Tumoren is an umlsterm, Hauttumoren is an umlsterm, Frau is an umlsterm, Literatur is an umlsterm, Tumore is an umlsterm, Klassifikation is an umlsterm
DerHautarzt.70480417.ger.abstr_task1
Sentence: Die Tumoren des Haarkeims sind eine Gruppe von Hauttumoren , in denen man teilweise oder vollstaendig den Entstehungsprozess des Haarfollikels beobachten kann . Das Trichoblastom stellt das benigne , epitheliale Extrem des Spektrums dar . Wir berichten von einem Fall einer 32jaehrigen Frau mit adenozystischem Trichoblastom als auschliesslich adenoid-zystisch aufgebauter Laesion , einer in der Literatur sehr selten beschriebenen Variante . Ausserdem wird ein geschichtlicher Ueberblick ueber die Tumore des Haarfollikels und die damit verbundenen Probleme ihrer Klassifikation gegeben . Instructions: please typing these entity words according to sentence: Tumoren, Hauttumoren, Frau, Literatur, Tumore, Klassifikation Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die Tumoren des Haarkeims sind eine Gruppe von Hauttumoren , in denen man teilweise oder vollstaendig den Entstehungsprozess des Haarfollikels beobachten kann . Das Trichoblastom stellt das benigne , epitheliale Extrem des Spektrums dar . Wir berichten von einem Fall einer 32jaehrigen Frau mit adenozystischem Trichoblastom als auschliesslich adenoid-zystisch aufgebauter Laesion , einer in der Literatur sehr selten beschriebenen Variante . Ausserdem wird ein geschichtlicher Ueberblick ueber die Tumore des Haarfollikels und die damit verbundenen Probleme ihrer Klassifikation gegeben .
[ "Die", "Tumoren", "des", "Haarkeims", "sind", "eine", "Gruppe", "von", "Hauttumoren", ",", "in", "denen", "man", "teilweise", "oder", "vollstaendig", "den", "Entstehungsprozess", "des", "Haarfollikels", "beobachten", "kann", ".", "Das", "Trichoblastom", "stellt", "das", "benigne", ",", "epitheliale", "Extrem", "des", "Spektrums", "dar", ".", "Wir", "berichten", "von", "einem", "Fall", "einer", "32jaehrigen", "Frau", "mit", "adenozystischem", "Trichoblastom", "als", "auschliesslich", "adenoid", "-", "zystisch", "aufgebauter", "Laesion", ",", "einer", "in", "der", "Literatur", "sehr", "selten", "beschriebenen", "Variante", ".", "Ausserdem", "wird", "ein", "geschichtlicher", "Ueberblick", "ueber", "die", "Tumore", "des", "Haarfollikels", "und", "die", "damit", "verbundenen", "Probleme", "ihrer", "Klassifikation", "gegeben", "." ]
[ "umlsterm" ]
Tumoren, Hauttumoren, Frau, Literatur, Tumore, Klassifikation
DerHautarzt.70480417.ger.abstr_task2
Sentence: Die Tumoren des Haarkeims sind eine Gruppe von Hauttumoren , in denen man teilweise oder vollstaendig den Entstehungsprozess des Haarfollikels beobachten kann . Das Trichoblastom stellt das benigne , epitheliale Extrem des Spektrums dar . Wir berichten von einem Fall einer 32jaehrigen Frau mit adenozystischem Trichoblastom als auschliesslich adenoid-zystisch aufgebauter Laesion , einer in der Literatur sehr selten beschriebenen Variante . Ausserdem wird ein geschichtlicher Ueberblick ueber die Tumore des Haarfollikels und die damit verbundenen Probleme ihrer Klassifikation gegeben . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die Tumoren des Haarkeims sind eine Gruppe von Hauttumoren , in denen man teilweise oder vollstaendig den Entstehungsprozess des Haarfollikels beobachten kann . Das Trichoblastom stellt das benigne , epitheliale Extrem des Spektrums dar . Wir berichten von einem Fall einer 32jaehrigen Frau mit adenozystischem Trichoblastom als auschliesslich adenoid-zystisch aufgebauter Laesion , einer in der Literatur sehr selten beschriebenen Variante . Ausserdem wird ein geschichtlicher Ueberblick ueber die Tumore des Haarfollikels und die damit verbundenen Probleme ihrer Klassifikation gegeben .
[ "Die", "Tumoren", "des", "Haarkeims", "sind", "eine", "Gruppe", "von", "Hauttumoren", ",", "in", "denen", "man", "teilweise", "oder", "vollstaendig", "den", "Entstehungsprozess", "des", "Haarfollikels", "beobachten", "kann", ".", "Das", "Trichoblastom", "stellt", "das", "benigne", ",", "epitheliale", "Extrem", "des", "Spektrums", "dar", ".", "Wir", "berichten", "von", "einem", "Fall", "einer", "32jaehrigen", "Frau", "mit", "adenozystischem", "Trichoblastom", "als", "auschliesslich", "adenoid", "-", "zystisch", "aufgebauter", "Laesion", ",", "einer", "in", "der", "Literatur", "sehr", "selten", "beschriebenen", "Variante", ".", "Ausserdem", "wird", "ein", "geschichtlicher", "Ueberblick", "ueber", "die", "Tumore", "des", "Haarfollikels", "und", "die", "damit", "verbundenen", "Probleme", "ihrer", "Klassifikation", "gegeben", "." ]
[ "umlsterm" ]
AP-1 site is a DNA_domain_or_region, -150 bp is a DNA_domain_or_region, NF - kappa B site is a DNA_domain_or_region, protein kinase C is a protein_molecule, interleukin 2 promoter is a DNA_domain_or_region
87177_task0
Sentence: The AP-1 site at -150 bp, but not the NF-kappa B site, is likely to represent the major target of protein kinase C in the interleukin 2 promoter. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: DNA_domain_or_region, protein_molecule
[ "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein_molecule", "I-protein_molecule", "I-protein_molecule", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O" ]
The AP-1 site at -150 bp, but not the NF-kappa B site, is likely to represent the major target of protein kinase C in the interleukin 2 promoter.
[ "The", "AP-1", "site", "at", "-150", "bp", ",", "but", "not", "the", "NF", "-", "kappa", "B", "site", ",", "is", "likely", "to", "represent", "the", "major", "target", "of", "protein", "kinase", "C", "in", "the", "interleukin", "2", "promoter", "." ]
[ "other_name", "protein_molecule", "cell_line", "protein_complex", "DNA_domain_or_region", "protein_family_or_group", "(AND protein_molecule protein_molecule)", "(AND DNA_domain_or_region DNA_domain_or_region)", "other_organic_compound", "RNA_molecule", "", "cell_type", "DNA_family_or_group" ]
AP-1 site is a DNA_domain_or_region, -150 bp is a DNA_domain_or_region, NF - kappa B site is a DNA_domain_or_region, protein kinase C is a protein_molecule, interleukin 2 promoter is a DNA_domain_or_region
87177_task1
Sentence: The AP-1 site at -150 bp, but not the NF-kappa B site, is likely to represent the major target of protein kinase C in the interleukin 2 promoter. Instructions: please typing these entity words according to sentence: AP-1 site, -150 bp, NF - kappa B site, protein kinase C, interleukin 2 promoter Options: DNA_domain_or_region, protein_molecule
[ "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein_molecule", "I-protein_molecule", "I-protein_molecule", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O" ]
The AP-1 site at -150 bp, but not the NF-kappa B site, is likely to represent the major target of protein kinase C in the interleukin 2 promoter.
[ "The", "AP-1", "site", "at", "-150", "bp", ",", "but", "not", "the", "NF", "-", "kappa", "B", "site", ",", "is", "likely", "to", "represent", "the", "major", "target", "of", "protein", "kinase", "C", "in", "the", "interleukin", "2", "promoter", "." ]
[ "other_name", "protein_molecule", "cell_line", "protein_complex", "DNA_domain_or_region", "protein_family_or_group", "(AND protein_molecule protein_molecule)", "(AND DNA_domain_or_region DNA_domain_or_region)", "other_organic_compound", "RNA_molecule", "", "cell_type", "DNA_family_or_group" ]
AP-1 site, -150 bp, NF - kappa B site, protein kinase C, interleukin 2 promoter
87177_task2
Sentence: The AP-1 site at -150 bp, but not the NF-kappa B site, is likely to represent the major target of protein kinase C in the interleukin 2 promoter. Instructions: please extract entity words from the input sentence
[ "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein_molecule", "I-protein_molecule", "I-protein_molecule", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O" ]
The AP-1 site at -150 bp, but not the NF-kappa B site, is likely to represent the major target of protein kinase C in the interleukin 2 promoter.
[ "The", "AP-1", "site", "at", "-150", "bp", ",", "but", "not", "the", "NF", "-", "kappa", "B", "site", ",", "is", "likely", "to", "represent", "the", "major", "target", "of", "protein", "kinase", "C", "in", "the", "interleukin", "2", "promoter", "." ]
[ "other_name", "protein_molecule", "cell_line", "protein_complex", "DNA_domain_or_region", "protein_family_or_group", "(AND protein_molecule protein_molecule)", "(AND DNA_domain_or_region DNA_domain_or_region)", "other_organic_compound", "RNA_molecule", "", "cell_type", "DNA_family_or_group" ]
paper is an umlsterm, surgery is an umlsterm, Future is an umlsterm, surgery is an umlsterm, guidelines is an umlsterm, procedures is an umlsterm, proven is an umlsterm, follow - up studies is an umlsterm
MundKieferGesichtschirurgie.0004s257.eng.abstr_task0
Sentence: This paper describes preprosthetic surgery from its historical beginnings to its present state-of-the-art status . Future perspectives of preprosthetic surgery are also outlined , excluding implants . In an enquiry of 250 German-speaking maxillofacial departments , 160 responded . Results showed that a surprising 30-50% of the institutions are still following guidelines for procedures which have been proven by scientific follow-up studies to be almost 100% unsuccessful . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
This paper describes preprosthetic surgery from its historical beginnings to its present state-of-the-art status . Future perspectives of preprosthetic surgery are also outlined , excluding implants . In an enquiry of 250 German-speaking maxillofacial departments , 160 responded . Results showed that a surprising 30-50% of the institutions are still following guidelines for procedures which have been proven by scientific follow-up studies to be almost 100% unsuccessful .
[ "This", "paper", "describes", "preprosthetic", "surgery", "from", "its", "historical", "beginnings", "to", "its", "present", "state", "-", "of", "-", "the", "-", "art", "status", ".", "Future", "perspectives", "of", "preprosthetic", "surgery", "are", "also", "outlined", ",", "excluding", "implants", ".", "In", "an", "enquiry", "of", "250", "German", "-", "speaking", "maxillofacial", "departments", ",", "160", "responded", ".", "Results", "showed", "that", "a", "surprising", "30", "-", "50", "%", "of", "the", "institutions", "are", "still", "following", "guidelines", "for", "procedures", "which", "have", "been", "proven", "by", "scientific", "follow", "-", "up", "studies", "to", "be", "almost", "100", "%", "unsuccessful", "." ]
[ "umlsterm" ]
paper is an umlsterm, surgery is an umlsterm, Future is an umlsterm, surgery is an umlsterm, guidelines is an umlsterm, procedures is an umlsterm, proven is an umlsterm, follow - up studies is an umlsterm
MundKieferGesichtschirurgie.0004s257.eng.abstr_task1
Sentence: This paper describes preprosthetic surgery from its historical beginnings to its present state-of-the-art status . Future perspectives of preprosthetic surgery are also outlined , excluding implants . In an enquiry of 250 German-speaking maxillofacial departments , 160 responded . Results showed that a surprising 30-50% of the institutions are still following guidelines for procedures which have been proven by scientific follow-up studies to be almost 100% unsuccessful . Instructions: please typing these entity words according to sentence: paper, surgery, Future, surgery, guidelines, procedures, proven, follow - up studies Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
This paper describes preprosthetic surgery from its historical beginnings to its present state-of-the-art status . Future perspectives of preprosthetic surgery are also outlined , excluding implants . In an enquiry of 250 German-speaking maxillofacial departments , 160 responded . Results showed that a surprising 30-50% of the institutions are still following guidelines for procedures which have been proven by scientific follow-up studies to be almost 100% unsuccessful .
[ "This", "paper", "describes", "preprosthetic", "surgery", "from", "its", "historical", "beginnings", "to", "its", "present", "state", "-", "of", "-", "the", "-", "art", "status", ".", "Future", "perspectives", "of", "preprosthetic", "surgery", "are", "also", "outlined", ",", "excluding", "implants", ".", "In", "an", "enquiry", "of", "250", "German", "-", "speaking", "maxillofacial", "departments", ",", "160", "responded", ".", "Results", "showed", "that", "a", "surprising", "30", "-", "50", "%", "of", "the", "institutions", "are", "still", "following", "guidelines", "for", "procedures", "which", "have", "been", "proven", "by", "scientific", "follow", "-", "up", "studies", "to", "be", "almost", "100", "%", "unsuccessful", "." ]
[ "umlsterm" ]
paper, surgery, Future, surgery, guidelines, procedures, proven, follow - up studies
MundKieferGesichtschirurgie.0004s257.eng.abstr_task2
Sentence: This paper describes preprosthetic surgery from its historical beginnings to its present state-of-the-art status . Future perspectives of preprosthetic surgery are also outlined , excluding implants . In an enquiry of 250 German-speaking maxillofacial departments , 160 responded . Results showed that a surprising 30-50% of the institutions are still following guidelines for procedures which have been proven by scientific follow-up studies to be almost 100% unsuccessful . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
This paper describes preprosthetic surgery from its historical beginnings to its present state-of-the-art status . Future perspectives of preprosthetic surgery are also outlined , excluding implants . In an enquiry of 250 German-speaking maxillofacial departments , 160 responded . Results showed that a surprising 30-50% of the institutions are still following guidelines for procedures which have been proven by scientific follow-up studies to be almost 100% unsuccessful .
[ "This", "paper", "describes", "preprosthetic", "surgery", "from", "its", "historical", "beginnings", "to", "its", "present", "state", "-", "of", "-", "the", "-", "art", "status", ".", "Future", "perspectives", "of", "preprosthetic", "surgery", "are", "also", "outlined", ",", "excluding", "implants", ".", "In", "an", "enquiry", "of", "250", "German", "-", "speaking", "maxillofacial", "departments", ",", "160", "responded", ".", "Results", "showed", "that", "a", "surprising", "30", "-", "50", "%", "of", "the", "institutions", "are", "still", "following", "guidelines", "for", "procedures", "which", "have", "been", "proven", "by", "scientific", "follow", "-", "up", "studies", "to", "be", "almost", "100", "%", "unsuccessful", "." ]
[ "umlsterm" ]
Mund- is an umlsterm, Kiefer- is an umlsterm, Gesichtschirurgie is an umlsterm, Gesichtsschaedels is an umlsterm, Frakturversorgung is an umlsterm, Chirurgie is an umlsterm, Immobilisation is an umlsterm, Kiefer is an umlsterm, Schienenverbaende is an umlsterm, Plattensystem is an umlsterm, Extremitaetenfrakturen is an umlsterm, Unterkieferfrakturen is an umlsterm, Extremitaetenchirurgie is an umlsterm, Kiefer - Gesichts - Chirurgie is an umlsterm, Extremitaetenchirurgie is an umlsterm, Kompressionsplatte is an umlsterm, Druckschraubenplatte is an umlsterm, Publikationen is an umlsterm, Unterkieferfrakturen is an umlsterm, Frakturen is an umlsterm, Mittelgesichts is an umlsterm, Namen is an umlsterm, Unterkieferrekonstruktion is an umlsterm, Tumorchirurgie is an umlsterm, Defektfrakturen is an umlsterm, Platten- is an umlsterm, Knochentransplantaten is an umlsterm, Immobilisation is an umlsterm, Kiefer is an umlsterm, Chirurgie is an umlsterm, Immobilisation is an umlsterm, Vitallium is an umlsterm, Titan is an umlsterm, Plattensystemen is an umlsterm, Gesichtsschaedels is an umlsterm, gewissen is an umlsterm
MundKieferGesichtschirurgie.0004s084.ger.abstr_task0
Sentence: Die Platten-Schrauben-Osteosynthese hat in den letzten 30 Jahren weite Teile des Fachgebiets Mund- , Kiefer- und Gesichtschirurgie revolutioniert . Neben der dreidimensionalen Rekonstruktion des knoechernen Gesichtsschaedels ermoeglicht die stabile Osteosynthese nach Frakturversorgung und auch im Rahmen der orthognathen Chirurgie einen Verzicht auf die frueher uebliche intramaxillare Immobilisation der Kiefer durch dentale Schienenverbaende . Die Plattenosteosynthese beginnt mit dem Hamburger Chirurgen Carl Hansmann , der 1886 erste Erfahrungen mit dem von ihm entwickelten Plattensystem vorstellte . Neben Extremitaetenfrakturen berichtete Hansmann auch ueber 2 mit diesem Verfahren behandelte Unterkieferfrakturen . Damit ist Hansmann auch fuer unser Fachgebiet der erste Vertreter der Plattenosteosynthese . Wegen der hohen Komplikationsrate konnte sich die Platten-Schrauben-Osteosynthese ueber viele Jahrzehnte nicht allgemein durchsetzen . Die Einfuehrung des Prinzips der axialen Kompression durch den Belgischen Chirurgen Robert Danis ( 1949 ) brachte hier eine Wende . Im Bereich der Extremitaetenchirurgie wurde diese Idee der axialen Kompression der Fragmentenden von der schweizerischen Forschungsgruppe der AO Anfang der 60er Jahre aufgenommen und zur klinischen Reife entwickelt . In der Kiefer-Gesichts-Chirurgie konnte aus anatomischen Gruenden die in der Extremitaetenchirurgie verwendete Apparatur zur Erzeugung der axialen Kompression jedoch nicht angewendet werden . Daher hat Luhr 1968 eine selbstspannende Kompressionsplatte publiziert , mit der sich auf vereinfachte Weise das Prinzip der axialen Kompression realisieren liess . Mit dieser Druckschraubenplatte hat Luhr 1967 die erste Kompressionsosteosynthese in der Welt im maxillofazialen Bereich durchgefuehrt . In den naechsten Jahren folgten dann zahlreiche Publikationen ueber aehnliche Verfahren der Kompressionsosteosynthese durch andere Autoren . Daneben entwickelte sich in den 70er Jahren mit der Einfuehrung der monokortikalen Miniplatten ein ganz anderes Verfahren der Osteosynthese fuer Unterkieferfrakturen und spaeter auch fuer Frakturen des Mittelgesichts , welches mit dem Namen Michelet und auch Champy verbunden ist . Fuer die Unterkieferrekonstruktion im Rahmen der Tumorchirurgie und nach Defektfrakturen wurden ebenfalls die unterschiedlichsten Platten- und Schraubensysteme entwickelt , die sowohl eine stabile alloplastische Ueberbrueckung von Defekten als auch die stabile Fixation von Knochentransplantaten unter axialer Kompression erlaubten . Auch hier bestand der wesentliche Vorteil aus dem Verzicht auf jede postoperative intermaxillare Immobilisation der Kiefer . Die Plattenosteosynthese hat auch die gesamte orthognathe Chirurgie revolutioniert , wobei auch hier der Verzicht auf die frueher uebliche wochenlange intermaxillare Immobilisation den groessten Vorteil darstellte . Die Einfuehrung hochkorrosionsbestaendiger Implantatmaterialien ( Vitallium Titan ) , und die Entwicklung von Plattensystemen adaequater Dimensionen fuer die unterschiedlichsten Anwendungsgebiete im Bereich des komplexen Gesichtsschaedels bis hin zu Mikrosystemen mit extrem kleinem Schraubendurchmesser von 0,8 mm fuehrten bis heute zu einem gewissen Abschluss in der Entwicklung der stabilen Osteosynthese in unserem Fachgebiet . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Platten-Schrauben-Osteosynthese hat in den letzten 30 Jahren weite Teile des Fachgebiets Mund- , Kiefer- und Gesichtschirurgie revolutioniert . Neben der dreidimensionalen Rekonstruktion des knoechernen Gesichtsschaedels ermoeglicht die stabile Osteosynthese nach Frakturversorgung und auch im Rahmen der orthognathen Chirurgie einen Verzicht auf die frueher uebliche intramaxillare Immobilisation der Kiefer durch dentale Schienenverbaende . Die Plattenosteosynthese beginnt mit dem Hamburger Chirurgen Carl Hansmann , der 1886 erste Erfahrungen mit dem von ihm entwickelten Plattensystem vorstellte . Neben Extremitaetenfrakturen berichtete Hansmann auch ueber 2 mit diesem Verfahren behandelte Unterkieferfrakturen . Damit ist Hansmann auch fuer unser Fachgebiet der erste Vertreter der Plattenosteosynthese . Wegen der hohen Komplikationsrate konnte sich die Platten-Schrauben-Osteosynthese ueber viele Jahrzehnte nicht allgemein durchsetzen . Die Einfuehrung des Prinzips der axialen Kompression durch den Belgischen Chirurgen Robert Danis ( 1949 ) brachte hier eine Wende . Im Bereich der Extremitaetenchirurgie wurde diese Idee der axialen Kompression der Fragmentenden von der schweizerischen Forschungsgruppe der AO Anfang der 60er Jahre aufgenommen und zur klinischen Reife entwickelt . In der Kiefer-Gesichts-Chirurgie konnte aus anatomischen Gruenden die in der Extremitaetenchirurgie verwendete Apparatur zur Erzeugung der axialen Kompression jedoch nicht angewendet werden . Daher hat Luhr 1968 eine selbstspannende Kompressionsplatte publiziert , mit der sich auf vereinfachte Weise das Prinzip der axialen Kompression realisieren liess . Mit dieser Druckschraubenplatte hat Luhr 1967 die erste Kompressionsosteosynthese in der Welt im maxillofazialen Bereich durchgefuehrt . In den naechsten Jahren folgten dann zahlreiche Publikationen ueber aehnliche Verfahren der Kompressionsosteosynthese durch andere Autoren . Daneben entwickelte sich in den 70er Jahren mit der Einfuehrung der monokortikalen Miniplatten ein ganz anderes Verfahren der Osteosynthese fuer Unterkieferfrakturen und spaeter auch fuer Frakturen des Mittelgesichts , welches mit dem Namen Michelet und auch Champy verbunden ist . Fuer die Unterkieferrekonstruktion im Rahmen der Tumorchirurgie und nach Defektfrakturen wurden ebenfalls die unterschiedlichsten Platten- und Schraubensysteme entwickelt , die sowohl eine stabile alloplastische Ueberbrueckung von Defekten als auch die stabile Fixation von Knochentransplantaten unter axialer Kompression erlaubten . Auch hier bestand der wesentliche Vorteil aus dem Verzicht auf jede postoperative intermaxillare Immobilisation der Kiefer . Die Plattenosteosynthese hat auch die gesamte orthognathe Chirurgie revolutioniert , wobei auch hier der Verzicht auf die frueher uebliche wochenlange intermaxillare Immobilisation den groessten Vorteil darstellte . Die Einfuehrung hochkorrosionsbestaendiger Implantatmaterialien ( Vitallium Titan ) , und die Entwicklung von Plattensystemen adaequater Dimensionen fuer die unterschiedlichsten Anwendungsgebiete im Bereich des komplexen Gesichtsschaedels bis hin zu Mikrosystemen mit extrem kleinem Schraubendurchmesser von 0,8 mm fuehrten bis heute zu einem gewissen Abschluss in der Entwicklung der stabilen Osteosynthese in unserem Fachgebiet .
[ "Die", "Platten", "-", "Schrauben", "-", "Osteosynthese", "hat", "in", "den", "letzten", "30", "Jahren", "weite", "Teile", "des", "Fachgebiets", "Mund-", ",", "Kiefer-", "und", "Gesichtschirurgie", "revolutioniert", ".", "Neben", "der", "dreidimensionalen", "Rekonstruktion", "des", "knoechernen", "Gesichtsschaedels", "ermoeglicht", "die", "stabile", "Osteosynthese", "nach", "Frakturversorgung", "und", "auch", "im", "Rahmen", "der", "orthognathen", "Chirurgie", "einen", "Verzicht", "auf", "die", "frueher", "uebliche", "intramaxillare", "Immobilisation", "der", "Kiefer", "durch", "dentale", "Schienenverbaende", ".", "Die", "Plattenosteosynthese", "beginnt", "mit", "dem", "Hamburger", "Chirurgen", "Carl", "Hansmann", ",", "der", "1886", "erste", "Erfahrungen", "mit", "dem", "von", "ihm", "entwickelten", "Plattensystem", "vorstellte", ".", "Neben", "Extremitaetenfrakturen", "berichtete", "Hansmann", "auch", "ueber", "2", "mit", "diesem", "Verfahren", "behandelte", "Unterkieferfrakturen", ".", "Damit", "ist", "Hansmann", "auch", "fuer", "unser", "Fachgebiet", "der", "erste", "Vertreter", "der", "Plattenosteosynthese", ".", "Wegen", "der", "hohen", "Komplikationsrate", "konnte", "sich", "die", "Platten", "-", "Schrauben", "-", "Osteosynthese", "ueber", "viele", "Jahrzehnte", "nicht", "allgemein", "durchsetzen", ".", "Die", "Einfuehrung", "des", "Prinzips", "der", "axialen", "Kompression", "durch", "den", "Belgischen", "Chirurgen", "Robert", "Danis", "(", "1949", ")", "brachte", "hier", "eine", "Wende", ".", "Im", "Bereich", "der", "Extremitaetenchirurgie", "wurde", "diese", "Idee", "der", "axialen", "Kompression", "der", "Fragmentenden", "von", "der", "schweizerischen", "Forschungsgruppe", "der", "AO", "Anfang", "der", "60er", "Jahre", "aufgenommen", "und", "zur", "klinischen", "Reife", "entwickelt", ".", "In", "der", "Kiefer", "-", "Gesichts", "-", "Chirurgie", "konnte", "aus", "anatomischen", "Gruenden", "die", "in", "der", "Extremitaetenchirurgie", "verwendete", "Apparatur", "zur", "Erzeugung", "der", "axialen", "Kompression", "jedoch", "nicht", "angewendet", "werden", ".", "Daher", "hat", "Luhr", "1968", "eine", "selbstspannende", "Kompressionsplatte", "publiziert", ",", "mit", "der", "sich", "auf", "vereinfachte", "Weise", "das", "Prinzip", "der", "axialen", "Kompression", "realisieren", "liess", ".", "Mit", "dieser", "Druckschraubenplatte", "hat", "Luhr", "1967", "die", "erste", "Kompressionsosteosynthese", "in", "der", "Welt", "im", "maxillofazialen", "Bereich", "durchgefuehrt", ".", "In", "den", "naechsten", "Jahren", "folgten", "dann", "zahlreiche", "Publikationen", "ueber", "aehnliche", "Verfahren", "der", "Kompressionsosteosynthese", "durch", "andere", "Autoren", ".", "Daneben", "entwickelte", "sich", "in", "den", "70er", "Jahren", "mit", "der", "Einfuehrung", "der", "monokortikalen", "Miniplatten", "ein", "ganz", "anderes", "Verfahren", "der", "Osteosynthese", "fuer", "Unterkieferfrakturen", "und", "spaeter", "auch", "fuer", "Frakturen", "des", "Mittelgesichts", ",", "welches", "mit", "dem", "Namen", "Michelet", "und", "auch", "Champy", "verbunden", "ist", ".", "Fuer", "die", "Unterkieferrekonstruktion", "im", "Rahmen", "der", "Tumorchirurgie", "und", "nach", "Defektfrakturen", "wurden", "ebenfalls", "die", "unterschiedlichsten", "Platten-", "und", "Schraubensysteme", "entwickelt", ",", "die", "sowohl", "eine", "stabile", "alloplastische", "Ueberbrueckung", "von", "Defekten", "als", "auch", "die", "stabile", "Fixation", "von", "Knochentransplantaten", "unter", "axialer", "Kompression", "erlaubten", ".", "Auch", "hier", "bestand", "der", "wesentliche", "Vorteil", "aus", "dem", "Verzicht", "auf", "jede", "postoperative", "intermaxillare", "Immobilisation", "der", "Kiefer", ".", "Die", "Plattenosteosynthese", "hat", "auch", "die", "gesamte", "orthognathe", "Chirurgie", "revolutioniert", ",", "wobei", "auch", "hier", "der", "Verzicht", "auf", "die", "frueher", "uebliche", "wochenlange", "intermaxillare", "Immobilisation", "den", "groessten", "Vorteil", "darstellte", ".", "Die", "Einfuehrung", "hochkorrosionsbestaendiger", "Implantatmaterialien", "(", "Vitallium", "Titan", ")", ",", "und", "die", "Entwicklung", "von", "Plattensystemen", "adaequater", "Dimensionen", "fuer", "die", "unterschiedlichsten", "Anwendungsgebiete", "im", "Bereich", "des", "komplexen", "Gesichtsschaedels", "bis", "hin", "zu", "Mikrosystemen", "mit", "extrem", "kleinem", "Schraubendurchmesser", "von", "0,8", "mm", "fuehrten", "bis", "heute", "zu", "einem", "gewissen", "Abschluss", "in", "der", "Entwicklung", "der", "stabilen", "Osteosynthese", "in", "unserem", "Fachgebiet", "." ]
[ "umlsterm" ]
Mund- is an umlsterm, Kiefer- is an umlsterm, Gesichtschirurgie is an umlsterm, Gesichtsschaedels is an umlsterm, Frakturversorgung is an umlsterm, Chirurgie is an umlsterm, Immobilisation is an umlsterm, Kiefer is an umlsterm, Schienenverbaende is an umlsterm, Plattensystem is an umlsterm, Extremitaetenfrakturen is an umlsterm, Unterkieferfrakturen is an umlsterm, Extremitaetenchirurgie is an umlsterm, Kiefer - Gesichts - Chirurgie is an umlsterm, Extremitaetenchirurgie is an umlsterm, Kompressionsplatte is an umlsterm, Druckschraubenplatte is an umlsterm, Publikationen is an umlsterm, Unterkieferfrakturen is an umlsterm, Frakturen is an umlsterm, Mittelgesichts is an umlsterm, Namen is an umlsterm, Unterkieferrekonstruktion is an umlsterm, Tumorchirurgie is an umlsterm, Defektfrakturen is an umlsterm, Platten- is an umlsterm, Knochentransplantaten is an umlsterm, Immobilisation is an umlsterm, Kiefer is an umlsterm, Chirurgie is an umlsterm, Immobilisation is an umlsterm, Vitallium is an umlsterm, Titan is an umlsterm, Plattensystemen is an umlsterm, Gesichtsschaedels is an umlsterm, gewissen is an umlsterm
MundKieferGesichtschirurgie.0004s084.ger.abstr_task1
Sentence: Die Platten-Schrauben-Osteosynthese hat in den letzten 30 Jahren weite Teile des Fachgebiets Mund- , Kiefer- und Gesichtschirurgie revolutioniert . Neben der dreidimensionalen Rekonstruktion des knoechernen Gesichtsschaedels ermoeglicht die stabile Osteosynthese nach Frakturversorgung und auch im Rahmen der orthognathen Chirurgie einen Verzicht auf die frueher uebliche intramaxillare Immobilisation der Kiefer durch dentale Schienenverbaende . Die Plattenosteosynthese beginnt mit dem Hamburger Chirurgen Carl Hansmann , der 1886 erste Erfahrungen mit dem von ihm entwickelten Plattensystem vorstellte . Neben Extremitaetenfrakturen berichtete Hansmann auch ueber 2 mit diesem Verfahren behandelte Unterkieferfrakturen . Damit ist Hansmann auch fuer unser Fachgebiet der erste Vertreter der Plattenosteosynthese . Wegen der hohen Komplikationsrate konnte sich die Platten-Schrauben-Osteosynthese ueber viele Jahrzehnte nicht allgemein durchsetzen . Die Einfuehrung des Prinzips der axialen Kompression durch den Belgischen Chirurgen Robert Danis ( 1949 ) brachte hier eine Wende . Im Bereich der Extremitaetenchirurgie wurde diese Idee der axialen Kompression der Fragmentenden von der schweizerischen Forschungsgruppe der AO Anfang der 60er Jahre aufgenommen und zur klinischen Reife entwickelt . In der Kiefer-Gesichts-Chirurgie konnte aus anatomischen Gruenden die in der Extremitaetenchirurgie verwendete Apparatur zur Erzeugung der axialen Kompression jedoch nicht angewendet werden . Daher hat Luhr 1968 eine selbstspannende Kompressionsplatte publiziert , mit der sich auf vereinfachte Weise das Prinzip der axialen Kompression realisieren liess . Mit dieser Druckschraubenplatte hat Luhr 1967 die erste Kompressionsosteosynthese in der Welt im maxillofazialen Bereich durchgefuehrt . In den naechsten Jahren folgten dann zahlreiche Publikationen ueber aehnliche Verfahren der Kompressionsosteosynthese durch andere Autoren . Daneben entwickelte sich in den 70er Jahren mit der Einfuehrung der monokortikalen Miniplatten ein ganz anderes Verfahren der Osteosynthese fuer Unterkieferfrakturen und spaeter auch fuer Frakturen des Mittelgesichts , welches mit dem Namen Michelet und auch Champy verbunden ist . Fuer die Unterkieferrekonstruktion im Rahmen der Tumorchirurgie und nach Defektfrakturen wurden ebenfalls die unterschiedlichsten Platten- und Schraubensysteme entwickelt , die sowohl eine stabile alloplastische Ueberbrueckung von Defekten als auch die stabile Fixation von Knochentransplantaten unter axialer Kompression erlaubten . Auch hier bestand der wesentliche Vorteil aus dem Verzicht auf jede postoperative intermaxillare Immobilisation der Kiefer . Die Plattenosteosynthese hat auch die gesamte orthognathe Chirurgie revolutioniert , wobei auch hier der Verzicht auf die frueher uebliche wochenlange intermaxillare Immobilisation den groessten Vorteil darstellte . Die Einfuehrung hochkorrosionsbestaendiger Implantatmaterialien ( Vitallium Titan ) , und die Entwicklung von Plattensystemen adaequater Dimensionen fuer die unterschiedlichsten Anwendungsgebiete im Bereich des komplexen Gesichtsschaedels bis hin zu Mikrosystemen mit extrem kleinem Schraubendurchmesser von 0,8 mm fuehrten bis heute zu einem gewissen Abschluss in der Entwicklung der stabilen Osteosynthese in unserem Fachgebiet . Instructions: please typing these entity words according to sentence: Mund-, Kiefer-, Gesichtschirurgie, Gesichtsschaedels, Frakturversorgung, Chirurgie, Immobilisation, Kiefer, Schienenverbaende, Plattensystem, Extremitaetenfrakturen, Unterkieferfrakturen, Extremitaetenchirurgie, Kiefer - Gesichts - Chirurgie, Extremitaetenchirurgie, Kompressionsplatte, Druckschraubenplatte, Publikationen, Unterkieferfrakturen, Frakturen, Mittelgesichts, Namen, Unterkieferrekonstruktion, Tumorchirurgie, Defektfrakturen, Platten-, Knochentransplantaten, Immobilisation, Kiefer, Chirurgie, Immobilisation, Vitallium, Titan, Plattensystemen, Gesichtsschaedels, gewissen Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Platten-Schrauben-Osteosynthese hat in den letzten 30 Jahren weite Teile des Fachgebiets Mund- , Kiefer- und Gesichtschirurgie revolutioniert . Neben der dreidimensionalen Rekonstruktion des knoechernen Gesichtsschaedels ermoeglicht die stabile Osteosynthese nach Frakturversorgung und auch im Rahmen der orthognathen Chirurgie einen Verzicht auf die frueher uebliche intramaxillare Immobilisation der Kiefer durch dentale Schienenverbaende . Die Plattenosteosynthese beginnt mit dem Hamburger Chirurgen Carl Hansmann , der 1886 erste Erfahrungen mit dem von ihm entwickelten Plattensystem vorstellte . Neben Extremitaetenfrakturen berichtete Hansmann auch ueber 2 mit diesem Verfahren behandelte Unterkieferfrakturen . Damit ist Hansmann auch fuer unser Fachgebiet der erste Vertreter der Plattenosteosynthese . Wegen der hohen Komplikationsrate konnte sich die Platten-Schrauben-Osteosynthese ueber viele Jahrzehnte nicht allgemein durchsetzen . Die Einfuehrung des Prinzips der axialen Kompression durch den Belgischen Chirurgen Robert Danis ( 1949 ) brachte hier eine Wende . Im Bereich der Extremitaetenchirurgie wurde diese Idee der axialen Kompression der Fragmentenden von der schweizerischen Forschungsgruppe der AO Anfang der 60er Jahre aufgenommen und zur klinischen Reife entwickelt . In der Kiefer-Gesichts-Chirurgie konnte aus anatomischen Gruenden die in der Extremitaetenchirurgie verwendete Apparatur zur Erzeugung der axialen Kompression jedoch nicht angewendet werden . Daher hat Luhr 1968 eine selbstspannende Kompressionsplatte publiziert , mit der sich auf vereinfachte Weise das Prinzip der axialen Kompression realisieren liess . Mit dieser Druckschraubenplatte hat Luhr 1967 die erste Kompressionsosteosynthese in der Welt im maxillofazialen Bereich durchgefuehrt . In den naechsten Jahren folgten dann zahlreiche Publikationen ueber aehnliche Verfahren der Kompressionsosteosynthese durch andere Autoren . Daneben entwickelte sich in den 70er Jahren mit der Einfuehrung der monokortikalen Miniplatten ein ganz anderes Verfahren der Osteosynthese fuer Unterkieferfrakturen und spaeter auch fuer Frakturen des Mittelgesichts , welches mit dem Namen Michelet und auch Champy verbunden ist . Fuer die Unterkieferrekonstruktion im Rahmen der Tumorchirurgie und nach Defektfrakturen wurden ebenfalls die unterschiedlichsten Platten- und Schraubensysteme entwickelt , die sowohl eine stabile alloplastische Ueberbrueckung von Defekten als auch die stabile Fixation von Knochentransplantaten unter axialer Kompression erlaubten . Auch hier bestand der wesentliche Vorteil aus dem Verzicht auf jede postoperative intermaxillare Immobilisation der Kiefer . Die Plattenosteosynthese hat auch die gesamte orthognathe Chirurgie revolutioniert , wobei auch hier der Verzicht auf die frueher uebliche wochenlange intermaxillare Immobilisation den groessten Vorteil darstellte . Die Einfuehrung hochkorrosionsbestaendiger Implantatmaterialien ( Vitallium Titan ) , und die Entwicklung von Plattensystemen adaequater Dimensionen fuer die unterschiedlichsten Anwendungsgebiete im Bereich des komplexen Gesichtsschaedels bis hin zu Mikrosystemen mit extrem kleinem Schraubendurchmesser von 0,8 mm fuehrten bis heute zu einem gewissen Abschluss in der Entwicklung der stabilen Osteosynthese in unserem Fachgebiet .
[ "Die", "Platten", "-", "Schrauben", "-", "Osteosynthese", "hat", "in", "den", "letzten", "30", "Jahren", "weite", "Teile", "des", "Fachgebiets", "Mund-", ",", "Kiefer-", "und", "Gesichtschirurgie", "revolutioniert", ".", "Neben", "der", "dreidimensionalen", "Rekonstruktion", "des", "knoechernen", "Gesichtsschaedels", "ermoeglicht", "die", "stabile", "Osteosynthese", "nach", "Frakturversorgung", "und", "auch", "im", "Rahmen", "der", "orthognathen", "Chirurgie", "einen", "Verzicht", "auf", "die", "frueher", "uebliche", "intramaxillare", "Immobilisation", "der", "Kiefer", "durch", "dentale", "Schienenverbaende", ".", "Die", "Plattenosteosynthese", "beginnt", "mit", "dem", "Hamburger", "Chirurgen", "Carl", "Hansmann", ",", "der", "1886", "erste", "Erfahrungen", "mit", "dem", "von", "ihm", "entwickelten", "Plattensystem", "vorstellte", ".", "Neben", "Extremitaetenfrakturen", "berichtete", "Hansmann", "auch", "ueber", "2", "mit", "diesem", "Verfahren", "behandelte", "Unterkieferfrakturen", ".", "Damit", "ist", "Hansmann", "auch", "fuer", "unser", "Fachgebiet", "der", "erste", "Vertreter", "der", "Plattenosteosynthese", ".", "Wegen", "der", "hohen", "Komplikationsrate", "konnte", "sich", "die", "Platten", "-", "Schrauben", "-", "Osteosynthese", "ueber", "viele", "Jahrzehnte", "nicht", "allgemein", "durchsetzen", ".", "Die", "Einfuehrung", "des", "Prinzips", "der", "axialen", "Kompression", "durch", "den", "Belgischen", "Chirurgen", "Robert", "Danis", "(", "1949", ")", "brachte", "hier", "eine", "Wende", ".", "Im", "Bereich", "der", "Extremitaetenchirurgie", "wurde", "diese", "Idee", "der", "axialen", "Kompression", "der", "Fragmentenden", "von", "der", "schweizerischen", "Forschungsgruppe", "der", "AO", "Anfang", "der", "60er", "Jahre", "aufgenommen", "und", "zur", "klinischen", "Reife", "entwickelt", ".", "In", "der", "Kiefer", "-", "Gesichts", "-", "Chirurgie", "konnte", "aus", "anatomischen", "Gruenden", "die", "in", "der", "Extremitaetenchirurgie", "verwendete", "Apparatur", "zur", "Erzeugung", "der", "axialen", "Kompression", "jedoch", "nicht", "angewendet", "werden", ".", "Daher", "hat", "Luhr", "1968", "eine", "selbstspannende", "Kompressionsplatte", "publiziert", ",", "mit", "der", "sich", "auf", "vereinfachte", "Weise", "das", "Prinzip", "der", "axialen", "Kompression", "realisieren", "liess", ".", "Mit", "dieser", "Druckschraubenplatte", "hat", "Luhr", "1967", "die", "erste", "Kompressionsosteosynthese", "in", "der", "Welt", "im", "maxillofazialen", "Bereich", "durchgefuehrt", ".", "In", "den", "naechsten", "Jahren", "folgten", "dann", "zahlreiche", "Publikationen", "ueber", "aehnliche", "Verfahren", "der", "Kompressionsosteosynthese", "durch", "andere", "Autoren", ".", "Daneben", "entwickelte", "sich", "in", "den", "70er", "Jahren", "mit", "der", "Einfuehrung", "der", "monokortikalen", "Miniplatten", "ein", "ganz", "anderes", "Verfahren", "der", "Osteosynthese", "fuer", "Unterkieferfrakturen", "und", "spaeter", "auch", "fuer", "Frakturen", "des", "Mittelgesichts", ",", "welches", "mit", "dem", "Namen", "Michelet", "und", "auch", "Champy", "verbunden", "ist", ".", "Fuer", "die", "Unterkieferrekonstruktion", "im", "Rahmen", "der", "Tumorchirurgie", "und", "nach", "Defektfrakturen", "wurden", "ebenfalls", "die", "unterschiedlichsten", "Platten-", "und", "Schraubensysteme", "entwickelt", ",", "die", "sowohl", "eine", "stabile", "alloplastische", "Ueberbrueckung", "von", "Defekten", "als", "auch", "die", "stabile", "Fixation", "von", "Knochentransplantaten", "unter", "axialer", "Kompression", "erlaubten", ".", "Auch", "hier", "bestand", "der", "wesentliche", "Vorteil", "aus", "dem", "Verzicht", "auf", "jede", "postoperative", "intermaxillare", "Immobilisation", "der", "Kiefer", ".", "Die", "Plattenosteosynthese", "hat", "auch", "die", "gesamte", "orthognathe", "Chirurgie", "revolutioniert", ",", "wobei", "auch", "hier", "der", "Verzicht", "auf", "die", "frueher", "uebliche", "wochenlange", "intermaxillare", "Immobilisation", "den", "groessten", "Vorteil", "darstellte", ".", "Die", "Einfuehrung", "hochkorrosionsbestaendiger", "Implantatmaterialien", "(", "Vitallium", "Titan", ")", ",", "und", "die", "Entwicklung", "von", "Plattensystemen", "adaequater", "Dimensionen", "fuer", "die", "unterschiedlichsten", "Anwendungsgebiete", "im", "Bereich", "des", "komplexen", "Gesichtsschaedels", "bis", "hin", "zu", "Mikrosystemen", "mit", "extrem", "kleinem", "Schraubendurchmesser", "von", "0,8", "mm", "fuehrten", "bis", "heute", "zu", "einem", "gewissen", "Abschluss", "in", "der", "Entwicklung", "der", "stabilen", "Osteosynthese", "in", "unserem", "Fachgebiet", "." ]
[ "umlsterm" ]
Mund-, Kiefer-, Gesichtschirurgie, Gesichtsschaedels, Frakturversorgung, Chirurgie, Immobilisation, Kiefer, Schienenverbaende, Plattensystem, Extremitaetenfrakturen, Unterkieferfrakturen, Extremitaetenchirurgie, Kiefer - Gesichts - Chirurgie, Extremitaetenchirurgie, Kompressionsplatte, Druckschraubenplatte, Publikationen, Unterkieferfrakturen, Frakturen, Mittelgesichts, Namen, Unterkieferrekonstruktion, Tumorchirurgie, Defektfrakturen, Platten-, Knochentransplantaten, Immobilisation, Kiefer, Chirurgie, Immobilisation, Vitallium, Titan, Plattensystemen, Gesichtsschaedels, gewissen
MundKieferGesichtschirurgie.0004s084.ger.abstr_task2
Sentence: Die Platten-Schrauben-Osteosynthese hat in den letzten 30 Jahren weite Teile des Fachgebiets Mund- , Kiefer- und Gesichtschirurgie revolutioniert . Neben der dreidimensionalen Rekonstruktion des knoechernen Gesichtsschaedels ermoeglicht die stabile Osteosynthese nach Frakturversorgung und auch im Rahmen der orthognathen Chirurgie einen Verzicht auf die frueher uebliche intramaxillare Immobilisation der Kiefer durch dentale Schienenverbaende . Die Plattenosteosynthese beginnt mit dem Hamburger Chirurgen Carl Hansmann , der 1886 erste Erfahrungen mit dem von ihm entwickelten Plattensystem vorstellte . Neben Extremitaetenfrakturen berichtete Hansmann auch ueber 2 mit diesem Verfahren behandelte Unterkieferfrakturen . Damit ist Hansmann auch fuer unser Fachgebiet der erste Vertreter der Plattenosteosynthese . Wegen der hohen Komplikationsrate konnte sich die Platten-Schrauben-Osteosynthese ueber viele Jahrzehnte nicht allgemein durchsetzen . Die Einfuehrung des Prinzips der axialen Kompression durch den Belgischen Chirurgen Robert Danis ( 1949 ) brachte hier eine Wende . Im Bereich der Extremitaetenchirurgie wurde diese Idee der axialen Kompression der Fragmentenden von der schweizerischen Forschungsgruppe der AO Anfang der 60er Jahre aufgenommen und zur klinischen Reife entwickelt . In der Kiefer-Gesichts-Chirurgie konnte aus anatomischen Gruenden die in der Extremitaetenchirurgie verwendete Apparatur zur Erzeugung der axialen Kompression jedoch nicht angewendet werden . Daher hat Luhr 1968 eine selbstspannende Kompressionsplatte publiziert , mit der sich auf vereinfachte Weise das Prinzip der axialen Kompression realisieren liess . Mit dieser Druckschraubenplatte hat Luhr 1967 die erste Kompressionsosteosynthese in der Welt im maxillofazialen Bereich durchgefuehrt . In den naechsten Jahren folgten dann zahlreiche Publikationen ueber aehnliche Verfahren der Kompressionsosteosynthese durch andere Autoren . Daneben entwickelte sich in den 70er Jahren mit der Einfuehrung der monokortikalen Miniplatten ein ganz anderes Verfahren der Osteosynthese fuer Unterkieferfrakturen und spaeter auch fuer Frakturen des Mittelgesichts , welches mit dem Namen Michelet und auch Champy verbunden ist . Fuer die Unterkieferrekonstruktion im Rahmen der Tumorchirurgie und nach Defektfrakturen wurden ebenfalls die unterschiedlichsten Platten- und Schraubensysteme entwickelt , die sowohl eine stabile alloplastische Ueberbrueckung von Defekten als auch die stabile Fixation von Knochentransplantaten unter axialer Kompression erlaubten . Auch hier bestand der wesentliche Vorteil aus dem Verzicht auf jede postoperative intermaxillare Immobilisation der Kiefer . Die Plattenosteosynthese hat auch die gesamte orthognathe Chirurgie revolutioniert , wobei auch hier der Verzicht auf die frueher uebliche wochenlange intermaxillare Immobilisation den groessten Vorteil darstellte . Die Einfuehrung hochkorrosionsbestaendiger Implantatmaterialien ( Vitallium Titan ) , und die Entwicklung von Plattensystemen adaequater Dimensionen fuer die unterschiedlichsten Anwendungsgebiete im Bereich des komplexen Gesichtsschaedels bis hin zu Mikrosystemen mit extrem kleinem Schraubendurchmesser von 0,8 mm fuehrten bis heute zu einem gewissen Abschluss in der Entwicklung der stabilen Osteosynthese in unserem Fachgebiet . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Platten-Schrauben-Osteosynthese hat in den letzten 30 Jahren weite Teile des Fachgebiets Mund- , Kiefer- und Gesichtschirurgie revolutioniert . Neben der dreidimensionalen Rekonstruktion des knoechernen Gesichtsschaedels ermoeglicht die stabile Osteosynthese nach Frakturversorgung und auch im Rahmen der orthognathen Chirurgie einen Verzicht auf die frueher uebliche intramaxillare Immobilisation der Kiefer durch dentale Schienenverbaende . Die Plattenosteosynthese beginnt mit dem Hamburger Chirurgen Carl Hansmann , der 1886 erste Erfahrungen mit dem von ihm entwickelten Plattensystem vorstellte . Neben Extremitaetenfrakturen berichtete Hansmann auch ueber 2 mit diesem Verfahren behandelte Unterkieferfrakturen . Damit ist Hansmann auch fuer unser Fachgebiet der erste Vertreter der Plattenosteosynthese . Wegen der hohen Komplikationsrate konnte sich die Platten-Schrauben-Osteosynthese ueber viele Jahrzehnte nicht allgemein durchsetzen . Die Einfuehrung des Prinzips der axialen Kompression durch den Belgischen Chirurgen Robert Danis ( 1949 ) brachte hier eine Wende . Im Bereich der Extremitaetenchirurgie wurde diese Idee der axialen Kompression der Fragmentenden von der schweizerischen Forschungsgruppe der AO Anfang der 60er Jahre aufgenommen und zur klinischen Reife entwickelt . In der Kiefer-Gesichts-Chirurgie konnte aus anatomischen Gruenden die in der Extremitaetenchirurgie verwendete Apparatur zur Erzeugung der axialen Kompression jedoch nicht angewendet werden . Daher hat Luhr 1968 eine selbstspannende Kompressionsplatte publiziert , mit der sich auf vereinfachte Weise das Prinzip der axialen Kompression realisieren liess . Mit dieser Druckschraubenplatte hat Luhr 1967 die erste Kompressionsosteosynthese in der Welt im maxillofazialen Bereich durchgefuehrt . In den naechsten Jahren folgten dann zahlreiche Publikationen ueber aehnliche Verfahren der Kompressionsosteosynthese durch andere Autoren . Daneben entwickelte sich in den 70er Jahren mit der Einfuehrung der monokortikalen Miniplatten ein ganz anderes Verfahren der Osteosynthese fuer Unterkieferfrakturen und spaeter auch fuer Frakturen des Mittelgesichts , welches mit dem Namen Michelet und auch Champy verbunden ist . Fuer die Unterkieferrekonstruktion im Rahmen der Tumorchirurgie und nach Defektfrakturen wurden ebenfalls die unterschiedlichsten Platten- und Schraubensysteme entwickelt , die sowohl eine stabile alloplastische Ueberbrueckung von Defekten als auch die stabile Fixation von Knochentransplantaten unter axialer Kompression erlaubten . Auch hier bestand der wesentliche Vorteil aus dem Verzicht auf jede postoperative intermaxillare Immobilisation der Kiefer . Die Plattenosteosynthese hat auch die gesamte orthognathe Chirurgie revolutioniert , wobei auch hier der Verzicht auf die frueher uebliche wochenlange intermaxillare Immobilisation den groessten Vorteil darstellte . Die Einfuehrung hochkorrosionsbestaendiger Implantatmaterialien ( Vitallium Titan ) , und die Entwicklung von Plattensystemen adaequater Dimensionen fuer die unterschiedlichsten Anwendungsgebiete im Bereich des komplexen Gesichtsschaedels bis hin zu Mikrosystemen mit extrem kleinem Schraubendurchmesser von 0,8 mm fuehrten bis heute zu einem gewissen Abschluss in der Entwicklung der stabilen Osteosynthese in unserem Fachgebiet .
[ "Die", "Platten", "-", "Schrauben", "-", "Osteosynthese", "hat", "in", "den", "letzten", "30", "Jahren", "weite", "Teile", "des", "Fachgebiets", "Mund-", ",", "Kiefer-", "und", "Gesichtschirurgie", "revolutioniert", ".", "Neben", "der", "dreidimensionalen", "Rekonstruktion", "des", "knoechernen", "Gesichtsschaedels", "ermoeglicht", "die", "stabile", "Osteosynthese", "nach", "Frakturversorgung", "und", "auch", "im", "Rahmen", "der", "orthognathen", "Chirurgie", "einen", "Verzicht", "auf", "die", "frueher", "uebliche", "intramaxillare", "Immobilisation", "der", "Kiefer", "durch", "dentale", "Schienenverbaende", ".", "Die", "Plattenosteosynthese", "beginnt", "mit", "dem", "Hamburger", "Chirurgen", "Carl", "Hansmann", ",", "der", "1886", "erste", "Erfahrungen", "mit", "dem", "von", "ihm", "entwickelten", "Plattensystem", "vorstellte", ".", "Neben", "Extremitaetenfrakturen", "berichtete", "Hansmann", "auch", "ueber", "2", "mit", "diesem", "Verfahren", "behandelte", "Unterkieferfrakturen", ".", "Damit", "ist", "Hansmann", "auch", "fuer", "unser", "Fachgebiet", "der", "erste", "Vertreter", "der", "Plattenosteosynthese", ".", "Wegen", "der", "hohen", "Komplikationsrate", "konnte", "sich", "die", "Platten", "-", "Schrauben", "-", "Osteosynthese", "ueber", "viele", "Jahrzehnte", "nicht", "allgemein", "durchsetzen", ".", "Die", "Einfuehrung", "des", "Prinzips", "der", "axialen", "Kompression", "durch", "den", "Belgischen", "Chirurgen", "Robert", "Danis", "(", "1949", ")", "brachte", "hier", "eine", "Wende", ".", "Im", "Bereich", "der", "Extremitaetenchirurgie", "wurde", "diese", "Idee", "der", "axialen", "Kompression", "der", "Fragmentenden", "von", "der", "schweizerischen", "Forschungsgruppe", "der", "AO", "Anfang", "der", "60er", "Jahre", "aufgenommen", "und", "zur", "klinischen", "Reife", "entwickelt", ".", "In", "der", "Kiefer", "-", "Gesichts", "-", "Chirurgie", "konnte", "aus", "anatomischen", "Gruenden", "die", "in", "der", "Extremitaetenchirurgie", "verwendete", "Apparatur", "zur", "Erzeugung", "der", "axialen", "Kompression", "jedoch", "nicht", "angewendet", "werden", ".", "Daher", "hat", "Luhr", "1968", "eine", "selbstspannende", "Kompressionsplatte", "publiziert", ",", "mit", "der", "sich", "auf", "vereinfachte", "Weise", "das", "Prinzip", "der", "axialen", "Kompression", "realisieren", "liess", ".", "Mit", "dieser", "Druckschraubenplatte", "hat", "Luhr", "1967", "die", "erste", "Kompressionsosteosynthese", "in", "der", "Welt", "im", "maxillofazialen", "Bereich", "durchgefuehrt", ".", "In", "den", "naechsten", "Jahren", "folgten", "dann", "zahlreiche", "Publikationen", "ueber", "aehnliche", "Verfahren", "der", "Kompressionsosteosynthese", "durch", "andere", "Autoren", ".", "Daneben", "entwickelte", "sich", "in", "den", "70er", "Jahren", "mit", "der", "Einfuehrung", "der", "monokortikalen", "Miniplatten", "ein", "ganz", "anderes", "Verfahren", "der", "Osteosynthese", "fuer", "Unterkieferfrakturen", "und", "spaeter", "auch", "fuer", "Frakturen", "des", "Mittelgesichts", ",", "welches", "mit", "dem", "Namen", "Michelet", "und", "auch", "Champy", "verbunden", "ist", ".", "Fuer", "die", "Unterkieferrekonstruktion", "im", "Rahmen", "der", "Tumorchirurgie", "und", "nach", "Defektfrakturen", "wurden", "ebenfalls", "die", "unterschiedlichsten", "Platten-", "und", "Schraubensysteme", "entwickelt", ",", "die", "sowohl", "eine", "stabile", "alloplastische", "Ueberbrueckung", "von", "Defekten", "als", "auch", "die", "stabile", "Fixation", "von", "Knochentransplantaten", "unter", "axialer", "Kompression", "erlaubten", ".", "Auch", "hier", "bestand", "der", "wesentliche", "Vorteil", "aus", "dem", "Verzicht", "auf", "jede", "postoperative", "intermaxillare", "Immobilisation", "der", "Kiefer", ".", "Die", "Plattenosteosynthese", "hat", "auch", "die", "gesamte", "orthognathe", "Chirurgie", "revolutioniert", ",", "wobei", "auch", "hier", "der", "Verzicht", "auf", "die", "frueher", "uebliche", "wochenlange", "intermaxillare", "Immobilisation", "den", "groessten", "Vorteil", "darstellte", ".", "Die", "Einfuehrung", "hochkorrosionsbestaendiger", "Implantatmaterialien", "(", "Vitallium", "Titan", ")", ",", "und", "die", "Entwicklung", "von", "Plattensystemen", "adaequater", "Dimensionen", "fuer", "die", "unterschiedlichsten", "Anwendungsgebiete", "im", "Bereich", "des", "komplexen", "Gesichtsschaedels", "bis", "hin", "zu", "Mikrosystemen", "mit", "extrem", "kleinem", "Schraubendurchmesser", "von", "0,8", "mm", "fuehrten", "bis", "heute", "zu", "einem", "gewissen", "Abschluss", "in", "der", "Entwicklung", "der", "stabilen", "Osteosynthese", "in", "unserem", "Fachgebiet", "." ]
[ "umlsterm" ]
Therapie is an umlsterm, radiologischer is an umlsterm, Medikamenten is an umlsterm, Osteotomien is an umlsterm, Techniken is an umlsterm, Knochentransplantation is an umlsterm, Knorpels is an umlsterm, Knorpelschaeden is an umlsterm, Oberflaechenersatzprothese is an umlsterm, Knorpelschaden is an umlsterm, Acetabulum is an umlsterm
DerOrthopaede.00290457.ger.abstr_task0
Sentence: Die Therapie der ON beinhaltet unterschiedliche Verfahren fuer ein breites Spektrum verschiedener radiologischer Stadien . Fuer Fruehformen im Praekollapsstadium mit kleinen bis mittelgrossen Laesionen kann der Einsatz von Medikamenten oder die Hueftkopfentlastungsbohrung empfohlen werden . Von verschiedenen Autoren wurden fuer die kleinen bis mittelgrossen Laesionen unterschiedliche Osteotomien eingesetzt , die jedoch maessige Ergebnisse zeigten . Im Postkollapsstadium mit kleinen bis mittelgrossen Laesionen koennen die verschiedenen Techniken der Knochentransplantation empfohlen werden . Diese Eingriffe sollten jedoch immer mit der Inspektion des Knorpels verbunden werden um grosse Laesionen oder Knorpelschaeden auszuschliessen . In diesen Faellen ist der Einsatz einer Oberflaechenersatzprothese des Femurkopfes sinnvoll . Bei bereits bestehendem Knorpelschaden am Acetabulum sollte jedoch primaer eine konventionelle Huefttotalendoprothese eingesetzt werden . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Therapie der ON beinhaltet unterschiedliche Verfahren fuer ein breites Spektrum verschiedener radiologischer Stadien . Fuer Fruehformen im Praekollapsstadium mit kleinen bis mittelgrossen Laesionen kann der Einsatz von Medikamenten oder die Hueftkopfentlastungsbohrung empfohlen werden . Von verschiedenen Autoren wurden fuer die kleinen bis mittelgrossen Laesionen unterschiedliche Osteotomien eingesetzt , die jedoch maessige Ergebnisse zeigten . Im Postkollapsstadium mit kleinen bis mittelgrossen Laesionen koennen die verschiedenen Techniken der Knochentransplantation empfohlen werden . Diese Eingriffe sollten jedoch immer mit der Inspektion des Knorpels verbunden werden um grosse Laesionen oder Knorpelschaeden auszuschliessen . In diesen Faellen ist der Einsatz einer Oberflaechenersatzprothese des Femurkopfes sinnvoll . Bei bereits bestehendem Knorpelschaden am Acetabulum sollte jedoch primaer eine konventionelle Huefttotalendoprothese eingesetzt werden .
[ "Die", "Therapie", "der", "ON", "beinhaltet", "unterschiedliche", "Verfahren", "fuer", "ein", "breites", "Spektrum", "verschiedener", "radiologischer", "Stadien", ".", "Fuer", "Fruehformen", "im", "Praekollapsstadium", "mit", "kleinen", "bis", "mittelgrossen", "Laesionen", "kann", "der", "Einsatz", "von", "Medikamenten", "oder", "die", "Hueftkopfentlastungsbohrung", "empfohlen", "werden", ".", "Von", "verschiedenen", "Autoren", "wurden", "fuer", "die", "kleinen", "bis", "mittelgrossen", "Laesionen", "unterschiedliche", "Osteotomien", "eingesetzt", ",", "die", "jedoch", "maessige", "Ergebnisse", "zeigten", ".", "Im", "Postkollapsstadium", "mit", "kleinen", "bis", "mittelgrossen", "Laesionen", "koennen", "die", "verschiedenen", "Techniken", "der", "Knochentransplantation", "empfohlen", "werden", ".", "Diese", "Eingriffe", "sollten", "jedoch", "immer", "mit", "der", "Inspektion", "des", "Knorpels", "verbunden", "werden", "um", "grosse", "Laesionen", "oder", "Knorpelschaeden", "auszuschliessen", ".", "In", "diesen", "Faellen", "ist", "der", "Einsatz", "einer", "Oberflaechenersatzprothese", "des", "Femurkopfes", "sinnvoll", ".", "Bei", "bereits", "bestehendem", "Knorpelschaden", "am", "Acetabulum", "sollte", "jedoch", "primaer", "eine", "konventionelle", "Huefttotalendoprothese", "eingesetzt", "werden", "." ]
[ "umlsterm" ]
Therapie is an umlsterm, radiologischer is an umlsterm, Medikamenten is an umlsterm, Osteotomien is an umlsterm, Techniken is an umlsterm, Knochentransplantation is an umlsterm, Knorpels is an umlsterm, Knorpelschaeden is an umlsterm, Oberflaechenersatzprothese is an umlsterm, Knorpelschaden is an umlsterm, Acetabulum is an umlsterm
DerOrthopaede.00290457.ger.abstr_task1
Sentence: Die Therapie der ON beinhaltet unterschiedliche Verfahren fuer ein breites Spektrum verschiedener radiologischer Stadien . Fuer Fruehformen im Praekollapsstadium mit kleinen bis mittelgrossen Laesionen kann der Einsatz von Medikamenten oder die Hueftkopfentlastungsbohrung empfohlen werden . Von verschiedenen Autoren wurden fuer die kleinen bis mittelgrossen Laesionen unterschiedliche Osteotomien eingesetzt , die jedoch maessige Ergebnisse zeigten . Im Postkollapsstadium mit kleinen bis mittelgrossen Laesionen koennen die verschiedenen Techniken der Knochentransplantation empfohlen werden . Diese Eingriffe sollten jedoch immer mit der Inspektion des Knorpels verbunden werden um grosse Laesionen oder Knorpelschaeden auszuschliessen . In diesen Faellen ist der Einsatz einer Oberflaechenersatzprothese des Femurkopfes sinnvoll . Bei bereits bestehendem Knorpelschaden am Acetabulum sollte jedoch primaer eine konventionelle Huefttotalendoprothese eingesetzt werden . Instructions: please typing these entity words according to sentence: Therapie, radiologischer, Medikamenten, Osteotomien, Techniken, Knochentransplantation, Knorpels, Knorpelschaeden, Oberflaechenersatzprothese, Knorpelschaden, Acetabulum Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Therapie der ON beinhaltet unterschiedliche Verfahren fuer ein breites Spektrum verschiedener radiologischer Stadien . Fuer Fruehformen im Praekollapsstadium mit kleinen bis mittelgrossen Laesionen kann der Einsatz von Medikamenten oder die Hueftkopfentlastungsbohrung empfohlen werden . Von verschiedenen Autoren wurden fuer die kleinen bis mittelgrossen Laesionen unterschiedliche Osteotomien eingesetzt , die jedoch maessige Ergebnisse zeigten . Im Postkollapsstadium mit kleinen bis mittelgrossen Laesionen koennen die verschiedenen Techniken der Knochentransplantation empfohlen werden . Diese Eingriffe sollten jedoch immer mit der Inspektion des Knorpels verbunden werden um grosse Laesionen oder Knorpelschaeden auszuschliessen . In diesen Faellen ist der Einsatz einer Oberflaechenersatzprothese des Femurkopfes sinnvoll . Bei bereits bestehendem Knorpelschaden am Acetabulum sollte jedoch primaer eine konventionelle Huefttotalendoprothese eingesetzt werden .
[ "Die", "Therapie", "der", "ON", "beinhaltet", "unterschiedliche", "Verfahren", "fuer", "ein", "breites", "Spektrum", "verschiedener", "radiologischer", "Stadien", ".", "Fuer", "Fruehformen", "im", "Praekollapsstadium", "mit", "kleinen", "bis", "mittelgrossen", "Laesionen", "kann", "der", "Einsatz", "von", "Medikamenten", "oder", "die", "Hueftkopfentlastungsbohrung", "empfohlen", "werden", ".", "Von", "verschiedenen", "Autoren", "wurden", "fuer", "die", "kleinen", "bis", "mittelgrossen", "Laesionen", "unterschiedliche", "Osteotomien", "eingesetzt", ",", "die", "jedoch", "maessige", "Ergebnisse", "zeigten", ".", "Im", "Postkollapsstadium", "mit", "kleinen", "bis", "mittelgrossen", "Laesionen", "koennen", "die", "verschiedenen", "Techniken", "der", "Knochentransplantation", "empfohlen", "werden", ".", "Diese", "Eingriffe", "sollten", "jedoch", "immer", "mit", "der", "Inspektion", "des", "Knorpels", "verbunden", "werden", "um", "grosse", "Laesionen", "oder", "Knorpelschaeden", "auszuschliessen", ".", "In", "diesen", "Faellen", "ist", "der", "Einsatz", "einer", "Oberflaechenersatzprothese", "des", "Femurkopfes", "sinnvoll", ".", "Bei", "bereits", "bestehendem", "Knorpelschaden", "am", "Acetabulum", "sollte", "jedoch", "primaer", "eine", "konventionelle", "Huefttotalendoprothese", "eingesetzt", "werden", "." ]
[ "umlsterm" ]
Therapie, radiologischer, Medikamenten, Osteotomien, Techniken, Knochentransplantation, Knorpels, Knorpelschaeden, Oberflaechenersatzprothese, Knorpelschaden, Acetabulum
DerOrthopaede.00290457.ger.abstr_task2
Sentence: Die Therapie der ON beinhaltet unterschiedliche Verfahren fuer ein breites Spektrum verschiedener radiologischer Stadien . Fuer Fruehformen im Praekollapsstadium mit kleinen bis mittelgrossen Laesionen kann der Einsatz von Medikamenten oder die Hueftkopfentlastungsbohrung empfohlen werden . Von verschiedenen Autoren wurden fuer die kleinen bis mittelgrossen Laesionen unterschiedliche Osteotomien eingesetzt , die jedoch maessige Ergebnisse zeigten . Im Postkollapsstadium mit kleinen bis mittelgrossen Laesionen koennen die verschiedenen Techniken der Knochentransplantation empfohlen werden . Diese Eingriffe sollten jedoch immer mit der Inspektion des Knorpels verbunden werden um grosse Laesionen oder Knorpelschaeden auszuschliessen . In diesen Faellen ist der Einsatz einer Oberflaechenersatzprothese des Femurkopfes sinnvoll . Bei bereits bestehendem Knorpelschaden am Acetabulum sollte jedoch primaer eine konventionelle Huefttotalendoprothese eingesetzt werden . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Therapie der ON beinhaltet unterschiedliche Verfahren fuer ein breites Spektrum verschiedener radiologischer Stadien . Fuer Fruehformen im Praekollapsstadium mit kleinen bis mittelgrossen Laesionen kann der Einsatz von Medikamenten oder die Hueftkopfentlastungsbohrung empfohlen werden . Von verschiedenen Autoren wurden fuer die kleinen bis mittelgrossen Laesionen unterschiedliche Osteotomien eingesetzt , die jedoch maessige Ergebnisse zeigten . Im Postkollapsstadium mit kleinen bis mittelgrossen Laesionen koennen die verschiedenen Techniken der Knochentransplantation empfohlen werden . Diese Eingriffe sollten jedoch immer mit der Inspektion des Knorpels verbunden werden um grosse Laesionen oder Knorpelschaeden auszuschliessen . In diesen Faellen ist der Einsatz einer Oberflaechenersatzprothese des Femurkopfes sinnvoll . Bei bereits bestehendem Knorpelschaden am Acetabulum sollte jedoch primaer eine konventionelle Huefttotalendoprothese eingesetzt werden .
[ "Die", "Therapie", "der", "ON", "beinhaltet", "unterschiedliche", "Verfahren", "fuer", "ein", "breites", "Spektrum", "verschiedener", "radiologischer", "Stadien", ".", "Fuer", "Fruehformen", "im", "Praekollapsstadium", "mit", "kleinen", "bis", "mittelgrossen", "Laesionen", "kann", "der", "Einsatz", "von", "Medikamenten", "oder", "die", "Hueftkopfentlastungsbohrung", "empfohlen", "werden", ".", "Von", "verschiedenen", "Autoren", "wurden", "fuer", "die", "kleinen", "bis", "mittelgrossen", "Laesionen", "unterschiedliche", "Osteotomien", "eingesetzt", ",", "die", "jedoch", "maessige", "Ergebnisse", "zeigten", ".", "Im", "Postkollapsstadium", "mit", "kleinen", "bis", "mittelgrossen", "Laesionen", "koennen", "die", "verschiedenen", "Techniken", "der", "Knochentransplantation", "empfohlen", "werden", ".", "Diese", "Eingriffe", "sollten", "jedoch", "immer", "mit", "der", "Inspektion", "des", "Knorpels", "verbunden", "werden", "um", "grosse", "Laesionen", "oder", "Knorpelschaeden", "auszuschliessen", ".", "In", "diesen", "Faellen", "ist", "der", "Einsatz", "einer", "Oberflaechenersatzprothese", "des", "Femurkopfes", "sinnvoll", ".", "Bei", "bereits", "bestehendem", "Knorpelschaden", "am", "Acetabulum", "sollte", "jedoch", "primaer", "eine", "konventionelle", "Huefttotalendoprothese", "eingesetzt", "werden", "." ]
[ "umlsterm" ]
use is an umlsterm, Point - of - Care is an umlsterm, testing is an umlsterm, emergency is an umlsterm, intensive care units is an umlsterm, operating room is an umlsterm, blood gas analysis is an umlsterm
DerAnaesthesist.80470490.eng.abstr_task0
Sentence: Within the last few years the use of Point-of-Care Analyzers increased . These testing is primarily performed in the emergency room , intensive care units , and in the operating room using small portable analyzers . The fact of being transportable and working with rechargeable or changable batteries and disposable cartridges caused us to use blood gas analysis in the prehospital setting . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O" ]
Within the last few years the use of Point-of-Care Analyzers increased . These testing is primarily performed in the emergency room , intensive care units , and in the operating room using small portable analyzers . The fact of being transportable and working with rechargeable or changable batteries and disposable cartridges caused us to use blood gas analysis in the prehospital setting .
[ "Within", "the", "last", "few", "years", "the", "use", "of", "Point", "-", "of", "-", "Care", "Analyzers", "increased", ".", "These", "testing", "is", "primarily", "performed", "in", "the", "emergency", "room", ",", "intensive", "care", "units", ",", "and", "in", "the", "operating", "room", "using", "small", "portable", "analyzers", ".", "The", "fact", "of", "being", "transportable", "and", "working", "with", "rechargeable", "or", "changable", "batteries", "and", "disposable", "cartridges", "caused", "us", "to", "use", "blood", "gas", "analysis", "in", "the", "prehospital", "setting", "." ]
[ "umlsterm" ]
use is an umlsterm, Point - of - Care is an umlsterm, testing is an umlsterm, emergency is an umlsterm, intensive care units is an umlsterm, operating room is an umlsterm, blood gas analysis is an umlsterm
DerAnaesthesist.80470490.eng.abstr_task1
Sentence: Within the last few years the use of Point-of-Care Analyzers increased . These testing is primarily performed in the emergency room , intensive care units , and in the operating room using small portable analyzers . The fact of being transportable and working with rechargeable or changable batteries and disposable cartridges caused us to use blood gas analysis in the prehospital setting . Instructions: please typing these entity words according to sentence: use, Point - of - Care, testing, emergency, intensive care units, operating room, blood gas analysis Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O" ]
Within the last few years the use of Point-of-Care Analyzers increased . These testing is primarily performed in the emergency room , intensive care units , and in the operating room using small portable analyzers . The fact of being transportable and working with rechargeable or changable batteries and disposable cartridges caused us to use blood gas analysis in the prehospital setting .
[ "Within", "the", "last", "few", "years", "the", "use", "of", "Point", "-", "of", "-", "Care", "Analyzers", "increased", ".", "These", "testing", "is", "primarily", "performed", "in", "the", "emergency", "room", ",", "intensive", "care", "units", ",", "and", "in", "the", "operating", "room", "using", "small", "portable", "analyzers", ".", "The", "fact", "of", "being", "transportable", "and", "working", "with", "rechargeable", "or", "changable", "batteries", "and", "disposable", "cartridges", "caused", "us", "to", "use", "blood", "gas", "analysis", "in", "the", "prehospital", "setting", "." ]
[ "umlsterm" ]
use, Point - of - Care, testing, emergency, intensive care units, operating room, blood gas analysis
DerAnaesthesist.80470490.eng.abstr_task2
Sentence: Within the last few years the use of Point-of-Care Analyzers increased . These testing is primarily performed in the emergency room , intensive care units , and in the operating room using small portable analyzers . The fact of being transportable and working with rechargeable or changable batteries and disposable cartridges caused us to use blood gas analysis in the prehospital setting . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O" ]
Within the last few years the use of Point-of-Care Analyzers increased . These testing is primarily performed in the emergency room , intensive care units , and in the operating room using small portable analyzers . The fact of being transportable and working with rechargeable or changable batteries and disposable cartridges caused us to use blood gas analysis in the prehospital setting .
[ "Within", "the", "last", "few", "years", "the", "use", "of", "Point", "-", "of", "-", "Care", "Analyzers", "increased", ".", "These", "testing", "is", "primarily", "performed", "in", "the", "emergency", "room", ",", "intensive", "care", "units", ",", "and", "in", "the", "operating", "room", "using", "small", "portable", "analyzers", ".", "The", "fact", "of", "being", "transportable", "and", "working", "with", "rechargeable", "or", "changable", "batteries", "and", "disposable", "cartridges", "caused", "us", "to", "use", "blood", "gas", "analysis", "in", "the", "prehospital", "setting", "." ]
[ "umlsterm" ]
Achilles tendon is an umlsterm, hypoxic is an umlsterm, injury is an umlsterm, tendon is an umlsterm, trauma is an umlsterm, patient is an umlsterm, fracture is an umlsterm, rupture is an umlsterm, Achilles tendon is an umlsterm, fracture is an umlsterm, diagnosis is an umlsterm, MRI is an umlsterm, treatment is an umlsterm
DerUnfallchirurg.01030248.eng.abstr_task0
Sentence: Ossification of the Achilles tendon is the result of a traumatic , hypoxic injury of the tendon . The usually asymptomatic ossification has a clinical importance only in case of a new trauma . We report about a patient with an isolated fracture of the ossification without an accompanying rupture of the Achilles tendon . Because of the radiologically " occult " fracture the diagnosis could only be verified by MRI . With a conservative treatment without resection of the ossification we could reach painless recovery . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Ossification of the Achilles tendon is the result of a traumatic , hypoxic injury of the tendon . The usually asymptomatic ossification has a clinical importance only in case of a new trauma . We report about a patient with an isolated fracture of the ossification without an accompanying rupture of the Achilles tendon . Because of the radiologically " occult " fracture the diagnosis could only be verified by MRI . With a conservative treatment without resection of the ossification we could reach painless recovery .
[ "Ossification", "of", "the", "Achilles", "tendon", "is", "the", "result", "of", "a", "traumatic", ",", "hypoxic", "injury", "of", "the", "tendon", ".", "The", "usually", "asymptomatic", "ossification", "has", "a", "clinical", "importance", "only", "in", "case", "of", "a", "new", "trauma", ".", "We", "report", "about", "a", "patient", "with", "an", "isolated", "fracture", "of", "the", "ossification", "without", "an", "accompanying", "rupture", "of", "the", "Achilles", "tendon", ".", "Because", "of", "the", "radiologically", "\"", "occult", "\"", "fracture", "the", "diagnosis", "could", "only", "be", "verified", "by", "MRI", ".", "With", "a", "conservative", "treatment", "without", "resection", "of", "the", "ossification", "we", "could", "reach", "painless", "recovery", "." ]
[ "umlsterm" ]
Achilles tendon is an umlsterm, hypoxic is an umlsterm, injury is an umlsterm, tendon is an umlsterm, trauma is an umlsterm, patient is an umlsterm, fracture is an umlsterm, rupture is an umlsterm, Achilles tendon is an umlsterm, fracture is an umlsterm, diagnosis is an umlsterm, MRI is an umlsterm, treatment is an umlsterm
DerUnfallchirurg.01030248.eng.abstr_task1
Sentence: Ossification of the Achilles tendon is the result of a traumatic , hypoxic injury of the tendon . The usually asymptomatic ossification has a clinical importance only in case of a new trauma . We report about a patient with an isolated fracture of the ossification without an accompanying rupture of the Achilles tendon . Because of the radiologically " occult " fracture the diagnosis could only be verified by MRI . With a conservative treatment without resection of the ossification we could reach painless recovery . Instructions: please typing these entity words according to sentence: Achilles tendon, hypoxic, injury, tendon, trauma, patient, fracture, rupture, Achilles tendon, fracture, diagnosis, MRI, treatment Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Ossification of the Achilles tendon is the result of a traumatic , hypoxic injury of the tendon . The usually asymptomatic ossification has a clinical importance only in case of a new trauma . We report about a patient with an isolated fracture of the ossification without an accompanying rupture of the Achilles tendon . Because of the radiologically " occult " fracture the diagnosis could only be verified by MRI . With a conservative treatment without resection of the ossification we could reach painless recovery .
[ "Ossification", "of", "the", "Achilles", "tendon", "is", "the", "result", "of", "a", "traumatic", ",", "hypoxic", "injury", "of", "the", "tendon", ".", "The", "usually", "asymptomatic", "ossification", "has", "a", "clinical", "importance", "only", "in", "case", "of", "a", "new", "trauma", ".", "We", "report", "about", "a", "patient", "with", "an", "isolated", "fracture", "of", "the", "ossification", "without", "an", "accompanying", "rupture", "of", "the", "Achilles", "tendon", ".", "Because", "of", "the", "radiologically", "\"", "occult", "\"", "fracture", "the", "diagnosis", "could", "only", "be", "verified", "by", "MRI", ".", "With", "a", "conservative", "treatment", "without", "resection", "of", "the", "ossification", "we", "could", "reach", "painless", "recovery", "." ]
[ "umlsterm" ]
Achilles tendon, hypoxic, injury, tendon, trauma, patient, fracture, rupture, Achilles tendon, fracture, diagnosis, MRI, treatment
DerUnfallchirurg.01030248.eng.abstr_task2
Sentence: Ossification of the Achilles tendon is the result of a traumatic , hypoxic injury of the tendon . The usually asymptomatic ossification has a clinical importance only in case of a new trauma . We report about a patient with an isolated fracture of the ossification without an accompanying rupture of the Achilles tendon . Because of the radiologically " occult " fracture the diagnosis could only be verified by MRI . With a conservative treatment without resection of the ossification we could reach painless recovery . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Ossification of the Achilles tendon is the result of a traumatic , hypoxic injury of the tendon . The usually asymptomatic ossification has a clinical importance only in case of a new trauma . We report about a patient with an isolated fracture of the ossification without an accompanying rupture of the Achilles tendon . Because of the radiologically " occult " fracture the diagnosis could only be verified by MRI . With a conservative treatment without resection of the ossification we could reach painless recovery .
[ "Ossification", "of", "the", "Achilles", "tendon", "is", "the", "result", "of", "a", "traumatic", ",", "hypoxic", "injury", "of", "the", "tendon", ".", "The", "usually", "asymptomatic", "ossification", "has", "a", "clinical", "importance", "only", "in", "case", "of", "a", "new", "trauma", ".", "We", "report", "about", "a", "patient", "with", "an", "isolated", "fracture", "of", "the", "ossification", "without", "an", "accompanying", "rupture", "of", "the", "Achilles", "tendon", ".", "Because", "of", "the", "radiologically", "\"", "occult", "\"", "fracture", "the", "diagnosis", "could", "only", "be", "verified", "by", "MRI", ".", "With", "a", "conservative", "treatment", "without", "resection", "of", "the", "ossification", "we", "could", "reach", "painless", "recovery", "." ]
[ "umlsterm" ]
mifepristone is a CHEMICAL, RU 486 is a CHEMICAL
10374120_task0
Sentence: Disparate actions of mifepristone (RU 486) on glands and stroma in the primate endometrium. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL
[ "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Disparate actions of mifepristone (RU 486) on glands and stroma in the primate endometrium.
[ "Disparate", "actions", "of", "mifepristone", "(", "RU", "486", ")", "on", "glands", "and", "stroma", "in", "the", "primate", "endometrium", "." ]
[ "GENE-Y", "CHEMICAL" ]
mifepristone is a CHEMICAL, RU 486 is a CHEMICAL
10374120_task1
Sentence: Disparate actions of mifepristone (RU 486) on glands and stroma in the primate endometrium. Instructions: please typing these entity words according to sentence: mifepristone, RU 486 Options: CHEMICAL
[ "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Disparate actions of mifepristone (RU 486) on glands and stroma in the primate endometrium.
[ "Disparate", "actions", "of", "mifepristone", "(", "RU", "486", ")", "on", "glands", "and", "stroma", "in", "the", "primate", "endometrium", "." ]
[ "GENE-Y", "CHEMICAL" ]
mifepristone, RU 486
10374120_task2
Sentence: Disparate actions of mifepristone (RU 486) on glands and stroma in the primate endometrium. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Disparate actions of mifepristone (RU 486) on glands and stroma in the primate endometrium.
[ "Disparate", "actions", "of", "mifepristone", "(", "RU", "486", ")", "on", "glands", "and", "stroma", "in", "the", "primate", "endometrium", "." ]
[ "GENE-Y", "CHEMICAL" ]
physical and emotional status is a Intervention_Educational, low - fat dietary pattern is a Intervention_Educational, Women is a Participant_Sex, low - fat ( 20 % energy ) dietary pattern is a Intervention_Educational, intervention program ( attending sessions and self - monitoring ) is a Intervention_Educational, dietary adherence is a Intervention_Educational, 13,277 is a Participant_Sample-size, postmenopausal is a Participant_Condition, women is a Participant_Sex, low - fat intervention is a Intervention_Physical, reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit / vegetable servings daily and 6 or more grain servings daily is a Intervention_Physical, Year 1 program participation ( degree of attending group sessions and submitting fat scores is a Outcome_Mental, adherence to the low - fat dietary pattern ( percent energy from fat ) is a Outcome_Mental, dietary intervention program is a Intervention_Educational, effect of poorer mental health is a Outcome_Mental, physical functioning is a Outcome_Mental, session attendance is a Outcome_Mental
9507_task0
Sentence: The effects of physical and emotional status on adherence to a low-fat dietary pattern in the Women 's Health Initiative . OBJECTIVE To examine whether the effects of physical and emotional status on adherance to a low-fat ( 20 % energy ) dietary pattern are mediated by participation in an intervention program ( attending sessions and self-monitoring ) . DESIGN The Baron and Kenny mediator model , a series of 4 regression analyses , was used to evaluate whether : a ) physical and emotional status predicted program participation , b ) program participation predicted dietary adherence , c ) physical and emotional status factors predicted dietary adherence , and , ultimately d ) the effects of physical and emotional status on dietary adherence were mediated by program participation . SUBJECTS/SETTING Data from 13,277 postmenopausal women randomly assigned to the low-fat intervention arm of the Women 's Health Initiative Dietary Modification Trial . INTERVENTION The nutrition goals for women randomly assigned to the low-fat intervention were to reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit/vegetable servings daily and 6 or more grain servings daily . MAIN OUTCOME MEASURES Year 1 program participation ( degree of attending group sessions and submitting fat scores ) and adherence to the low-fat dietary pattern ( percent energy from fat ) as predicted by baseline physical and emotional status ( eight SF-36 Health Survey subscales ) . RESULTS Participating in the dietary intervention program reduced ( mediated ) the negative effect of poorer mental health on dietary adherence by 15 % . Additional findings included that a 10 % increase in physical functioning increased session attendance by 0.4 % ( P < .001 ) and a 10 % increase in mental health predicted a decrease in percent energy from fat of 0.3 % ( P < .001 ) . Program participation had a marked effect on dietary adherence : a 10 % increase in session attendance predicted a 1.2 % decrease in percent energy from fat ( P < .001 ) . APPLICATIONS/CONCLUSIONS Understanding and using instruments to assess the physical and emotional status of a target population will help dietetic professionals promote healthful dietary change and maintenance . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Physical, Participant_Condition, Participant_Sex, Intervention_Educational, Participant_Sample-size, Outcome_Mental
[ "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "B-Participant_Sex", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "B-Participant_Condition", "B-Participant_Sex", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The effects of physical and emotional status on adherence to a low-fat dietary pattern in the Women 's Health Initiative . OBJECTIVE To examine whether the effects of physical and emotional status on adherance to a low-fat ( 20 % energy ) dietary pattern are mediated by participation in an intervention program ( attending sessions and self-monitoring ) . DESIGN The Baron and Kenny mediator model , a series of 4 regression analyses , was used to evaluate whether : a ) physical and emotional status predicted program participation , b ) program participation predicted dietary adherence , c ) physical and emotional status factors predicted dietary adherence , and , ultimately d ) the effects of physical and emotional status on dietary adherence were mediated by program participation . SUBJECTS/SETTING Data from 13,277 postmenopausal women randomly assigned to the low-fat intervention arm of the Women 's Health Initiative Dietary Modification Trial . INTERVENTION The nutrition goals for women randomly assigned to the low-fat intervention were to reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit/vegetable servings daily and 6 or more grain servings daily . MAIN OUTCOME MEASURES Year 1 program participation ( degree of attending group sessions and submitting fat scores ) and adherence to the low-fat dietary pattern ( percent energy from fat ) as predicted by baseline physical and emotional status ( eight SF-36 Health Survey subscales ) . RESULTS Participating in the dietary intervention program reduced ( mediated ) the negative effect of poorer mental health on dietary adherence by 15 % . Additional findings included that a 10 % increase in physical functioning increased session attendance by 0.4 % ( P < .001 ) and a 10 % increase in mental health predicted a decrease in percent energy from fat of 0.3 % ( P < .001 ) . Program participation had a marked effect on dietary adherence : a 10 % increase in session attendance predicted a 1.2 % decrease in percent energy from fat ( P < .001 ) . APPLICATIONS/CONCLUSIONS Understanding and using instruments to assess the physical and emotional status of a target population will help dietetic professionals promote healthful dietary change and maintenance .
[ "The", "effects", "of", "physical", "and", "emotional", "status", "on", "adherence", "to", "a", "low", "-", "fat", "dietary", "pattern", "in", "the", "Women", "'", "s", "Health", "Initiative", ".", "OBJECTIVE", "To", "examine", "whether", "the", "effects", "of", "physical", "and", "emotional", "status", "on", "adherance", "to", "a", "low", "-", "fat", "(", "20", "%", "energy", ")", "dietary", "pattern", "are", "mediated", "by", "participation", "in", "an", "intervention", "program", "(", "attending", "sessions", "and", "self", "-", "monitoring", ")", ".", "DESIGN", "The", "Baron", "and", "Kenny", "mediator", "model", ",", "a", "series", "of", "4", "regression", "analyses", ",", "was", "used", "to", "evaluate", "whether", ":", "a", ")", "physical", "and", "emotional", "status", "predicted", "program", "participation", ",", "b", ")", "program", "participation", "predicted", "dietary", "adherence", ",", "c", ")", "physical", "and", "emotional", "status", "factors", "predicted", "dietary", "adherence", ",", "and", ",", "ultimately", "d", ")", "the", "effects", "of", "physical", "and", "emotional", "status", "on", "dietary", "adherence", "were", "mediated", "by", "program", "participation", ".", "SUBJECTS", "/", "SETTING", "Data", "from", "13,277", "postmenopausal", "women", "randomly", "assigned", "to", "the", "low", "-", "fat", "intervention", "arm", "of", "the", "Women", "'", "s", "Health", "Initiative", "Dietary", "Modification", "Trial", ".", "INTERVENTION", "The", "nutrition", "goals", "for", "women", "randomly", "assigned", "to", "the", "low", "-", "fat", "intervention", "were", "to", "reduce", "total", "fat", "intake", "to", "20", "%", "or", "less", "of", "energy", "from", "fat", "and", "to", "consume", "5", "or", "more", "fruit", "/", "vegetable", "servings", "daily", "and", "6", "or", "more", "grain", "servings", "daily", ".", "MAIN", "OUTCOME", "MEASURES", "Year", "1", "program", "participation", "(", "degree", "of", "attending", "group", "sessions", "and", "submitting", "fat", "scores", ")", "and", "adherence", "to", "the", "low", "-", "fat", "dietary", "pattern", "(", "percent", "energy", "from", "fat", ")", "as", "predicted", "by", "baseline", "physical", "and", "emotional", "status", "(", "eight", "SF-36", "Health", "Survey", "subscales", ")", ".", "RESULTS", "Participating", "in", "the", "dietary", "intervention", "program", "reduced", "(", "mediated", ")", "the", "negative", "effect", "of", "poorer", "mental", "health", "on", "dietary", "adherence", "by", "15", "%", ".", "Additional", "findings", "included", "that", "a", "10", "%", "increase", "in", "physical", "functioning", "increased", "session", "attendance", "by", "0.4", "%", "(", "P", "<", ".001", ")", "and", "a", "10", "%", "increase", "in", "mental", "health", "predicted", "a", "decrease", "in", "percent", "energy", "from", "fat", "of", "0.3", "%", "(", "P", "<", ".001", ")", ".", "Program", "participation", "had", "a", "marked", "effect", "on", "dietary", "adherence", ":", "a", "10", "%", "increase", "in", "session", "attendance", "predicted", "a", "1.2", "%", "decrease", "in", "percent", "energy", "from", "fat", "(", "P", "<", ".001", ")", ".", "APPLICATIONS", "/", "CONCLUSIONS", "Understanding", "and", "using", "instruments", "to", "assess", "the", "physical", "and", "emotional", "status", "of", "a", "target", "population", "will", "help", "dietetic", "professionals", "promote", "healthful", "dietary", "change", "and", "maintenance", "." ]
[ "Intervention_Physical", "Outcome_Mental", "Intervention_Educational", "Participant_Condition", "Outcome_Other", "Participant_Sample-size", "Participant_Sex" ]
physical and emotional status is a Intervention_Educational, low - fat dietary pattern is a Intervention_Educational, Women is a Participant_Sex, low - fat ( 20 % energy ) dietary pattern is a Intervention_Educational, intervention program ( attending sessions and self - monitoring ) is a Intervention_Educational, dietary adherence is a Intervention_Educational, 13,277 is a Participant_Sample-size, postmenopausal is a Participant_Condition, women is a Participant_Sex, low - fat intervention is a Intervention_Physical, reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit / vegetable servings daily and 6 or more grain servings daily is a Intervention_Physical, Year 1 program participation ( degree of attending group sessions and submitting fat scores is a Outcome_Mental, adherence to the low - fat dietary pattern ( percent energy from fat ) is a Outcome_Mental, dietary intervention program is a Intervention_Educational, effect of poorer mental health is a Outcome_Mental, physical functioning is a Outcome_Mental, session attendance is a Outcome_Mental
9507_task1
Sentence: The effects of physical and emotional status on adherence to a low-fat dietary pattern in the Women 's Health Initiative . OBJECTIVE To examine whether the effects of physical and emotional status on adherance to a low-fat ( 20 % energy ) dietary pattern are mediated by participation in an intervention program ( attending sessions and self-monitoring ) . DESIGN The Baron and Kenny mediator model , a series of 4 regression analyses , was used to evaluate whether : a ) physical and emotional status predicted program participation , b ) program participation predicted dietary adherence , c ) physical and emotional status factors predicted dietary adherence , and , ultimately d ) the effects of physical and emotional status on dietary adherence were mediated by program participation . SUBJECTS/SETTING Data from 13,277 postmenopausal women randomly assigned to the low-fat intervention arm of the Women 's Health Initiative Dietary Modification Trial . INTERVENTION The nutrition goals for women randomly assigned to the low-fat intervention were to reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit/vegetable servings daily and 6 or more grain servings daily . MAIN OUTCOME MEASURES Year 1 program participation ( degree of attending group sessions and submitting fat scores ) and adherence to the low-fat dietary pattern ( percent energy from fat ) as predicted by baseline physical and emotional status ( eight SF-36 Health Survey subscales ) . RESULTS Participating in the dietary intervention program reduced ( mediated ) the negative effect of poorer mental health on dietary adherence by 15 % . Additional findings included that a 10 % increase in physical functioning increased session attendance by 0.4 % ( P < .001 ) and a 10 % increase in mental health predicted a decrease in percent energy from fat of 0.3 % ( P < .001 ) . Program participation had a marked effect on dietary adherence : a 10 % increase in session attendance predicted a 1.2 % decrease in percent energy from fat ( P < .001 ) . APPLICATIONS/CONCLUSIONS Understanding and using instruments to assess the physical and emotional status of a target population will help dietetic professionals promote healthful dietary change and maintenance . Instructions: please typing these entity words according to sentence: physical and emotional status, low - fat dietary pattern, Women, low - fat ( 20 % energy ) dietary pattern, intervention program ( attending sessions and self - monitoring ), dietary adherence, 13,277, postmenopausal, women, low - fat intervention, reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit / vegetable servings daily and 6 or more grain servings daily, Year 1 program participation ( degree of attending group sessions and submitting fat scores, adherence to the low - fat dietary pattern ( percent energy from fat ), dietary intervention program, effect of poorer mental health, physical functioning, session attendance Options: Intervention_Physical, Participant_Condition, Participant_Sex, Intervention_Educational, Participant_Sample-size, Outcome_Mental
[ "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "B-Participant_Sex", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "B-Participant_Condition", "B-Participant_Sex", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The effects of physical and emotional status on adherence to a low-fat dietary pattern in the Women 's Health Initiative . OBJECTIVE To examine whether the effects of physical and emotional status on adherance to a low-fat ( 20 % energy ) dietary pattern are mediated by participation in an intervention program ( attending sessions and self-monitoring ) . DESIGN The Baron and Kenny mediator model , a series of 4 regression analyses , was used to evaluate whether : a ) physical and emotional status predicted program participation , b ) program participation predicted dietary adherence , c ) physical and emotional status factors predicted dietary adherence , and , ultimately d ) the effects of physical and emotional status on dietary adherence were mediated by program participation . SUBJECTS/SETTING Data from 13,277 postmenopausal women randomly assigned to the low-fat intervention arm of the Women 's Health Initiative Dietary Modification Trial . INTERVENTION The nutrition goals for women randomly assigned to the low-fat intervention were to reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit/vegetable servings daily and 6 or more grain servings daily . MAIN OUTCOME MEASURES Year 1 program participation ( degree of attending group sessions and submitting fat scores ) and adherence to the low-fat dietary pattern ( percent energy from fat ) as predicted by baseline physical and emotional status ( eight SF-36 Health Survey subscales ) . RESULTS Participating in the dietary intervention program reduced ( mediated ) the negative effect of poorer mental health on dietary adherence by 15 % . Additional findings included that a 10 % increase in physical functioning increased session attendance by 0.4 % ( P < .001 ) and a 10 % increase in mental health predicted a decrease in percent energy from fat of 0.3 % ( P < .001 ) . Program participation had a marked effect on dietary adherence : a 10 % increase in session attendance predicted a 1.2 % decrease in percent energy from fat ( P < .001 ) . APPLICATIONS/CONCLUSIONS Understanding and using instruments to assess the physical and emotional status of a target population will help dietetic professionals promote healthful dietary change and maintenance .
[ "The", "effects", "of", "physical", "and", "emotional", "status", "on", "adherence", "to", "a", "low", "-", "fat", "dietary", "pattern", "in", "the", "Women", "'", "s", "Health", "Initiative", ".", "OBJECTIVE", "To", "examine", "whether", "the", "effects", "of", "physical", "and", "emotional", "status", "on", "adherance", "to", "a", "low", "-", "fat", "(", "20", "%", "energy", ")", "dietary", "pattern", "are", "mediated", "by", "participation", "in", "an", "intervention", "program", "(", "attending", "sessions", "and", "self", "-", "monitoring", ")", ".", "DESIGN", "The", "Baron", "and", "Kenny", "mediator", "model", ",", "a", "series", "of", "4", "regression", "analyses", ",", "was", "used", "to", "evaluate", "whether", ":", "a", ")", "physical", "and", "emotional", "status", "predicted", "program", "participation", ",", "b", ")", "program", "participation", "predicted", "dietary", "adherence", ",", "c", ")", "physical", "and", "emotional", "status", "factors", "predicted", "dietary", "adherence", ",", "and", ",", "ultimately", "d", ")", "the", "effects", "of", "physical", "and", "emotional", "status", "on", "dietary", "adherence", "were", "mediated", "by", "program", "participation", ".", "SUBJECTS", "/", "SETTING", "Data", "from", "13,277", "postmenopausal", "women", "randomly", "assigned", "to", "the", "low", "-", "fat", "intervention", "arm", "of", "the", "Women", "'", "s", "Health", "Initiative", "Dietary", "Modification", "Trial", ".", "INTERVENTION", "The", "nutrition", "goals", "for", "women", "randomly", "assigned", "to", "the", "low", "-", "fat", "intervention", "were", "to", "reduce", "total", "fat", "intake", "to", "20", "%", "or", "less", "of", "energy", "from", "fat", "and", "to", "consume", "5", "or", "more", "fruit", "/", "vegetable", "servings", "daily", "and", "6", "or", "more", "grain", "servings", "daily", ".", "MAIN", "OUTCOME", "MEASURES", "Year", "1", "program", "participation", "(", "degree", "of", "attending", "group", "sessions", "and", "submitting", "fat", "scores", ")", "and", "adherence", "to", "the", "low", "-", "fat", "dietary", "pattern", "(", "percent", "energy", "from", "fat", ")", "as", "predicted", "by", "baseline", "physical", "and", "emotional", "status", "(", "eight", "SF-36", "Health", "Survey", "subscales", ")", ".", "RESULTS", "Participating", "in", "the", "dietary", "intervention", "program", "reduced", "(", "mediated", ")", "the", "negative", "effect", "of", "poorer", "mental", "health", "on", "dietary", "adherence", "by", "15", "%", ".", "Additional", "findings", "included", "that", "a", "10", "%", "increase", "in", "physical", "functioning", "increased", "session", "attendance", "by", "0.4", "%", "(", "P", "<", ".001", ")", "and", "a", "10", "%", "increase", "in", "mental", "health", "predicted", "a", "decrease", "in", "percent", "energy", "from", "fat", "of", "0.3", "%", "(", "P", "<", ".001", ")", ".", "Program", "participation", "had", "a", "marked", "effect", "on", "dietary", "adherence", ":", "a", "10", "%", "increase", "in", "session", "attendance", "predicted", "a", "1.2", "%", "decrease", "in", "percent", "energy", "from", "fat", "(", "P", "<", ".001", ")", ".", "APPLICATIONS", "/", "CONCLUSIONS", "Understanding", "and", "using", "instruments", "to", "assess", "the", "physical", "and", "emotional", "status", "of", "a", "target", "population", "will", "help", "dietetic", "professionals", "promote", "healthful", "dietary", "change", "and", "maintenance", "." ]
[ "Intervention_Physical", "Outcome_Mental", "Intervention_Educational", "Participant_Condition", "Outcome_Other", "Participant_Sample-size", "Participant_Sex" ]
physical and emotional status, low - fat dietary pattern, Women, low - fat ( 20 % energy ) dietary pattern, intervention program ( attending sessions and self - monitoring ), dietary adherence, 13,277, postmenopausal, women, low - fat intervention, reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit / vegetable servings daily and 6 or more grain servings daily, Year 1 program participation ( degree of attending group sessions and submitting fat scores, adherence to the low - fat dietary pattern ( percent energy from fat ), dietary intervention program, effect of poorer mental health, physical functioning, session attendance
9507_task2
Sentence: The effects of physical and emotional status on adherence to a low-fat dietary pattern in the Women 's Health Initiative . OBJECTIVE To examine whether the effects of physical and emotional status on adherance to a low-fat ( 20 % energy ) dietary pattern are mediated by participation in an intervention program ( attending sessions and self-monitoring ) . DESIGN The Baron and Kenny mediator model , a series of 4 regression analyses , was used to evaluate whether : a ) physical and emotional status predicted program participation , b ) program participation predicted dietary adherence , c ) physical and emotional status factors predicted dietary adherence , and , ultimately d ) the effects of physical and emotional status on dietary adherence were mediated by program participation . SUBJECTS/SETTING Data from 13,277 postmenopausal women randomly assigned to the low-fat intervention arm of the Women 's Health Initiative Dietary Modification Trial . INTERVENTION The nutrition goals for women randomly assigned to the low-fat intervention were to reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit/vegetable servings daily and 6 or more grain servings daily . MAIN OUTCOME MEASURES Year 1 program participation ( degree of attending group sessions and submitting fat scores ) and adherence to the low-fat dietary pattern ( percent energy from fat ) as predicted by baseline physical and emotional status ( eight SF-36 Health Survey subscales ) . RESULTS Participating in the dietary intervention program reduced ( mediated ) the negative effect of poorer mental health on dietary adherence by 15 % . Additional findings included that a 10 % increase in physical functioning increased session attendance by 0.4 % ( P < .001 ) and a 10 % increase in mental health predicted a decrease in percent energy from fat of 0.3 % ( P < .001 ) . Program participation had a marked effect on dietary adherence : a 10 % increase in session attendance predicted a 1.2 % decrease in percent energy from fat ( P < .001 ) . APPLICATIONS/CONCLUSIONS Understanding and using instruments to assess the physical and emotional status of a target population will help dietetic professionals promote healthful dietary change and maintenance . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "B-Participant_Sex", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "B-Participant_Condition", "B-Participant_Sex", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "B-Outcome_Mental", "I-Outcome_Mental", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The effects of physical and emotional status on adherence to a low-fat dietary pattern in the Women 's Health Initiative . OBJECTIVE To examine whether the effects of physical and emotional status on adherance to a low-fat ( 20 % energy ) dietary pattern are mediated by participation in an intervention program ( attending sessions and self-monitoring ) . DESIGN The Baron and Kenny mediator model , a series of 4 regression analyses , was used to evaluate whether : a ) physical and emotional status predicted program participation , b ) program participation predicted dietary adherence , c ) physical and emotional status factors predicted dietary adherence , and , ultimately d ) the effects of physical and emotional status on dietary adherence were mediated by program participation . SUBJECTS/SETTING Data from 13,277 postmenopausal women randomly assigned to the low-fat intervention arm of the Women 's Health Initiative Dietary Modification Trial . INTERVENTION The nutrition goals for women randomly assigned to the low-fat intervention were to reduce total fat intake to 20 % or less of energy from fat and to consume 5 or more fruit/vegetable servings daily and 6 or more grain servings daily . MAIN OUTCOME MEASURES Year 1 program participation ( degree of attending group sessions and submitting fat scores ) and adherence to the low-fat dietary pattern ( percent energy from fat ) as predicted by baseline physical and emotional status ( eight SF-36 Health Survey subscales ) . RESULTS Participating in the dietary intervention program reduced ( mediated ) the negative effect of poorer mental health on dietary adherence by 15 % . Additional findings included that a 10 % increase in physical functioning increased session attendance by 0.4 % ( P < .001 ) and a 10 % increase in mental health predicted a decrease in percent energy from fat of 0.3 % ( P < .001 ) . Program participation had a marked effect on dietary adherence : a 10 % increase in session attendance predicted a 1.2 % decrease in percent energy from fat ( P < .001 ) . APPLICATIONS/CONCLUSIONS Understanding and using instruments to assess the physical and emotional status of a target population will help dietetic professionals promote healthful dietary change and maintenance .
[ "The", "effects", "of", "physical", "and", "emotional", "status", "on", "adherence", "to", "a", "low", "-", "fat", "dietary", "pattern", "in", "the", "Women", "'", "s", "Health", "Initiative", ".", "OBJECTIVE", "To", "examine", "whether", "the", "effects", "of", "physical", "and", "emotional", "status", "on", "adherance", "to", "a", "low", "-", "fat", "(", "20", "%", "energy", ")", "dietary", "pattern", "are", "mediated", "by", "participation", "in", "an", "intervention", "program", "(", "attending", "sessions", "and", "self", "-", "monitoring", ")", ".", "DESIGN", "The", "Baron", "and", "Kenny", "mediator", "model", ",", "a", "series", "of", "4", "regression", "analyses", ",", "was", "used", "to", "evaluate", "whether", ":", "a", ")", "physical", "and", "emotional", "status", "predicted", "program", "participation", ",", "b", ")", "program", "participation", "predicted", "dietary", "adherence", ",", "c", ")", "physical", "and", "emotional", "status", "factors", "predicted", "dietary", "adherence", ",", "and", ",", "ultimately", "d", ")", "the", "effects", "of", "physical", "and", "emotional", "status", "on", "dietary", "adherence", "were", "mediated", "by", "program", "participation", ".", "SUBJECTS", "/", "SETTING", "Data", "from", "13,277", "postmenopausal", "women", "randomly", "assigned", "to", "the", "low", "-", "fat", "intervention", "arm", "of", "the", "Women", "'", "s", "Health", "Initiative", "Dietary", "Modification", "Trial", ".", "INTERVENTION", "The", "nutrition", "goals", "for", "women", "randomly", "assigned", "to", "the", "low", "-", "fat", "intervention", "were", "to", "reduce", "total", "fat", "intake", "to", "20", "%", "or", "less", "of", "energy", "from", "fat", "and", "to", "consume", "5", "or", "more", "fruit", "/", "vegetable", "servings", "daily", "and", "6", "or", "more", "grain", "servings", "daily", ".", "MAIN", "OUTCOME", "MEASURES", "Year", "1", "program", "participation", "(", "degree", "of", "attending", "group", "sessions", "and", "submitting", "fat", "scores", ")", "and", "adherence", "to", "the", "low", "-", "fat", "dietary", "pattern", "(", "percent", "energy", "from", "fat", ")", "as", "predicted", "by", "baseline", "physical", "and", "emotional", "status", "(", "eight", "SF-36", "Health", "Survey", "subscales", ")", ".", "RESULTS", "Participating", "in", "the", "dietary", "intervention", "program", "reduced", "(", "mediated", ")", "the", "negative", "effect", "of", "poorer", "mental", "health", "on", "dietary", "adherence", "by", "15", "%", ".", "Additional", "findings", "included", "that", "a", "10", "%", "increase", "in", "physical", "functioning", "increased", "session", "attendance", "by", "0.4", "%", "(", "P", "<", ".001", ")", "and", "a", "10", "%", "increase", "in", "mental", "health", "predicted", "a", "decrease", "in", "percent", "energy", "from", "fat", "of", "0.3", "%", "(", "P", "<", ".001", ")", ".", "Program", "participation", "had", "a", "marked", "effect", "on", "dietary", "adherence", ":", "a", "10", "%", "increase", "in", "session", "attendance", "predicted", "a", "1.2", "%", "decrease", "in", "percent", "energy", "from", "fat", "(", "P", "<", ".001", ")", ".", "APPLICATIONS", "/", "CONCLUSIONS", "Understanding", "and", "using", "instruments", "to", "assess", "the", "physical", "and", "emotional", "status", "of", "a", "target", "population", "will", "help", "dietetic", "professionals", "promote", "healthful", "dietary", "change", "and", "maintenance", "." ]
[ "Intervention_Physical", "Outcome_Mental", "Intervention_Educational", "Participant_Condition", "Outcome_Other", "Participant_Sample-size", "Participant_Sex" ]
Aged is a Person, over 18 is a Value, Primary symptom is a Qualifier, chest pain is a Condition, No is a Negation, contraindication is a Condition, CTA is a Procedure
NCT03187639_inc_task0
Sentence: Aged over 18 Primary symptom of chest pain No contraindication to CTA Willing and able to provide written informed consent Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Condition, Qualifier, Value, Person, Procedure, Negation
[ "B-Person", "B-Value", "I-Value", "O", "B-Qualifier", "I-Qualifier", "O", "B-Condition", "I-Condition", "O", "B-Negation", "B-Condition", "O", "B-Procedure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Aged over 18 Primary symptom of chest pain No contraindication to CTA Willing and able to provide written informed consent
[ "Aged", "over", "18", "\n", "Primary", "symptom", "of", "chest", "pain", "\n", "No", "contraindication", "to", "CTA", "\n", "Willing", "and", "able", "to", "provide", "written", "informed", "consent", "\n" ]
[ "Condition", "Qualifier", "Value", "Person", "Procedure", "Negation" ]
Aged is a Person, over 18 is a Value, Primary symptom is a Qualifier, chest pain is a Condition, No is a Negation, contraindication is a Condition, CTA is a Procedure
NCT03187639_inc_task1
Sentence: Aged over 18 Primary symptom of chest pain No contraindication to CTA Willing and able to provide written informed consent Instructions: please typing these entity words according to sentence: Aged, over 18, Primary symptom, chest pain, No, contraindication, CTA Options: Condition, Qualifier, Value, Person, Procedure, Negation
[ "B-Person", "B-Value", "I-Value", "O", "B-Qualifier", "I-Qualifier", "O", "B-Condition", "I-Condition", "O", "B-Negation", "B-Condition", "O", "B-Procedure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Aged over 18 Primary symptom of chest pain No contraindication to CTA Willing and able to provide written informed consent
[ "Aged", "over", "18", "\n", "Primary", "symptom", "of", "chest", "pain", "\n", "No", "contraindication", "to", "CTA", "\n", "Willing", "and", "able", "to", "provide", "written", "informed", "consent", "\n" ]
[ "Condition", "Qualifier", "Value", "Person", "Procedure", "Negation" ]
Aged, over 18, Primary symptom, chest pain, No, contraindication, CTA
NCT03187639_inc_task2
Sentence: Aged over 18 Primary symptom of chest pain No contraindication to CTA Willing and able to provide written informed consent Instructions: please extract entity words from the input sentence
[ "B-Person", "B-Value", "I-Value", "O", "B-Qualifier", "I-Qualifier", "O", "B-Condition", "I-Condition", "O", "B-Negation", "B-Condition", "O", "B-Procedure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Aged over 18 Primary symptom of chest pain No contraindication to CTA Willing and able to provide written informed consent
[ "Aged", "over", "18", "\n", "Primary", "symptom", "of", "chest", "pain", "\n", "No", "contraindication", "to", "CTA", "\n", "Willing", "and", "able", "to", "provide", "written", "informed", "consent", "\n" ]
[ "Condition", "Qualifier", "Value", "Person", "Procedure", "Negation" ]
Swedish is an ethnicity, adenomatous polyposis is a disease, families is a cohort-patient, dominantly inherited is a Concepts_Ideas, familial adenomatous polyposis is a disease, FAP is a disease, germline mutations is a mutation, APC is a gene, families is a cohort-patient, patients is a cohort-patient, APC is a gene, 96 is a size, unrelated FAP patients is a cohort-patient, Swedish is an ethnicity, Polyposis is a disease, lowered expression of APC is a Physiology, Sixty - one is a size, APC is a gene, mutations is a mutation, 81 of the 96 is a size, families is a cohort-patient, 27 is a mutation, 6 of the 96 is a size, patients is a cohort-patient, biallelic MUTYH mutations is a mutation, 9 is a size, mutation - negative cases is a cohort-patient, Probands with a genotype ( codon 1250–1464 ) is a cohort-patient, median age at diagnosis of 21.8 is an age, 34.4 ( range , 14–57 ) years is an age, those with mutations outside this region is a cohort-patient, Dense polyposis is a Disorder, 75 % is a size, probands with a severe phenotype is a cohort-patient, 30 % is a size, those with mutations outside this region is a cohort-patient, morbidity is a Concepts_Ideas, colorectal cancer is a disease, probands is a cohort-patient, 25 % is a size, mean age of 37.5 years is an age, 29 % is a size, mean age of 46.6 years is an age, classical is a Concepts_Ideas, FAP is a disease, Probands is a cohort-patient, APC is a gene, mutations outside codon 1250–1464 is a mutation, less - severe phenotype is a Physiology, high risk of having a colorectal cancer is a Concepts_Ideas, disease is a disease, colorectal cancer is a disease, morbidity is a Concepts_Ideas
41_task0
Sentence: ** IGNORE LINE ** ** IGNORE LINE ** ** IGNORE LINE ** Clinical characterization and the mutation spectrum in Swedish adenomatous polyposis families Abstract Background The dominantly inherited condition familial adenomatous polyposis (FAP) is caused by germline mutations in the APC gene. Finding the causative mutations has great implications for the families. Correlating the genotypes to the phenotypes could help to improve the diagnosis and follow-up of patients. Methods Mutation screening of APC and the clinical characterization of 96 unrelated FAP patients from the Swedish Polyposis Registry was performed. In addition to generally used mutation screening methods, analyses of splicing-affecting mutations and investigations of the presence of low-frequency mutation alleles, indicating mosaics, have been performed, as well as quantitative real-time polymerase chain reaction to detect lowered expression of APC. Results Sixty-one different APC mutations in 81 of the 96 families were identified and 27 of those are novel. We have previously shown that 6 of the 96 patients carried biallelic MUTYH mutations. The 9 mutation-negative cases all display an attenuated or atypical phenotype. Probands with a genotype (codon 1250–1464) predicting a severe phenotype had a median age at diagnosis of 21.8 (range, 11–49) years compared with 34.4 (range, 14–57) years among those with mutations outside this region (P < 0.017). Dense polyposis (> 1000) occurred in 75% of the probands with a severe phenotype compared with 30% in those with mutations outside this region. The morbidity in colorectal cancer among probands was 25% at a mean age of 37.5 years and 29% at a mean age of 46.6 years. Conclusion Using a variety of mutation-detection techniques, we have achieved a 100% detection frequency in classical FAP. Probands with APC mutations outside codon 1250–1464, although exhibiting a less-severe phenotype, are at high risk of having a colorectal cancer at diagnosis indicating that age at diagnosis is as important as the severity of the disease for colorectal cancer morbidity. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: ethnicity, size, Concepts_Ideas, disease, cohort-patient, Physiology, Disorder, mutation, gene, age
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ethnicity", "B-disease", "I-disease", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "B-Concepts_Ideas", "I-Concepts_Ideas", "O", "B-disease", "I-disease", "I-disease", "O", "B-disease", "O", "O", "O", "O", "B-mutation", "I-mutation", "O", "O", "B-gene", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "B-gene", "O", "O", "O", "O", "O", "B-size", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-ethnicity", "B-disease", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Physiology", "I-Physiology", "I-Physiology", "I-Physiology", "O", "O", "O", "O", "B-size", "I-size", "I-size", "O", "B-gene", "B-mutation", "O", "B-size", "I-size", "I-size", "I-size", "B-cohort-patient", "O", "O", "O", "B-mutation", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-size", "I-size", "I-size", "I-size", "B-cohort-patient", "O", "B-mutation", "I-mutation", "I-mutation", "O", "O", "B-size", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "I-age", "O", "O", "O", "O", "O", "O", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "I-age", "I-age", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "B-Disorder", "I-Disorder", "O", "O", "O", "O", "O", "O", "B-size", "I-size", "O", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-size", "I-size", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-Concepts_Ideas", "O", "B-disease", "I-disease", "O", "B-cohort-patient", "O", "B-size", "I-size", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "O", "B-size", "I-size", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Concepts_Ideas", "B-disease", "O", "B-cohort-patient", "O", "B-gene", "B-mutation", "I-mutation", "I-mutation", "I-mutation", "O", "O", "O", "O", "B-Physiology", "I-Physiology", "I-Physiology", "I-Physiology", "O", "O", "O", "B-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-disease", "O", "B-disease", "I-disease", "B-Concepts_Ideas", "O", "O" ]
** IGNORE LINE ** ** IGNORE LINE ** ** IGNORE LINE ** Clinical characterization and the mutation spectrum in Swedish adenomatous polyposis families Abstract Background The dominantly inherited condition familial adenomatous polyposis (FAP) is caused by germline mutations in the APC gene. Finding the causative mutations has great implications for the families. Correlating the genotypes to the phenotypes could help to improve the diagnosis and follow-up of patients. Methods Mutation screening of APC and the clinical characterization of 96 unrelated FAP patients from the Swedish Polyposis Registry was performed. In addition to generally used mutation screening methods, analyses of splicing-affecting mutations and investigations of the presence of low-frequency mutation alleles, indicating mosaics, have been performed, as well as quantitative real-time polymerase chain reaction to detect lowered expression of APC. Results Sixty-one different APC mutations in 81 of the 96 families were identified and 27 of those are novel. We have previously shown that 6 of the 96 patients carried biallelic MUTYH mutations. The 9 mutation-negative cases all display an attenuated or atypical phenotype. Probands with a genotype (codon 1250–1464) predicting a severe phenotype had a median age at diagnosis of 21.8 (range, 11–49) years compared with 34.4 (range, 14–57) years among those with mutations outside this region (P < 0.017). Dense polyposis (> 1000) occurred in 75% of the probands with a severe phenotype compared with 30% in those with mutations outside this region. The morbidity in colorectal cancer among probands was 25% at a mean age of 37.5 years and 29% at a mean age of 46.6 years. Conclusion Using a variety of mutation-detection techniques, we have achieved a 100% detection frequency in classical FAP. Probands with APC mutations outside codon 1250–1464, although exhibiting a less-severe phenotype, are at high risk of having a colorectal cancer at diagnosis indicating that age at diagnosis is as important as the severity of the disease for colorectal cancer morbidity.
[ "*", "*", "IGNORE", "LINE", "*", "*", "\n", "*", "*", "IGNORE", "LINE", "*", "*", "\n", "*", "*", "IGNORE", "LINE", "*", "*", "\n", "Clinical", "characterization", "and", "the", "mutation", "spectrum", "in", "Swedish", "adenomatous", "polyposis", "families", "\n\n", "Abstract", "\n\n", "Background", "\n\n", "The", "dominantly", "inherited", "condition", "familial", "adenomatous", "polyposis", "(", "FAP", ")", "is", "caused", "by", "germline", "mutations", "in", "the", "APC", "gene", ".", "Finding", "the", "causative", "mutations", "has", "great", "implications", "for", "the", "families", ".", "Correlating", "the", "genotypes", "to", "the", "phenotypes", "could", "help", "to", "improve", "the", "diagnosis", "and", "follow", "-", "up", "of", "patients", ".", "\n\n", "Methods", "\n\n", "Mutation", "screening", "of", "APC", "and", "the", "clinical", "characterization", "of", "96", "unrelated", "FAP", "patients", "from", "the", "Swedish", "Polyposis", "Registry", "was", "performed", ".", "In", "addition", "to", "generally", "used", "mutation", "screening", "methods", ",", "analyses", "of", "splicing", "-", "affecting", "mutations", "and", "investigations", "of", "the", "presence", "of", "low", "-", "frequency", "mutation", "alleles", ",", "indicating", "mosaics", ",", "have", "been", "performed", ",", "as", "well", "as", "quantitative", "real", "-", "time", "polymerase", "chain", "reaction", "to", "detect", "lowered", "expression", "of", "APC", ".", "\n\n", "Results", "\n\n", "Sixty", "-", "one", "different", "APC", "mutations", "in", "81", "of", "the", "96", "families", "were", "identified", "and", "27", "of", "those", "are", "novel", ".", "We", "have", "previously", "shown", "that", "6", "of", "the", "96", "patients", "carried", "biallelic", "MUTYH", "mutations", ".", "The", "9", "mutation", "-", "negative", "cases", "all", "display", "an", "attenuated", "or", "atypical", "phenotype", ".", "Probands", "with", "a", "genotype", "(", "codon", "1250–1464", ")", "predicting", "a", "severe", "phenotype", "had", "a", "median", "age", "at", "diagnosis", "of", "21.8", "(", "range", ",", "11–49", ")", "years", "compared", "with", "34.4", "(", "range", ",", "14–57", ")", "years", "among", "those", "with", "mutations", "outside", "this", "region", "(", "P", "<", "0.017", ")", ".", "Dense", "polyposis", "(", ">", "1000", ")", "occurred", "in", "75", "%", "of", "the", "probands", "with", "a", "severe", "phenotype", "compared", "with", "30", "%", "in", "those", "with", "mutations", "outside", "this", "region", ".", "The", "morbidity", "in", "colorectal", "cancer", "among", "probands", "was", "25", "%", "at", "a", "mean", "age", "of", "37.5", "years", "and", "29", "%", "at", "a", "mean", "age", "of", "46.6", "years", ".", "\n\n", "Conclusion", "\n\n", "Using", "a", "variety", "of", "mutation", "-", "detection", "techniques", ",", "we", "have", "achieved", "a", "100", "%", "detection", "frequency", "in", "classical", "FAP", ".", "Probands", "with", "APC", "mutations", "outside", "codon", "1250–1464", ",", "although", "exhibiting", "a", "less", "-", "severe", "phenotype", ",", "are", "at", "high", "risk", "of", "having", "a", "colorectal", "cancer", "at", "diagnosis", "indicating", "that", "age", "at", "diagnosis", "is", "as", "important", "as", "the", "severity", "of", "the", "disease", "for", "colorectal", "cancer", "morbidity", ".", "\n\n" ]
[ "cohort-patient", "Concepts_Ideas", "mutation", "age", "disease", "Physiology", "Disorder", "size", "body-part", "ethnicity", "gene" ]
Swedish is an ethnicity, adenomatous polyposis is a disease, families is a cohort-patient, dominantly inherited is a Concepts_Ideas, familial adenomatous polyposis is a disease, FAP is a disease, germline mutations is a mutation, APC is a gene, families is a cohort-patient, patients is a cohort-patient, APC is a gene, 96 is a size, unrelated FAP patients is a cohort-patient, Swedish is an ethnicity, Polyposis is a disease, lowered expression of APC is a Physiology, Sixty - one is a size, APC is a gene, mutations is a mutation, 81 of the 96 is a size, families is a cohort-patient, 27 is a mutation, 6 of the 96 is a size, patients is a cohort-patient, biallelic MUTYH mutations is a mutation, 9 is a size, mutation - negative cases is a cohort-patient, Probands with a genotype ( codon 1250–1464 ) is a cohort-patient, median age at diagnosis of 21.8 is an age, 34.4 ( range , 14–57 ) years is an age, those with mutations outside this region is a cohort-patient, Dense polyposis is a Disorder, 75 % is a size, probands with a severe phenotype is a cohort-patient, 30 % is a size, those with mutations outside this region is a cohort-patient, morbidity is a Concepts_Ideas, colorectal cancer is a disease, probands is a cohort-patient, 25 % is a size, mean age of 37.5 years is an age, 29 % is a size, mean age of 46.6 years is an age, classical is a Concepts_Ideas, FAP is a disease, Probands is a cohort-patient, APC is a gene, mutations outside codon 1250–1464 is a mutation, less - severe phenotype is a Physiology, high risk of having a colorectal cancer is a Concepts_Ideas, disease is a disease, colorectal cancer is a disease, morbidity is a Concepts_Ideas
41_task1
Sentence: ** IGNORE LINE ** ** IGNORE LINE ** ** IGNORE LINE ** Clinical characterization and the mutation spectrum in Swedish adenomatous polyposis families Abstract Background The dominantly inherited condition familial adenomatous polyposis (FAP) is caused by germline mutations in the APC gene. Finding the causative mutations has great implications for the families. Correlating the genotypes to the phenotypes could help to improve the diagnosis and follow-up of patients. Methods Mutation screening of APC and the clinical characterization of 96 unrelated FAP patients from the Swedish Polyposis Registry was performed. In addition to generally used mutation screening methods, analyses of splicing-affecting mutations and investigations of the presence of low-frequency mutation alleles, indicating mosaics, have been performed, as well as quantitative real-time polymerase chain reaction to detect lowered expression of APC. Results Sixty-one different APC mutations in 81 of the 96 families were identified and 27 of those are novel. We have previously shown that 6 of the 96 patients carried biallelic MUTYH mutations. The 9 mutation-negative cases all display an attenuated or atypical phenotype. Probands with a genotype (codon 1250–1464) predicting a severe phenotype had a median age at diagnosis of 21.8 (range, 11–49) years compared with 34.4 (range, 14–57) years among those with mutations outside this region (P < 0.017). Dense polyposis (> 1000) occurred in 75% of the probands with a severe phenotype compared with 30% in those with mutations outside this region. The morbidity in colorectal cancer among probands was 25% at a mean age of 37.5 years and 29% at a mean age of 46.6 years. Conclusion Using a variety of mutation-detection techniques, we have achieved a 100% detection frequency in classical FAP. Probands with APC mutations outside codon 1250–1464, although exhibiting a less-severe phenotype, are at high risk of having a colorectal cancer at diagnosis indicating that age at diagnosis is as important as the severity of the disease for colorectal cancer morbidity. Instructions: please typing these entity words according to sentence: Swedish, adenomatous polyposis, families, dominantly inherited, familial adenomatous polyposis, FAP, germline mutations, APC, families, patients, APC, 96, unrelated FAP patients, Swedish, Polyposis, lowered expression of APC, Sixty - one, APC, mutations, 81 of the 96, families, 27, 6 of the 96, patients, biallelic MUTYH mutations, 9, mutation - negative cases, Probands with a genotype ( codon 1250–1464 ), median age at diagnosis of 21.8, 34.4 ( range , 14–57 ) years, those with mutations outside this region, Dense polyposis, 75 %, probands with a severe phenotype, 30 %, those with mutations outside this region, morbidity, colorectal cancer, probands, 25 %, mean age of 37.5 years, 29 %, mean age of 46.6 years, classical, FAP, Probands, APC, mutations outside codon 1250–1464, less - severe phenotype, high risk of having a colorectal cancer, disease, colorectal cancer, morbidity Options: ethnicity, size, Concepts_Ideas, disease, cohort-patient, Physiology, Disorder, mutation, gene, age
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ethnicity", "B-disease", "I-disease", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "B-Concepts_Ideas", "I-Concepts_Ideas", "O", "B-disease", "I-disease", "I-disease", "O", "B-disease", "O", "O", "O", "O", "B-mutation", "I-mutation", "O", "O", "B-gene", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "B-gene", "O", "O", "O", "O", "O", "B-size", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-ethnicity", "B-disease", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Physiology", "I-Physiology", "I-Physiology", "I-Physiology", "O", "O", "O", "O", "B-size", "I-size", "I-size", "O", "B-gene", "B-mutation", "O", "B-size", "I-size", "I-size", "I-size", "B-cohort-patient", "O", "O", "O", "B-mutation", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-size", "I-size", "I-size", "I-size", "B-cohort-patient", "O", "B-mutation", "I-mutation", "I-mutation", "O", "O", "B-size", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "I-age", "O", "O", "O", "O", "O", "O", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "I-age", "I-age", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "B-Disorder", "I-Disorder", "O", "O", "O", "O", "O", "O", "B-size", "I-size", "O", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-size", "I-size", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-Concepts_Ideas", "O", "B-disease", "I-disease", "O", "B-cohort-patient", "O", "B-size", "I-size", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "O", "B-size", "I-size", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Concepts_Ideas", "B-disease", "O", "B-cohort-patient", "O", "B-gene", "B-mutation", "I-mutation", "I-mutation", "I-mutation", "O", "O", "O", "O", "B-Physiology", "I-Physiology", "I-Physiology", "I-Physiology", "O", "O", "O", "B-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-disease", "O", "B-disease", "I-disease", "B-Concepts_Ideas", "O", "O" ]
** IGNORE LINE ** ** IGNORE LINE ** ** IGNORE LINE ** Clinical characterization and the mutation spectrum in Swedish adenomatous polyposis families Abstract Background The dominantly inherited condition familial adenomatous polyposis (FAP) is caused by germline mutations in the APC gene. Finding the causative mutations has great implications for the families. Correlating the genotypes to the phenotypes could help to improve the diagnosis and follow-up of patients. Methods Mutation screening of APC and the clinical characterization of 96 unrelated FAP patients from the Swedish Polyposis Registry was performed. In addition to generally used mutation screening methods, analyses of splicing-affecting mutations and investigations of the presence of low-frequency mutation alleles, indicating mosaics, have been performed, as well as quantitative real-time polymerase chain reaction to detect lowered expression of APC. Results Sixty-one different APC mutations in 81 of the 96 families were identified and 27 of those are novel. We have previously shown that 6 of the 96 patients carried biallelic MUTYH mutations. The 9 mutation-negative cases all display an attenuated or atypical phenotype. Probands with a genotype (codon 1250–1464) predicting a severe phenotype had a median age at diagnosis of 21.8 (range, 11–49) years compared with 34.4 (range, 14–57) years among those with mutations outside this region (P < 0.017). Dense polyposis (> 1000) occurred in 75% of the probands with a severe phenotype compared with 30% in those with mutations outside this region. The morbidity in colorectal cancer among probands was 25% at a mean age of 37.5 years and 29% at a mean age of 46.6 years. Conclusion Using a variety of mutation-detection techniques, we have achieved a 100% detection frequency in classical FAP. Probands with APC mutations outside codon 1250–1464, although exhibiting a less-severe phenotype, are at high risk of having a colorectal cancer at diagnosis indicating that age at diagnosis is as important as the severity of the disease for colorectal cancer morbidity.
[ "*", "*", "IGNORE", "LINE", "*", "*", "\n", "*", "*", "IGNORE", "LINE", "*", "*", "\n", "*", "*", "IGNORE", "LINE", "*", "*", "\n", "Clinical", "characterization", "and", "the", "mutation", "spectrum", "in", "Swedish", "adenomatous", "polyposis", "families", "\n\n", "Abstract", "\n\n", "Background", "\n\n", "The", "dominantly", "inherited", "condition", "familial", "adenomatous", "polyposis", "(", "FAP", ")", "is", "caused", "by", "germline", "mutations", "in", "the", "APC", "gene", ".", "Finding", "the", "causative", "mutations", "has", "great", "implications", "for", "the", "families", ".", "Correlating", "the", "genotypes", "to", "the", "phenotypes", "could", "help", "to", "improve", "the", "diagnosis", "and", "follow", "-", "up", "of", "patients", ".", "\n\n", "Methods", "\n\n", "Mutation", "screening", "of", "APC", "and", "the", "clinical", "characterization", "of", "96", "unrelated", "FAP", "patients", "from", "the", "Swedish", "Polyposis", "Registry", "was", "performed", ".", "In", "addition", "to", "generally", "used", "mutation", "screening", "methods", ",", "analyses", "of", "splicing", "-", "affecting", "mutations", "and", "investigations", "of", "the", "presence", "of", "low", "-", "frequency", "mutation", "alleles", ",", "indicating", "mosaics", ",", "have", "been", "performed", ",", "as", "well", "as", "quantitative", "real", "-", "time", "polymerase", "chain", "reaction", "to", "detect", "lowered", "expression", "of", "APC", ".", "\n\n", "Results", "\n\n", "Sixty", "-", "one", "different", "APC", "mutations", "in", "81", "of", "the", "96", "families", "were", "identified", "and", "27", "of", "those", "are", "novel", ".", "We", "have", "previously", "shown", "that", "6", "of", "the", "96", "patients", "carried", "biallelic", "MUTYH", "mutations", ".", "The", "9", "mutation", "-", "negative", "cases", "all", "display", "an", "attenuated", "or", "atypical", "phenotype", ".", "Probands", "with", "a", "genotype", "(", "codon", "1250–1464", ")", "predicting", "a", "severe", "phenotype", "had", "a", "median", "age", "at", "diagnosis", "of", "21.8", "(", "range", ",", "11–49", ")", "years", "compared", "with", "34.4", "(", "range", ",", "14–57", ")", "years", "among", "those", "with", "mutations", "outside", "this", "region", "(", "P", "<", "0.017", ")", ".", "Dense", "polyposis", "(", ">", "1000", ")", "occurred", "in", "75", "%", "of", "the", "probands", "with", "a", "severe", "phenotype", "compared", "with", "30", "%", "in", "those", "with", "mutations", "outside", "this", "region", ".", "The", "morbidity", "in", "colorectal", "cancer", "among", "probands", "was", "25", "%", "at", "a", "mean", "age", "of", "37.5", "years", "and", "29", "%", "at", "a", "mean", "age", "of", "46.6", "years", ".", "\n\n", "Conclusion", "\n\n", "Using", "a", "variety", "of", "mutation", "-", "detection", "techniques", ",", "we", "have", "achieved", "a", "100", "%", "detection", "frequency", "in", "classical", "FAP", ".", "Probands", "with", "APC", "mutations", "outside", "codon", "1250–1464", ",", "although", "exhibiting", "a", "less", "-", "severe", "phenotype", ",", "are", "at", "high", "risk", "of", "having", "a", "colorectal", "cancer", "at", "diagnosis", "indicating", "that", "age", "at", "diagnosis", "is", "as", "important", "as", "the", "severity", "of", "the", "disease", "for", "colorectal", "cancer", "morbidity", ".", "\n\n" ]
[ "cohort-patient", "Concepts_Ideas", "mutation", "age", "disease", "Physiology", "Disorder", "size", "body-part", "ethnicity", "gene" ]
Swedish, adenomatous polyposis, families, dominantly inherited, familial adenomatous polyposis, FAP, germline mutations, APC, families, patients, APC, 96, unrelated FAP patients, Swedish, Polyposis, lowered expression of APC, Sixty - one, APC, mutations, 81 of the 96, families, 27, 6 of the 96, patients, biallelic MUTYH mutations, 9, mutation - negative cases, Probands with a genotype ( codon 1250–1464 ), median age at diagnosis of 21.8, 34.4 ( range , 14–57 ) years, those with mutations outside this region, Dense polyposis, 75 %, probands with a severe phenotype, 30 %, those with mutations outside this region, morbidity, colorectal cancer, probands, 25 %, mean age of 37.5 years, 29 %, mean age of 46.6 years, classical, FAP, Probands, APC, mutations outside codon 1250–1464, less - severe phenotype, high risk of having a colorectal cancer, disease, colorectal cancer, morbidity
41_task2
Sentence: ** IGNORE LINE ** ** IGNORE LINE ** ** IGNORE LINE ** Clinical characterization and the mutation spectrum in Swedish adenomatous polyposis families Abstract Background The dominantly inherited condition familial adenomatous polyposis (FAP) is caused by germline mutations in the APC gene. Finding the causative mutations has great implications for the families. Correlating the genotypes to the phenotypes could help to improve the diagnosis and follow-up of patients. Methods Mutation screening of APC and the clinical characterization of 96 unrelated FAP patients from the Swedish Polyposis Registry was performed. In addition to generally used mutation screening methods, analyses of splicing-affecting mutations and investigations of the presence of low-frequency mutation alleles, indicating mosaics, have been performed, as well as quantitative real-time polymerase chain reaction to detect lowered expression of APC. Results Sixty-one different APC mutations in 81 of the 96 families were identified and 27 of those are novel. We have previously shown that 6 of the 96 patients carried biallelic MUTYH mutations. The 9 mutation-negative cases all display an attenuated or atypical phenotype. Probands with a genotype (codon 1250–1464) predicting a severe phenotype had a median age at diagnosis of 21.8 (range, 11–49) years compared with 34.4 (range, 14–57) years among those with mutations outside this region (P < 0.017). Dense polyposis (> 1000) occurred in 75% of the probands with a severe phenotype compared with 30% in those with mutations outside this region. The morbidity in colorectal cancer among probands was 25% at a mean age of 37.5 years and 29% at a mean age of 46.6 years. Conclusion Using a variety of mutation-detection techniques, we have achieved a 100% detection frequency in classical FAP. Probands with APC mutations outside codon 1250–1464, although exhibiting a less-severe phenotype, are at high risk of having a colorectal cancer at diagnosis indicating that age at diagnosis is as important as the severity of the disease for colorectal cancer morbidity. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ethnicity", "B-disease", "I-disease", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "B-Concepts_Ideas", "I-Concepts_Ideas", "O", "B-disease", "I-disease", "I-disease", "O", "B-disease", "O", "O", "O", "O", "B-mutation", "I-mutation", "O", "O", "B-gene", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "B-gene", "O", "O", "O", "O", "O", "B-size", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-ethnicity", "B-disease", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Physiology", "I-Physiology", "I-Physiology", "I-Physiology", "O", "O", "O", "O", "B-size", "I-size", "I-size", "O", "B-gene", "B-mutation", "O", "B-size", "I-size", "I-size", "I-size", "B-cohort-patient", "O", "O", "O", "B-mutation", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-size", "I-size", "I-size", "I-size", "B-cohort-patient", "O", "B-mutation", "I-mutation", "I-mutation", "O", "O", "B-size", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "O", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "I-age", "O", "O", "O", "O", "O", "O", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "I-age", "I-age", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "O", "O", "O", "O", "B-Disorder", "I-Disorder", "O", "O", "O", "O", "O", "O", "B-size", "I-size", "O", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-size", "I-size", "O", "B-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "I-cohort-patient", "O", "O", "B-Concepts_Ideas", "O", "B-disease", "I-disease", "O", "B-cohort-patient", "O", "B-size", "I-size", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "O", "B-size", "I-size", "O", "O", "B-age", "I-age", "I-age", "I-age", "I-age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Concepts_Ideas", "B-disease", "O", "B-cohort-patient", "O", "B-gene", "B-mutation", "I-mutation", "I-mutation", "I-mutation", "O", "O", "O", "O", "B-Physiology", "I-Physiology", "I-Physiology", "I-Physiology", "O", "O", "O", "B-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "I-Concepts_Ideas", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-disease", "O", "B-disease", "I-disease", "B-Concepts_Ideas", "O", "O" ]
** IGNORE LINE ** ** IGNORE LINE ** ** IGNORE LINE ** Clinical characterization and the mutation spectrum in Swedish adenomatous polyposis families Abstract Background The dominantly inherited condition familial adenomatous polyposis (FAP) is caused by germline mutations in the APC gene. Finding the causative mutations has great implications for the families. Correlating the genotypes to the phenotypes could help to improve the diagnosis and follow-up of patients. Methods Mutation screening of APC and the clinical characterization of 96 unrelated FAP patients from the Swedish Polyposis Registry was performed. In addition to generally used mutation screening methods, analyses of splicing-affecting mutations and investigations of the presence of low-frequency mutation alleles, indicating mosaics, have been performed, as well as quantitative real-time polymerase chain reaction to detect lowered expression of APC. Results Sixty-one different APC mutations in 81 of the 96 families were identified and 27 of those are novel. We have previously shown that 6 of the 96 patients carried biallelic MUTYH mutations. The 9 mutation-negative cases all display an attenuated or atypical phenotype. Probands with a genotype (codon 1250–1464) predicting a severe phenotype had a median age at diagnosis of 21.8 (range, 11–49) years compared with 34.4 (range, 14–57) years among those with mutations outside this region (P < 0.017). Dense polyposis (> 1000) occurred in 75% of the probands with a severe phenotype compared with 30% in those with mutations outside this region. The morbidity in colorectal cancer among probands was 25% at a mean age of 37.5 years and 29% at a mean age of 46.6 years. Conclusion Using a variety of mutation-detection techniques, we have achieved a 100% detection frequency in classical FAP. Probands with APC mutations outside codon 1250–1464, although exhibiting a less-severe phenotype, are at high risk of having a colorectal cancer at diagnosis indicating that age at diagnosis is as important as the severity of the disease for colorectal cancer morbidity.
[ "*", "*", "IGNORE", "LINE", "*", "*", "\n", "*", "*", "IGNORE", "LINE", "*", "*", "\n", "*", "*", "IGNORE", "LINE", "*", "*", "\n", "Clinical", "characterization", "and", "the", "mutation", "spectrum", "in", "Swedish", "adenomatous", "polyposis", "families", "\n\n", "Abstract", "\n\n", "Background", "\n\n", "The", "dominantly", "inherited", "condition", "familial", "adenomatous", "polyposis", "(", "FAP", ")", "is", "caused", "by", "germline", "mutations", "in", "the", "APC", "gene", ".", "Finding", "the", "causative", "mutations", "has", "great", "implications", "for", "the", "families", ".", "Correlating", "the", "genotypes", "to", "the", "phenotypes", "could", "help", "to", "improve", "the", "diagnosis", "and", "follow", "-", "up", "of", "patients", ".", "\n\n", "Methods", "\n\n", "Mutation", "screening", "of", "APC", "and", "the", "clinical", "characterization", "of", "96", "unrelated", "FAP", "patients", "from", "the", "Swedish", "Polyposis", "Registry", "was", "performed", ".", "In", "addition", "to", "generally", "used", "mutation", "screening", "methods", ",", "analyses", "of", "splicing", "-", "affecting", "mutations", "and", "investigations", "of", "the", "presence", "of", "low", "-", "frequency", "mutation", "alleles", ",", "indicating", "mosaics", ",", "have", "been", "performed", ",", "as", "well", "as", "quantitative", "real", "-", "time", "polymerase", "chain", "reaction", "to", "detect", "lowered", "expression", "of", "APC", ".", "\n\n", "Results", "\n\n", "Sixty", "-", "one", "different", "APC", "mutations", "in", "81", "of", "the", "96", "families", "were", "identified", "and", "27", "of", "those", "are", "novel", ".", "We", "have", "previously", "shown", "that", "6", "of", "the", "96", "patients", "carried", "biallelic", "MUTYH", "mutations", ".", "The", "9", "mutation", "-", "negative", "cases", "all", "display", "an", "attenuated", "or", "atypical", "phenotype", ".", "Probands", "with", "a", "genotype", "(", "codon", "1250–1464", ")", "predicting", "a", "severe", "phenotype", "had", "a", "median", "age", "at", "diagnosis", "of", "21.8", "(", "range", ",", "11–49", ")", "years", "compared", "with", "34.4", "(", "range", ",", "14–57", ")", "years", "among", "those", "with", "mutations", "outside", "this", "region", "(", "P", "<", "0.017", ")", ".", "Dense", "polyposis", "(", ">", "1000", ")", "occurred", "in", "75", "%", "of", "the", "probands", "with", "a", "severe", "phenotype", "compared", "with", "30", "%", "in", "those", "with", "mutations", "outside", "this", "region", ".", "The", "morbidity", "in", "colorectal", "cancer", "among", "probands", "was", "25", "%", "at", "a", "mean", "age", "of", "37.5", "years", "and", "29", "%", "at", "a", "mean", "age", "of", "46.6", "years", ".", "\n\n", "Conclusion", "\n\n", "Using", "a", "variety", "of", "mutation", "-", "detection", "techniques", ",", "we", "have", "achieved", "a", "100", "%", "detection", "frequency", "in", "classical", "FAP", ".", "Probands", "with", "APC", "mutations", "outside", "codon", "1250–1464", ",", "although", "exhibiting", "a", "less", "-", "severe", "phenotype", ",", "are", "at", "high", "risk", "of", "having", "a", "colorectal", "cancer", "at", "diagnosis", "indicating", "that", "age", "at", "diagnosis", "is", "as", "important", "as", "the", "severity", "of", "the", "disease", "for", "colorectal", "cancer", "morbidity", ".", "\n\n" ]
[ "cohort-patient", "Concepts_Ideas", "mutation", "age", "disease", "Physiology", "Disorder", "size", "body-part", "ethnicity", "gene" ]
Immunohistochemical study is an other_name, steroid hormones is a lipid, estrogen binding assay is an other_name, malignant soft tissue tumors is a cell_type
94980_task0
Sentence: Immunohistochemical study of steroid hormones and an estrogen binding assay in malignant soft tissue tumors. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: cell_type, lipid, other_name
[ "B-other_name", "I-other_name", "O", "B-lipid", "I-lipid", "O", "O", "B-other_name", "I-other_name", "I-other_name", "O", "B-cell_type", "I-cell_type", "I-cell_type", "I-cell_type", "O" ]
Immunohistochemical study of steroid hormones and an estrogen binding assay in malignant soft tissue tumors.
[ "Immunohistochemical", "study", "of", "steroid", "hormones", "and", "an", "estrogen", "binding", "assay", "in", "malignant", "soft", "tissue", "tumors", "." ]
[ "tissue", "cell_type", "other_name", "protein_family_or_group", "lipid", "multi_cell" ]
Immunohistochemical study is an other_name, steroid hormones is a lipid, estrogen binding assay is an other_name, malignant soft tissue tumors is a cell_type
94980_task1
Sentence: Immunohistochemical study of steroid hormones and an estrogen binding assay in malignant soft tissue tumors. Instructions: please typing these entity words according to sentence: Immunohistochemical study, steroid hormones, estrogen binding assay, malignant soft tissue tumors Options: cell_type, lipid, other_name
[ "B-other_name", "I-other_name", "O", "B-lipid", "I-lipid", "O", "O", "B-other_name", "I-other_name", "I-other_name", "O", "B-cell_type", "I-cell_type", "I-cell_type", "I-cell_type", "O" ]
Immunohistochemical study of steroid hormones and an estrogen binding assay in malignant soft tissue tumors.
[ "Immunohistochemical", "study", "of", "steroid", "hormones", "and", "an", "estrogen", "binding", "assay", "in", "malignant", "soft", "tissue", "tumors", "." ]
[ "tissue", "cell_type", "other_name", "protein_family_or_group", "lipid", "multi_cell" ]
Immunohistochemical study, steroid hormones, estrogen binding assay, malignant soft tissue tumors
94980_task2
Sentence: Immunohistochemical study of steroid hormones and an estrogen binding assay in malignant soft tissue tumors. Instructions: please extract entity words from the input sentence
[ "B-other_name", "I-other_name", "O", "B-lipid", "I-lipid", "O", "O", "B-other_name", "I-other_name", "I-other_name", "O", "B-cell_type", "I-cell_type", "I-cell_type", "I-cell_type", "O" ]
Immunohistochemical study of steroid hormones and an estrogen binding assay in malignant soft tissue tumors.
[ "Immunohistochemical", "study", "of", "steroid", "hormones", "and", "an", "estrogen", "binding", "assay", "in", "malignant", "soft", "tissue", "tumors", "." ]
[ "tissue", "cell_type", "other_name", "protein_family_or_group", "lipid", "multi_cell" ]
Antigen - extrahierter is an umlsterm, Knochen is an umlsterm, Knochen is an umlsterm, knocheneigenen is an umlsterm, Schaedeldachdefekte is an umlsterm, Patienten is an umlsterm, Radiologische is an umlsterm, Knochenintegration is an umlsterm, Tumorrezidiv is an umlsterm, Biopsie is an umlsterm, Knochenneubildung is an umlsterm, infektionsbedingten is an umlsterm, Knochenimplantate is an umlsterm, Schaedeldachplastiken is an umlsterm, Schaedelkalotten is an umlsterm, Schaedelbereichen is an umlsterm
MundKieferGesichtschirurgie.8002s032.ger.abstr_task0
Sentence: Autolysierter Antigen-extrahierter , allogener Knochen ( , AAA-Knochen ) wird aus kortikalem Knochen von Multiorganspendern hergestellt und besitzt aufgrund seiner Freisetzung von knocheneigenen BMPs osteoinduktive Eigenschaften . Im Rahmen einer prospektiven Studie wurden ueber einen Zeitraum von mehr als 7 Jahren 37 Schaedeldachdefekte mit AAA-Knochenimplantaten rekonstruiert . Die Patienten wurden standardisiert nachuntersucht . Radiologische Untersuchungen sowie Knochenszintigraphien ergaben eine Knochenintegration und Remodellierung der ehemaligen AAA-Knochenimplantate . In 1/4 der Faelle wurde ein erneuter operativer Eingriff 10-18 Monaten nach der Kranioplastik durchgefuehrt ( Entfernung von Osteosynthesematerial , Tumorrezidiv ) . Alle 9 AAA-Knochen-Rekonstruktionen zeigten blutende Oberflaechen und eine knoecherne Konsolidierung . Aus dem Zentrum eines dieser AAA-Knochenimplantate wurde eine Biopsie entnommen , welche eine , von der Oberflaeche ausgehende , Knochenneubildung zeigte . In 1 Fall kam es zu einem infektionsbedingten Verlust eines AAA-Knochenimplantats . Dies ist insbesondere bemerkenswert , da bei ca. 1/3 der Faelle die Knochenimplantate in direktem Kontakt zur Stirnhoehle standen . Die klinischen Resultate unterstreichen eindrucksvoll den therapeutischen Nutzen von osteoinduktivem AAA-Knochen bei Schaedeldachplastiken . Grossflaechige AAA-Knochen-Chips aus menschlichen Schaedelkalotten erleichtern die Rekonstruktion in Schaedelbereichen mit grosser Konvexitaet . Dies gilt insbesondere dann , wenn ein stereolithographisches Modell des Defekts zur praeoperativen Planung zur Verfuegung steht . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Autolysierter Antigen-extrahierter , allogener Knochen ( , AAA-Knochen ) wird aus kortikalem Knochen von Multiorganspendern hergestellt und besitzt aufgrund seiner Freisetzung von knocheneigenen BMPs osteoinduktive Eigenschaften . Im Rahmen einer prospektiven Studie wurden ueber einen Zeitraum von mehr als 7 Jahren 37 Schaedeldachdefekte mit AAA-Knochenimplantaten rekonstruiert . Die Patienten wurden standardisiert nachuntersucht . Radiologische Untersuchungen sowie Knochenszintigraphien ergaben eine Knochenintegration und Remodellierung der ehemaligen AAA-Knochenimplantate . In 1/4 der Faelle wurde ein erneuter operativer Eingriff 10-18 Monaten nach der Kranioplastik durchgefuehrt ( Entfernung von Osteosynthesematerial , Tumorrezidiv ) . Alle 9 AAA-Knochen-Rekonstruktionen zeigten blutende Oberflaechen und eine knoecherne Konsolidierung . Aus dem Zentrum eines dieser AAA-Knochenimplantate wurde eine Biopsie entnommen , welche eine , von der Oberflaeche ausgehende , Knochenneubildung zeigte . In 1 Fall kam es zu einem infektionsbedingten Verlust eines AAA-Knochenimplantats . Dies ist insbesondere bemerkenswert , da bei ca. 1/3 der Faelle die Knochenimplantate in direktem Kontakt zur Stirnhoehle standen . Die klinischen Resultate unterstreichen eindrucksvoll den therapeutischen Nutzen von osteoinduktivem AAA-Knochen bei Schaedeldachplastiken . Grossflaechige AAA-Knochen-Chips aus menschlichen Schaedelkalotten erleichtern die Rekonstruktion in Schaedelbereichen mit grosser Konvexitaet . Dies gilt insbesondere dann , wenn ein stereolithographisches Modell des Defekts zur praeoperativen Planung zur Verfuegung steht .
[ "Autolysierter", "Antigen", "-", "extrahierter", ",", "allogener", "Knochen", "(", ",", "AAA", "-", "Knochen", ")", "wird", "aus", "kortikalem", "Knochen", "von", "Multiorganspendern", "hergestellt", "und", "besitzt", "aufgrund", "seiner", "Freisetzung", "von", "knocheneigenen", "BMPs", "osteoinduktive", "Eigenschaften", ".", "Im", "Rahmen", "einer", "prospektiven", "Studie", "wurden", "ueber", "einen", "Zeitraum", "von", "mehr", "als", "7", "Jahren", "37", "Schaedeldachdefekte", "mit", "AAA", "-", "Knochenimplantaten", "rekonstruiert", ".", "Die", "Patienten", "wurden", "standardisiert", "nachuntersucht", ".", "Radiologische", "Untersuchungen", "sowie", "Knochenszintigraphien", "ergaben", "eine", "Knochenintegration", "und", "Remodellierung", "der", "ehemaligen", "AAA", "-", "Knochenimplantate", ".", "In", "1/4", "der", "Faelle", "wurde", "ein", "erneuter", "operativer", "Eingriff", "10", "-", "18", "Monaten", "nach", "der", "Kranioplastik", "durchgefuehrt", "(", "Entfernung", "von", "Osteosynthesematerial", ",", "Tumorrezidiv", ")", ".", "Alle", "9", "AAA", "-", "Knochen", "-", "Rekonstruktionen", "zeigten", "blutende", "Oberflaechen", "und", "eine", "knoecherne", "Konsolidierung", ".", "Aus", "dem", "Zentrum", "eines", "dieser", "AAA", "-", "Knochenimplantate", "wurde", "eine", "Biopsie", "entnommen", ",", "welche", "eine", ",", "von", "der", "Oberflaeche", "ausgehende", ",", "Knochenneubildung", "zeigte", ".", "In", "1", "Fall", "kam", "es", "zu", "einem", "infektionsbedingten", "Verlust", "eines", "AAA", "-", "Knochenimplantats", ".", "Dies", "ist", "insbesondere", "bemerkenswert", ",", "da", "bei", "ca", ".", "1/3", "der", "Faelle", "die", "Knochenimplantate", "in", "direktem", "Kontakt", "zur", "Stirnhoehle", "standen", ".", "Die", "klinischen", "Resultate", "unterstreichen", "eindrucksvoll", "den", "therapeutischen", "Nutzen", "von", "osteoinduktivem", "AAA", "-", "Knochen", "bei", "Schaedeldachplastiken", ".", "Grossflaechige", "AAA", "-", "Knochen", "-", "Chips", "aus", "menschlichen", "Schaedelkalotten", "erleichtern", "die", "Rekonstruktion", "in", "Schaedelbereichen", "mit", "grosser", "Konvexitaet", ".", "Dies", "gilt", "insbesondere", "dann", ",", "wenn", "ein", "stereolithographisches", "Modell", "des", "Defekts", "zur", "praeoperativen", "Planung", "zur", "Verfuegung", "steht", "." ]
[ "umlsterm" ]
Antigen - extrahierter is an umlsterm, Knochen is an umlsterm, Knochen is an umlsterm, knocheneigenen is an umlsterm, Schaedeldachdefekte is an umlsterm, Patienten is an umlsterm, Radiologische is an umlsterm, Knochenintegration is an umlsterm, Tumorrezidiv is an umlsterm, Biopsie is an umlsterm, Knochenneubildung is an umlsterm, infektionsbedingten is an umlsterm, Knochenimplantate is an umlsterm, Schaedeldachplastiken is an umlsterm, Schaedelkalotten is an umlsterm, Schaedelbereichen is an umlsterm
MundKieferGesichtschirurgie.8002s032.ger.abstr_task1
Sentence: Autolysierter Antigen-extrahierter , allogener Knochen ( , AAA-Knochen ) wird aus kortikalem Knochen von Multiorganspendern hergestellt und besitzt aufgrund seiner Freisetzung von knocheneigenen BMPs osteoinduktive Eigenschaften . Im Rahmen einer prospektiven Studie wurden ueber einen Zeitraum von mehr als 7 Jahren 37 Schaedeldachdefekte mit AAA-Knochenimplantaten rekonstruiert . Die Patienten wurden standardisiert nachuntersucht . Radiologische Untersuchungen sowie Knochenszintigraphien ergaben eine Knochenintegration und Remodellierung der ehemaligen AAA-Knochenimplantate . In 1/4 der Faelle wurde ein erneuter operativer Eingriff 10-18 Monaten nach der Kranioplastik durchgefuehrt ( Entfernung von Osteosynthesematerial , Tumorrezidiv ) . Alle 9 AAA-Knochen-Rekonstruktionen zeigten blutende Oberflaechen und eine knoecherne Konsolidierung . Aus dem Zentrum eines dieser AAA-Knochenimplantate wurde eine Biopsie entnommen , welche eine , von der Oberflaeche ausgehende , Knochenneubildung zeigte . In 1 Fall kam es zu einem infektionsbedingten Verlust eines AAA-Knochenimplantats . Dies ist insbesondere bemerkenswert , da bei ca. 1/3 der Faelle die Knochenimplantate in direktem Kontakt zur Stirnhoehle standen . Die klinischen Resultate unterstreichen eindrucksvoll den therapeutischen Nutzen von osteoinduktivem AAA-Knochen bei Schaedeldachplastiken . Grossflaechige AAA-Knochen-Chips aus menschlichen Schaedelkalotten erleichtern die Rekonstruktion in Schaedelbereichen mit grosser Konvexitaet . Dies gilt insbesondere dann , wenn ein stereolithographisches Modell des Defekts zur praeoperativen Planung zur Verfuegung steht . Instructions: please typing these entity words according to sentence: Antigen - extrahierter, Knochen, Knochen, knocheneigenen, Schaedeldachdefekte, Patienten, Radiologische, Knochenintegration, Tumorrezidiv, Biopsie, Knochenneubildung, infektionsbedingten, Knochenimplantate, Schaedeldachplastiken, Schaedelkalotten, Schaedelbereichen Options: umlsterm
[ "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Autolysierter Antigen-extrahierter , allogener Knochen ( , AAA-Knochen ) wird aus kortikalem Knochen von Multiorganspendern hergestellt und besitzt aufgrund seiner Freisetzung von knocheneigenen BMPs osteoinduktive Eigenschaften . Im Rahmen einer prospektiven Studie wurden ueber einen Zeitraum von mehr als 7 Jahren 37 Schaedeldachdefekte mit AAA-Knochenimplantaten rekonstruiert . Die Patienten wurden standardisiert nachuntersucht . Radiologische Untersuchungen sowie Knochenszintigraphien ergaben eine Knochenintegration und Remodellierung der ehemaligen AAA-Knochenimplantate . In 1/4 der Faelle wurde ein erneuter operativer Eingriff 10-18 Monaten nach der Kranioplastik durchgefuehrt ( Entfernung von Osteosynthesematerial , Tumorrezidiv ) . Alle 9 AAA-Knochen-Rekonstruktionen zeigten blutende Oberflaechen und eine knoecherne Konsolidierung . Aus dem Zentrum eines dieser AAA-Knochenimplantate wurde eine Biopsie entnommen , welche eine , von der Oberflaeche ausgehende , Knochenneubildung zeigte . In 1 Fall kam es zu einem infektionsbedingten Verlust eines AAA-Knochenimplantats . Dies ist insbesondere bemerkenswert , da bei ca. 1/3 der Faelle die Knochenimplantate in direktem Kontakt zur Stirnhoehle standen . Die klinischen Resultate unterstreichen eindrucksvoll den therapeutischen Nutzen von osteoinduktivem AAA-Knochen bei Schaedeldachplastiken . Grossflaechige AAA-Knochen-Chips aus menschlichen Schaedelkalotten erleichtern die Rekonstruktion in Schaedelbereichen mit grosser Konvexitaet . Dies gilt insbesondere dann , wenn ein stereolithographisches Modell des Defekts zur praeoperativen Planung zur Verfuegung steht .
[ "Autolysierter", "Antigen", "-", "extrahierter", ",", "allogener", "Knochen", "(", ",", "AAA", "-", "Knochen", ")", "wird", "aus", "kortikalem", "Knochen", "von", "Multiorganspendern", "hergestellt", "und", "besitzt", "aufgrund", "seiner", "Freisetzung", "von", "knocheneigenen", "BMPs", "osteoinduktive", "Eigenschaften", ".", "Im", "Rahmen", "einer", "prospektiven", "Studie", "wurden", "ueber", "einen", "Zeitraum", "von", "mehr", "als", "7", "Jahren", "37", "Schaedeldachdefekte", "mit", "AAA", "-", "Knochenimplantaten", "rekonstruiert", ".", "Die", "Patienten", "wurden", "standardisiert", "nachuntersucht", ".", "Radiologische", "Untersuchungen", "sowie", "Knochenszintigraphien", "ergaben", "eine", "Knochenintegration", "und", "Remodellierung", "der", "ehemaligen", "AAA", "-", "Knochenimplantate", ".", "In", "1/4", "der", "Faelle", "wurde", "ein", "erneuter", "operativer", "Eingriff", "10", "-", "18", "Monaten", "nach", "der", "Kranioplastik", "durchgefuehrt", "(", "Entfernung", "von", "Osteosynthesematerial", ",", "Tumorrezidiv", ")", ".", "Alle", "9", "AAA", "-", "Knochen", "-", "Rekonstruktionen", "zeigten", "blutende", "Oberflaechen", "und", "eine", "knoecherne", "Konsolidierung", ".", "Aus", "dem", "Zentrum", "eines", "dieser", "AAA", "-", "Knochenimplantate", "wurde", "eine", "Biopsie", "entnommen", ",", "welche", "eine", ",", "von", "der", "Oberflaeche", "ausgehende", ",", "Knochenneubildung", "zeigte", ".", "In", "1", "Fall", "kam", "es", "zu", "einem", "infektionsbedingten", "Verlust", "eines", "AAA", "-", "Knochenimplantats", ".", "Dies", "ist", "insbesondere", "bemerkenswert", ",", "da", "bei", "ca", ".", "1/3", "der", "Faelle", "die", "Knochenimplantate", "in", "direktem", "Kontakt", "zur", "Stirnhoehle", "standen", ".", "Die", "klinischen", "Resultate", "unterstreichen", "eindrucksvoll", "den", "therapeutischen", "Nutzen", "von", "osteoinduktivem", "AAA", "-", "Knochen", "bei", "Schaedeldachplastiken", ".", "Grossflaechige", "AAA", "-", "Knochen", "-", "Chips", "aus", "menschlichen", "Schaedelkalotten", "erleichtern", "die", "Rekonstruktion", "in", "Schaedelbereichen", "mit", "grosser", "Konvexitaet", ".", "Dies", "gilt", "insbesondere", "dann", ",", "wenn", "ein", "stereolithographisches", "Modell", "des", "Defekts", "zur", "praeoperativen", "Planung", "zur", "Verfuegung", "steht", "." ]
[ "umlsterm" ]
Antigen - extrahierter, Knochen, Knochen, knocheneigenen, Schaedeldachdefekte, Patienten, Radiologische, Knochenintegration, Tumorrezidiv, Biopsie, Knochenneubildung, infektionsbedingten, Knochenimplantate, Schaedeldachplastiken, Schaedelkalotten, Schaedelbereichen
MundKieferGesichtschirurgie.8002s032.ger.abstr_task2
Sentence: Autolysierter Antigen-extrahierter , allogener Knochen ( , AAA-Knochen ) wird aus kortikalem Knochen von Multiorganspendern hergestellt und besitzt aufgrund seiner Freisetzung von knocheneigenen BMPs osteoinduktive Eigenschaften . Im Rahmen einer prospektiven Studie wurden ueber einen Zeitraum von mehr als 7 Jahren 37 Schaedeldachdefekte mit AAA-Knochenimplantaten rekonstruiert . Die Patienten wurden standardisiert nachuntersucht . Radiologische Untersuchungen sowie Knochenszintigraphien ergaben eine Knochenintegration und Remodellierung der ehemaligen AAA-Knochenimplantate . In 1/4 der Faelle wurde ein erneuter operativer Eingriff 10-18 Monaten nach der Kranioplastik durchgefuehrt ( Entfernung von Osteosynthesematerial , Tumorrezidiv ) . Alle 9 AAA-Knochen-Rekonstruktionen zeigten blutende Oberflaechen und eine knoecherne Konsolidierung . Aus dem Zentrum eines dieser AAA-Knochenimplantate wurde eine Biopsie entnommen , welche eine , von der Oberflaeche ausgehende , Knochenneubildung zeigte . In 1 Fall kam es zu einem infektionsbedingten Verlust eines AAA-Knochenimplantats . Dies ist insbesondere bemerkenswert , da bei ca. 1/3 der Faelle die Knochenimplantate in direktem Kontakt zur Stirnhoehle standen . Die klinischen Resultate unterstreichen eindrucksvoll den therapeutischen Nutzen von osteoinduktivem AAA-Knochen bei Schaedeldachplastiken . Grossflaechige AAA-Knochen-Chips aus menschlichen Schaedelkalotten erleichtern die Rekonstruktion in Schaedelbereichen mit grosser Konvexitaet . Dies gilt insbesondere dann , wenn ein stereolithographisches Modell des Defekts zur praeoperativen Planung zur Verfuegung steht . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Autolysierter Antigen-extrahierter , allogener Knochen ( , AAA-Knochen ) wird aus kortikalem Knochen von Multiorganspendern hergestellt und besitzt aufgrund seiner Freisetzung von knocheneigenen BMPs osteoinduktive Eigenschaften . Im Rahmen einer prospektiven Studie wurden ueber einen Zeitraum von mehr als 7 Jahren 37 Schaedeldachdefekte mit AAA-Knochenimplantaten rekonstruiert . Die Patienten wurden standardisiert nachuntersucht . Radiologische Untersuchungen sowie Knochenszintigraphien ergaben eine Knochenintegration und Remodellierung der ehemaligen AAA-Knochenimplantate . In 1/4 der Faelle wurde ein erneuter operativer Eingriff 10-18 Monaten nach der Kranioplastik durchgefuehrt ( Entfernung von Osteosynthesematerial , Tumorrezidiv ) . Alle 9 AAA-Knochen-Rekonstruktionen zeigten blutende Oberflaechen und eine knoecherne Konsolidierung . Aus dem Zentrum eines dieser AAA-Knochenimplantate wurde eine Biopsie entnommen , welche eine , von der Oberflaeche ausgehende , Knochenneubildung zeigte . In 1 Fall kam es zu einem infektionsbedingten Verlust eines AAA-Knochenimplantats . Dies ist insbesondere bemerkenswert , da bei ca. 1/3 der Faelle die Knochenimplantate in direktem Kontakt zur Stirnhoehle standen . Die klinischen Resultate unterstreichen eindrucksvoll den therapeutischen Nutzen von osteoinduktivem AAA-Knochen bei Schaedeldachplastiken . Grossflaechige AAA-Knochen-Chips aus menschlichen Schaedelkalotten erleichtern die Rekonstruktion in Schaedelbereichen mit grosser Konvexitaet . Dies gilt insbesondere dann , wenn ein stereolithographisches Modell des Defekts zur praeoperativen Planung zur Verfuegung steht .
[ "Autolysierter", "Antigen", "-", "extrahierter", ",", "allogener", "Knochen", "(", ",", "AAA", "-", "Knochen", ")", "wird", "aus", "kortikalem", "Knochen", "von", "Multiorganspendern", "hergestellt", "und", "besitzt", "aufgrund", "seiner", "Freisetzung", "von", "knocheneigenen", "BMPs", "osteoinduktive", "Eigenschaften", ".", "Im", "Rahmen", "einer", "prospektiven", "Studie", "wurden", "ueber", "einen", "Zeitraum", "von", "mehr", "als", "7", "Jahren", "37", "Schaedeldachdefekte", "mit", "AAA", "-", "Knochenimplantaten", "rekonstruiert", ".", "Die", "Patienten", "wurden", "standardisiert", "nachuntersucht", ".", "Radiologische", "Untersuchungen", "sowie", "Knochenszintigraphien", "ergaben", "eine", "Knochenintegration", "und", "Remodellierung", "der", "ehemaligen", "AAA", "-", "Knochenimplantate", ".", "In", "1/4", "der", "Faelle", "wurde", "ein", "erneuter", "operativer", "Eingriff", "10", "-", "18", "Monaten", "nach", "der", "Kranioplastik", "durchgefuehrt", "(", "Entfernung", "von", "Osteosynthesematerial", ",", "Tumorrezidiv", ")", ".", "Alle", "9", "AAA", "-", "Knochen", "-", "Rekonstruktionen", "zeigten", "blutende", "Oberflaechen", "und", "eine", "knoecherne", "Konsolidierung", ".", "Aus", "dem", "Zentrum", "eines", "dieser", "AAA", "-", "Knochenimplantate", "wurde", "eine", "Biopsie", "entnommen", ",", "welche", "eine", ",", "von", "der", "Oberflaeche", "ausgehende", ",", "Knochenneubildung", "zeigte", ".", "In", "1", "Fall", "kam", "es", "zu", "einem", "infektionsbedingten", "Verlust", "eines", "AAA", "-", "Knochenimplantats", ".", "Dies", "ist", "insbesondere", "bemerkenswert", ",", "da", "bei", "ca", ".", "1/3", "der", "Faelle", "die", "Knochenimplantate", "in", "direktem", "Kontakt", "zur", "Stirnhoehle", "standen", ".", "Die", "klinischen", "Resultate", "unterstreichen", "eindrucksvoll", "den", "therapeutischen", "Nutzen", "von", "osteoinduktivem", "AAA", "-", "Knochen", "bei", "Schaedeldachplastiken", ".", "Grossflaechige", "AAA", "-", "Knochen", "-", "Chips", "aus", "menschlichen", "Schaedelkalotten", "erleichtern", "die", "Rekonstruktion", "in", "Schaedelbereichen", "mit", "grosser", "Konvexitaet", ".", "Dies", "gilt", "insbesondere", "dann", ",", "wenn", "ein", "stereolithographisches", "Modell", "des", "Defekts", "zur", "praeoperativen", "Planung", "zur", "Verfuegung", "steht", "." ]
[ "umlsterm" ]
Aprepitant is a DRUG, Aprepitant is a DRUG, aprepitant is a DRUG, aprepitant is a DRUG, Aprepitant is a DRUG, S(- ) warfarin is a DRUG, tolbutamide is a DRUG, Aprepitant is a DRUG, phenytoin is a DRUG, Aprepitant is a DRUG, Aprepitant is a DRUG, digoxin is a DRUG, 5-HT3 antagonists is a GROUP, aprepitant is a DRUG, ondansetron is a DRUG, granisetron is a DRUG, dolasetron is a DRUG, Corticosteroids is a GROUP, Dexamethasone is a DRUG, Aprepitant is a DRUG, dexamethasone is a DRUG, Aprepitant is a DRUG, dexamethasone is a DRUG, dexamethasone is a DRUG, dexamethasone is a DRUG, Aprepitant is a DRUG, dexamethasone is a DRUG, Aprepitant is a DRUG, dexamethasone is a DRUG, Aprepitant is a DRUG, dexamethasone is a DRUG, Methylprednisolone is a DRUG, Aprepitant is a DRUG, methylprednisolone is a DRUG, methylprednisolone is a DRUG, methylprednisolone is a DRUG, methylprednisolone is a DRUG, Aprepitant is a DRUG, methylprednisolone is a DRUG, Aprepitant is a DRUG, Warfarin is a DRUG, Aprepitant is a DRUG, warfarin is a DRUG, Aprepitant is a DRUG, R(+ ) is a DRUG, S(- ) warfarin is a DRUG, S(-)warfarin is a DRUG, Aprepitant is a DRUG, warfarin is a DRUG, Aprepitant is a DRUG, Tolbutamide is a DRUG, Aprepitant is a DRUG, tolbutamide is a DRUG, tolbutamide is a DRUG, Aprepitant is a DRUG, contraceptives is a GROUP, Aprepitant is a DRUG, contraceptive is a GROUP, ethinyl estradiol is a DRUG, norethindrone is a DRUG, ethinyl estradiol is a DRUG, norethindrone is a DRUG, contraceptives is a GROUP, Aprepitant is a DRUG, Aprepitant is a DRUG, contraceptives is a GROUP, Midazolam is a DRUG, Aprepitant is a DRUG, midazolam is a DRUG, midazolam is a DRUG, Aprepitant is a DRUG, midazolam is a DRUG, benzodiazepines is a GROUP, alprazolam is a DRUG, triazolam is a DRUG, Aprepitant is a DRUG, midazolam is a DRUG, Aprepitant is a DRUG, midazolam is a DRUG, Aprepitant is a DRUG, Aprepitant is a DRUG, midazolam is a DRUG, midazolam is a DRUG, Aprepitant is a DRUG, midazolam is a DRUG, aprepitant is a DRUG, Aprepitant is a DRUG, Aprepitant is a DRUG, aprepitant is a DRUG, Aprepitant is a DRUG, ketoconazole is a DRUG, itraconazole is a DRUG, nefazodone is a DRUG, troleandomycin is a DRUG, clarithromycin is a DRUG, ritonavir is a DRUG, nelfinavir is a DRUG, diltiazem is a DRUG, aprepitant is a DRUG, Aprepitant is a DRUG, Aprepitant is a DRUG, rifampin is a DRUG, carbamazepine is a DRUG, phenytoin is a DRUG, aprepitant is a DRUG, Aprepitant is a DRUG, Ketoconazole is a DRUG, Aprepitant is a DRUG, Ketoconazole is a DRUG, Aprepitant is a DRUG, ketoconazole is a DRUG, aprepitant is a DRUG, aprepitant is a DRUG, Aprepitant is a DRUG, Rifampin is a DRUG, Aprepitant is a DRUG, rifampin is a DRUG, aprepitant is a DRUG, Aprepitant is a DRUG, Aprepitant is a DRUG, Diltiazem is a DRUG, aprepitant is a DRUG, diltiazem is a DRUG, aprepitant is a DRUG, diltiazem is a DRUG, diltiazem is a DRUG, Paroxetine is a DRUG, aprepitant is a DRUG, paroxetine is a DRUG, aprepitant is a DRUG, paroxetine is a DRUG
Aprepitant_ddi_task0
Sentence: Aprepitant is a substrate, a moderate inhibitor, and an inducer of CYP3A4. Aprepitant is also an inducer of CYP2C9. Effect of aprepitant on the pharmacokinetics of other agents As a moderate inhibitor of CYP3A4, aprepitant can increase plasma concentrations of coadministered medicinal products that are metabolized through CYP3A4. Aprepitant has been shown to induce the metabolism of S(-) warfarin and tolbutamide, which are metabolized through CYP2C9. Coadministration of Aprepitant with these drugs or other drugs that are known to be metabolized by CYP2C9, such as phenytoin, may result in lower plasma concentrations of these drugs. Aprepitant is unlikely to interact with drugs that are substrates for the P-glycoprotein transporter, as demonstrated by the lack of interaction of Aprepitant with digoxin in a clinical drug interaction study. 5-HT3 antagonists: In clinical drug interaction studies, aprepitant did not have clinically important effects on the pharmacokinetics of ondansetron or granisetron. No clinical or drug interaction study was conducted with dolasetron. Corticosteroids: Dexamethasone: Aprepitant, when given as a regimen of 125mg with dexamethasone coadministered orally as 20 mg on Day 1, and Aprepitant when given as 80 mg/day with dexamethasone coadministered orally as 8 mg on Days 2 through 5, increased the AUC of dexamethasone, a CYP3A4 substrate by 2.2-fold, on Days 1 and 5. The oral dexamethasone doses should be reduced by approximately 50% when coadministered with Aprepitant, to achieve exposures of dexamethasone similar to those obtained when it is given without Aprepitant. The daily dose of dexamethasone administered in clinical studies with Aprepitant reflects an approximate 50% reduction of the dose of dexamethasone. Methylprednisolone Aprepitant, when given as a regimen of 125 mg on Day 1 and 80 mg/day on Days 2 and 3, increased the AUC of methylprednisolone, a CYP3A4 substrate, by 1.34-fold on Day 1 and by 2.5-fold on Day 3, when methylprednisolone was coadministered intravenously as 125 mg on Day 1 and orally as 40 mg on Days 2 and 3. The IV methylprednisolone dose should be reduced by approximately 25%, and the oral methylprednisolone dose should be reduced by approximately 50% when coadministered with Aprepitant to achieve exposures of methylprednisolone similar to those obtained when it is given without Aprepitant. Warfarin: A single 125-mg dose of Aprepitant was administered on Day 1 and 80 mg/day on Days 2 and 3 to healthy subjects who were stabilized on chronic warfarin therapy. Although there was no effect of Aprepitant on the plasma AUC of R(+) or S(-) warfarin determined on Day 3, there was a 34% decrease in S(-)warfarin (a CYP2C9 substrate) trough concentration accompanied by a 14% decrease in the prothrombin time (reported as International Normalized Ratio or INR) 5 days after completion of dosing with Aprepitant. In patients on chronic warfarin therapy, the prothrombin time (INR) should be closely monitored in the 2-week period, particularly at 7 to 10 days, following initiation of the 3-day regimen of Aprepitant with each chemotherapy cycle. Tolbutamide: Aprepitant, when given as 125 mg on Day 1 and 80 mg/day on Days 2 and 3, decreased the AUC of tolbutamide (a CYP2C9 substrate) by 23% on Day 4, 28% on Day 8, and 15% on Day 15, when a single dose of tolbutamide 500 mg was admini,stered orally prior to the administration of the 3-day regimen of Aprepitant and on Days 4,8, and 15. Oral contraceptives: Aprepitant, when given once daily for 14 days as a 100-mg capsule with an oral contraceptive containing 35 mcg of ethinyl estradiol and 1 mg of norethindrone, decreased the AUC of ethinyl estradiol by 43%, and decreased the AUC of norethindrone by 8%; therefore, the efficacy of oral contraceptives during administration of Aprepitant may be reduced. Although a 3-day regimen of Aprepitant given concomitantly with oral contraceptives has not been studied, alternative or back-up methods of contraception should be used. Midazolam: Aprepitant increased the AUC of midazolam, a sensitive CYP3A4 substrate, by 2.3-fold on Day 1 and 3.3-fold on Day 5, when a single oral dose of midazolam 2 mg was coadministered on Day 1 and Day 5 of a regimen of Aprepitant 125 mg on Day 1 and 80 mg/day on Days 2 through 5. The potential effects of increased plasma concentrations of midazolam or other benzodiazepines metabolized via CYP3A4 (alprazolam, triazolam) should be considered when coadministering these agents with Aprepitant. In another study with intravenous administration of midazolam, Aprepitant was given as 125 mg on Day 1 and 80 mg/day on Days 2 and 3, and midazolam 2 mg IV was given prior to the administration of the 3-day regimen of Aprepitant and on Days 4, 8, and 15. Aprepitant increased the AUC of midazolam by 25% on Day 4 and decreased the AUC of midazolam by 19% on Day 8 relative to the dosing of Aprepitant on Days 1 through 3. These effects were not considered clinically important. The AUC of midazolam on Day 15 was similar to that observed at baseline. Effect of other agents on the pharmacokinefics of aprepitant Aprepitant is a substrate for CYP3A4; therefore, coadministration of Aprepitant with drugs that inhibit CYP3A4 activity may result in increased plasma concentrations of aprepitant. Consequently, concomitant administration of Aprepitant with strong CYP3A4 inhibitors (e.g., ketoconazole, itraconazole, nefazodone, troleandomycin, clarithromycin, ritonavir, nelfinavir) should be approached with caution. Because moderate CYP3A4 inhibitors (e.g., diltiazem) result in 2-fold increase in plasma concentrations of aprepitant, concomitant administration should also be approached with caution. Aprepitant is a substrate for CYP3A4; therefore, coadministration of Aprepitant with drugs that strongly induce CYP3A4 activity (e.g., rifampin, carbamazepine, phenytoin) may result in reduced plasma concentrations of aprepitant that may result in decreased efficacy of Aprepitant. Ketoconazole: When a single 125-mg dose of Aprepitant was administered on Day5 of a Ketoconazole: When a single 125-mg dose of Aprepitant was administered on Day5 of a 10-day regimen of 400 mg/day of ketoconazole, a strong CYP3A4 inhibitor, the AUC of aprepitant increased approximately 5-fold and the mean terminal half-life of aprepitant increased approximately 3-fold. Concomitant administration of Aprepitant with strong CYP3A4 inhibitors should be approached cautiously. Rifampin: When a single 375-mg dose of Aprepitant was administered on Day9 of a 14-day regimen of 600 mg/day of rifampin, a strong CYP3A4 inducer, the AUC of aprepitant decreased approximately 11-fold and the mean terminal half-life decreased approximately 3-fold. Coadministration of Aprepitant with drugs that induce CYP3A4 activity may result in reduced plasma concentrations and decreased efficacy of Aprepitant. Additional interactions Diltiazem: In patients with mild to moderate hypertension, administration of aprepitant once daily, as a tablet formulation comparable to 230 mg of the capsule formulation, with diltiazem 120 mg 3 times daily for 5 days, resulted in a 2-fold increase of aprepitant AUC and a simultaneous 1.7-fold increase of diltiazem AUC. These pharmacokinetic effects did not result in clinically meaningful changes in ECG, heart rate or blood pressure beyond those changes induced by diltiazem alone. Paroxetine: Coadministration of once daily doses of aprepitant, as a tablet formulation comparable to 85 mg or 170 mg of the capsule formulation, with paroxetine 20 mg once daily, resulted in a decrease in AUC by approximately 25% and Cmax, by approximately 20% of both aprepitant and paroxetine. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: GROUP, DRUG
[ "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "I-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-GROUP", "I-GROUP", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-GROUP", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "B-DRUG", "I-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "B-GROUP", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "B-GROUP", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "B-DRUG", "O", "B-DRUG", "O", "B-DRUG", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-DRUG", "O" ]
Aprepitant is a substrate, a moderate inhibitor, and an inducer of CYP3A4. Aprepitant is also an inducer of CYP2C9. Effect of aprepitant on the pharmacokinetics of other agents As a moderate inhibitor of CYP3A4, aprepitant can increase plasma concentrations of coadministered medicinal products that are metabolized through CYP3A4. Aprepitant has been shown to induce the metabolism of S(-) warfarin and tolbutamide, which are metabolized through CYP2C9. Coadministration of Aprepitant with these drugs or other drugs that are known to be metabolized by CYP2C9, such as phenytoin, may result in lower plasma concentrations of these drugs. Aprepitant is unlikely to interact with drugs that are substrates for the P-glycoprotein transporter, as demonstrated by the lack of interaction of Aprepitant with digoxin in a clinical drug interaction study. 5-HT3 antagonists: In clinical drug interaction studies, aprepitant did not have clinically important effects on the pharmacokinetics of ondansetron or granisetron. No clinical or drug interaction study was conducted with dolasetron. Corticosteroids: Dexamethasone: Aprepitant, when given as a regimen of 125mg with dexamethasone coadministered orally as 20 mg on Day 1, and Aprepitant when given as 80 mg/day with dexamethasone coadministered orally as 8 mg on Days 2 through 5, increased the AUC of dexamethasone, a CYP3A4 substrate by 2.2-fold, on Days 1 and 5. The oral dexamethasone doses should be reduced by approximately 50% when coadministered with Aprepitant, to achieve exposures of dexamethasone similar to those obtained when it is given without Aprepitant. The daily dose of dexamethasone administered in clinical studies with Aprepitant reflects an approximate 50% reduction of the dose of dexamethasone. Methylprednisolone Aprepitant, when given as a regimen of 125 mg on Day 1 and 80 mg/day on Days 2 and 3, increased the AUC of methylprednisolone, a CYP3A4 substrate, by 1.34-fold on Day 1 and by 2.5-fold on Day 3, when methylprednisolone was coadministered intravenously as 125 mg on Day 1 and orally as 40 mg on Days 2 and 3. The IV methylprednisolone dose should be reduced by approximately 25%, and the oral methylprednisolone dose should be reduced by approximately 50% when coadministered with Aprepitant to achieve exposures of methylprednisolone similar to those obtained when it is given without Aprepitant. Warfarin: A single 125-mg dose of Aprepitant was administered on Day 1 and 80 mg/day on Days 2 and 3 to healthy subjects who were stabilized on chronic warfarin therapy. Although there was no effect of Aprepitant on the plasma AUC of R(+) or S(-) warfarin determined on Day 3, there was a 34% decrease in S(-)warfarin (a CYP2C9 substrate) trough concentration accompanied by a 14% decrease in the prothrombin time (reported as International Normalized Ratio or INR) 5 days after completion of dosing with Aprepitant. In patients on chronic warfarin therapy, the prothrombin time (INR) should be closely monitored in the 2-week period, particularly at 7 to 10 days, following initiation of the 3-day regimen of Aprepitant with each chemotherapy cycle. Tolbutamide: Aprepitant, when given as 125 mg on Day 1 and 80 mg/day on Days 2 and 3, decreased the AUC of tolbutamide (a CYP2C9 substrate) by 23% on Day 4, 28% on Day 8, and 15% on Day 15, when a single dose of tolbutamide 500 mg was admini,stered orally prior to the administration of the 3-day regimen of Aprepitant and on Days 4,8, and 15. Oral contraceptives: Aprepitant, when given once daily for 14 days as a 100-mg capsule with an oral contraceptive containing 35 mcg of ethinyl estradiol and 1 mg of norethindrone, decreased the AUC of ethinyl estradiol by 43%, and decreased the AUC of norethindrone by 8%; therefore, the efficacy of oral contraceptives during administration of Aprepitant may be reduced. Although a 3-day regimen of Aprepitant given concomitantly with oral contraceptives has not been studied, alternative or back-up methods of contraception should be used. Midazolam: Aprepitant increased the AUC of midazolam, a sensitive CYP3A4 substrate, by 2.3-fold on Day 1 and 3.3-fold on Day 5, when a single oral dose of midazolam 2 mg was coadministered on Day 1 and Day 5 of a regimen of Aprepitant 125 mg on Day 1 and 80 mg/day on Days 2 through 5. The potential effects of increased plasma concentrations of midazolam or other benzodiazepines metabolized via CYP3A4 (alprazolam, triazolam) should be considered when coadministering these agents with Aprepitant. In another study with intravenous administration of midazolam, Aprepitant was given as 125 mg on Day 1 and 80 mg/day on Days 2 and 3, and midazolam 2 mg IV was given prior to the administration of the 3-day regimen of Aprepitant and on Days 4, 8, and 15. Aprepitant increased the AUC of midazolam by 25% on Day 4 and decreased the AUC of midazolam by 19% on Day 8 relative to the dosing of Aprepitant on Days 1 through 3. These effects were not considered clinically important. The AUC of midazolam on Day 15 was similar to that observed at baseline. Effect of other agents on the pharmacokinefics of aprepitant Aprepitant is a substrate for CYP3A4; therefore, coadministration of Aprepitant with drugs that inhibit CYP3A4 activity may result in increased plasma concentrations of aprepitant. Consequently, concomitant administration of Aprepitant with strong CYP3A4 inhibitors (e.g., ketoconazole, itraconazole, nefazodone, troleandomycin, clarithromycin, ritonavir, nelfinavir) should be approached with caution. Because moderate CYP3A4 inhibitors (e.g., diltiazem) result in 2-fold increase in plasma concentrations of aprepitant, concomitant administration should also be approached with caution. Aprepitant is a substrate for CYP3A4; therefore, coadministration of Aprepitant with drugs that strongly induce CYP3A4 activity (e.g., rifampin, carbamazepine, phenytoin) may result in reduced plasma concentrations of aprepitant that may result in decreased efficacy of Aprepitant. Ketoconazole: When a single 125-mg dose of Aprepitant was administered on Day5 of a Ketoconazole: When a single 125-mg dose of Aprepitant was administered on Day5 of a 10-day regimen of 400 mg/day of ketoconazole, a strong CYP3A4 inhibitor, the AUC of aprepitant increased approximately 5-fold and the mean terminal half-life of aprepitant increased approximately 3-fold. Concomitant administration of Aprepitant with strong CYP3A4 inhibitors should be approached cautiously. Rifampin: When a single 375-mg dose of Aprepitant was administered on Day9 of a 14-day regimen of 600 mg/day of rifampin, a strong CYP3A4 inducer, the AUC of aprepitant decreased approximately 11-fold and the mean terminal half-life decreased approximately 3-fold. Coadministration of Aprepitant with drugs that induce CYP3A4 activity may result in reduced plasma concentrations and decreased efficacy of Aprepitant. Additional interactions Diltiazem: In patients with mild to moderate hypertension, administration of aprepitant once daily, as a tablet formulation comparable to 230 mg of the capsule formulation, with diltiazem 120 mg 3 times daily for 5 days, resulted in a 2-fold increase of aprepitant AUC and a simultaneous 1.7-fold increase of diltiazem AUC. These pharmacokinetic effects did not result in clinically meaningful changes in ECG, heart rate or blood pressure beyond those changes induced by diltiazem alone. Paroxetine: Coadministration of once daily doses of aprepitant, as a tablet formulation comparable to 85 mg or 170 mg of the capsule formulation, with paroxetine 20 mg once daily, resulted in a decrease in AUC by approximately 25% and Cmax, by approximately 20% of both aprepitant and paroxetine.
[ "Aprepitant", "is", "a", "substrate", ",", "a", "moderate", "inhibitor", ",", "and", "an", "inducer", "of", "CYP3A4", ".", "Aprepitant", "is", "also", "an", "inducer", "of", "CYP2C9", ".", "Effect", "of", "aprepitant", "on", "the", "pharmacokinetics", "of", "other", "agents", "As", "a", "moderate", "inhibitor", "of", "CYP3A4", ",", "aprepitant", "can", "increase", "plasma", "concentrations", "of", "coadministered", "medicinal", "products", "that", "are", "metabolized", "through", "CYP3A4", ".", "Aprepitant", "has", "been", "shown", "to", "induce", "the", "metabolism", "of", "S(-", ")", "warfarin", "and", "tolbutamide", ",", "which", "are", "metabolized", "through", "CYP2C9", ".", "Coadministration", "of", "Aprepitant", "with", "these", "drugs", "or", "other", "drugs", "that", "are", "known", "to", "be", "metabolized", "by", "CYP2C9", ",", "such", "as", "phenytoin", ",", "may", "result", "in", "lower", "plasma", "concentrations", "of", "these", "drugs", ".", "Aprepitant", "is", "unlikely", "to", "interact", "with", "drugs", "that", "are", "substrates", "for", "the", "P", "-", "glycoprotein", "transporter", ",", "as", "demonstrated", "by", "the", "lack", "of", "interaction", "of", "Aprepitant", "with", "digoxin", "in", "a", "clinical", "drug", "interaction", "study", ".", "5-HT3", "antagonists", ":", "In", "clinical", "drug", "interaction", "studies", ",", "aprepitant", "did", "not", "have", "clinically", "important", "effects", "on", "the", "pharmacokinetics", "of", "ondansetron", "or", "granisetron", ".", "No", "clinical", "or", "drug", "interaction", "study", "was", "conducted", "with", "dolasetron", ".", "Corticosteroids", ":", "Dexamethasone", ":", "Aprepitant", ",", "when", "given", "as", "a", "regimen", "of", "125", "mg", "with", "dexamethasone", "coadministered", "orally", "as", "20", "mg", "on", "Day", "1", ",", "and", "Aprepitant", "when", "given", "as", "80", "mg", "/", "day", "with", "dexamethasone", "coadministered", "orally", "as", "8", "mg", "on", "Days", "2", "through", "5", ",", "increased", "the", "AUC", "of", "dexamethasone", ",", "a", "CYP3A4", "substrate", "by", "2.2-fold", ",", "on", "Days", "1", "and", "5", ".", "The", "oral", "dexamethasone", "doses", "should", "be", "reduced", "by", "approximately", "50", "%", "when", "coadministered", "with", "Aprepitant", ",", "to", "achieve", "exposures", "of", "dexamethasone", "similar", "to", "those", "obtained", "when", "it", "is", "given", "without", "Aprepitant", ".", "The", "daily", "dose", "of", "dexamethasone", "administered", "in", "clinical", "studies", "with", "Aprepitant", "reflects", "an", "approximate", "50", "%", "reduction", "of", "the", "dose", "of", "dexamethasone", ".", "Methylprednisolone", "Aprepitant", ",", "when", "given", "as", "a", "regimen", "of", "125", "mg", "on", "Day", "1", "and", "80", "mg", "/", "day", "on", "Days", "2", "and", "3", ",", "increased", "the", "AUC", "of", "methylprednisolone", ",", "a", "CYP3A4", "substrate", ",", "by", "1.34-fold", "on", "Day", "1", "and", "by", "2.5-fold", "on", "Day", "3", ",", "when", "methylprednisolone", "was", "coadministered", "intravenously", "as", "125", "mg", "on", "Day", "1", "and", "orally", "as", "40", "mg", "on", "Days", "2", "and", "3", ".", "The", "IV", "methylprednisolone", "dose", "should", "be", "reduced", "by", "approximately", "25", "%", ",", "and", "the", "oral", "methylprednisolone", "dose", "should", "be", "reduced", "by", "approximately", "50", "%", "when", "coadministered", "with", "Aprepitant", "to", "achieve", "exposures", "of", "methylprednisolone", "similar", "to", "those", "obtained", "when", "it", "is", "given", "without", "Aprepitant", ".", "Warfarin", ":", "A", "single", "125-mg", "dose", "of", "Aprepitant", "was", "administered", "on", "Day", "1", "and", "80", "mg", "/", "day", "on", "Days", "2", "and", "3", "to", "healthy", "subjects", "who", "were", "stabilized", "on", "chronic", "warfarin", "therapy", ".", "Although", "there", "was", "no", "effect", "of", "Aprepitant", "on", "the", "plasma", "AUC", "of", "R(+", ")", "or", "S(-", ")", "warfarin", "determined", "on", "Day", "3", ",", "there", "was", "a", "34", "%", "decrease", "in", "S(-)warfarin", "(", "a", "CYP2C9", "substrate", ")", "trough", "concentration", "accompanied", "by", "a", "14", "%", "decrease", "in", "the", "prothrombin", "time", "(", "reported", "as", "International", "Normalized", "Ratio", "or", "INR", ")", "5", "days", "after", "completion", "of", "dosing", "with", "Aprepitant", ".", "In", "patients", "on", "chronic", "warfarin", "therapy", ",", "the", "prothrombin", "time", "(", "INR", ")", "should", "be", "closely", "monitored", "in", "the", "2-week", "period", ",", "particularly", "at", "7", "to", "10", "days", ",", "following", "initiation", "of", "the", "3-day", "regimen", "of", "Aprepitant", "with", "each", "chemotherapy", "cycle", ".", "Tolbutamide", ":", "Aprepitant", ",", "when", "given", "as", "125", "mg", "on", "Day", "1", "and", "80", "mg", "/", "day", "on", "Days", "2", "and", "3", ",", "decreased", "the", "AUC", "of", "tolbutamide", "(", "a", "CYP2C9", "substrate", ")", "by", "23", "%", "on", "Day", "4", ",", "28", "%", "on", "Day", "8", ",", "and", "15", "%", "on", "Day", "15", ",", "when", "a", "single", "dose", "of", "tolbutamide", "500", "mg", "was", "admini", ",", "stered", "orally", "prior", "to", "the", "administration", "of", "the", "3-day", "regimen", "of", "Aprepitant", "and", "on", "Days", "4,8", ",", "and", "15", ".", "Oral", "contraceptives", ":", "Aprepitant", ",", "when", "given", "once", "daily", "for", "14", "days", "as", "a", "100-mg", "capsule", "with", "an", "oral", "contraceptive", "containing", "35", "mcg", "of", "ethinyl", "estradiol", "and", "1", "mg", "of", "norethindrone", ",", "decreased", "the", "AUC", "of", "ethinyl", "estradiol", "by", "43", "%", ",", "and", "decreased", "the", "AUC", "of", "norethindrone", "by", "8", "%", ";", "therefore", ",", "the", "efficacy", "of", "oral", "contraceptives", "during", "administration", "of", "Aprepitant", "may", "be", "reduced", ".", "Although", "a", "3-day", "regimen", "of", "Aprepitant", "given", "concomitantly", "with", "oral", "contraceptives", "has", "not", "been", "studied", ",", "alternative", "or", "back", "-", "up", "methods", "of", "contraception", "should", "be", "used", ".", "Midazolam", ":", "Aprepitant", "increased", "the", "AUC", "of", "midazolam", ",", "a", "sensitive", "CYP3A4", "substrate", ",", "by", "2.3-fold", "on", "Day", "1", "and", "3.3-fold", "on", "Day", "5", ",", "when", "a", "single", "oral", "dose", "of", "midazolam", "2", "mg", "was", "coadministered", "on", "Day", "1", "and", "Day", "5", "of", "a", "regimen", "of", "Aprepitant", "125", "mg", "on", "Day", "1", "and", "80", "mg", "/", "day", "on", "Days", "2", "through", "5", ".", "The", "potential", "effects", "of", "increased", "plasma", "concentrations", "of", "midazolam", "or", "other", "benzodiazepines", "metabolized", "via", "CYP3A4", "(", "alprazolam", ",", "triazolam", ")", "should", "be", "considered", "when", "coadministering", "these", "agents", "with", "Aprepitant", ".", "In", "another", "study", "with", "intravenous", "administration", "of", "midazolam", ",", "Aprepitant", "was", "given", "as", "125", "mg", "on", "Day", "1", "and", "80", "mg", "/", "day", "on", "Days", "2", "and", "3", ",", "and", "midazolam", "2", "mg", "IV", "was", "given", "prior", "to", "the", "administration", "of", "the", "3-day", "regimen", "of", "Aprepitant", "and", "on", "Days", "4", ",", "8", ",", "and", "15", ".", "Aprepitant", "increased", "the", "AUC", "of", "midazolam", "by", "25", "%", "on", "Day", "4", "and", "decreased", "the", "AUC", "of", "midazolam", "by", "19", "%", "on", "Day", "8", "relative", "to", "the", "dosing", "of", "Aprepitant", "on", "Days", "1", "through", "3", ".", "These", "effects", "were", "not", "considered", "clinically", "important", ".", "The", "AUC", "of", "midazolam", "on", "Day", "15", "was", "similar", "to", "that", "observed", "at", "baseline", ".", "Effect", "of", "other", "agents", "on", "the", "pharmacokinefics", "of", "aprepitant", "Aprepitant", "is", "a", "substrate", "for", "CYP3A4", ";", "therefore", ",", "coadministration", "of", "Aprepitant", "with", "drugs", "that", "inhibit", "CYP3A4", "activity", "may", "result", "in", "increased", "plasma", "concentrations", "of", "aprepitant", ".", "Consequently", ",", "concomitant", "administration", "of", "Aprepitant", "with", "strong", "CYP3A4", "inhibitors", "(", "e.g", ".", ",", "ketoconazole", ",", "itraconazole", ",", "nefazodone", ",", "troleandomycin", ",", "clarithromycin", ",", "ritonavir", ",", "nelfinavir", ")", "should", "be", "approached", "with", "caution", ".", "Because", "moderate", "CYP3A4", "inhibitors", "(", "e.g", ".", ",", "diltiazem", ")", "result", "in", "2-fold", "increase", "in", "plasma", "concentrations", "of", "aprepitant", ",", "concomitant", "administration", "should", "also", "be", "approached", "with", "caution", ".", "Aprepitant", "is", "a", "substrate", "for", "CYP3A4", ";", "therefore", ",", "coadministration", "of", "Aprepitant", "with", "drugs", "that", "strongly", "induce", "CYP3A4", "activity", "(", "e.g", ".", ",", "rifampin", ",", "carbamazepine", ",", "phenytoin", ")", "may", "result", "in", "reduced", "plasma", "concentrations", "of", "aprepitant", "that", "may", "result", "in", "decreased", "efficacy", "of", "Aprepitant", ".", "Ketoconazole", ":", "When", "a", "single", "125-mg", "dose", "of", "Aprepitant", "was", "administered", "on", "Day5", "of", "a", "Ketoconazole", ":", "When", "a", "single", "125-mg", "dose", "of", "Aprepitant", "was", "administered", "on", "Day5", "of", "a", "10-day", "regimen", "of", "400", "mg", "/", "day", "of", "ketoconazole", ",", "a", "strong", "CYP3A4", "inhibitor", ",", "the", "AUC", "of", "aprepitant", "increased", "approximately", "5-fold", "and", "the", "mean", "terminal", "half", "-", "life", "of", "aprepitant", "increased", "approximately", "3-fold", ".", "Concomitant", "administration", "of", "Aprepitant", "with", "strong", "CYP3A4", "inhibitors", "should", "be", "approached", "cautiously", ".", "Rifampin", ":", "When", "a", "single", "375-mg", "dose", "of", "Aprepitant", "was", "administered", "on", "Day9", "of", "a", "14-day", "regimen", "of", "600", "mg", "/", "day", "of", "rifampin", ",", "a", "strong", "CYP3A4", "inducer", ",", "the", "AUC", "of", "aprepitant", "decreased", "approximately", "11-fold", "and", "the", "mean", "terminal", "half", "-", "life", "decreased", "approximately", "3-fold", ".", "Coadministration", "of", "Aprepitant", "with", "drugs", "that", "induce", "CYP3A4", "activity", "may", "result", "in", "reduced", "plasma", "concentrations", "and", "decreased", "efficacy", "of", "Aprepitant", ".", "Additional", "interactions", "Diltiazem", ":", "In", "patients", "with", "mild", "to", "moderate", "hypertension", ",", "administration", "of", "aprepitant", "once", "daily", ",", "as", "a", "tablet", "formulation", "comparable", "to", "230", "mg", "of", "the", "capsule", "formulation", ",", "with", "diltiazem", "120", "mg", "3", "times", "daily", "for", "5", "days", ",", "resulted", "in", "a", "2-fold", "increase", "of", "aprepitant", "AUC", "and", "a", "simultaneous", "1.7-fold", "increase", "of", "diltiazem", "AUC", ".", "These", "pharmacokinetic", "effects", "did", "not", "result", "in", "clinically", "meaningful", "changes", "in", "ECG", ",", "heart", "rate", "or", "blood", "pressure", "beyond", "those", "changes", "induced", "by", "diltiazem", "alone", ".", "Paroxetine", ":", "Coadministration", "of", "once", "daily", "doses", "of", "aprepitant", ",", "as", "a", "tablet", "formulation", "comparable", "to", "85", "mg", "or", "170", "mg", "of", "the", "capsule", "formulation", ",", "with", "paroxetine", "20", "mg", "once", "daily", ",", "resulted", "in", "a", "decrease", "in", "AUC", "by", "approximately", "25", "%", "and", "Cmax", ",", "by", "approximately", "20", "%", "of", "both", "aprepitant", "and", "paroxetine", "." ]
[ "DRUG", "GROUP" ]