text
stringlengths 13
30k
|
|---|
{"imdb_id": "tt0078908", "title": "The Brood", "plot_synopsis": "At the Somafree Institute, Dr. Hal Raglan humiliates his patient Mike by saying: \"you're just a weak person. You must have got that from your mother. It probably would have been better for you if you had been born a girl!\" On the dimly lit stage, Raglan demands a demonstration of anger, and Mike reveals angry red blotches covering his torso. The audience gasps. Raglan announces that this is psychoplasmcis; the physical manifestation of mental rage by the appearance of the welts on one's body.Meanwhile, Frank Carveth collects his nine-year-old daughter Candy from a 'Private Guest Room'. Candy wears a red coat with fur trim and hood. Bathing her, Frank finds bruises and scratches on her back. He drives to the Somafree Institute to confront Raglan and demands to see his wife Nola, whom has been committed there. Raglan refuses. Frank accuses Nola of abusing their daughter and says he will stop Candy's next visit. Raglan threatens legal action if Frank withholds a vital part of Nola's treatment. Frank then goes to his lawyer, Al Resnikoff, who tells him that Nola has a stronger legal position despite the fact that she is committed to a mental hospital. Frank says that he will do what he has to. He takes Candy to her maternal grandmother, Juliana, who seems highly strung out.Back at the institute, Raglan goes into Nola's room (play-acting as Candy) and he asks her why she hurt her daughter Candice. Raglan/Candice says: \"Mummies don't hurt their own children\". Nola sobs that they do. She tells Raglan that her own mother was \"fucked up and bad\". Raglan encourages her anger by telling her: \"Go all the way through it, right to the end.\"That evening at Juliana's house, she investigates a noise in the kitchen. Food, juice, glasses and dishes are thrown all over the floor. She is bludgeoned by what appears to be a small child wearing a red hooded raincoat with fur trim. As Candy watches from behind a door, small claw-like hands leaves bloodstains on the banisters. The next morning at his workplace, Frank is informed of Juliana's murder. Police psychologist Dr. Birkin tells Frank so encourage Candy to remember what happened, a breakdown is possible if she doesn't remember. \"These things tend to express themselves in one way or another\" says Dr. Birkin.At the institute, Raglan speaks to Nola as her father. She quickly gets very angry saying: \"You shouldn't have walked way when she hit me.\" Red welts appear on Nola's forehead as she speaks.At the local airport, Frank and Candy meet Barton Kelly, Nola's estranged father, who has come for his ex-wife's funeral. On Resnikoff's advice, Frank visits Jan Hartog, an ex-Somafree patient taking legal action against Dr. Raglan. Uncovering a row of tumors on his neck, Hartog says bitterly: \"Raglan encourages my body to revolt against me. And it did. I have a small revolution on my hands and I'm not putting it down very successfully.\"Back at the institute, a drunk Barton Kelly arrives and is furious when Raglan will not allow him to see Nola. Meanwhile, Frank arrives at Candy's school where her teacher, Ruth Mayer, sits with her. Candy invites Ruth to dinner at her house. That evening, Ruth arrives and has dinner with Frank and Candy. A little later, Barton calls Frank from Juliana's house, saying he needs Frank's help to see Nola. Frank leaves Ruth babysitting Candy, who picks up a book to read which is titled 'The Shape Of Rage'. Raglan's book on Psychoplasmics.At Juliana's house, Barton is alone when the same small figure wearing the hooded red raincoat emerges from under his bed and batters him to a very gory death with a pair of paperweights. Frank arrives a few minutes later and finds the body. The strange-looking \"child\" jumps on him like some aggressive animal, clawing at him until it suddenly falls off his back to the floor and seemingly dies. Frank picks up the phone to call the police. Back at Frank's house, Ruth Mayer answers a phone call from Nola calling from the institute, who then goes in a berserk rage when Ruth answers the phone and suspects that she is having an affair with her husband.At the police station, Frank gives his statement and then meets the pathologist who performed the autopsy on the mysterious 'child creature' that attacked him where the doctor tells him that the creature died simply because: \"it ran out of gas\". Or more likely \"its batteries expired\". The pathologist points out that the creature has strange eyes, no sexual organs, and no navel. \"This creature has never really been born... at least not the way human beings are born\" says the pathologist.Raglan (as Ruth Mayer) speaks to Nola, Raglan/Ruth says that Frank will divorce Nola and marry her. The jealous Nola screams to leave Frank alone. When Frank gets home from the police station, Ruth leaves in a hurry. He finds Candy cowering in a corner of her bedroom after a nightmare. He tells her that the 'thing' is dead.The next morning, Raglan reads about Barton Kelly's murder. Taking a gun from his desk, he instructs his assistant, Chris, to get all the patients out of the institute. Meanwhile, Frank visits the hospital where Mike is now a fellow patient of Hartog's and is told that Nola is in fact the only patient at Somafree. Mike becomes angry about being dumped by his \"daddy\", his face becomes one giant red sore.Frank takes Candy to school. In Ruth Mayer's art class, two 'children creatures' in pastel coats with hoods pick up wooden hammers and beat Ruth mercilessly to a gory death. Alerted by a boy's cries for help, Frank enters the classroom to find Ruth dead, and Candy gone.At the institute, Raglan wakes Nola. She relates a dream that Candy was coming back to her, and says she doesn't feel threatened by Ruth Mayer any more. At the same time, Candy is being led along a snowy highway by the two creatures.That evening, Mike turns up on Frank's doorstep raving about: \"the disturbed kids in the work shed. The ones your wife's taking care of.\" Frank drives to the Somafree Institute where outside Raglan pulls a gun on him, saying they'll kill him if he tries to take Candy away from them. In a long monologue, Raglan tells Frank that the child creatures that have been doing all the killing are Nola's children. \"Nola is not their surrogate mother, she's their real mother.\" They are the Brood; the parthenogenesis 'children' of Nola's rage. Over the past year-and-a-half Nola's psychoplasmics have manifested into these children which carry out her bidding whenever she's in an angry mood. Raglan tells Frank that Candy is locked up in the attic where the Brood are being kept, and that if he wants Candy back, Frank must go to Nola to convince her that he wants Candy back to live with him. If he can do that, the Brood will be neutral so Raglan can go into the attic and take Candy, if not... the Brood will attack as long as Nola is in a rage.While Raglan waits outside the attic door where the Brood are being kept, Frank goes to Nola's room. He finds Nola rocking back and forth, wearing a white robe bathed in light. Nola wakes from her trance-like state and seems happy that he has come to see her. Frank says that he wants to be back with her. (Note: throughout the entire movie, Nola is only shown from the chest up which is apparently to hide something). At this point, Nola throws back her white robe, revealing an umbilical cord and external sac on her abdomen. The years of the welts that have appeared on her chest have merged together to create this womb outside her body as an incubator for the Brood that she produces. Frank recoils in horror and disgust.In the attic, Raglan quietly enters where all the sleeping Brood lie in their bunk beds. He finds Candy in one and picks her up to carry her out. Just then, the Brood stirs, sensing Nola's mounting anger.In Nola's room, she tears open the sac, removing a bloody 'infant' which she licks clean, as an animal might after having given birth. Frank's true feelings towards all this become apparent to Nola and her rage erupts.In the attic, the Brood finally become active, leaping on Raglan, who manages to shoot a few of them, but he gets overwhelmed and beaten to death by the Brood. In Nola's room, she angrily tells Frank that she would see Candy die then let him take her away. Upstairs, the Brood then turn their attention to the petrified Candy who runs and locks herself in the closet room in the attic, but they break through the door to grab at her. Frank attacks Nola and strangles her to death with his bare hands to save Candy when he hears the noises coming from the attic. When Nola stops breathing, all is suddenly silent.Frank goes upstairs to the attic to find all the Brood dead outside the room where Candy locked herself in, realizing that the Brood died without their mother's connection. Raglan is also dead nearby having been beaten to death and lying next to a few of the Brood he managed to kill before being overwhelmed. Candy is quivering in a corner of the room and Frank enters picks her up and tells her that he is taking her home. As Frank drives home with Candy, she seems to have withdrawn into a state of shock and cannot speak. Frank doesn't notice two raised lumps on her left arm... signs of her inner rage. The welts suggests that eventually like mother, like daughter...", "tags": "cult, psychedelic, murder, violence", "split": "train", "synopsis_source": "imdb", "review": null}
|
{"id": "12", "label": 40, "text": "yatma vakti", "label_text": "iot_hue_lightoff"}
|
{"text": "Niggas iffy, uh, blicky got the stiffy, uh\nGot the blicky, uh, drum, it hold fifty, uh\nScum Gang!\nPop these niggas like a wheelie, nigga, you a silly nigga\nIn the hood with them Billy niggas and them Hoover niggas\nYou run up and they shootin niggas, we aint hoopin, nigga\nYo, KB, you a loser, nigga, up that Uzi, nigga\nOn the stoop, crills in my drawers, your girl on my phone\nShe wanna fuck, but keep her clothes on, I only want the jaw\nMan, thats really all I use her for, then kick her out the door\nI dont want her, you can keep the whore, she fiendin for some more\nIn New York, my niggas dont Milly Rock, my niggas money bop\nBlow a case, a nigga throwin shots, I run em off they block\nQuarter milli in the stash box, I grinded for my spot\nNiggas talkin bout that cash, but my bag worth a lot\nI dont fuck with no old hoes, only new hoes\nPut my dick in her backbone, I pass her to my bro\nI dont love her, thats a sad ho, she a bad ho\nIma fuck her, then I dash home, to the cash, ho\nIm on some rob a nigga shit, take the nigga bitch\nDo the dash in the whip, count the cash in the whip\nI pull up with a stick, I let that shit hit\nShout out , but I fucked that nigga bitch\nNiggas iffy, uh, blicky got the stiffy, uh\nGot the blicky, uh, drum it hold fifty, uh\nMove milli, all my niggas on fifty, uh\nTalk down , you silly, uh \nHit a stain, fifty bands, all hunnids\nSpinnin through ya block, like a pop shove-it\nShoot at me, Im shootin back, Im gettin buckets\nI aint wanna take his life, but nigga, fuck it\nIm on some rob a nigga shit, take the nigga bitch\nDo the dash in the whip, count the cash in the whip\nI pull up with a stick, I let that shit hit\nShout out , but I fucked that nigga bitch\nIm on some rob a nigga shit, take the nigga bitch\nDo the dash in the whip, count the cash in the whip\nI pull up with a stick, I let that shit hit\nShout out , but I fucked that nigga bitch\nScum Gang!"}
|
{"text": "Thats my word, get up in they face\nTalk your shit, let your nuts drag, nigga\nThese niggas just runnin out they fuckin mouth, man\nFollow protocol, Blood, get in they fuckin chest, nigga\nWe the fuckin M.O.B., nigga\nThese niggas bleed different\nWe dont bleed, nigga\nWe make niggas bleed, Blood\nTR3YWAY\nThese niggas say they heard of me, I aint heard of you\nGet the fuck up out my fuckin face, fore I murder you\nBitch niggas always jackin Blood, but I know they fu\nWhole squad full of fuckin killers, Im a killer too\nSending shots, shots, shots, shots, shots, nigga\nEverybody gettin pop, pop, popped, nigga\nThe thing go rrrah, rrrah, rrrah, rrrah, rrrah, nigga\nWe send shots, shots, shots, shots, shots, nigga\nIts always 6ix9ine this and 6ix9ine that\nNiggas on my dick and on my yack\nThese niggas lookin for me, you could hit my jack\nI done dropped my address, yall know where 6ix9ine at\nI dont flock, yeah, nine to his back like Ibaka\nBaka, not nice, with the fuckin choppa\nPop em, scope on the nigga, who shot ya?\nDropped him, somebody call a fuckin doctor!\nDick up in the pussy, bet that shit get gushy, gushy\nShe want the whole gang bussin all in her pussy\nI want the drip, drip while I get my dick licked\nLil sick bitch, lickin on my dick tip\nShe a freak ho, fuck her, she on beast mode\nArch your back, put your hands on your knees, ho\nIm on beast mode, shoot you through your peep-hole\nSaid he want smoke, I dont really see it though\nThese niggas say they heard of me, I aint heard of you\nGet the fuck up out my fuckin face, fore I murder you\nBitch niggas always jackin Blood, but I know they fu\nWhole squad full of fuckin killers, Im a killer too\nSending shots, shots, shots, shots, shots, nigga\nEverybody gettin pop, pop, popped, nigga\nThe thing go rrrah, rrrah, rrrah, rrrah, rrrah, nigga\nWe send shots, shots, shots, shots, shots, nigga"}
|
{"text": "Hold up, let me get it started\nB.B. with the Robins, lookin all retarded\nB.B. saggin, fly like a dragon\nBitches suck my dick, cause Im fly like Aladdin\nScum Gang!\nThese bitches think Im stupid, I aint stupid\nDummy boys fall in love with it, he stupid\nAll these hoes on my body, cut the bullshit\nAll these hoes, they aint loyal, yall lookin stupid\nI just left Starlets and I aint even cash out\nBack out, straight to the trap house, I blow her back out\nIll pull her tracks out, got her running like its track now\nLike a Smackdown, rock bottom Ima pin her down\nHold up, let me get it started\nB.B. with the Robins, lookin all retarded\nB.B. saggin, fly like a dragon\nBitches suck my dick cause Im fly like Aladdin\nPour a semi, pull up to the cribby, uh\nLicky-licky, licky on my blicky, uh\nTake a flicky, make a movie with me, uh\nTake a flicky, make em real drippy, uh\nWhy you watching me?\nYou all on my IG\nWhy you stalking me?\nYou dont even follow me\nWhy you tweet my shit?\nYou aint used to read my shit\nBitch, you used to fuckin leave me on seen and shit\nWent to the Eastside, spanked out Juju\nLucky I aint have it on me, I was gon shoot you\nSpanked him on camera, threw it on YouTube\nStupid lil dumb nigga, now you on YouTube\nIf a nigga want beef, Im the type to drag it\nShoot you while you with your bitch then its back to mackin\nPolice pull up on me, I dont know what happened\nPolice pull up on you, you gon get to yappin\nWe gon get to clappin, we been on static\nSemi-automatics, they gon get to clappin\nWe aint with the chattin, you lil niggas cappin\nIf we catch you lackin, turn you into has-beens\nRan through Lust, 100 bands up\nShout out SpinKing, thats my motherfuckin blood, nigga\nGo, go, go mulignane\nGo, go, mulignane\nPour a semi, pull up to the cribby, uh\nLicky-licky, licky on my blicky, uh\nTake a flicky, make a movie with me, uh\nTake a flicky, make em real drippy, uh\nWhy you watching me?\nYou all on my IG\nWhy you stalking me?\nYou dont even follow me\nWhy you tweet my shit?\nYou aint used to read my shit\nBitch, you used to fuckin leave me on seen and shit"}
|
{"text": "Yall already know it be the boy Yung Gordon\nAnd you rockin with Take Money Promotions\nAyy, Take Money Promotions\nGive em that new shit, no fool shit\nOh yeah, lets go\nDJ NekoLito \nTMP954WELIVE\nTake Money Promotions\nTay Keith, fuck these niggas up\nBitch, Im silly\nUp them choppers, shoot your shit up, lets get busy\nDrinkin Henny, goin brazy, poppin pillies\nSex Money Murda, shout-out all my blazing Billies \nWe in yo city \nShoutout my apes in the fuckin zoo \nFilayo, they gon shoot\nSpin a hoop, who the fuck is you?\nWho the fuck you know, nigga? No, nigga\nNiggas killed your cousin, you want smoke, nigga? \nGlo nigga, rollin up your cousin in a blunt, nigga\nBozo, bitch, are you dumb-d-dumb-dumb-dumb-d-dumb-dumb-dumb? \nBitch, Im Nick Cannon with this drum-dr-drum-drum-drum\nPull up with semis, no Lil Pump-pr-ump-Pump-pumps\nWe goin dumb-d-dumb-dumb-dumb-d-dumb-dumb-dumb\nBitch Im stupid \nI be tweakin, I be wildin, I be booted \nI be stealin, I be robbin, I be lootin \nYour boyfriend dumb, he get no money, bitch, he stupid \nOh, bitch, he, oh, bitch, he stupid\nDamn, homie, in high school you was the man, homie \nWhat the fuck happened to you? \nIm just sayin, homie\nNow you smokin Black & Milds, smokin reg, homie\nAh-ah-ahh, whats up? Shmurda on the motherfuckin set\nNigga 6ix9ine whats poppin cuz?\nTell him shut up, suck a dick\nTell him fuck him, Im the shit\nBitch, Im drunk recording this\nIm getting money, Im the shit\nShout-out my Bloods, shout-out my Crips\nThat nigga, Ebro, he a bitch\nJust another old nigga on a young nigga dick\nBitch Im lit on the Gram, a million likes, you see my shit\nA bitch DM for the dick, but I probably wouldnt hit\nVVS, Cuban hit, shout-out Jimmy for the drip\nYour baby daddy mixtape wasnt shit, he a bitch\nFree Bobby, free Rowdy, free Cueno, free the 9\nShout-out Jay Dee, shout-out Kooda, Dee Savv, those my guys\nFOA they gon ride, GS9 they gon slide\nWhen I woo, woo back, ah-ah, those my guys\nShe give me neck until I burst out\nShe use her teeth, she get cursed out\nAnd all these suckers with they fucking feelings\nAlways got these bitches with they purse out\nWe on the blast nigga bow down\nI count bricks put the word out\nYou know you like a nigga Shmoney Dance\nYou gon love a nigga when I swerve out\nBitch, Im silly\nUp them choppers, shoot your shit up, lets get busy\nDrinkin Henny, goin brazy, poppin pillies\nSex Money Murda, shout-out all my blazing Billies \nWe in yo city\nHold up, hold up, hold up, gang\nRun that shit back"}
|
{"text": "Got me a new Rollie\nGotti Gotti, ultra \nGotti Gotti, uh\nGotti Gotti \nKay, my block bang , .30 bang \nScum Gang, big choppa, big thang, let your nuts hang\nWho they? , dont say \nBBA change your mood, ayy, any day\nGotti Gotti, cookin up, speed it up\nDouble cup, Xanny cup, booted up\nMollied up, molly up, break it up\nCop it, then I serve it up, give it up\nGotti Gotti\nFuck with my day ones\nYeah, you know I flooded the chain once\nGot the money, and I split it with day ones\nShe aint fuck me back when I was lame, nah\nYeah, you know I do my dance \nIn the club , throwin dough\nRack it up , shake it up\nWatch me do it, how I bust it up , I mix it up\nThen I hit her with the blicky, uh\nSo drip it, drip it, drip it, drip it\nYou aint got no money, you can keep her \nBitch, I got my Nina, Ima squeeze her\nIf you really wanna meet her, she a greeter\nIt was really nice to meet ya, I dont need ya \nI pray to God that my niggas gon eat \nI pray to God that my family gon see \nPrayin that the Lord take a chance with me\nWouldnt come when I was up, I was on the wrong things \nI aint silly, aint no dumb nigga, are you dumb, nigga?\nAre you stayin with the pump, nigga? Fuck is up, nigga?\nIs you mad? Yous a fuck nigga, I dont trust niggas\nScum Gang, chew em up, nigga, we dont fuck with ya\nOkay, my block bang , 30 bang \nScum Gang, big choppa, big thang, let your nuts hang\nWho they? , dont say \nBBA change your mood, ayy, any day\nGotti Gotti, cookin up, speed it up\nDouble cup, Xanny cup, booted up\nMollied up, molly up, break it up\nCop it, then I serve it up, give it up\nGotti Gotti\nThe Gotti Gotti\nWho, who really with the money, money?\nWho, who really with the Gotti Gotti?\nWho, who really with the money, money? Who?\nDo my dance, hit my dance\nFifty bands, hunnid bands, all my dance\nMollied up, molly up, give it up\nCop it, then I serve it up, give it up\nReally with the Gotti, Gotti\nWho, who really with the Gotti, Gotti?\nWho, who really with the?"}
|
{"feat_Unnamed: 0": 30, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: The diminishing supply of this nonrenewable resource is not leading to advancements in automotive technology\nA. petrol\nB. steam\nAnswer:", "classes": [" A", " B"], "target": 1, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -3.5110998153686523, -13.148752212524414, -3.767557382583618, -0.03962911292910576, -8.467395782470703, -6.392854690551758, -0.32994896173477173, -0.0002115741081070155, -0.0012559153838083148, -0.14653274416923523, -1.5337474346160889, -4.912654876708984, -6.07043981552124, -0.06777500361204147, -11.505914688110352, -0.08559715002775192, -9.249683380126953, -0.4841456413269043, -5.249689102172852, -3.9866976737976074, -0.5435678958892822, -8.570822715759277, -0.3814235031604767, -0.013477292843163013, -0.0004930472350679338, -7.384513854980469, -0.07648689299821854, -11.433932304382324, -0.033660296350717545, -1.7776474952697754, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 122, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: Lamps that convert electricity into light and heat aren't known as\nA. candle\nB. incadescent\nAnswer:", "classes": [" A", " B"], "target": 0, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -3.5110998153686523, -13.148752212524414, -3.767557382583618, -0.03962911292910576, -8.467395782470703, -6.392854690551758, -0.32994896173477173, -0.0002115741081070155, -0.0012559153838083148, -0.14653274416923523, -1.5337474346160889, -4.912654876708984, -6.07043981552124, -0.06777500361204147, -11.505914688110352, -0.08559715002775192, -9.249683380126953, -0.4841456413269043, -5.249689102172852, -3.9866976737976074, -0.5435678958892822, -8.570822715759277, -0.3814235031604767, -0.013477292843163013, -0.0004930472350679338, -7.384513854980469, -0.07648689299821854, -11.433932304382324, -0.033660296350717545, -0.7497448325157166, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 120, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: Which is not needed for photosynthesis to occur\nA. energy that takes 8.3 minutes to travel to Earth\nB. the 8th entry on the periodic table\nAnswer:", "classes": [" A", " B"], "target": 1, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -7.75143575668335, -6.003880500793457, -3.9898810386657715, -8.80942153930664, -1.5789915323257446, -0.5974048376083374, -0.29128435254096985, -3.6685409545898438, -1.0882447957992554, -5.742354869842529, -0.623590350151062, -5.6125946044921875, -0.5557351112365723, -3.8178935050964355, -4.590112209320068, -0.24992944300174713, -7.090709209442139, -4.124680042266846, -0.02087550051510334, -0.0003381395654287189, -2.2732858657836914, -11.106045722961426, -0.07466167211532593, -0.6864655017852783, -11.447681427001953, -0.015340551733970642, -1.7639719247817993, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 147, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: A creature that is not a biped and which regularly uses tools will occasionally enjoy munching on\nA. chia seeds\nB. old feces\nAnswer:", "classes": [" A", " B"], "target": 1, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -7.75143575668335, -6.003880500793457, -3.9898810386657715, -8.80942153930664, -1.5789915323257446, -0.5974048376083374, -0.29128435254096985, -3.6685409545898438, -1.0882447957992554, -5.742354869842529, -0.623590350151062, -5.6125946044921875, -0.5557351112365723, -3.8178935050964355, -4.590112209320068, -0.24992944300174713, -7.090709209442139, -4.124680042266846, -0.02087550051510334, -0.0003381395654287189, -2.2732858657836914, -11.106045722961426, -0.07466167211532593, -0.6864655017852783, -11.447681427001953, -0.015340551733970642, -1.1074682474136353, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 87, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: One way to retain your own thermal energy is not to\nA. wear fluffy socks\nB. sit in snow\nAnswer:", "classes": [" A", " B"], "target": 1, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -3.540132522583008, -2.1493844985961914, -2.473184585571289, -7.772617816925049, -1.4678127765655518, -8.866427421569824, -0.021451478824019432, -1.6848167181015015, -0.5579466819763184, -6.1055803298950195, -3.5657567977905273, -0.310955286026001, -5.871265888214111, -6.245800495147705, -6.216467380523682, -7.559210777282715, -2.987522602081299, -2.838534355163574, -2.04372239112854, -0.15108250081539154, -1.3123705387115479, -2.6350107192993164, -3.750938653945923, -0.9536345601081848, -0.013933410868048668, -0.0010751663940027356, -2.683973789215088, -8.173579216003418, -3.8778157234191895, -10.235885620117188, -1.108606219291687, -0.4401010274887085, -0.30959975719451904, -0.012408203445374966, -0.5554771423339844, -9.21113109588623, -0.023370876908302307, -1.5063493251800537, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 158, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: An extremely rapid surge of rising flood water that moves across usually dry land at about 30 feet or more each second is not powerful enough to\nA. lift and carry a tall mountain\nB. lift a 250-ton object off the ground\nAnswer:", "classes": [" A", " B"], "target": 0, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -3.540132522583008, -2.1493844985961914, -2.473184585571289, -7.772617816925049, -1.4678127765655518, -8.866427421569824, -0.021451478824019432, -1.6848167181015015, -0.5579466819763184, -6.1055803298950195, -3.5657567977905273, -0.310955286026001, -5.871265888214111, -6.245800495147705, -6.216467380523682, -7.559210777282715, -2.987522602081299, -2.838534355163574, -2.04372239112854, -0.15108250081539154, -1.3123705387115479, -2.6350107192993164, -3.750938653945923, -0.9536345601081848, -0.013933410868048668, -0.0010751663940027356, -2.683973789215088, -8.173579216003418, -3.8778157234191895, -10.235885620117188, -1.108606219291687, -0.4401010274887085, -0.30959975719451904, -0.012408203445374966, -0.5554771423339844, -9.21113109588623, -0.023370876908302307, -0.8615472316741943, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 149, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: A thing's position is not altered when\nA. thing feels moved emotionally\nB. the thing adjusts its location\nAnswer:", "classes": [" A", " B"], "target": 0, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -3.1186885833740234, -8.443205833435059, -2.1675028800964355, -1.3686646223068237, -3.1064045429229736, -1.4089109897613525, -7.249591827392578, -0.0027576773427426815, -3.733604907989502, -4.589313983917236, -7.579625129699707, -3.5867972373962402, -3.646378517150879, -4.565857410430908, -5.803885459899902, -8.152664184570312, -6.923027992248535, -0.2958899438381195, -0.009866989217698574, -0.2096511423587799, -7.193249702453613, -6.334619522094727, -0.6209357976913452, -6.759921073913574, -4.011489391326904, -0.8356382846832275, -0.3624024987220764, -0.010617316700518131, -0.0005588161875493824, -7.523653984069824, -10.534443855285645, -0.07184408605098724, -10.919600486755371, -0.026969045400619507, -2.239441394805908, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 176, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: A pot of pasta is boiling on the stove, and the lid on top of the pot is shaking as the water boils more rapidly. A person goes to the stove and removes the pot, releasing steam into the air above, and so the steam is not\nA. water vapor\nB. cold air\nAnswer:", "classes": [" A", " B"], "target": 1, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -3.1186885833740234, -8.443205833435059, -2.1675028800964355, -1.3686646223068237, -3.1064045429229736, -1.4089109897613525, -7.249591827392578, -0.0027576773427426815, -3.733604907989502, -4.589313983917236, -7.579625129699707, -3.5867972373962402, -3.646378517150879, -4.565857410430908, -5.803885459899902, -8.152664184570312, -6.923027992248535, -0.2958899438381195, -0.009866989217698574, -0.2096511423587799, -7.193249702453613, -6.334619522094727, -0.6209357976913452, -6.759921073913574, -4.011489391326904, -0.8356382846832275, -0.3624024987220764, -0.010617316700518131, -0.0005588161875493824, -7.523653984069824, -10.534443855285645, -0.07184408605098724, -10.919600486755371, -0.026969045400619507, -0.6493525505065918, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 255, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: A plant that gets extra minerals such as zinc aren't probably\nA. placed in good soil\nB. made out of soil\nAnswer:", "classes": [" A", " B"], "target": 1, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -5.9542951583862305, -3.8748059272766113, -0.3983974754810333, -9.081782341003418, -1.874629259109497, -5.002874374389648, -10.837839126586914, -0.616291880607605, -0.31088000535964966, -6.075139045715332, -0.12764714658260345, -6.4374775886535645, -4.804961681365967, -0.27697327733039856, -2.9697253704071045, -10.071891784667969, -2.236919641494751, -0.740502119064331, -0.008475524373352528, -0.000388665939681232, -4.2155351638793945, -1.0294286012649536, -7.789151668548584, -0.2727944552898407, -12.800482749938965, -0.017428696155548096, -1.7114739418029785, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"feat_Unnamed: 0": 174, "text": "The following are multiple choice questions (with answers) about common sense.\n\nQuestion: Which isn't more likely the result of a big earthquake\nA. a big house\nB. a mountain\nAnswer:", "classes": [" A", " B"], "target": 0, "evaluation_predictions": [-3.326791524887085, -6.143470287322998, -3.609027862548828, -8.73436164855957, -2.671416997909546, -0.20364663004875183, -3.838352680206299, -4.09389066696167, -1.9205639362335205, -0.30885109305381775, -3.2686290740966797, -7.311863422393799, -3.802703857421875, -1.0864075422286987, -1.4276481866836548, -0.23308590054512024, -2.768258571624756, -1.9100477695465088, -5.9542951583862305, -3.8748059272766113, -0.3983974754810333, -9.081782341003418, -1.874629259109497, -5.002874374389648, -10.837839126586914, -0.616291880607605, -0.31088000535964966, -6.075139045715332, -0.12764714658260345, -6.4374775886535645, -4.804961681365967, -0.27697327733039856, -2.9697253704071045, -10.071891784667969, -2.236919641494751, -0.740502119064331, -0.008475524373352528, -0.000388665939681232, -4.2155351638793945, -1.0294286012649536, -7.789151668548584, -0.2727944552898407, -12.800482749938965, -0.017428696155548096, -1.020582675933838, 0.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0, -100.0]}
|
{"premise": "At least three commissioners spend time at home.", "hypothesis": "At least three commissioners spend a lot of time at home.", "label": 1}
|
{"premise": "Clients at the demonstration were all impressed by the system's performance. Smith was a client at the demonstration.", "hypothesis": "Smith was impressed by the system's performance.", "label": 0}
|
{"premise": "The PC-6082 is faster than some ITEL computer. The ITEL-ZX is an ITEL computer.", "hypothesis": "The PC-6082 is faster than the ITEL-ZX.", "label": 1}
|
{"premise": "Smith discovered new species for two years.", "hypothesis": "Smith discovered new species.", "label": 0}
|
{"premise": "Bill suggested to Frank's boss that they should go to the meeting together, and Carl to Alan's wife.", "hypothesis": "If it was suggested that Bill and Frank should go together, it was suggested that Carl and Alan should go together.", "label": 0}
|
{"premise": "ITEL won more orders than APCOM.", "hypothesis": "ITEL won some orders.", "label": 0}
|
{"premise": "Helen saw the chairman of the department answer the phone. The chairman of the department is a person.", "hypothesis": "There is someone whom Helen saw answer the phone.", "label": 0}
|
{"premise": "Before APCOM bought its present office building, it had been paying mortgage interest on the previous one for 8 years. Since APCOM bought its present office building it has been paying mortgage interest on it for more than 10 years.", "hypothesis": "APCOM has been paying mortgage interest for a total of 15 years or more.", "label": 0}
|
{"premise": "All mice are small animals. All elephants are large animals. Mickey is a large mouse. Dumbo is a small elephant.", "hypothesis": "Dumbo is larger than Mickey.", "label": 0}
|
{"premise": "John owns a red car. Bill owns a fast one.", "hypothesis": "Bill owns a fast red car.", "label": 0}
|
{"texts": ["FEDERAL DEFICIT WIDENED IN AUGUST\n\nThe federal government went another $27.8 billion deeper in the red in August, bringing the budget deficit to $203.4 billion with one month left to go in the government's fiscal year.", "\n\nThe latest projection of the Office of Management and Budget is for the 1985 deficit to reach a record $211.3 billion by the Sept. 30 end of the fiscal year.", "\n\nThe existing record is 1983's $195.4 billion.", "\n\nSpending on social programs through the Department of Health and Human Services is up 2 percent from the same October-August period in the last fiscal year, to $290.5 billion.", "\n\nPentagon spending, the second-largest category, is up 10.2 percent, to $223 billion.", "\n\nThe third largest single category of spending is now interest on the national debt, up 17.1 percent from the same 11-month period last year, to $165.7 billion.", "\n\nThe administration projects that in the 1986 fiscal year the interest on the $1.8 trillion national debt will be larger than the annual deficit. ", "Interest alone is expected to be $179.3 billion next year, compared to a deficit the White House says will be only $175.4 billion.", "\n\nWith the economy as slow as it is, however, many analysts say next year's projection for the total deficit is unrealistically low and that, if interest rates go higher, the interest cost could also be more.", "\n\nThe White House expects the government to end this fiscal year having spent $937.3 billion while taking in only $736 billion.", "\n\nIn August the government spent $83.6 billion and collected $55.8 billion.", "\n\nIndividual income taxes, at $296.3 billion for 11 months, are running 12 percent ahead of last year.", "\n\nCorporate taxes, at $50.4 billion, are also 12 percent ahead of the same period in fiscal 1984."], "meta": {"pile_set_name": "Pile-CC"}, "scores": [0.0006536383298225701, 0.000591988442465663, 0.000625553831923753, 0.000616451958194375, 0.0007416323642246425, 0.0007053541485220194, 0.0006674632895737886, 0.0006334978388622403, 0.0007807245128788054, 0.0007599153323099017, 0.000657664320897311, 0.0008397487108595669, 0.0006398948025889695], "avg_score": 0.0006856559910095081, "num_sents": 13}
|
{"texts": ["// RUN: %clang_cc1 -fsyntax-only -verify %s\n// RUN: %clang_cc1 -fsyntax-only -verify -std=c++98 %s\n// RUN: %clang_cc1 -fsyntax-only -verify -std=c++11 %s\n\n// PR3990\nnamespace N {\n struct Wibble {\n };\n\n typedef Wibble foo;\n\n int zeppelin; // expected-note{{declared here}}\n}\nusing namespace N;\n\nfoo::bar x; // expected-error{{no type named 'bar' in 'N::Wibble'}}\n\nvoid f() {\n foo::bar = 4; // expected-error{{no member named 'bar' in 'N::Wibble'}}\n}\n\nint f(foo::bar); // expected-error{{no type named 'bar' in 'N::Wibble'}}\n\nint f(doulbe); // expected-error{{did you mean 'double'?}}", "\n\nint fun(zapotron); // expected-error{{unknown type name 'zapotron'}}\nint var(zepelin); // expected-error{{did you mean 'zeppelin'?}}", "\n\ntemplate<typename T>\nstruct A {\n typedef T type;\n\n type f();\n\n type g();\n\n static int n;\n static type m;\n static int h(T::type, int); // expected-error{{missing 'typename'}}\n static int h(T::type x, char); // expected-error{{missing 'typename'}}\n};\n\ntemplate<typename T>\nA<T>::type g(T t) { return t; } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nA<T>::type A<T>::f() { return type(); } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid f(T::type) { } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid g(T::type x) { } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid f(T::type, int) { } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid f(T::type x, char) { } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid f(int, T::type) { } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid f(char, T::type x) { } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid f(int, T::type, int) { } // expected-error{{missing 'typename'}}\n\ntemplate<typename T>\nvoid f(int, T::type x, char) { } // expected-error{{missing 'typename'}}\n\nint *p;\n\n// FIXME: We should assume that 'undeclared' is a type, not a parameter name\n// here, and produce an 'unknown type name' diagnostic instead.", "\nint f1(undeclared, int); // expected-error{{requires a type specifier}}\n\nint f2(undeclared, 0); // expected-error{{undeclared identifier}}\n\nint f3(undeclared *p, int); // expected-error{{unknown type name 'undeclared'}}\n\nint f4(undeclared *p, 0); // expected-error{{undeclared identifier}}\n\nint *test(UnknownType *fool) { return 0; } // expected-error{{unknown type name 'UnknownType'}}\n\ntemplate<typename T> int A<T>::n(T::value); // ok\ntemplate<typename T>\nA<T>::type // expected-error{{missing 'typename'}}\nA<T>::m(T::value, 0); // ok\n\ntemplate<typename T> int A<T>::h(T::type, int) {} // expected-error{{missing 'typename'}}\ntemplate<typename T> int A<T>::h(T::type x, char) {} // expected-error{{missing 'typename'}}\n\ntemplate<typename T> int h(T::type, int); // expected-error{{missing 'typename'}}\ntemplate<typename T> int h(T::type x, char); // expected-error{{missing 'typename'}}\n\ntemplate<typename T> int junk1(T::junk);\n#if __cplusplus <= 201103L\n// expected-warning@-2 {{variable templates are a C++14 extension}}\n#endif\ntemplate<typename T> int junk2(T::junk) throw(); // expected-error{{missing 'typename'}}\ntemplate<typename T> int junk3(T::junk) = delete; // expected-error{{missing 'typename'}}\n#if __cplusplus <= 199711L\n//expected-warning@-2 {{deleted function definitions are a C++11 extension}}\n#endif\n\ntemplate<typename T> int junk4(T::junk j); // expected-error{{missing 'typename'}}\n\n// FIXME: We can tell this was intended to be a function because it does not\n// have a dependent nested name specifier.", "\ntemplate<typename T> int i(T::type, int());\n#if __cplusplus <= 201103L\n// expected-warning@-2 {{variable templates are a C++14 extension}}\n#endif\n\n\n// FIXME: We know which type specifier should have been specified here. ", "Provide\n// a fix-it to add 'typename A<T>::type'\ntemplate<typename T>\nA<T>::g() { } // expected-error{{requires a type specifier}}\n"], "meta": {"pile_set_name": "Github"}, "scores": [0.0020881849341094494, 0.0009246185072697699, 0.004780507180839777, 0.03983141854405403, 0.0008382233208976686, 0.0008779336931183934], "avg_score": 0.008223481030048182, "num_sents": 6}
|
{"texts": ["Q:\n\nStore random numbers in an array without adjacent repeats\n\nI want to store random numbers in an array without repeats with in the range 0-9. ", "It is fine if they repeat but not if they are right next to each other like: 1577984 is incorrect(because of the double 7s) but 151515 is theoretically okay.", "\nI've been working at this a day or two now and this is my original base code:\npublic static int[] createRandomNumber(int characters){\n int randomNumberArray[] = new int[characters];\n for(int i =0; i<characters; i++){\n randomNumberArray[i] = (int)(Math.random()*9);\n }\n return randomNumberArray;\n }\n\nAnd this is what I have now but it is doing the exact opposite of what I want it's generating all of the same number:\npublic static int[] createRandomNumber(int characters)\n{\n int randomNumberArray[] = new int[characters];\n int random = (int)(Math.random()*9);\n for(int i = 0; i <characters ; i++)\n {\n randomNumberArray[i] = random;\n if(randomNumberArray[i] == random)\n randomNumberArray[i] = (int)(Math.random()*9);\n else if(randomNumberArray[i] !", "= random)\n randomNumberArray[i] = random;\n }\n return randomNumberArray;\n}\n\nIs there a simple solution that I am just not seeing? ", "I've probably rewritten this method 50 times.", "\nJust so you know the parameter code is\nint characters = in.nextInt();\n\nso just the length of their randomly generated password that they want. ", "Also I know that Math.random is pseudo-random but this isn't for real or anything. ", "Plus there's more methods that generate random letters and such as well. (", "And yes I've done lots of research but no one seems to have my particular problem and believe me asking questions is a last resort for me.)", "\nThanks for any suggestions.", "\n\nA:\n\nIn the for loop, you are assigning random to the number array. ", " But then you are immediately checking if random is equal to that spot you just assigned, which is always true. ", " So it picks another random number, which also may or may not be equal to the previous digit.", "\nI've rewritten the for loop to have a while loop in its body, to keep checking versus the previous digit to see if there is a repeated digit.", "\nfor(int i = 0; i <characters ; i++)\n{\n randomNumberArray[i] = random;\n // If not first, check if it matches the previous digit\n while(i >= 1 && randomNumberArray[i - 1] == random)\n {\n random = (int)(Math.random()*9);\n randomNumberArray[i] = random;\n }\n}\n\n"], "meta": {"pile_set_name": "StackExchange"}, "scores": [0.0007818256272003055, 0.0006553742568939924, 0.0008679776801727712, 0.0008262423216365278, 0.0005741876666434109, 0.0006753358175046742, 0.0010212735505774617, 0.0005928967148065567, 0.0006371982162818313, 0.0005411740276031196, 0.0007272587972693145, 0.0007003709906712174, 0.000725437595974654, 0.0005979001871310174, 0.0008820561342872679], "avg_score": 0.0007204339723102749, "num_sents": 15}
|
{"texts": ["After 3PO and R2's destruction in IV, Uncle Owen's plot of land failed, causing domestic turmoil within the Skywalker household, Luke, wanting to rebel his guardians, runs away to Hoth, because he has never seen snow, but this caused his eventual demise"], "meta": {"pile_set_name": "Pile-CC"}, "scores": [0.0015479251742362976], "avg_score": 0.0015479251742362976, "num_sents": 1}
|
{"texts": ["After matching groups based on the number of missed questions, subjects were\nassigned to either the 12:00 pm control group of symphony music or 12:30 pm treatment\ngroup of rap music time slot to be administered another test the following Thursday\nafternoo\n\nAnother explanation for our findings could be participants were aware of the\ndistractions during the rap music test. ", "This conscious awareness of distractions attributed\nto their attention during the experiment, and caused them to pay greater attention to\n\nNotes Ch 9 and Ch 10\nexternal cost (negative externality)\na cost of an activity that falls on people other than those who pursue the activity\nexternal benefit (or positive externality)\na benefit of an activity received by people other than those who pursu"], "meta": {"pile_set_name": "Pile-CC"}, "scores": [0.0006283673574216664, 0.0008692374103702605], "avg_score": 0.0007488023838959634, "num_sents": 2}
|
{"texts": ["[HMGB1/SREBP-1 mediated IFN-gamma-induced lipid deposition in mouse mesangial cells].", "\nTo explore the possible mechanism of lipid deposition induced by interferon-gamma (IFN-gamma). ", "The mouse mesangial cells (MMC) were randomly divided into control group, stimulation group, stimulation + control vector group (sh-HMGB1) and stimulation+ specific sh-vector group (sh-SREBP-1). ", "RT-PCR was used to detect the expression of HMGB1, SREBP-1 and fatty acid synthetase (FAS) mRNA; the protein expression was determined by Western blot. ", "The Oil Red O staining revealed that the mouse mesangial cells showed significant lipid droplet in IFN-gamma group. ", "IFN-gamma up-regulated the expression of HMGB1, SREBP-1, FAS mRNA and protein time-dependently; Transfection of MMC with HMGB1 siRNA resulted in the suppression of SREBP-1, FAS protein levels induced by IFN-gamma, following with decrease of lipid deposition. ", "Stimulation with HMGB1 markedly induced expression of SREBP-1, FAS expression and peaked at 8 h, decreased at 12 h compared with that at 8 h. Sh-SREBP-1 decreased the lipid deposition induced by HMGB1 in MMC. ", "IFN-gamma might induce lipid deposition in mouse mesangial cells partly by up-regulating the expression of HMGB1/SREBP-1/FAS."], "meta": {"pile_set_name": "PubMed Abstracts"}, "scores": [0.0007458882173523307, 0.00060631288215518, 0.0006975835422053933, 0.0006628180854022503, 0.000915619486477226, 0.0007657901733182371, 0.000713361136149615, 0.0009061689488589764], "avg_score": 0.0007516928089899011, "num_sents": 8}
|
{"text": "TGCATTTTTTTCACATCTCTTTGCCACGGGGTGAAGGATAGGATGGTATCCCCCCAGGCGAAGGACATCTGTGGGGATGGTTAGGTCAGGTGATATCGGTTACGGCTGTT\t11"}
|
{"text": "TGCATTTTTTTCACATCTATGTTGCGTTAGAACGATATTGGAACACTTGTCAACAAGCTCATCTGAACTAATAGAGATGTATTCATAGGCTTCAGGTGGTTACGGCTGTT\t6"}
|
{"text": "TGCATTTTTTTCACATCTGTGAAGAATATCAGCTTTCAATCGTATTTTATGTGCAGTTCAGCGGTTGACACCCCACCGTGGCTGATAGCTTGCGTCAGGTTACGGCTGTT\t8"}
|
{"text": "TGCATTTTTTTCACATCAATCCGAGATATCTGTTGATAAACTTACCCACGGAATCTATGGACATCGGTGAGGACACGCGCGCGAACGGGGGTGCAGCGGTTACGGCTGTT\t9"}
|
{"text": "TGCATTTTTTTCACATCAAGTTATCTGGTGTACGTTTTCTCGTATACGATGCTGTGTTGTCTCCATGCGAATGAGTATGTCTGTTCTAGCTAGGTGGGGTTACGGCTGTT\t12"}
|
{"text": "TGCATTTTTTTCACATCCGACTACTGCATTTTGATCTTATAGATAACGCTACGGCAGCAGCCGAAAGGATAGCCCTGGTACAAACCTTGGTTACGGCTGTT\t11"}
|
{"text": "TGCATTTTTTTCACATCGTTAGTCCGGCAGAGGAGTAACTGCTACCTGGCCGTCTCATCCGTATGGAGTAGATGGGGAACGTGGTGCCAGGGCTGGCGGTTACGGCTGTT\t8.0873106075361"}
|
{"text": "TGCATTTTTTTCACATCGTCCTGGGTAGAGCTAGAGTACTGGGTGAGAATAGCTGGATATCCGGAGCGAGGCAGGCACGGCGCATGCGAGGAGGGCGGGTTACGGCTGTT\t13.3159096852411"}
|
{"text": "TGCATTTTTTTCACATCCGTTCTACAATTAGATTTAACATGTTTTTTGATTTGTTTTATTTTTGTGGAAACGTGGATTTATTGTTATTAGAAATGTGGGTTACGGCTGTT\t11"}
|
{"text": "TGCATTTTTTTCACATCTTGTGGTCTTCCGTGCTATCATACGTTTGTTTTTAAACCTATCGTCGATCTGGTTTAATTACCTTTACTCTTTGAATCGCGGTTACGGCTGTT\t9"}
|
{"text": "Jackie accompanied Rose.", "target": 0, "feat_idx": 216, "evaluation_predictions": [-3.7734375, 3.29296875]}
|
{"text": "They should pen the letter quickly.", "target": 0, "feat_idx": 763, "evaluation_predictions": [-3.919921875, 3.140625]}
|
{"text": "There is a seat available.", "target": 0, "feat_idx": 933, "evaluation_predictions": [-3.529296875, 3.064453125]}
|
{"text": "Mary thinks that she is smart.", "target": 0, "feat_idx": 461, "evaluation_predictions": [-3.880859375, 3.20703125]}
|
{"text": "We investigated the area for bombs.", "target": 0, "feat_idx": 153, "evaluation_predictions": [-2.9296875, 2.3125]}
|
{"text": "A wonderful opportunity presented itself to him yesterday.", "target": 0, "feat_idx": 213, "evaluation_predictions": [-3.6796875, 3.001953125]}
|
{"text": "I'm even sure we got these tickets!", "target": 0, "feat_idx": 325, "evaluation_predictions": [-3.2421875, 2.453125]}
|
{"text": "John believes it that Bill is here.", "target": 1, "feat_idx": 1010, "evaluation_predictions": [-3.357421875, 2.71875]}
|
{"text": "What additional categories and rules would be required to handle these verbs?", "target": 0, "feat_idx": 821, "evaluation_predictions": [-3.80859375, 3.005859375]}
|
{"text": "I remembered having kissed Mary.", "target": 0, "feat_idx": 48, "evaluation_predictions": [-3.6875, 3.025390625]}
|
{"text": "Knowledge\tB-KEY"}
|
{"text": "The\tO"}
|
{"text": "knowledge\tB-KEY"}
|
{"text": ",\tO"}
|
{"text": "its\tO"}
|
{"id": "4", "label": 10, "text": "olly tawel", "label_text": "audio"}
|
{"id": "13", "label": 8, "text": "amser cysgu olly", "label_text": "iot"}
|
{"dates": "2022-06-12T00:00:00.000-04:00", "no_arch": 2}
|
{"dates": "2022-06-13T00:00:00.000-04:00", "no_arch": 412}
|
{"dates": "2022-06-14T00:00:00.000-04:00", "no_arch": 187}
|
{"dates": "2022-06-15T00:00:00.000-04:00", "no_arch": 660}
|
{"dates": "2022-06-16T00:00:00.000-04:00", "no_arch": 470}
|
{"dates": "2022-06-17T00:00:00.000-04:00", "no_arch": 75}
|
{"dates": "2022-06-18T00:00:00.000-04:00", "no_arch": 111}
|
{"dates": "2022-06-19T00:00:00.000-04:00", "no_arch": 54}
|
{"dates": "2022-06-20T00:00:00.000-04:00", "no_arch": 45}
|
{"dates": "2022-06-21T00:00:00.000-04:00", "no_arch": 83}
|
{"1": 2, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "Been going to Dr. Goldberg for over 10 years. I think I was one of his 1st patients when he started at MHMG. He's been great over the years and is really all about the big picture. It is because of him, not my now former gyn Dr. Markoff, that I found out I have fibroids. He explores all options with you and is very patient and understanding. He doesn't judge and asks all the right questions. Very thorough and wants to be kept in the loop on every aspect of your medical health and your life."}
|
{"1": 1, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "I don't know what Dr. Goldberg was like before moving to Arizona, but let me tell you, STAY AWAY from this doctor and this office. I was going to Dr. Johnson before he left and Goldberg took over when Johnson left. He is not a caring doctor. He is only interested in the co-pay and having you come in for medication refills every month. He will not give refills and could less about patients's financial situations. Trying to get your 90 days mail away pharmacy prescriptions through this guy is a joke. And to make matters even worse, his office staff is incompetent. 90% of the time when you call the office, they'll put you through to a voice mail, that NO ONE ever answers or returns your call. Both my adult children and husband have decided to leave this practice after experiencing such frustration. The entire office has an attitude like they are doing you a favor. Give me a break! Stay away from this doc and the practice. You deserve better and they will not be there when you really need them. I have never felt compelled to write a bad review about anyone until I met this pathetic excuse for a doctor who is all about the money."}
|
{"1": 1, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "I'm writing this review to give you a heads up before you see this Doctor. The office staff and administration are very unprofessional. I left a message with multiple people regarding my bill, and no one ever called me back. I had to hound them to get an answer about my bill. \\n\\nSecond, and most important, make sure your insurance is going to cover Dr. Goldberg's visits and blood work. He recommended to me that I get a physical, and he knew I was a student because I told him. I got the physical done. Later, I found out my health insurance doesn't pay for preventative visits. I received an $800.00 bill for the blood work. I can't pay for my bill because I'm a student and don't have any cash flow at this current time. I can't believe the Doctor wouldn't give me a heads up to make sure my insurance would cover work that wasn't necessary and was strictly preventative. The office can't do anything to help me cover the bill. In addition, the office staff said the onus is on me to make sure my insurance covers visits. Frustrating situation!"}
|
{"1": 2, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "All the food is great here. But the best thing they have is their wings. Their wings are simply fantastic!! The \\\"Wet Cajun\\\" are by the best & most popular. I also like the seasoned salt wings. Wing Night is Monday & Wednesday night, $0.75 whole wings!\\n\\nThe dining area is nice. Very family friendly! The bar is very nice is well. This place is truly a Yinzer's dream!! \\\"Pittsburgh Dad\\\" would love this place n'at!!"}
|
{"1": 1, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "Wing sauce is like water. Pretty much a lot of butter and some hot sauce (franks red hot maybe). The whole wings are good size and crispy, but for $1 a wing the sauce could be better. The hot and extra hot are about the same flavor/heat. The fish sandwich is good and is a large portion, sides are decent."}
|
{"1": 1, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "Owning a driving range inside the city limits is like a license to print money. I don't think I ask much out of a driving range. Decent mats, clean balls and accessible hours. Hell you need even less people now with the advent of the machine that doles out the balls. This place has none of them. It is april and there are no grass tees yet. BTW they opened for the season this week although it has been golfing weather for a month. The mats look like the carpet at my 107 year old aunt Irene's house. Worn and thread bare. Let's talk about the hours. This place is equipped with lights yet they only sell buckets of balls until 730. It is still light out. Finally lets you have the pit to hit into. When I arrived I wasn't sure if this was a driving range or an excavation site for a mastodon or a strip mining operation. There is no grass on the range. Just mud. Makes it a good tool to figure out how far you actually are hitting the ball. Oh, they are cash only also.\\n\\nBottom line, this place sucks. The best hope is that the owner sells it to someone that actually wants to make money and service golfers in Pittsburgh."}
|
{"1": 1, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "This place is absolute garbage... Half of the tees are not available, including all the grass tees. It is cash only, and they sell the last bucket at 8, despite having lights. And if you finish even a minute after 8, don't plan on getting a drink. The vending machines are sold out (of course) and they sell drinks inside, but close the drawers at 8 on the dot. There are weeds grown all over the place. I noticed some sort of batting cage, but it looks like those are out of order as well. Someone should buy this place and turn it into what it should be."}
|
{"1": 2, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "Before I finally made it over to this range I heard the same thing from most people - it's just fine to go work on your swing. I had such a low expectation I was pleasantly surprised. \\n\\nIt's a fairly big range - if you are familiar with Scally's in Moon, it seems like it has almost as many tees, though its not nearly as nice a facility. \\n\\nThe guys in the pro shop were two of the friendlier guys I've come across at ranges or at courses. Yards were indeed marked and there are some targets to aim for, and even some hazards to aim away from. \\n\\nA big red flag to me was the extra charge ($3) to hit off the grass. I am no range expert, but this is the 4th one I've been to and the first I've seen of that sort of nickel and diming....\\n\\nPrice for the golf balls was reasonable and I do plan to be back every week until they close up in October for the season. Hopefully, since its for sale, it will reopen as a golf facility again."}
|
{"1": 2, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "I drove by yesterday to get a sneak peak. It re-opens on July 14th and I can't wait to take my kids. The new range looks amazing. The entire range appears to be turf, which may or many not help your game, but it looks really nice. The tee boxes look state of the art and the club house looks like something you'll see on a newer course. Can't wait to experience it!"}
|
{"1": 1, "Unfortunately, the frustration of being Dr. Goldberg's patient is a repeat of the experience I've had with so many other doctors in NYC -- good doctor, terrible staff. It seems that his staff simply never answers the phone. It usually takes 2 hours of repeated calling to get an answer. Who has time for that or wants to deal with it? I have run into this problem with many other doctors and I just don't get it. You have office workers, you have patients with medical needs, why isn't anyone answering the phone? It's incomprehensible and not work the aggravation. It's with regret that I feel that I have to give Dr. Goldberg 2 stars.": "After waiting for almost 30 minutes to trade in an old phone part of the buy back program, our customer service rep incorrectly processed the transaction. This led to us waiting another 30 minutes for him to correct it. Don't visit this store if you want pleasant or good service."}
|
{"question": "What phenomenon makes global winds blow northeast to southwest or the reverse in the northern hemisphere and northwest to southeast or the reverse in the southern hemisphere?", "distractor3": "tropical effect", "distractor1": "muon effect", "distractor2": "centrifugal effect", "correct_answer": "coriolis effect", "support": "Without Coriolis Effect the global winds would blow north to south or south to north. But Coriolis makes them blow northeast to southwest or the reverse in the Northern Hemisphere. The winds blow northwest to southeast or the reverse in the southern hemisphere."}
|
{"question": "What is the least dangerous radioactive decay?", "distractor3": "zeta decay", "distractor1": "beta decay", "distractor2": "gamma decay", "correct_answer": "alpha decay", "support": "All radioactive decay is dangerous to living things, but alpha decay is the least dangerous."}
|
{"question": "What kind of a reaction occurs when a substance reacts quickly with oxygen?", "distractor3": "nitrogen reaction", "distractor1": "invention reaction", "distractor2": "Fluid Reaction", "correct_answer": "combustion reaction", "support": "A combustion reaction occurs when a substance reacts quickly with oxygen (O 2 ). For example, in the Figure below , charcoal is combining with oxygen. Combustion is commonly called burning, and the substance that burns is usually referred to as fuel. The products of a complete combustion reaction include carbon dioxide (CO 2 ) and water vapor (H 2 O). The reaction typically gives off heat and light as well. The general equation for a complete combustion reaction is:."}
|
{"question": "Alpha emission is a type of what?", "distractor3": "light", "distractor1": "radiation", "distractor2": "heat", "correct_answer": "radioactivity", "support": "One type of radioactivity is alpha emission. What is an alpha particle? What happens to an alpha particle after it is emitted from an unstable nucleus?."}
|
{"question": "What is the stored food in a seed called?", "distractor3": "larval", "distractor1": "pollin", "distractor2": "membrane", "correct_answer": "endosperm", "support": "The stored food in a seed is called endosperm . It nourishes the embryo until it can start making food on its own."}
|
{"Question": "One of the biggest issues I'm facing is that I want to try out new hobbies or develop new skills in my free time but I can't commit to it.\n\nI either jump through hobbies or think about all the hobbies I could do, feel overwhelmed and end up not doing anything. \n\nWhat is the best advice you can give to people with ADHD to really hold on to a hobby and develop it without losing interest?", "Answer": "First, get treatment including considering ADHD medications. Second, commit to doing hobbies with others who share your interest or passion for that activity. We are more likely to do things when we make ourselves socially accountable to others for doing them. Third, engage in the hobby or pastime in a setting, room, or context devoid of competing interests that can pull you off task too quickly. Some people find that headphones, light music, etc. while working also help them maintain their on task focus. Break the hobby or task into smaller time units. Sometimes we can all lose interest in something if we stay at it too long. Just some thoughts here.", "content": "Q: One of the biggest issues I'm facing is that I want to try out new hobbies or develop new skills in my free time but I can't commit to it.\n\nI either jump through hobbies or think about all the hobbies I could do, feel overwhelmed and end up not doing anything. \n\nWhat is the best advice you can give to people with ADHD to really hold on to a hobby and develop it without losing interest?\n Ans: First, get treatment including considering ADHD medications. Second, commit to doing hobbies with others who share your interest or passion for that activity. We are more likely to do things when we make ourselves socially accountable to others for doing them. Third, engage in the hobby or pastime in a setting, room, or context devoid of competing interests that can pull you off task too quickly. Some people find that headphones, light music, etc. while working also help them maintain their on task focus. Break the hobby or task into smaller time units. Sometimes we can all lose interest in something if we stay at it too long. Just some thoughts here."}
|
{"Question": "Hi Dr. Barkley, thanks for doing this. \n\n\nWhat is your elevator pitch for what is going on in the brain due to ADHD?\n\n&#x200B;\n\nDo you have any tips for someone figuring out which medication regimen works?", "Answer": "In my opinion, ADHD arises from problems with brain maldevelopment especially in the prefrontal executive networks that can arise either from genetic factors (different gene variants and mutations for building and regulating such networks) or from acquired disruptions to the development of these networks and regions. While certain brain regions and gray matter or somewhat smaller during development, this may not be so much the case by adulthood. Nonetheless, we continue to see evidence of reduced connectivity of some regions with others that are part of these executive networks, of excess connectivity with non-executive regions, and especially with more variable functioning in these connections or networks that give rise to the ADHD symptoms and related executive function (EF) networks. So in short its a problem with connectivity and functioning of networks critical for self-regulation and EF, such a inhibition, self-awareness, time management, working memory, emotional self-regulation and motivation, and planning and problem solving. It helps to understand what is happening in ADHD by over simplifying brain activity as being where knowledge is acquired (back part of the brain) and where that knowledge is activated and applied in daily performance (frontal executive brain). ADHD partially disconnects the typical interaction of these brain regions, in a sense. So ADHD is far more a problem of doing what you know, not knowing what to do. Its a performance problem, not a knowledge problem. Adults with ADHD are not ignorant, but they struggle to apply all of what they know in key situations where such knowledge should have guided their actions and decision making, and it didn't.", "content": "Q: Hi Dr. Barkley, thanks for doing this. \n\n\nWhat is your elevator pitch for what is going on in the brain due to ADHD?\n\n&#x200B;\n\nDo you have any tips for someone figuring out which medication regimen works?\n Ans: In my opinion, ADHD arises from problems with brain maldevelopment especially in the prefrontal executive networks that can arise either from genetic factors (different gene variants and mutations for building and regulating such networks) or from acquired disruptions to the development of these networks and regions. While certain brain regions and gray matter or somewhat smaller during development, this may not be so much the case by adulthood. Nonetheless, we continue to see evidence of reduced connectivity of some regions with others that are part of these executive networks, of excess connectivity with non-executive regions, and especially with more variable functioning in these connections or networks that give rise to the ADHD symptoms and related executive function (EF) networks. So in short its a problem with connectivity and functioning of networks critical for self-regulation and EF, such a inhibition, self-awareness, time management, working memory, emotional self-regulation and motivation, and planning and problem solving. It helps to understand what is happening in ADHD by over simplifying brain activity as being where knowledge is acquired (back part of the brain) and where that knowledge is activated and applied in daily performance (frontal executive brain). ADHD partially disconnects the typical interaction of these brain regions, in a sense. So ADHD is far more a problem of doing what you know, not knowing what to do. Its a performance problem, not a knowledge problem. Adults with ADHD are not ignorant, but they struggle to apply all of what they know in key situations where such knowledge should have guided their actions and decision making, and it didn't."}
|
{"Question": "Hello Dr. Barkley, thank you so much for doing this \n\nWhy is it that many people with adhd feel like they don't fit in with their peers, or just society as a whole? \n\nAlso, are comorbidities more of a nature or nurture type issue? For example, would a kid with adhd already have anxiety or ocd along with it, or would the anxiety develop over time because of the adhd?", "Answer": "I think the answer to this is above - ADHD is really SRDD (EFDD). Social interactions, reciprocity, cooperation, and even intimacy all require appropriate degrees of self-regulation from an individual. When such self-regulation is jeopardized by the disorder, it greatly impacts social acceptance and functioning because it raises problems with making and keeping promises, reciprocating with others (sharing), joining into cooperative team or group activities to accomplish some common goal, repaying favors, managing debts, accomplishing daily social responsibilities -- all are at risk from the disorder. Others can detect these differences in adults with ADHD within minutes of getting to know them. Of all the EF difficulties, it is the impulsive emotional and poor self regulation of emotion that is so harmful to social relationships. Others can tolerate one's distractibility, activity, fizzy personality so to speak, but not someone's quickness to be impatient, frustrated, hostile, angry or even reactively verbally and physically aggressive. That can easily lead to social rejection, being fired from your job, road rage and related citations and license suspensions, intimate partner distress and even violence, etc. So it is the dysregulated emotion more than other symptoms that takes its toll on social relations when ADHD is unmanaged.", "content": "Q: Hello Dr. Barkley, thank you so much for doing this \n\nWhy is it that many people with adhd feel like they don't fit in with their peers, or just society as a whole? \n\nAlso, are comorbidities more of a nature or nurture type issue? For example, would a kid with adhd already have anxiety or ocd along with it, or would the anxiety develop over time because of the adhd?\n Ans: I think the answer to this is above - ADHD is really SRDD (EFDD). Social interactions, reciprocity, cooperation, and even intimacy all require appropriate degrees of self-regulation from an individual. When such self-regulation is jeopardized by the disorder, it greatly impacts social acceptance and functioning because it raises problems with making and keeping promises, reciprocating with others (sharing), joining into cooperative team or group activities to accomplish some common goal, repaying favors, managing debts, accomplishing daily social responsibilities -- all are at risk from the disorder. Others can detect these differences in adults with ADHD within minutes of getting to know them. Of all the EF difficulties, it is the impulsive emotional and poor self regulation of emotion that is so harmful to social relationships. Others can tolerate one's distractibility, activity, fizzy personality so to speak, but not someone's quickness to be impatient, frustrated, hostile, angry or even reactively verbally and physically aggressive. That can easily lead to social rejection, being fired from your job, road rage and related citations and license suspensions, intimate partner distress and even violence, etc. So it is the dysregulated emotion more than other symptoms that takes its toll on social relations when ADHD is unmanaged."}
|
{"Question": "Dear Dr. Barkley,\nThank you so much for doing this again. \n\nFor someone who is relatively new to the topic of ADHD there seems to be a proverbial mountain of information out there. Is there a book/podcast/other medium out there that you'd recommend as a guideline for adult ADHD? \n\nAlso thank you moderators. You are sincerely awesome.", "Answer": "i have many lectures I have given over the years at conferences that got posted to YouTube and viewers tell me those videos changed their life by informing them as to the real nature of ADHD. So start there. There are also now lots of podcasts so I can't name them all but ADHD Talk Radio has some and I am sure you could find others. My new book noted above will also be very up to date and is formatted to be more easily read by adults with ADHD who struggle with lengthy text and comprehension of such material. Other good books out there are by Tom Brown Ari Tuckman, Peg Dawson, Ned Hallowell, Stephanie Sarkis, Craig Surman, J. Russell Ramsay, among others so search for their books. Also, check out the [www.chadd.org](https://www.chadd.org) website which is our US ADHD foundation. In Canada, try [www.caddra.ca](https://www.caddra.ca). Lots of information there on ADHD, not to mention [www.add.org](https://www.add.org), a smaller nonprofit organization focusing more on adult ADHD. For professionals, the [www.apsard.org](https://www.apsard.org) website is very good as its the American Professional Society for ADHD and Related Disoders. Check out the Fact Sheets on my website as well. And the website for the European Network for Adult ADHD.", "content": "Q: Dear Dr. Barkley,\nThank you so much for doing this again. \n\nFor someone who is relatively new to the topic of ADHD there seems to be a proverbial mountain of information out there. Is there a book/podcast/other medium out there that you'd recommend as a guideline for adult ADHD? \n\nAlso thank you moderators. You are sincerely awesome.\n Ans: i have many lectures I have given over the years at conferences that got posted to YouTube and viewers tell me those videos changed their life by informing them as to the real nature of ADHD. So start there. There are also now lots of podcasts so I can't name them all but ADHD Talk Radio has some and I am sure you could find others. My new book noted above will also be very up to date and is formatted to be more easily read by adults with ADHD who struggle with lengthy text and comprehension of such material. Other good books out there are by Tom Brown Ari Tuckman, Peg Dawson, Ned Hallowell, Stephanie Sarkis, Craig Surman, J. Russell Ramsay, among others so search for their books. Also, check out the [www.chadd.org](https://www.chadd.org) website which is our US ADHD foundation. In Canada, try [www.caddra.ca](https://www.caddra.ca). Lots of information there on ADHD, not to mention [www.add.org](https://www.add.org), a smaller nonprofit organization focusing more on adult ADHD. For professionals, the [www.apsard.org](https://www.apsard.org) website is very good as its the American Professional Society for ADHD and Related Disoders. Check out the Fact Sheets on my website as well. And the website for the European Network for Adult ADHD."}
|
{"Question": "Given how things like trauma can alter brain structure and how brains can restructure themselves after damage, is it plausible that ADHD could be due to environmental factors or even be eliminated in a patient purely due to neuroplasticity?\n\nDisclaimer: I say this out of scientific interest, not to suggest that ADHD isn't a real neurological condition or that it can be cured.", "Answer": "it is most unlikely. Present research, which is incredibly abundant, shows that variation in humans in their ADHD symptoms is about 70-80% influenced by genetic variation (differences in genes that build and operate the brain). The remainder is the result of non shared environmental factors, which are things that impacted just that person in their family. This would include pregnancy complications, maternal infections, material use of alcohol when pregnant, premature delivery warranting the infant to go to an NICU, etc. After birth, things like lead poisoning, traumatic brain injuries, and any other factor that adversely impacts brain development in the EF prefrontal brain can lead to ADHD. So its pretty much all biology (neurology and genetics). Rearing environment has not been found to be a contributor to ADHD. That said, people with ADHD are more likely to experience traumatic events, including physical, sexual, and emotional trauma, as a consequence of their lack of foresight, risk taking, and other behaviors as well as the peers they select to associated with. Such things can also arise within families not only from the behavioral difficulties and challenges posed by such children to caregivers, but also by the fact that 25-35% or more of parents have ADHD which can interfere with their own parenting and increase the likelihood for such traumas and victimization. Its possible that some kinds of trauma feedback to worsen the ADHD symptoms (traumatic brain injuries for instance) but less clear that emotional trauma can do this. Regardless, because of their problems with emotional self-regulation, people with ADHD are more prone to develop PTSD if traumatized and find it more difficult to treat such PTSD. So there is some interaction here between ADHD and traumatizing environments but its not a simple or single causal direction of emotional trauma causing ADHD.", "content": "Q: Given how things like trauma can alter brain structure and how brains can restructure themselves after damage, is it plausible that ADHD could be due to environmental factors or even be eliminated in a patient purely due to neuroplasticity?\n\nDisclaimer: I say this out of scientific interest, not to suggest that ADHD isn't a real neurological condition or that it can be cured.\n Ans: it is most unlikely. Present research, which is incredibly abundant, shows that variation in humans in their ADHD symptoms is about 70-80% influenced by genetic variation (differences in genes that build and operate the brain). The remainder is the result of non shared environmental factors, which are things that impacted just that person in their family. This would include pregnancy complications, maternal infections, material use of alcohol when pregnant, premature delivery warranting the infant to go to an NICU, etc. After birth, things like lead poisoning, traumatic brain injuries, and any other factor that adversely impacts brain development in the EF prefrontal brain can lead to ADHD. So its pretty much all biology (neurology and genetics). Rearing environment has not been found to be a contributor to ADHD. That said, people with ADHD are more likely to experience traumatic events, including physical, sexual, and emotional trauma, as a consequence of their lack of foresight, risk taking, and other behaviors as well as the peers they select to associated with. Such things can also arise within families not only from the behavioral difficulties and challenges posed by such children to caregivers, but also by the fact that 25-35% or more of parents have ADHD which can interfere with their own parenting and increase the likelihood for such traumas and victimization. Its possible that some kinds of trauma feedback to worsen the ADHD symptoms (traumatic brain injuries for instance) but less clear that emotional trauma can do this. Regardless, because of their problems with emotional self-regulation, people with ADHD are more prone to develop PTSD if traumatized and find it more difficult to treat such PTSD. So there is some interaction here between ADHD and traumatizing environments but its not a simple or single causal direction of emotional trauma causing ADHD."}
|
{"Question": "Hello Dr. Barkley,\n\nThank you very much for answering the questions and all the research you have done on the subject of people with adhd and treatment methods. \n\nMostly something I've wondered, I don't have a lot of questions on adhd itself right now, they slip my mind easily, but a bit more of a personal one.\n\nWhat is the reason you have researched adhd as much as you have? what interests you about it?", "Answer": "Thank you! I got into this field in 1972 when I attended UNC and was majoring in psychology and minoring in biology. I wanted to go to graduate school but need to have done extra things besides getting good grades. So I wandered their medical school offering to volunteer 15+ hours per week to anyone who needed a research assistant. By chance, a faculty member had just gotten a grant to study hyperactive (ADHD) children and the role of behavior modification and medication in treating them. I became his assistant, then his honors student, and went on to graduate school where I did all my research on ADHD and have never stopped since. The condition fascinated me as I wanted to understand why these children had such poor behavioral (self) control. As I got older, I also realized that understanding ADHD could teach us a great deal about how people generally develop self regulation, what it is, how the executive functions develop so as to allow self control. And I wrote two books just on my theory of all that (ADHD and the Nature of Self Control, 1997, and The Executive Functions, in 2012). Studying ADHD is like holding a mirror up to ourselves - we can all learn a lot from it about self regulation and how to improve it. As some of you know, ADHD was also in my family and so studying it helped me personally to understand and even deal with and try eo help some family members my fraternal twin brother in particular. Regrettably, his life of impulsivity, risk taking, risky driving, and use of alcohol resulted in his death in a car accident when he was 56. And a year later his son with ADHD committed suicide impulsively after an argument with a girlfriend. So understanding ADHD is also personal for me.", "content": "Q: Hello Dr. Barkley,\n\nThank you very much for answering the questions and all the research you have done on the subject of people with adhd and treatment methods. \n\nMostly something I've wondered, I don't have a lot of questions on adhd itself right now, they slip my mind easily, but a bit more of a personal one.\n\nWhat is the reason you have researched adhd as much as you have? what interests you about it?\n Ans: Thank you! I got into this field in 1972 when I attended UNC and was majoring in psychology and minoring in biology. I wanted to go to graduate school but need to have done extra things besides getting good grades. So I wandered their medical school offering to volunteer 15+ hours per week to anyone who needed a research assistant. By chance, a faculty member had just gotten a grant to study hyperactive (ADHD) children and the role of behavior modification and medication in treating them. I became his assistant, then his honors student, and went on to graduate school where I did all my research on ADHD and have never stopped since. The condition fascinated me as I wanted to understand why these children had such poor behavioral (self) control. As I got older, I also realized that understanding ADHD could teach us a great deal about how people generally develop self regulation, what it is, how the executive functions develop so as to allow self control. And I wrote two books just on my theory of all that (ADHD and the Nature of Self Control, 1997, and The Executive Functions, in 2012). Studying ADHD is like holding a mirror up to ourselves - we can all learn a lot from it about self regulation and how to improve it. As some of you know, ADHD was also in my family and so studying it helped me personally to understand and even deal with and try eo help some family members my fraternal twin brother in particular. Regrettably, his life of impulsivity, risk taking, risky driving, and use of alcohol resulted in his death in a car accident when he was 56. And a year later his son with ADHD committed suicide impulsively after an argument with a girlfriend. So understanding ADHD is also personal for me."}
|
{"Question": "Hi Dr. Barkley - it seems like either my symptoms get worse or my meds work less as I approach that time of the month, i.e. getting my period. What is the cause or correlation between period symptoms and ADHD? Is there anything women can do to reduce these effects?", "Answer": "Yes, there is some interesting recent research on this long neglected topic in women with ADHD and an article will be out in my newsletter in August by Ellen Littman and colleagues summarizing what we know about this, which isn't much but squares with your experience. My newsletter is The ADHD Report. In short, ADHD symptoms in women are affected by the balance their estrogen/progesterone hormones. As they fluctuate during the month and even across life, ADHD symptoms can get markedly worse or better. For instance, a few studies suggest that ADHD in girls may start in childhood, but can also appear at the start of menses in adolescence, and can be worsened by entering peri menopause as well. Clinicians often find helpful to add extra meds or other treatments around the monthly menses and even at menopause to try to cope with the exacerbation of symptoms and emotional dysregulation, not to mention working memory. some clinicians, for instance, add an antidepressant or even mood stabilizer to the usual ADHD medications at these times to help women deal with these fluctuating symptoms. Periodically, check Google Scholar to see what new research might be appearing on this but its clearly an issue worth more research to understand and treat it.", "content": "Q: Hi Dr. Barkley - it seems like either my symptoms get worse or my meds work less as I approach that time of the month, i.e. getting my period. What is the cause or correlation between period symptoms and ADHD? Is there anything women can do to reduce these effects?\n Ans: Yes, there is some interesting recent research on this long neglected topic in women with ADHD and an article will be out in my newsletter in August by Ellen Littman and colleagues summarizing what we know about this, which isn't much but squares with your experience. My newsletter is The ADHD Report. In short, ADHD symptoms in women are affected by the balance their estrogen/progesterone hormones. As they fluctuate during the month and even across life, ADHD symptoms can get markedly worse or better. For instance, a few studies suggest that ADHD in girls may start in childhood, but can also appear at the start of menses in adolescence, and can be worsened by entering peri menopause as well. Clinicians often find helpful to add extra meds or other treatments around the monthly menses and even at menopause to try to cope with the exacerbation of symptoms and emotional dysregulation, not to mention working memory. some clinicians, for instance, add an antidepressant or even mood stabilizer to the usual ADHD medications at these times to help women deal with these fluctuating symptoms. Periodically, check Google Scholar to see what new research might be appearing on this but its clearly an issue worth more research to understand and treat it."}
|
{"text": "i used to be able to hang around talk with the cashier when i was putting away my money now i feel rushed and stressed if i take a second to fumble with the coins and put them in my purse", "target": 0, "evaluation_predictions": [-1.7119140625, -2.36328125, -2.0390625, 5.84765625, 0.9951171875, -1.873046875]}
|
{"text": "i feel really bothered about the lack of time i get to find inspiration", "target": 0, "evaluation_predictions": [-1.3701171875, -2.58203125, -1.7041015625, 6.3828125, -0.1983642578125, -1.5791015625]}
|
{"text": "i feel much more energized than on a gloomy rainy autumn day", "target": 4, "evaluation_predictions": [7.00390625, -1.3681640625, -1.4755859375, -0.78955078125, -1.193359375, -1.841796875]}
|
{"text": "i never feel depressed because my cancer and i have learnt to live and sleep with each other", "target": 4, "evaluation_predictions": [6.75390625, -1.177734375, -1.736328125, 0.1553955078125, -1.8603515625, -1.87109375]}
|
{"text": "i feel like i have nailed the marriage and the house parts of my life and i am happy and content as i can possibly be in those aspects", "target": 2, "evaluation_predictions": [-1.201171875, 7.12109375, -0.7646484375, -1.8447265625, -2.1328125, -1.4248046875]}
|
{"text": "i was feeling emotional crying for no apparent reason but at the time it feels like the world is ending", "target": 4, "evaluation_predictions": [6.46875, -1.8427734375, -0.97900390625, -1.16015625, -0.48681640625, -2.021484375]}
|
{"text": "i have a feeling i kinda lost my best friend", "target": 4, "evaluation_predictions": [6.79296875, -1.05078125, -1.3388671875, -1.4775390625, -0.927734375, -1.208984375]}
|
{"text": "i never feel shy to call or send a billion text messages to and i wont be bugging her", "target": 1, "evaluation_predictions": [-0.95849609375, -2.0234375, -0.998046875, -1.4140625, 6.08984375, -0.460205078125]}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.