text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
the preferred embodiments of the present invention will be described with reference to examples . it will be understood that the present invention will not be limited by the examples below ; modifications are possible without departing from the scope of the present invention . nickel , cobalt , and aluminum were co - precipitated to have nickel - cobalt - aluminum hydroxide . lithium hydroxide was added to the nickel - cobalt - aluminum hydroxide , followed by baking at 700 ° c ., thus obtaining lithium nickel composite oxide containing cobalt and aluminum ( lini 0 . 8 co 0 . 15 al 0 . 05 o 2 ). the element contents of the lithium nickel composite oxide were analyzed by icp - aes ( inductive coupling plasma emission analysis ). the lithium nickel composite oxide and water were mixed together , and this mixture was kneaded in water . then , the water was removed and the lithium nickel composite oxide was washed with water . the washed lithium nickel composite oxide was then dried , thus obtaining the positive electrode active material . the positive electrode active material was sampled into a vial bottle . then , 5 ml of hydrochloride ( hcl ) solution of 0 . 05 m ( mole / liter ) was injected into the bottle and mixed with the positive electrode active material . after the mixture was settled for some period of time , resulting gas was sampled by 0 . 1 ml and measured by gas chromatography . the amount of lithium carbonate was 0 . 1 mass % relative to the positive electrode active material . this reaction can be expressed as follows : ninety mass parts of the positive electrode active material , 5 mass parts of carbon powder as a conducting agent , 5 mass parts of polyvinylidene fluoride ( pvdf ) as a binding agent , and n - methyl - 2 - pyrrolidone ( nmp ) were mixed together , thus preparing a positive electrode active material slurry . this positive electrode active material slurry was applied to both surfaces of a positive electrode current collector ( 20 μm thick ) made of aluminum by doctor blading , followed by drying to form a positive electrode active material layer on the positive electrode current collector . then , the resulting product was rolled with a compressive roller , thus preparing a positive electrode . al 2 o 3 , lithium carbonate , and polytetrafluoroethylene ( ptfe ) as a binding agent were mixed in water in which carboxymethyl cellulose ( cmc ) as a thickening agent was dissolved , thus obtaining an inorganic oxide slurry . the mass ratio of al 2 o 3 , lithium carbonate , cmc , and ptfe was 85 : 10 : 3 : 2 . this slurry was applied to the surface of the positive electrode active material layer and dried , and on the positive electrode active material layer , a porous layer of 2 μm thick was formed . an area of the positive electrode with the porous layer was removed to measure the amount of lithium carbonate in the above - described manner . the lithium carbonate content in the porous layer was 0 . 5 mass % relative to the positive electrode active material . ninety - five mass parts of a negative electrode active material made of natural graphite , 5 mass parts of polyvinylidene fluoride ( pvdf ) as a binding agent , and n - methyl - pyrrolidone were mixed together , thus preparing a negative electrode active material slurry . the negative electrode active material slurry was applied to both surfaces of a negative electrode current collector ( 18 μm thick ) made of copper , followed by drying . then , the dried electrode plate was rolled , thus preparing a negative electrode . the potential of graphite is 0 . 1 v on the basis of lithium . the amounts of the active materials filled in the positive electrode and the negative electrode were adjusted such that the charge capacity ratio ( negative electrode charge capacity / positive electrode charge capacity ) would be 1 . 1 at the potential of the positive electrode active material ( 4 . 3v on the basis of lithium in this example , while the voltage being 4 . 2 v ), which served as a design reference . the positive electrode and the negative electrode were wound with a separator made of a polypropylene porous film therebetween , thus preparing a flat electrode assembly . ethylene carbonate and diethyl carbonate were mixed together at a volume ratio of 3 : 7 ( 25 ° c . ), and then lipf 6 as electrolytic salt was dissolved therein at a rate of 1 . 0 ( mol / liter ), thus obtaining a non - aqueous electrolyte . a sheet - formed laminate material was prepared having a five - layer structure composed of resin layer ( polypropylene )/ adhesive layer / aluminum alloy layer / adhesive layer / resin layer ( polypropylene ). then , the laminate material was folded to make a bottom portion , thus forming a cup - formed electrode assembly housing space . in a glove box with an argon atmosphere , the flat electrode assembly and the non - aqueous electrolyte were inserted into the housing space . then , the outer casing was depressurized to cause the separator to be impregnated with the non - aqueous electrolyte , and the opening of the outer casing was sealed . thus , a non - aqueous electrolyte secondary cell according to example 1 with a height of 62 mm , a width of 35 mm , and a thickness of 3 . 6 mm was prepared . a non - aqueous electrolyte secondary cell according to comparative example 1 was prepared in the same manner as in example 1 except that no porous layer was formed . a non - aqueous electrolyte secondary cell according to comparative example 2 was prepared in the same manner as in comparative example 1 except that the washing step was controlled to make the amount of lithium carbonate 0 . 2 mass % on the surface of the positive electrode active material . a non - aqueous electrolyte secondary cell according to comparative example 3 was prepared in the same manner as in comparative example 1 except that no washing step was carried out and the amount of lithium carbonate on the surface of the positive electrode active material was made 0 . 5 mass %. a non - aqueous electrolyte secondary cell according to comparative example 4 was prepared in the same manner as in comparative example 3 except that a change was made in the lithium content during preparation of the lithium nickel composite oxide to make the amount of lithium carbonate 0 . 6 mass % on the surface of the positive electrode active material . a non - aqueous electrolyte secondary cell according to comparative example 5 was prepared in the same manner as in comparative example 3 except that a change was made in the amount of the lithium source during preparation of the lithium nickel composite oxide to make the amount of lithium carbonate 0 . 8 mass % on the surface of the positive electrode active material . a non - aqueous electrolyte secondary cell according to comparative example 6 was prepared in the same manner as in example 1 except that no lithium carbonate was contained in the porous layer . each of the cells was charged at a constant current of 650 ma to a voltage of 4 . 2 v , then at a constant voltage of 4 . 2 v to a current of 32 ma ( all at 25 ° c .). each of the charged cells was preserved in a thermostatic chamber of 85 ° c . for 3 hours to measure the thickness before and after preservation . the swelling rate of each cell was calculated from the following formula : each of the cells was repeatedly charged and discharged under the following conditions to calculate the cycle characteristic from the following formula : charging : in a room of 25 ° c ., each of the cells was charged at a constant current of 650 ma to a voltage of 4 . 2 v , then at a constant voltage of 4 . 2 v to a current of 32 ma . discharging : in a room of 25 ° c ., each of the cells was charged at a constant current of 650 ma to a voltage of 2 . 75 v . table 1 shows that as the amount of lithium carbonate on the surface of the positive electrode active material increases , the swelling rate tends to increase and the cycle characteristic tends to improve ( see comparative examples 1 to 5 ). a possible explanation for this is as follows . the larger the amount of lithium carbonate on the surface of the positive electrode active material , the more of the lithium carbonate is decomposed to generate carbon dioxide gas during the high - temperature preservation , thereby swelling the cell on a large scale . meanwhile , the charge and discharge reactions gradually decompose the lithium carbonate to generate carbon dioxide gas . this carbon dioxide gas moves to the negative electrode to react therewith to form a stable covering film on the surface of the negative electrode . this improves the cycle characteristic . table 1 also shows that comparative example 6 , whose porous layer contains no lithium carbonate on the surface of the positive electrode , has a cycle characteristic of 74 %, which is superior to 50 % for comparative example 1 , which contains lithium carbonate at the same mass . a possible explanation for this is as follows . since the porous layer keeps therein the non - aqueous electrolyte in a preferable manner to supply the non - aqueous electrolyte to the positive electrode active material , the amount of the non - aqueous electrolyte around the positive electrode active material increases . thus , comparative example 6 has higher cycle characteristic than that of comparative example 1 . table 1 also shows that example 1 , which contains lithium carbonate in the porous layer , has a cycle characteristic of 82 %, which is superior to 74 % for comparative example 6 , which contains no lithium carbonate in the porous layer . a possible explanation for this is as follows . in example 1 , the charge and discharge reactions decompose the lithium carbonate contained in the porous layer to generate carbon dioxide gas . this makes the amount of carbon dioxide gas larger than in comparative example 6 . this makes denser the covering film of example 1 , which is formed by the reaction between the negative electrode and the carbon dioxide gas . thus , the cycle characteristic improves in example 1 over comparative example 6 . a non - aqueous electrolyte secondary cell according to example 2 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 0 . 3 mass % relative to the positive electrode active material . a non - aqueous electrolyte secondary cell according to example 3 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 5 . 0 mass % relative to the positive electrode active material . a non - aqueous electrolyte secondary cell according to example 4 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 10 . 0 mass % relative to the positive electrode active material . a non - aqueous electrolyte secondary cell according to example 5 was prepared in the same manner as in example 1 except that the amount of lithium carbonate contained in the porous layer was 20 . 0 mass % relative to the positive electrode active material . the cells according to examples 1 to 5 and comparative example 6 were subjected to the above - described high - temperature preservation test and cycle characteristic test . the results are shown in table 2 . table 2 shows that as the amount of lithium carbonate in the porous layer increases , the swelling rate tends to increase ( see comparative example 6 , examples 1 to 5 ). a possible explanation for this is as follows . the larger the amount of lithium carbonate contained in the porous layer , the more of the lithium carbonate is decomposed to generate carbon dioxide gas during the high - temperature preservation , thereby swelling the cell on a large scale . table 2 also shows that when the amount of lithium carbonate contained in the porous layer is 5 . 0 mass % or less relative to the positive electrode active material , as the amount of lithium carbonate contained in the porous layer increases , the cycle characteristic tends to improve ( see comparative example 6 , examples 1 to 3 ). table 2 also shows that when the amount of lithium carbonate contained in the porous layer exceeds 5 . 0 mass % relative to the positive electrode active material , the cycle characteristic tends to be degraded ( see examples 4 and 5 ). a possible explanation for these is as follows . the charge and discharge reactions decompose the lithium carbonate to generate carbon dioxide gas . this carbon dioxide gas moves to the negative electrode to react therewith to form a stable covering film on the surface of the negative electrode . this improves the cycle characteristic . however , too large a content of the lithium carbonate generates a large amount of carbon dioxide gas , which is detained between the positive and negative electrodes . this is detrimental to the opposing relation between positive and negative electrodes , resulting in degraded cycle characteristic . in view of this , the amount of lithium carbonate contained in the porous layer is preferably 0 . 5 to 10 mass % relative to the positive electrode active material , more preferably 0 . 5 to 5 . 0 mass %. a non - aqueous electrolyte secondary cell according to example 6 was prepared in the same manner as in example 1 except that mgo was used instead of al 2 o 3 as the inorganic oxide used for the porous layer . a non - aqueous electrolyte secondary cell according to example 7 was prepared in the same manner as in example 1 except that zro 2 was used instead of al 2 o 3 as the inorganic oxide used for the porous layer . a non - aqueous electrolyte secondary cell according to example 8 was prepared in the same manner as in example 1 except that tio 2 was used instead of al 2 o 3 as the inorganic oxide used for the porous layer . the cells according to examples 1 , 6 to 8 were subjected to the above - described high - temperature preservation test and cycle characteristic test . the results are shown in table 3 . as has been described above , the present invention realizes a non - aqueous electrolyte secondary cell that has high capacity and excellent cycle characteristic . thus , the industrial applicability of the present invention is considerable .
| 7 |
the system shown in fig1 provides a strictly controlled bi - directional data connection between a user alfa who can be at any one of several remote terminals and an authorisation centre 1 which is typically a computer with data storing and processing capacity . the authorisation centre 1 keeps a database of a predetermined number of basic graphical symbol selection and / or modification algorithms . a basic graphical symbol selection algorithm is an algorithm , which generates one or more graphical symbol ( s ) as output from a multiplicity of graphical symbols as input . a basic graphical symbol modification algorithm is an algorithm , which generates a graphical symbol as output from another graphical symbol ( s ) as input . a complex graphical symbol set generating algorithm is a multiplicity of simple graphical symbol selection and modification algorithms to be performed one by one according to the result of the previous operation . a graphical symbol may be the visual representation of any object , person , form , shape , idea , concept — including numbers , letters and signs — or anything else what may be visually represented . in addition to the basic visual appearance a graphical symbol can have different further features . such further feature of a graphical symbol may comprise any property by the changing of which two graphical symbols of the same form may be distinguished ( such as size , colour , pattern , direction , movement , attached voice or sound , etc .). the authorisation centre 1 keeps a further database of user identification codes or in short user id &# 39 ; s which can be in combination numbers , symbols , character chains , etc . within the authorisation centre 1 each user is uniquely identified by an associated id . linked to the user id database the authorisation centre 1 also comprises a further database storing symbol set generating algorithms . in the database each user id is associated with a predetermined graphical symbol set generating algorithm . the graphical symbol set generating algorithms are , however , not unique and may be assigned to different users . the assignment of user id - s and symbol set generating algorithms may occur by a system administrator that can either be a natural person or an automated assignment system . the user may interactively participate in creating his graphical symbol set generating algorithm . the users may change their graphical symbol selection algorithms any time they wish to do so . the authorisation centre 1 stores furthermore an algorithm capable of generating a cryptographic key of a certain length from any set of graphical symbols that have the same or smaller length . it is preferable but not always required that different multi - digit numbers represent the different graphical symbols . in such a case the cryptographic key generating algorithm may be any kind of message digest function . message digest functions are known in the art of cryptography , and they are capable of generating a unique cryptographic key of predetermined length from every multi digit number of much longer length so that one cannot retrieve the multi digit number from the generated key . besides the cryptographic key generating algorithm the authorisation centre 1 can also store a cryptographic algorithm generating process used to generate the unique encryption algorithms which are further used for encrypting and decrypting messages sent or received by a remote terminal . such cryptographic algorithms generated can be variables of different symmetric key algorithms ( ecb , cbc , cfb , ofb ). as a further means of security , the authorisation centre may also store a higher level encryption algorithm , which may be a symmetric key algorithm or a combined public key and symmetric key algorithm . typical representations of such high level symmetric key algorithms are the conventionally known des and triple des algorithms . a typical example for the combination of a public key and symmetric key method is encrypting the original message with a symmetric key using des algorithm at the remote terminal . when this step is completed , the symmetric cryptographic key is encrypted by using the public key of the authorisation centre 1 . the original message may be recovered by decrypting the cryptogram of the symmetric key by the private key of the authorisation centre and decrypting the message with the newly decrypted symmetric key . as a means to decrease the processing need associated to the encryption - decryption of the whole message of the user , it is possible to create a digital fingerprint ( message authentication code , mac ) from the message and to encrypt and decrypt only the digital fingerprint while the message may be transferred unencrypted . this method alone does not provide for the privacy of the message , however authenticates the person of sender , the receiver and the integrity of the message . a digital fingerprint is a chain of alphanumeric characters generated from a file or text by a one way hash function ( for example md5 ). the main characteristic of a one way hash function is that it is easy to create a character chain from a text or a file but it is extremely difficult or impossible to regain the text or the file from the character chain . as the one way hash functions generate very different character chains from slightly different texts ( more than 50 % of the characters in a character chain are different if one letter is different in an entire page of text ) they may be used to control the integrity of a file or a text transferred via the internet . an algorithm to create a digital fingerprint from a message ( for example md5 ) may be stored both in the authentication centre and on the remote terminal . a remote terminal is typically a computer with temporary data storage and data processing capacity . the remote terminal either stores an algorithm generating a cryptographic key of a certain length from any set of graphical symbols , or receives it from the authorisation centre each time a user wishes to gain access to the system . in the examples such cryptographic key generating algorithm are the same as those defining the algorithms stored by the authorisation centre . the remote terminal either stores a cryptographic algorithm encrypting and decrypting messages to be sent by the user to the authorisation centre , or receives it from the authorisation centre each time a user wishes to communicate with the authorisation centre or stores a cryptographic algorithm generating process also known to the authorisation centre by means of which it generates a unique cryptographic algorithm from each set of graphical symbols selected by the user . it is preferable if such cryptographic algorithm is the same as the algorithms stored or generated by the authorisation centre . a user is typically a natural person with average sensory and cognitive capacity who wishes to gain access to the services of a limited access system . the user shall store or know his unique identifier or id and the graphical symbol set generating and / or modification algorithm stored at the authorisation centre in the symbol set generating algorithm database associated with his id . such an algorithm is generally a few of specific geometrical or selection rules , which the user can easily memorise . typically , the authorisation centre and the remote terminal are connected to each other via a wide area network of extreme dimensions — such as the internet — and they are communicating with each other using common communication protocols such as tcp / ip . the physical means of communication may be any method capable of transferring digital data from one geographic location to another such as telephone lines , optical cables , satellites , broadcasting , etc . the main means of communication between the remote user and data authorisation centre can be the internet . [ 0062 ] fig3 shows a pictorial representation of a typical screenplay used by the user to perform the user &# 39 ; s symbol set generating task in a preferred embodiment of the invention . such a screenplay is displayed to the user at the remote terminal . in this embodiment the user &# 39 ; s id consists of an alphanumeric character chain . the graphical symbol set of the user consists of at least three graphical symbols that has to be selected as well . in this example the graphical symbols used are basic geometric shapes ( such as regular triangle , square and circle ). each basic graphical symbol of a definite form and shape may be further characterised by two further selection criterions i . e . one of two colours and one of four numbers written on the objects . a ) using the object selection table shown at the left field of the screen , which determine twenty four different symbols categorised by their basic shape e . g . rectangle , triangle , circle etc ., their colour and the number written on them ( the user has to use the mouse or the arrows on the keyboard and the enter at any line ), b ) using the random arrangement of graphical objects ( the user may use the mouse to click on any symbol or on any alphanumeric character shown at the side of each radius to select a group of symbols ), c ) using the keyboard to enter any alphanumeric characters identifying groups of symbols and when the selection criterion is met , he can press the ok button or the enter key . any wrong selection may be repeated after using the cancel key on the keyboard . the significance of the suggested way of symbol selection lies in that humans can well memorise complex shapes including the listed features , and by doing this a comparatively small amount of symbol set elements can represent a huge choice , of which the required selection represents only a single possibility , and it is practically impossible for anyone to find it out without the knowledge of the selection criteria of the user . in this specific embodiment the number of basic graphical symbols is three , each being represented by one of two possible colours and one of four possible numbers being written on them . as there are 108 symbols in the random arrangement , 36 alphanumeric characters at the end of the radiuses plus the user may enter any of the 36 alphanumeric characters also by using the keys of the keyboard , the total number of different three click selections is (( 3 * 2 * 4 = 24 )+ 108 + 36 + 36 = 204 ) 3 = 8 ′ 489 ′ 664 . the user shall identify himself by an alphanumeric character chain . as the number of different character chains is unlimited , in this embodiment the number of users of the system is theoretically not limited . in this preferred embodiment the arrangement of graphical symbols provided by the authorisation centre to the user shall be three concentric circles containing 36 graphical symbols each . in the preferred embodiment the graphical symbol selection algorithms shall consist of subtypes a ) selecting graphical symbol ( s ) by location ( sl ), with variants of absolute location related to a starting symbol and relative location related to an other graphical symbol , or b ) selecting the first , second , etc . graphical symbol by form or feature ( colour , shape , number written on the object or the result of a comparison of two symbols ). the scope and direction of the selection shall be provided ( the whole arrangement , from the starting symbol to one location , from one location to an another location , from one location to the ending symbol ), searching from the direction of the starting symbol toward the ending symbol or from the direction of the ending symbol toward the starting symbol . in this preferred embodiment the graphical symbol modification algorithms shall consist of algorithms changing one form or feature at a time to another specific form or feature ( such as changing any shape to a predetermined shape , changing any colour to a predetermined colour , changing any pattern to a definite pattern ). as an example , the complex graphical symbol selection algorithms may include any of the following commands : select the last two red symbols anticlockwise in the third quarter of the second and third circles , select the first symbol with a 4 digit written on it in the first circle clockwise selected from the radius signed by the character 1 , select the symbols of the second and third circle located on the same radius as the first red symbol in the first circle selected from the radius signed by the character q clockwise , select the symbols being located immediately bellow , above and to the direction of the clock of the first green symbol in the second circle selected in clockwise direction from the radius signed by the character g , etc . with these selection algorithms one may provide 204 * 204 * 204 = 8 ′ 489 ′ 664 different sets of three mouse clicks or key hits from any given random arrangement consisting of 3 concentric circles of 36 symbols . as any set of three mouse clicks or key hits may be reached by many different symbol selection algorithms ( the same symbols may be found on different selection criteria and from different directions ) therefore the number of applicable symbol selection operations is higher by magnitudes . it should be understood that the implementation of other variations and modifications of the invention in its various aspects will be apparent to those of ordinary skill in the art , and that the invention is not limited by the specific embodiments described . the present examples were given only for the illustration how easy thoughts lie behind the sophisticated definitions used hereinabove . with the explanations given above fig2 a shows a flow chart representing the first embodiment of the invention and illustrating how the communication between a user and an authorisation centre is built up required for providing secure access to a limited access system . the user begins the process in step 2 a 1 by communicating his wish to access . in step 2 a 2 the authorisation centre in response to the request to access generates an arrangement of randomly selected graphical symbols and via the remote terminal communicates it to the user . in steps 2 a 3 and 2 a 4 the user uses the randomly selected symbols displayed to him to apply his own unique symbol set generating algorithm and defines ( generates ) his user id which is e . g . a character chain and makes the required symbol selection . in doing this he uses the remote terminal and his selection is entered at the same time in the system . in step 2 a 5 the remote terminal generates a cryptographic key — a multi digit number consisting of a predetermined number of digits — from the set of graphical symbols entered by the user and communicates the key with the authorisation centre . there is a one - to - one correspondence between the selected symbols and the key . in step 2 a 6 , the authorisation centre searches its user id database to verify that the entered user id is valid . in step 2 a 7 , if the user id is not found in the database , access is denied and the system asks the user to try access again . if the reported id is found , the authorisation centre continues with step 2 a 8 , and the valid user id is used to locate the users corresponding symbol set generation algorithm . based on this algorithm and the arrangement of graphical symbols communicated to the user , in step 2 a 9 the authorisation centre generates a corresponding symbol set , i . e . the centre performs the same task on the graphical symbols sent to the user as the user did at steps 2 a 3 and 2 a 4 . in step 2 a 10 the authorisation centre generates a cryptographic key from the corresponding symbol set using the same algorithm as the remote terminal did in step 2 a 5 . in step 2 a 11 the authorisation centre compares the cryptographic key generated by the remote terminal with the corresponding cryptographic key produced in step 2 a 9 . if no matching occurs , the authorisation centre denies access and returns to step 2 a 1 . if a match is detected , the authorisation centre acknowledges access and qualifies the user as an authorised one . once the authorisation centre has granted access , the access procedure is terminated and the user then may continue with the desired transactions . in this example the graphical symbol set displayed to the user was sent to the remote terminal before the identification and control of the user &# 39 ; s id . this can impose certain limitation to the user regarding the freedom of selecting any symbol set algorithm . in the second example illustrated by the flow chart of fig2 b the order of steps are slightly different . this version of user &# 39 ; s authorisation differs from the previous example in steps 2 b 2 and 2 b 6 , whereby the authorisation system first receives the user id of the user and then , instead of generating an arrangement consisting of randomly selected graphical symbols as in step 2 a 2 , the authorisation system generates an arrangement of graphical symbols taking into consideration the best performance of the symbol set generating algorithm assigned to the user id of the user wishing to gain access . the term “ best performance ” designates a graphical symbol sets by which the individual symbol set algorithm can be carried out . really , this can be done easily because after identification the authorisation centre knows the symbol set algorithm selected previously by the user and can generate a set of symbols for display on the screen of the remote terminal , which fits to this selected algorithm . the communication of the user id in step 2 b 2 can take place by using and typing in a pre - selected code by the user , or in the same way as in the previous example , i . e . by the selection of two symbols from an initially displayed set of graphical representations . in this embodiment the graphical symbol set displayed to the user in step 2 b 7 is generally different from the one displayed in step 2 b 2 . in steps 2 b 8 and 2 b 9 the user carries out the selection according to his individual selection algorithm . if a higher degree of security is required , this step can be a symbol set selection and modification step , if the user &# 39 ; s individual algorithm comprises a modification after the selection . the modification can be very simple , e . g . after the selection of a property in a list , the algorithm can be the use of the immediately next or previous property in the list . by this , the number of possible choices increases by a substantial extent . in step 2 b 10 a cryptographic key is generated from the selected ( e . g . three ) symbols . in steps 2 b 11 and 2 b 12 the authorisation centre reproduces the symbol set entered by the user by using the user &# 39 ; s individual algorithm and applying it on the graphical symbols displayed to the user earlier , and generates the cryptographic key by using the same transformation as it occurred at the remote terminal . in steps 2 b 13 the two keys are compared , and login is accepted in case of matching keys only . while in the embodiments shown in the previous two examples the authorisation process was finished by providing access for the authorised user , who then had to send his message of substance to the centre , the embodiment shown in the flow chart of fig2 c combines the transmission of the message with the authorisation process . the steps 2 c 1 to 2 c 10 are identical with the steps of 2 b 1 to 2 b 10 , respectively . in step 2 c 10 the remote terminal generates a cryptographic key — a multi digit number consisting of predefined digits — from the set of graphical symbols entered by the user . in step 2 c 11 the user enters his message and the remote terminal encrypts the users login message with the newly generated cryptographic key . if necessary , the remote terminal can encrypt the whole message again by using a symmetric key or by a combined public key symmetric key cryptographic method . the actual way of this additional encryption does not form part of the present invention . in step 2 c 12 the remote terminal sends the encrypted login message to the authorisation centre . in step 2 c 13 the authorisation centre — based on the user &# 39 ; s symbol set generating algorithm and the arrangement of graphical symbols communicated to the user — generates the corresponding symbol set . in step 2 c 14 the authorisation centre generates a cryptographic key from the symbol set using the same algorithm as the remote terminal in step 2 c 10 . upon creating the cryptographic key , in step 2 c 15 the authorisation centre tries to decrypt the cryptogram of the user &# 39 ; s login message received from the remote terminal . if the message is further encrypted with a symmetric key or a combined public key — symmetric key method , the authorisation centre first decrypts the cryptogram with this method , and upon regaining the original cryptogram — encrypted only with the cryptographic key generated from the symbol set of the user — tries to decrypt the message . in step 2 c 16 the authorisation centre decides whether the result of the decryption fulfils certain conditions known to the remote terminal and to the authorisation centre ( for example the message is written in normal alphanumeric characters or contains a predefined key word , etc .) or not . if the result does not fulfil these conditions , the authorisation centre denies access and continues back to step 2 c 1 . if the result fulfils these conditions , the authorisation centre acknowledges access , and accepts the user as an authorised sender of the whole message . once the authorisation centre grants access and authenticates the user as the sender of the login message , the authorisation procedure is terminated as indicated by step 2 c 17 . in this embodiment by the end of the authorisation process the message of substance is already available for the authorisation centre . if further communication is required between the user and the centre , the so established encryption method can further be used . in the fourth embodiment of the invention represented by fig2 d not only a unique encryption key is generated from the graphical symbol set generated by the user but also a unique cryptographic algorithm . as most of the different encryption methods belonging to block cipher algorithms are — in a simplified way — not more than the repetition of the logical xor operation , permutation and shift operation on the bits of a block of plain text and / or a block of ciphertext in a particular order , it is relatively easy to generate unique cryptographic algorithms to each different graphical symbol set represented by a certain set of multidigit numbers . for example the number of the repetition of each operation ( xor , permutation , shift ) and the parameters of the operation ( in which direction the bits of the text are shifted and by how many places , etc .) may be determined by the actual digits being at certain predefined positions of the multidigit numbers representing the graphical symbol set . according to the above , in step 2 d 11 the remote terminal generates a unique encryption algorithm from the symbol set generated by the user , while in step 2 d 16 the authorisation system generates a corresponding encryption algorithm from the graphical symbol set generated by the authorisation system from the arrangement of graphical symbols communicated to the user and in step 2 d 17 the authorisation system tries to decrypt the cryptogram received from the remote terminal using the cryptographic key and the cryptographic algorithm generated at the authorisation centre . in all other aspects the procedure is done as explained by the description of the previous embodiment . in the fifth embodiment of the invention represented by fig2 e a further way of how to use the basic concept of the invention is represented . in this embodiment not the entire message of the user is encrypted , but a digital fingerprint ( message authentication code , mac ) of the message prepared by he remote terminal . the digital fingerprint is encrypted by using the cryptographic key and the cryptographic algorithm generated on the basis of the graphical symbol set generated by the user . when the authorisation centre receives the message and the encrypted digital fingerprint of the original message , it may generate the same cryptographic key and algorithm as the user , may decrypt the cryptogram of the digital fingerprint received from the user , may create the digital fingerprint of the message received from the user and may compare the digital fingerprint of the message received and the digital fingerprint received in encrypted form . if the two digital fingerprints are identical , the authorisation centre may declare the user authorised and the message authentic . according to the above , in step 2 e 12 the remote terminal generates a digital fingerprint of the message of the user while in step 2 e 13 the remote terminal encrypts the digital fingerprint with the encryption key and encryption algorithm generated in steps 2 e 10 and 2 e 11 . in step 2 e 18 it encrypts the cryptogram of the digital fingerprint received from the user while in step 2 e 19 the authorisation centre generates the digital fingerprint of the message received from the user . in step 2 e 20 the authorisation centre compares the two digital fingerprints and if they are identical it accepts the user and the message as authenticated otherwise denies the login and does not accept the message as authentic . in all other aspects the procedure is done as explained by the description of the previous embodiment . the invention provides a highly secure authorisation and user identification system , which is closely associated to the person of the user , it does not require that the user should use any device for carrying out the identification process . no one can learn the user specific symbol selection and / or modification algorithm even after the watching of several transactions . furthermore , a very reliable and user specific message encryption is provided between the user and the centre . this high degree of reliability allows the use of the internet as a basic and everywhere available tool of communication . these powerful features are basically the results of the fact that graphic symbols can be remembered easily , and the memorising of a symbol selection algorithm is just as easy .
| 6 |
the track of this invention consists of a pair of horizontally spaced rail members 10 and 11 composed of ferromagnetic material laminated to reduce eddy currents as illustrated at the numeral 12 . each of the rail members 10 and 11 is attached to a continuous support member 16 which may also be composed of ferromagnetic material but does not need to be so . the support members 16 are in turn fastened to spaced support pillars 17 . the base of each of the support members 16 terminates in a continuous strip member 48 to give an l - shaped cross - sectional configuration to the members 16 and 48 as shown in fig1 and 2 . centered between the rails 10 and 11 are a plurality of spaced cobalt - rare earth magnets 13 which have alternate transverse polarity orientation as indicated by the letters &# 34 ; s &# 34 ; and &# 34 ; n &# 34 ;. there is a small air gap between each pole and the nearest vertical surface of the rails 10 and 11 . thus , as indicated by the arrowed line in fig3 magnetic flux from the north pole of the magnet 13 illustrated at the left in fig3 crosses the air gap to the rail 10 , proceeds along the rail 10 to the south pole of the magnet 13 at the right , thence to the rail 11 and along the rail 11 to the south pole of the magnet 13 at the left , and back to the north pole of this magnet to complete a magnetic circuit . cobalt - rare earth magents have become well known and commercially available during the past fifteen years . their magnetic field strength is so great that a kilogram of such magnets can hold fifty kilograms of ferromagnetic material against the pull of gravity . the technology of such magnets will not be discussed herein as it plays no part in the present invention . of course , other permanent magnets possessing magnetic field strength comparable to that of cobalt - rare earth magnets could be used in place of the cobalt - rare earth magnets . as an example of the effectiveness of cobalt - rare earth magnets , a 20 , 000 - pound vehicle with 100 passengers requires about 500 pounds of high - magnetic - strength ( 25 million gauss - oersteds ) rare earth magnets . this provides for a safety factor of 2 and allows 11 / 2 centimeter gaps on either side of the magnets -- an important feature . with this large a gap , variations in roadbed have negligible effect on operations . the influence of roadbed variations is of course minimal anyway because they only affect the area of the gap and not the length of the gap . a hanger member 14 connects a cargo - carrying vehicle 15 to the magnets 13 . the weight of the vehicle 15 exerts a downward force on the magnets 13 producing a vertically off - center position of the magnets as illustrated in fig1 and 4 . if there were no such downward force , the magnets 13 would seek a vertically centered position with respect to the closest faces of the rails 10 and 11 . the magnets 13 resist either an upward or a downward force from this centered position . thus , the system of this invention is inherently stable with respect to vertical forces . of course , an applied force can be sufficiently great to cause fall - out . for this reason , the system must be designed so that the maximum likely applied force will be insufficient to cause fall - out . in addition , a mechanical limiting arrangement with a set of wheels 21 is incorporated as a safety measure to limit vertical movement downward . the vertical stability afforded by the present system overcomes problems of roll and pitch present in other systems and enables safe high - speed operation of the vehicle 15 . this may be perceived by reference to the embodiment of fig4 . superficially , it appears that this embodiment is the magnetic equivalent of a conventional wheeled system but it operates in a significantly safer manner . if a very severe side wind strikes the side of a wheeled vehicle the windward wheels can be raised from rail contact and the weight of the vehicle thrown on the leeward wheels . if the wind force persists the vehicle can be pushed beyond a critical angle and gravity will then aid the wind force to pull the vehicle over on its side . in the embodiment of fig4 the same application of wind force will raise the magnets on the windward side of the vehicle and lower those on the leeward . but as the windward magnets rise above their vertically centered position with respect to the rails 10 and 11 , they will exert a downward force on the windward side of the vehicle which -- combined with the increased upward force applied by the magnets on the leeward side of the vehicle -- will offer to the wind force a resistance tending to restore the vehicle 15 to normal operating position . by providing inherent vertical stability rather than inherent horizontal stability as in other maglev systems the present invention converts a difficult problem -- vertical stability - into a rather simple one . horizontal destabilizing forces are much smaller than vertical ones and a plurality of wheels 20 mounted on a shaft 22 , which are not under load ( except in embodiments where they are used for propulsion ) can readily contain them . in the embodiment illustrated in fig1 a plurality of spaced coils 19 are run through the rails 10 and 11 . these coils are used for synchronous propulsion of the vehicle 15 after the manner of sawyer u . s . pat . no . 4 , 061 , 089 . while the system has inherent vertical stability , it does not have inherent horizontal stability and for this reason the wheels 20 serve to maintain the magnets 13 in a horizontally centered position with respect to the rails 10 and 11 . the structure of fig3 illustrates an electromagnetic means for centering the magnets 13 with respect to the rails 10 and 11 . it may be used alone or -- preferably -- to supplement the action of the wheels 20 . in this embodiment , centering of each magnet 13 between the rails 10 and 11 is maintained or aided by electromagnets . a set of extensions 18 is fixedly connected one at each end to the magnets 13 . each extension 18 has a set of electromagnets such as 26 , 28 and 31 , 33 positioned in spaced relation with the vertical inner walls of the rails 10 and 11 . associated with the electromagnet 26 is a gap sensor 27 positioned in spaced relation with the inner vertical surface of the rail 11 . a typical gap sensor is a hall effect device that senses a change in air gap dimension by producing a voltage error signal which can be used to energize an electromagnet . when the gap sensor 27 senses that it is getting too close to the inner vertical surface of the rail 11 , it sends an energizing signal along an electrical connector 39 to a coil 35 which activates the electromagnet 26 to pull the magnet 13 back toward centered position between the rails 10 and 11 . the electromagnets 28 , 31 and 33 with their respective gap sensors 29 , 32 and 34 , their respective electric cables 40 , 41 and 42 , and their respective coils 36 , 37 and 38 operate in a complementary fashion . thus , the fast - acting electromagnetic controls of fig3 operate to prevent any contact between the magnets 13 and the rails 10 and 11 . fig4 illustrates the invention as applied to a rail - below - vehicle system . while the illustration of this embodiment shows a double track system it could also be used as a single track system provided the vehicle 15 included a gyroscope to maintain it in upright position . the levitation mechanism of fig4 operates in the same manner as the levitation mechanisms of fig1 and 2 . in this embodiment the coils 19 are recessed so as not to protrude above the rails 10 and 11 and the safety wheels 21 are mounted on a shaft 22 &# 39 ; above the rails 10 and 11 so as to make contact with the tops of these rails in the event of an emergency magnetic fall - out . in fig1 - 4 dimensions have been exaggerated in order to promote clarity of illustration . each vehicle has at least two sets of magnets like the magnets 13 of fig1 and they may be swivel - mounted in order to accommodate to track curvature . typical propulsion means used in maglev systems are linear induction motors and linear synchronous motors such as are described in the aforementioned sawyer u . s . pat . no . 4 , 061 , 089 which issued dec . 6 , 1977 . such propulsion systems , however , are not necessary to the practice of the present invention . utilizing conventional electric motors to rotate the wheels 20 is quite satisfactory . thus , it can be seen that this invention is subject to many variations which can properly be considered as falling within its scope . accordingly , the scope of the invention should not be limited other than as may be necessitated by the scope of the appended claims .
| 1 |
the following examples further specifically illustrate the improved electrophoretic imaging system provided by this invention . parts and percentages are by weight unless otherwise indicated . the following examples are intended to illustrate various preferred embodiments of the present invention . all of the examples are carried out in an apparatus of the general type illustrate in fig1 . a 500 watt quartz iodine light source is used to illuminate a black and white negative transparency , the image being projected by a lens through the tin oxide coated glass on which the particular photoconductor is coated . the suspension is formed by dispersing finely divided particles of the specific material in an insulating liquid . the suspension is milled until the particles are less than about 2 microns in cross - section and are uniformly dispersed . a source of high potential is connected to a roller electrode which has a one inch diameter steel core and a 3 / 4 layer of polyurethane having a resistivity of 5 × 10 8 ohm cm forming a 2 . 5 inch diameter roller . a paper sheet is placed over the polyurethane surface to receive the images . the other lead of the source of high potential is connected to the conductive surface of a nesa glass plate . a 1 micron layer of selenium is vacuum evaporated onto the conductive surface of the nesa glass plate to form the photoconductive electrode . approximately two parts of magenta dyed resin type r103 - 6 available from the radiant color co ., richmond , california is suspended in about 5 parts of sohio odorless solvent 3454 , a mixture of kerosene fractions available from standard oil co . of ohio . this suspension is coated onto the selenium surface using a no . 4 mayer coating rod . the roller electrode is rolled across the suspension at a rate of about 2 inches per second with a potential of about 3500 volts applied . the roller is held at a negative potential with respect to the photoconductive electrode . as the roller traverses the suspension , the photoconductor is exposed to light projected through a negative transparency . on completion of roller traverse a positive image is found adhering to the paper on the roller electrode and a negative image is found on the photoconductor surface . the experiment of example i is repeated except that prior to roller traverse and imagewise illumination the suspension is subjected to a source of corona from a corona generating electrode held at a negative 7000 volts with respect to ground . the image formed on the paper is compared to the image formed in example i . the image formed in this example is found to have a decreased background . the experiment of example ii is completed except that the selenium is coated with a 0 . 5 micron protective layer of poly ( n - vinyl carbazole ) ( pvk ). the coating is applied by dissolving about 2 parts by weight pvk in 60 parts dioxane and 40 parts cyclohexanone and coating the solution on the selenium using a no . 4 mayer rod . the coating is allowed to dry . the suspension is placed on this coating . pvk is an example of an active transport dielectric . on completion of roller traverse , a positive image of excellent quality is found adhering to the paper . in the following examples iv - vi , the particles are dispersed in a solid binder which is dissolved just prior to imaging by application of a solvent . these layers have an advantage in that colored liquids need not be handled . a photoconductive layer is formed by dispersing about one part by weight of the x - form of metal - free phthalocyanine made as shown in u . s . pat . no . 3 , 357 , 989 in a mixture containing 3 parts of pe - 200 ( a polyester resin available from goodyear tire and rubber co . ), about 15 parts of methyl ethyl keytone , and about 10 parts of toluene . the slurry is coated on a 2 . 0 mil mylar film , a polyester available from dupont using a no . 6 wire wound rod producing a photoconductive layer of about 4 - 5 microns dry thickness . this mylar backed photoconductive layer is then overcoated with an ink suspension of about 2 parts by weight lawter cyan blue ( b - 2858 hi - viz pigment available from the lawter chemicals inc . chicago , ill .) and about one part eicosane , and 15 parts sohio 3454 , a mixture of kerosene fractions available from standard oil of ohio using a no . 8 wire wound rod providing a 5 - 6 micron layer dry . this combination of photoconductor , substrate and particle - binder layers is placed on a nesa glass plate , the photoconductive layer in contact with the conductive nesa glass coating . the photoconductor is exposed and traversed by the roller as in example i except that the paper on the roller is wetted with sohio 3454 which dissolves the binder for the lawter cyan blue pigment . on completion of roller traverse , a positive image is formed on the paper on the roller electrode . in this embodiment the photoconductive layer can be varied from about 1 to about 50 microns and the particle - binder layer can be varied from about 3 to about 20 microns with satisfactory results . the experiment of example iv is repeated except that the photoconductive layer is replaced with a photoconductive layer made by coating about one part by weight monastral red b , a quinacridone pigment available from dupont , one part by weight pe - 200 , about 6 parts by weight methyl ethyl ketone and about 4 parts by weight toluene on 2 . 0 mil myler as in example iv . an image is formed as in example iv . the experiment of example iv is repeated except that the photoconductive layer is made by coating a slurry of about 2 parts indofast yellow lake y - 5713 , available from harmon color , division of allied chemical and dye company about one part pe - 200 , about 15 parts by weight methyl ethyl ketone and about 10 parts by weight toluene on 2 mil mylar as in example iv . a cyan image is formed as in example iv with the exception that the roller is held at a positive about 3500 volts with respect to the nesa glass . the experiment of example iii is repeated except that the magenta dyed resin particles are replaced by particles of iron oxide , mapico eg3 , available from columbia carbon co ., new york , new york , overcoated with melamine - formaldehyde resin . the paper receiver sheet is also replaced by a mylar sheet available from dupont . the image formed may then be magnetized and used as a ferromagnetic master as shown , for example , in ferrography by atkinson and ellis , journal of the franklin institute , volume 252 , no . 5 , november , 1951 . it may also be used as a record in machines equipped for the automatic reading of magnetic patterns , for example , printed on a bank check and read in an automatic magnetic check sorter . the experiment of example iii is repeated except that the magenta dyed resin particles are replaced with particles of luxol fast black l , a spirit soluble dye available from dupont . the image formed on the paper receiver sheet may then be used as a spirit master . spirit masters are made in these examples as in example viii except that in example ix the particles are grasol fast brilliant red bl , available from geigy chemical co ., in example x the particles are luxol fast scarlet c and in example xi the particles are gentian violet available from hartman - leddon co . in this example a full color image is prepared by combining yellow , cyan and magenta monochroome images . first , red , yellow and blue separation images are prepared using conventional techniques to provide negative transparencies . a magenta image is made as in example iii using the proper separation image . a cyan image is formed as in example iii using lawter cyan blue b2 , as the particles , exposure being made through the proper separation image . a yellow image is formed as in example iii using strong lemon yellow b2141 , available from lawter chemical inc . in place of the magenta particle . the three images are transferred in register to a receiver sheet . since the particles are all resinous fusible materials fixing is accomplished by radiant or contact heating providing a full color positive image . the experiment of example xii is repeated except that sunset yellow p6000 g , blue r103 - g - 119 and magenta p1700 available from radiant color co ., richmond , california are used as the particles . the image is fixed as in example xii . although specific components and proportions have been described in the above examples , other materials as listed above , where suitable may be used with similar results . in addition , other materials may be added to the various layers to synergize , enhance or otherwise modify their properties . for example , the photoconductive layer may be dye - sensitized to alter its photoresponse . other modifications and ramifications of the present invention will occur to those skilled in the art upon a reading of the present disclosure . these are intended to be included within the scope of this invention :
| 6 |
the inventors herein show that it is possible to give a more accurate prediction of the presence of lymph node metastasis of hnscc than currently possible , by measuring mrna expression of a concise set of genes ( the predictor signature ). it appeared possible to give an accurate prediction on basis of a set of 102 genes listed in table i . it appeared that half of these genes have not been directly associated with tumorigenesis or metastasis before . besides expected epithelial marker genes , interesting categories include genes ( putatively ) coding for extracellular matrix components , genes involved in cell adhesion including three members of the plakin family of cytolinkers and the enzyme transglutaminase 3 , which play a role in maintaining tissue integrity ; cell death genes ; cell growth and maintenance genes and genes encoding hydrolyzing activities including proteins involved in degradation of the extracellular matrix ( upa and pai - 1 ) and a metalloproteinase . another feature of the metastasis signature is that there is more down - regulation associated with metastasis ( two thirds ) than up - regulation . it is likely that this involves stromal and immune - regulatory components ( pollard , j . w . ( 2004 ) nat . rev . cancer 4 , 71 - 78 ; chambers , a . f . et al . ( 2002 ) nat . rev . cancer 2 , 563 - 572 ). many of the predictor genes belong to this categories , strengthening the argument for profiling bulk tumour tissue rather than laser - dissected regions densely populated with tumour cells . it is shown herein that a diagnosis / prediction of the presence of metastases can be given using expression data of a set of only five genes from this large set of 102 genes . table 2 indicates 15 of the genes which rank high in predictive value and which can especially be used to give a diagnosis or prediction of metastasis in hnscc . of course , accuracy of prediction will increase when more then five , preferably all 15 and even more preferably all 102 genes will be used on an array for gene expression analysis for the diagnostic / predictive signature . gene expression analysis is preferably done using a micro - array . the techniques for measuring and comparing gene expression on micro - arrays is well established within the art . it should be understood that it is not necessary to have the full length nucleotides encoding the above mentioned genes on said array : a stretch of nucleotides which is sufficient to establish unique hybridisation with the rna expressed from said genes in the tumour cells can be used . such a stretch of nucleotides is hereinafter referred to as ‘ element ’. preferably for the specific use of gene expression analysis for the current invention ( i . e . with relation to detection of the presence of or the risk for metastases of hnscc ) such an array need not contain a large number of ( different ) genes or elements . it would be sufficient for the array to contain the necessary genes , as discussed above , and , preferably , some control genes , as will be discussed below . the array , which can be used for the analysis of the invention thus does not need to contain more than 1000 genes or elements , preferably not more than 500 genes or elements , more preferably not more than 200 genes or elements and most preferably from about 50 to about 150 genes or elements . to investigate a gene expression profile the array should be subjected to hybridisation with target polynucleotide molecules from a clinically relevant source , in this case e . g . a person with hnscc . therefore , preferably a fresh frozen ( within 1 hour from surgical removal ), liquid nitrogen ( at least − 80 ° c .) stored tumour sample needs to be available . said target polynucleotide molecules should be expressed rna or a nucleic acid derived therefrom ( e . g ., cdna or amplified rna derived from cdna that incorporates an rna polymerase promoter ). if the target molecules consist of rna , it may be total cellular rna , poly ( a ) + messenger rna ( mrna ) or fraction thereof , cytoplasmic mrna , or rna transcribed from cdna ( crna ). methods for preparing total and poly ( a ) + messenger rna are well known in the art , and are described e . g . in sambrook et al ., ( 1989 ) molecular cloning — a laboratory manual ( 2 nd ed .) vols . 1 - 3 , cold spring harbor , n . y . in one embodiment , rna is extracted from cells using guanidinium thiocyanate lysis followed by cscl centrifugation ( chrigwin et al ., ( 1979 ) biochem . 18 : 5294 - 5299 ). in another embodiment , total rna is extracted using a silica - gel based column , commercially available examples of which include rneasy ( qiagen , valencia , calif ., usa ) and strataprep ( stratagene , la jolla , calif ., usa ). poly ( a ) + messenger rna can be selected , e . g . by selection with oligo - dt cellulose or , alternatively , by oligo - dt primed reverse transcription of total cellular rna . in another embodiment , the polynucleotide molecules analyzed by the invention comprise cdna , or pcr products of amplified rna or cdna . preferably , the target polynucleotides are detectably labelled at one or more nucleotides . any method known in the art may be used to detectably label the nucleotides . preferably , this labelling incorporates the label uniformly along the length of the polynucleotide and is carried out at a high degree of efficiency . one embodiment for this labelling uses oligo - dt primed reverse transcription to incorporate the label ; however , conventional methods hereof are biased toward generating 3 ′ end fragments . thus , in this embodiment , random primers ( e . g . 9 - mers ) are used in reverse transcription to uniformly incorporate labelled nucleotides over the full length of the target polynucleotides . alternatively , random primers may be used in conjunction with pcr methods or t7 promoter - based in vitro transcription methods in order to amplify the target polynucleotides . in a preferred embodiment , the detectable label is a luminescent label . for example , fluorescent labels , bioluminescent labels , chemiluminescent labels and calorimetric labels may be used . in a highly preferred embodiment , the label is a fluorescent label , such as a cy5 or cy3 , fluorescein , a phosphor , a rhodamine , or a polymethine dye or derivative . in another embodiment , the detectable label is a radiolabeled nucleotide . the array may be any nucleotide array which represents five or more of the genes of table 2 or table 1 . to indicate the difference with the existing very large arrays of e . g . affymetrix , the dedicated arrays of the present invention should preferably comprise no more than 50 , or 100 , or 250 or , alternatively 500 or 1000 genes altogether . presence of other genes on the array is allowable and the expression data from such other genes need not necessarily be considered for the present application . the methods of the invention can be applied on the above mentioned dedicated arrays , but can also be performed on arrays that are commercially available ( e . g . from agilent us ; affymetrix inc , ca , usa ; and others ). it is also possible to work with self - made arrays by spotting or synthesizing nucleotides which are known to selectively hybridise to the target genes on a surface . methods to prepare such arrays are well within the skill of the artisan . the microarrays can comprise cdna , but can also comprise short oligonucleotides ( affymetrix and nimblegen ) or long oligonucleotides which are synthesized in situ_ ( agilent ); in another embodiment the arrays comprise long oligonucleotides and are self - made by spotting . nucleic acid hybridisation and wash conditions are chosen so that the target polynucleotide molecules specifically hybridize to the complementary polynucleotide sequences of the array , preferably to a specific array site , wherein its complementary dna is located . optimal hybridisation conditions will depend on the type ( e . g ., rna or dna ) of the target nucleotides and array . general parameters for specific ( i . e ., stringent ) conditions of hybridisation are described in sambrook et al . ( supra ). typical hybridisation conditions for cdna microarrays are hybridisation in 5 × ssc plus 0 . 2 % sds at 65 ° c . four hours , followed by washes at 25 ° c . in low stringency wash buffer ( 1 × ssc plus 0 . 2 % sds ), followed by 10 minutes at 25 ° c . in higher stringency wash buffer ( 0 . 1 × ssc plus 0 . 2 % sds ). when fluorescently labelled probes are used , the fluorescence emissions at each site of the microarray may be detected by scanning confocal laser microscopy . in one embodiment , the arrays is scanned with a laser fluorescent scanner with a computer controlled x - y stage and a microscope objective . fluorescent laser scanning devices are described in e . g . schena et al . ( 1996 ) genome res . 6 : 639 - 645 . signals are recorded and , in a preferred embodiment , analysed by computer using a 12 or 16 bit analog to digital board . in one embodiment the scanned image is despeckled using a graphics program ( e . g ., hijaak graphics suite ) and then analysed using an image gridding program that creates a spreadsheet of the average hybridisation at each wavelength at each site . not all of the genes are evenly contributing to the discriminating effect . as is shown in table 1 , the genes differ in significant expression . although the statistical data presented in the examples are calculated with all of the 102 genetic elements of table 1 , it is submitted that a good distinction between the two groups of patients and therewith a good diagnosing / predicting ability of the signature gene set can also be achieved with only a part of the elements of table 1 . at least 5 ( 5 %) of the elements of table 1 are included in the analysis , more preferably 20 %, more preferably 40 %, more preferably 60 %, more preferably 80 %, more preferably 90 % and most preferably all of the elements . it would be advisable not to randomly choose the elements , but to pick the most discriminating genes in this list . table 2 gives an overview of the top 15 genes out of the 102 genes of table 1 , of which at least 5 , more preferably at least 6 , more preferably at least 7 , more preferably at least 8 , more preferably at least 9 , more preferably at least 10 , more preferably at least 11 , more preferably at least 12 , more preferably at least 13 , more preferably at least 14 , and most preferably all 15 can be used for making up the signature with which the microarray analysis is performed . it furthermore has been found that a more comprehensive set of predicting genes can be compiled by repeatedly calculating a predictive signature via a multiple training approach ( similar to michiels , s . et al ., lancet 365 : 488 - 492 , 2005 ). in this study ( see examples ) it appeared that from the originally more than 2000 differentially expressed genes only 825 ( table 3 ) had a predictive character , and that for these a subgroup of 179 ( table 4 ) genes was used in more than half of the signatures . from this group again a supergroup of 61 genes ( table 5 ) could be distinguished which was predominantly used to discriminate between n + and n0 . it will be understood that preferably an array would comprise at least three , but preferably five , more preferably 10 , even more preferably 25 and most preferably 61 of the genes of table 65 . however , it also appeared possible to classify on basis of genes , which did not occur in table 5 , but in such cases many genes are required to achieve an acceptable prediction . thus , an array could also comprise at least 10 , preferably 25 , more preferably 50 , and most preferably 100 of the genes of table 5 . as indicated above , various combinations of these genes can be used for determining the presence of lymph node metastases in several ways . on dual channel dna microarrays this is performed by determining the expression level ratios of the genes in the primary tumour sample versus expression of the same genes in reference material . the reference material can be derived from a pool of total rna or amplified mrna from a set of hnscc primary tumours with established lymph node metastasis characteristics . the individual gene expression ratios contribute towards the expression ratio signature of a sample . the degree of correlation of a sample &# 39 ; s signature with the signatures of samples with known metastatic status ( preferably calculated by the cosine correlation ( jones , w . p ., & amp ; furnas , g . w . ( 1987 ). pictures of relevance : a geometric analysis of similarity measures . journal of the american society for information science , 36 ( 6 ), 420 - 442 ) as , e . g , provided by the genesis software ; http :// genome . tugraz . at / software / genesis / description . html ) is used to predict the metastatic state of the unknown sample . the correlation threshold for predicting the metastatic state is based on the optimal threshold for discriminating between the metastatic states of the samples with known metastatic states , which can easily be determined by a person skilled in the art other measurements of absolute expression and expression ratios of these genes can also be used . reference material can be derived from other sources than a pool of samples with known metastatic states . preferably , however , samples with known metastatic states are still required to determine the correlation threshold for determining the metastatic status . expression ratios can also be derived from single channel microarray experiments , using as a reference so - called housekeeping genes ( i . e . with stable expression across many different samples ) or a collection of housekeeping genes or any collection of genes or features with stable expression . again here it is preferred to use samples with known metastatic states to determine the correlation threshold for determining the metastatic status . gene expression measurements and the derived ratios can also be obtained by ( quantitative ) reverse transcription pcr or any other assay for gene expression , using as a reference any gene or collection of genes that have stable expression across many samples . in a specific embodiment of this application of the invention , samples with known metastatic states are still required to determine the correlation threshold for determining the metastatic status . in the absence of tumour samples with known metastatic states for calibration of the prediction , the genes or various combinations of the ( expression analysis of the ) genes can still be used to predict the metastatic state . in these embodiments of the invention an absolute or relative measurement of gene expression is determined for example using single or dual channel dna microarrays , or by other methods such as ( quantitative ) reverse transcription pcr . increased expression of the genes in table 1 or 2 with a positive n + correlation will hereby contribute positively towards prediction of the n + status and negatively towards prediction of the n0 status . conversely , increased expression of the genes in table 1 or 2 with a negative n + correlation will contribute positively towards n0 prediction and negatively towards n + prediction . increased expression in both cases indicates an increase relative to a suitable marker gene or feature , set of genes or features or collectively in relation to each other . however , a person skilled in the art is able to obtain the reference data that have been produced in the below example , since this data is available as dataset e - umcu - 11 from the public micro - array database arrayecpress ( http :// www . ebi . ac . uk / arrayexpress /). when desiring to predict or determine the presence of metastases for a certain patient , the practitioner should take a biopsy from that patient , isolate the rna and determine the expression of at least 5 of the elements of table 1 . to normalize these expression data with respect to the data of the reference set e - umcu - 11 , it is possible to correct the data for variations with the help of expression data of a control gene or element which is not affected by the tumour state ( such as a housekeeping gene ), which is present in the reference set e - umcu - 11 and should also be available on the array that has been used to determine the expression profile of the patient to be assessed . in stead of one control gene or element , also the mean value of a poll of control genes or elements can be taken . this correction can , for instance , be done by subtracting the expression level of the control gene ( s )/ element ( s ) from the expression levels of each of the tested genes / elements . preferably , the ratio for every tested gened with respect to the control gene ( s ) is calculated for both the patient &# 39 ; s expression profile as well as for the expression data of the reference set . with these figures , the correlation with the mean value of the n0 values of the reference set should be calculated . if this correlation is negative ( i . e . a value below zero ) it can be concluded that the patient is n + ( i . e . having or prone to develop metastases ). conversely , the correlation can be calculated with respect to the mean value of the n + values of the reference set . then a negative correlation indicates a match with the n0 group . further enablement for a diagnosis / prediction of cancer metastasis on basis of gene expression analyses can be found in wo 03 / 010337 , indicating that methods as have been generally described above are well within the skills of the practitioners in the art . miame 1 compliant data in mage - ml 2 format as well as complete descriptions of protocols , microarrays and clinical parameters have been submitted to the public microarray database arrayexpress ( http :// www . ebi . ac . uk / arrayexpress /) with the following accession numbers : microarray layout , a - umcu - 3 ; hnscc tumour data , e - umcu - 11 ; protocols for sectioning of tumour material , p - umcu - 18 ; rna isolation , p - umcu - 19 ; dnase treatment , p - umcu - 20 ; mrna amplification , p - umcu - 21 ; generating reference pool , p - umcu - 26 ; crna labeling , p - umcu - 22 ; hybridization and washing of slides , p - umcu - 23 and p - umcu - 24 ; scanning of slides , p - umcu - 25 ; image analysis , p - umcu - 11 for the training set , 92 samples were randomly taken from a collection of primary tumours surgically removed between 1996 and 2000 and that fulfilled the following criteria : biopsy - proven hnscc in the oropharynx and oral cavity ; no previous malignancies in the head and neck region ; tumour sections contained more than 50 % tumour cells . of these 92 tumours , 82 passed total rna and crna quality control ( qc ) and were included in this study . for the validation set , 27 tumours were randomly taken from the same collection of tumours , surgically removed between 2000 and march 2001 , and that fulfilled the same selection criteria . of these , 22 passed total rna and crna qc and were included in this study . the diagnostic procedures for clinical staging of cervical lymph nodes was performed according to the netherlands national guidelines for oral cavity and oropharynx carcinomas , by clinical examination ( palpation ) of the neck region , followed by bilateral ultrasound examination , computed tomography ( ct ) and / or magnetic resonance imaging ( mri ). suspected nodes were subjected to aspiration cytology . in this way , patients were pre - operatively classified as either n0 or n +, the latter in the case of aspirates yielding metastatic tumour cells . only in the case of obvious neck involvement , as shown by huge swelling , were the patients classified as n + without additional efforts to prove the presence of metastasis . surgery was aimed at complete tumour removal . with regard to the neck , in the case of clinical n0 only a sohnd was performed 3 . in cases clinically classified as n + a rnd was performed including all five lymph node levels 3 . postoperative irradiation was administered in accordance with current practice and depending on margin status , tumour growth features , number of positive nodes and extracapsular growth . in practice , 36 out of 60 clinically assessed n0 patients and 38 out of 43 clinically assessed n + patients received radiation therapy . this treatment as well as additional clinical information is presented in supplemental data 2 ( for accessibility , see above ). after surgery , patients were periodically checked for development of neck metastasis , and patients initially classified as n0 but showing positive nodes in their surgical specimen or developing neck nodes within a time span of 3 years after surgery without having another head and neck cancer that could be responsible for this metastasis , were retrospectively added to the n + patient group . less than 5 % of patients with hnscc in the oral cavity or oropharynx subsequently develop metastasis after treatment 4 , 5 . here , for the training and validation cohorts , one patient subsequently developed positive neck nodes after surgery . three years is to be considered as a reliable time period , since at least 80 % of the recurrences are known to take place in the first two years after surgery ( takes , r . p . et al . ( 2001 ) j pathol 194 , 298 - 302 ; jones , k . r ., et al ., ( 1992 ) arch . otolaryngol . head neck surg . 118 , 483 - 485 ) fresh tumour tissue was taken from the surgical specimen , snap - frozen in liquid nitrogen immediately after surgical removal and stored at − 80 ° c . frozen sections were cut for rna isolation and immediately transferred to a rnalater solution ( ambion ). a haematoxylin and eosin stained section was prepared for tumour percentage assessment . only samples with at least 50 percent tumour cells were used . for a small number of samples the tumour percentage was increased by removing areas with no tumour cells . total rna was isolated from 2 - 3 sections ( 20 μm ) with trizol reagent ( invitrogen ), followed by a purification using the rneasy mini - kit ( qiagen ) and a dnase treatment using the qiagen dna - free kit . the yield and quality of total rna was checked by spectrophotometry and by the agilent 2100 bioanalyser ( agilent ). total rna quality control criteria were in accordance with the tumour analysis best practices working group 6 , discarding samples with no clear 18s and 28s ribosomal bands . we also removed samples that had a yield lower than 500 ng total rna or showed mycoplasma contamination . mrna was amplified by in vitro transcription using t7 rna polymerase on 1 μg of total rna . first a double stranded cdna template was generated including the t7 promoter . next , this template was used for in vitro transcription with the t7 megascript kit ( ambion ) to generate crna . during the in vitro transcription , 5 -( 3 - aminoallyl )- utp ( ambion ) was incorporated into the single - stranded crna . the yield and quality of the crna was analyzed by spectrophotometry and by the agilent 2100 bioanalyser . samples with a yield less than 5000 ng or with small crna fragments ( median less than 500 bp ) were not used . cy3 or cy5 fluorophores ( amersham ) were coupled to 500 ng of crna . after coupling , free dye molecules were removed using clontech chromospin - 30 columns ( clontech ). the yield and label incorporation ( 5 - 7 %) of the cy - labeled crna was checked using spectrophotometry . before hybridization , 300 ng of cy - labeled crna from one tumor was mixed with an equal amount of reverse color cy - labeled material from the reference sample . the human array - ready oligo set ( version 2 . 0 ) was purchased from qiagen and printed on corning ultragaps slides as described elsewhere 7 . the microarrays contained 70 - mer oligonucleotides representing 21 , 329 genes as well as 3871 additional features for control purposes . before use , the microarray slides were treated with sodium - borohydrate solution to reduce auto - fluorescence in the cy3 - channel 8 . the labelled crna targets were hybridized on the microarray for 10 hours at 42 ° c . using the ventana discovery hybridization station in combination with the chipmap - 80 kit ( ventana europe ). after hybridization the slides were manually washed and scanned in the agilent g2565aa dna microarray scanner ( 100 % laser power , 30 % pmt ). the scanned images were quantified and background corrected using imagene 4 . 0 software ( biodiscovery ). the expression data was normalized for dye and print - tip biases using a lowess per print - tip normalization algorithms applied in the statistical package r 10 . following normalization , variance stabilization ( vsn ) 11 was applied to stabilize variance in the intensity data . both duplicate dye - swap hybridizations of each tumour were averaged and for each gene a tumour - reference ratio was calculated . reference versus reference hybridizations were used to build a gene error model for technical variation . nine reference self - self comparisons were performed in dye - swap ( 18 hybridizations ), resulting in nine reference ratios for each gene on the microarray . these nine reference ratios yield an estimate of the technical variation for each gene . to test whether a gene in a tumour samples shows differential expression , a student &# 39 ; s t - test was applied on the tumour ratio and the corresponding nine reference ratios ( technical variation ). the calculated p - values for differential expression were used to select those genes that show differential expression in the tumour samples . a classifier was constructed to distinguish between n0 and n + patients . of the 21 , 329 genes on the microarray , 6221 were excluded based on aberrant signal and spot morphology in one of the 164 hybridizations . from these remaining 15 , 108 genes , only genes that were significantly different from the reference in at least 31 tumours were selected based on the error model for technical variation ( p & lt ; 0 . 01 ). this resulted in a set of 1 , 986 genes . for these genes the signal - to - noise - ratio ( snr ) 12 was computed and employed to rank the genes ( top ranked genes being genes that are best suited to distinguish the outcome classes ). the optimal gene set to employ in the classifier ( a nearest mean classifier similar to the classifier employed in 13 ), was determined by gradually expanding the gene set starting from the highest ranked gene . at each expansion round the nearest mean classifiers was trained on a training set and tested on a test set . the performance on the test set served as a quality measure of the gene set . the performance was measured as the average of the false positive ( n0 classified as n +) and false negative ( n + classified as n0 ) rates of the test samples . initially the performance increases as the set is expanded . the expansion of the gene set is terminated when the performance deteriorates , i . e . when the optimal performance is reached . the steps of ranking the genes and training and testing the classifier are performed in a 10 - fold cross - validation procedure . the output of this procedure is an optimal number of top - ranked genes and a trained classifier . to ensure independent validation , this process of optimizing the set of genes and training the classifier is wrapped in a second 3 - fold cross - validation loop . this entails that the optimization of the gene set and the training of the classifier is performed on ⅔ of the data , while the classifier is validated on ⅓ of the data . since this ⅓ of the data is never involved in any of the gene selection and training steps , this ensures completely independent validation of the classifier , which avoids selection bias 14 , 15 and therefore results in a reliable performance estimate . this double - loop procedure determined 102 genes to form the final diagnostic classifier . this classifier was trained on the complete set of 82 samples by recalculating the signal - to - noise ratio for all genes and subsequently selecting the top 102 genes . the predictor was trained using the 102 selected genes and the 82 training samples . a decision threshold for this classifier was fixed such that the highest overall predictive accuracy for both n0 and n + tumours . was reached . odds ratios ( or ) were calculated by fitting a logistic regression model on the prediction outcome of the validation set . the predictor had an infinitive or since no false negative prediction was made . to get an estimate of the or for the predictor , one false negative was artificially introduced resulting in a predictor or of 30 ( p = 0 . 006 ) and a clinical or of 4 . 2 ( p = 0 . 15 ). the standard error for predictive accuracy ( fig3 a ) includes the predictions made on the latter half of the training set . a multiple training approach was used to identify a complete set of predictive genes , based on the 66 tumor samples from 1998 to 2001 . the tumor samples were randomly divided into a training set and test set using a 10 - fold cross validation procedure . based on the training set , p - values were calculated for all 3064 differentially expressed genes based on the difference in expression between n + and n0 tumor samples ( student &# 39 ; s t - test ). the set of genes with lowest p - values ( i . e . most - predictive ) was used for prediction of the test samples by calculating the correlation with the average n + and average n0 training profile and , based on these correlations , classifying the test samples as n0 or n +. repeating this resampling procedure a thousand times resulted in multiple predictions for each tumor sample , based on the different predictive gene sets . this approach was repeated three times to determine 1000 predictive gene sets consisting of 50 genes , 1000 gene sets of 100 genes and 1000 gene sets of 200 genes . all gene sets had predictive value ( fig1 ). genes selected at least once are listed in table 3 . this consists of 825 genes with predictive power for detection or prediction of metastasis in head and neck squamous cell carcinoma . small and large sets of genes from this list can be used for prediction ( fig5 ). genes selected more frequently , that is present in more than 50 % of the 200 gene set predictors are listed in table 4 . this consists of 179 genes with strongest predictive power for detection or prediction of metastasis in head and neck squamous cell carcinoma . small and large sets of genes from this list can be used for prediction . genes selected most frequently ( more than 90 %) are listed in table 5 . this consists of 51 genes with the highest predictive power . small and large sets of genes from this list can be used for prediction . this list consists of genes , most / all of which have never before been associated with prediction of metastasis in tumors , especially metastasis in head - neck squamous cell carcinoma . 1 . brazma , a . et al . minimum information about a microarray experiment ( miame )- toward standards for microarray data . nat . genet . 29 , 365 - 371 ( 2001 ). 2 . spellman , p . t . et al . design and implementation of microarray gene expression markup language ( mage - ml ). genome biol . 3 , research0046 ( 2002 ). 3 . robbins , k . t . et al . neck dissection classification update : revisions proposed by the american head and neck society and the american academy of otolaryngology - head and neck surgery . arch . otolaryngol . head neck surg . 128 , 751 - 758 ( 2002 ). 4 . carvalho , a . l ., kowalski , l . p ., borges , j . a ., aguiar , s ., jr . & amp ; magrin , j . ipsilateral neck cancer recurrences after elective supraomohyoid neck dissection . arch . otolaryngol . head neck surg . 126 , 410 - 412 ( 2000 ). 5 . ridge , j . a . squamous cancer of the head and neck : surgical treatment of local and regional recurrence . semin . oncol . 20 , 419 - 429 ( 1993 ). 6 . expression profiling - best practices for data generation and interpretation in clinical trials . nat . rev . genet . 5 , 229 - 237 ( 2004 ). 7 . van de peppel , j . et al . monitoring global messenger rna changes in externally controlled microarray experiments . embo rep . 4 , 387 - 393 ( 2003 ). 8 . raghavachari , n ., bao , y . p ., li , g ., xie , x . & amp ; muller , u . r . reduction of autofluorescence on dna microarrays and slide surfaces by treatment with sodium borohydride . anal . biochem . 312 , 101 - 105 ( 2003 ). 9 . yang , y . h . et al . normalization for cdna microarray data : a robust composite method addressing single and multiple slide systematic variation . nucleic acids res . 30 , e15 ( 2002 ). 10 . ihaka , r . & amp ; gentleman , r . r : a language for data analysis and graphics . j . comp . graph . statist . 5 , 299 - 314 ( 1996 ). 11 . huber , w ., von heydebreck , a ., sultmann , h ., poustka , a . & amp ; vingron , m . variance stabilization applied to microarray data calibration and to the quantification of differential expression . bioinformatics 18 suppl 1 , s96 - s104 ( 2002 ). 12 . golub , t . r . et al . molecular classification of cancer : class discovery and class prediction by gene expression monitoring . science 286 , 531 - 537 ( 1999 ). 13 . van &# 39 ; t veer , l . j . et al . gene expression profiling predicts clinical outcome of breast cancer . nature 415 , 530 - 536 ( 2002 ). 14 . simon , r ., radmacher , m . d ., dobbin , k . & amp ; mcshane , l . m . pitfalls in the use of dna microarray data for diagnostic and prognostic classification . j . natl . cancer inst . 95 , 14 - 18 ( 2003 ). 15 . ambroise , c . & amp ; mclachlan , g . j . selection bias in gene extraction on the basis of microarray gene - expression data . proc natl acad sci usa 99 , 6562 - 6566 ( 2002 ).
| 8 |
referring to fig1 and 2 , there is depicted an a vtol / stol free wing aircraft 100 , as disclosed in co - pending application ser . no . 08 / 007 , 130 , now u . s . pat . no . 5 , 395 , 073 , incorporated herein by reference , capable of short field take - offs and landings ( stol ) and straight and level flight , and , with some minor modifications , vertical take - offs and landings ( vtol ) as well . although the features of this invention is described with reference to the embodiment shown in fig1 and 2 and disclosed in the &# 39 ; 073 patent , it is to be appreciated that the invention is equally applicable to the vtol embodiment disclosed in the &# 39 ; 057 patent . the free wing aircraft 100 comprises a fuselage 102 containing a variable pitch propulsion system 104 including an engine mounted to the fuselage rotating a variable pitch propeller 108 . a free wing 110 is connected to the fuselage 102 and is free to rotate or pivot about its spanwise axis 112 located forward of its aerodynamic center . the free wing 110 includes left and right wings 114 and 116 extending from a fixed wing root or center section 117 formed on opposite sides of the fuselage 102 and which left and right wings are coupled together as disclosed in the &# 39 ; 073 patent , to collectively freely pivot about the spanwise axis 112 . the left and right wings 114 , 116 may be adjustable in pitch relative to one another in the manner described in the aforesaid &# 39 ; 057 patent , or may be formed with elevons ( not shown ) to provide for elevator and aileron control . the aircraft 100 further comprises a tail section 118 which is mounted to a boom assembly 120 pivotally connected or articulated to the fuselage 102 for movement relative to the fuselage both into and out of alignment with the thrust line t of the propulsion system 104 to enable stol / vtol operations as well as straight and level flight . preferably , boom assembly 120 includes a pair of parallel booms 134 , each including at the rear end thereof a horizontal stabilizing member 138 and a vertical stabilizing member 140 . the feature of swinging or pivoting the entire boom assembly 120 and tail section 118 out of straight and level alignment with the fuselage 102 and the thrust line t of propulsion system 104 thereon advantageously results in an aircraft 100 capable of taking off and landing in slow flight or stol mode while retaining the advantages of free wing flight . since the tail surfaces 138 , 140 are not subject to any dynamic pressure effects caused by the slip stream of propeller 108 when in the stol flight mode of fig2 it will be appreciated that directional stability and yaw control deteriorates at extremely slow or 0 horizontal speeds as will occur during vtol flight as opposed to stol flight . the fixed wing center section 117 advantageously remain in the slip stream and the dynamic pressure acting thereon tends to provide some degree of directional stability and yaw control . further stability and control may be achieved with additional fins ( not shown ) which may project outwardly from fuselage 102 or fixed wing center section 117 to provide additional surfaces for improved stability and control . as will now occur to one of ordinary skill , such fins may either continuously project from the fuselage or fixed wing section , or may be retractably mounted therein to project from the fuselage and become operational only during vtol flight . the fixed wing root or center section 117 in horizontal flight mode depicted in fig2 performs as a wing by generating lift in association with the left and right free wing sections 114 , 116 . when the tail boom 120 is &# 34 ; raised ,&# 34 ; the fixed wing center section 117 advantageously act as an aerodynamic brake ( see , e . g ., the fig2 position ) to rapidly decelerate the aircraft 100 to slow flight . the operation of the stol free wing aircraft 100 of this invention will now be described . at takeoff , aircraft 100 is initially lifted by the variable pitch propulsion system 104 from the landing field or platform . to transition from vertical or near vertical ( take - off or flight ) to horizontal flight , the pilot or remote controller rotates the boom from its position depicted in fig2 to that depicted in fig1 . as the boom 120 is &# 34 ; lowered &# 34 ; in the direction opposite arrow a , the fuselage 102 pitches toward the horizontal which in turn causes the horizontal speed of the aircraft to increase . this in turn causes the freely rotatable wing 110 to rotate relative to the fuselage 102 in accordance with the relative wind . the effects of the relative wind acting on the freely rotating wing 110 quickly overcome the braking effects of the air flow over the fixed wing center section 117 from the variable pitch propulsion system 104 and , with increasing horizontal speed , the wing 110 develops lift . the aircraft 100 soon transitions into horizontal flight in a free wing straight and level flight mode . assuming the pilot or remote control aircraft operator desires to land the aircraft 100 in a stol free wing flight mode , the reverse procedure is used . the articulated boom is pivoted relative to the fuselage in the counter - clockwise direction a , i . e ., toward the upper surface of the fuselage . in actuality , as the boom is &# 34 ; raised ,&# 34 ; it is essentially maintained in its horizontal or straight and level flight mode of fig1 due to the dynamic pressure acting on its horizontal control surfaces 138 as a result of the straight and level direction of flight , and it is the fuselage 102 and the thrust line t of the propulsion system 104 which essentially rotates towards a vertical orientation with its nose pointed upwardly as best depicted in fig2 . as the fuselage 102 and the thrust line t rotate towards the vertical , horizontal speed is gradually decreased and the vertical thrust vector gradually increases . as a result , the lift generated by variable - pitch propulsion system 104 increases to compensate for the decreasing wing lift . the effect of varying the pitch of the propulsion system 104 on the glide path of the aircraft is schematically illustrated in fig3 . as the aircraft begins the descent for landing , the propellers of variable pitch propulsion system are set in an intermediate pitch position , as shown in ( a ) of fig3 . thus , there is provided by the variable pitch propulsion system 104 &# 34 ; room &# 34 ; for the pitch to change in either direction . when the pitch of the propeller blades is decreased relative to the plane of the propeller , as shown in ( b ) of fig3 the lift is consequently reduced , resulting in a relatively steep glide path . conversely , as shown in fig3 ( c ), increasing the pitch of the propeller blades results in greater lift , i . e ., a relatively shallow glide path . accordingly , if the aircraft is descending at too steep of an angle or too great of a speed , the pilot can increase the pitch of the propeller blades , whereupon the lift of the aircraft is increased with a resulting decrease in both speed and descent angle . similarly , if the aircraft is descending too slowly or at too shallow of an angle , the pilot can decrease the pitch of the propeller blades and accordingly decrease the lift and increase the speed and angle of descent . advantageously , adjustment of the pitch of the propeller is virtually instantaneous , thereby invoking an instantaneous response in the engine . hence , the utilization of a variable pitch propulsion system eliminates the aforementioned problems with spool - up delay . furthermore , the delay in feedback is also eliminated , since a change in the pitch of the propeller results in a virtually simultaneous change in the lift of the aircraft . it will be readily seen by one of ordinary skill in the art that the present invention fulfills all of the objects set forth above . after reading the foregoing specification , one of ordinary skill will be able to effect various changes , substitutions of equivalents and various other aspects of the invention as broadly disclosed herein . it is therefore intended that the protection granted hereon be limited only by the definition contained in the appended claims and equivalents thereof .
| 1 |
the scaffolding system generally shown as 1 has a series of upright standards interconnected by generally horizontal ledgers . the upright standards include a rosette at selective vertical spacings which are used for connection of the ledgers to the uprights . a work surface can be provided at different heights and is supported by the ledgers . in the arrangement shown in fig1 , the ladder 4 is connected to the scaffolding system 1 by means of additional horizontal tubular members 100 secured to the scaffolding system 1 , by ladder brackets 102 secured to members . basically the ladder 4 can be produced in a series of discrete segments with these segments connectable in an end to end manner to define a ladder of a desired length . the ladder can be supported in a number of different ways to one side of the scaffolding system 1 . once the ladder is in place and properly supported by the scaffolding system it is usually necessary to assemble a safety cage 2 to one side of the ladder . different labour laws require a safety cage once the ladder exceeds a certain height . with the present system , a series of safety cage sections 6 are secured to the ladder and are spaced in the length of the ladder . the sections do not need to abut one to the other and some vertical spacing between the sections is permitted . each section 6 has a first section component 8 and a second section component 10 . these section components are identical and one section has merely been reversed and assembled to the opposite side of the ladder . these section components are joined at the vertical split 12 by means of an upper connector 14 and a lower connector 14 . the upper connector at fig1 is associated with the right hand section and the lower mechanical connector is associated with the left hand section . the connector 14 is captured on section 8 and includes a t - head for insertion through a slot and rotation to engage the vertical flange of the opposite section . the section components 8 and 10 each include at the free edge 20 thereof , hook connectors 22 and 24 . hook connector 22 is shown as facing downwardly , and hook connector 24 is facing upwardly . connector 24 will form the upper connector when this section is used for defining a left hand section . these hook connectors 22 and 24 allow a worker to carry the section to the appropriate point on the ladder and temporarily secure the section to the ladder by placing the hook connector over a rung of the ladder with the upright portion of the ladder fitted within this connector . with this arrangement , the lower connector which has a u - shaped section , also engages and straddles the upright member of the ladder . once this section has been temporarily secured on the ladder , the worker can then adjust the section and positively secure it to the ladder by pushing the section at the top towards the ladder allowing the pin to be placed behind the upright to close the connector and the wedge driven downwardly to provide positive engagement . once this has been accomplished , the lower connector can also be fastened . the pin is a captured member with a “ t ” shaped bolt head for releasably engaging one side of the upper connector . once a first section has been secured , the opposite section can then be brought up and placed on the ladder . once again , it is temporarily secured and then positively secured to the ladder . once so located , the vertical split between the two sections are generally aligned . the worker can then use the wedges with the t - shaped bolts for securing the vertical split between the sections by means of the two connectors . this can be accomplished in a fast and effective manner and represents a significant labour saving over the construction of an onsite fabricated safety cage which is fabricated each time a ladder is erected . each section includes a top band 50 , a lower band 60 , and a series of interconnected vertical members 55 . each cage section is a fabricated component and allows for quick assembly and disassembly from an access ladder . turning to fig2 , it can be seen that the access ladder 4 extends above the work surface 120 and a full safety cage section 6 is shown with a single section component 8 secured to the right hand side of the ladder without a corresponding section 10 . in this case , access to the work surface 120 is desired . therefore , after section 8 has been assembled to the ladder , a safety cage exit section 74 is secured to the section 8 . the exit section includes an upper band member 76 , a lower band member 78 , a securing tubular member 80 and at least one upright 82 . the exit section includes a vertical securing face 84 for cooperating with the section 8 . a similar mechanical connection is made at the vertical split and the exit section 74 is secured to ledgers 90 and 92 by clamps 86 and 88 . with this arrangement , a safety cage structure is defined and the cage structure provides convenient access to adjacent workspaces while still providing a safe environment . details of the safety cage sections and the various securing brackets are shown in fig3 . the safety cage system , as shown in fig1 through 4 , can be used with many scaffolding systems as the structure of access ladders is similar . in addition , the connectors at the free end of each section can be shaped for specific ladders and scaffolding systems . the system uses the rungs and uprights of the ladder to simplify the securement of the safety cage sections and provides an effective arrangement for many different types of scaffolding systems . in fig5 , a new ladder structure 200 is shown with its own securing arm 250 . the ladder 250 has a series of rungs 202 which interconnect the two upright members 204 . each of these upright members are of an outwardly opening u - shape with the base of the u connected to the rungs 202 . the u - shaped upright members 204 also have the outer edges of the u partially closed by inwardly directing flanges 206 and 208 . this arrangement provides an outwardly opening securing slot which is used with a bolt having a t - head for effecting securement of the ladder as will be more fully described . in addition , each of the upright members 204 has a series of holes 210 extending in the length of the ladder . the securing arm 250 is engagable with the upright members 204 of the ladder at a number of points along the length of the upright member . the securing arm 250 includes a mechanical fastener 260 defined by a bolt 262 which receives the captured wedge 264 with the bolt 262 having a t - head received and retained within the securing slot . in addition , the securing arm 250 includes a projecting stop 266 which is received in one of the holes 210 . as shown , this stop is in engagement with a lower part of the slot 210 . once the arm has been temporarily located at an appropriate point for securement to a rosette , such as the rosette 290 in fig6 , the fastener 260 can be initially brought in engagement with the slot of the upright . the wedge member is generally in a horizontal position such that the t - head of the bolt aligns with the slot opening . it is then inserted in the slot and the wedge is rotated 90 degrees and thus rotates the bolt head 90 degrees . the wedge is then driven downwardly through the bolt and draws the t - head into engagement with the slot . there is no sliding of the securing arm along the upright due to the stop 266 engaging a lower portion of the hole 210 . the securing arm can then be secured to the rosette 290 as shown in fig6 and 8 . the t - head of the bolt is shown at 265 at fig8 . the structure of fig5 through 8 has particular application with scaffolding systems having a series of rosettes as shown in fig1 . the ladder of fig5 through 7 in addition to the engaging of the securing arm 250 is adapted to cooperate with the safety cages shown in the earlier drawings . in this case , the fasteners at the free edge of the safety cage are altered to specifically to cooperate with the modified ladder . a right hand top hook is shown in fig9 , a left hand top hook is shown in fig1 , a bottom right hand clamp is shown in fig1 and a bottom left hand clamp is shown in fig1 . the hook portions are adapted to be received in and retained by one of the series of holes 210 in the upright members . the bottom clamps are adapted to engage the securing slot of the upright members in a manner similar to the securing arm 250 . fig1 shows the safety cage secured to the ladder 250 . the hook fasteners pass through any of the holes 210 and the lower clamping members engage the securing slot . in this case , the ladder safety cage sections do have a left hand component and a right hand component . the actual ladder section without the fasteners at the free edge thereof , is not right handed or left handed but the securing of the clamps will render the section a right hand section or a left hand section . fig1 shows the preferred ladder structure engaging the scaffolding system with a series of cage sections and an exit section . although various preferred embodiments of the present invention have been described herein in detail , it will be appreciated by those skilled in the art , that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims .
| 4 |
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . the data structures and code described in this detailed description are typically stored on a computer readable storage medium , which may be any device or medium that can store code and / or data for use by a computer system . this includes , but is not limited to , magnetic and optical storage devices such as disk drives , magnetic tape , cds ( compact discs ) and dvds ( digital versatile discs or digital video discs ), and does not include computer instruction signals embodied in a transmission medium . fig1 illustrates exemplary databases 100 and 110 in accordance with an embodiment of the present invention . database 100 and database 110 contain the same information . however , database 100 is an unencrypted database comprising table 102 , whereas database 110 is a privacy - enabled database comprising table 112 . as illustrated in fig1 , social security numbers ( ssns ) in table 102 are stored in plain text . hence , anyone who has access to table 102 can view all of the information in table 102 , including the ssns . in contrast , table 112 contains the same data as table 102 , but with hashed ssns . note that generating the hash can involve performing any one of a number of one - way functions , including sha - 1 and md5 . fig2 presents a flowchart illustrating the process of protecting private information in accordance with an embodiment of the present invention . the process starts when the system receives a piece of private information to be stored in the database ( step 202 ). this piece of private information is typically a social security number , driver &# 39 ; s license number , or some other unique piece of information that is used as a key in the database to look up a record associated with an individual . next , the system checks a type value for a column in which the information is to be stored in database 110 ( step 204 ), and if this type value indicates that privacy is enabled for the column , the system creates a hash of the private information ( step 206 ). at this point , the system also throws away the private information , or alternatively stores it in a secure location ( step 207 ). as mentioned previously , any type of one - way function can be used to generate the hash . also note that several pieces of private information can be combined into the hash . once the hash is created , the hash and other related information is stored in a record in database 110 ( step 206 ). in one embodiment of the present invention , the hash is created automatically by the database in a manner that is transparent to the application . a new column attribute can be defined in the database instructing the database to always hash values upon inserting the values into the column . note that performing this hashing automatically provides security without having to modify applications that access the database . these hash values can also be indexed to speed lookups . however , range searches become complicated . one possible method for performing a range search is to generate each value in the range , perform a hash on each value , and then look up each hash in the database . fig3 presents a flowchart illustrating the processing of a query in accordance with an embodiment of the present invention . the process starts when the system receives a query that involves the piece of private information ( step 302 ). next , the system checks the associated column type in database 110 ( step 304 ). if this column type indicates that privacy is enabled , the system creates a hash of the piece of private information ( step 306 ). the system then performs the query using the hash in place of the piece of private information ( step 308 ). for example , the system can perform a “ select ” on the database where the hash is substituted in the “ where ” clause in place of the piece of private information . note that as described previously , the hashing can take place at the database level in a manner that is transparent to the application . for example , the select statement might contain the private information in the “ where ” clause , and the database , knowing that the column referenced by the “ where ” clause is marked as privacy - enabled , would automatically hash the data before performing the lookup . in one embodiment of the present invention , the hashing operations are not performed automatically , but are instead performed by a programmer . in this embodiment , the methods for checking if a column is privacy enabled and for creating the hashes are exposed to programmers through an api . the foregoing descriptions of embodiments of the present invention have been presented for purposes of illustration and description only . they are not intended to be exhaustive or to limit the present invention to the forms disclosed . accordingly , many modifications and variations will be apparent to practitioners skilled in the art . for example , although the present invention is described in the context of a relational database , the present invention is not limited to relational databases . in general , the present invention can be applied to any type of database , including relational databases , hierarchical databases , centralized databases and distributed databases . in one embodiment of the present invention , the present invention is used to hash directory information stored in a lightweight directory access protocol ( ldap ) database . additionally , the above disclosure is not intended to limit the present invention . the scope of the present invention is defined by the appended claims .
| 6 |
in all embodiments , the structural unit of the invention has two opposite transverse sides , and two end sides join the transverse sides . the transverse and end sides are each generally in one of four respective planes , and the four planes preferably intersect at right angles . the transverse sides have outer surfaces near the respective intersecting end sides and the outer sides are oriented obliquely to each other . this gives the structural unit of the invention an external or cross - sectional contour in the shape of an octagon . fig1 shows one of the many possible uses for the structural unit of the invention . a bungalow wall with roof trusses and a skeleton construction is shown . it is formed of axially elongated structural units 1 having a bar shape in accordance with the invention . a truss reinforcement 2 , which is inserted in the below described grooves 4 and 5 of the structural units 1 , also forms an upper horizontal wall termination . the frame and sash for a window 3 are also constructed using the structural elements in accordance with the invention . fig2 shows an embodiment of the structural element 1 . the element 1 has longitudinal grooves 4 and 5 extending longitudinally along the opposite transverse sides 7 and 8 . the longitudinal grooves 4 and 5 widen toward the center of the structural unit 1 . thus , the base of each groove is trapezoidal in shape . the longitudinal grooves 4 and 5 also widen toward the outside of the grooves as is shown by groove sections 9 . the side walls of the grooves and 5 first converge and at section 9 , the side walls simply reverse their inclination and diverge . the effect is to make the outward side of the grooves wider than their base portion . along the transverse sides 7 and 8 , alongside the grooves 4 and 5 , the transverse sides are oblique to each other at outer surfaces 12 ; moving toward end sides 14 and 15 of the unit . the outer surfaces 12 extend obliquely between the longitudinal edges 13 of the two opposite , parallel end sides 14 and 15 of the bar and the longitudinal grooves 4 and 5 . the outer surfaces 12 are preferably flat . together with the outer ends of the side walls of the longitudinal grooves 4 and 5 , the surfaces 12 form essentially sharp - edged , longitudinal edges 16 at which the structural unit 1 has its greatest width . it is apparent that the surfaces 12 and the sides 14 , 15 together define an octagonal peripheral profile for the structural element 1 . it is advantageous for many uses of the structural units to provide at least one lengthwise extending longitudinal groove 17 and / or 18 , respectively , on the end sides . the grooves 17 , 18 are preferably identical to each other ; and preferably have the illustrated trapezoidal cross - section , i . e . a cross - section which widens toward the middle of the bar shaped unit 1 . the side walls of the grooves 17 and 18 preferably extend parallel to the respective , adjacent oblique bar outer surfaces 12 . in other embodiments , it is possible to develop the longitudinal grooves 17 and 18 to be similar to or identical to the longitudinal grooves 4 and 5 . as already mentioned , the structural units in accordance with the invention may be fabricated from wood , metal or plastic . solid material is preferred in the case of wood units , and tubular material in the case of metal units . combinations of metal and wood are preferred for certain uses , as will become evident from the description of the following embodiments . fig3 shows another structural unit 19 in accordance with the invention , similar to that of fig2 in use . it is a tubular , metal , profile unit , comprised , for instance , of aluminum or steel . on each of its transverse sides 20 and 21 , there are two laterally spaced apart , longitudinal grooves , viz . 22 and 23 on side 20 and 24 and 25 on side 21 . on the end sides 26 and 27 of the structural unit 19 , respective longitudinal grooves 28 and 29 are formed . these are analogous to grooves 17 and 18 , respectively . fig3 shows diverse possible uses for structural units in accordance with the invention . for example , an intermediate slab 30 , with which a ceiling board 32a is engaged , is inserted into the lower lateral longitudinal groove 23 at one transverse side of the structural unit . in the upper lateral longitudinal groove 24 on the other side of the structural unit , a transverse reinforcement 31 is inserted . the lower lateral longitudinal groove 24 on the other side engages a ceiling board 32 , together with insulating material 33 . into the upper end - side longitudinal groove 28 , roof slabs 34 and 35 are engaged , via corresponding bends . the upper longitudinal groove 28 can serve as a water discharge off the roof . by means of suitable holding members , cover rails or clamps 36 , the slabs placed on the end side 26 are screwed or clamped in the longitudinal groove 28 . the roof slabs 34 , generally of sheet metal or plastic , can be stiffened by transverse ledges 37 , ribbed members 38 , or corrugated plates 39 . a plate 40 has an upper edge that is inserted into the lower end longitudinal groove 29 of the structural element 19 . the plate has a lower edge that is inserted into an upper end - side longitudinal groove 41 of another structural unit 42 , which is another embodiment in accordance with the invention . the plate 40 corresponds to the plate 2 in fig1 and serves both for reinforcing the roof truss and as a wall termination . respective cover plates 45 and 46 are inserted into the lateral side longitudinal grooves 43 and 44 of the structural unit 42 . in a lower end side longitudinal groove 47 of the lower structural element 42 , an insulating member 48 is inserted . inner boards or an inner facing 49 which has a moisture barrier rests against the member 48 . the insulating member 48 is so dimensioned that between the structural element 42 and the inner facing 49 , there is a space which prevents the transmission of cold . the free - space insulation can also be arranged on the outside , depending on the board selected , the outer facing and the k value , with or without external aeration of outer walls or roof constructions . in the case of a bungalow , emergency accommodations , and the like , the so - called breathing of the walls need not be taken into consideration if good short ventilation ( preferably cross ventilation ) of the room in question is possible and the moisture barrier lies behind the first inner board . with this type of construction , the greatest amount of energy is saved . because of the diversified uses of the structural units of the invention , the most suitable and most favorably priced structures can be erected , depending on the climatic zone , always using the same manufacturing technique . fig4 shows further uses of different structural units in accordance with the invention . here a larger and stronger structural unit 50 in accordance with the invention , e . g . of wood , is used as a column or casing . wood does not warp as much as metal under the action of heat , while metal is fireproof . the appropriate material is selected for a structural unit to suit the particular application . the structural unit is provided on the outside , i . e . at the lower end side 51 in fig4 with any desired shape covering member 52 of metal , preferably steel or aluminum , in order to provide greater resistance to weather , sound , and fire . the protective outer shaped member 52 could , however , also consist of plastic . in the longitudinal groove of the inner end side 53 , i . e . that end at the top in fig4 a plate 54 is anchored . fig4 now shows two other advantageous variants for door and window frames . a shaped molding 56 of elastic material , for instance of rubber or neoprene , is contained in a lateral longitudinal groove 55 of the larger structural unit 50 . the molding 56 has an oblique stop surface 57 . on a door 58 , with which the molding cooperates , there is a stop 59 having a beveled surface 60 which rests in sealing fashion against the oblique stop surface 57 of the shaped molding 56 when the door 58 is closed . the frame of the door 58 can also have the form of the structural unit 50 . in that case , the oblique stop surface 60 can be developed similarly to the oblique stop surface 57 by an elastic , shaped member , which is placed into a lateral longitudinal groove of this structural unit . by such a simple arrangement , which results in a tight closure , the previously customary multiple step - shaped sectional members can be avoided , as they take up a large amount of space . on that transverse side of the structural unit 50 which is to the right of fig4 a longitudinally extending stop member 61 is fastened . it has a generally u - shaped end groove which opens to the right . into the end groove 62 , an elastic sealing element 63 is inserted . a similar longitudinally extending stop member 64 has a u - shaped end groove 65 . the stop member 64 is arranged on a shaped member 67 of a separate structural unit 68 , which is also developed in accordance with the invention . within its end groove 65 , the stop member 64 has an elastic sealing member 69 , which cooperates with an oblique side surface 70 of the structural unit 50 . thus , the invention not only permits two multiply sealing oblique surface stops , but also , with the same construction , permits doors and windows which open toward the outside or the inside to be erected . the shaped member 67 is a hollow section of metal , which is connected via an insulating intermediate layer 71 with a shaped wooden strip 72 . the wooden strip 72 can be covered on its outer side with a shaped member 73 , which is plastic or preferably metal . the hollow member 67 and the wooden strip 72 together form the structural unit 68 of the invention . the unit 68 has lateral longitudinal grooves 74 and 75 . as is shown also in fig3 in connection with the structural unit 19 , a wood strip or a steel pipe 76 for serving as a reinforcement or stiffening means , can also be inserted into the hollow member 67 . on the right in fig4 at the members 67 and 72 of the trapezoidal structural unit 68 , insertion of panes of glass is suggested . a pane of glass 77 is inserted in a frame 78 of wood , metal or plastic , using ordinary fastening means , such as putty . the pane frame 78 is placed on the upper oblique outer surface 79 of the wooden strip 72 so that the entire width of the frame , which consists of the elements 68 and 78 , is not substantially greater than the width of the structural unit 68 by itself . in the right side lateral longitudinal groove 75 of the structural unit 68 , an insulating glass pane 81 comprised of two individual panes can , for instance , be inserted . another glazing corresponding to the pane 77 can be arranged on the outside , i . e . in the bottom in fig4 in a mirror - image arrangement with respect to the window 77 , 78 . thus , it is possible in a simple and space - saving manner , for instance , to produce a quadruple glazing . a single elastic profiled member 82 can serve to hold the pane of insulating glass 81 fast and to seal it off from the frame 78 of the pane 77 . in the structural units of the invention , the longitudinal grooves provided on the transverse sides and the longitudinal grooves provided on the end sides are preferably in each case arranged in the centers of the side in question . it is particularly advantageous , furthermore , to use the same shape structural units in different sizes , as required . although the dimensions in themselves may be any desired ones , they are preferably selected in such a manner that in each case , smaller structural units in accordance with the invention can be inserted into larger size , hollow structural units . in this way , a saving in storage and transportation costs is obtained . the drawings show diverse possible uses of structural units of shaped bar form in accordance with the invention . with some varients , fixed structural units having several walls or glass panes can be assembled . further , there is a possibility of providing multiply sealing oblique stops . in this connection , the outer surfaces , which are oblique with respect to each other and extend obliquely to the end sides , play a particular role . in the structural units of the invention , the transverse sides are generally wider than the end sides . the outer longitudinal edges can be fitted substantially better to ceilings , walls , or the like than can flat surfaces . as a whole , it can be said that with the development of the structural unit in accordance with the invention , the same effect is obtained as was possible heretofore only by combining a plurality of individual known special shape structural units . of particular advantage is the amazing simplicity and at the same time diversified utility of the structural unit of the invention . as shown above , many variants and combinations using shaped parts of wood , metal and plastic are possible , so that both better protection and better rigidity and a more pleasant appearance result . by insertion of rubber , sealing and insulating material at desired points , increased acoustic and heat insulation properties are obtained . although the present invention has been described in connection with preferred embodiments thereof , many variations and modifications will now become apparent to those skilled in the art . it is preferred , therefore , that the present invention be limited not by the specific disclosure herein , but only by the appended claims .
| 4 |
embodiments of the present invention will hereinafter be described with reference to the drawings . first , an arf - halftone ( ht ) mask was prepared which was a photomask manufactured by an ordinary photomask manufacturing process . a pattern formed on this arf - ht mask is a memory device under a design rule of 55 nm , and places where lithographic margins are low ( referred to as hot spots ) have been extracted in advance from this mask pattern . to extract the hot spots , the places where the lithographic margins are low are specified by a lithographic simulation of a chip from data obtained after an optical proximity effect correction ( opc ) of design data . this time , 64 hot spots were extracted . the prepared arf - ht mask was set on a fine pixel sem ( ngr4000 ) manufactured by topcon corporation , and an sem image of the hot spots was acquired . ngr4000 is an apparatus capable of acquiring a fine pixel image having 8000 × 8000 pixels , and has such a high resolution that one pixel is 2 nm on the mask . that is , the viewing field of the acquired image is 16 μm square , which is a size sufficient to run the lithographic simulation . fig1 a is a diagram showing the sem image of the arf - ht mask , and fig1 b is a diagram showing pattern outline data extracted from the sem image . the outline of the pattern was extracted by outline extraction software manufactured by ngr corporation from the acquired sem image shown in fig1 a , thereby acquiring the pattern outline data shown in fig1 b . then , the sidewall angle of the mask pattern was obtained from the width of a white line forming the pattern outline in the sem image in fig1 a . fig2 is a diagram showing the relation between the sidewall angle of the mask pattern and the signal intensity profile of the sem image . as shown in fig2 , there is a principle that a width ( a part where the signal intensity profile stands out ) w of the white line in the sem image is great when a sidewall angle θ of the mask pattern is small , while the width w of the white line is short when the sidewall angle θ is large . this principle was utilized to obtain the sidewall angle of the pattern of the arf - ht mask . actually , not simply on the basis of the width of the white line , but also on the basis of a subtle difference of intensity profiles of the white lines forming the pattern outlines in the pattern image which is the sem image , the intensity profile is matched with previously obtained intensity profile data per sidewall angle , thereby obtaining a sidewall angle . for the obtained sidewall angle , pattern sidewall angle data and the pattern outline data were stored in association with each other at predetermined intervals ( e . g ., every 100 pixels ) for each outline . fig3 is a block diagram showing the configuration of a photomask evaluation apparatus according to the present first embodiment . a photomask evaluation method in the present first embodiment can be carried out by one photomask evaluation apparatus shown in fig3 . as shown in fig3 , a mask pattern image acquiring unit 1 is connected to a lithographic simulator 4 via a pattern sidewall angle analyzing unit 2 , and also connected to the lithographic simulator 4 via a pattern outline extracting unit 3 . the mask pattern image acquiring unit 1 acquires a pattern image of an arf - ht mask m set in the present apparatus . the pattern sidewall angle analyzing unit 2 generates pattern sidewall angle data which is information on the sidewall angle of the pattern from the acquired pattern image . the pattern outline extracting unit 3 extracts pattern outline from the acquired pattern image and generates pattern outline data . the lithographic simulator 4 runs a lithographic simulation on the basis of the pattern outline data and the pattern sidewall angle data . fig4 is a flowchart showing the procedure of a photomask evaluation method in the present first embodiment . first , in step s 1 , an inspector selects by an sem a place to acquire an sem image in a mask pattern of the arf - ht mask m . in step s 2 , the mask pattern image acquiring unit 1 acquires an sem image ( pattern image ) of the mask pattern . in step s 3 , the pattern sidewall angle analyzing unit 2 calculates a pattern sidewall angle from the pattern image which is the sem image in accordance with the principle described above , thereby obtaining pattern sidewall angle data in step s 4 . after step s 3 , the pattern outline extracting unit 3 extracts in step s 5 a pattern outline from the pattern image which is the sem image , thereby obtaining pattern outline data in step s 6 . next , in step s 7 , the pattern sidewall angle data and the pattern outline data are input to the in - house lithographic simulator 4 , and a lithographic simulation was run under optical conditions used when a wafer was exposed by use of the manufactured arf - ht mask m . as a result , it was calculated in step s 8 that an exposure dose margin was 8 % and the depth of focus was 0 . 21 μm at which desired pattern dimensions could be obtained on the wafer . since it is necessary that the exposure dose margin be 10 % or more and the depth of focus be 0 . 2 μm or more to obtain the desired pattern dimensions , the place of the hot spot of the arf - ht mask m this time does not fulfill the specification in the exposure dose margin , so that the arf - ht mask m is judged as a reject product . it is to be noted that both or one of the exposure dose margin ( exposure dose range ) and the depth of focus necessary to obtain the desired pattern dimensions are called an exposure margin . alternatively , the exposure margin may be defined by pattern dimensions obtained by an optimum exposure dose and an optimum focal position . for comparison , when the pattern outline data alone was used to simply run the same simulation with a fixed sidewall angle , an exposure dose margin obtained was 11 % and a depth of focus obtained was 0 . 23 μm , such that the arf - ht mask m was judged as an acceptable product . thus , this arf - ht mask m was actually used to form a resist pattern on a wafer . an exposure apparatus was a liquid immersion exposure apparatus manufactured by nikon corporation , and na was 0 . 92 . moreover , polarized illumination was employed . as a result , the desired pattern dimensions were obtained with an exposure dose margin of 8 % and a depth of focus of 0 . 22 μm . this reveals that the influence of the sidewall angle of the mask is greater in the light exposure with a high na such as liquid immersion exposure . thus , as in the present first embodiment , considering the fluctuation of the sidewall angle of the mask enables a more faithful lithography simulation and improved accuracy in the judgment of the acceptability of the mask . as a second embodiment , a case will be described in which the pattern outline data is corrected on the basis of the pattern sidewall angle data . the procedure up to the acquisition of the pattern sidewall angle data and the pattern outline data from the sem image of the hot spot is the same as that in the first embodiment described above . the difference is that an outline position of the pattern outline data is corrected on the basis of the pattern sidewall angle data . fig5 is a block diagram showing the configuration of a photomask evaluation apparatus according to the present second embodiment . a photomask evaluation method in the present second embodiment can be carried out by one photomask evaluation apparatus shown in fig5 . in fig5 , the same reference numerals are assigned to the same parts as those in fig3 . as shown in fig5 , a mask pattern image acquiring unit 1 is connected to an outline data correcting unit 5 via a pattern sidewall angle analyzing unit 2 , and also connected to the outline data correcting unit 5 via a pattern outline extracting unit 3 . the outline data correcting unit 5 is connected to a lithographic simulator 4 . the outline data correcting unit 5 corrects a pattern outline position of the pattern outline data generated in the pattern outline extracting unit 3 on the basis of the pattern sidewall angle data generated in the pattern sidewall angle analyzing unit 2 . the lithographic simulator 4 runs a lithographic simulation on the basis of the pattern outline data which has been corrected by the outline data correcting unit 5 . fig6 is a flowchart showing the procedure of the photomask evaluation method according to the present second embodiment . first , in step s 11 , an inspector selects by an sem a place to acquire an sem image in a mask pattern of the arf - ht mask m . in step s 12 , the mask pattern image acquiring unit 1 acquires an sem image ( pattern image ) of the mask pattern . in step s 13 , the pattern sidewall angle analyzing unit 2 calculates a pattern sidewall angle from the pattern image which is the sem image in accordance with the principle described above , thereby obtaining pattern sidewall angle data . in step s 14 , the pattern outline extracting unit 3 extracts a pattern outline from the pattern image which is the sem image to obtain pattern outline data , and the outline data correcting unit 5 corrects the outline position of the pattern outline data on the basis of the pattern sidewall angle data , thereby obtaining corrected pattern outline data in step s 15 . next , in step s 16 , the corrected pattern outline data is input to the in - house lithographic simulator 4 , and a lithographic simulation was run under optical conditions used when a wafer was exposed by use of the manufactured arf - ht mask m , thereby calculating an exposure margin in step s 17 . the processing in step s 14 means that the pattern outline extracted under uniform conditions from the sem image is corrected to an optically significant outline position . the processing in the present second embodiment is effective when the pattern sidewall angle data is not easily taken into the lithographic simulation . fig7 is a diagram showing the outline position of the sem image and an optically significant outline position in the section of a mask pattern . in the case of the outline in an sem image conventionally used , an outline as high as about 50 % of a thickness h of a halftone film is extracted . on the other hand , an optically significant outline in the lithographic simulation which considers the mask as a planar object without a three - dimensional structure is located at about 25 % from the bottom of the halftone film . that is , as shown in fig7 , the optically significant outline position corresponds to an outline shifted outside the outline position acquired from the sem image . a uniform shift amount has only to be added to the outline position from the sem image when the sidewall angle θ is fixed , but a shift amount corresponding to the sidewall angle needs to be added to the outline position from the sem image when the sidewall angle varies depending on the place . for example , the smaller the sidewall angle θ is , the greater the shift amount is . in the present second embodiment , the outline position is corrected with the pattern sidewall angle data . that is , the outline position is shifted in accordance with the sidewall angle . the lithographic simulation was run with this corrected pattern outline data , such that an improvement substantially equal to that in the first embodiment described above was verified in the accuracy of the mask acceptability judgment . as described above , according to the embodiments , the information on the sidewall angle of the mask pattern is acquired from the acquired sem image , and the lithographic simulation is run on the basis of the pattern sidewall angle data and the pattern outline data . alternatively , the outline position of the pattern outline data is corrected on the basis of the pattern sidewall angle data , and the lithographic simulation is run on the basis of the corrected pattern outline data . an exposure margin thus calculated is judged to find out whether this exposure margin is the desired exposure margin , such that it is possible to inspect whether the mask pattern is finished in desired dimensions . thus , it is possible to properly take , into the lithographic simulation , the influence of the sidewall angle of the mask pattern which has heretofore been a problem , and achieve the correspondence between the results of the lithographic simulation and the results of the actual wafer light exposure . it is to be noted that the present invention is not exclusively limited to the embodiments described above , and modifications can be properly made without departing from the spirit thereof . for example , the information on the sidewall angle of the pattern may be acquired separately by a scatterometry method based on an optical technique , rather than from the sem image . moreover , this information may be acquired from an sem which obliquely applies an electron beam . further , while the photomask evaluation method has been described in the embodiments , a photomask judged to satisfy a desired specification by this evaluation method can be used to form a circuit pattern on a semiconductor substrate such that a semiconductor device is manufactured . according to the present embodiments , it is possible to provide a photomask evaluation method , a photomask evaluation apparatus and a semiconductor device manufacturing method capable of achieving the correspondence between the results of the lithographic simulation and the results of the actual wafer light exposure . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .
| 6 |
referring to the drawing , there is shown the distal end portion of a stent delivery catheter indicated generally by numeral 10 . the stent 11 itself ( fig2 ) may typically comprise a braided or slotted , non - self - expanding metal or plastic tube whose inside diameter closely conforms to the exterior of the expander member 12 when the expander member is non - inflated ( not shown ). the delivery catheter 13 may be introduced into the vascular system 15 in a conventional way and then advanced through the vascular system until the expander member 12 on the catheter body stock 14 carrying the yet non - expanded stent is juxtaposed relative to a treatment site in the vascular system . once so positioned , the expander member 12 is inflated and , in doing so , the stent is also expanded to a predetermined diameter that is a function of the outside diameter of the expander member 12 at a desired pressure . once the stent has been expanded in the manner described , the expander member 12 is again deflated by aspirating the inflation fluid therefrom and , once deflated , is extracted from the vascular system . it is , of course , desirable that upon aspiration , the expander member 12 deflates so as to closely conform to the outside diameter of the catheter body stock 14 on which it is mounted . so - called winging or pancaking of the expander member is undesirable . furthermore , when the end - use of the balloon catheter is for deploying non - self - expanding stents , it is important that the expander member 12 possess high abrasion resistance so as to prevent rupture as the surface of the expander member 12 frictionally engages the stent during expansion thereof . as shown in fig1 the catheter body stock 14 comprises an elongated , flexible tube having an inflation lumen 16 extending the length thereof . affixed to the distal end portion of the catheter body stock 14 is a generally cylindrical , tubular expander member having conically - shaped end portions as at 18 and 20 which are bonded to the exterior wall of the catheter body stock 14 in zones 22 and 24 to define a hollow chamber 26 when the expander member 12 is inflated . the distal end of the inflation lumen 16 extends beyond the seal zone 22 permitting inflation fluid under pressure to flow into the chamber 26 and expand the expander member . in accordance with the present invention , the expander member 12 is formed by blow - molding and stretching a parison previously formed in a coextrusion process such as is described in the hamlin u . s . pat . no . 5 , 270 , 086 . thus , the resulting expander member 12 has double walls 28 and 30 , respectively . the coextruded parison is designed to have an inner wall comprising pet and an outer wall of polyamide , with nylon - 12 being preferred . several nylons suitable for the expander member are grilamid l25 , ems , vestamide 2101 f , huls and vestamide 1801 f , huls . the pet component may be ici 5822 c or shell traytuf 1006 . when subjected to the stretch / blow - molding operation , both the pet layer and the nylon layer are biaxially oriented within a heated mold until a desired composite wall thickness and outer diameter are attained . typical wall thickness in an unexpanded state may range from about 0 . 0004 - 0 . 0009 , preferably about 0 . 00045 - 0 . 0006 inches . when the end - use of the balloon catheter is stent delivery , it is important that the expander member 12 exhibit a relatively low compliance factor so that the stent will only be expanded to a desired outside diameter . those skilled in the art will recognize that if the expander member is highly compliant , it becomes more difficult to control the extent of expansion of the stent being delivered thereby . it has been determined that if the compliance factor is kept below about 15 percent , and preferably 13 percent or less for pressures in the range of from 18 atmospheres to 18 atmospheres , good control over expanded stent diameter can be realized . it has been determined that when the outer wall 30 of the expander member 12 comprises polyamide , such as nylon - 12 , and when the inner wall 28 is pet , of the percent by weight of the polyamide in the composite is in the range of from 20 to 80 percent , the balloon &# 39 ; s compliance can be maintained in the desired range indicated . the pet layer 28 provides an expander member with a high burst strength while the outer nylon - 12 layer 30 offers excellent abrasion resistance . to improve the conformance parameter of the composite , double - walled expander member , such that upon inflation and subsequent deflation , it conforms closely to the profile of the catheter body stock 14 , temperature annealing of the expander member in accordance with the teachings of the aforereferenced roychowdhury patent application may be used . preferably , a blown expander member is taco - wrapped in a sheath and subjected to a heating cycle at a temperature between 75 ° and 95 ° c . for a period of time in the range of from 1 to 4 hours . the annealed double - walled balloon has been found to closely conform to the outer diameter of the catheter body stock 14 when first expanded to a pressure of about 8 atmospheres and subsequently deflated by aspirating the inflation fluid from the chamber 26 . no appreciable winging results . it has also been found that the distension curve for the composite , double - walled balloon can be tailored based upon the nylon - 12 content and the annealing conditions imposed . an expander member having a diameter of 3 . 0 mm and comprising coextruded pet , and nylon - 12 in ratios from about 55 - 45 to 65 - 35 were formed and during the stretch / blow - molding thereof were stretched a distance of from 5 : 1 to 8 : 1 in the radial direction . the expander members exhibited a wall thickness in the range of from 0 . 0005 to 0 . 001 inches and in an unexpanded state and were found to exhibit the following composite hoop stresses and burst pressures for the indicated wall thicknesses . hoop stress was calculated as a σ = pd / 2t , wherein t is the balloon wall thickness measured in an unexpanded state , p is the burst pressure measured at 37 ° c ., and d is the diameter at 10 atmospheres and room temperature . ______________________________________ hoop stresswall ( in .) nylon (%) burst ( psi ) ( psi ) ______________________________________ . 00058 38 . 2 441 . 8 44 , 941 . 0007 38 . 5 436 . 4 36 , 782 . 0009 41 . 7 483 . 0 35 , 621______________________________________ fig3 a and 3b are graphs reflecting the variation in the compliance characteristics of average value for five groups of five samples each of catheter expander members when each group of five was subjected to annealing temperatures varying from 75 ° for the first group to 95 ° c . for the fifth group in each case for one hour . the expander members were each 3 . 0 mm in diameter and 20 mm in length . they comprised 40 % nylon , 60 % pet coextrusions . these curves show that by proper control of annealing temperatures , it is possible to tailor the expander members to exhibit desired compliance characteristics in a range of from 10 % to 18 % between 8 and 18 atmospheres . the relative percentages of nylon and pet in the co - extrusion also has an effect on the compliance characteristics . measurements were taken at room temperature and using water as the inflation medium . a summary of the results is shown in table 1 below . table i__________________________________________________________________________1 hour @ 75 ° c . 1 hour @ 80 ° c . 1 hour @ 85 ° c . 1 hour @ 90 ° c . 1 hour @ 95 ° c . psi average psi average psi average psi average psi average__________________________________________________________________________14 . 7 2 . 921 14 . 7 2 . 879 14 . 7 2 . 805 14 . 7 2 . 754 14 . 7 2 . 64929 . 4 2 . 935 29 . 4 2 . 893 29 . 4 2 . 827 29 . 4 2 . 783 29 . 4 2 . 67244 . 1 2 . 946 44 . 1 2 . 905 44 . 1 2 . 847 44 . 1 2 . 797 44 . 1 2 . 68758 . 8 2 . 953 58 . 8 2 . 915 58 . 8 2 . 861 58 . 8 2 . 809 58 . 8 2 . 69873 . 5 2 . 960 73 . 5 2 . 925 73 . 5 2 . 864 73 . 5 2 . 821 73 . 5 2 . 71088 . 2 2 . 970 88 . 2 2 . 939 88 . 2 2 . 886 88 . 2 2 . 830 88 . 2 2 . 719102 . 5 2 . 982 102 . 5 2 . 956 102 . 5 2 . 902 102 . 5 2 . 850 102 . 5 2 . 732117 . 6 2 . 996 117 . 6 2 . 976 117 . 6 2 . 916 117 . 6 2 . 864 117 . 6 2 . 748132 . 3 3 . 013 132 . 3 2 . 997 132 . 3 2 . 937 132 . 3 2 . 892 132 . 3 2 . 769147 . 0 3 . 029 147 . 0 3 . 018 147 . 0 2 . 967 147 . 0 2 . 923 147 . 0 2 . 806161 . 7 3 . 042 161 . 7 3 . 034 161 . 7 2 . 996 161 . 7 2968 161 . 7 2 . 857176 . 4 3 . 056 176 . 4 3 . 047 176 . 4 3 . 022 176 . 4 3 . 002 176 . 4 2 . 919191 . 1 3 . 069 191 . 1 3 . 061 191 . 1 3 . 046 191 . 1 3 . 036 191 . 1 2 . 978205 . 8 3 . 082 205 . 8 3 . 079 205 . 8 3 . 065 205 . 8 3 . 061 205 . 8 3 . 019220 . 5 3 . 101 220 . 5 3 . 089 220 . 5 3 . 065 220 . 5 3 . 079 220 . 5 3 . 054235 . 8 3 . 116 235 . 8 3 . 104 235 . 8 3 . 101 235 . 8 3 . 095 235 . 8 3 . 079249 . 9 3 . 132 249 . 9 3 . 118 249 . 9 3 . 118 249 . 9 3 . 115 249 . 9 3 . 104264 . 6 3 . 153 264 . 6 3 . 135 264 . 6 3 . 138 264 . 6 3 . 136 264 . 6 3 . 123279 . 3 3 . 173 279 . 3 3 . 151 279 . 3 3 . 154 279 . 3 3 . 155 279 . 3 3 . 141294 . 0 3 . 192 294 . 0 3 . 171 294 . 0 3 . 170 294 . 0 3 . 179 294 . 0 3 . 160308 . 7 3 . 214 308 . 7 3 . 192 308 . 7 3 . 189 308 . 7 3 . 197 308 . 7 3 . 184323 . 4 3 . 234 323 . 4 3 . 215 323 . 4 3 . 208 323 . 4 3 . 222 323 . 4 3 . 209338 . 1 3 . 250 338 . 1 3 . 233 338 . 1 3 . 227 338 . 1 3 . 237 338 . 1 3 . 228__________________________________________________________________________ this invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be understood that the invention can be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment details and operating procedures , can be accomplished without departing from the scope of the invention itself .
| 0 |
the following description relates to various embodiments of methods a for a vehicle system which includes an exhaust fluid sensor . in one example embodiment , a method comprises indicating degradation of an exhaust fluid sensor positioned upstream of an exhaust injector based on a first exhaust fluid concentration when exhaust fluid is present at the sensor and a second exhaust fluid concentration after exhaust fluid is evacuated away from the sensor . the first exhaust fluid concentration may be determined when the engine is on and after an exhaust gas treatment system is started . the second exhaust fluid concentration may be determined when after the engine is shutdown and the exhaust gas treatment system is shutdown . by comparing the first exhaust fluid concentration and the second exhaust fluid concentration measured under different conditions , for example , degradation of the exhaust fluid sensor may be indicated . for example , the first exhaust fluid concentration may be expected to be higher than the second exhaust fluid concentration because is exhaust fluid is present only when the first exhaust fluid concentration is measured . in this way , degradation of the exhaust fluid sensor may be determined . fig1 shows a schematic diagram of engine system 100 . engine system 100 includes engine 102 which may be included in a propulsion system of a vehicle . engine 102 may be controlled at least partially by a control system including controller 104 and by input from a vehicle operator via an input device ( not shown ). intake air is inducted into engine 102 via intake passage 106 , an exhaust gas resulting from combustion in engine 102 is exhausted via exhaust passage 108 eventually leading to a tailpipe ( not shown ) that eventually routes exhaust gas to the atmosphere . as shown , exhaust gas treatment system 110 including exhaust gas treatment device 112 is shown arranged along exhaust passage 108 . in the example embodiment of fig1 , exhaust gas treatment device 112 may be a selective catalyst reduction ( scr ) system , for example . in other examples , exhaust gas treatment system 110 may additionally or alternatively include a three way catalyst ( twc ), a no x trap , various other emission control devices , or combinations thereof . further , as depicted , exhaust fluid injector 114 is disposed upstream of exhaust gas treatment device 112 . exhaust fluid injector 114 injects an exhaust fluid into the exhaust stream for reaction with no x in exhaust gas treatment device 112 responsive to signals received from controller 104 . the exhaust fluid may be a reductant , for example , such as urea or ammonia . in the example depicted in fig1 , exhaust fluid injector 114 is supplied with exhaust fluid from exhaust fluid storage tank 116 . exhaust fluid storage tank 116 may be a reservoir suitable for holding the exhaust fluid throughout a range of temperatures , for example . the exhaust fluid is pumped from exhaust fluid storage tank 116 via pump 118 . pump 118 pumps exhaust fluid from exhaust fluid storage tank 116 and delivers the exhaust fluid to exhaust fluid passage 120 at a higher pressure . a pressure in exhaust fluid passage 120 may be measured by pressure sensor 122 , for example , disposed in exhaust fluid passage 120 . as shown , exhaust fluid passage 120 fluidically couples pump 118 and injector 114 . further , reverting valve 124 is mechanically coupled to pump 118 such that a flow of fluid through the pump may be reversed . as an example , it may be desired to reverse the flow through the pump after engine shutdown such that exhaust fluid passage 120 may be drained of exhaust fluid . a concentration of the exhaust fluid which passes through exhaust fluid passage 180 may be determined via exhaust fluid sensor 126 , which is positioned upstream of injector 114 . for example , the concentration of the exhaust fluid may be determined so that it may be determined whether or not the exhaust fluid storage tank is holding the correct fluid or fluid mixture . thus , the exhaust fluid sensor may output a first reading indicating a first exhaust fluid concentration during engine operation when the exhaust fluid line is full and exhaust fluid is present at the exhaust fluid sensor . the exhaust fluid sensor may further output a second reading indicating a second exhaust fluid concentration after engine shutdown when the exhaust fluid line is empty and exhaust fluid is not present at the sensor . the first reading may be compared to the second reading in order to test the functionality of the exhaust fluid sensor , for example , as will be described in greater detail below with reference to fig2 - 5 . controller 104 may be a microcomputer including the following , although not shown in fig1 : a microprocessor unit , input / output ports , an electronic storage medium for executable programs and calibration values ( e . g ., a read only memory chip ), random access memory , keep alive memory , and a data bus . storage medium read - only memory may be programmed with computer readable data representing instructions executable by the microprocessor for performing the methods described below as well as other variants that are anticipated but not specifically listed . for example , the controller may receive communication ( e . g ., input data ) from the various sensors , process the input data , and trigger the actuators in response to the processed input data based on instruction or code programmed therein corresponding to one or more routines . example routines are described herein with reference to fig2 - 5 . controller 104 sends signals to communications system 128 , such as a wireless network or controller area network ( can ). as an example , after processing data from exhaust fluid sensor 126 and determining that exhaust fluid sensor 126 is degraded , controller 104 send may set a fault code and send a message to communications system 128 indicating degradation of exhaust fluid sensor 126 . communications system 128 may then notify the operator of the vehicle via an operator interface , such as a dashboard or other vehicle display , for example . in some examples , communications system 128 may additionally or alternatively send a message to a third party 130 , such a selling dealership of the vehicle or another service center . thus , the vehicle system includes an exhaust gas treatment system which includes an exhaust fluid sensor . the exhaust fluid sensor measures an exhaust fluid concentration and sends a signal to the controller indicating the concentration . as will be described below , based on the exhaust fluid readings , degradation of the exhaust fluid sensor may be determined . fig2 - 5 show flow charts illustrating routines for an engine system , such as engine system 100 described above with reference to fig1 . specifically , fig2 shows a routine for controlling start - up and shutdown of an exhaust gas treatment system which includes an exhaust fluid sensor . fig3 shows a routine for starting - up an exhaust gas treatment system while the engine is on and measuring a first exhaust fluid concentration . fig4 shows a routine for shutting down the exhaust gas treatment system after the engine is shutdown and measuring a second exhaust fluid concentration . fig5 shows a routine for diagnosing the exhaust fluid sensor based on the first and second exhaust fluid concentrations . further , fig6 shows a graph illustrating various parameters of the exhaust gas treatment system while the exhaust gas treatment system is shutting down . fig2 shows a flow chart illustrating routine 200 for controlling start - up and shutdown an exhaust gas treatment system which includes an exhaust fluid sensor , such as exhaust gas treatment system 110 described above with reference to fig1 . specifically , the routine determines when to run start - up and shutdown of the exhaust gas treatment system based on whether the engine is running . at 202 of routine 200 , it is determined if the engine is on . as an example , it may be determined if the engine is on if the engine is spinning . further , it maybe determined if the engine was recently started . for example , it may be determined if the coolant temperature is less than a threshold temperature or if a time since engine start is less than a threshold . if it is determined that the engine is not on , the routine ends . on the other hand , if it is determined that the engine is on , the routine proceeds to 204 where start - up of the exhaust gas treatment system is carried out according to routine 300 of fig3 . as will be described in greater detail below , once the exhaust gas treatment system is operation , a first exhaust fluid reading may be determined . at 206 of routine 200 , it is determined if the engine is shutdown . as an example , it may be determined if the engine is not spinning . further , it may be determined if the engine was recently shutdown . for example , it may be determined if the coolant temperature is greater than a threshold temperature or if the time since engine shutdown is less than a threshold . if it is determined that the engine is still on , the routine moves to 212 and current operation is continued . on the other hand , if it is determined that the engine is off ( e . g ., shutdown ), routine 200 continues to 208 where shutdown of the exhaust gas treatment system is carried out according to routine 400 of fig4 . as will be described in greater detail below , once the exhaust gas treatment system is shutdown , a second exhaust fluid reading may be determined . at 210 of routine 200 , exhaust gas fluid sensor diagnostics are carried out according to routine 500 of fig5 . as will be described in greater detail below , the first exhaust fluid reading determined in routine 300 and the second exhaust fluid reading determined in routine 400 are compared such that degradation of the exhaust fluid sensor may be determined . continuing to fig3 , a flow chart illustrating routine 300 for estimating a first exhaust fluid concentration during engine operation is shown . specifically , the routine starts - up the exhaust gas treatment system measures the second exhaust fluid concentration via an exhaust fluid sensor disposed in an exhaust fluid passage once the exhaust gas treatment system is in operation . at 302 of routine 300 , it is determined if the engine is on . as an example , it may be determined if the engine is on if the engine is spinning . further , it maybe determined if the engine was recently started . for example , it may be determined if the coolant temperature is less than a threshold temperature or if a time since engine start is less than a threshold . if it is determined that the engine is not on , the routine ends . at 304 , it is determined if a temperature of an exhaust gas treatment device of the exhaust gas treatment system is greater than a threshold temperature . for example , the exhaust gas treatment device may need to be to have warmed - up to a certain temperature ( e . g ., the threshold temperature ) before exhaust fluid is injected in the exhaust passage upstream of the exhaust gas treatment device in order to reduce a possibility of degradation of the exhaust gas treatment device . if it is determined that the temperature of the exhaust gas treatment device is less than the threshold temperature , the routine waits to proceed until the temperature has reached the threshold temperature . once it is determined that the exhaust gas treatment device temperature is greater than the threshold temperature , routine 300 continues to 306 where the pump pressure is increased . for example , the controller may turn the pump on or increase a voltage supplied to the pump to increase the pump pressure . by increasing the pump pressure , an amount of exhaust fluid drawn from the exhaust fluid storage tank and supplied to the exhaust fluid passage may be increased , thereby increasing a pressure in the exhaust fluid passage . at 308 , the injector is opened . the injector may be opened such that the system fills with the exhaust fluid , for example , and air bubbles are cleared from the exhaust fluid passage . once the injector has been opened for a threshold duration , the injector is closed at 310 . once the injector is closed , pressure may build in the exhaust fluid passage so that the injector is ready to inject the exhaust fluid into the exhaust passage at a desired pressure when exhaust fluid injection is requested . thus , at 312 , it is determined if the pump pressure is greater than a threshold pressure . the threshold pressure may be a desired pressure at which to inject exhaust fluid into the exhaust passage , for example . if the pump pressure is not greater than the threshold pressure , the system waits to proceed until the pump pressure reaches the threshold pressure . once it is determined that the pump pressure is greater than the threshold pressure , routine 300 continues to 314 where a first exhaust fluid concentration is determined . thus , the first exhaust fluid concentration is measured when the exhaust fluid passage is filled with exhaust fluid and the system is ready to inject exhaust fluid into the exhaust passage . as such , a possibility that air bubbles might be in the exhaust fluid passage and affect the exhaust fluid concentration measurement is decreased . the first exhaust fluid reading may be obtained via exhaust fluid sensor 126 described above with reference to fig1 , for example . the first exhaust fluid concentration may correspond to an amount of urea or ammonia in the exhaust fluid mixture . for example , the urea may be aqueous urea which contains water . by determining the exhaust fluid concentration when the exhaust fluid passage is full and the exhaust gas treatment system is ready for operation , a vehicle operator and / or third party may be notified if the exhaust fluid concentration is too high or too low and the exhaust fluid is not suitable for use in the exhaust gas treatment system , for example . further , in some embodiments , the routine may further include adjusting an exhaust fluid injection to the exhaust passage based on the first exhaust concentration reading obtained when exhaust fluid is present at the exhaust fluid sensor . for example , if the measured concentration of the exhaust fluid is less than expected , a greater amount of exhaust fluid may be injected to the exhaust passage such that a desired amount of exhaust fluid is received by the catalyst . as another example , if the measured concentration of the exhaust fluid is greater than expected , a lesser amount of exhaust fluid may be injected to the exhaust passage such that a desired amount of exhaust fluid is delivered to the catalyst . thus , after start - up of the exhaust gas treatment system during engine operation , a first exhaust fluid concentration may be determined . the first exhaust fluid concentration corresponds to an exhaust fluid reading when the exhaust fluid passage is full and there is exhaust fluid present at the exhaust fluid sensor . as such , the first exhaust fluid concentration may be measured at any time while the engine is on and after the exhaust gas treatment system has been started - up and is in operation . the first exhaust fluid reading may indicate whether a suitable exhaust fluid is being used by the exhaust gas treatment system , for example . further , as will be described below , the first exhaust fluid concentration may be compared to a second exhaust fluid concentration to diagnose the exhaust fluid sensor . fig4 shows a flow chart illustrating routine 400 for estimating a second exhaust fluid concentration after engine shutdown . specifically , the routine shuts down the exhaust gas treatment system after engine shutdown and evacuates exhaust fluid from an exhaust fluid passage in which an exhaust fluid sensor is disposed . for example , exhaust fluid may be drained from a pump , exhaust fluid passage , and injector of the system after engine shutdown such that degradation of the system due to freezing , corrosion , or the like is reduced during while the engine is off . once the exhaust fluid is drained from the exhaust fluid passage , a second exhaust fluid concentration is determined . at 402 of routine 400 , it is determined if the engine is shutdown . as an example , it may be determined if the engine is not spinning . further , it may be determined if the engine was recently shutdown . for example , it may be determined if the coolant temperature is greater than a threshold temperature or if the time since engine shutdown is less than a threshold . if it is determined that the engine is still on , the routine ends . on the other hand , it if is determined that the engine is shutdown , routine 400 continues to 404 where it is determined if the pump pressure has decreased below a threshold pressure . for example , the pressure in the system may be decreased such that the system may be shutdown and the flow of exhaust fluid from the exhaust fluid storage tank may be reduced . as an example , curve 602 in fig6 shows the pump pressure over time after an engine shutdown . although the pump pressure is decreased , the pump may remain on . for example , curve 604 of fig6 shows pump dc . if it is determined that the pump pressure is not less than the threshold pressure , routine 400 of fig4 waits until the pump pressure has decreased below the threshold pressure before proceeding . once it is determined that the pump pressure is below the threshold pressure , a reverting valve is actuated . the reverting valve may be actuated such that a flow through the pump may be reversed , for example . actuation of the reverting valve is depicted by curve 606 in fig6 , for example . in this manner , exhaust fluid that is in the pump may be sent back to the exhaust fluid storage tank and , additionally , exhaust fluid may be drained from the exhaust fluid passage via the pump . further , once the reverting valve is actuated , the injector is opened for a threshold duration . curve 608 in fig6 shows the opening of the injector after the pump pressure has decreased . as such , some exhaust fluid may be evacuated from the exhaust fluid passage via the injector and a pressure in the exhaust fluid passage may be further reduced . once the injector has been closed , routine 400 proceeds to 410 and a second exhaust fluid concentration is determined . thus , the second exhaust fluid concentration is measured after the exhaust fluid has been evacuated from the exhaust fluid passage and exhaust fluid is not present at the exhaust fluid sensor . as such , the second exhaust fluid reading may correspond to a concentration of a component of the exhaust fluid mixture , such as urea or ammonia , in air or exhaust gas . the second exhaust fluid reading may be obtained via exhaust fluid sensor 126 described above with reference to fig1 , for example . in some examples , the second exhaust fluid concentration may be measured to determined if exhaust fluid has been evacuated from the exhaust fluid passage , for example . an amount of fluid injected to the exhaust passage may not be adjusted responsive to the measured second exhaust concentration , however . for example , the second exhaust concentration is obtained when exhaust fluid is not present at the sensor and is not representative of the exhaust fluid concentration when exhaust fluid is present at the sensor and ready for delivery to the exhaust passage . in some embodiments , the second exhaust fluid concentration may be determined immediately subsequent an engine key - on , or other start request ( such as key - less entry and / or key - less push - button start ), before the exhaust gas treatment system is pressurized . for example , the second exhaust fluid concentration may be determined at engine key - on if the time the engine has been shutdown ( e . g ., key - off ) or soak time is greater than a threshold duration . in such an embodiment , the exhaust fluid passage may still be drained and exhaust fluid is not present at the sensor , as the system has not yet pressurized the exhaust fluid in the exhaust gas treatment system . thus , after the engine is shutdown and exhaust fluid is drained from the exhaust fluid passage , pump , and injector , a second exhaust fluid concentration may be determined . the second exhaust fluid concentration corresponds to an exhaust fluid reading when the exhaust fluid passage is empty and there is not exhaust fluid present at the exhaust fluid sensor . the second exhaust fluid reading may indicate whether the exhaust fluid has actually drained from the exhaust fluid passage , for example . further , as will be described below , the second exhaust fluid concentration may be compared to the first exhaust fluid concentration to diagnose the exhaust fluid sensor . fig5 shows a flow chart illustrating routine 500 for diagnosing an exhaust fluid sensor , such as exhaust fluid sensor 126 described above with reference to fig1 . specifically , the routine indicates degradation of the exhaust fluid sensor based on a first exhaust fluid concentration obtained when an exhaust fluid passage between a pump and an injector is full ( e . g ., the first exhaust fluid concentration determined in routine 300 ) relative to a second exhaust fluid concentration obtained after the exhaust fluid passage is has been cleared of exhaust fluid ( e . g ., the second exhaust fluid concentration determined in routine 400 ). at 502 of routine 500 , the second exhaust fluid concentration is compared to the first exhaust fluid concentration . for example , the controller may determine a difference between the first exhaust fluid concentration and the second exhaust fluid concentration . curve 612 in fig6 shows an exhaust fluid concentration signal . as depicted , when the pump pressure is high before the reverting valve is actuated and the injector is opened ( e . g ., when the engine is on ), the exhaust fluid concentration signal has a higher value than after the pump pressure has decreased , the pump direction has been reversed by actuation of the reverting valve , and the injector has been opened ( e . g ., after engine shutdown ). this is because there is exhaust fluid present in the exhaust fluid passage when the first reading is obtained and there is no exhaust fluid present in the exhaust fluid passage when the second reading is obtained , for example . area 612 in fig6 shows a time when the first exhaust fluid concentration may be determined and area 614 in fig6 shows a time when the second exhaust fluid concentration may be determined . thus , at 504 of routine 500 it is determined if the difference between the first exhaust fluid concentration and the second exhaust fluid concentration is greater than a threshold difference . as an example , the threshold difference may be the difference between a minimum exhaust fluid concentration during engine operation and a concentration of an exhaust fluid component in air or exhaust gas . if it is determined that the difference is not greater than a threshold difference , the routine moves to 512 and it is indicated that the sensor is not degraded . on the other hand , if the difference between the first exhaust fluid concentration and the second exhaust fluid concentration is greater than the threshold difference , routine 500 proceeds to 506 and degradation of the exhaust fluid sensor is indicated . indicating degradation of the exhaust fluid sensor may include setting a fault code in the controller at 508 . further , indicating degradation of the controller may additionally or alternatively include sending a message to an operator interface at 510 . for example , the vehicle operator may be notified that the exhaust fluid sensor is degraded via a message or indicator lamp on a vehicle display such as a dashboard . as another example , a third party , such as a vehicle service center , may be notified of the degraded exhaust fluid sensor such that the third party may inform the vehicle operator to bring the vehicle in for service . thus , by comparing a first exhaust fluid concentration sensed while the engine is on and there is exhaust fluid present at the exhaust fluid sensor and a second exhaust fluid concentration sensed after the engine is shutdown and there is not exhaust fluid present at the exhaust fluid sensor , degradation of the exhaust fluid sensor may be determined . the vehicle operator may be notified of the degraded sensor via the vehicle interface , for example , and the vehicle may be taken to a service center such that the exhaust fluid sensor may be replaced or repaired . note that the example control and estimation routines included herein can be used with various engine and / or vehicle system configurations . the specific routines described herein may represent one or more of any number of processing strategies such as event - driven , interrupt - driven , multi - tasking , multi - threading , and the like . as such , various acts , operations , or functions illustrated may be performed in the sequence illustrated , in parallel , or in some cases omitted . likewise , the order of processing is not necessarily required to achieve the features and advantages of the example embodiments described herein , but is provided for ease of illustration and description . one or more of the illustrated acts or functions may be repeatedly performed depending on the particular strategy being used . further , the described acts may graphically represent code to be programmed into the computer readable storage medium in the engine control system . it will be appreciated that the configurations and routines disclosed herein are exemplary in nature , and that these specific embodiments are not to be considered in a limiting sense , because numerous variations are possible . for example , the above technology can be applied to v - 6 , i - 4 , i - 6 , v - 12 , opposed 4 , and other engine types . the subject matter of the present disclosure includes all novel and nonobvious combinations and subcombinations of the various systems and configurations , and other features , functions , and / or properties disclosed herein . the following claims particularly point out certain combinations and subcombinations regarded as novel and nonobvious . these claims may refer to “ an ” element or “ a first ” element or the equivalent thereof . such claims should be understood to include incorporation of one or more such elements , neither requiring nor excluding two or more such elements . other combinations and subcombinations of the disclosed features , functions , elements , and / or properties may be claimed through amendment of the present claims or through presentation of new claims in this or a related application . such claims , whether broader , narrower , equal , or different in scope to the original claims , also are regarded as included within the subject matter of the present disclosure .
| 8 |
referring to fig1 a and 1b , an arbitration controller apparatus is shown , such apparatus being shown in a duplex form . the present application teaches duplex arbitration control . simplex arbitration control is taught in co - pending sister application ser . no . 163 , 045 . each central processing unit ( cpu ) 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; is shown connected via a tri - state bus to a corresponding arbitration circuit 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; respectively . cpus 0 and 0 &# 39 ;, 1 and 1 &# 39 ;, etc . constitute duplex pairs , having one cpu of the pair active and the other a ready - standby for fault failure of the active one . each cpu of the pair has its buses cross connected to the other arbitration circuit of the pair . ( that is , cpu 0 is connected via buses to arbitration circuits 0 and 0 &# 39 ;, cpu 0 &# 39 ; is connected via buses to arbitration circuits 0 &# 39 ; and 0 . cpu 1 is connected to arbitration circuits 1 and 1 &# 39 ;, cpu 1 &# 39 ; is connected to arbitration circuits 1 &# 39 ; and 1 , etc .) however , only one cpu of the pair is active at one time . the buses are enabled only from the active cpu via tri - state driver elements . due to physical constraints , cpus 0 - 15 and 0 &# 39 ;- 15 &# 39 ; each comprise one subgroup and cpus 16 - 31 and 16 &# 39 ;- 31 &# 39 ; each comprise another . each arbitration circuit 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; is in turn connected via a corresponding common tri - state bus to memory a and to its duplicate copy memory a &# 39 ;. arbitration circuit 0 is connected to arbitration circuit 1 with arbitration circuit 1 being connected to the last arbitration circuit 15 of the subgroup and the last arbitration circuit connected back again to arbitration circuit 0 , thereby forming a completed ring connection . arbitration circuit 0 &# 39 ; is connected to arbitration circuit 1 &# 39 ; with arbitration circuit 1 &# 39 ; being connected to the last prime arbitration circuit 15 &# 39 ; of the subgroup and the last prime arbitration circuit 15 &# 39 ; connected back again to arbitration circuit 0 &# 39 ;, thereby forming a second parallel and synchronously operated ring connection . arbitration circuit 16 is connected to arbitration circuit 17 with arbitration circuit 17 being connected to the last arbitration circuit 31 of the subgroup and the last arbitration circuit 31 connected back again to arbitration circuit 16 . arbitration circuit 16 &# 39 ; is connected to arbitration circuit 17 &# 39 ; with arbitration circuit 17 &# 39 ; being connected to the last arbitration circuit 31 &# 39 ; of the subgroup and the last arbitration circuit 31 &# 39 ; connected back again to arbitration circuit 16 &# 39 ;, thereby forming two parallel and synchronously operated ring connections . there is an exact correspondence between each group of arbitration circuits . the number of arbitration circuits of each ring connection is in direct relation to the number of cpus in the configuration . the configuration may contain as many as 32 pairs of central processing units ( each may comprise an intel 8086 or similar device ) and therefore , 32 pairs of arbitration circuits . the number of cpus is expandable from 2 pairs to a total of 32 pairs in this implementation . as a practical matter , at least two pairs of cpus are required for the function of telephone central office switching . when an initialization signals is applied to arbitration circuit 0 , 0 &# 39 ;, 16 and 16 &# 39 ; bus available signals are derived and each is propagated along to successive arbitration circuits of its subgroup ultimately returning to arbitration circuit 0 , 0 &# 39 ;, 16 , and 16 &# 39 ; where it is again propagated . when , for example , cpu 0 requests access to memory a and a &# 39 ;, arbitration circuit 0 and 0 &# 39 ; each receive a request signal via their respective buses . and as the bus available signal is propagating through the logic of arbitration circuit 0 and synchronously through the logic of arbitration circuit 0 &# 39 ;, arbitration circuit 0 and 0 &# 39 ; will each temporarily block the propagating of the bus available signal . as a result , cpu 0 will have control of each of the common buses between the arbitration circuits 0 and 0 &# 39 ; and can access memory a and a &# 39 ; synchronously . cpu 0 then performs parallel memory accesses to memories a and a &# 39 ; of a duration of one memory cycle while simultaneously re - propagating the bus available signal in each ring connection to the next sequential arbitration circuit 1 and 1 &# 39 ;. this operation is analogous for cpu 16 and arbitration circuits 16 and 16 &# 39 ; accessing memory a and a &# 39 ;. the bus available signals travel along each ring connection of arbitration circuits 0 - 15 , 0 &# 39 ;- 15 &# 39 ;, 16 - 31 and 16 &# 39 ;- 31 &# 39 ; at a relatively high rate of speed , so that the probability of any active cpu gaining access to memory a and a &# 39 ; is relatively equal among the active cpus . each arbitration circuit of a subgroup slows the propagation of the bus available signal only by the time required to propagate this signal through a high speed gating arrangement of each ring connection . when two or more active cpus of duplex pairs in one subgroup simultaneously request access to memory a and a &# 39 ;, a conflict situation arises . this conflict is arbitrated by means of the two parallel ring connections of arbitration circuits . the bus available signal propagates along each ring connection of arbitration circuits . if an arbitration circuit pair ( 0 and 0 &# 39 ;) has an active request for access to the common bus of memory a and a &# 39 ;, cpu 0 associated with these arbitration circuits is then given control of each common bus enabling the memory transfer to occur . since , the conflict was with a subgroup and arbitrated by the ring connection of arbitration circuits , subgroup switching circuits a and a &# 39 ; operate only to gate through the bus connections to common memories a and a &# 39 ;. if cpu 0 &# 39 ; is the active one of the pair the transfer will occur as above except that cpu 0 is replaced by cpu 0 &# 39 ;. during this time , each bus available signal is re - propagated to the next succeeding arbitration circuit pair 1 and 1 &# 39 ; of each ring , so that cpus 1 or 1 &# 39 ; may establish their priority to obtain the common buses next . the associated cpu of this arbitration circuit pair then has control of each common bus and associated memory a and a &# 39 ;. then the active cpu of the duplex pair performs its memory transfer operation . the arbitration occurs sequentially as described above until all outstanding requests for access to memory a and a &# 39 ; have been serviced . while a particular cpu has been granted access to memory a and a &# 39 ;, the bus available signals will be re - propagated by each of its corresponding arbitration circuits of the subgroup . other active cpus will have the opportunity to establish a priority for service before a memory request will be granted to the same cpu of the subgroup . if the bus available signal returns to the arbitration circuit pair presently in control of the duplicate memories , grant signals will automatically pass control of the grant of access to the next sequential arbitration circuit pair . thereby , a particular active cpu does not utilize its arbitration circuit to monopolize memory a and a &# 39 ;. when two cpus of duplex pairs located in different groups and subgroups , for example cpu 0 and cpu 16 , simultaneously request access to the memories a and a &# 39 ;, arbitration of this conflict is resolved by subgroup switching circuits a and a &# 39 ;. switching circuits a and a &# 39 ; synchronously operate to select cpu 0 or 16 randomly and then alternates access to memories a and a &# 39 ; from one subgroup to the other subgroup , for example first cpu 0 , next cpu 16 , next cpu 1 , next cpu 17 , etc . the order within a subgroup need not be sequential . if only one cpu is requesting , switching circuits a and a &# 39 ; simply allocate memories a and a &# 39 ; to that cpu . when switching circuits a and a &# 39 ; must choose between cpus of different subgroups , the initial choice is established by a periodic pulse input signal selecting one group . access is then alternately allocated between groups . however , optionally each active cpu of a duplex pair may lockout other active cpus for more than one memory cycle . such conditions are limited and closely monitored . referring now to fig2 a schematic diagram of three arbitration circuits of one subgroup of a group is shown . these circuits correspond to a first a second and a last arbitration circuits of one of the two parallel ring connections . a particular implementation may include up to 16 pair of arbitration circuits per subgroup , one pair for each cpu pair equipped in the configuration . thereby , a maximum configuration of 32 pair of cpus and 32 pair of arbitration circuits is capable of implementation via this scheme . the operation will be explained for one arbitration subgroup of ring connection for simplicity . it is to be noted the same operation synchronously occurs in a corresponding parallel arbitration group . that is , arbitration circuits 0 - 15 and 0 &# 39 ;- 15 &# 39 ; operate synchronously forming duplex subgroups . in addition , arbitration circuits 16 - 31 and 16 &# 39 ;- 31 &# 39 ; operate synchronously forming another pair of duplex subgroups . thereby , both memory copies a and a &# 39 ; are written to or read from simultaneously . in the operation either cpu of the pair may be active , for example , cpu 0 or 0 &# 39 ; and 16 or 16 &# 39 ;. each arbitration circuit includes a gating arrangement composed of an and - or gate 200 , which may be implemented via an integrated circuit part number 74s51 or similar device . a ring connection of gates 200 , 210 , etc . propagates the bus - avail signal from one arbitration circuit to the next at a relatively high rate of speed so that the signal is not inhibited by any single arbitration circuit for a substantial period of time . d - type flip - flop 201 , 211 and 351 are each connected between a respective cpu and its respective arbitration logic . gates 201 , etc . may be implemented via integrated circuit part number 74s74 . jk flip - flop 204 , 214 , etc . are each connected between their corresponding d - type flip - flops 201 , 211 , etc . and their corresponding and - or gate 200 , 210 , etc . as a portion of the system clear and initialization , cpu 0 pulses the reset lead which is connected to jk flip - flops 204 , 214 , etc . as a result the bus - avail signal is generated through and - or gate 200 and propagates along the ring connection to and - or gate 210 , 350 and back gain to gate 200 . a 12 mhz clock signal , from a clock ( not shown ) is transmitted to all flip - flops ( d - type and jk ) via the clk lead to operate each of these flip - flops . an example will best serve to illustrate the granting of control of the common bus to a particular cpu . when active cpu 0 signals via the reset lead , flip - flop 204 is preset enabling gate 200 to transmit the bus available signal via the bus - avail lead to each successive gate 210 , etc . when cpu 0 requests access to the common memory , cpu 0 raises the sel 0 lead via the bus connected between cpu 0 and arbitration circuit 0 . at the next clock cycle , the clock signal is transmitted to flip - flop 201 which becomes set and the q output of this flip - flop temporarily disables gate 200 from passing the bus - avail signal . the q output of flip - flop 201 is passed through gates 202 and 203 and sets flip - flop 204 , which causes it to toggle and produce a signal on the grant 0 lead and simultaneously enables gate 205 . the grant 0 lead is returned to cpus 0 and 0 &# 39 ; and this signal also enables tri - state elements ( not shown ), gating cpu 0 bus onto the common bus of memory a . the above simultaneously occurs in arbitration circuit 0 &# 39 ;. while this memory access takes place , the bus available signal is re - propagated via the output of j - k flip - flop 204 through the lower portion of gate 200 , so that the successive arbitration circuits may establish their respective priority for memory access . if the bus available signal returns to arbitration circuit 0 via the bus - avail lead while the access is in progress , the grant signal is transmitted via the take - grant lead automatically to the next sequential arbitration circuit 1 , so that if sel 1 is set , cpu 1 access request will be given the grant on the next clock cycle . this scheme distributes determination of which is the next available memory request to be given access on a rotational basis ; and this scheme further keeps memory access equal when cpu access requests are sporadic . in this way , a cpu may not make successive memory requests . cpu 0 may now completes its data transfer to memory a and a &# 39 ;. if another arbitration circuit pair has established its priority , that circuit pair will receive control of the common buses next . in this way , while one cpu is accessing memories a and a &# 39 ;, the next cpu is establishing its priority for service . all buses are bidirectional and each directional link includes tri - state bus drivers which may be implemented via integrated circuit part number 74ls245 . all above mentioned integrated circuits are manufactured by texas instruments incorporated and various other manufacturers . the cpu having the memory access grant may signal via the lock lead ( normally high ) to halt the re - propagation of the bus available signal and thereby hold memory access for longer than one cycle . this optional use is a rare circumstance and is closely monitored by the cpus . referring to fig3 a schematic diagram of subgroup switching circuit a and a &# 39 ; of fig1 a is shown . j - k flip - flop 370 is connected via the clk lead to a clock ( not shown ) providing an 12 mhz cycle clock signal , flip - flop 370 is further connected to each of and - or gates 380 and 381 and or gate 390 . if , for example , a cpu of subgroup a is the only one requesting , the upper and gate of gate 380 is enabled and the cpu of subgroup a has its tri - state bus ( not shown ) enabled to access memory a . when two cpus , one from each subgroup ( cpu 0 and cpu 16 , for example ), simultaneously request access to the memory , the upper portion of gate 380 and lower portion of gate 381 are disabled . on the next clock cycle via the clk lead , flip - flop 370 will toggle to enable the lower portion of gate 380 or the upper portion of gate 381 , thereby selecting subgroup a or b respectively . only one subgroup is enabled to access memory and on the next clock cycle the remaining subgroup is enabled . although the preferred embodiment of the invention has been illustrated , and that form described in detail , it will be readily apparent to those skilled in the art that various modifications may be made therein without departing from the spirit of the invention or from the scope of the appended claims .
| 6 |
the invention is described hereinbelow by way of example in a sheet - fed printing press , the device according to the invention being introducible into any type of printing press wherein a part must be aligned at a predetermined adjustment line and then picked up from the side of the adjustment line and moved forward . referring now to the drawings and , first , particularly to fig1 thereof , there is shown therein a feeding table 3 with a front lay 1 in working position . in the working position , a contact plate 20 of the front lay 1 is disposed at a front edge 47 of the feeding table 3 so that the contact plate 20 protrudes upwardly beyond a supporting surface 49 of the feeding table 3 and is disposed parallel to the front edge 47 on a predetermined alignment or adjustment line 46 ( note fig2 ). the contact plate 20 has an intercepting surface 48 , which , in the working position , is oriented approximately perpendicularly to the supporting surface 49 of the feeding table 3 . the contact plate 20 extends beneath the feeding table 3 into a first region 51 following a bend 50 . as shown in fig1 in the working position of the contact plate 20 , also shown in phantom at 25 in fig4 the first region 51 is realized approximately parallel to the supporting surface 49 and extends in a direction towards an adjusting device 4 . the first region 51 merges into a second region 52 , which is disposed approximately perpendicularly to the first region 51 . the second region 52 merges via a third region 53 into a fourth region 54 . the third region 53 has an asymmetrical u shape , and the fourth region 54 extends approximately parallel to the second region 52 . the fourth region 54 is in contact with a contact surface 55 of a shaft 6 . the fourth region 54 is fixedly screwed to the shaft 6 by a first screw 14 . the contact surface 55 is advantageously oriented perpendicularly to the feeding table 3 . the shaft 6 is formed with a centrally oriented borehole 56 which is oriented parallel to the contact surface 55 . thus , in the working position , the borehole 56 is oriented perpendicularly to the feeding table 3 . in the borehole 56 , a rod 19 having a lock disk 7 at the top end thereof , as viewed in fig1 for example , is rotatably mounted . the lock disk 7 lies on the shaft 6 . above the lock disk 7 , a stop element 8 in the form of an eccentric disk is provided . a side margin 57 of the stop element 8 is disposed parallel to the longitudinal axis of the rod 19 . the stop element 8 has a substantially cylindrical construction , with an axis of rotation situated outside the midpoint of the cross - section of the cylinder formed by the stop element 8 . the axis of rotation of the stop element 8 is coaxial with the axis of rotation 59 of the rod 19 . the stop element 8 has an upper side , as viewed in fig1 for example , which is oriented parallel to the underside of the feeding table 3 , and is formed with an opening 58 , which is bounded by an interior wall 9 of the stop element 8 . the interior wall 9 is advantageously constructed as a contact surface in the shape of an interior hexagon . the feeding table 3 is formed with a second recess 5 above the opening 58 . the second recess 5 is constructed so that a tool can be guided into the opening 58 through the feed table 3 from above , in order to vary the rotational position of the stop element 8 . a hex or hexagon key is preferably used as the tool . in its simplest form , the second recess 5 is a cylindrical recess . the lock disk 7 is disposed centrosymmetrically to the axis of rotation 59 of the rod 19 . lock recesses 13 are provided at the outer perimeter of the lock disk 7 . a lock element 12 is provided in the shape of a leaf spring , which is screwed to the shaft 6 by the first screw 14 , the lock element 12 having a lock nose 23 in the shape of an outward bend at the top end thereof , as viewed in fig1 . the lock nose 23 is disposed in a region of the outer perimeter of the lock disk 7 and engages in a respective lock recess 13 . interaction of the lock recesses 13 and the lock element 12 ensures a precise rotation of the stop element 8 into predetermined angular positions . the second region 52 of the front lay 1 is braced , via a contact part 15 , against a side edge of the stop element 8 , which represents the outer perimeter 57 thereof . the contact part 15 is advantageously constructed in the shape of a nut 16 through which a threaded adjusting screw 17 is guided . the nut 16 is secured at the second region 52 of the front lay 1 via a second weld or joint 44 . the front end of the adjusting screw 17 is in contact with the side edge 57 of the stop element 8 . the front lay 1 is shaped by the third region 53 thereof so that the second region 52 of the front lay 1 has a tensioning bias acting in a direction towards the stop element 8 . in the second region 52 , a borehole is formed , through which the other end of the adjusting screw 17 extends . the contact part 15 is thus clamped between the second region 52 and the outer perimeter 57 . the contact part 15 serves for setting or establishing a defined spacing between the outer perimeter 57 and the second region 52 and thus a defined position of the intercepting surface 48 . by turning the adjusting screw 17 , the position of the intercepting surface 48 relative to the feeding table 3 can be adjusted . the adjusting screw 17 and the nut 16 represent an adjusting mechanism . by the adjusting mechanism 16 , 17 , a basic setting of the front lay 1 can be executed . with the basic setting , several front lays can be aligned on a predetermined adjustment line . in addition , due to the eccentric shape of the stop element 8 , the position of the intercepting surface 48 can be set by turning the stop element 8 . the shaft 6 with the rod 19 and the stop element 8 represent an adjusting device 4 by which the position of the intercepting surface 48 can be adjusted from the basic setting that was previously set using the contact part 15 and the adjusting screw 17 . the rod 19 has a connecting element 60 at the bottom end thereof , as viewed in fig1 to which an elastic shaft 11 is attached . the elastic shaft 11 is connected to a controllable servomotor 10 . the rod 19 and thus the stop element 8 are turned , via the elastic shaft 11 , by actuating the servomotor 10 accordingly . in this manner , the intercepting surface 48 can be displaced , regardless of the accessibility of the front lay 1 , by actuating the servomotor 10 accordingly . because a servomotor 10 is used , the front lay 1 can be adjusted by remote control . the remote control can be accomplished via programs of a control computer of the sheet - fed printing machine . of course , this is also possible during the printing - machine cycle . in a relatively simple embodiment , the front lay 1 comprising the contact plate 20 , and the first , second , third , and fourth regions 51 , 52 , 53 and 54 , is constructed in the shape of a suitably bent thin plate . advantageously , the front lay 1 is produced from spring steel . because the front lay 1 is biased in the direction towards the stop element 8 in the second region 52 , due to the shape and the connection thereof to the shaft 6 , additional devices for biasing the contact plate 20 can be dispensed with . this ensures a cost - effective and compact construction . the lower end of the rod 19 has an axial guard 61 which limits the axial mobility of the rod 19 in the shaft 6 . the shaft 6 , the screw 14 and the rod 19 , together , represent a holding device 2 for the front lay 1 and the adjusting device 4 . [ 0062 ] fig2 shows the arrangement of fig1 as viewed from above and from the perspective of the feeding table 3 , which is represented only diagrammatically , in phantom . the feeding table 3 is formed with notches 45 in the region of a front lay 47 , through which respective contact plates 20 are guided from below . the intercepting surfaces 48 of the contact plates 20 are aligned at the adjusting line 46 . the notches 45 permit the arrangement of the adjustment line 46 in the region of the support surface 49 . thus , a sheet that is situated on the feeding table 3 , with the leading edge of the sheet abutting the intercepting surface 48 , is located in the region of the support surface 49 , so that the whole surface of the sheet is held by the feeding table 3 . the first region 51 and the third region 53 of the front lay 1 are clearly visible in fig2 . the adjusting screw 17 contacts the outer perimeter 57 of the stop element 8 . the shape of the lock nose 23 of the lock element 12 is also clearly visible . in this exemplifying embodiment , the lock nose 23 is locked in the first lock recess 13 . the lock disk 7 is formed with a recess which is bounded by first and second stop surfaces 21 and 22 . installed in the shaft 6 is a stop bolt 18 , which is disposed in the region of the recess of the lock disk 7 , so that rotation of the stop element 8 is limited by the fact that the first or second stop surface 21 , 22 strikes the stop bolt 18 . the lock disk 7 can be rotated only within a predetermined angular range due to the stop bolt 18 and the first and second stop surfaces 21 and 22 . a maximum permissible angular range for rotating the adjusting device 4 is thereby prescribed . fig2 clearly shows the shape of the lock disk 7 , which has a central opening through which the stop element 8 extends . the lock disk 7 is firmly connected to the stop element 8 . [ 0064 ] fig3 shows a device with two front lays 1 , which are affixed onto a common shaft 6 . the front lays 1 are aligned so that the stop plates 20 of the two front lays 1 are arranged on a common adjustment line 46 . in the same way , additional front lays 1 on the shaft 6 can also be distributed along the front or leading edge 47 of the feeding table 3 . a drive is also provided for rotating the shaft 6 , by the aid of which the shaft 6 shown in fig4 for example , is rotatable . the shaft 6 is mounted in a bearing support 76 and connected to the sheet - fed printing machine . [ 0065 ] fig4 shows a device similar to that of fig1 but with a slide ring 28 disposed between the adjusting screw 17 and the stop element 8 for reducing sliding friction . the slide ring 28 prevents wear of the stop element or the adjusting screw 17 and additionally accomplishes a precise adjustment of the position of the intercepting surface 48 due to low - frictional movement of the stop element 8 relative to the adjusting screw 17 . the slide ring 28 is rotatably mounted on the stop element 8 and secured against axial movement . the adjusting screw 17 is braced against the outer circumference of the slide ring 28 , and is resiliently prestressed against the slide ring 28 . [ 0066 ] fig4 shows the front lay 1 in the neutral or inactive position thereof at 26 , wherein the contact plate 20 is tilted about a central axis 63 over a pivot angle 27 relative to the working position 25 of the contact plate 20 , which is represented in phantom . the pivot angle 27 is so dimensioned that , in the neutral or inactive position 26 of the contact plates 20 , the latter are tilted far enough away from the front or leading edge 47 in the forward and downward directions so that the feeding table 3 and , thus , the sheet 64 lying thereon can be accessed freely in the region of the front or leading edge 47 . this is necessary because the sheet 64 is seized by a gripper in the region of the front or leading edge 47 and moved off the feeding table 3 . the gripper seizes the sheet 64 between the individual front lays . how the device according to the invention operates or functions is described hereinafter in detail with reference to fig1 and 4 . a sheet 64 coming from the righthand side , as represented in fig1 and 2 , is transported in a direction towards the intercepting surface 48 . the leading edge 65 of the sheet 64 strikes the intercepting surface 48 . the sheet 64 is stopped and aligned , with the leading edge 65 thereof on the adjustment line 46 . after the sheet 64 is aligned and settled on the feeding table 3 , it is seized by a gripper . the front lays 1 are then tilted away forwardly over the pivot angle 27 by rotating the shaft 6 about the central axis 63 , as is represented in fig4 and the sheet is drawn off and away from the feeding table 3 . the shaft 6 is then tipped back into the working position thereof , so that the front lay 1 again assumes the working position thereof , as represented in fig1 . because the front lay 1 is always in contact with the stop element 8 during the movement of the front lay 1 from the working position thereof into the neutral or inactive position thereof and back into the working position thereof again , the front lay 1 , with respect to the stop element 8 , is always at a defined spacing and always returns to the working position thereof at the same instant of time . because it is unnecessary to take into account any time reserve for undefined swinging - away and returning , more time is available for aligning and stabilizing the sheet . [ 0069 ] fig5 illustrates an additional embodiment of the invention wherein the adjusting screw 17 engages the stop element 8 via an anti - friction bearing 66 . in this regard , the adjusting screw 17 engages an exterior ring 67 of the anti - friction bearing under prestressing . [ 0070 ] fig6 shows an additional embodiment of the invention wherein the front lay 1 has a different shape than that of fig1 . in fig6 the first region 51 is longer and , shortly before the stop element 8 , the first region 51 buckles downwardly in a direction towards the shaft 6 and merges into a fifth region 68 . the fifth region 68 extends to a location beneath the shaft 6 , and merges into a sixth region 69 , which is disposed approximately parallel to the feeding table 3 and abuts a lower contact surface 70 of the shaft 6 . the sixth region 69 is formed with an opening out of which the rod 19 extends in a downward direction . a hexagon screw 35 that has been bored through is provided for bolting the sixth region 69 to the lower contact surface 70 and thus fixes the front lay 1 in position . the rod 19 extends through the hollow hexagon screw 35 and is secured against axial movement . the hexagon screw 35 additionally has an exterior thread mating with an interior thread of the second borehole 56 . also provided is a clamping or retaining nut 29 which is connected to the underside of the first region 51 of the front lay 1 via a weld 30 . the clamping nut 29 has an inner thread through which a bolt 71 , which extends through a corresponding opening in the fifth region 68 of the front lay 1 to the exterior perimeter 57 of the stop element 8 , is screwed . the bolt 71 is screwed so far into the clamping nut 29 in the direction towards the stop element 8 that the basic adjustment of the intercepting surface 48 of the contact plate 20 is correctly performed . the shapes of the first , fifth and sixth regions 51 , 68 and 69 of the front lay 1 are selected so that the fifth region 68 is biased in the direction towards the stop element 8 in the region of the bolt 71 . in this embodiment , the lock element 12 is fixed to the shaft 6 laterally opposite the fifth region 68 by a second screw 34 . accordingly , the lock disk 7 also is formed with the lock recesses 13 on the side of the lock element 12 . in this embodiment also , the rod 19 extends downwardly through the hexagon screw 35 and has a connecting element 60 for connecting the servomotor 10 thereto . [ 0073 ] fig7 is a top plan view of an embodiment like that of fig6 but with the stop element 8 constructed in the shape of an archimedes &# 39 ; spiral 31 . the archimedes &# 39 ; spiral 31 is constructed approximately in the shape of a plate , with the distance from the spiral wall 74 to the axis of rotation varying in dependence upon the rotational position of the disk . in this way , the spacing between the bolt 71 and the axis of rotation of the archimedes &# 39 ; spiral 31 can be varied in dependence upon the rotational position of the spiral 31 . the illustrated embodiment of the archimedes , spiral 31 is formed with a bolt opening 32 and has a graduated or index ring shape extending over a predetermined angular range at a defined distance from the axis of rotation . the two side edges of the bolt opening 32 are formed by first and second stop surfaces 21 and 22 . the stop bolt 18 extends through the bolt opening 32 and serves to limit the permissible rotational angular range of the archimedes &# 39 ; spiral 31 . [ 0074 ] fig8 shows an additional embodiment of the front lay 1 , which includes a connecting part 37 and a plate 36 . the connecting part 37 is mounted in a holding arm 42 parallel to the feeding table 3 and is movable parallel to the feeding table 3 . the holding arm 42 is formed with a guide borehole 72 which is disposed parallel to the feeding table 3 . the connecting part 37 is disposed so as to be axially movable in the guide borehole 72 . an end of the connecting part 37 protrudes from the guide borehole 72 at an exterior side of the holding arm 42 , and the connecting part 37 is connected at this end to the plate 36 , which is disposed perpendicularly to the connecting part 37 . the plate 36 , at the top thereof , as viewed in fig8 extends beyond the plane of the supporting surface 49 of the feeding table 3 , and the interior side surface of the plate 36 serves as the intercepting surface 48 . the connecting part 37 protrudes from the borehole 72 in the direction towards the stop element 8 , in like manner . at this end of the connecting part 37 , a second adjusting screw 39 is screwed into the connecting part 37 via an inner thread formed therein . the second adjusting screw 39 includes a stop 40 in the form of a nut engaged by a tension spring . the tension spring 41 is placed in contact with the holding arm 42 , as well , so that the second adjusting screw 39 is prestressed in the direction towards the stop element 8 . the intercepting surface 48 of the plate 36 is also prestressed in the direction towards the stop element 8 . the holding arm 42 is fixed to the shaft 7 through the intermediary of a bushing 73 through which the rod 19 extends . in this regard , a second contact surface 43 of the bushing 73 comes into contact with a correspondingly assigned supporting surface of the shaft 6 . the second contact surface 43 is expediently disposed parallel to the feeding table 3 . the bushing 73 is fixed to the shaft 6 by a hollow - bored hexagonal screw 35 . the hexagonal screw 35 has an exterior thread , which is suitably mated with an interior thread of the bushing 73 . the rod 19 , which is connected to the stop element 8 , extends downwardly through the hollow - bored hexagonal screw 35 and out of the shaft 6 and the hexagonal screw 35 . the bottom end of the rod 19 has a connecting element 60 for connecting a flexible shaft 11 and a servomotor 10 thereto . the device in fig8 has a leaf spring 12 located opposite to the second adjusting screw 39 , which is fixed to the bushing 73 of the holding arm 42 by a third screw 75 . a lock nose 23 of the lock element 12 is assigned to lock recesses 13 of a lock disk 7 . [ 0078 ] fig9 is a top plan view of the device of fig8 as viewed from the perspective of the feeding table 3 . the shape of the archimedes &# 39 ; spiral , which is formed with lock recesses 13 opposite the second adjusting screw 39 , can be clearly recognized therein . in this embodiment , the function of the lock disk and the function of the stop element 8 are integrated in a single component . this permits the construction of a low building structure . the shape of the recess 58 , which is bounded by an interior hexagonal form 24 , can also be readily recognized . the embodiment of fig8 differs from the embodiment of fig6 with respect to the development of the front lay 1 . an essential core of the invention is in constructing the front lay 1 and the stop element 8 as one internally stressed entity which is moved from a working or operating position in order to release the leading edge 65 of a sheet 64 , into a neutral or inactive position wherein the contact plate 20 releases the leading edge 47 . to accomplish this , the component can be moved , swung or rotated in any manner whatsoever . the shaft 6 used in the foregoing description , to which the stop element 8 and the front lay 1 are fastened , merely represents a preferred embodiment . the invention is not limited to using a shaft 6 . for example , the front lay 1 and the stop element 8 can also be fastened onto a component which is swung away from the leading edge 47 of the sheet by using lever arms in order to release the leading edge 47 . furthermore , the invention is exemplarily described as having a rotary element as the adjusting device 4 . but other shapes can be used to adjust the position of the front lay relative to the edge of the sheet . the holder 2 , e . g ., formed of the shaft 6 and the screw 14 , can be displaceably mounted . by this measure , all front lays can be displaced jointly in or opposite to the direction of sheet transport , i . e ., at an angle .
| 1 |
the present inventors have developed a new class of coagulants which exhibit enhanced performance in dewatering of mineral slurries . these coagulants are copolymers of dadmac and trialkoxysilanes . such hydrophobically associating copolymers have an enhanced performance with replacement ratios on the order of about 0 . 35 to about 0 . 50 over commercially available poly ( dadmac ) treatments . the mineral slurries are preferably treated with coagulants and optionally with flocculants . it has been discovered that surface charge neutralization of colloidal particles in the mineral slurries can be enhanced by the use of a copolymer which has been modified to incorporate a certain degree of hydrophobicity . such a modification can be accomplished by copolymerizing a diallyldimethylammonium halide , particularly diallyldimethylammonium chloride ( dadmac ) with vinyl alkoxysilane , preferably vinyl trimethoxysilane . the vinyl alkoxysilane monomers useful in the copolymer composition of the invention contain an alkyl group of from 1 - 4 carbon atoms . as such vinyl trimethoxy , triethoxy , tripropoxy and tributoxysilanes , and combinations thereof , may find use in the subject invention . while vinyl trialkoxysilanes are preferred , the monomers may be mono or di - substituted as well , or mixtures of mono -, di - and tri - alkoxy substituted silanes may be used . a preferred vinyl trialkoxysilane for use in this invention is vinyl trimethoxysilane , commercially available from hals america , piscataway , n . j . diallyldimethylammonium halides , especially diallyldimethylammonium chloride ( dadmac ) are well - known and commercially available from a variety of sources . one method for the preparation of dadmac is detailed in u . s . patent no . 4 , 151 , 202 , the disclosure of which is hereinafter incorporated by reference into this specification . the mole ratio of dadmac to the vinyl trialkoxysilane ranges from 99 . 99 : 01 to 80 : 20 and , preferably from 99 . 9 : 0 . 1 to 85 : 15 . most preferably , the mole ratio of dadmac to the vinyl trialkoxysilane range from 99 . 9 : 0 . 1 to 95 . 0 : 5 . 0 . the polymers may be prepared as in conventional vinyl polymerization techniques . these techniques include conventional solution polymerization in water , and polymerization in water - in - oil emulsion form , such as that described in u . s . pat . no . 3 , 624 , 019 , the disclosure of which is hereinafter incorporated by reference into this specification . the polymers of the invention may also be prepared in so - called dispersion form , such as that described in u . s . pat . nos . 4 , 929 , 655 and 5 , 006 , 590 the disclosures of which is also hereinafter incorporated by reference into this specification . the polymers of the instant invention may be in solid , dispersion , latex or solution form . conventional free radical catalysis may be used , including both free radical initiators and redox systems . such polymerizations are within the purview of those skilled in the art and as such will not be elaborated on in this specification . the molecular weights of the copolymer prepared hereunder can vary greatly . generally , copolymers of diallyldimethylammonium chloride and vinyl trimethoxysilane produced hereunder will have a molecular weight of from 50 , 000 to 5 , 000 , 000 , and preferably 75 , 000 to 2 , 500 , 000 , and most preferably from 100 , 000 to 1 , 000 , 000 . the polymers of this invention will accordingly have a reduced specific viscosity for a one percent by weight polymer solution as measured in one molar sodium nitrate of from 0 . 2 - 5 dl / gm and preferably from 0 . 5 - 4 . 0 dl / gm . a most preferred reduced specific viscosity range is from 0 . 7 - 3 . 0 dl / gm . while discussed herein as copolymers of diallyldimethylammonium halides and vinyl alkoxysilanes , other monomers may be incorporated into the resultant polymers without detracting from the spirit and intent of the invention . possible monomers that may be incorporated include , but are not limited to nonionic and cationic vinyl monomers . these materials are exemplified by acrylamide , and such cationic monomers as dimethylaminoethylmethacrylate and dimethylaminoethyl acrylate and their respective water soluble quaternary amine salts . the copolymers of this invention may be used alone , or in combination with a high molecular weight anionic or non - ionic water soluble or dispersible flocculant . such polymers include polyacrylamide , and copolymers of acrylamide with acrylic acid and its water soluble alkali metal or ammonium salts . as used herein , the term acrylic acid is meant to encompass such water soluble salts . also useful are such polymers as sulfomethylated acrylamides as exemplified in u . s . pat . nos . 5 , 120 , 797 and 4 , 801 , 388 , the disclosures of which are hereinafter incorporated by reference into this specification . other commercially available anionic flocculant materials may also be utilized . a preferred class of flocculants for use in this invention includes copolymers of acrylamide and acrylic acid having a mole ratio of acrylamide to acrylic acid of from 99 : 1 to 1 : 99 and preferably 99 : 1 to 50 : 50 . most preferably , the mole ratio of acrylamide to acrylic acid will be 95 : 5 to 60 : 40 . an especially preferred flocculant for use in this invention has a mole ratio of acrylamide to acrylic acid of about 70 : 30 . the flocculants of this invention may be prepared in solution form , or in water - in - oil emulsion form . the preparation of such flocculants is known to those skilled in the art . the flocculants generally have molecular weights ranging from as low as 1 , 000 , 000 to 20 , 000 , 000 or higher . preferred flocculants have a molecular weight of about 10 , 000 , 000 . the upper weight of molecular weight is not critical so long as the polymer is water soluble or dispersible . the flocculant is believed to cause the aggregation of the neutralized colloidal particles which are suspended in the tailings suspension . aggregation is the result of either entrapping agents ( i . e ., inorganic flocculants ) or bonding agents ( i . e ., organic flocculants ) bringing the neutralized particles together . the coagulants and flocculants can be added at several points along the feed line to the thickener and in different sequences . the flocculants may be added either prior to or subsequent to coagulant addition . a typical thickener is a gravity sedimentation unit which is a cylindrical continuous thickener with mechanical sludge raking arms . the tailings ( i . e ., a solids / liquid dispersion ) enter the thickener at the centerwell . the coagulants and / or flocculants are added at points in the feed line and / or centerwell . the number of addition points , sequence , flocculant , coagulant , etc . are determined by laboratory cylinder tests for each particular application . the flocculated solids settle to the bottom of the thickener . the mechanical arms rake the sludge and it is discharged . the clarified water overflows into a launder surrounding the upper part of the thickener . the copolymer of diallyldimethylammonium chloride and vinyl trialkoxysilane is generally added to the thickener or mechanical filter device at a rate of about 0 . 01 to about 0 . 3 lb / ton of slurry , and preferably 0 . 075 to about 0 . 25 lb / ton . most preferably from about 0 . 1 to 0 . 25 lb of polymer is used per ton of slurry . the amount of coagulant will vary according to the particular stream to be dewatered . flocculant may also be added to the thickener in an effective amount , generally between about 0 . 01 to about 0 . 25 lb / ton of slurry . after treatment of the slurry with sufficient coagulant and optional flocculant , the thickener underflow or refuse ( i . e ., concentrated tailings ) are removed from the bottom of the thickener , while water and / or other liquids are taken out overhead . the water can thereafter be recycled as process water for use in the beneficiation process or disposed of in impoundment ponds . the concentrated tailings or refuse from the thickener can be thereafter disposed of , generally as landfill . in most instances , adding a given amount of flocculant in two or more increments results in better performance than adding the same amount of flocculant in one increment . it is not unusual to be able to reduce the amount of flocculant required by as much as 30 - 40 % by multi - point addition and still achieve the required settling rate . multi - point addition may also provide improved clarity ( i . e ., lower suspended solids ) at a given settling rate . this practice is implemented in a beneficiation plant process by adding the flocculant at different points in the feed line to the thickener . the improvement results from reducing the amount of surface area that the second or third portion of flocculant actually contacts when added to the system , as well as improved distribution of the flocculant . the present invention can best be understood by reference to the following working and comparative examples . a 90 : 10 mole copolymer of diallyldimethylammonium chloride ( dadmac ) and vinyl trimethoxysilane ( vtms ), at 20 % actives , was prepared for use as a coagulant . the following reactants were used to form the hydrophobically modified polyelectrolyte copolymer coagulant : ______________________________________312 . 91 grams diallydimethylammonium chloride dadmac ( a 58 % solution ) 18 . 89 grams vinyl trimethoxysilane ( a 98 % solution ) 200 . 0 grams deionized water1 . 80 grams [ 2 , 2 &# 39 ;- azobis ( 2 - amidinopropane )] dihydrochloride initiator20 . 0 grams sodium chloride446 . 20 final solution water0 . 1 grams versene______________________________________ a 1 . 5l reactor equipped with a mechanical stirrer a thermocouple , nitrogen inlet / outlet tubes , condenser and two syringe pumps was set up . vinyl trimethoxysilane was taken in the first pump set at a delivery rate of 4 . 5 cc / hr . the second pump contained an aqueous solution of 2 , 2 &# 39 ; azobis ( 2 - amidinopropane ) dihydrochloride ( 1 . 2 g in 48 . 8 g di water ), and the pump was set at 12 . 5 cc / hr . the dadmac , sodium chloride , and versene were charged into a polymerization reactor and heated to 52 ° c . the reaction mixture was purged with nitrogen . vtms and initiator - containing pumps were started and the polymerization was allowed to proceed . a thick polymer started forming after about 2 hours . at the end of two and a half hours , the viscosity increased to a point where continued agitation was difficult . 200 ml of deionized water was then added . the reaction continued for a period of 5 hours , and then subjected to a post treatment at 82 ° c . for 5 hours . product phase separated in two days and indicated extensive crosslinking as shown below : ## str1 ## a 99 . 5 / 0 . 5 mole ratio copolymer of diallyldimethylammonium chloride ( dadmac ) and vinyl trimethoxysilane ( vtms ), at 20 % actives , was prepared for use as a coagulant . the following reactants were used to form the hydrophobic polyelectrolyte copolymer coagulant : ______________________________________321 . 13 grams dadmac ( a 62 % solution ) 1 . 00 grams vtms ( a 98 % solution ) 0 . 2 grams versene258 . 8 grams deionized water1 . 20 grams 2 , 2 &# 39 ;- azobis [ 2 ( 2 - imdazolin - 2yl ) propane dihydrochloride initiator61 . 00 grams sodium chloride356 . 87 grams dilution water______________________________________ a batch process was used to prepare the dadmac / vtms copolymer . a reactor similar to the one described in example 1 was used . the dadmac , vtms , versene , sodium chloride and deionized water were charged into a polymerization reactor at a temperature of 58 ° c . thereafter , the initiator ( 0 . 6 grams in 49 . 4 grams deionized water ) was charged into the reactor dropwise via a syringe pump at 12 . 5 cc / hour . a thick polymer started forming after about 1 . 0 hour . at the end of 1 . 5 hours , the mixture was difficult to stir . at this point , deionized water addition was started using a syringe pump set at 70 ml / hour . the reaction continued for a period of 5 . 5 hours . after that , initiator ( 0 . 6 grams in 19 . 4 grams of deionized water ) was added . the reactor was heated to 82 ° c . and held at that temperature for 3 hours . the reaction product was then diluted with 356 . 87 grams of water and stored . reduced specific viscosity and intrinsic viscosity measurements were determined on a 1 % polymer solution in nano 3 ( sodium nitrate ) and found to be 2 . 02 and 1 . 3 dl / gm respectively . a 99 . 0 / 1 . 0 mole ratio dadmac / vtms copolymer was prepared using the procedure of example 2 . 2 . 0 g of vtms and 355 . 07 g of di water were used in place of the amounts in example ii . all other quantities were the same . rsv / iv for a 1 % by weight solution of the polymer in sodium nitrate were 2 . 2 and 1 . 2 dl / g , respectively . this material is hereinafter referred to as example 3 . the gravity dewatering test is a tool for reliably screening products and evaluating application variables for dewatering . results obtained in testing can generally be directly translated to the plant process . the following procedure outlines suggested steps in performing a thorough test program . 1 . an apparatus consisting of a 500 ml graduated cylinder , powder funnel , and plastic collar which retains a filter cloth on the top of the powder funnel , all supported by a ringstand and appropriate clamps was constructed . the filter cloth used was a nylon filterlink ® 400 mesh round orifice cloth of a type similar to that used in commercial practice . 3 . using a spatula , hand mix the slurry to uniformly disperse any coarse solids present . immediately sample and transfer 200 ml of underflow slurry into a 500 ml graduated cylinder . re - mix the underflow slurry prior to filling each new cylinder . 4 . measure in a syringe and set aside the desired amount of coagulant as 1 % solutions . measure and add the desired amount of anionic polymer flocculant stock solution to a 50 or 100 ml graduated cylinder , dilute to a total of 20 ml ( or 10 % of the underflow slurry volume ) with process water , mix thoroughly , and set aside . 5 . invert the 500 ml graduate cylinder containing the 200 ml of underflow slurry 4 times to thoroughly disperse the solids , then immediately add the pre - measured flocculant solution from step 3 , re - stopper the cylinder and invert 4 times . duplicate the mixing motion as closely as possible in each test . 6 . immediately add the pre - measured coagulant solution , re - stopper and invert 2 additional times . 7 . pour the conditioned slurry into the plastic collar section of the test apparatus and immediately start a stopwatch . record the drainage volumes collected every 10 seconds for a time period greater than actual commercial plant process time for gravity drainage . after removing the plastic collar , note the dewatered cake stability and thickness . if the thickness is significantly different from plant conditions , adjust the initial test slurry volume in step 2 accordingly . 8 . repeat testing , adjusting products and dosages to obtain maximum free drainage volumes in the process time allowed . turbidity was measured with a hach ratio / xr turbidimeter . the results of the testing performed at a midwestern mine are tabulated below in table i . the blank is included for comparison purposes to demonstrate that the turbidity of the untreated mineral slurry is very high . the settling rate results indicate comparable settling may be achieved by polymers of the instant invention to settling rates achieved with conventional poly ( dadmac ) treatment . however , the polymers of the instant invention are much more active , as demonstrated by lower dosages utilized . table i__________________________________________________________________________taconite field trial results cationic flocculant dosage dosage ( mls of 0 . 1 % ( mls of 0 . 1 % turbidity settling ratecationic polymer sol &# 39 ; n .) flocculant sol &# 39 ; n .) ( ntu ) ( inches / min ) __________________________________________________________________________none 0 . 00 poly 0 . 45 439 8 . 8 ( acam / aa ). sup . 2latex 0 . 20 poly 0 . 45 173 15 . 0poly ( dadmac ) ( acam / aa ). sup . 2 0 . 20 0 . 45 197 13 . 3 0 . 20 0 . 22 246 7 . 6 0 . 10 0 . 22 392 7 . 6 0 . 06 0 . 15 460 5 . 0 0 . 06 0 . 15 504 4 . 1 0 . 06 0 . 10 618 4 . 5example 3 . sup . 3 0 . 03 poly 0 . 15 778 3 . 8 ( acam / aa ). sup . 2 0 . 04 0 . 15 628 4 . 9 0 . 04 0 . 10 530 3 . 9 0 . 06 0 . 05 411 4 . 4poly ( dadmac ). sup . 1 0 . 8 496 3 . 3 2 241 4 . 7 blank 1832 0 . 8__________________________________________________________________________ . sup . 1 = commercially available dry polymer of polydiallyldimethylammoniu chloride having approximately the same intrinsic viscosity as polymer of example 3 . product is commercially available from nalco chemical company , naperville , illinois . . sup . 2 = the anionic poly ( acam / aa ) with a 70 : 30 molar ratio of acrylamide to acrylic acid . . sup . 3 = 99 : 1 mole ratio of poly ( dadmac / vtms ) synthesized according to th procedure of example 3 . a standard filter test leaf procedure which generates a filter cake whose weight and thickness thereafter are determined was utilized at a southwestern mining facility to obtain the results of table ii . the slurry sample size in each test was 600 mls of mineral slurry with a 30 second form time and a 90 second drying time . the results indicate that the polymer of the instant invention works as well as conventional poly ( dadmac ) treatments , yet at much lower concentrations . table h__________________________________________________________________________copper processing field trial results lb / ton latex lb / ton lb / ton increase poly ( dadmac ) example 3 . sup . 1 poly ( dadmac ). sup . 2 % yield % yield 40 % polymer 20 % polymer 40 % polymer wet dry % weight #/ sq . vs . polysample actives actives actives wt . wt . moisture changes ft ( dadmac ). sup . 2__________________________________________________________________________ # 1 0 0 0 114 . 1 98 . 4 13 . 8 -- 2 . 17 --# 2 0 0 1 82 . 6 72 . 2 12 . 8 & lt ; 20 . 0 %& gt ; 1 . 59 --# 3 0 . 25 0 0 177 . 7 153 . 7 13 . 5 50 % 3 . 39 113 . 0 %# 4 0 . 5 0 0 252 . 7 220 12 . 0 124 % 4 . 85 205 . 00 %# 5 0 . 75 0 0 288 . 7 251 . 6 12 . 8 156 % 5 . 55 249 %# 6 0 0 . 25 0 137 . 7 118 . 4 14 21 2 . 61 64 %# 7 0 0 . 5 0 176 . 7 153 . 7 12 . 9 56 % 3 . 39 113 . 00 %# 8 0 0 . 75 0 246 . 7 216 12 . 4 120 4 . 76 199 % __________________________________________________________________________ . sup . 1 = 99 : 1 mole ratio of poly ( dadmac / vtms ) synthesized according to th procedure of example 3 . . sup . 2 = commercially available dry polymer of polydiallyldimethylammoniu chloride having approximately the same intrinsic viscosity as polymer of example 3 . product is commercially available from nalco chemical company , naperville , illinois . while we have shown and described several embodiments in accordance with our invention , it is to be clearly understood that the same are susceptible to numerous changes apparent to one skilled in the art . therefore , we do not wish to be limited to the details shown and described but intend to show all changes and modifications which come within the scope of the appended claims .
| 1 |
referring now to the drawings in detail , fig1 illustrates a somewhat simplified longitudinal section of a typical gamma ray sensor of the axial heat flow type disclosed in prior u . s . pat . no . 4 , 298 , 420 , aforementioned , generally referred to herein by reference numeral 10 . in this type of sensor , which is suitable for a pressurized water reactor installation , an elongated cylindrical body 12 is made of a gamma radiation absorbing material such as stainless steel and is enclosed by a tubular heat sink jacket 14 which is cooled by water inside a guide tube 16 . heat generated within the body 12 in response to absorption of gamma radiation produces radial heat flow except for the axial heat flow pattern occurring within reduced diameter portions 20 of the body . the portions 20 form spaces 22 of high thermal resistance within jacket 14 to produce deviations in heat flow in thermal as well as electrical resistance of the elongated body 12 . by measuring the difference in internal body temperature between a location in portion 20 and a location outside but adjacent to the space 22 , the heat flow rate may be determined which reflects local power generation for the measurement zone within which the space 22 is located . the temperature difference is measured by means of a differential temperature sensing device generally referred to by reference numeral 26 mounted within a central bore 28 formed within the body 12 . in accordance with one embodiment of the present invention , the differential temperature sensing device 26 is of the multiple junction thermocouple type wherein electrical signal producing junctions between dissimilar metals , such as cromel and alumel , are positioned within each measurement zone . the measurement zone includes a hot region substantially coextensive with the space 22 having a predetermined axial length ( 2l ) and two cold regions on either side of the hot region . the four thermocouple junctions associated with each measurement zone are connected in series and consist of a first junction 30 located on one axial side of a second junction 32 which is located midway within the portion 20 . the third junction 34 at the tip of the thermocouple device is located on the other axial side of the junction 32 and spaced therefrom in an axial direction equal to the spacing of the first junction 30 from junction 32 . the fourth junction 36 is axially aligned with the second junction 32 . thus , junctions 32 and 36 are hot junctions for the same hot region of the measurement zone while the junctions 30 and 40 are cold junctions sensing the temperature of the body 12 within cold regions of the measurement zone on both axial sides of the space 22 . heat flow to the heat sink at the axial locations of the thermocouple junctions is often distributed by asymmetrical axial heat flow through the portion 20 of the body 12 because of irregular or intermittent thermal contact in gap 18 resulting , for example , from deposits of foreign matter therein . such asymmetrical heat flow conditions within the measurement zone produces a non - symmetrical temperature gradient as depicted by curve 38 in fig2 wherein the peak temperature at point 40 is offset by an amount ( d ) from the otherwise symmetrical location of the hot junctions 32 and 36 . where a single differential thermocouple device is utilized , the hot junction temperature ( t2 ) and only one cold junction temperature ( t1 ) are sensed to produce a differential temperature signal ( δts ). under the asymmetrical heat flow condition aforementioned , a signal error is therefore introduced as indicated by the following equation derived from the laws of thermal conduction : ## equ1 ## ( w ) is the volumetric heat generation rate , ( a ) is the cross - sectional area of the body and ( k ) is its thermal conductivity constant in the foregoing equation . the expression ( wadl / 2k ) represents the signal error . however , since the double differential thermocouple device 26 associated with the present invention senses temperatures ( t1 and t3 ) through cold junctions 30 and 34 on both sides of the hot junction , a differential temperature signal ( δt ) is obtained because of the series connection of the junctions in accordance with the following expression : ## equ2 ## it will therefore be apparent that the double differential thermocouple device produces a differential temperature signal that is twice the signal strength of a single differential thermocouple device . furthermore , the signal error ( wadl / 2k ) cancels out , so that to enable one to accurately determine the heat flow rate ( w ) from the differential temperature signal ( δt ) whether or not heat flow is symmetrical . it will be apparent that changes in temperature differential signal will lag changes in power in accordance with a thermal response time ( t ) which depends on a thermal time constant ( υ ) as indicated in the following equation : ## equ3 ## where ( θ ) is the change in ( δt ). it was discovered that this response time factor ( υ ) is directly related to the mass of the body 12 in the measurement zone or the axial length of the axial thermal resistance space 22 ( 2l ). this relationship between axial space length and thermal response time is useful in designing a sensor with a rapid thermal response by reducing the axial length of the reduced diameter portion and yet maintain the signal large enough above noise level to measure heat rate . fig3 illustrates schematically , an embodiment in which the advantages of the present invention may be extended by interconnecting in series the thermocouple junctions associated with two adjacent reduced diameter portions of the sensor body for a single measurement zone . each reduced diameter portion is one - half the axial length of the portion 20 for the independent double differential thermocouple type sensor 10 of fig1 . the following chart compares various thermocouple arrangements hereinbefore referred to with respect to the relationships between response time , space length and signal change . ______________________________________ ( θ ) ( t ) ( 2l ) change in response total space signal timetype of thermocouple length ( mm ) ( degrees ) ( seconds ) ______________________________________single differential 8 71 / 2 21 / 2double differential 8 15 21 / 2 ( fig1 ) two double in series 8 ( 4 + 4 ) 71 / 2 3 / 4 ( fig3 ) ______________________________________ fig4 illustrates another type of gamma ray sensor to which the improvement of the present invention may be applied through a thermocouple device having series connected junctions enclosed in a single cable 44 . as shown in fig5 the cable 44 extends through a heat conductive body 46 of the sensor constituting a hot region of the measurement zone . four parallel spaced loop portions of the cable containing four hot junctions are embedded in body 46 while cold junctions at the loop ends are positioned within cold regions of the measurement zone . the same advantages of eliminating signal error because of asymmetrical heat flow and increasing signal strength are applicable to this embodiment . fig6 shows a radial heat flow type of gamma sensor 10 &# 39 ; wherein the heater body 12 &# 39 ; is exposed to coolant throughout its external surface at which a uniform heat sink temperature is established . accordingly , the cold region of the measurement zone is established coextensive with the reduced diameter portion 20 &# 39 ;, while hot regions are formed on both axial sides thereof , as depicted by the temperature gradient curve 38 &# 39 ; in fig7 . a thermocouple device 26 &# 39 ; similar to that shown in fig1 for sensor 10 is utilized for sensor 10 &# 39 ; and is mounted within central bore 28 &# 39 ; of sensor body 12 &# 39 ;. the thermocouple device 26 &# 39 ; has also four signal producing junctions 30 &# 39 ;, 32 &# 39 ;, 34 &# 39 ; and 36 &# 39 ; interconnected in series to produce a signal output of twice the level of a two junction type of thermocouple device . however , no signal error correction is involved herein because there is no axial heat flow pattern subject to asymmetrical heat flow errors as is the case of sensor 10 hereinbefore described . the advantage of utilizing the plural differential thermocouple arrangement for a radial heat flow type of gamma sensor , resides in the increase in the signal output obtained without increasing the mass of the sensor body and the achievement of a faster signal response at a suitable signal level . this is particularly desirable for a boiling water reactor installation utilizing a radial heat flow type of sensor having an intrinsically lower signal level output as compared to an axial heat flow type of sensor . the significance of the present invention is illustrated in fig8 graphically showing signal level vs . signal response time curves determined for a constant heat flow rate . curve 48 represents the signal characteristic obtained from a single double junction thermocouple arrangement heretofore utilized for gamma sensors . at some point 50 on curve 48 , a minimum signal level is determined , below which power measurement accuracy is unreliable . also , point 50 on curve 48 represents the maximum desirable time limit above which signal response is too slow for safety system operation . when utilizing a thermocouple arrangement for the sensor of the type shown in fig6 a signal curve 52 is obtained as shown in fig8 . curve 54 in fig8 represents the signals obtained from a four differential junction pair type of thermocouple such as that shown in fig3 . thus , signal ranges reflected by curves 52 and 54 within the response time limit may be selected above the mimimum signal level by practice of the present invention .
| 6 |
the preferred low density polymeric labels are made of polypropylene which is commercially available . the preferred density is 0 . 55 to 0 . 85 , an especially preferred density is 0 . 6 to 0 . 75 , as distinguished from the conventional polypropylene label stock which has a density above 0 . 9 . these materials are sometimes referred to as cavitated , micro voided or foamed polypropylene . other polymers which may be used include polyethylene , polyester , polystyrene , polycarbonate or compatibilized polymer blends . it is preferred to utilize a hydrophilic material in conjunction with the low density polymeric label to allow for more rapid escape of water from the water based adhesive that is placed on the back of the low density polymeric label . hydrophilic materials are selected so that their thickness and modulus of elasticity when applied to a polymer film will result in a polymeric film facestock that will have hydrophilicity , absorbtivity , wet tack and drying properties that will permit the polymer film to be applied to polymeric or glass containers via water based wet labeling techniques on standard paper labeling equipment . the apparatus which is used to apply paper labels is well known to those in the art . the polymeric label substrate with the hydrophilic coating will demonstrate sufficient “ wet tack ” during the label application period and the label drying period to permit containers to be handled and processed . the polymeric film based facestock will provide a label with printability , chemical and dimensional stability , resistance to cracking , tearing , creasing , wrinkling or any other degradation of the sort experienced by paper labels due to physical or environmental extremes . as used herein , the reference to “ a container ” includes a surface of an object made of glass , plastic or metal , such a dishes , toys , beer bottles , building materials and the like . optionally , if a metalized coating of a thin metal film is deposited on the polymeric sheets or rolls , premium quality decorative labels with all of the advantages set forth above will be provided . the hydrophilic component or blends containing the hydrophilic component will be applied in the present invention to the selected polymeric sheet in a continuous or patterned layer to provide the absorptive , wet tack and drying properties that are necessary to enable polymeric sheets to be successfully used as label substrates on polymeric or glass containers when applied with water based wet labeling techniques . the hydrophilic layer which may be applied by either a coating or an extrusion technique has the function of absorbing moisture to activate the layer , thus causing the hydrophilic layer to function as an adhesive without any additional adhesive or to absorb the moisture from an adhesive if used and to pass the moisture thru the hydrophilic layer and micro voided substrate to cause the polymer film to adhere to the glass , metal or plastic container and to set up rapidly and positively . the choice of polymeric substrate for the label film will determine the rigidity , deformability or conformability , regrindability , printability and expansion or contraction characteristics required for application to the selected container without the problems associated with paper labels . the term “ film facestock ” or “ polymeric label substrate ” as used herein should be taken for purposes of the present invention to refer to a monolayer , coextruded , coated or laminated material compatible in terms of rigidity , deformability or conformability , regrindability if a plastic container and expansion or contraction characteristics with the plastic , metal or glass container to be labeled . similarly , the “ hydrophilic layer ” previously mentioned has the properties of wet tack , absorbtivity , drying , sufficient adhesion to the polymeric label substrate and affinity and adhesion to the labeling adhesive if used in the wet or dry form . it is contemplated that selected hydrophilic layers can be wet or remoistened without adhesive for use on a glass or plastic container or a water based adhesive can be used to affix the polymeric label substrate with the hydrophilic layer to the glass or polymeric container . for deformable containers , the adhesive if used , can be selected from those commercially available that are characterized by the ability to form a bond with the container and a hydrophilic layer such that when dry , the strength of the container wall - adhesive interface and the hydrophilic layer - adhesive interface and the cohesive strength of the adhesive itself are all greater than the forces required for deformation of the label . as used herein and in the appended claims , the term “ hydrophilic ” is used to describe materials or mixtures of materials which bind , pass or absorb water . the preferred “ hydrophilic ” materials are those acrylic polymers which bind or absorb water . the especially preferred “ hydrophilic ” material is dp6 - 6006 , a sodium polyacrylate available from ciba specialties . it is also an aspect of the present invention to use crosslinkable ( reactive ) components in the hydrophilic layer that can cure with a catalyst supplied in the hydrophilic layer , rewetting water or adhesive ( if used ) that will promote adhesion to the labeled container along with chemical and moisture resistance . examples of cross - linkable materials include carboxylated synthetic resins . the catalyst can also be added to the adhesive which could have reactive components which would cure the adhesive and hydrophilic layer together . examples of crosslinkable components include zirconium salts of mineral acids , polyfunctional aziridine , water soluble polyamide - epichlorohydrin material such as polycup 172 , zinc ammonium carbonate and the like which may be used at a level of 0 . 2 - 8 % by weight of the adhesive composition . the coated , extruded or coextruded hydrophilic layers functionality can be defined as a substance capable of combining two surfaces by the formation of a bond whether it is a moist hydrophilic layer to glass or polymer or a dry hydrophilic layer to a wet labeling adhesive which as an intermediate layer that bonds to both the hydrophilic layer and glass or polymer of the container when dry . the use of the proper hydrophilic layer for a given polymeric labeling substrate and container to be labeled will have a direct effect on the speed which the labeling line can be run . when considering the choice of the material which forms the hydrophilic layer , which may be applied by coating , coextrusion or extrusion , one must consider the label substrate , container to be labeled , labeling machinery , water or adhesive application technique and down stream processing requirements such as filling , conveying and packing . generally a thickness of from 0 . 1 to 8 mils of the hydrophilic layer , when dried , may be employed on the polymeric film layer , depending on the particular hydrophilic material that is selected . it is critical to the successful application of a hydrophilic polymeric film label to control how the water or water based adhesive is applied to the hydrophilic layer , how deposition ( weight or thickness ) is controlled and how the resultant combination with the container is pressed together . generally , from 0 . 25 to 6 mils of water or water based adhesive is applied to the hydrophilic layer with 100 % coverage of the label . if a grid or other pattern of adhesive is employed , then the overall amount of adhesive consumed is reduced . if a grid pattern is employed , the hydrophilic layer may be applied to be substantially in register with the adhesive layer . it will generally be possible to reduce the typical amount of adhesive applied to a label when using the hydrophilic layer of the invention to an amount which 20 - 80 % of the amount that is typically employed for affixing paper labels to a surface . the choice of the hydrophilic layer and the type of label substrate and container to be adhered together , as discussed above , the plant processing conditions after labeling , storage requirements and the end use requirements that must be met such as high temperature resistance or ice proofness and the choice of an intermediate adhesive layer are important considerations . there are many more specific variables within these considerations all of which influence the formulation of the proper hydrophilic layer and adhesive ( if used ) for a specific application . mechanical adhesion is defined as the bonding between surfaces in which the adhesive holds the parts together by inter - locking action and actual physical penetration . specific adhesion is the bonding between surfaces which are held together by molecular forces wherein the surfaces are non porous and no penetration is possible . these forces are related to the polarity and size of the molecules and the initial action in obtaining a bond when the hydrophilic surface is wet and a bond develops through molecular forces . in mechanical as well as specific adhesion , the optional hydrophilic layer with optional intermediate adhesive layer must “ wet ” both surfaces completely or weak bonded areas will develop as it dries or “ sets ” resulting in a poor bond . not only is wetting of the surfaces critical , penetration is also important . penetration is important since most combinations of surfaces to be adhered together involve at least one porous or absorptive surface which controls the “ setting ” characteristics . to facilitate specific adhesion , wetting of the surface and penetration are critical for the hydrophilic layer or hydrophilic layer with intermediate adhesive which must be in a fluid state . for purposes of this invention , this is accomplished by applying water or water based adhesive to the selected hydrophilic layer which when applied to the container to be labeled brings the hydrophilic layer and container wall into intimate molecular contact . by using a wet hydrophilic layer or intermediate adhesive which also wets and penetrates the hydrophilic layer as well as the container surface , a fluid region is created that flows to cover the surface as completely as possible . this is critical to the invention where even an apparently smooth surface in reality is composed of a random network of hills and valleys . when the hydrophilic layer is in the wet condition , with or without adhesive , it serves as a wetting bridge to promote adhesion . various commercially available adhesives can be utilized to provide good adhesion of polymeric film layers to a plastic , metal or glass surface . these materials include starch based adhesives or casein based adhesives now predominantly used for glass applications since they do not bond well to plastic or metal . specific adhesives that may be employed include eva based materials which have free carboxyl groups , converted starch solutions , pva based adhesives , casein based adhesives , synthetic resin dispersions for metal or plastic containers or blends of synthetic and starch based products and the like . it is clear that one specific hydrophilic layer may not fit all applications but hydrophilic layers can be tailored to particular applications based on the conditions and requirements for wet pml labeling of polymeric substrates . if an adhesion promoting tie layer or primer is employed to promote hydrophilic layer adhesion or adhesive adhesion , materials such as maleic anhydride , ethyl acrylic acid , carboxylated polyurethane resin and the like may be employed at levels of 0 . 1 - 3 lb / 3 , 000 sq . ft . if a cross - linking catalyst is added to the adhesion promoting tie layer , the ratio of catalyst to adhesion promoting tie layer may be an amount that is sufficient to cure the adhesion promoting tie layer . an excess of the catalyst , i . e . 5 - 25 % in excess of the amount of the catalyst that is required to cure the adhesion promoting tie layer may be used to provide a portion of the catalyst at the interface of the adhesion tie promoter and the hydrophilic layer to increase the moisture resistance of the hydrophilic layer without decreasing the moisture absorbtivity of the hydrophilic layer . additionally , excess catalyst can also be available to aid in curing of the adhesive . plasticizers such as n - di - octylphthalate may be employed at a level of 0 . 5 - 3 % by weight of the adhesive composition to prevent the polymeric film label from losing flexibility . the slip aids and anti - blocking compounds prevent excessive friction between the hydrophilic layer and the adhesive layer and also control the effect of ambient moisture levels which may tend to interfere with the operation of high speed automated machinery which is used for apply labels . these materials may be used at a level of 0 . 5 - 3 % by weight of the hydrophilic composition or may be coextruded or coated with the low density film and include materials such as microcrystalline wax emulsions , erucamide disp , polytetrafluoroethylene compositions , silicone beads , modified silicone solutions , parafin wax emulsions , high melting polypropylene emulsions , carnauba wax emulsions , oxidized ethylene / eva compositions , micronized polyethylene wax / ptfe emulsions , micronized polypropylene , micronized fluorocarbons such as ptfe ( teflon ), micronized polyethylene , silica and talc . if an antistatic agent is employed , it may be present at a level of 0 . 5 - 3 % by weight of the hydrophilic formulation . these materials include quaternary ammonium salts such as ethaquad c12 , sulfonated styrene maleic anhydride , sulfonated polystyrene , sulfonated vinyl toluene maleic anhydride conductive polymers and organo modified silicones such as silwet 77 . protective coatings may be used to protect the exposed polymer film of the label when applied at a level of 0 . 25 - 4 lbs / 3000 sq . ft . using conventional application techniques . these materials include styrenated acrylics such as oc1043 from o . c . adhesives , inc ., flexon release varnish from manders - premier . if desired a humectant may be added to the hydrophilic layer at a level of 0 . 5 - 3 % to provide curl resistance and to impart layflat properties to the polymeric film labels . these humectants include urea , polyethylene glycols ( such as peg400 ), polyvinyl alcohol , glycerine and the like . 2 . 2 mil white oriented polypropylene ( opp ) product code opalyte from mobil chemical with a nominal density of 0 . 62 was coated at 4 lb ./ 3000 sq . ft . dry with a 50 % solids water based solution . the solution consisted of a mixture of 50 parts dry of dextrin 2723625 from findley adhesives and dextrin compatible polyvinyl acetate homopolymer emulsion binder resin 25 - 1072 from national starch and chemical . the coated substrate was printed and cut into individual patch labels which were applied to high density polyethylene containers on a high speed water based labeler using water based resin - starch adhesive oc363 - 20 from oc adhesives corp . at a deposition of 1 . 5 dry mils in a corn row pattern . there was sufficient wet tack to prevent label swimming immediately after labeling through conveying and bulk packing . the labeled containers dried sufficiently after 8 hours to ship bulk packed to a filling plant 20 miles away by truck where they were conveyed through a filling system and packed in cases . when it was attempted to remove the labels after 3 days , the bond of the label was stronger than the cohesive strength of the cavitated layer of film which fractured and left a thin layer of voided opp over 55 % of the labeled area of the container . it was noted that the adhesive had penetrated the cellular structure of the voided opp because the tack of the adhesive could be felt on top of the fractured area . nominal 3 mil white oriented polypropylene ( opp ) product code iml - 333 from applied extrusion technologies , with a density of 0 . 7 was coated at 2 lb ./ 3000 sq . ft . with a 40 % solids water based solution . the solution consisted of a mixture of asp400p clay from engelhard industries and dp6 - 6066 sodium polyacrylate binder polymer as a hydrophilic layer in the dry ratio of 2 : 1 clay to binder . the clay binder mixture was catalyzed with cx - 100 polyfunctional aziridine at a level of 0 . 25 % based on the total dry weight of the hydrophilic layer to promote adhesion of the coating to the substrate and improve water resistance without eliminating the hydrophilic nature of the coating . the coated substrate was printed and coated with a protective over lacquer prior to being cut into individual patch labels which were applied to coextruded polyester based containers on a high speed water based labeler using water based starch - resin adhesive 10 - 7302 from henkel adhesives at a deposition of 2 dry mils in a corn row pattern . there was sufficient wet tack to prevent label swimming immediately after labeling through packing . the labeled containers dried sufficiently at the edges after 3 days at room temperature to permit handling and use . when it was attempted to remove the labels , the bond of the label was stronger than the cohesive strength of the cavitated layer of film which fractured and left a thin layer of voided opp over 70 % of the labeled area of the container . a laminate was made which consisted cavitated polypropylene of trade name ( wtl a 2 mil cavitated oriented polypropylene ( opp ) from applied extrusion technologies with a density of 0 . 7 ) was permanently adhered to the underside of a 0 . 48 mil metalized polyethylene terephthalate from advanced web products . the composite structure was assembled using a urethane - acrylic laminating adhesive ( as284 - 16 from adhesion systems inc .) applied at 1 . 5 lb ./ 3000 sq . ft . and 2 % of cx - 100 aziridine cross - linker from zeneca resins using conventional laminating techniques . the opp side of the laminate was primed with a reactive primer consisting of a carboxylated polyurethane resin sancure 1301 from sancure industries that was catalyzed with excess ( 5 % wet on wet ) cx - 100 polyfunctional aziridine from zeneca resins at a deposition of 0 . 1 - 0 . 2 lb ./ 3000 sq . ft . a coating at 2 dry lb ./ 3000 sq . ft . was applied over the primed surface from a 40 % solids water based solution . the solution consisted of a mixture of asp400p clay from engelhard industries and dp6 - 6066 sodium polyacrylate binder polymer in the dry ratio of 1 . 5 : 1 clay to binder . a portion of the excess aziridine in the primer is available on the surface of the cured primer to react with active sites in the dp6 - 6066 / clay matrix ( hydrophilic layer ) to promote adhesion of the coating to the substrate and improve water resistance without eliminating the hydrophilic nature of the coating . the coated substrate was printed and cut into individual patch labels which were applied to glass containers on a high speed water based labeler using water based adhesive 10 - 7026 from henkel adhesives at a deposition of 3 dry mils in a corn row pattern . there was sufficient wet tack to prevent label swimming immediately after labeling through packing . the labeled containers dried sufficiently at the edges after 1 day at room temperature or 3 days in cold storage to permit handling and use . when it was attempted to remove the labels , the bond of the label was stronger than the cohesive strength of the cavitated layer of film which fractured and left a thin layer of voided opp over 75 % of the labeled area of the container . in areas where the metalized pet could be separated from the opp , it was noticed that the adhesive had penetrated the cellular structure of the voided opp . this was noticed because the moist surface and wet tack of the adhesive drying through the cellular structure could be felt on top of the opp fractured area . a cavitated polypropylene film from applied extrusion technologies , ( iml 333 ) with a density of 0 . 7 was coated on one side of the film with clay filled acrylic resin at a ratio of 3 parts clay to 1 part resin ( pd959 - 400 from process resources corp .) at a coating level 1 . 5 lb / 3 , 000 sq . ft . using 2 % cx - 100 aziridine as a cross - linker . the film is printed with label indicia on the uncoated side and patch labels were cut and applied to glass bottles using a water based starch - resin adhesive with zinc cross - linker ( as692 - 1 from adhesion systems , inc .). after two weeks , it was determined that the labels were fully dried and adherent to the glass bottles .
| 2 |
the practice of the techniques described herein may employ , unless otherwise indicated , conventional techniques and descriptions of organic chemistry , polymer technology , molecular biology ( including recombinant techniques ), cell biology , biochemistry , and sequencing technology , which are within the skill of those who practice in the art . such conventional techniques include polymer array synthesis , hybridization and ligation of polynucleotides , and detection of hybridization using a label . specific illustrations of suitable techniques can be had by reference to the examples herein . however , other equivalent conventional procedures can , of course , also be used . such conventional techniques and descriptions can be found in standard laboratory manuals such as green , et al ., eds . ( 1999 ), genome analysis : a laboratory manual series ( vols . i - iv ); weiner , gabriel , stephens , eds . ( 2007 ), genetic variation : a laboratory manual ; dieffenbach , dveksler , eds . ( 2003 ), pcr primer : a laboratory manual ; bowtell and sambrook ( 2003 ), dna microarrays : a molecular cloning manual ; mount ( 2004 ), bioinformatics : sequence and genome analysis ; sambrook and russell ( 2006 ), condensed protocols from molecular cloning : a laboratory manual ; and sambrook and russell ( 2002 ), molecular cloning : a laboratory manual ( all from cold spring harbor laboratory press ); stryer , l . ( 1995 ) biochemistry ( 4th ed .) w . h . freeman , new york n . y . ; gait , “ oligonucleotide synthesis : a practical approach ” 1984 , irl press , london ; nelson and cox ( 2000 ), lehninger , principles of biochemistry 3 rd ed ., w . h . freeman pub ., new york , n . y . ; and berg et al . ( 2002 ) biochemistry , 5 th ed ., w . h . freeman pub ., new york , n . y ., all of which are herein incorporated in their entirety by reference for all purposes . note that as used herein and in the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include plural referents unless the context clearly dictates otherwise . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . all publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices , formulations and methodologies that may be used in connection with the presently described invention . where a range of values is provided , it is understood that each intervening value , between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention . the upper and lower limits of these smaller ranges may independently be included in the smaller ranges , and are also encompassed within the invention , subject to any specifically excluded limit in the stated range . where the stated range includes one or both of the limits , ranges excluding either both of those included limits are also included in the invention . in the following description , numerous specific details are set forth to provide a more thorough understanding of the present invention . however , it will be apparent to one of skill in the art that the present invention may be practiced without one or more of these specific details . in other instances , well - known features and procedures well known to those skilled in the art have not been described in order to avoid obscuring the invention . the present invention is drawn to measuring the level of expression of fel d 1 from cat saliva . the methods of the invention are noninvasive and allow for accurate measurement of fel d 1 expression by measuring mrna levels , most preferably through reverse transcription of the mrna into cdna , then quantifying the cdnas using qpcr , dpcr or next generation ( massively parallel ) sequencing . to date , an elisa assay has been developed to measure fel d 1 protein directly ; however , the elisa assay requires administration of a salivant to the cat to produce the large amount of saliva needed to run the assay . the methods of the present invention require a greatly reduced amount of saliva — as much as 100 - fold less or more — to measure fel d 1 expression . sample collection for the present invention is straightforward . sterile cotton swabs can be used , or , alternatively , saliva collection kits known in the art can be used , where such devices typically comprise a sterile absorbent device or swab or “ sponge ”, and a sterile container in which the device can be placed once it has been used and before sample processing . the methods of the present invention typically are used without first administering a salivant to the cat — instead , the methods of the present invention utilize collection of saliva that is naturally produced by the cat . however , because mrna is used to quantify the expression of the felis domesticus 1 ( fel d 1 ) protein , extreme care needs to be taken to assure that ribonucleases ( rnases ) are avoided . though studies show that saliva has natural stabilizing enzymes that keep mrna intact for up to three months at room temperature ( wong , et al , clinical chemistry , 57 ( 9 ): 1295 - 302 ( 2011 )), rnases are very stable and active enzymes that generally do not require cofactors to function , making rnases difficult to inactivate . because even minute amounts are sufficient to destroy rna , plasticware or glassware should never be used without first eliminating possible rnase contamination . that is , great care should be taken to avoid inadvertently introducing rnases into the rna sample during or after the isolation procedure . in order to create and maintain an rnase - free environment , precautions should be taken . for example , use of sterile , disposable polypropylene tubes is recommended , and glassware , e . g ., should be cleaned with a detergent , thoroughly rinsed , and oven baked at 240 ° c . for four or more hours . additionally , gloves , a lab coat , sterile face mask and goggles should be worn , and preferably , all prep work should be performed in an area that has been scrubbed down and preferably is dedicated to working with rna . the present methods are drawn to collection of saliva and are noninvasive ; however , alternative methods may employ sample collection from the sebaceous glands of the cat . mrna can be isolated by any one of many methods known in the art . for example , poly ( a )- rna preparation can be accomplished using cellulose - bound oligo - dt , but several other reagents have been developed , e . g ., streptavidin - coupled magnetic beads used in combination with biotinylated oligo - dt or oligo - dt - coupled polystyrene - latex beads . the oligo - dt / carrier combinations are available separately from several manufacturers ; however , one may find it more convenient to use a kit which has the advantage of containing most of the necessary reagents pre - packaged in rnase - free quality , e . g ., polyattract ® from promega , polya spin ™ from new england biolabs or oligotex ™ mrna kit from qiagen . alternatively , one can simply treat the sample with rnase - free dnase to eliminate the dna in the sample , thereby enriching the sample for rna . rt - pcr ( reverse transcription pcr ) is used to clone expressed genes by reverse transcribing mrna into its dna complement through the use of the enzyme reverse transcriptase . subsequently , the newly synthesized cdna is quantified using qpcr , dpcr or next generation ( aka massively parallel ) sequencing . the quantification of mrna using rt - pcr can be achieved as either a one - step or a two - step reaction . the difference between the two approaches lies in the number of tubes used when performing the reverse transcription step and the subsequent pcr amplification step . in the one - step approach , the entire reaction from cdna synthesis to qpcr or dpcr amplification occurs in a single tube . in contrast , the two - step reaction requires that the reverse transcriptase reaction and qpcr or dpcr amplification be performed in separate tubes . the one - step approach is thought to minimize experimental variation by containing all of the enzymatic reactions in a single environment . one method for quantifying the cdna resulting from the reverse transcription procedure in a sample is use of quantitative pcr or qpcr . qpcr follows the general principle of the polymerase chain reaction ; the key feature of qpcr being that amplified dna is detected as the reaction progresses in real time as opposed to standard pcr , where amplified dna is detected only after the final reaction cycle . two common methods for detection of products in real - time pcr are the use of non - specific fluorescent dyes that intercalate with any double - stranded dna , and the use of sequence - specific dna primers consisting of oligonucleotides that are labeled with a fluorescent reporter that permits detection only after hybridization of the primer with its complementary dna target . qpcr typically is run in a real - time pcr instrument , where after each cycle levels of fluorescence are measured with a detector . the detection or reporter dye fluoresces only when bound to double - stranded dna , that is , the pcr product and can be detected only when a threshold of pcr product has been produced . the earlier the cycle in which pcr product is detected , the more cdna — hence mrna — there is in the sample . a low ct value correlates with detectable pcr product at an early cycle , and a large ct value correlates with detectible pcr products at a later cycle . the concentration of the qpcr product can then be determined , e . g ., with reference to a standard dilution or concentration can be relative to other samples . an alternative method for quantifying cdna in a sample is digital pcr or dpcr . with dpcr , the cdna sample is partitioned so that individual nucleic acid molecules within the sample are localized in separate small volumes , such as in micro - well plates , capillaries , a phase emulsion , or in arrays of very small - volume chambers , typically in a dilution of only one molecule in every two chambers . as a result , each small volume will contain one or no molecules , resulting in a positive or negative pcr reaction , respectively . the separation of the nucleic acids allows for counting of individual molecules , resulting in a more reliable and sensitive measurement of nucleic acids than can be obtained by standard pcr or by qpcr , as amplification bias is effectively eliminated . after amplification , the nucleic acids are quantified by counting the number of locations that contain a pcr end - product ; for example , by using differently - labeled oligonucleotide probes ( see , e . g ., vogelstein and kinzler , pnas usa , 96 : 9236 - 41 ( 1999 )). a third method for quantifying the cdna in a sample is next generation sequencing ( ngs ), also known as massively parallel sequencing ( mps ), which also allows for single molecule counting , and thus increased accuracy . current ngs methods and systems that allow for single molecule counting include pyrosequencing , as commercialized by 454 life sciences ; sequencing by ligation , as commercialized in the solid ™ technology , by life technology , inc ., carlsbad , calif . ; sequencing - by - synthesis methods using modified nucleotides , as commercialized in truseq ™ and hiseq ™ technology by illumina , inc ., san diego , calif . ; pacbio rs by pacific biosciences of california , inc ., menlo park , calif . ; sequencing by ion detection technologies , as commercialized by ion torrent , inc ., south san francisco , calif . ; and sequencing of dna nanoballs , commercialized by complete genomics , inc ., mountain view , calif . it should be noted that many techniques for sample collection , sample processing , mrna isolation or enrichment and nucleic acid quantification are known in the art , and the present invention should not be limited by the exemplary methods mentioned above , or in the examples , below . the following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention , and are not intended to limit the scope of what the inventors regard as their invention , nor are they intended to represent or imply that the experiments below are all of or the only experiments performed . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . efforts have been made to ensure accuracy with respect to numbers used ( e . g ., amounts , temperature , etc .) but some experimental errors and deviations should be accounted for . unless indicated otherwise , parts are parts by weight , molecular weight is weight average molecular weight , temperature is in degrees centigrade , and pressure is at or near atmospheric . saliva was obtained from adult cats using an rnase free technique with sterile gloves . cats were gently wrapped in blankets , containing their bodies while exposing their heads . a sterile buccal swab was inserted into the cat &# 39 ; s mouth and gently brushed against each of the cat &# 39 ; s four cheek pouches in a circular motion . the buccal swab was then inserted under the tongue , contacting all salivary glands possible . the buccal swab was then inserted into an rnase free 1 . 7 ml microcentrifuge tube and cut at the base of the cotton tip with scissors sterilized with ethanol . the tube containing the swab was then labeled . studies show that saliva has natural stabilizing enzymes that keep mrna intact for up to three months at room temperature , but samples were refrigerated to inhibit the growth of bacteria until transported to the lab ( wong , et al , clinical chemistry , 57 ( 9 ): 1295 - 302 ( 2011 )). in order to acquire a large enough sample , each cat was swabbed two times to obtain a sufficient starting volume of saliva . the swabbing process is the extent of cat participation in the methods of the invention , and the process itself took under a minute . the swabs were centrifuged at 8 , 000 × g for one minute and then carefully inverted with two sets of sterile tweezers and replaced in the microcentrifuge tubes . the tweezers were sterilized with 70 % ethanol between inversions among samples of different test subjects . once the swabs were inverted , the samples were centrifuged again at 8 , 000 × g for an additional minute to pull remaining saliva out of the cotton swab . the swabs were then discarded , and the supernatant in the microcentrifuge tube was centrifuged briefly . anywhere from 30 μl to 200 μl of feline whole saliva was collected depending on the cat &# 39 ; s mouth size and varying production of saliva . primers were created using ncbi and idt ( integrated dna technologies ) online databases and services . the following primers were used : immediately after the pooling of samples , preparations for reverse transcription were made . the resulting cdna was then used as a template for qpcr . throughout the procedure , rnase free techniques were used . a lab coat , goggles , and gloves were worn for the duration of the experiment and rnase - zap was utilized to clean surfaces , pipets , and gloves throughout experimentation . to prepare for reverse transcription , 10 mm dntp , edta , 10 × buffer , 5 × buffer , and 0 . 1 m dtt ( all from qiagen ) were taken out of the − 20 ° c . freezer and set on the bench to thaw . when the reagents were fully thawed , each was vortexed , centrifuged , and put on ice . the primers for the genes of interest ( fel d 1 - 2 , feline gapdh , and / or feline rps7 ) were also taken from the freezer and set to thaw . the enzymes rnase out ™ ( life technologies , inc . ), superscript iii ® ( ssiii ) ( life technologies , inc . ), and dnase out ™ ( life techologies , inc .) were left in the freezer until needed . 200 μl rnase - free tubes were clearly labeled with the rna sample id ( the cat ), the target gene , negative or positive , and the date . the negative reverse transcription control tubes did not receive the ssiii . a negative and positive control reaction was run for each gene for each sample . two genes were tested , so each cat required a feline gapdh or rps7 negative and positive reaction , as well as a fel d 1 - 2 negative and positive reaction . when the primers were fully thawed , each was vortexed and centrifuged three times . then 5 μl forward and 5 μl reverse primers were added into a 1 . 7 ml microcentrifuge tube . the primer stock was 100 mm concentration , and the inner primer solution used for reverse transcription was 50 mm . if more inner primer solution was needed for a larger sample size , 5 μl more of both forward and reverse primers were added in equal parts until desired volume was obtained . the primer stock was then returned to the freezer and the inner primers were vortexed vigorously and centrifuged three times . the primers were then set on ice . the saliva samples were vortexed and centrifuged at & gt ; 4 , 000 × g three times . 12 . 6 μl rnase free water was then added to each 200 μl microcentrifuge tube , then 4 μl of sample was added to the microcentrifuge tubes . a total starting volume of 16 . 6 μl was achieved for each reaction tube . the reactions were then vortexed and centrifuged at & gt ; 4 , 000 × g three times . to each reaction , 1 μl rnase out ™ ( life technologies , inc ), 1 . 6 μl 10 × dnase buffer , and 5 μl dnase out ™ ( life techologies , inc .) were added . the dnase out ™ was added last , and the reactions were quickly pipetted up and down to mix the reaction . a timer was then set for six minutes and the reactions were incubated at room temperature . during incubation , the thermocycler was turned on and the program “ 70 hold ” was selected and set for a volume of 25 μl . immediately after six minutes , 1 . 2 μl 25 mm edta was added to each reaction ( to inhibit the dnase digestion ) and the tube was then flicked to mix . all reactions were then centrifuged & gt ; 4 , 000 × g . the samples were then incubated in the thermocycler at 70 ° c . for five minutes . after incubation the reactions were set on ice for a few minutes to cool and then centrifuged at & gt ; 4 , 000 × g to collect any condensation . the thermocylcer was then reset to “ 70 hold ” once more . 2 μl of inner primer was then added to each sample . feline gapdh or rps7 primer was added to its specified tubes and fel d 1 - 2 was added to its corresponding tubes . 1 μl 10 mm dntp was then added to each reaction , and tubes were then vortexed and centrifuged at & gt ; 4 , 000 × g . samples were incubated once again in the thermocycler for five minutes . reactions were put on ice for several minutes , and then centrifuged once more . while the reactions incubated in the thermoclycler , a mix was made in a 1 . 7 ml microcentrifuge tube . the number of reactions ( plus one extra for pipet error ) were multiplied by 6 μl 5 × rt buffer , 1 μl rnase out , and 1 μl 0 . 1 m dtt . the mix was then vortexed and centrifuged three times . 8 μl of the mix was then added to each reaction . next 1 μl ssiii was added to the positive reactions only . 1 μl of rnase free water was added to negative reactions only to make up for the volume difference . the samples were then vortexed and centrifuged at & gt ; 4 , 000 × g and incubated in the thermocycler under the program “ rt 50 ” ( volume set for 40 μl ). the reactions then incubated for about an hour . in the program “ rt 50 ” incubation temperatures are as follows : 50 ° c . for 50 minutes , 85 ° c . for 5 minutes , and 4 ° c . until samples were removed for further experimentation . the 4 ° c . mode acts as a freezer to preserve the samples . samples were then stored in the − 20 ° c . freezer . the unique aspect of the modified reverse transcription developed in this invention is the low sample volume required for experimentation . only 4 μl of feline saliva is needed for analysis , whereas elisa technology requires hundreds of microliters if not milliliters of starting sample . qpcr is the process where cdna is amplified within the qpcr thermocycler and specific gene expression is quantified using sybr green . cdna was taken from the − 20 ° c . freezer and set on the bench top to thaw . diluted primer mixes ( 10 μl forward primer , 10 μl reverse primer , 80 μl rnase free water , all vortexed and centrifuged three times ) were also set on the bench top to thaw . 200 μl microcentrifuge tubes were labeled with the test subject , gene of interest , negative or positive , and the date . two 1 . 7 ml tubes were labeled as “ fel d 1 mix ” and “ gapdh mix ” or “ rps7 mix ”. once the cdna completely thawed , all samples were centrifuged at & gt ; 4 , 000 × g and vortexed three times . 4 μl of cdna was then pipetted into corresponding tubes according to labels . 36 μl of rnase free water was then added to each sample . cdna was returned to the freezer and the samples were centrifuged at & gt ; 4 , 000 × g and vortexed three times once again . the qpcr primer mixes were then made in the following manner : 5 μl sybr green , 0 . 5 μl primer , and 1 . 5 μl rnase free water . a primer mix was created for each gene of interest multiplying the ingredients by the number of reactions plus one extra . once primer mixes were made , each was centrifuged at & gt ; 4 , 000 × g and vortexed three times . the diluted primers were then returned to the freezer . each sample was tested in triplicate . to begin , 3 μl of rnase free water was pipetted into all water reactions . each gene had two water reactions treated as a control to monitor erroneous amplification of primer dimers . next 3 μl of the corresponding cdna was pipetted into the well plate . then 7 μl of the corresponding primer mix ( fel d 1 primer for fel d 1 reactions and the appropriate housekeeping gene ) was pipetted into all wells including water reactions . the plate was then sealed and set in the qpcr thermocycler . qpcr analysis was run for two hours using sybr green as a fluorescent dye indicator . the entire qpcr experiment took approximately two hours , at which point cycle times and melt temperatures were recorded and graphs were created ( data not shown ). in addition , a melt curve was attached to the end of the amplification cycles to indicate product similarities . the cycle times and melt temperatures were recorded and δδct calculations are done ( data not shown ). amplification plots and melt curve graphs were stored on a flash drive for further use . δδct calculations were used to analyze all data . as all experiments were run in triplicate and therefore produced three ct values , the first step was to average and find the standard deviation for both the positive and negative ct values . this is done for both fel d 1 ( target gene ) and gapdh / rps7 ( the endogenous control / housekeeping gene ). negative controls should always have higher ct values than positive ct samples as larger ct values correlate to lower levels of expression . a table was created recording ct values along with averages and standard deviation values ( data not shown ). this table was then referred to throughout calculations . the next step was to normalize the amount of mrna in the reactions by subtracting the average ct value for gapdh or rps7 from the average ct value of fel d 1 ( 1 ). the standard deviation was calculated by finding the square root of the standard deviations for fel d 1 squared plus gapdh or rps7 squared ( 2 ). this was done for each cat saliva sample tested . this calculation is called the δct calculation as it compares or normalizes the expression of the target gene to the endogenous control gene in preparation to compare multiple cats side by side ( see livak and schmittgen , ( 2001 ), available from doi : 10 . 1000 / meth / 2001 . 1262 ). √{ square root over ( s 2 fel d 1 + s 2 gapdh )} ( 2 ) to compare the expression of fel d 1 amongst multiple cats , a δδct equation was used ( 3 ). this was accomplished by subtracting the “ calibrator ” cat &# 39 ; s δct value from the other cat &# 39 ; s δct value . the calibrator was always the hypoallergenic cat test subject . the standard deviation value used in δδct was the same value used for each δct value . the last mathematical step was calculating the relative quantity ( rq ) value ( 4 ). this calculation shows the fold difference of expression of fel d 1 among multiple cats . a maximum and minimum rq value was also calculated to express the error which is not proportionate due to the exponential nature of ct values . melt curves displayed a graphical representation of the melting temperature of the product of the qpcr reaction ( data not shown ). if the triplicates are aligned , only one product is being amplified . if multiple peaks appear on the graph , more than one product is being amplified or primer dimers are present ( primers binding to themselves ) and the qpcr experiment for that gene is deemed unsuccessful . a 1 . 5 % gel was run with a ladder and the product of qpcr reactions to see if the product size of the primer matched its intended target . the fel d 1 - 2 primer used was supposed to have a product length of 72 bp , and by running a gel with a ladder , this product length was confirmed ( data not shown ). fel d 1 , gapdh , and rps7 were all successfully detected and quantified in feline saliva . in one example , the amplification curve obtained represented the expression of fel d 1 and gapdh . on the x - axis was the cycle time ( ct ). larger cts indicate lower expression levels and smaller cts indicate higher expression levels . on the y - axis was a measurement of fluorescence . in the case of cat subject a , there was more fel d 1 relative to gapdh . each reaction was run in triplicates , with a tight amplification curve indicating a more precise experiment . δδct calculations were processed using the raw data represented in the amplification curves and allowed creation of relative comparisons among cats . as an alternative in some experiments , rps7 was used as an alternative to gapdh as the housekeeping gene . the preceding merely illustrates the principles of the invention . it will be appreciated that those skilled in the art will be able to devise various arrangements which , although not explicitly described or shown herein , embody the principles of the invention and are included within its spirit and scope . furthermore , all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions . moreover , all statements herein reciting principles , aspects , and embodiments of the invention as well as specific examples thereof , are intended to encompass both structural and functional equivalents . additionally , it is intended that such equivalents include both currently known equivalents and equivalents developed in the future , i . e ., any elements developed that perform the same function , regardless of structure . the scope of the present invention , therefore , is not intended to be limited to the exemplary embodiments shown and described herein . rather , the scope and spirit of present invention is embodied by the appended claims .
| 2 |
referring now to the figures of the drawing in detail , all the data cables 2 which are described below are cables preferably for symmetrical signal transmission in which the signal is transmitted over one line of a line pair , and an inverted signal is transmitted over the other line of a line pair . the data cable 2 is preferably a non - screened data cable 2 , that is to say , it does not have any screening . it has a comparatively simple structure . the data cable 2 in the exemplary embodiments has only a single conductor pair as a transmission core 4 . the conductor pair is composed here of two conductors 6 which are each formed by a line 8 and a conductor insulation 10 which surrounds it concentrically . the two conductors 6 are stranded to one another , that is to say twisted together , with a lay length . the conductor insulation 10 is preferably composed of polypropylene , and the line 8 is , in particular , a stranded conductor . the individual wires of the stranded conductor are embodied , in particular , as copper wires and are preferably tin - plated . as an alternative , the transmission core 4 can be formed by a quad stranded assembly , in particular a so - called star quad , in which two conductors 6 which are located diagonally opposite one another define the conductor pair for the symmetrical data transmission . the four conductors 6 are stranded to one another . the conductors 6 bear with their conductor insulations 10 directly against one another . a filler strand can be arranged in the center in order to ensure the high level of symmetry which is desired for an interference - free signal transmission . overall , a high degree of symmetry with such a non - screened data cable 2 is sought and realized , in order to ensure an interference - free signal transmission . in the first basic variant illustrated in fig1 , the transmission core 4 is first surrounded directly by an intermediate sheath 12 which is in turn surrounded by a foamed outer sheath 14 . the data cable 2 preferably does not have further layers . the intermediate sheath 12 is preferably a solid intermediate sheath 12 . alternatively , it can also be a foamed intermediate sheath 12 . both the intermediate sheath 12 and the outer sheath 14 are preferably applied by way of an extrusion process . the intermediate sheath is composed , for example , of tpe s ( thermoplastic elastomer , styrenic block copolymers ). in the exemplary embodiment , the foamed outer sheath 14 is composed of polypropylene . owing to the foamed embodiment , the outer sheath 14 forms a jacket with a high proportion of air . the degree of foaming is here , in particular , at least approximately 50 %. the outer sheath 14 has a wall thickness w 1 which is in the range from 0 . 2 to 0 . 8 mm and is preferably in the region of 0 . 5 mm . the intermediate sheath 12 has an average wall thickness w 2 which is in the range from 0 . 3 to 1 mm and is in particular approximately 0 . 5 mm . it is preferably somewhat larger than the wall thickness w 1 of the outer sheath 14 . the average wall thickness w 2 is understood here to be the difference between the radii of the transmission core 4 and the outer radius of the intermediate sheath 12 , as is apparent from fig1 . in view of the desired high degree of symmetry , the intermediate sheath 12 surrounds the transmission core 4 strictly concentrically . in this context , during the extrusion process sheath material of the intermediate sheath 12 also penetrates the interstices between the two conductors 6 . the outer sheath 14 is also arranged strictly concentrically . the entire data cable 2 has an outer diameter d 1 which is defined by the outer diameter of the outer sheath 14 . furthermore , the intermediate sheath 12 has a diameter d 2 , and the transmission core has a diameter d 3 . the latter is usually in the range between 1 . 5 and 2 . 2 mm and is in particular approximately 1 . 8 mm . the diameter d 2 of the intermediate sheath 12 is in the range from 2 . 8 to 3 . 4 mm and is preferably approximately 3 mm . the total outer diameter d 1 is approximately 0 . 8 to 2 mm and in particular approximately 1 mm above that , with the result that overall there is a total outer diameter d 1 of approximately 3 . 6 to 5 . 5 mm and preferably of approximately 4 mm . it is henceforth of particular significance that the diameter d 2 of the intermediate sheath corresponds to a standard outer diameter such as is necessary for standard plugs in such ethernet lines which are used in the field of automobiles . when a plug 16 such as is indicated in a highly simplified form , for example , in fig2 is assembled , firstly only the outer sheath 14 is removed in the end region over , for example , several centimeters and the data cable 2 is only introduced with the intermediate sheath 12 into the plug 16 . for the necessary assembly , the outer sheath 14 is preferably easily separable from the intermediate sheath 12 here . this is achieved , for example , by means of different materials for these two sheaths 12 , 14 and / or by providing a separating layer between these two sheaths 12 , 14 . the data cable 2 which is described in fig1 and 2 provides overall the particular advantage that as a result of the arrangement of the outer sheath 14 with the high proportion of air and the specific dimensioning of the intermediate sheath 12 to the standard measure of 3 mm a data cable 12 which is improved with respect to the signal transmission quality is made available and at the same time it is possible to have recourse to standard assembly elements such as the plug 16 . in particular an input of energy of an interfering source coming from the outside is at least reduced by the outer sheath 14 and the resulting increased dimensioning and surface of the data cable 2 . at the same time , the amount of material required and the additional weight is kept as low as possible by virtue of the foamed outer sheath 14 . the sensitivity with respect to the so - called alien - next is therefore reduced . the embodiment variants which are illustrated in the further figures represent different embodiment variants of a second basic variant in which the jacket with the high proportion of air is arranged directly around the transmission core 4 . in the exemplary embodiment illustrated in fig3 a and 3b , this jacket forms at the same time an outer sheath 18 . the entire data cable 2 is therefore formed merely by the transmission core 4 and the outer sheath 18 thereof . fig3 a also illustrates a four - conductor , starquad cable . it should be understood that the embodiment of fig3 a may also contain two conductors ; at the same time , the embodiment of fig1 may be a starquad cable . the outer sheath 18 is , in particular , a hose - shaped element in the form of a spunbonded fabric 20 which is extruded onto the transmission core 4 . this outer sheath 18 is therefore characterized by individual strands which cross one another and which are therefore embodied , for example , in the form of a grid and enclose free air spaces 22 between them . in this context , a solid or else a foamed hf - compatible plastic is used as the material for the spunbonded fabric 20 . such extruded spunbonded fabrics are known as packing materials . they are produced by two perforated disks which rotate in opposite directions in an extruder . in order to form the structure , in particular two so - called d braiding elements running in opposite directions are bonded to one another at the intersection points . the conductors 6 of the transmission core 4 are basically suitable to be used even without a solid outer sheath . this is exploited by the exemplary embodiment in fig3 a and 3b , since additional protection via a solid outer sheath is not absolutely necessary . at the same time , an improved data transmission owing to relatively low signal attenuation is achieved by virtue of the outer sheath 18 which is embodied as a jacket with a high proportion of air . the dimensions of the data cable 2 are in turn comparable with those according to fig1 . the trans - mission core 4 is here embodied in an identical way and the outer sheath 18 has here a diameter d 2 which corresponds to the diameter d 2 of the intermediate sheath 12 in the embodiment variant of fig1 . the outer sheath 18 according to fig3 a therefore has a diameter d 2 of approximately 3 mm , with the result that the data cable 2 is suitable for standard plugs 16 . the spunbonded fabric 20 forms in total a spacer element . this spunbonded fabric 20 therefore forms a spacer with respect to , for example , adjacent data cables 2 or else ground potentials ( vehicle bodywork ) and other components . as a result of the embodiment of the outer sheath 18 as a spunbonded fabric , material and weight are saved compared to solid outer sheaths . in the further exemplary embodiment according to fig4 a , 4b and 4c , the jacket with a high proportion of air is also additionally surrounded by an , in particular , solid outer sheath 24 . in the embodiment variant according to fig4 a , a foamed intermediate sheath 26 is concentrically applied to the transmission core 4 here before the latter is surrounded by a preferably solid outer sheath 24 . in fig4 b , in order to form the jacket with the high proportion of air a plastic strand 28 is applied which is arranged in a helical shape around the transmission core 4 and therefore keeps the outer sheath 24 at a distance from the transmission core 4 . the intermediate space between the transmission core 4 and the outer sheath 24 is formed by the free air space 22 . as a result of the application of the plastic strand 28 with the opposite lay to the stranding direction of the conductors 6 , the plastic strand 28 is reliably prevented from sagging in an interstice between the conductors 6 . as a result , the desired high degree of symmetry is ensured . subsequently , the outer sheath 24 is connected as a prefabricated hose onto this transmission core 4 which is provided with the plastic strand 28 . overall , this embodiment variant permits a very small usage of material with at the same time a high proportion of air in the jacket . as an alternative to the embodiment of the plastic strand 28 as a spacer element , in a way which is not illustrated in more detail here a hose - like element , similar for example to the spunbonded fabric 20 , is applied around the transmission core 4 . this can be the spunbonded fabric 20 shown in fig3 b or else a mesh or some other hose - like structure with free air spaces 22 . in particular , a so - called c screen as a mesh composed of plastic threads is applied . the outer sheath 24 is also preferably applied in a hose extrusion or semi - hose extrusion here . fig4 c shows an embodiment variant in which individual spacer elements 30 are integrally molded onto the outer sheath 24 so that they extend radially inward . the spacer elements 30 taper here in the direction of the transmission core 4 , with the result that they have a preferably rounded tip , with the result that they make contact with the conductors 6 as far as possible only in a punctiform fashion . in order to form the spacer elements 30 , corresponding protrusions are formed in an extrusion mouthpiece which is used for the extrusion of the outer sheath 24 . these protrusions remain at the identical point during the manufacturing process . at the same time , owing to the stranding the conductor pair rotates , and the rotation of the conductor pair therefore guides said conductor pair precisely in the center of the outer sheath 24 . the conductor pair therefore cannot slip into the gaps in the outer sheath 24 . in order to achieve the highest possible proportion of air , only a small number of spacer elements 30 , in particular at maximum eight and preferably only four spacer elements 30 , are expediently used here . in view of the desired high degree of symmetry , an even number is used here . in terms of manufacturing equipment , this embodiment can be fabricated on conventional extruders , and is defined by a high degree of mechanical stability and good processability , since no additional working steps are necessary for the assembly of a plug 16 . the diameter of the outer sheath 24 preferably corresponds here in turn to the standard diameter of approximately 3 mm . finally , in an alternative embodiment variant , which is not specifically illustrated in more detail , the outer sheath can be embodied as a hollow hose into which the stranded conductor pair is laid in a corrugated shape or zigzag shape . as a result , the transmission core 4 bears against the outer sheath only at the apex points of the recurring deformation . in the embodiment variants described here , an hf - compatible material is selected for the respective jacket . in the embodiment variants with the formed sheath , gas or air is introduced as virtual occlusions through either chemical or physical foaming processes . in particular , in the embodiment variant in fig1 , the foamed outer sheath 14 has at least also a thin skin layer to counteract mechanical stresses . this thin skin layer is sealed . in order to manufacture the foamed sheath , an extrusion line with the possibility of physical foaming or a sheath material which is provided with a blowing agent is used for the extrusion . the data cable 2 which is described here is used , for example with further cables or lines in a common cable harness , in a motor vehicle as part of the on - board power system . the following is a summary list of reference numerals and the corresponding structure used in the above description of the invention :
| 7 |
fig1 is a series of histograms showing the reactivity of anti - b1 and anti - b5 monoclonal antibody to splenic b - cells activated with anti - ig antibody ; fig2 is a pair of histograms showing the reactivity of anti - b1 and anti - b5 monoclonal antibody to splenic b - cells before ( a ) and after activation with anti - ig antibody ( b ); fig3 is a series of histograms showing the reactivity of anti - b1 and anti - b5 monoclonal antibody to splenic b - cells unactivated ( a ) and activated with anti - ig antibody ( b ), and unactivated monocytes ( c ); and fig4 is an sds - page characterization of labeled cell surface proteins immunoprecipitated with anti - b5 monoclonal antibody . normal human splenic b - lymphocytes were cultured at 1 . 5 × 10 6 cells / ml in rpmi 1640 supplemented with 10 % fcs , 2 mm glutamine , 1 mm sodium pyruvate in tissue culture flasks for 1 , 3 , and 6 days with four different stimuli . ( 1 ) pokeweed mitogen ( pwm ): at a final concentration of 1 : 300 . for days , 1 , 3 , and 6 whole splenic mononuclear cells were used . ( 2 ) anti - ig : affinity purified rabbit anti - human ig was coupled to affigel 702 beads , specificity was checked by testing affigel 702 beads which has been conjugated to bovine serum albumin , anti - b1 , or anti - b2 antibody , none of which showed any b cell stimulation . for the day 1 and day 3 stimulations , anti - ig beads were incubated with highly purified b cells which were obtained by lysing the e rosette negative fraction of splenic mononuclear cells with anti - mo1 , anti - mo2 , anti - t4 , and anti - t8 followed by complement . the day 6 stimulation utilized unfractionated splenic mononuclear cells . ( 3 ) protein a : protein a was used at a final concentration of 10 g / ml . as described above , highly purified b cells were cultured for 1 and 3 days at a concentration of 1 . 5 × 10 6 / ml . the day 6 stimulation utilized unfractionated splenic mononuclear cells . ( 4 ) ebv : the e rosette negative fraction of splenic mononuclear cells were cultured with ebv ( 1 : 4 diluted supernatant from the ebv - producing marmoset cell line b955 ) for 1 , 3 , and 6 days . prior to phenotypic analysis of all activated samples , the cells were harvested and lysed with anti - mo1 , anti - mo2 , anti - t4 , and anti - t8 followed by complement to clear monocytes and t - cells respectively and enrich the b - cell fraction from the samples . a 6 week old female balb / c mouse was immunized i . p . with 5 × 10 6 cryopreserved b cell diffuse histiocytic lymphoma ( dhl ) cells in phosphate - buffered saline ( pbs ). these tumor cells were of b cell origin in that they expressed monoclonal cell surface igm , k , as well as the b cell associated antigens ia , b1 , and b4 . in contrast , these tumor cells were unreactive with monoclonal antibodies directed against the common acute leukemia antigen ( calla ); t cell antigens t3 , t4 , t8 , and t11 ; and the myeloid / monocyte antigens mo1 , mo2 , and my7 . twenty eight days later , the animal was boosted with 5 × 10 6 tumor cells i . v . and somatic cell hybridization was carried out 4 days later by the method of kohler and milstein ( nature , ( 1977 ) 256 : 495 ) with modifications as described in nadler et al ., j . immunol . ( 1980 ) 125 : 570 . mouse splenocytes ( 1 . 5 × 10 8 ) were fused with 30 % polyethylene glycol and dulbecco &# 39 ; s mem with 2 × 10 7 p3 / ns1 / 1 - ag4 - 1 myeloma cells . after fusion , cells were cultured in aminopterin - containing medium at 37 ° in a 5 % co 2 humid atmosphere . ten to 28 days later , approximately 300 macroscopic clones were identified , 125 of which were reactive with the immunizing dhl cells , measured by indirect immunofluorescence . in brief , 0 . 5 to 1 × 10 6 viable washed dhl cells were treated with 100 ul of supernatant from hybridoma cultures exhibiting growth , incubated at 4 ° c . for 30 minutes and washed three times . the cells were then treated with 100 ul of 1 : 50 dilution of goat anti - mouse igg and goat anti - mouse igm conjugated with fluorescein isothiocyanate incubated at 4 ° for 30 minutes , washed three times , analyzed on an epics v cell sorter . the percent positive cells were determined using the easy immuno - program . producer clones were then screened on a panel of fractionated peripheral blood and tumor cells . one hybrid clone , designated anti - b5 was found to react with the immunizing dhl cells , several other b cell dhl cell lines , but was unreactive with fractionated peripheral blood mononuclear cells . hybrid clone anti - b5 was then subcloned three times by limiting dilution and passaged into balb / c mice to produce a malignant ascites . supernatant and ascites anti - b5 were shown to have a similar reactivity pattern by indirect immunofluorescence . the b5 ascites demonstrated reactivity with the immunizing dhl cells to a dilution of 1 / 20 , 000 that diminished to background at 1 / 50 , 000 . the b5 antibody was determined to be of the murine igm isotype . in all subsequent experiments , b5 ascites were used . the anti - b5 - producing hybridoma cell line , designated hybridoma b5 , has been deposited in the american type culture collection , rockville , md , and given atcc accession no . hb 8716 dated feb . 8 , 1985 . as shown in table i , prior to culturing , cells did not express b5 . in the presence of media alone , approximately 10 - 15 % of cells expressed b5 after three days of culture , although the viability of these cells was only 10 - 20 %. when stimulated with protein a , anti - ig antibody or ebv as shown in fig1 ( viability approximately 70 - 80 %) about 10 - 15 % of cells weakly expressed b5 after 1 day , while 65 % of cells expressed the antigen more intensely by 3 days of culture . the level of expression of b5 by day 6 was similar to day 1 , and by day 10 ( in the presence of anti - ig antibody ), b5 antigen expression was again background level . pwm did not appear to induce cells to express b5 as well as anti - ig antibody , ebv , or protein a , with the number of cells being only two - fold over background . table______________________________________expression of b5 and b1 antigens on splenic bcells stimulated in vitro * antigen % positive cells when stimulated in vitroday tested media protein a anti - igg ebv pwm______________________________________0 b1 80 80 80 80 80b5 & lt ; 5 & lt ; 5 & lt ; 5 & lt ; 5 & lt ; 51 b1 74 68 80 84 56b5 6 38 14 12 183 b1 44 78 90 80 69b5 10 43 68 64 256 b1 46 48 57 71 31b5 2 5 16 24 4______________________________________ * one of three experiments showing identical patterns of induction of b5 expression . in order to further demonstrate that b5 was expressed on activated b cells , splenic mononuclear cells enriched for b cells were stimulated for 3 days with anti - ig conjugated to beads . viable cells were harvested and labelled with directly fluoresceinated anti - b1 and directly biotinylated anti - b5 developed with texas - red - avidin , and then evaluated by dual laser flow cytometric analysis . as shown in fig2 panel a unstimulated cells only expressed the b1 antigen and failed to express b5 . after three days in culture with anti - ig , all cells expressing b5 co - expressed the b1 antigen . b5 is expressed on cell lines and tumor cells of b - cell origin . as shown in table 2 , anti - b5 was reactive with cell lines of b lineage including all ebv transformed lymphoblastoid b cell lines , burkitt &# 39 ; s lymphoma lines , four of five dhl lines and the plasma cell leukemia cell line rpmi 8226 . the non - t - cell all line laz 221 , and the cml blast crisis line nalm 1 , both known to be of early neoplastic b cell origin , were unreactive with anti - b5 . no reactivity was found on t - cell lines or an ia + t - cell clone . these results as well as the lack of expression of b5 myeloid cell lines hl - 60 , kg - 1 , u937 , and su - dhl 1 and the erythroid cell line k562 indicate that anti - b5 has restricted reactivity to cells of b cell derivation . table 2__________________________________________________________________________ degree of positivity with monoclonal antibodycell lines line designation b5 b1 b2 b4 k / l ia__________________________________________________________________________ebv lymphoblastoid 156 + +++ + ++ +++ +++ sb ++ +++ + ++ +++ +++ burkitt &# 39 ; s raji ++ +++ ++ ++ +++ +++ ramos +++ +++ 0 + +++ 0 daudi +++ +++ 0 + +++ +++ non - t cell all laz 221 0 0 0 ++ + ( μ ) +++ cml blast crisis nalm - 1 0 + 0 ++ + ( μ ) +++ dhl su - dhl 1 0 0 0 0 0 0 su - dhl 2 + ++ + 0 0 0 0 su - dhl 4 ++ +++ 0 ++ +++ +++ su - dhl 6 ++ +++ 0 ++ +++ +++ su - dhl 8 + 0 0 ++ + +++ myeloma rpmi 8226 +++ 0 ++ 0 0 +++ mecar 0 ++ 0 ++ 0 +++ t - all hsb 0 0 0 0 0 0 cem 0 0 0 0 0 0ia + t cell el 156 0 0 0 0 0 +++ myeloid hl - 60 0 0 0 0 0 0 kg - 1 0 0 0 0 0 ++ u 937 0 0 0 0 0 0erythroid k 562 0 0 0 0 0 0__________________________________________________________________________ . sup . a degree of positivity was qualitatively assessed by flow cytometry . 0 , no detectable reactivity over background ; +, designated weak to moderate ( b5 on day 1 , fig2 ); ++, designated strong ( b5 on day 3 , fig2 ); +++, strongest reactivity ( b1 on day 3 , fig2 ). the reactivity of anti - b5 with a variety of b - cell malignancies was next investigated ( table 3 ). this series of neoplasms represent stages of normal b cell differentiation . all of the non - t - cell acute lymphoblastic leukemias ( all ) tested were of b - cell origin by expression of ia and b4 . none of these early neoplastic b - cells expressed b5 . about half of the b cell chronic lymphocytic leukemias ( cll ) and dhls examined , expressed b5 , with a smaller percentage of poorly differentiated lymphocytic lymphomas ( pdl ) expressing the antigen . with the lack of expression of b5 on the waldenstrom &# 39 ; s macroglobulinemia cells and myelomas examined , the expression of b5 antigen was limited to cells which correspond to the mid stages of normal b cell differentiation . cells from patients with t cell derived all , cll , and t cell non - hodgkin &# 39 ; s lymphoma , including lymphoblastic lymphoma and dhl were unreactive with anti - b5 . the b5 antigen was also not expressed on cells from patients with acute myeloblastic leukemia ( aml ). these observations confirm the b cell specificity of b5 and indicate that b5 is expressed on populations of b lymphocytes in the mid stages of normal b cell differentiation . table 3______________________________________ # of patients reactive with # of patient monoclonal antibodydisease samples b5 b4 b1 ia t3______________________________________b cellnon - t all 21 0 21 8 21 0b - cll 24 12 24 24 24 0dhl 18 8 18 18 18 0pdl - n 7 5 7 7 7 0pdl - d 8 0 8 8 8 0waldenstrom &# 39 ; s 2 0 2 2 2 0myeloma 2 0 0 0 0 0t cellall 8 0 0 0 nd 8cll 3 0 0 0 0 3nhl * 5 0 0 0 2 5myeloidaml / ammol 12 0 0 0 12 0______________________________________ * waldenstrom &# 39 ; s macroglobulinemia * includes lymphoblastic lymphoma and t cell dhl the reactivity of anti - b5 to unactivated fractionated peripheral blood cells , and normal lymphoid and myeloid tissues was examined . less than 1 % of peripheral blood mononuclear cells ( pbmc ) isolated by ficoll - hypaque density sedimentation expressed the antigen , ( table 4 ) whereas they demonstrated significant reactivity with monoclonal antibodies directed against b - cell , t - cell , and monocyte antigens . table 4__________________________________________________________________________reactivity of anti - b5 with resting lymphoidand myeloid cells % of cells expressing antigencell # of tests b5 b1 t3 mol ia__________________________________________________________________________peripheral bloodpbmc 4 1 ± 1 5 ± 2 50 ± 5 31 ± 8 18 ± 4e + ( t ) 6 1 ± 1 1 ± 1 90 ± 5 8 ± 3 2 ± 1e - nonadherant ( b ) 3 1 ± 1 22 ± 4 2 ± 1 24 ± 3 42 ± 5monocyte 3 1 ± 1 2 ± 1 9 ± 3 54 ± 6 71 ± 5granulocyte 5 0 ± 1 1 ± 1 0 ± 1 88 ± 10 1 ± 1rbc 3 0 ± 1 0 ± 1 0 ± 1 0 ± 0 0 ± 0platelet 3 0 ± 1 0 ± 1 0 ± 1 0 ± 1 0 ± 1__________________________________________________________________________ t - cells isolated by e rosetting similarly lacked detectable b5 expression . the e rosette negative fraction containing b - cells , monocytes , and null cells was further enriched for b - cells by adherence . the b - cell - enriched pbmc were stained with directly fluoresceinated anti - b1 and directly biotin - conjugated anti - b5 developed with avidin texas red . utilizing dual laser flow cytometic analysis , cells were examined as shown in fig3 before ( panel a ) and after 3 days of stimulation with anti - ig antibody ( panel b ). as seen in panel a very few dual labelled cells were observed , whereas in panel b clearly demonstrated b1 + b5 + cells could be detected . in addition , monocytes were stained with directly fluoresceinated anti - mo1 and directly biotin - conjugated anti - b5 developed with avidin texas red ( panel c ) and similarly analyzed . adherent monocytes were noted to weakly express b5 on 10 - 20 % of cells analyzed . however , when monocytes were incubated in 10 % human serum for 1 hour prior to phenotyping , no cells appeared to co - express b5 and mo1 . similarly granulocytes , rbc and platelet preparations lacked reactivity with anti - b5 . the percentage of b5 bearing ficoll - hypaque mononuclear cells within lymphoid tissues is enumerated in table 5 . table 5______________________________________reactivity of anti - b5 with lymphoid tissues % of cells reactive with monoclonal antibodytissue # of tests b5 b1______________________________________lymph node 4 6 ± 2 28 ± 8spleen ( whole ) 7 2 ± 1 45 ± 5spleen ( e -) 3 5 ± 3 72 ± 12tonsil 3 4 ± 2 54 ± 9thymus 3 0 ± 1 0 ± 1bone marrow 3 1 ± 1 6 ± 3______________________________________ mononuclear cells isolated from normal lymph node , tonsil , and spleen were weakly reactive with anti - b5 , with less than 6 % of cells analyzed being positive . the e - population of normal spleen of which 70 - 80 % of cells express the b1 antigen , similarly weakly expressed b5 . mononuclear cells from thymus and bone marrow were unreactive with anti - b5 . reactivity of anti - b5 monoclonal antibody to activated fractionated peripheral blood cells was also determined . b - cells were prepared by e rosetting , adherence , and then lysis of the remaining cells with anti - t - cell ( t4 and t8 ) and anti - monocyte ( mo1 and mo2 ) antibodies and complement . this b cell enriched fraction ( 50 % b1 +) was cultured in the presence of anti - ig antibody conjugated to beads . at 3 days , these cells ( 60 % b1 +) were harvested and the viability ranged between 60 and 80 %. these cells were considered activated since they were proliferating as measured by uptake of h 3 tdr ( stimulation index = 5 - 10 ) and morphologically approximately 2 / 3 of cells now were enlarged with a lymphoblastoid appearance . the cells were then examined by indirect immunofluorescence and flow cytometric analysis for b5 expression . in contrast to resting peripheral blood b - cells , approximately 25 % of cells now expressed b5 . in order to demonstrate that b5 expression was limited to activated b - cells , cells were labelled with anti - b1 directly conjugated to fluorescein and anti - b5 conjugated to biotin then developed with texas - red - avidin . utilizing dual laser flow cytometric analysis , it was clearly shown that the majority of unstimulated cells only expressed b1 with rare cells expressing b1 and b5 ( fig3 ). however , after 3 days of culture with anti - ig antibody , 25 % of cells expressed b5 and all cells expressing b5 co - expressed b1 . in contrast , t cells isolated by e rosetting , were cultured with pha for six days . viable cells were isolated and the cell surface phenotype examined after 2 and 6 days of stimulation . these cells were uniformly t cells by their strong expression of t11 and were activated as determined by their expression of ia ( 30 % of cells expressed ia at day 6 ) and il - 2 receptor ( 90 % of cells expressed il - 2r at day 2 , 70 % at day 6 ). these activated t - cells demonstrated no detectable b5 antigen . similarly monocytes were activated overnight with pha - leukocyte conditioned medium ( pha - lcm ), and although these cells strongly expressed mo1 , mo2 , and ia , they did not express b5 . burkitt &# 39 ; s lymphoma cell line ramos , and the plasma cell leukemia cell line rpmi 8226 , were used for the isolation of the b5 cell surface antigen . a modification of the lactoperoxidase conjugation iodination technique as described by boyd et al ., j . immunol ( 1981 ) 126 : 2461 was used to label cell surface proteins with i 125 . the iodinated cells obtained from this procedure were washed twice with cold pbs and lysed on ice with cell lysis buffer ( 50 mm tris hcl , 0 . 4m nacl , 1 % triton x - 100 , 2 mm dmsf , 5 mm edta , 50 mm iodoacetamide , ph 8 ). after 30 minutes the lysate was centrifuged at 800 g for 10 minutes to remove unlysed cells , nuclei , and other insoluble material . the supernatant was frozen at - 80 ° c . until analyzed by immunoprecipitation . cell supernatants and cell lysates were centrifuged at 10 , 000 g for 30 minutes and transferred to fresh test tubes . prior to immunoprecipitation of cell lysates were mixed with 20 mg of rabbit anti - human ig antibody and pre - cleared four times ; twice , for 1 hour at 4 ° c ., with pansorbin s . aureus cells once with sepharose 4b beads and finally with preformed complex of rabbit anti - mouse antibody and an irrelevant mouse immunoglobulin . the pre - cleared samples were mixed with either : ( 1 ) anti - b5 rabbit anti - mouse ig complexes . ( 2 ) an irrelevant monoclonal igm complex with rabbit anti - mouse ig . ( 3 ) b5 - conjugated sepharose beads or ( 4 ) irrelevant igm - conjugated beads sepharose 4b beads . the mixtures were held on ice for 2 hours at 0 ° c . after which the samples were centrifuged at 10 , 000 g for 5 minutes and the supernatants discarded . the pellets were washed four times in 1 % triton ( octyl phenoxy polyethoxy ethanol ) x - 100 / 0 . 2 % sodium deoxycholate in ripa buffer ( 0 . 2 sodium phosphate , 5 mm edta , 5 mm egta , 1 mm naf , ph 7 . 4 ). as shown in fig4 the precipitates were analyzed by 10 % sds - polyacrylamide gel electrophoresis under non - reducing ( lanes 1 - 5 ) and reducing ( 50 mm dithiothreitol ) ( lanes 6 - 10 ) conditions . ramos cell lines : anti - b5 conjugated to sepharose 4b beads 4b ( lanes 1 and 5 ) was compared with an irrelevant antibody conjugated to sepharose 4b ( lanes 2 and 6 ). rpmi 8226 cell line : anti - b5 rabbit anti - mouse ig preformed complexes ( lanes 4 and 8 ) were compared to irrelevant antibody rabbit anti - mouse ig preformed complexes ( lanes 3 and 7 ). the apparent molecular weights ( m . w .) of b5 at 75 kilodaltons ( kd ) under reducing and 67 kd under non - reducing conditions , reflect the presence of interchain disulfide bonds . ( this biochemical characterization of the b5 antigen shows that it is a single chain cell surface protein .) the monoclonal antibody of the invention can be labeled with a detectable label , e . g ., a radiolabel by conventional procedures , and provide a quantitative measurement of activated b - cells in biological samples or in vivo . because of its specificity for neoplasms of b - cell origin corresponding to the mid - stage of b - cell differentiation , the monoclonal antibody of the invention can be used to detect the presence of these cell types in biological samples . the monoclonal antibody of the invention can be used as a diagnostic aid in characterizing the cell type of various lymphomas and leukemias arising from b - cells . in addition , in vivo imaging using rodiolabeled monoclonal antibody of the invention can provide a noninvasive means for detecting and localizing these cell types , e . g ., lymphoid tumors . the monoclonal antibody of the invention will also be useful in defining the role of activated b - cells in autoimmune diseases , infections and other diseases which are characterized by activated b - cells , e . g ., organ rejection .
| 8 |
for better understanding the purposes , technical solutions , and advantages of the present invention , the technical solutions provided in the embodiments of the present invention are illustrated in detail below with reference to the accompanying drawings . a de - registration method is provided in a first embodiment of the present invention . referring to fig1 , the method includes the following steps : step 201 : an hnb gw acquires a message indicating that a ue has moved to another cell . the hnb gw can learn that the ue has moved to another cell by using the following methods . method 1 : the ue initiates a register request to the hnb gw in another cell , and at this time , the hnb gw can know that the ue has moved out of the coverage of the mb ; method 2 : when the hnb gw has a corresponding interface with a radio network controller ( rnc ) of a neighboring macro network or a neighboring hnb gw , and when the ue registers with a cell controlled by the rnc of the neighboring macro network or the hnb gw , the rnc of the neighboring macro network or the neighboring hnb gw can analyze that the ue at one time camps on an hnb in the hnb gw by parsing signaling , and notify the hnb gw that the ue has moved to another cell through a message ( such as a cell update message ). method 3 : the ue will initiate an lau procedure when the ue moves out of the coverage of the hnb , and notifies a core network of updating information about a location area where the ue locates through the lau process so that the core network can know that the ue has moved out of original cell of the ue , and can find corresponding hnb gw according to a location area code of the original cell reported by the ue and send a notification message to the hnb gw to notify the hnb gw that the ue has moved out of the coverage of the hnb . step 202 : the hnb gw detects whether pre - registration resources assigned by the hnb gw for the ue exist , and if the pre - registration resources exist , releases the pre - registration resources , and sends a ue de - register request to the hnb to notify the hnb that the ue has moved to another cell and releases the pre - registration resources assigned by the hnb for the ue . step 203 : optionally , if , in step 202 , the hnb detects that no pre - registration resources exist , the hnb sends a de - register response message to the hnb gw to notify the hnb gw that the pre - registration resources have been released . a second embodiment is similar to this embodiment , with the exception of the time of initiating the de - registration procedure . specifically , the hnb gw sends a ue de - register request to the hnb after a preset period of time when the hnb gw acquires the message indicating that the ue has moved to another cell , to notify the hnb that the ue has moved to another cell and release the pre - registration resources assigned for the ue . to prevent the ue from switching back to the hnb cell again and initiating a register request of the ue from the hnb cell in a short time , that is , reconstructing registration information after releasing the registration resources in a short time , the second embodiment of the present invention sets that the hnb gw sends the de - register request to a corresponding hnb only if the hnb gw does not receive a message sent by the ue from the hnb for a period of time . in the first and second embodiments , the hnb gw detects whether the hnb gw itself has pre - registration resources after receiving indication information indicating that the ue moves to another cell , and if the hnb gw itself has the pre - registration resources , releases the pre - registration resources and sends a de - register request message to the hnb immediately or after a preset period of time . if the hnb does not detect any pre - registration resources , the hnb sends a de - register response message to the hnb gw . fig2 is another de - registration method provided in an embodiment of the present invention . as shown in fig2 , the method includes the following steps . step 301 : an hnb gw receives a message indicating that a ue has moved to another cell . step 302 : the hnb gw sends information indicating that the ue has moved to another cell to an hnb . step 303 : the hnb releases pre - registration resources assigned by the hnb for the ue if the hnb detects the pre - registration resources , and immediately sends a de - register request message to the hnb gw . however , to prevent the ue from switching back to the hnb gw cell again and initiating a register request of the ue from the hnb gw cell in a short time , i . e ., reconstructing registration information after releasing the registration resources in a short time , the hnb can also send the de - register request message to the hnb gw after a period of time . step 304 : if the hnb gw does not detect pre - registration resources assigned by the hnb for the ue at the hnb gw , the hnb gw sends a de - register response message to the hnb to notify the hnb that the pre - registration resources on the hnb gw have been released . fig3 describes a schematic diagram of an hnb gw according to an embodiment of the present invention , which includes a transceiver 401 and a release initiating unit 402 . the transceiver 401 is configured to receive indication information that indicates a ue moves to another cell from a source hnb and is sent by the hnb gw , which includes receiving a register request initiated to the hnb gw by the ue in another cell , a cell update message of the ue sent by an rnc of a neighboring macro network or a neighboring hnb gw , and a message indicating that the ue moves into a macro network sent by a core network . the transceiver may be further configured to receive a de - register response message sent by the hnb . after the hnb gw sends the de - register request message to the hnb , if the hnb does not detect the pre - registration resources of the ue , the hnb sends the de - register response message to the hnb gw to notify the hnb gw that the pre - registration resources assigned by the hnb have been released . the transceiver is further configured to forward the indication information to the hnb , and receive a de - register request message sent by the hnb after receiving the indication information . the release initiating unit 402 is configured to initiate release of the pre - registration resources corresponding to the ue after the transceiver receives the indication information . when the transceiver receives the indication information and pre - registration resources corresponding to the ue exist in the hnb gw , the pre - registration resources in the hnb gw are released , and the hnb is notified of releasing the pre - registration resources corresponding to the ue by sending the de - register request message to the hnb immediately or after a preset period of time through the transceiver . the release initiating unit is further configured to release the pre - registration resources corresponding to the ue in the hnb gw after the transceiver receives the de - register request message . it can be seen from the above that the hnb gw determines whether the ue moves to another cell before sending the de - register request to the hnb and releases the reserved iuh resources , thereby reducing waste of resources . fig4 describes a schematic structural diagram of an hnb according to an embodiment of the present invention , which includes a base station transceiver 501 and a base station release initiating unit 502 . the base station transceiver 501 is configured to receive indication information which indicates that a ue moves to another cell from a source hnb and is forwarded by an hnb gw to the hnb . it includes receiving a register request initiated to the hnb gw by the ue in another cell , a cell update message of the ue sent by an rnc of a neighboring macro network or a neighboring hnb gw , and a message indicating that the ue moves into a macro network sent by a core network . the base station transceiver may further be configured to receive a de - register response message sent by the hnb gw to the hnb . after the hnb sends the de - register request message to the hnb gw , if the hnb gw itself does not detect pre - registration resources , the hnb gw sends the de - register response message to the hnb to notify the hnb that the pre - registration resources have been released . the base station transceiver is configured to receive a de - register request message sent by the hnb gw after receiving the indication information . after the transceiver receives the indication information , the base station release initiating unit 502 is configured to initiate release of the pre - registration resources corresponding to the ue . after the base station transceiver receives the indication information and pre - registration resources corresponding to the ue exist in the hnb , the pre - registration resources in the hnb are released , and the hnb gw is notified of releasing the pre - registration resources corresponding to the ue by sending the de - register request message to the hnb gw immediately or after a preset period of time through the transceiver . after the base station transceiver receives the de - register request message , the base station release initiating unit is configured to release the pre - registration resources corresponding to the ue in the hnb . it can be seen from the above embodiments that the hnb gw receives indication information indicating that a ue moves to another cell and initiates release of the pre - registration resources corresponding to the ue , thereby enabling the hnb gw to acquire the message indicating that the ue has moved out of the coverage of the hnb cell and release the pre - registration resources assigned for the ue in time , reducing waste of resources . it will be clearly understood by those skilled in the art through the above description of various embodiments that , the present invention can be implemented by means of software and a necessary general hardware platform , or , of course , by means of hardware , but the former is preferred in many cases . based on such understanding , the technical solutions of the present invention , or the portions contributing to the prior art can essentially be embodied in form of a software product . the computer software product is stored in one storage medium and includes several instructions to cause a computer device , which may be a personal computer , a server or a network device , to perform the methods described in the embodiments of the present invention . the present invention has been illustrated and described with reference to some exemplary embodiments of the present invention , but it should be understood by those of ordinary skill in the art that various changes can be made thereto in forms and details without departing from the spirit and scope of the present invention .
| 7 |
the present application comprises two parts , the group key chaining and key distribution allowing an efficient revocation mechanism . when a group access key is to be renewed , the message containing the new group access key is sent to the decoders of that group . the message is broadcasted so all decoders , even not belonging to that group can receive this message and the encryption will determine which decoders can really obtain the new group access key . let us take the example with a group of 256 decoders and two decoders should be revoked . each decoder contains at least a master group key and a personal key . the new group access key is encrypted by the current group access key and by the keys only available in the decoders that are not revoked . a simple example using a trivial broadcast encryption scheme can be to create firstly a cryptogram containing the new group access key and encrypted by the current group access key . this cryptogram ct is then encrypted with a decoder personal key . the message will then comprises 254 cryptograms , each being encrypted by a personal key of the non - revoked decoders . of course , the inverse method is also applicable , the new group access key is firstly encrypted by the personal key of a non - revoked decoder and then encrypted by the current group access key . for the next renewal of the group access key , so - called further next group access key , even if the revoked decoders still contain the master group key and their personal key , the next message will contain the further next group access key encrypted by the master key only and by the next group access key . since the revoked decoders have not been able to access to the next group access key , this further next group access key is also not accessible for these decoders even if they have the master group key . according to another example , the further next group access key is simply encrypted by the next group access key . the second part of the invention is to propose a scheme that reduces greatly the size of the message when a revocation is to be carried out . one can imagine a group of 5000 decoders and only one is to be revoked . in this case , with the example above , the next group access key should be duplicated 4999 times , each time associated with the personal key of the non - revoked decoders . the fig4 illustrates the process of revocation . the top part shows the audio / video product ( could be one channel or a group of channels ) encrypted by the key successively k 1 , k 2 and k 3 . it is to be noted that this key ( k 1 , k 2 or k 3 ) could be used to decrypt directly the audio / video product or serving as decryption key to decrypt the messages ( ecm ) containing the keys to decrypt the audio / video product . in the example of the fig4 , during the first time period , the decoders t 1 , t 2 , t 3 and t 4 are part of the group . the group access key c 1 is the current one when the message k 1 c 2 is arrived , containing the next group access key c 2 and the key k 1 to access the audio / video product . in fact , the product key k 1 will arrive before this key is used to decrypt the product . the decoders will store the current product key k 1 and when the next is received , the product key k 2 , ready to be applied at the time the product swap from k 1 to k 2 . during the second time period , the group access key c 3 is sent to the non - revoked decoders . these decoders are t 1 , t 2 and t 4 . the message k 2 c 3 is encrypted by the current group access key c 2 and the keys pertaining to the non - revoked decoders t 1 , t 2 and t 4 . the decoder t 3 , having the current group access key c 2 , cannot decrypt this message and have access to the group access key c 3 . during the third time period , the message carrying the next group access key c 4 can be simply encrypted by the current group access key c 3 . the position into the group of formerly t 3 can be reallocated ( to a decoder t 30 ) by transmitting the current group access key c 3 and the key or keys previously distributed to the decoder t 3 . this reallocation can be executed only after the group access key c 3 is active i . e . after the transmission of the message k 2 c 3 . the group is organized by the management system and each position into the group is associated with a position status . this status can comprises three states , namely “ free ”, “ allocated ” and “ transitional ”. at the creation of a group , all positions are marked “ free ”. when a position is allocated to a member , this position is marked “ allocated ”. as soon as a member is withdrawn of the group , the position is marked “ transitional ”. this state indicates that the position was used before and special care is to be taken while reallocating this position . this position can be reallocated as soon as the group access key has been renewed into the members of this group at the exception of this specific member . the time between the revocation of the member until the group access key is changed for all other members is the so - called “ quarantine ” period . after this quarantine period , the position is virtually “ free ” and can be reused . the management of the database of the management center regularly checks the status of the “ transitional ” positions and checks whether the group access key is no longer present into the revoked decoder attached to that position . in this case , the position can be modified from “ transitional ” to “ free ”. in the case that no regular scan of the database is carried out , the status of a specific position is determined when a new member is to be inserted into that group . this is why in the case that the position has the state “ transitional ”, a further check is carried out to determine if the quarantine period is over . the renewal message of the group access key is formed by the group access data ( cgd ) which includes at least the group access key ( cgk ). this key can be used to decrypt the entitlement messages ( ecm ) related to the services for which the group of decoders has access . as a consequence , the group access key serves for the chaining mechanism and to access the services . according to another embodiment , the group access data comprises a session key sk . this session key sk will serves to access the services and decrypt the entitlement messages ( ecm ) related to these services . according to another embodiment , when the group access data comprising the new group access key is received and stored in the non - revoked decoders , another message is sent to the decoders containing the session key sk . this message is then encrypted by the group access key , thus only the non - revoked decoders can decrypt and obtain this session key sk . although the group access key can be distributed according to any broadcast encryption scheme as described above , in order to efficiently generate a revocation message , the present invention will now describe an efficient way to organize the key distribution . the main property of an ideal broadcast encryption system can be summarized for the purpose of this invention : assuming each terminal in the system has been provisioned with a unique set of secrets , a server , knowing the secrets of each terminal , may encrypt a single message in a way that is both efficient ( the message is small ) and that can be decrypted by authorized terminals but not by excluded ( revoked ) terminals even if all revoked terminals collude together . a particular scheme is considered here to illustrate the working principle of the invention . it is described in [ 3 ], however , it is to be noted that due to its severe lack in collusion resistance its use is not recommended in practice and it is only used here for its simplicity and for illustrative purposes . n is the total population of terminals in the broadcast encryption scheme r is the number of terminals revoked in an encrypted message log is the logarithm base 2 k is the size in bytes of keys in the system ( value assumed here is 128 bits = 16 bytes ) each terminal must store ( log ( n )+ 1 )* k bytes of key material the size of the encrypted message is at most : n / 8 + k + payload size bytes the terminal must perform at most r *( log ( n )− 1 ) crypto operations to retrieve the message encryption key the mechanism operates on a population of n = 2 m terminals . a binary tree of keys is built as illustrated in the fig1 for this population using a one way function to derive the key of each branch from the key of the node above . the f ( k , n ) function is a public one - way function ( e . g . hash primitive ) that derives a key from its two parameters . each terminal is assigned a leaf key , as depicted above , however , this key is not given to the terminal , instead , each terminal is given the key of all the other terminals in the group , or the means to compute them . for instance , as illustrated in the fig2 , the keys provided to terminal t 2 are k 10 , k 3 and k 2 . using k 3 , t 2 can compute k 7 and k 8 , and using k 2 , it can compute k 11 to k 14 , through k 5 and k 6 . when joining the group , each terminal then effectively receives log 2 ( n ) keys , plus an additional group key k g used for addressing a message to all members of the group . once this is in place , any message that must be sent to the group or subset of the group is encrypted in the following way : if the message is targeted to all terminals in the group , it is encrypted with the group key , k g which is known to all terminals if the message is targeted to a subset of the terminals in the group , a key is built by hashing together the keys assigned to each excluded terminals , and the message is encrypted with this key : k = hash ( k a , kb , . . . , k z ). for example , if terminals t 0 and t 6 are excluded , keys k 7 and k 13 are hashed together to compute a key and the message is encrypted with it . since t 0 and t 6 do not know their respective keys , they can not compute the final key , while all the other terminals in the group can compute these keys and thus access the content of the message . the resulting encrypted message is essentially the same size as the original , only padding and the use of a session key slightly increase its size . in addition to the message itself , some signaling must be added so that receiving terminals know whether they are excluded or not and how to compute the keys . this is done using a bitmap where each bit corresponds to a terminal and indicates whether that terminal is included in the recipient or not . the bitmap may be compressed under certain conditions . some mechanism must be introduced to reach an addressable population of tens of millions while keeping the number of revoked terminals to a minimum ( and thus the bandwidth to an acceptable level ). the first goal is easily met by splitting the total population into a number of subsets of the adequate size and managing each subset as an independent population . the second goal is more difficult to meet without a dedicated mechanism for revoked population control . the dynamic group management mechanism described below proposes to solve this problem . the content is put up for sale in packages , typically by grouping a number of services in independent products . the unit of sale , and thus the unit of control , is the product . for each product , the population of terminals subscribed to this product is split in a number of groups , for which an independent broadcast encryption system is generated ( for instance using methods well - known in the art ). the number of groups is proportional with the actual population of subscribers for this product ( population divided by the group size ), not with the total population of terminals . upon subscribing to a product , a slot is allocated to the terminal in one of the groups associated to this product ( a new group is created if needed ). the unique set of keys corresponding to this slot is sent to the terminal using a message addressed to this particular terminal . an additional key is also provided , the group access key , which use is described below on a regular basis ( e . g . every day ), a positive addressing message is generated for each group of terminals of each product . this pa message contains all the keys required to access the content of the product over the next period of control ( e . g . the next week or month ). this pa message is encrypted using the broadcast encryption primitive for this group of terminals , and is further over - encrypted with the group access key . upon cancellation of a subscription by the user , the terminal is put in the list of revoked terminals for its group ( for this particular product ). in the next pa message , those terminals that are revoked may decrypt the first layer of encryption using the group access key , however , they are not capable of decrypting the underlying message , by virtue of the broadcast encryption scheme . as a consequence , these terminals cannot retrieve the content keys for the next period of control and are thus unable to access the content . furthermore , they cannot retrieve the next group access key which is covered by the broadcast encryption and are thus effectively definitively excluded from this group . as soon as the last group access key given to a revoked terminal is replaced by a new one , the slot of the revoked terminal may be assigned to a new subscribing terminal . t n indicates a terminal , the solid arrows indicate the ability of the targeted terminal to access the message in the middle layer of the diagram . this message is the pa message addressing a subset of the terminal population with the broadcast encryption scheme , containing the service keys k n and over encrypted with the group access key c n . the first benefit is that the number of the pa emm generated for any product is directly proportional to the number of subscribers to that product , not to the total population of subscribers . thus , if a product is purchased by a minority , the pa bandwidth required to maintain it is small . the second benefit is that the population of receivers targeted by any pa emm is extremely homogeneous : indeed , all receivers have purchased that product and only a small percentage of them have cancelled it . this means that the addressing bit field , which indicates which receivers in the pa group are revoked is essentially composed of bits set to ‘ 1 ’ and thus can be compressed . a simple and efficient compression algorithm will provide a compression ratio of 1 / 14 for a 0 % revocation rate , 1 / 6 for a 2 % revocation rate and still 1 / 3 for a 5 % revocation rate . the third benefit is that slots in the group are recycled : when a terminal is excluded from the group , its slot is reassigned to a new terminal , constantly keeping the number of revoked slots in the group to a minimum ( no more than 2 %- 3 % in the ideal case ). fourth benefit is that any broadcast encryption method can be used , such as previously known in the art , as well as new ones , hence improving even more the efficiency ( bandwidth , terminal key storage and / or encryption / decryption complexity ) of the entire system . all these put together allow for a very efficient use of the broadcast bandwidth . dan boneh , craig gentry , brent waters : collusion resistant broadcast encryption with short ciphertexts and private keys . crypto 2005 dalit naor , moni naor , jeffery lotspiech : revocation and tracing schemes for stateless receivers . crypto 2001 cecile delerablee et al . “ fully collusion secure dynamic broadcast encryption with constant - size ciphertexts or decryption keys ”, pairing 2007 wo 2007 / 138204 a1 ( france telecom , delerablee cecile ) “ cryptographic method with integrated encryption and revocation , system , device and programs for implementing this method ” pan wang et al . “ storage - efficient stateless group key revocation ”, isc 2004 masafumi kusakawa et al . “ efficient dynamic broadcast encryption and its extension to authenticated dynamic broadcast encryption ”, cans 2008 us 2004 / 114762 ( general instrument corp ., alexander medvinsky ) “ subset difference method for multi - cast rekeying ” fr 2 850 822 a1 ( canal plus technolies [ fr ]) “ système de télévision a péage , procédé de révocation dans un tel système , décodeur et cartes à puces associés , et message transmis à un tel décodeur ”.
| 7 |
the present invention encompasses several techniques for enhancing the adsorption capacity of commercial activated carbons for odor - causing compounds such as 2 - methylisoborneol ( mib ) and geosmin . the techniques involve heat treatments in gas environments , comprised of one or more of the following gases : hydrogen , steam , methane , and / or natural gas , ammonia , propane , or benzene . these treatments promote favorable chemical and / or physical changes in activated carbon pores and internal surfaces . by carefully controlling the temperature , environment , and time of exposure during these heat treatments , activated carbons can be “ tailored ” to achieve superior adsorption capacities . lab - scale experiments have demonstrated that the treatments herein produce carbons with much higher mib adsorption capacities than current commercial carbons . to date , odorant adsorption experiments conducted by the present inventors have focused on mib uptake , since it was previously established that mib is as difficult or more difficult to remove than geosmin . therefore , an activated carbon exhibiting superior mib uptake should work well for removing geosmin . other adsorption experiments have shown that the tailored carbons included in this invention adsorb more natural organic matter than commercial carbons , and this heightened capacity may apply to a variety of other organic compounds . the bench - scale heat treatments described below were performed in a tubular quartz glass furnace . unless otherwise noted , a sample ( typically 300 – 1100 mg ) of commercially available , lignite - based activated carbon that had been acid - washed ( hereafter identified as “ commercial carbon ”) was suspended within the furnace in a basket constructed of stainless steel mesh . the sample was first heated in a flow of pure nitrogen until the desired temperature was reached . next , while maintaining the target temperature , the “ treatment gases ” were applied to the sample . in general , treatment gas flow rates ranged from 70 to 140 ml / min and the total treatment time ranged from 10 to 60 minutes . upon completion of a treatment , the furnace was again flooded with nitrogen and allowed to cool . samples were stored in a dessicator under vacuum until the adsorption experiments were performed . the pilot - scale heat treatments described below were performed in a cylindrical kiln furnace that rotated about a horizontal axis . these pilot tests employed 1000 – 1500 grams ( initial dry mass ) of lignite - based activated carbon that had been acid - washed . the natural gas heat treatments proceeded for 0 – 10 minutes at 1000 ° c ., and the steam heat treatments proceeded for 0 – 25 minutes at 1000 ° c . when steam was used , the mass ratio of steam - to - initial dry activated carbon was greater than about 0 . 7 : 1 . 0 . when natural gas was used , the mass ratio of natural gas - to - initial dry activated carbon was greater than about 0 . 35 : 1 . 0 . a standardized mini - column mib adsorber test protocol was used to determine the 2 - methylisobomeol ( mib ) adsorption performance of small contactors filled with activated carbon grains . these tests were conducted using treated water that discharged from the clarifiers at the norristown water purification facility of the pennsylvania - american water company ( norristown , pa .) ( hereafter identified as the “ norristown plant ”). this water had previously undergone full - scale chlorination , coagulation ( with ferric chloride ), and clarification through superpulsators ™. the norristown plant utilizes filter - bed adsorbers for odor control , and the water samples utilized herein were collected just prior to these full - scale filter - bed contactors . in other words , the laboratory tests in this work employed the same water as would have been processed by full - scale activated carbon beds . this water contained 3 . 7 mg / l of natural organic matter , measured as total organic carbon ( toc ); other water quality parameters for the norristown water sample are listed in table 1 . in general , the standardized mini - column mib adsorber test protocol could employ any surface water used as a municipal water supply that contains the specified level of natural organic matter ( measured as total organic carbon ). the standardized mini - column mib adsorber test protocol employed 14 c - labeled mib . radiolabeled mib was purchased from american radiolabeled chemicals ( arc ) and it exhibited a specific activity of 55 mci / mm ( mci = millicuries , mm = millimoles / l ). consequently , when this material was spiked into experimental waters , the resultant mib concentrations were directly proportional to the radioactivity of those waters . radioactivity was measured using a scintillation counter ( wallac 1217 rackbeta ), and this required combining samples with scintillation cocktail . for the tests herein , 2 . 5 ml aliquots of sample water were combined with 18 ml of scintillation cocktail . once the radioactivity of an aliquot was determined , the mib concentration could be calculated using the following equation , where dpm stands for “ disintegrations per minute .” due to the inherent variability of the scintillation counter , the detection limit for this protocol ( under the given conditions ) was about 3 – 4 ng / l . unless otherwise indicated , the mib adsorption studies described herein were conducted according to the standardized mini - column mib adsorber ( smcma ) test protocol . this protocol employed mini - columns ( standardized mini - column mib adsorbers ) that were designed to simulate the performance of full - scale filter - bed absorbers , similar to those found at the norristown plant and a number of other full - scale water treatment plants . the norristown adsorbers provide a rated empty - bed contact time ( ebct ) of 7 . 6 minutes , and this is within the range of typical values for systems that employ activated carbon . a comparison of full - scale and standardized mini - column mib adsorber parameters is given in table 2 . for these standardized mini - column mib adsorber tests , the norristown water that is characterized above was spiked with 130 – 140 parts per trillion of 14 c - mib and then processed through a smcma . influent and effluent 14 c - mib concentrations were monitored at regular intervals so as to determine the “ breakthrough profile ” of the carbon being tested . the pore volume and pore size distribution data were collected by means of an argon adsorption density functional theory protocol . this protocol employed a micromeritics asap 2000 or 2010 pore analyzer , which generates argon adsorption isotherms . argon adsorption isotherms were determined in the relative pressure range of 10 − 6 to 0 . 99 , and each isotherm included 60 – 133 data points . for each data point , gaseous argon was pulsed into a sample chamber that contained about 0 . 3 g of activated carbon sample and was immersed in liquid argon ( 87 . 3 k ). following a 0 . 5 to 3 hour equilibration period , the relative pressure in the chamber was recorded . tests began at low relative pressure ( 10 − 6 ) and proceeded to the final pressure of 0 . 99 . completed isotherms were interpreted via the software package provided with the micromeritics equipment , which utilizes the density functional theory in converting isotherm data to pore size distributions . slurry ph measurements were made via a slurry ph protocol . this entailed combining 0 . 5 to 0 . 6 grams of powdered carbon (& lt ; 325 mesh size , or & lt ; 45 micrometers ) with 5 ml of deionized water ( milli - q ™ water system — millipore corporation , bedford , mass .) that had been purged with nitrogen . the slurry was agitated for 24 hours , after which the ph ( considered to be the equilibrium ph ) was measured . previous research suggests that the equilibrium ph of an activated carbon reflects its ph pzc . the ph pzc of a material is the ph at which that material &# 39 ; s net surface charge is zero , as determined by surface titrations . surface charge titrations were conducted using a mettler - toledo dl53 automatic titrator . for these tests , carbon samples were immersed in an electrolyte solution ( either 0 . 01 molar or 0 . 1 molar sodium chloride ), and after adding a fixed volume of 1 . 0 molar sodium hydroxide , this solution was titrated with incremental volumes of 0 . 1 molar hydrochloric acid . titrations were also performed in the absence of activated carbon , and these “ blanks ” were compared to the carbon titrations to determine the surface charge . batch mib adsorption studies were conducted using 40 ml borosilicate vials with teflon - lined closures . in standard tests , the vials were filled with clarified norristown water ( i . e ., the same water as listed above ) that contained the appropriate dose of 14 c - labeled mib . carbon samples were powdered (& lt ; 325 mesh size , or & lt ; 45 micrometers ), combined with deionized water , and added to the batch reactors as slurries . the vials were then sealed so that no headspace remained . each vial contained an equal number of glass beads to promote mixing while the vials were agitated on a rotating tumbler . following a 24 - hour contact period , samples were collected using a syringe and filtered through a 0 . 2 μm cellulose acetate syringe filter . the total organic carbon ( toc ) adsorption studies referenced herein were conducted using filtered water from the cincinnati water works richard miller treatment plant . this water had previously undergone full - scale coagulation ( with aluminum sulfate ), clarification , and filtration . it contained 1 . 2 mg / l toc , 0 . 07 ntu turbidity , 66 mg / l alkalinity ( as caco 3 ), and exhibited a ph of 7 . 9 . batch toc adsorption tests were conducting using 20 - liter polycarbonate containers . these were filled with cincinnati water and dosed with varying amounts of activated carbon . following a one - week equilibration period , the remaining toc in each vessel was measured using a shimadzu toc - 5000a toc analyzer . it was observed that heat treatments in pure hydrogen greatly improved the mib adsorption capacity of the commercial carbon . for example , a one - hour treatment in pure hydrogen at 900 ° c . increased mib removal under standard batch adsorption conditions from 60 % with the untreated carbon , up to 75 % with the treated carbon . the standard batch adsorption experiments referenced herein utilized clarified river water from norristown , pa ., with an initial spiked 14 c - mib concentration of 135 ng / l and an initial background natural organic matter level that exhibited a total organic carbon concentration of 3 . 7 mg / l . a one - hour treatment in pure hydrogen at 1025 ° c . increased mib removal to 95 % under these conditions ( this carbon is identified herein as “ h2 ( 1025 )”). in these treatments hydrogen gas was applied at a rate of 70 ml / min and the sample mass was 220 mg , meaning the ratio of total applied hydrogen to activated carbon ( on a mass basis ) was 1 . 7 : 1 . in standardized mini - column mib adsorber tests h2 ( 1025 ) processed about 5000 bed volumes before initial detectable breakthrough ( i . e ., up to 4 parts per trillion ) occurred and about 10 , 000 bed volumes before the effluent 14 c - mib concentration exceeded 10 parts per trillion ( 10 ppt - breakthrough ) ( fig1 and table 3 ). in comparison , the untreated commercial carbon processed about 2600 bed volumes prior to initial detectable breakthrough and about 5000 bed volumes prior to 10 ppt - breakthrough . heat treatments in steam environments also caused significant improvements in mib uptake by the commercial carbon . for instance , a one - hour treatment in steam at 375 ° c . ( with a ratio of 11 . 7 grams of steam applied per gram of initial dry activated carbon ), followed by ramping in pure nitrogen to 850 ° c . ( 50 ° c ./ min . ), increased mib removal from 60 % to 75 % under the batch conditions described above . the aforementioned steam treatment therefore increased mib adsorption capacity as much as the one - hour hydrogen treatment at 900 ° c . in a standardized mini - column mib adsorber test , this same steam - treated carbon ( identified as “ h2o ( 375 ), n2 ( 850 )” in the accompanying figures ) processed about 4500 bed volumes prior to initial detectable breakthrough and about 7000 bed volumes prior to 10 ppt - breakthrough ( fig2 ). one - hour steam treatments at 600 ° c . ( identified as “ h2o ( 600 )”) produced roughly the same standardized mini - column mib adsorber results as for h2o ( 375 ), n2 ( 850 ). it was also discovered that heat treatments in various combinations of steam and pure methane could improve mib uptake . following a one - hour exposure to a steam / methane mixture ( 6 : 1 molar ratio of steam to pure methane ) at 600 ° c . ( identified as “ ch4 / h2o ( 600 )” in the accompanying figures ), the experimental carbon performed as well as a hydrogen - treated carbon during the first 6000 – 10 , 000 bed volumes of a mini - column test ( fig3 ). in this treatment 9 . 5 grams of steam and 0 . 97 grams of methane were applied per gram of initial dry activated carbon . a similar result was observed following a 23 - minute exposure to steam and methane ( 1 : 1 molar ratio ) at 850 ° c . ( identified as “ ch4 / h2o ( 850 )” in fig3 ). here again , the treated carbon processed about 5 , 000 bed volumes prior to initial breakthrough and about 10 , 000 bed volumes prior to 10 ppt - breakthrough . in preparing ch4 / h2o ( 850 ), 10 . 5 grams of steam and 7 . 5 grams of methane were applied per gram of initial dry activated carbon . favorable mib removal also occurred after exposing the commercial carbon to a combination of steam and methane ( 1 : 1 molar ratio ) at 1000 ° c . this treatment lasted 18 minutes , during which 2 . 9 grams of steam and 2 . 0 grams of methane were applied per gram of initial dry activated carbon . the resultant material ( identified as “ ch4 / h2o ( 1000 )- 1 ” in the accompanying figures ) processed 10 , 000 bed volumes prior to initial breakthrough and 15 , 000 bed volumes prior to 10 ppt - breakthrough ( fig4 ). similar breakthrough performance was observed following separate application of methane followed by steam . in this case , a carbon sample ( identified as “ ch4 / h2o ( 1000 )- 2 ” in the accompanying figures ) was heated to 1000 ° c . and exposed to pure methane until it gained 13 % mass . thereafter it was exposed to steam ( no methane ) until it lost 25 % of its pyrolyzed mass . in this treatment , 0 . 9 grams of methane and 1 . 6 grams of steam were applied per gram of initial dry activated carbon . the authors observed that some residual steam was present during the cooling phase of the above - listed methane / steam trials . one important benefit of the “ methane deposition ” phase of methane / steam treatment is that it offsets the mass loss accompanying the “ steam oxidation ” phase . activated carbons are normally sold according to weight , and for this reason , activated carbon manufacturers may avoid using production protocols that cause excessive mass loss . another potential advantage of the “ methane deposition ” phase is that it promotes important physical / chemical changes within activated carbon . when carbon samples were exposed to steam at 1000 ° c . until 20 – 25 % mass loss occurred ( without prior exposure to methane ), their mib breakthrough performance in norristown water was also improved over existing commercial grades of activated carbon that were tested , but they were less favorable than if methane had also been applied . as shown in fig5 , a carbon exposed solely to steam ( with no methane ) at 1000 ° c . ( identified as “ h2o ( 1000 )”) exhibited almost immediate ( but slight ) mib breakthrough , and it processed 10 , 000 bed volumes prior to 10 ppt - breakthrough . although its breakthrough profile was shallow , this carbon might be considered inferior to a carbon exhibiting more rapid breakthrough , if that carbon achieved a longer period of no detectable breakthrough . water utilities tend to prefer treatments that completely remove mib from finished water , due to its extremely low odor threshold concentration ( 7 – 15 ng / l ). equilibrium ph measurements for hydrogen -, steam -, and methane + steam - treated samples ( as well as for other experimental carbons not discussed herein ) revealed that mib uptake was linked to equilibrium ph . in general , carbons that exhibited high equilibrium ph ( above 9 ) were able to remove more mib in standard batch tests than carbons that exhibited low equilibrium ph ( below 6 ). the equilibrium ph values for steam -, hydrogen -, and methane + steam - treated carbons were all in the range of 10 . 3 to 10 . 6 . pore size distribution measurements for the experimental carbons described above are shown in fig6 . these curves reveal a distinct correlation between the pore volume of hydrogen - and steam / methane - treated carbons and their respective mib breakthrough performance in norristown water . as shown in fig5 , the period of below - detectable - breakthrough for a number of experimental carbons ( some of which are not described herein ) was proportional to pore volume in certain pore size ranges , with the exception of steam - treated carbon ( heated to 1000 ° c ., identified by an “ x ” in fig7 ). the authors suspect that the steam - treated carbon contained more surface acidic groups than carbons that were also exposed to methane . to assess the impact of hydrogen treatment on toc removal , samples of bituminous coal - based carbon were heated to 1000 ° c . and then exposed to hydrogen for one hour . these samples included a virgin ( previously unused ) material , and two carbons that had undergone either 5 or 12 cycles of water treatment service ( for toc removal ) and thermal reactivation . standard batch toc removal tests ( as described above ) revealed that hydrogen treatment enhanced toc adsorption . as shown in fig8 , the toc uptake ( as measured in mg toc / g gac ) of hydrogen - treated (“ surface - modified ”) carbons was 10 – 200 % higher than for untreated (“ as - received ”) samples when the equilibrium toc concentration was between 0 . 1 to 0 . 85 mg / l . surface charge titrations of the “ as - received ” and “ surface - modified ” versions of the virgin sample are shown in fig9 . clearly the “ surface - modified ” sample has a higher net surface charge in the ph range of 4 – 10 , and this indicates that it contains fewer surface acidic groups than the “ as - received ” carbon . moreover , the “ as - received ” activated carbons exhibited zero net surface charge ( ph pzc ) at ph values between 8 . 5 ( for the virgin carbon ) and 9 . 5 ( for the thermally reactivated carbons — not shown herein ), whereas the “ surface - modified ” activated carbons exhibited zero net surface charge at ph values above 10 . 0 – 11 . 0 ( see fig9 ). furthermore , pore size distribution measurements ( fig1 ) revealed that the pore structure of “ surface - modified ” and “ as - received ” virgin carbon was nearly identical . this indicates that surface acidic groups and the ph pzc ( surface chemistry ) were important controlling factors in the toc adsorption tests discussed above . industries that employ activated carbon must routinely face the costs and operational challenges associated with removing and replacing carbon that has lost its capacity for removing contaminants . the invention described herein would facilitate the manufacture of activated carbons requiring less frequent replacement than current commercial carbons . these “ tailored ” carbons could greatly lower the operational costs of many activated carbon applications , particularly for odor control . slurry ph and zeta potential are two useful parameters for characterizing the surface charge and surface properties of activated carbons . zeta potential ( zp ) can represent the external charge of an activated carbon grain immersed in water , and is not affected by charged sites within the grain ( that are remote because of diffusion limitations ). the zeta potential of an activated carbon grain is influenced by the quantity of acidic , oxygen - containing functional groups on the grain &# 39 ; s external surfaces . with this in mind , the zeta potential of several steam - and methane + steam - treated carbons were compared . these included two samples that were prepared in a bench - scale tubular quartz glass furnace , as described in example 1 above , and two samples that were prepared in a pilot - scale rotary kiln furnace . the bench - scale samples are identified as s - 1000 and ms - 11000 , where s - 1000 was treated in steam at 1000 ° c . and ms - 1000 was treated in methane followed by steam at 1000 ° c . the pilot - scale samples are identified as pilot a and pilot b . to assess the relative propensity of these carbons to adsorb oxygen onto their external surfaces , their zeta potential was measured following varying periods of oxygen exposure by means of the mobility - based zeta potential protocol . for this protocol , 50 mg of activated carbon were mixed into 200 ml of distilled - deionized water , and pure oxygen gas was bubbled through the solution . the activated carbon grains had diameters between about 75 and 90 micrometers . at certain time intervals , 25 ml of each carbon / water suspension were collected and mixed with 25 ml of 0 . 2 m nacl . the ph of these suspensions was then adjusted to ph 10 . 5 and the zeta potential of particles in these “ adjusted suspensions ” was determined using a standard model 501 laser zee meter . zeta potential measurements were carried out in the following manner : approximately 25 ml of “ adjusted suspension ” was injected directly into a quartz glass cell ; the cell was placed under a microscope ( nikon su equipped with a 20 ×, 0 . 4 n . a . objective and two 10 × eyepieces mounted on a binocular head ) where it was automatically illuminated by a laser beam . next , an electric field was applied to the cell , and the voltage was adjusted manually until the carbon particles , as observed through the microscope , were stationary . a minimum of three zeta readings were taken for each sample , and the standard deviation in each case was less than 1 . 5 mv . analyses were conducted within one minute of applying voltage , so as to minimize the zeta potential - altering effects of prolonged electrification that are related to diffusion and other phenomena . results are shown in fig1 ( values are listed in table 4 below ) and they indicate that the zeta potential of pilot b and ms - 1000 was relatively unaffected by exposure to oxygen . in contrast , the zeta potential of pilot a and s - 1000 became considerably more negative during the 24 - hour test . the slurry ph of various carbons was measured in accordance with the slurry ph protocol described above . results are listed in table 3 , and these data , along with the results shown in table 4 , indicate that slurry ph , changes in zeta potential , and pore volume distribution ( see table 3 ) are all important parameters for predicting how well an activated carbon will remove mib from water that also contains natural organic matter . it should be understood that the foregoing description is only illustrative of the present invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to encompass all such alternatives , modifications and variances that fall within the scope of the following claims .
| 1 |
in fig1 a washing machine is generally shown at 10 which has a tub 12 with a vertical agitator 14 therein , a water supply 15 , a power supply ( not shown ), an electrically driven motor 16 operably connected via a transmission 20 to the agitator 14 and controls 18 including a presettable sequential control device 22 for use in selectively operating the washing machine 10 through a programmed sequence of washing , rinsing and extracting steps . a water level setting control 18 is provided for use in conjunction with control device 22 . a fully electronic control having an electronic display ( not shown ) may be substituted for control device 22 . the control device 22 is mounted to a panel 24 of a console 26 on the washing machine 10 . a rotatable and perforate wash basket 28 is carried within the tub 12 and has an opening 36 which is accessible through an openable top lid 30 of the washer 10 . tub ring 37 is positioned overlying wash basket 28 and tub 12 . the invention disclosed herein is not necessarily limited to implementation in a vertical axis washing machine as shown in the figures . inasmuch as the invention is a washing machine having a unique control and recirculating spray wash arrangement , the invention may be equally applied in a horizontal or tilted axis washing machine . moreover , in the specific application of the invention in a vertical axis washing machine , the invention may be practiced in a variety of machines which may include different motor and transmission arrangements , pumps , recirculation arrangements , agitators or impellers , or controls . a sump hose 40 is fluidly connected to a sump ( not shown ) contained in a lower portion of tub 12 for providing a wash fluid recirculating source . pressure dome 42 receives the recirculating fluid which exits via recirculating spray nozzle hose 48 which is fluidly connected to recirculating spray nozzle 32 . a pressure sensor or transducer 46 detects fluid pressure within pressure dome 42 and provides an output signal via lines 47 to the control , the signal varying dependent upon the sensed dynamic pressure . a second air dome 50 having a deepfill pressure sensor or transducer optionally provides a second pressure signal indicating static pressure to the control via lines 52 . as described herein , a pressure sensor may be a pressure switch having predetermined pressure levels that , within certain limits , will provide one or more signals to control 22 that a certain pressure has been achieved . depending on the presence or absence of such signals , the control will receive and store or process such information , as is well known . alternatively , a transducer may be used to sense pressure and provide a signal of varying frequency or voltage to control 22 indicating the pressure levels detected . in fig2 a schematic diagram further describes an example of a washing machine incorporating the present invention . hot water inlet 11 and cold water inlet 13 are controlled by hot water valve 17 and cold water valve 19 , respectively . valves 17 and 19 are selectably openable to provide fresh water to feed line 60 . a spray nozzle valve 21 is fluidly connected to feed line 60 for selectably providing fresh water to tub 12 when desired . this fresh water is delivered by fresh water spray nozzle 31 via fresh water hose 33 . valves 17 and 19 are openable individually or together to provide a mix of hot and cold water to a selected temperature . upon opening one or both of valves 17 and 19 , fresh water is selectably provided to a series of dispenser valves via feed line 60 . valve 62 selectably provides fresh water to detergent dispenser 63 , valve 64 selectably provides fresh water to bleach dispenser 65 , and valve 66 selectably provides fresh water to softening agent dispenser 67 . as further shown in fig2 the washing machine includes a wash liquid recirculation system . in order to recirculate wash liquid for the recirculating spray wash , tub sump 41 collects wash liquid and is fluidly connected to pump 23 by sump hose 40 . pump 23 is selectably operational to pump liquid from tub sump 41 via pump outlet hose 25 either to recirculating hose 27 or drain hose 29 depending on the position of bidirectional valve 30 . recirculating hose 27 provides recirculating wash liquid to pressure dome 42 , the wash liquid exiting the pressure dome 42 via recirculating spray nozzle hose 48 and being emitted to the wash basket 28 via recirculating spray nozzle 32 . pressure dome 42 provides a head of pressure varying dependent upon the amount of wash liquid contained in the recirculating wash system by maintaining a captured dome of air in communication with the recirculating wash liquid . the pressure dome 42 provides a channel for the captured air to keep in contact with pressure sensor 46 via pressure line 45 . pressure sensor 46 provides optionally either an on / off or a varying or dynamic signal to control 22 via lines 47 , the signal varying dependent on the sensed pressure of the recirculating wash liquid . control 22 also optionally receives a static pressure signal from deepfill transducer dome 50 via lines 52 for signaling the level of wash liquid within wash tub 12 , however the invention disclosed herein may be practiced without use of a deepfill pressure dome . control 22 is further operable to receive input signals via lines 49 , including signals from valves 21 , 62 , 64 and 66 providing on and off times for these valves . by sensing the air pressure within pressure dome 42 , the amount of recirculating wash liquid in the washing machine may be inferred . this information is useful to determine the amount of free water in the washing machine during a recirculating wash . thereby , the amount of clothing in the washing machine may be inferred , which information is useful in order to minimize water and energy usage during a spray pretreatment cycle , stain cycle or other recirculating wash cycle , and further during later or other portions of the cycle . also , the suds lock condition , or absence thereof during portions of a cycle may be determined . suds lock may be prevented by limiting recirculating wash liquid to slightly in excess of clothes saturation . a basic process for the new control scheme of the spray pretreatment portion of the wash cycle is shown in the block diagram 100 in fig3 . the process begins at the commencement of spray treatment 102 by starting monitoring of the suds lock algorithm 104 . the process simply either completes the full cycle if suds lock does not occur or skips through the rest of the pretreatment cycle and onto the next step 106 in the case that suds lock should occur . this process 100 is independent of the method by which the existence of suds lock is determined . several methods can be applied in order to ascertain the existence of suds lock . fig4 a displays a block diagram 108 of the automatic washer containing recirculation hardware where a measure based on the flow rate of the wash liquid recirculation line is used to ascertain when water is added to the recirculation system . the flow rate can be measured in one of a number of known ways . a flow washer 68 contained in detergent dispenser valve 63 controls the flow rate within a predetermined range for a variety of predictable inlet water pressures . limiting flow in this manner allows the flow rate to be inferred based upon the on time of the inlet valve . a flow meter may also be used . finally , the deep fill rate may also be discerned . this intermittent process is due to the dry clothes load absorbing water into the load and thus the system requiring more water to regain the necessary flow rate . a similar approach shown in a block diagram 110 in fig4 b to determine when water needs to be added to the system can be performed by any of various techniques capable of measuring the height of the wash fluid in the sump portion of the tub . alternatively , a pressure sensor may be used to determine whether one or more predetermined pressure levels have been reached . in either case , if the control determines that the necessary wash fluid amount recirculating within the washer is satisfied , the control discontinues adding water by intermittent opening of the water inlet valve . using either of these means shown in fig4 a or 4 b to control the process of adding water to the system , an alternating pattern of the times for the addition of water to the system and not adding water to the system can be gained . fig5 shows such a typical pattern or profile 112 relating to the on and off periods of the inlet valve for the spray pretreatment portion of the automatic wash cycle , based on whether the water level or water pressure detecting means is satisfied . preferably , the control determines the necessary amount of wash liquid as that amount which is slightly in excess of the saturation level for the clothes load . accordingly , as the pretreatment portion of the cycle proceeds as shown in fig5 the control continually monitors the inlet on or off times or both on and off times , or the pressure or water level signals which are used to control the inlet on , off or on and off times . this information , as discussed later herein , may be used to determine whether the clothes washer is experiencing a suds lock condition or some other abnormal condition if the information is outside a certain expected range . as well , however , this information may be used to determine the load size being washed , so that the pretreatment cycle and later portions of the wash cycle may be altered and preferably optimized or adapted to effectively complete the cleaning and rinsing of the clothes , but no more in order to avoid suds lock . by using the measure of load size during the pretreatment cycle , the rest of the pretreatment cycle can be optimized based on the load size information . after the desired water level or pressure is detected as initially satisfied by the control 22 , the washing machine is allowed to continue the normal pretreatment cycle where water is added to the system as requested by the control system for a first predetermined time . the control then identifies the load size in a manner as previously discussed . the inlet valve may be shut off regardless of whether water is called for by the control system when a second predetermined time is reached . this second predetermined time may be defined based on the load size measure . at this time , the pretreatment step is completed and the machine proceeds through the rest of the cycle . the process of not adding water will aid the system in avoiding suds lock which increases the performance of the cycle . in another example of optimizing the rest of the pretreatment cycle based on the load size information , the control system determines the total water fill times at preselected intervals . depending on the total water fill time , a preselected overall cycle time for pretreatment is performed , during which water may be added . the cycle is further optimized by taking into consideration the water level and cycle selected by the user , so that the washer may perform not only according to the load size detected but in accordance with the demands of the user . from the various means of determining load size during the pretreatment portion of the cycle , this information can be applied to control other portions of the cycle . in previous washers , the load size or water level input on the console is the input used to control the amount of water added to the system in the deep fill and the relative agitation rate based on the type of cycle chosen . in the present invention , the load size determined from the pretreatment step can be applied in a similar way to determine water amounts and control the agitation performed during the rest of the wash cycle . for example , the load size information can be used to determine the agitation length and rate , to determine the deep fill wash length , spin time and speed , the deep fill or spray rinse length , spin time and speed , or the number of rinses . an automatic washer incorporating the present invention may preferably include traditional user control inputs such as cycle , water temperature and water level . although the input by the consumer may be taken into consideration to affect the cleaning cycle , the control selectively processes the previously mentioned inlet on , off or on and off , water level or pressure information independently of such user input to determine the size of the clothes load . it is noted that the type of clothes , particularly the variety of materials providing the makeup of the clothes is not of critical importance once the pretreatment cycle is completed , since the load size information gained during the pretreatment cycle is all that is needed to continue the wash process . however , the user input may be considered as part of an algorithm such that the performance of the washer , for example the length of wash time , is not greatly different than consumer expectations for a selected input . in another example of optimizing the rest of the wash cycle based on detected load size , it is a known problem in a vertical axis washer to turn over a large clothes load approaching 17 pounds during a deep fill wash . one difficulty is that after filling the washer to the maximum level and beginning agitation , the large items in the load such as sheets , tablecloths or towels may be displaced above the waterline by the agitator , which physically lowers the water level in the tub . the lowering of the water level in the tub can be anticipated by control 22 or detected via a pressure sensor 46 or 50 and compensated for by adding water to return to the maximum level . alternatively , to address the aforementioned problem , a delayed fill may be used . when the user selects a heavy duty cycle along with maximum water level , for example the water level in the deep fill wash is initially brought to a level slightly below the maximum . the clothes load will be partially submerged , with a portion of the load remaining dry or at most partially saturated on the surface . at this water level , the agitator is allowed to commence turning and will easily pull the dry clothing from the top of the load , moving the clothes down the center of the basket and up the outside in the normal motion . after an initial preselected period , long enough to allow the load to be fully wetted and largely submerged , the washing machine may be filled to the maximum level followed by additional agitation or while continuing to agitate . the preceding process assures that normal rollover of the wash load is achieved as quickly as possible despite the large load . [ 0043 ] fig6 displays a block diagram 118 of the general process for determining whether suds lock has occurred based on selected criteria and suds lock measure information . this diagram is independent of chosen measurement technique . several sets of criteria are satisfactory for the case of using information about the inlet water valve cycling information measurement of suds lock . the following table contains several functional criteria : table suds lock criteria table for inlet water valve based measures . suds lock measure suds lock criteria case ( 1 ) t on ( 0 ) 10 - 20 sec . case ( 2 ) t on ( 0 )/( t on ( 1 )) n case ( 3 ) t on ( 0 )/( t on ( 1 ) + t on ( 2 )) n case ( 4 ) t on ( 0 )/( t on ( 1 ) + t on ( 2 ) + t on ( 3 )) n as part of the suds lock criteria , note that if t on ( 2 ), t on ( 3 )= 0 , then let t on ( 2 )= t on ( 3 )= t on ( 1 ). the optimum value for n is approximately 2 . the algorithm also incorporates a minimum time , t min — check , which to start checking for suds lock to occur . this time could be set between 0 sec and 40 sec . in addition to satisfying the suds lock criteria , there also is a time t on — min which sets a minimum time of addition which it must be above to be considered as suds lock condition . typical ranges for this are between 2 to 4 sec . other ways exist for detecting suds lock in the washing machine . fig7 displays a block diagram 120 that shows the components which make up the drive system and the corresponding means for detecting the existence of suds lock through each component . for the basket , the means for detecting the existence of suds lock 122 may be summarized as follows . a first suds lock detection method is by measurement of the basket rpm ( by magnetic , optical or ultrasonic means ) after the basket is brought up to normal operating speed . when basket reduces rpm by 70 % from the steady state value , suds lock has occurred . a second suds lock detection method is by measurement of the basket or tub acceleration after the basket is brought up to normal operating speed . vibration of the basket or tub should be fairly constant or increasing during the spray pretreatment portion of the cycle unless suds lock occurs . for the drive system , the means for detecting the existence of suds lock 124 may be summarized as follows . a first suds lock detection method is by measuring the temperature of the clutch . when a suds lock condition occurs , the temperature of the clutch will increase significantly during suds lock condition . a second suds lock detection method is by measuring torque on drive components . when a suds lock condition occurs , a significant drop in torque will occur . for the motor , motor control and supply power , the means for detecting the existence of suds lock 126 , 128 and 129 may be summarized as follows . a first suds lock detection method is by measurement of motor rpm using a tachometer which is built into the motor . when the basket reduces rpm by 70 % from steady state value , suds lock has occurred . a second suds lock detection method is by measurement of the current or wattage going to the motor measured at motor . when current or wattage increase by a given percentage , suds lock has occurred . a third suds lock detection method is by measurement of total current or wattage going to the entire machine , since motor current is by far most significant component . when current or wattage increase by a given percentage , suds lock has occurred . a fourth suds lock detection method is by measurement using an opto coupler for obtaining information about drop in the torque draw of the motor . a fifth suds lock detection method is by measurement using a ferrite core sensor for obtaining information about the drop in the torque draw of the motor . in the latter two methods , when torque drops by a given amount , suds lock has occurred . in addition to measurements which can be made on the drive system , measurement of the height of the suds in the system can be made . fig8 displays a block diagram 130 illustrating the components which are to be observed , that is the tub or the basket , and the means for detecting the existence of suds lock through each component . specific embodiments of such techniques to measure the height of the suds during a spray pretreatment portion of the wash cycle may include a ) providing a conductivity strip along the side of the basket ; b ) ultrasonic measurement , or c ) optical measurement . feedback provided to the control in each case indicates an oversuds condition , from which it may be inferred that suds lock has occurred . in addition to the occurrence of suds lock , there are a few special conditions which can as be detected by the control . although other detection means may be used , in these examples the control monitors the inlet valve on time over a prescribed check time . one such condition occurs when the machine is started in pretreatment portion of the cycle with much more water than necessary . fig9 displays the process by which the inlet valve is controlled based on measure information for the special case of having too much added water in the system at the start of the cycle . this condition can occur for the reasons that the user starts the machine into normal deepfill ( without prefill ), then stops the machine after a good amount of water has filled the machine ( over 2 gallons ) and the machine is switched and restarted in pretreatment cycle ; the user puts a very soggy clothes load into the machine or the user physically adds water into the machine with the load . for all these conditions , the time by which the machine calls for water will be very small . thus by monitoring the time by which the control system calls for water with respect to some length of checking time , this condition can be ascertained . if such a case should occur , the pretreatment cycle may be ended and the rest of the cycle is continued . another special condition can be detected by the primary means of monitoring the inlet valve on time over a prescribed check time . one such condition may occur when the washing machine is in the recirculating spray pretreatment portion of the cycle and the machine continuously calls for water without stopping . [ 0056 ] fig1 displays a graphic depiction 140 of the process by which the inlet valve is controlled based on measured information in the special case where the recirculation flow in the system at the start of the cycle is not satisfied for some finite period of time . in addition to sensing this condition based on the recirculation flow being not satisfied , additional information can be gained from the deepfill pressure transducer for the air dome 50 in the tub . for the case where the deepfill pressure transducer does not sense the existence of a sizable amount of water in the tub , a variety of machine conditions may be a cause . under the category of washing machine component failures , the failures can include a sizable leak in the tub or the recirculation or drain hose system ; one or more bad inlet valves not adding water to system , or a recirculation diverter valve failed or stuck in the drain direction . under the category of non - washing machine component failures might be a long fill due to very low line pressure . for the case where the deepfill pressure transducer is sensing the existence of a sizable amount of water in the tub , the following machine conditions may be a cause , all of which are washing machine component failures . the failures can include a bad recirculation pressure switch , a pump or motor failure , a severe recirculation line clog or the recirculation pressure hose is disconnected . in case of such failure , the control 22 will end the cycle and indicate the failure condition to the consumer . as is apparent from the foregoing specification , the invention is susceptible of being embodied with various alterations and modifications which may differ particularly from those that have been described in the preceding specification and description . it should be understood that we wish to embody within the scope of the patent warranted hereon all such modifications as reasonably and properly come within the scope of the contribution to the art .
| 3 |
a method and a system are provided for managing packet data interconnections in mobile communications . the method and system help to avoid a pdsn handoff in ms data communications when an ms moves between areas associated with different pcfs . in a first general approach , each ms has a permanently assigned pdsn . the pcf obtains this address ( and backup addresses ) from the home location register ( hlr ) for a mobile subscriber when the subscriber registers and authenticates with the network . in such a case , all of the network providers interconnect the ip radio networks between all pcfs and pdsns regardless of geographical or administrative concerns / boundaries . changes are made to the hlr and to the messaging between the bsc / msc ( hlr proxy ) and the pcf . a static mapping between mobile subscribers and available pdsns is maintained . the hlr may also identify a backup pdsn address for each ms in case the primary pdsn for an ms is not available . in a second general approach , an administratively cooperative group of pcfs use a signaling scheme among themselves to identify an appropriate pdsn to service each a10 / a11 mobile subscriber session . a large amount of per session storage and complex signaling is involved ; each pcf is aware of every currently established ms session within an administrative domain . in a simplification , each pcf within an administrative domain is configured with a complete list of available pdsns and each pcf applies the same or effectively the same hashing function that maps mobile session identification information onto the list of pdsns . information that may be used to identify a potential mobile session includes the following “ three number set ”: mn type , mn id , and mn session reference id . in a specific implementation , each pcf selects the primary pdsn to terminate a ms session by hashing the three number set onto the list of pdsns and first offering the session to the selected pdsn ; if the session is not accepted by the selected primary pdsn , any other available pdsn can be used ( the pcf may give a preference to a pdsn suggested by the original pdsn that did not accept the offered session ). in such a case , non - overlapping administrative pcf areas are defined , and it may be necessary to address how to handle taking pdsns in and out of service , and how to handle dynamic load balancing with a lack of feedback from pdsns . an inter - pcf signaling protocol may be used , or new pcf - pdsn signaling messages may be provided so that the pcf has access to information available only within the pdsn , such as user profile and pdsn administrative state information , which may be needed or helpful . in a third general approach , described in more detail below , existing capabilities of pcfs are used by enhanced pdsn software to allow the pdsn software to help avoid inter - pdsn handoffs . in particular , in a specific implementation , the r - p registration request error code 0 × 88 ( indicating “ registration denied == administratively denied ”), is used by the enhanced pdsn software to help avoid pdsn handoffs . when this error code is returned by the pdsn in response to the pcf issuing a registration request , the pdsn may suggest another pdsn to try instead of itself . using this mechanism , the pdsn can suggest a specific pdsn to terminate a session for a mobile subscriber . a variety of techniques are described below for selecting a specific pdsn to suggest to a pcf performing a registration request . the techniques allow an ongoing data call that has changed pcfs to continue to be directed to the same pdsn , which helps to avoid pdsn handoffs . a first technique for selecting a specific pdsn to suggest to a pcf includes configuring each pdsn with two addresses ( also known as ports ): an r - p redirection address and an r - p service address . the pcfs are configured only with the addresses that correspond to r - p redirection addresses . when a pcf contacts the pdsn for the first time , the pdsn selects the specific pdsn to handle the new session for the mobile subscriber based on the three number set ( mn type , mn id , and mn session reference id ). the three numbers are used in a pdsn selection procedure to select an “ optimal ” pdsn . the pdsn selection procedure may be or include a hashing function to a preconfigured ( or discovered ) list of pdsn service addresses . an example follows : both pdsns are configured with a pdsn service address list as follows : the hashing function computes an index into the pdsn service address list ( an index of 0 corresponds to 10 . 1 . 1 . 1 ; an index of 1 corresponds to 10 . 2 . 2 . 1 ). a pcf is configured with the following list of pdsn addresses : ( 10 . 1 . 1 . 2 , 10 . 2 . 2 . 2 ). a call for ms # 1 comes in , having the following characteristics : the pcf sends an r - p registration request to the first pdsn in its list : pdsn - a ( 10 . 1 . 1 . 2 ). pdsn - a computes h ( 1 , 978851110 , 1 )= 0 , which indicates that the service address for the call is to be 10 . 1 . 1 . 1 . the service address 10 . 1 . 1 . 1 represents pdsn - a itself , which therefore accepts the call . a call for ms # 2 comes in , having the following characteristics : the pcf sends an r - p registration request to the first pdsn in its list : pdsn - a ( 10 . 1 . 1 . 2 ). pdsn - a computes h ( 1 , 978851111 , 1 )= 1 , which indicates that the service address for the call is to be 10 . 2 . 2 . 1 . since the service address 10 . 2 . 2 . 1 does not correspond to pdsn - a , a registration reject message with error code 0 × 88 is sent back to the pcf with the home agent field of the message set to 10 . 2 . 2 . 1 . the pcf sends a new registration request to pdsn - b 10 . 2 . 2 . 1 . since the request is sent to the service address , pdsn - b does not execute the hashing function ; instead , pdsn - b starts r - p service if sufficient resources are available . an example procedure is illustrated in fig4 - 5 . ( for simplicity , fig4 does not show the elements between the ms and the pcf shown in fig3 .) each of pdsns pdsn1 , pdsn2 , pdsn3 , pdsn4 has an r - p redirection address and an r - p service address ( such as , in the case of pdsn1 , address a and address b , respectively ). pcf1 and pcf2 are configured to use only the r - p redirection addresses for initial contact with the pdsns . each pdsn runs software sw that operates as now described . initially , ms is in an area covered by pcf1 . when a data call involving ms is initiated , pdsn1 receives a connection request ( an a11 - registration request message ) from pcf1 at pdsn1 address a ( step 1010 ). the pdsn corresponding to ms ( pdsn2 in this example ) is determined ( step 1020 ). if the pdsn corresponding to ms is the current pdsn ( in this example , if the corresponding pdsn were pdsn1 ), the connection request is accepted and the procedure ends ( step 1030 ). a response ( an a11 - registration reply with a reject result code ‘ 88h ’) is transmitted to pcf1 indicating the r - p service address ( here , address d ) of the corresponding pdsn . ( step 1040 ). if ms roams to the area served by pcf2 , pcf2 sends a connection request to one of the pdsns ( here , pdsn4 , at address g ). software sw on pdsn4 determines , as the same software sw on pdsn1 did above , that the pdsn corresponding to ms is pdsn2 , and responds to pcf2 indicating a redirection to address d of pdsn2 . thus , ms remains associated with pdsn2 despite having moved from an area served by pcf1 to an area served by pcf2 . in at least two ways , the arrangement described above helps to reduce or prevent unnecessary redirection communications between the pcfs and the pdsns . first , by accepting a connection request when the pdsn corresponding to ms is the current pdsn , the software sw avoids causing the pcf to redirect the request back to the same pdsn . second , by providing for separate redirection and service addresses on each pdsn , the software sw can be enhanced to detect when a request is the result of a redirection , and thereby avoid causing the pcf to perform another redirection , back to the same pdsn . according to the enhancement , since the pcfs are configured with the redirection addresses only , when a request comes into the pdsn via the service address instead of the redirection address , the software sw accepts the request without further analysis , because it is assumed that the pcf generates a request to the service address only as a result of a redirection response . an alternative pdsn selection procedure includes dynamic management of the key - space generated by the hashing function . the following is a description of a procedure 6000 ( fig6 ) suitable for the dynamic management of key space . a key space may consist of a finite integral range 0 . n . this key space may correspond directly to the three number set ( mn type , mn id , and mn session reference id ) or to the result of a hash function applied to the three number set . first , the pdsns within a domain are directed to discover each other ( step 6010 ) and agree on membership to the administrative pdsn domain ( step 6020 ). next , the key space is evenly partitioned among the operationally active pdsns within the administrative domain ( step 6030 ), keeping intact any active sessions . each pdsn maintains a complete view of the partitioned key space ( step 6040 ) and attempts to minimize or reduce the number of holes in the space ( step 6050 ) by acquiring key space from peers as sessions are added locally . an example follows : both pdsns are configured with an available pdsn service address list ( 10 . 1 . 1 . 1 , 10 . 2 . 2 . 1 ), a pdsn service list having 65536 entries ( 10 . 1 . 1 . 1 & lt ; repeats 32768 times & gt ;, 10 . 2 . 2 . 1 & lt ; repeats 32768 times & gt ;), and a hashing function the hashing function computes an index into the 65536 entry pdsn service list . to join the existing two pdsns , another pdsn solicits a list of free entries from each pdsn , intersects the lists , and asserts ownership of unused slots by sending an request ownership message to each pdsn . after receiving a positive acknowledgement from each pdsn , the other pdsn may send an assert ownership message to each pdsn . as pdsns are added or removed or added and removed , and as load changes , it may be necessary or helpful to re - partition the key space dynamically among the pdsns . in a specific implementation , such re - partitioning is performed in a centralized fashion by a procedure 7000 ( fig7 ) as follows . a designated “ master ” pdsn is directed to propose various repartitions of the key space ( step 7010 ). in such a case , each pdsn informs the master pdsn how many key conflicts the pdsn would have with a proposed partition ( step 7020 ) and , depending on the circumstances , the master pdsn proposes further refinements of the key space ( step 7030 ) by further splitting contentious key ranges . when an acceptable repartition of the key space is reached , each pdsn switches to the new key space ( step 7040 ). it is desirable to avoid unresolved key conflicts , which may result in failure to achieve transparent inter - pdsn mobility in the simple ip case . a second technique for selecting a specific pdsn to suggest to a pcf shares some aspects with the first technique . in this case , according to a procedure 8000 ( fig8 ), an external server such as a remote authentication dial - in user service ( radius ) server is used to select an “ optimal ” pdsn to handle an r - p session ( step 8010 ), and return the “ optimal ” pdsn selection back to the pcf ( step 8020 ). an advantage is that this technique takes advantage of the existing radio resource records that identify the last pdsn that handled a session corresponding to a particular three number set ( mn type , mn id , and mn session reference id ). an external server may also provide load balancing services or map specific users to specific pdsns . the technique ( including one or more of the procedures described above ) may be implemented in hardware or software , or a combination of both . in at least some cases , it is advantageous if the technique is implemented in computer programs executing on one or more programmable computers , such as a line - card or a control processor of a pdsn or a pcf , or a radius server , hlr , or vlr running on a general purpose computer , or a computer running or able to run microsoft windows 95 , 98 , 2000 , millennium edition , nt , xp ; unix ; linux ; or macos ; that each include a processor such as an intel pentium 4 , a storage medium readable by the processor ( including volatile and non - volatile memory and / or storage elements ), at least one input device such as a keyboard , and at least one output device . program code is applied to data entered using the input device to perform the method described above and to generate output information . the output information is applied to one or more output devices such as a display screen of the computer . in at least some cases , it is advantageous if each program is implemented in a high level procedural or object - oriented programming language such as c , c ++, java , or perl to communicate with a computer system . however , the programs can be implemented in assembly or machine language , if desired . in any case , the language may be a compiled or interpreted language . in at least some cases , it is advantageous if each such computer program is stored on a storage medium or device , such as rom or magnetic diskette , that is readable by a general or special purpose programmable computer for configuring and operating the computer when the storage medium or device is read by the computer to perform the procedures described in this document . the system may also be considered to be implemented as a computer - readable storage medium , configured with a computer program , where the storage medium so configured causes a computer to operate in a specific and predefined manner . other embodiments are within the scope of the following claims . for example , one or more of the actions performed by the software sw may be performed by another entity , such as the pcf or the msc . in such a case , the other entity may determine the pdsn corresponding to the ms .
| 7 |
the following description is of the best embodiments presently contemplated for carrying out this invention . this description is made for the purpose of illustrating the general principles of this invention and is not meant to limit the inventive concepts claimed herein . referring now to fig1 , there is shown a disk drive 100 embodying this invention . as shown in fig1 , at least one rotatable magnetic disk 112 is supported on a spindle 114 and rotated by a disk drive motor 118 , all of which are mounted within a housing 101 . the magnetic recording on each disk is in the form of annular patterns of concentric data tracks ( not shown ) on the magnetic disk 112 . at least one slider 113 is positioned near the magnetic disk 112 , each slider 113 supporting one or more magnetic head assemblies 121 . as the magnetic disk rotates , slider 113 moves radially in and out over the disk surface 122 so that the magnetic head assembly 121 can access different tracks of the magnetic disk where desired data are written . each slider 113 is attached to an actuator arm 119 by way of a suspension 115 . the suspension 115 provides a slight spring force which biases slider 113 against the disk surface 122 . each actuator arm 119 is attached to an actuator means 127 . the actuator means 127 as shown in fig1 may be a voice coil motor ( vcm ). the vcm comprises a coil movable within a fixed magnetic field , the direction and speed of the coil movements being controlled by the motor current signals supplied by controller 129 . during operation of the disk storage system , the rotation of the magnetic disk 112 generates an air bearing between the slider 113 and the disk surface 122 which exerts an upward force or lift on the slider . the air bearing thus counter - balances the slight spring force of suspension 115 and supports slider 113 off and slightly above the disk surface by a small , substantially constant spacing during normal operation . the various components of the disk storage system are controlled in operation by control signals generated by control unit 129 , such as access control signals and internal clock signals . typically , the control unit 129 comprises logic control circuits , storage means and a microprocessor . the control unit 129 generates control signals to control various system operations such as drive motor control signals on line 123 and head position and seek control signals on line 128 . the control signals on line 128 provide the desired current profiles to optimally move and position slider 113 to the desired data track on disk 112 . write and read signals are communicated to and from write and read heads 121 by way of recording channel 125 . with reference to fig2 , the orientation of the magnetic head 121 in a slider 113 can be seen in more detail . fig2 is an abs view of the slider 113 , and as can be seen the magnetic head including an inductive write head and a read sensor , is located at a trailing edge of the slider . the above description of a typical magnetic disk storage system and the accompanying illustration of fig1 are for representation purposes only . it should be apparent that disk storage systems may contain a large number of disks and actuators , and each actuator may support a number of sliders . fig3 and 4 show a schematic view of a magnetic read head 300 . fig3 is a view of the sensor 300 as seen from the air bearing surface ( abs ), and fig4 is a side cross sectional view as seen from line 4 - 4 of fig3 . the magnetic read head 300 includes a sensor stack 302 that is sandwiched between upper and lower magnetic shields 304 , 306 that can be constructed of an electrically conductive , magnetic material such as nife so that they can function as electrical leads as well as magnetic shields . the sensor stack 302 includes a first sensor stack portion ( lower portion ) 308 and a second sensor stack portion ( upper portion ) 310 . as shown in fig3 , the lower portion 308 has a width that defines a sensor track - width tw , whereas the upper portion 310 can be much wider . the lower sensor portion 308 can include a magnetic free layer 312 that can be formed on a seed layer 314 . the magnetic free layer 312 can include materials such as nife , cofe and / or a heusler alloy . a non - magnetic spacer or barrier layer 316 can be formed over the magnetic free layer 312 . the non - magnetic spacer layer 316 can be a magnetically insulating material such as mgo , if the sensor 300 is a tunnel junction sensor or can be an electrically conductive spacer layer such as agsn if the sensor 300 is a giant magnetoresistive ( gmr ) sensor . the lower sensor portion 308 also includes a first portion of a first magnetic pinned layer ( ap1 first portion ) 318 a , which can be constructed of a magnetic material such as nife or cofe . the layer 318 a will be discussed in greater detail herein below . the sensor stack 302 includes a pinned layer structure 320 that include a first pinned magnetic layer ( ap1 ) 318 and second pinned magnetic layer 322 and an antiparallel coupling layer 324 sandwiched between the ap1 layer 318 and ap2 layer 322 . the antiparallel coupling layer 324 can be formed of a material such as ru . as seen in fig3 , the ap1 layer 318 is formed as two magnetic layers , a first layer 318 a and a second layer 318 b . the first layer 318 a is part of the lower sensor stack portion 308 , while the second layer 318 b is part of the upper sensor stack portion 310 . also , it can be seen that the first layer 318 a has a width that is within the track - width tw , whereas the second layer 318 b extends laterally beyond the track - width tw . a method for manufacturing such pinned layer structure 320 with the novel bi - layer ap1 layer 318 will be described in greater detail herein below . both the ap1 and ap2 layers can be constructed of one or more magnetic materials such as cofe , nife or combinations of these . with reference to fig4 , the upper sensor stack portion 310 includes layer of antiferromagnetic material afm layer 326 that is formed over the pinned layer structure 320 , opposite the free layer 312 . as seen in fig4 , the afm layer 326 is recessed from the abs , and a magnetic pedestal 402 is disposed between the afm layer 326 and the abs and also between the ap2 layer 322 and the upper shield 306 . the afm layer 326 can be a material such as irmn or ptmn and is exchange coupled with the ap2 layer 322 . the exchange coupling between the afm layer 326 and the ap2 layer 322 pins the magnetization of the ap2 layer in a direction that is perpendicular to the abs . the antiparallel coupling between the ap1 layer 318 and ap2 layer 322 pins the magnetization of the ap1 layer 318 in a direction that is also perpendicular to the abs and that is opposite to that of the ap2 layer 322 . a capping layer 328 can be formed over the afm layer 326 to protect the underlying layers during manufacture and to magnetically decouple the sensor stack 302 from the upper shield 306 . the space behind the first sensor stack portion 308 can be filled with a non - magnetic , electrically insulating fill layer such as alumina 404 . the magnetic pedestal 402 can be constructed of a material similar to that of the upper shield 306 , such as nife . the magnetic pedestal 402 can be magnetically coupled with the magnetic shield 306 so that it functions as part of the magnetic shield . as a result , the afm layer 326 and capping layer 328 advantageously do not contribute to the read gap , resulting in increased data density . therefore , the read gap g is the distance between the top of the lower shield 304 and the bottom of the pedestal 402 as shown fig4 . with reference again to fig3 , the sensor 300 can include magnetic bias layers 330 , 332 at either side of the sensor stack 302 . the bias layers 330 , 332 provide a magnetic bias field that biases the magnetization of the magnetic free layer 312 in a direction parallel with the air bearing surface ( abs ). the bias layers 330 , 332 can be separated from the sensor stack 302 and bottom shield by a thin , non - magnetic , electrically insulating material such as alumina 334 . the magnetic bias structures 330 , 332 can be constructed of a high coercivity , hard magnetic material that keeps its magnetization as a result of its intrinsic hard magnetic properties . alternatively , the bias layers 330 , 332 can be constructed of a soft magnetic material . in that case , the magnetization of the bias structure can be maintained by an exchange coupled layer of antiferromagnetic material formed there - under . for example , a layer of nonmagnetic material such as ru 336 , a layer of antiferromagnetic material such as irmn 338 formed over the nonmagnetic material 336 and a magnetic layer 340 formed over the layer of antiferromagnetic material 338 . the non - magnetic layer 336 magnetically decouples the layer 338 from the bottom shield 304 . the antiferromagnetic layer 338 is exchange coupled with the magnetic layer 340 to pin its magnetization . this pinned magnetization of the layer 340 then maintains the magnetization of the bias layers 330 , 332 in a desired direction parallel with the air bearing surface . fig5 - 25 illustrate a method for manufacturing a magnetic sensor such as the sensor 300 , and further illustrate the advantages provided by such a sensor structure . with particular reference to fig5 , a bottom magnetic shield 502 is formed of a material such as nife . then , an optional series of layers can be deposited to maintain magnetization of a yet to be formed bias structure . these layers can include : a non - magnetic decoupling layer such as ru 504 deposited onto the bottom shield ; a layer of antiferromagnetic material 506 deposited over the decoupling layer 504 ; and a layer of magnetic material such as nife 508 deposited over the layer of antiferromagnetic material 506 . after depositing the optional layers 504 , 506 , 508 , a first series of sensor layers 510 is deposited . this first series of sensor layers 510 can correspond to the bottom sensor stack portion 308 described above with reference to fig3 . the first series of sensor layers 510 can include : a seed layer 512 ; a magnetic free layer 514 formed over the seed layer 512 , a non - magnetic barrier or spacer layer 516 deposited over the magnetic free layer 514 and a first portion of a magnetic first pinned layer ( first portion of an ap1 layer ) 518 formed over the non - magnetic spacer or barrier layer 516 . then , a first mask structure 520 is formed over the first series of sensor layers . the configuration of the mask 520 can be better understood with reference to fig6 which shows a top down view as seen from line 6 - 6 of fig5 . as can be seen in fig6 the mask 520 extends over an air bearing surface plane denoted abs and extends to a back edge 522 that is configured to define a lower sensor stack stripe height . with reference now to fig7 , a first ion milling is performed to remove layers not protected by the mask 520 . the ion milling can be performed until the bottom shield 502 has been reached . then , a non - magnetic , electrically insulating fill layer such as alumina 802 is deposited and a planarization process performed , leaving a structure as shown in fig8 . the planarization can include performing a chemical mechanical polishing and may include a mask liftoff process . as can be seen from the above , the masking and milling process that defines the track - width tw is performed on a much thinner structure ( the series of sensor layers 510 ) than would be the case if rest of the pinned layer structure and antiferromagnetic pinning layer were to be included . this advantageously allows the masking and ion milling to define a much smaller track with than would otherwise be possible . with reference now to fig9 and 10 , a second mask structure 902 is formed . fig1 is a top down view as seen from line 10 - 10 of fig9 . the mask 902 has an opening 904 that is configured to define a stripe height of a lower sensor stack portion . then , with reference to fig1 , a second ion milling is performed to remove material not protected by the mask 902 . this ion milling can be terminated prior to removal of layers 504 , 506 , 508 as shown in fig1 . with reference to fig1 , a thin , nonmagnetic , electrically insulating layer 1202 is deposited . the layer 1202 can be a material such as sin and is preferably deposited by a conformal deposition process such as atomic layer deposition or ion beam deposition . then , with reference to fig1 , a directional material removal process such as ion milling is performed in such a manner to remove horizontally disposed portions of the insulation layer 1202 leaving vertical insulation side walls as shown in fig1 . then , with reference to fig1 , a magnetic bias material 1402 is deposited followed by a cmp stop layer / bias capping layer 1404 . the bias material 1402 can be nife and the capping layer can be carbon or diamond like carbon . the insulation side walls 1202 passivate the sensor layers 510 , while leaving the magnetic layer 508 exposed to exchange couple with the magnetic bias layer 1402 . then , a chemical mechanical polishing ( cmp ) can be performed to planarize the structure and remove the second mask 902 , leaving a structure as shown in fig1 . with reference now to fig1 , a glancing angle mill , such as at an angle of 50 degrees - 75 degrees is performed to expose layer 518 then a second series of sensor layers 1602 is deposited . these layers 1602 can correspond with the upper sensor stack portion 310 described above with reference to fig3 and 4 . the series of sensor layers include a magnetic layer 1604 that forms a second portion of the ap1 layer . an anti - parallel coupling layer such as ru 1606 is deposited over the magnetic layer 1604 . another magnetic layer ( ap2 ) layer 1608 is deposited over the anti - parallel coupling layer 1606 . a layer of antiferromagnetic material ( afm layer ) such as irmn or ptmn 1610 is deposited over the ap2 layer 1608 , and a capping layer 1612 is deposited over the afm layer 1610 . the capping layer can include one or more of ta and ru . then , with reference to fig1 , a third mask structure 1702 is formed over the second series of sensor layers 1602 . the configuration of the mask 1702 can be seen more clearly with reference to fig1 , which shows a top - down view as seen from line 18 - 18 of fig1 . the mask 1702 defines the outer boundaries ( stripe height and width ) of the second series of sensor layers 1602 . then , with reference to fig1 , a third ion milling is performed to remove material not protected by the third mask 1702 . the third ion milling can be performed until the bottom shield 502 has been reached . then , an electrically insulating , nonmagnetic fill layer 2002 is deposited and a planarization process such as chemical mechanical polishing is performed , leaving a structure as shown in fig2 . with reference now to fig2 and 22 , a fourth mask structure 2101 is formed having an opening 2104 located in a region at the air bearing surface . fig2 is a side cross sectional view as seen from line 22 - 22 of fig2 . with reference to fig2 , an ion milling is performed just sufficiently to remove portions of the capping layer 1612 and afm layer 1610 that are not protected by the mask 2102 , stopping at the ap2 layer 1608 . then , a magnetic material 2402 is deposited and a planarization process such as chemical mechanical polishing is performed , leaving a structure as shown in fig2 with the magnetic material 2402 forming a pedestal . then , with reference to fig2 , an upper magnetic shield 2502 is formed , such as by electroplating . the upper magnetic shield 2502 is stitched to and magnetically connected with the magnetic pedestal . 2402 . while various embodiments have been described above , it should be understood that they have been presented by way of example only and not limitation . other embodiments falling within the scope of the invention may also become apparent to those skilled in the art . thus , the breadth and scope of the invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .
| 7 |
referring to fig1 , a transmitter system 10 may include a distributed laser 12 coupled to a data signal source 14 that supplies a modulation signal encoding binary data . the laser 12 may be a distributed bragg reflector ( dbr ) laser , distributed feed back ( dfb ) laser , or other laser having one or more reflectors formed using a grating formed in or adjacent to a waveguide . the output of the laser 12 may be transmitted through an optical spectrum reshaper ( osr ) 16 . the output of the osr 16 may be transmitted through a fiber 18 to a receiver 20 . the osr 16 converts a frequency modulated signal from the laser 12 to an amplitude modulated signal . in some embodiments , the output of the laser 12 is both frequency and amplitude modulated , such as adiabatically chirped pulses produced by a directly modulated dbr laser or distributed feedback ( dfb ) laser . the output of the osr may also remain somewhat frequency modulated . the osr 16 may be embodied as one or more filters , including , but not limited to , a coupled multi - cavity ( cmc ) filter , a periodic multi - cavity etalon , a fiber bragg grating , a ring resonator filter or any other optical element having a wavelength - dependent loss . the osr 16 may also comprise a fiber , a gire - tournois interferometer , or some other element with chromatic dispersion . in some methods of use the laser 12 is modulated between a peak and a base frequency in order to encode a data signal in the output of the laser 12 . in some embodiments the output of the laser 12 will also be modulated between peak and base amplitudes . the osr 16 has a transmission function aligned with the base and peak frequencies such that the base frequency is attenuated more than the peak frequency in order to improve the extinction ratio of the output of the osr 16 . referring to fig2 and 3 , various dbr lasers 12 may be used with the present invention . although fig2 and 3 illustrate two examples , they are not limiting of the type of dbr lasers that may benefit from embodiments of the present invention . referring specifically to fig2 , a dbr section 22 receives light from a gain section 24 . the laser 12 may include other sections such as a phase control section 26 and / or electro - absorption section 28 . the gain section 24 and other sections such as the phase control section 26 and electro - absorption section 28 may be positioned between the dbr section 22 and a filter 30 . in some embodiments the filter 30 may be embodied as another dbr section . referring to fig3 , another example of a dbr laser is a tunable twin guide sampled grating dbr ( ttg - sg dbr ), which includes a dbr section 22 embodied as two sampled gratings 22 a , 22 b . the sampled gratings 22 a , 22 b are coupled to the gain section 24 by means of a multi - mode interface ( mmi ) 32 . the sampled gratings 22 a , 22 b preferably have reflection peaks having a different free spectral range such that the reflection peaks of the combined sampled gratings 22 a , 22 b may be tuned using the vernier effect . in a dbr laser , such as those shown in fig2 and 3 , a grating structure within the dbr section 22 defines reflection peaks that control which wavelengths of light are reflected back into the gain section 24 . the dbr section 22 therefore determines the output spectrum of the laser . the reflection peaks of the dbr section 22 may be shifted by means of current injection or heating due to the thermo - optic effect in order to control the output spectrum of the laser . although current injection is a widely used means for tuning , it tends to degrade the materials of the dbr section over time , which limits the useful life of transmitters using current injection . temperature tuning does not shorten the useful life of a dbr laser to the same extent as current injection . however , prior temperature tuning systems and methods have high power requirements , slow frequency response , and narrow tuning bands . referring to fig4 , in some embodiments , a dbr section 22 may be formed in a waveguide 38 that is separated from a base substrate 40 by an air gap . in the illustrated embodiment , the waveguide 38 is formed in a raised substrate 42 supported above the base substrate by pillars 44 . the pillars have a height 46 that defines the height of the air gap between the raised substrate 42 and the base substrate 40 . the separation 48 between the pillars 44 is preferably much larger than the width 50 of the pillars 44 such that a majority of the length of the dbr section 22 is separated from the base substrate by an air gap . in a preferred embodiment , at least 90 percent of the length of the dbr section 22 parallel to the direction of propagation of light within the dbr section 22 is separated from the base substrate by an air gap . the material forming the pillars 44 may be the same as , or different from , the material forming the base substrate 40 and / or raised substrate 42 . for example , the pillars 44 may be formed of indium phosphide ( inp ), indium gallium arsenide phosphide ( ingaasp ), or the like . in some embodiments 1 . 3 q ingaasp is used for the pillars 44 due to its highly insulative properties . the raised portion 42 of the substrate may include a heated portion 52 and a non - heated portion 54 . the dbr section 22 is preferably located in the heated portion whereas the gain section 24 , phase section 26 , and / or electro - absorption section are located in the un - heated portion 54 . in some embodiments , the dbr section 22 includes a sampled grating including gratings formed only at discrete areas 56 along the waveguide 38 . in such embodiments , heaters 60 may be formed only on the discrete areas 56 . the heaters 60 may be embodied as platinum stripe heaters . in such embodiments , metal layers 62 , such as gold , may be deposited between the discrete areas 56 to reduce heating of other portions of the waveguide 38 . in one embodiment , parallel to the optical axis of the waveguide 38 , the heaters 60 have a length of about 10 μm and the metal layers 62 have a length of 70 μm . in some embodiments , the pillars 44 are located at or near a mid point between discrete areas 56 , such as between 40 and 60 percent of a distance between the pillars . the air gap insulates the waveguide 38 from the base substrate 40 and reduces the power required to raise the temperature of the waveguide 38 in order to tune the response of the dbr section 22 . it also reduces the time required to raise the temperature of the waveguide 38 . referring to fig5 a through 5g , an air gap may be created between the raised substrate 42 and the base substrate 40 by performing the illustrated steps . referring specifically to fig5 a , an n - inp substrate 70 is formed having an ingaasp layer 72 and n - inp layer 74 formed thereon . the ingaasp layer 72 may be about 0 . 1 μm thick and the n - inp layer is preferably 30 nm thick , however other thicknesses are also possible . the ingaasp may have a bandgap wavelength of 1 . 3 μm . referring to fig5 b , silicon oxide ( sio 2 ) areas 76 may then be formed on the upper n - inp layer 74 . a gap 78 between adjacent areas 76 may have a width of 3 μm . as is apparent below , the width of the gap determines the width 50 of the pillars 44 . the areas 76 have a length 80 that defines the length of the air gap between the raised substrate 42 and base substrate 40 . thus , the width of the gap 78 may be less than 90 percent of the length 80 . in the illustrated embodiment , the areas 76 have a width of about 10 μm perpendicular to the optical axis of the waveguide 38 formed in subsequent steps and a length of about 30 μm parallel to the optical axis of the waveguide 38 . in the illustrated example , the gap 78 is about equal to 3 μm in the direction parallel to the optical axis of the waveguide 38 . other values may be used depending on the pillar size and air gap length desired . referring to fig5 c , the layers of the previous figures are then selectively etched to form the structure of fig5 c , wherein portions of the n - inp layer 74 and ingaasp layer 72 that are not covered by the sio 2 areas 76 are etched away . referring to fig5 d , another n - inp layer 82 is grown over the remaining layers . in some embodiments the sio 2 areas 76 are also removed . referring to fig5 e , layers for formation of the dbr laser 12 may then be formed on the n - inp layer 82 . various layers may be grown as known in the art to form any of various types of lasers and grating structures known in the art . as an example , a multi - quantum well ( mqw ) layer 84 and p - inp layer 86 are grown as illustrated . in the illustrated example , the n - inp layer 86 has a thickness of about 3 μm . referring to fig5 f , an active mqw portion 88 and passive dbr portion 90 may then be formed coupled to one another by a butt joint according to known methods . fe - inp blocking portions 92 a , 92 b may be formed along the mqw portions 88 and passive dbr portion 90 as known in the art . the passive dbr portion 90 may be embodied as a sampled grating dbr . however , other structures may be formed as known in the art to form other laser and / or grating types referring to fig5 g , the layers may then be selectively etched on either side of the dbr portion 90 . the etching may be performed using dry etching , deep reactive ion etching , or the like . the volume removed during the etching step preferably extends up to and including the ingaasp layer 72 . the remaining ingaasp layer 72 is then selectively removed in a wet etching step , such as by using an etchant that dissolves ingaasp substantially faster than other materials forming other layers that are exposed to the etchant , such as inp . upon removal of the ingaasp layer , portions of the inp layer 82 between the remaining areas of the ingaasp layers then become the pillars 44 . referring to fig6 a , in an alternative embodiment , the pillars 44 include ingaasp , rather than only inp . such embodiments provide the advantage of having improved insulative properties , which further reduce power consumption . in such embodiments , the sio 2 areas 76 illustrated in fig5 b are replaced with areas 94 a , 94 b having an area 96 positioned therebetween . the area 96 is narrower than the areas 94 a , 94 b and is separated from the areas 94 a , 94 b by a small gap . for example , parallel to the optical axis of the waveguide 38 , the area 96 is separated from each area 94 a , 94 b by a gap of between 10 and 25 percent of the length of the area 96 . the length of the area 96 parallel to the optical axis of the waveguide 38 may be between five and ten percent of the lengths of the areas 94 a , 94 b . perpendicular to the optical axis of the waveguide 38 , the area 96 may have a width that is between 20 and 50 percent of the width of one of the areas 94 a , 94 b . in the illustrated example , parallel to the optical axis of the waveguide 38 , the area 96 is separated from each area 94 a , 94 b by a gap of 0 . 5 μm and has a length of 3 μm . perpendicular to the optical axis of the waveguide 38 , the area 96 may have a width of 3 μm whereas the areas 94 a , 94 b have widths of 10 μm . the other steps of fig5 c through 5f may then be performed as described above . referring to fig6 b , when the dry etching step of fig5 g is performed up to the lines 98 , area 100 of inp remains and shields the portion of the ingaasp layer 72 that was beneath area 96 from etching whereas the portion of the ingaasp layer 72 that is beneath areas 94 a , 94 b is exposed and is etched away . thus a pillar 44 having an ingaasp center remains to support the raised substrate 42 . referring to fig7 a through 7c , in some laser designs , an ingaasp contact layer 102 is formed as part of the dbr laser 12 formed in step 5 f , or in another step prior to performing the steps of fig5 g . in such embodiments , the wet etching step of fig5 g using an etchant that removes ingaasp may damage the contact layer 102 . accordingly , in such embodiments , an sio 2 layer is formed to protect the contact layer prior to the etching step of fig5 g , in one embodiment , the protective sio 2 layer is formed by forming the structure illustrated in fig7 a , having a thick sio 2 etching mask 104 deposited on the contact layer up to the boundary where dry etching occurs in the dry etching step of fig5 g . a slight undercut is formed in the contact layer 102 . the undercut may have , for example , a depth less than the thickness of the contact layer 102 . referring to fig7 b , an sio 2 overcoat 106 is then formed over the sio 2 etching mask 104 and surrounding exposed surfaces . referring to fig8 , sio 2 growth at the gap between the sio 2 etching mask 104 and a layer 108 supporting the contact layer 102 projects beyond the mask 104 and 108 , such that a barrier spanning the gap is formed effective to protect the ingaasp contact layer 102 . referring to fig7 c , the dry etching step of fig5 g progresses downwardly through the layers , removing some of the sio 2 overcoat 106 , especially portions on horizontal surfaces . however , vertical portions of the sio 2 overcoat 106 remain and protect the ingaasp contact layer 102 whereas the lower ingaasp layer 72 is exposed to wet etching . referring to fig9 , in an alternative embodiment , a waveguide 38 having a distributed bragg reflector formed therein is embedded within a high - mesa structure that isolates the waveguide 38 in order to improve thermal tuning efficiency . in the illustrated embodiment , the waveguide 38 is formed in an upper layer 120 of a multi layer structure . an insulative layer 122 is formed between the upper layer 120 and a lower layer 124 . in some embodiments , the upper layer 120 and lower layer 124 are formed of inp whereas the insulative layer 122 includes 1 . 3q ingaasp , which has much lower thermal conductivity than inp . in the illustrated embodiment , the insulative layer 122 has a height of 0 . 8 μm and a width of 3 μm , whereas the upper and lower layers 120 , 124 have widths of 5 μm . the combined height of the layers 120 , 122 , 124 is 5 μm in the illustrated example . areas 128 one either side of the waveguide 38 are etched , such as by dry etching to expose vertical faces of the upper layer 120 and lower layer 124 . in some embodiments , only layers 120 and 122 such that the lower layer 124 does not include exposed faces parallel to the exposed vertical faces of the upper layer 120 . the insulative layer 124 may be etched to form an undercut 129 between the upper layer 120 and lower layer 124 to further decrease the thermal conductivity therebetween . a heater 130 , such as a platinum stripe heater , may be deposited on the upper layer 120 to control the temperature of the waveguide 38 . referring to fig1 a , the high - mesa structure of fig9 may be formed by first forming a 1 . 3q ingaasp layer 132 on an inp substrate 134 . a second inp layer 136 is then formed on the layer 134 . referring to fig1 b , the structure of fig1 a , is masked and etched to form parallel areas 138 a , 138 b of 1 . 3q ingaasp positioned in correspondence to the dbr reflectors of a dbr laser 12 . referring to fig1 c , an inp spacer layer 140 is then formed over the inp layer 134 and 1 . 3q ingaasp areas 138 a , 138 b . one or more dbr sections 142 , a multi - mode interface ( mmi ) 144 , and a gain section 146 may then be formed on the inp spacer layer 140 . an additional inp layer 148 may be formed over the dbr sections 142 and mmi 144 . as is apparent in fig1 c , the dbr 142 and mmi 144 are offset from one another due to the thickness of the ingaasp areas 138 a , 138 b , which may result in some coupling losses . however , the inp spacer layer 140 is preferably sufficiently thick to reduce losses to acceptable levels . referring to fig1 , in an alternative embodiment , alignment between the dbr sections 142 and the mmi 144 may be improved by creating additional areas 150 and 152 of 1 . 3q ingaasp positioned under the mmi 144 and gain section 146 , respectively . inasmuch as the area 152 under the gain section 146 is embedded within surrounding inp layer in the final product , heat is able to dissipate from the gain section not withstanding the presence of the 1 . 3q ingaasp area 152 . referring to fig1 a and 12b , in an alternative embodiment , coupling between the dbr sections 142 and the mmi 144 is improved by performing a planarizing step prior to formation of the dbr sections 142 and mmi 144 . for example , the ingaasp layer 132 and second inp layer 136 , such as are shown in figure 10a , may be selectively etched to leave areas 138 a , 138 b of the ingaasp layer 132 . a mask layer 154 may be formed over the areas 152 . alternatively the layer 154 may include portions of the second inp layer 136 that remain after selective etching . a third inp layer 156 is then selectively grown around the areas 138 a , 138 b and the upper surface of the layers is then planarized . the dbr sections 142 , mmi 144 , and gain section 146 are then formed having the dbr sections formed over the areas 138 a , 138 b . referring to fig1 , in another alternative embodiment , following the selective etching step of fig1 b that forms form parallel areas 138 a , 138 b , areas 158 of a masking material , such as sio 2 , are formed adjacent an area where the mmi 144 and gain section 146 are formed in subsequent steps . a third inp layer 160 is then grown over areas not covered by the areas 158 of masking material , including over the areas where the mmi 144 and gain section 146 are formed and over the parallel areas 138 a , 138 b of 1 . 3q ingaasp . the third inp layer 160 is then planarized and the dbr sections 142 , mmi 144 , and gain section 146 are formed . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .
| 7 |
fig1 shows in plan view a motorized vehicle 10 according to a first embodiment of the present invention , the vehicle 10 taking the form of a walk - behind motorized crawler cart . the motorized crawler cart 10 generally comprises a vehicle frame or body 11 , batteries 12 mounted on the vehicle body 11 , left and right electric motors 13 l , 13 r powered with the batteries 12 , left and right driving axles 14 l , 14 r rotatably mounted on the vehicle frame 11 and independently driven by the left and right electric motors 13 l , 13 r , respectively , left and right driving wheels 15 l , 15 r attached to an end of the left and right driving axles 14 l , 14 r , respectively , left and right crawler belts 16 l , 16 r each stretched between the driving wheel 15 l , 15 r and a driven wheel 15 ′ l , 15 ′ r and driven by the driving wheel 15 l , 15 r , and left and right brakes 17 l , 17 r for independently applying a braking force to the left and right driving wheels 15 l , 15 r , respectively . in the illustrated embodiment , the left and right brakes 17 l , 17 r are associated with the left and right electric motors 13 l , 13 r , respectively , for independently braking the motors 13 l , 13 r to vary the speeds of the left and right driving wheels 15 l , 15 r . the driven wheels 15 ′ l , 15 ′ r are rotatably mounted on opposite ends of a front axle 14 ′ rotatably mounted on the vehicle body 11 . the vehicle 10 further has a load - carrying platform 20 mounted on the vehicle body 11 , an operator control panel 21 mounted to a rear end of the load - carrying platform 20 , and left and right operation handlebars 30 l , 30 r extending from a rear portion of the operator control panel 21 obliquely upward in a rearward direction of the motorized crawler cart 10 . the handlebars 30 l , 30 r may be so arranged to extend from the vehicle body 11 or the platform 20 . the operator control panel 21 is provided with an accelerator lever 22 . the operation handlebars 30 l , 30 r have handgrips 25 l , 25 r at free ends thereof for being gripped with hands of the operator . left and right turn control levers 23 l , 23 r attached to the left and left handlebars 30 l , 30 r so as to extend along the left and right handgrips 25 l , 25 r , respectively , the turn control levers 23 l , 23 r are manually operated to control operation of the corresponding electric motors 13 l , 13 r and the brakes 17 l , 17 r in a manner as described below . the operator manipulates levers and buttons including the accelerator lever 22 on the operator control panel 21 and the turn control levers 23 l , 23 r while walking behind the vehicle 10 so as to move the vehicle forward or backward , turn the vehicle leftward or rightward , and stop 20 the vehicle . a control unit 24 is disposed inside the operator control panel 21 and controls operation of the electric motors 13 l , 13 r and the left and right brakes 17 l , 17 r based on the positions of the accelerator lever 22 and turn control levers 23 l , 23 r . the brakes 17 l , 17 r may be an electromagnetic brake , a hydraulic brake , a mechanical brake , regenerative brake and so on . the accelerator lever 22 is manually actuated to control the direction and speed of movement of the vehicle 10 . the accelerator lever 22 is normally disposed in a neutral position where the vehicle is stopped . the position of the acceleration lever 22 is monitored by an accelerator potentiometer 26 shown in fig2 a . the output from the accelerator potentiometer 26 varies linearly with the amount of angular displacement of the accelerator lever 22 , as indicated by a graph shown in fig2 . in the illustrated embodiment , the output from the accelerator potentiometer 26 is set to vary within a range from 0 to 5 . 0 volts ( v ). a maximum forward speed of the vehicle is achieved when the output from the accelerator potentiometer 26 is + 5 . 0 v . a maximum backward vehicle speed is achieved when the accelerator potentiometer output is 0 volt . the vehicle is stopped when the accelerator potentiometer output is 2 . 5 v . fig3 shows a free end portion of the operation handlebar 30 l , 30 r including the handgrip 25 l , 25 r . the turn control lever 23 l , 23 r is pivotally connected by a hinge pin 31 l , 31 r to the handlebar 30 l , 30 r so as to extend along the handgrip 25 l , 25 r . the turn control lever 23 l , 23 r is firmly connected to one end of an actuator arm 32 l , 32 r of a brake potentiometer 27 a , 27 b so that the actuator 32 l , 32 r angularly moves or turns in unison with the turn control lever 25 l , 25 r . the brake potentiometer 27 l , 27 r is designed such that the output from the brake potentiometer 27 a , 27 b varies linearly with the amount of angular displacement of the actuator arm 32 l , 32 r and turn control lever 23 l , 23 r . as shown in fig3 the turn control lever 23 l , 23 r is angularly movable between an initial zero - brake position ( first position ) p 1 indicated by the solid line and a stroke end position ( second position ) p 2 indicated by two - dot chain line through a full - brake position ( third position ) p 3 indicated by the dashed line . the turn control lever 23 l , 23 r is normally disposed in the solid - lined zero - brake position p 1 by the force of a return spring 33 l , 33 r . fig4 a shows a range of angular movement of the actuator arm 32 l , 32 r of the brake potentiometer 27 l , 27 r , which corresponds to the range of movement of the turn control lever 23 l , 23 r shown in fig3 . as shown in fig4 the actuator arm 32 l , 32 r is angularly movable between the first position ( zero - brake position ) p 1 and the second position ( stroke end position ) p 2 through the third position ( full - brake position ) p 3 . the output from the brake potentiometer 27 l , 27 r varies linearly with the position of the actuator arm 32 l , 32 r and turn control lever 23 l , 23 r , as indicated by a graph shown in fig4 b . in the illustrated embodiment , the output from the brake potentiometer 27 l , 27 r is set to vary within a range from 0 to 5 . 0 volts ( v ). when the turn control lever 23 l , 23 r is in the initial zero - brake position p 1 , the output from the brake potentiometer is nil . when the turn control lever 23 l , 23 r is in the stoke end position p 3 , the output from the brake potentiometer is 5 . 0 v . and when the turn control lever 23 l , 23 r is in the intermediate full - brake position p 2 , the output from the brake potentiometer is vm volts , where vm is greater than 0 and smaller than 5 . 0 . the output voltage vm may be 1 . 5 , 2 . 0 or 2 . 5 volts . as shown in fig4 a and 4b , when the turn control lever 23 l , 23 r ( i . e ., the actuator arm 32 l , 32 r ) moves within a range defined between the zero - brake position p 1 and the full - brake position p 3 , brake control operation is achieved . on the other hand , when the turn control lever 23 l , 23 r ( actuator arm 32 l , 32 r ) moves within a range defined between the full - brake position p 3 and the stroke end position p 2 , turn control operation is achieved . fig5 shows a control system of the motorized vehicle 10 . as shown in this figure , the accelerator potentiometer 26 and the left and right brake potentiometers 27 l , 27 r are electrically connected to the control unit 24 . also connected to the control unit 24 is a vehicle speed sensor 34 for detecting the speed of the vehicle 10 . the control unit 24 is electrically connected to the left and right brakes 17 l , 17 r via left and right brake drivers 28 l , 28 r , respectively , for controlling operation of the brakes 17 l , 17 r based on the position of the corresponding turn control levers 23 l , 23 r in a manner described below . similarly , the control unit 24 is electrically connected to the left and right electric motors 13 l , 13 r via left and right motor drivers 29 l , 29 r , respectively , for controlling operation of the motors 13 l , 13 r based on the position of the accelerator lever 22 in a manner described below . in a practical sense , the brake drivers 28 l , 28 r and the motor drivers 29 l , 29 r are formed as a part of the control unit 24 . when the left turn control lever 23 l is manipulated or otherwise pulled by the operator , the left brake potentiometer 27 l generates an output signal bklv corresponding in magnitude to the amount of angular displacement of the turn control lever 23 l . upon receipt of the output signal bklv from the brake potentiometer 27 l , the controller 24 sends a command signal to the left brake driver 28 l so that the left brake 17 l is driven to apply to the left driving wheel 15 l a brake force corresponding to the position of the left turn control lever 23 l . when the left turn control lever 23 l ( i . e ., the actuator arm 32 l of the left brake potentiometer 27 l ) is in the brake control range defined between the zero - brake position p 1 and the full - brake position p 3 ( fig4 a and 4 b ), brake control operation is achieved , in which the brake force applied from the left brake 17 l to the left driving wheel 15 l varies linearly with the amount of angular displacement of the left turn control lever 23 l . similarly , when the right turn control lever 23 r is manipulated or otherwise pulled by the operator , the right brake potentiometer 27 r generates an output signal bkrv corresponding in magnitude to the amount of angular displacement of the turn control lever 23 r . upon receipt of the output signal bkrv from the brake potentiometer 27 r , the controller 24 sends a command signal to the right brake driver 28 r so that the right brake 17 l is driven to apply to the right driving wheel 15 r a brake force corresponding to the position of the right turn control lever 23 r . when the right turn control lever 23 r ( i . e ., the actuator arm 32 r of the right brake potentiometer 27 r ) is in the brake control range defined between the zero - brake position p 1 and the full - brake position p 3 ( fig4 a and 4 b ), brake control operation is achieved , in which the brake force applied from the right brake 17 r to the right driving wheel 15 r varies linearly with the amount of angular displacement of the right turn control lever 23 r . when the accelerator lever 22 is actuated or otherwise tilted by the operator , the accelerator potentiometer 26 generates an output signal accv corresponding in magnitude to the amount of angular displacement of the accelerator lever 22 . upon receipt of the output signal accv from the accelerator potentiometer 26 , the controller 24 sends a command signal to the left and right motor drivers 29 l , 29 r so that the left and right electric motors 13 l , 13 r rotate the corresponding driving wheels 15 l , 15 r in the forward or backward direction at a speed corresponding to the position of the accelerator lever 22 . thus , the vehicle ( crawler cart ) with crawler belts 16 l , 16 r independently driven by the driving wheels 15 l , 15 r moves in the forward or backward direction at the desired speed . when the left or right turn control lever 23 l , 23 r is pulled to approach the handgrip 25 l , 25 r across the full - brake position p 2 ( fig4 a and 4 b ), turn control operation is achieved under the control of the control unit 24 so as to ensure that the vehicle makes a turn while staying at the same position ( spot turn ). the turn control operation will be described with reference to a flowchart shown in fig6 . at a first step st 01 , a judgment is made to determine as to whether or not the output signal bklv from the left brake potentiometer 27 d ( fig5 ) is greater than vm ( fig4 b ). when the result of judgment is “ yes ” ( bklv & gt ; vm ), this means that the left turn control lever 23 l is disposed in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 ( fig3 and 4 a ). the control then goes on to a step sto 2 . alternately , when the result of judgment is “ no ” ( bklv ,≦ vm ), the control moves to a step sto 7 . at the step st 02 , the output signal v from the vehicle speed sensor 34 ( fig5 ) is monitored so as to determine whether or not the vehicle speed v is not more than v 0 where v 0 represents the vehicle being at halt or moving at a slow speed which allows the vehicle to make an abrupt turn . when the result of judgment is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 04 . alternately when the judgment result is “ no ” ( v ≧ v 0 ), the control moves to a step st 03 . at the step st 03 , slowdown control is achieved in which the control unit 24 ( fig5 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . at the step st 04 , the left and right brakes 17 l , 17 r ( fig5 ) are released or de - activated to allow rotation of the left and right driving wheels 15 l , 15 r . after the step st 04 , the control goes on to a step st 05 . the step st 05 is achieved on condition that vklv & gt ; vm and v & lt ; v 0 ( that is , the left turn control lever 23 l is in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 , and the vehicle is stopped or moving at a slow speed which allow the vehicle to make an abrupt turn ). at the step st 05 , the left electric motor 13 l ( fig5 ) is rotated in the reverse direction and , at the same time , the right electric motor 13 r is rotated in the forward direction . the term “ forward direction ” is used to refer to a direction to move the vehicle forward , and the term “ reverse direction ” is used to refer to a direction to move the vehicle backward . by thus driving the left and right electric motors 13 l , 13 r simultaneously in opposite directions , the vehicle starts to make an abrupt turn in the leftward direction while staying at the same position ( spot turn ). when the vehicle has turned leftward through a desired angle ( 180 degrees , for example ), the operator releases the left turn control lever 23 l , allowing the lever 23 l to return to its initial zero - brake position p 1 ( fig3 and 4 b ). this causes the output bklv from the left brake potentiometer 27 l to go down to or below vm ( bklv ≦ vm ). this condition is detected at a step st 06 whereupon the control comes to an end and operation of the vehicle returns to a regular operation mode . at the step st 07 , which follows the “ no ” state at the preceding step st 01 , a judgment is made to determine as to whether or not the output signal bkrv from the right brake potentiometer 27 r ( fig5 ) is greater than vm ( fig4 b ). when the result of judgment is “ yes ” ( bkrv & gt ; vm ), the control advances to a step st 08 . alternately , when the judgment result is “ no ” ( bkrv ≦ vm ), this means that either lever 23 l , 23 r ( actuator arm 32 l , 32 r of the brake potentiometer 27 l , 27 r ) is not in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 . accordingly , the control is terminated . at the step st 08 , following the “ yes ” state in the preceding step st 07 , the output signal v from the vehicle speed sensor 34 ( fig5 ) is compared with v 0 so as to determine whether or not v & lt ; v 0 . when the comparison result is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 10 . alternately when the comparison result is “ no ” ( v ≧ v 0 ), the control moves to a step st 09 . at the step st 09 , slowdown control is achieved in which the control unit 24 ( fig5 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . at the step st 10 , the left and right brakes 17 l , 17 r ( fig5 ) are released or de - activated to allow rotation of the left and right driving wheels 15 l , 15 r . after the step st 10 , the control goes on to a step st 11 . the step st 11 is achieved on condition that vkrv & gt ; vm and v & lt ; v 0 ( that is , the right turn control lever 23 r is in the turn control range defined between the full - brake position p 3 and the stroke end position p 2 , and the vehicle is stopped or moving at a slow speed which allows the vehicle to make an abrupt turn ). at the step st 11 , the right electric motor 13 r ( fig5 ) is rotated in the reverse direction and , at the same time , the left electric motor 13 l is rotated in the forward direction . as a result of simultaneous driving of the left and right electric motors 13 l , 13 r in opposite directions , the vehicle starts to make an abrupt turn in the rightward direction while staying at the same position ( spot turn ). when the vehicle has turned rightward through a desired angle ( 180 degrees , for example ), the operator releases the right turn control lever 23 r , allowing the lever 23 r to return to its initial zero - brake position p 1 ( fig3 and 4 b ). this causes the output bkrv from the right brake potentiometer 27 r to go down to or below vm ( bkrv ≦ vm ). this condition is detected at a step st 12 whereupon the control is terminated and operation of the vehicle returns to the regular operation mode . the speed of the electric motors 13 l , 13 r achieved at the steps st 05 and st 11 may be either fixed at a predetermined value , or alternately variable . in the latter case , the motor speed is set to be proportional to the output accv from the accelerator potentiometer 26 ( corresponding to the position of the accelerator lever 22 ). by thus setting the motor speed , the vehicle can make a spot turn at the same speed as a preceding working operation which the vehicle has done . fig7 a to 7 c are illustrative of the manner in which the vehicle makes a spot turn in the rightward direction through an angle of 180 degrees . in these figures , the left turn control lever is not shown for the purpose of illustration . when the right turn control lever 23 r is manipulated or otherwise pulled so as to approach the handgrip 25 r across the full - brake position p 2 ( fig3 ), the left electric motor 13 l is driven to rotate in the forward direction and , at the same time , the right electric motor 13 r is driven to rotate in the reverse direction . this means that the left crawler belt 16 l is driven to run or travel in the forward direction , while the right crawler belt 16 r is driven to run or travel in the backward direction . as a result of simultaneous running of the left and right crawler belts 16 l , 16 r in the forward and backward directions , respectively , the vehicle 10 starts to turn rightward about a center g 1 common to the left and right crawler belts 16 l , 16 r , with a turning radius r 1 equal to the distance from the turning center g 1 to a front left corner of the load - carrying platform 20 , as shown in fig7 a . continuing operation of the left and right motors 13 l , 13 r will place the vehicle 10 to a position shown in fig7 b where the vehicle 10 has turned about the center g 1 in the rightward direction through an angle of 90 degrees . as the turning operation further continues , the vehicle 10 completes a 180 ° turn while staying at the same position , as shown in fig7 c . then the operator releases the right turn control lever 23 to thereby terminate the spot turn operation . a spot turn in the leftward direction can be achieved in the same manner as described above by pulling the left turn control lever 23 l until it assumes a position located within the turn control range defined between the full - brake position p 3 and the stroke end position p 2 shown in fig3 and 4b . for comparative purposes , description will be made to a normal pivot turn operation of the vehicle 10 with reference to fig5 a and 5b . when a right turn of the vehicle 10 is desired , the right turn control lever 23 r is pulled to assume the full - brake position p 3 ( fig3 and 4b ) or a position immediately before the full - brake position p 3 , whereupon by the effect of a maximum brake force applied from the right brake 17 r to the right driving wheel 15 r , the right crawler belt 16 r is stopped . in this instance , since the left crawler belt 16 l continues its running in the forward direction , the vehicle 10 starts to turn rightward about a turning center g 2 located at a longitudinal center of the right crawler belt 16 r , with a turning radius r 2 equal to the distance from the turning center g 2 to the front left corner of the platform 20 , as shown in fig8 b . as the turning operation further continues , the vehicle 10 completes a 180 ° turn about the turning center g 2 . a comparative review of fig7 c and 8b indicates that a turning area in a circle drawn with the turning radius r 1 achieved by the spot turn operation ( fig7 c ) is much smaller than that in a circle drawn with the turning radius r 2 achieved by the normal pivot turn operation ( fig8 b ). this proves that the spot turn is optimum to minimize the turning area of the vehicle 10 . when the direction of travel of the vehicle 10 is to be adjusted , the left or the right turn control lever 23 l , 23 r is lightly pulled to create a speed difference between the left and right crawler belts 16 l , 16 r due to a brake force applied from the left or right brake 17 l , 17 r to the corresponding driving wheel 15 l , 15 r . thus , the vehicle 10 starts to make a gradual turn in a desired direction . when a rapid direction change is needed , the left or right turn control lever 23 l , 23 r is pulled to an increased extent . in this instance , when the turn control lever 23 l , 23 r is in the brake full - brake position p 3 , the normal pivot turn will be achieved in the same manner as described above with reference to fig8 a and 8b . alternatively , when the turn lever 23 l , 23 r is in the turn control region defined between the full - brake position p 3 and the stroke end position p 2 , the spot turn will be achieved in the same manner as described above with reference to fig7 a to 7 c . it will readily be understood that by merely manipulating the turn control levers 23 l , 23 r in an appropriate manner , the vehicle can make a gradual turn , a normal pivot turn or a spot turn . the turn control levers 23 l , 23 r double in function as brake control levers to achieve gradual turns and a normal pivot turn , and also as spot - turn initiating levers to achieve a spot turn . this obviates the need for the provision of a separate lever used exclusively for achieving different sorts of turn . the motorized vehicle is relatively simple in construction and can easily be operated even by an un - skilled operator . fig9 shows a motorized vehicle 10 a taking the form of a walk - behind motorized crawler cart according to a second embodiment of the present invention . the vehicle 10 a is structurally and operationally the same as the vehicle 10 of the first embodiment shown in fig1 with the exception that the left and right turn control levers 23 l , 23 r serve only as brake control levers , and left and right spot turn switches 35 l , 35 r are provided separately to achieve a spot turn . due to this similarly , these parts which are identical to those shown in fig1 are designated by the same reference characters and further description thereof can , therefore , be omitted to avoid duplicate description . as shown in fig9 the left and right spot turn switches 35 l , 35 r are provided on an operator control panel 21 and electrically connected to a control unit 24 disposed inside the operator control panel 21 . the left and right turn control levers 23 l , 23 r ( hereinafter referred to as brake control levers ) are electrically connected to the control unit 24 via left and right brake potentiometers 27 l , 27 r ( fig1 a and 11 ). the potentiometers 27 l , 29 l each have an actuator arm 32 l , 32 r ( fig1 a ) directly connected to the corresponding brake control lever 23 l , 23 r . as understood from fig1 a , the brake control levers 23 l , 23 r ( i . e ., the actuator arms 32 l , 32 r of the brake potentiometers 27 l , 27 r ) are angularly movable between an initial zero - brake position ( first position ) p 1 and a full - brake position ( second position ) p 2 . the output from the brake potentiometer 27 l , 27 r varies linearly with the position of the actuator arm 32 l , 32 r ( i . e ., the position of the brake control lever 23 l , 23 r ), as indicated by a graph shown in fig1 b . in the illustrated embodiment , the output from the brake potentiometer 27 l , 27 r is set to vary within a range from 0 to 5 . 0 volts ( v ). when the brake control lever 23 l , 23 r is in the initial zero - brake position p 1 , the output from the brake potentiometer is nil . when the turn control lever 23 l , 23 r is in the full - brake position p 2 , the output from the brake potentiometer is 5 . 0 v . in terms of the output , the full - brake position p 2 in this position corresponds to the stroke end position p 2 of the first embodiment shown in fig4 b . fig1 shows a control system of the motorized vehicle 10 a . the control system structurally differs from the control system of the first embodiment shown in fig5 in that the spot turn switches 35 l , 35 r are provided separately from the brake control levers ( turn control levers ) 23 l , 23 r . due to this similarity , these parts which are identical to those shown in fig5 are designated by the same reference characters , and no further description thereof is needed . with the control system arranged as shown in fig1 , when the left brake control lever 23 l is manipulated or otherwise pulled by the operator , the left brake potentiometer 27 l generates an output signal bklv corresponding in magnitude to the amount of angular displacement of the brake control lever 23 l . upon receipt of the output signal bklv from the brake potentiometer 27 l , the controller 24 sends a command signal to the left brake driver 28 l so that the left brake 17 l is driven to apply to the left electric motor 13 l a brake force corresponding to the position of the left brake control lever 23 l . by thus braking the electric motor 13 l , the rotating speed of the left driving wheel 15 l decreases linearly with the amount of displacement of the left brake control lever 23 l . when the brake control lever 23 l is pulled so as to assume the full - brake position 22 ( fig1 a ), a maximum brake force is applied from the left brake 17 l to the left motor 13 l , thereby stopping rotation of the left motor 13 l . thus , the left driving wheel 15 l is stopped . similarly , when the right brake control lever 23 r is manipulated or otherwise pulled by the operator , the control unit 24 controls operation of the right brake 17 r via the right brake driver 28 r so that the right motor 13 r is braked with a brake force variable linearly with the output bkrv from the right brake potentiometer 27 r . when the right brake control lever 23 r is in the full - brake position p 2 ( fig1 a ), the output bkrv from the right brake potentiometer 27 r has a maximum value . this makes the right motor 13 r to stop rotation by the effect of a maximum brake force applied from the right brake 17 r . when the accelerator lever 22 is actuated or otherwise tilted by the operator , the accelerator potentiometer 26 generates an output signal accv corresponding in magnitude to the amount of angular displacement of the accelerator lever 22 . upon receipt of the output signal accv from the accelerator potentiometer 26 , the controller 24 sends a command signal to the left and right motor drivers 29 l , 29 r so that the left and right electric motors 13 l , 13 r rotate the corresponding driving wheels 15 l , 15 r in the forward or backward direction at a speed corresponding to the position of the accelerator lever 22 . thus , the vehicle ( crawler cart ) with crawler belts 16 l , 16 r independently driven by the driving wheels 15 l , 15 r moves in the forward or backward direction at the desired speed . when the left or right spot turn switch 35 l , 35 r is activated , turn control operation is achieved under the control of the control unit 24 so as to ensure that the vehicle makes a turn while staying at the same direction ( spot ). the turn control operation will be described with reference to a flowchart shown in fig1 at a first step st 01 , a judgment is made to determine as to whether or not the left spot turn switch 35 l is in the “ on ” state . when the result of judgment is “ yes ”, the control then goes on to a step st 02 . alternately , when the judgment result is “ no ”, the control moves to a step st 06 . at the step st 02 , the output signal v from the vehicle speed sensor 34 ( fig1 ) is monitored so as to determine whether or not the vehicle speed v is not more than v 0 where v 0 represents the vehicle being at halt or moving at a slow speed which allows the vehicle to make an abrupt turn . when the judgment result is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 04 . alternately when the judgment result is “ no ” ( v ≦ v 0 ), the control moves to a step st 03 . at the step st 03 , slowdown control is achieved in which the control unit 24 ( fig1 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . the step st 04 is achieved on condition that vklv & gt ; vm and v & lt ; v 0 ( that is , the left spot turn switch 35 l is in the “ on ” state , and the vehicle is stopped or moving at a slow speed which allows the vehicle to make an abrupt turn ). at the step st 04 , the left electric motor 13 l ( fig1 ) is rotated in the reverse direction and , at the same time , the right electric motor 13 r is rotated in the forward direction . by thus driving the left and right electric motors 13 l , 13 r simultaneously in opposite directions , the vehicle starts to make an abrupt turn in the leftward direction while staying at the same position ( spot turn ). when the vehicle has turned leftward through a desired angle ( 180 degrees , for example ), the operator deactivates the left spot turn switch 35 l , causing the output bklv from the left brake potentiometer 27 l to go down to or below vm ( bklv ≦ vm ). this condition is detected at a step st 05 , and upon detention of this condition , the control comes to an end and operation of the vehicle returns to a regular operation mode . at the step st 06 , which follows the “ no ” state at the preceding step st 01 , a judgment is made to determine as to whether or not the right spot turn switch 35 r is in the “ on ” state . when the result of judgment is “ yes ”, the control advances to a step st 07 . alternately , when the judgment result is “ no ”, this means that either switch 35 l , 35 r is not activated . accordingly , the control is terminated . at the step st 07 , following the “ yes ” state in the preceding step st 06 , the output signal v from the vehicle speed sensor 34 ( fig1 ) is compared with v 0 so as to determine whether or not v & lt ; v 0 . when the comparison result is “ yes ” ( v & lt ; v 0 ), the control advances to a step st 09 . alternately when the comparison result is “ no ” ( v ≧ v 0 ), the control moves to a step st 08 . at the step st 05 , slowdown control is achieved in which the control unit 24 ( fig1 ) controls the electric motors 13 l , 13 r via the motor drivers 29 l , 29 r so as to slow down the rotational speed of the driving wheels 15 l , 15 r . this operation continues until the vehicle speed v is below v 0 . the step st 09 is achieved on condition that vkrv & gt ; vm and v & lt ; v 0 ( that is , the right spot turn switch 35 r is in the “ on ” state , and the vehicle is stopped or moving at a slow speed which allows the vehicle to make an abrupt turn ). at the step st 09 , the right electric motor 13 r ( fig1 ) is rotated in the reverse direction and , at the same time , the left electric motor 13 l is rotated in the forward direction . as a result of simultaneous driving of the left and right electric motors 13 l , 13 r in opposite directions , the vehicle starts to make an abrupt turn in the rightward direction while staying at the same position ( spot turn ). when the vehicle has turned rightward through a desired angle ( 180 degrees , for example ), the operator deactivates the right spot turn switch 35 r , causing the output bkrv from the right brake potentiometer 27 r to go down to or below vm ( bkrv ≦ vm ). this condition is detected at a step st 010 , and upon detention of this condition , the control is terminated operation of the vehicle returns to a regular operation mode . the speed of the electric motors 13 l , 13 r achieved at the steps st 04 and st 09 may be either fixed at a predetermined value , or alternately variable . in the latter case , the motor speed is set to be proportional to the output accv from the accelerator potentiometer 26 ( fig1 ) by thus setting the motor speed , the vehicle can make a spot turn at the same speed as a preceding working operation which the vehicle has done . fig1 a to 13 c are illustrative of the manner in which the vehicle 10 a makes a spot turn in the rightward direction through an angle of 180 degrees . in these figures , the brake control levers are not shown for the purpose of illustration . when the right spot turn switch 35 r is activated , the left electric motor 13 l is driven to rotate in the forward direction and , at the same time , the right electric motor 13 r is driven to rotate in the reverse direction . this means that the left crawler belt 16 l is driven to run or travel in the forward direction , while the right crawler belt 16 r is driven to run or travel in the backward direction . as a result of simultaneous running of the left and right crawler belts 16 l , 16 r in the forward and backward directions , respectively , the vehicle 10 a starts to turn rightward about a center g common to the left and right crawler belts 16 l , 16 r , with a turning radius r equal to the distance from the turning center g to a front left corner of the load - carrying platform 20 , as shown in fig1 a . continuing operation of the left and right motors 13 l , 13 r will place the vehicle 10 a to a position shown in fig1 b where the vehicle 10 has turned about the turning center g in the rightward direction through an angle of 90 degrees . as the turning operation further continues , the vehicle 10 a completes a 180 ° turn while staying at the same position , as shown in fig1 c . then the operator deactivates the right spot turn switch 35 r to thereby terminate the spot turn operation . a spot turn in the leftward direction can be achieved in the same manner as described above by activating the left spot turn switch 35 l . the spot turn switches 35 l , 35 r may be comprised of a push button switch , a self - hold push — push switch , a self - hold toggle switch , or a self - hold dial switch . though not shown , these switches 35 l , 35 r may be mounted to the left and right handlebars 30 l , 30 r adjacent to the handgrips 25 , 25 r . fig1 and 15 show a walk - behind self - propelled crawler snowplow 40 embodying the present invention . the snowplow 40 generally comprises a propelling frame 42 carrying thereon left and right crawler belts 41 l , a vehicle frame 45 carrying thereon a snowplow mechanism 43 and an engine ( prime motor ) 44 for driving the snowplow mechanism 43 , a frame lift mechanism 46 operable to lift a front end portion of the vehicle frame 45 up and down relative to the propelling frame 42 , and a pair of left and right operation handlebars 47 l and 47 r extending from a rear portion of the propelling frame 42 obliquely upward in a rearward direction of the snowplow 40 . the propelling frame 42 and the vehicle frame 45 jointly form a vehicle body 49 . the left and right crawler belts 41 l , 41 r are driven by left and right electric motors 71 l , 71 r , respectively . the crawler belts 41 l , 41 r are each trained around a driving wheel 72 l , 72 r and an idler wheel 73 l , 73 r . the driving wheel 72 l , 72 r is disposed on a rear side of the crawler belt 41 l , 41 r , and the idler wheel 73 l , 73 r is disposed on a front side of the crawler belt 41 l , 41 r . the snowplow mechanism 43 has an auger 43 a , a blower 43 b and a discharge duct 43 c that are mounted to a front portion of the vehicle frame 45 . in operation , the auger 43 a rotates to cut snow away from a road , for example , and feed the cut mass of snow to the blower 43 b which blows out the snow through the discharge duct 43 c to a position far distant from the snowplow 40 . the operation handlebars 47 l , 47 r are adapted to be gripped by a human operator ( not shown ) walking behind the snowplow 40 in order to manwuver the snowplow 40 . an operator control panel 51 , a control unit 52 and batteries 53 are arranged in a verticla space defined between the handlebars 47 l , 47 r and they are mounted to the handlebars 47 l , 47 r in the order named when viewed from the top to the bottom of fig1 . the operation handlebars 47 l , 47 r each have a handgrip 48 l , 48 r at the distal end ( free end ) thereof . the left handlebar 47 l has a parking brake lever 54 disposed in close proximity to the handgrip 48 l . the parking brake lever 54 is of the deadman lever type and is adapted to be gripped by the operator together with the left handgrip 48 l . when gripped , the parking brake lever 54 turns about a pivot pin 54 a in a direction toward the handgrip 48 l . with this movement of the parking brake lever 54 , a brake switch 55 ( fig1 ) is turned on , thereby releasing a brake on the driving wheels 72 l , 72 r . the left and right handlebars 14 l , 47 r further have turn control levers 56 l , 56 r associated with the respective handgrips 18 l , 48 r . the crawler snowplow 40 of the foregoing construction is self - propelled by the crawler belts 41 l , 41 r driven by the electric motors 71 l , 71 r and is also maneuvered by the human operator walking behind the snowplow 40 while gripping the handlebars 47 l , 47 r . in the crawler snowplow 40 , a generator driving pulley 75 is attached to an output shaft 65 of the engine 44 . the diving pulley 75 is connected by an endless belt 77 to a generator driven pulley 76 mounted to the shaft of a generator 69 . thus , rotation of the engine output shaft 65 is transmitted via the belt 77 to the generator 69 . that is , when the engine 44 is running , the generator 69 is driven via the belt drive 75 - 77 so that the batteries 53 ( fig1 ) are charged with electric current supplied from the generator 69 . a second driving pulley 67 a is coupled via an electromagnetic clutch 66 to the output shaft 65 of the engine 44 , and a second driven pulley 68 b is connected to one end of a rotating shaft 68 a . the second driving and driven pulleys 67 a , 68 b are connected by a second endless belt 67 b . the rotating shaft 68 a is connected to a central shaft of the auger 43 a via a worm gear speed reducing mechanism ( not designated ). the rotating shaft 68 a is also connected to the blower 43 b . while the engine 44 is running , the auger 43 a and blower 43 b are drivable through the second belt drive 67 a , 67 b , 68 b when the electromagnetic clutch 66 is in the engaged state . the operator control panel 51 has a lift control lever 60 a for controlling operation of the frame lift mechanism 46 ( fig1 ), a duct control lever 60 b for changing direction of the discharge duct 43 c , an accelerator lever 22 for controlling the direction and speed of travel of the snowplow 40 , and a throttle lever 64 for controlling the speed of the engine 44 . the operator control panel 51 further has a clutch switch 59 disposed adjacent to the right operation handlebar 47 r . the clutch switch 59 is a normally open contact switch and adapted to be turned on and off to achieve on - off control of the electromagnetic clutch 66 . as shown in fig1 , the left and right turn control levers 56 l , 56 r each have an integral pivot pin 56 a by means of which the lever 56 l , 56 r is pivotally mounted to the corresponding handlebar 47 l , 47 r . the pivot pin 56 a serves also as a rotating shaft of a rotary type brake potentiometer 57 l , 57 r which is associated with the turn control lever 56 l , 56 r to monitor the position of the turn control lever 56 l , 56 r . the brake potentiometer 57 l , 57 r are electrically connected to the control unit 52 . left and right brakes 74 l , 74 r are associated with the left and right motors 71 l , 71 r , respectively , for independently applying a brake force to the corresponding motors 71 l , 71 r . the left and right brakes 74 l , 74 r are driven by left and right brake drivers 58 l , 58 r under the control of the control unit 52 based on the amount of angular displacement of the turn control levers 56 l , 56 r detected by the brake potentiometers 57 l , 57 r . the accelerator lever 22 is electrically connected to the control unit 52 via an accelerator potentiometer 26 . the left and right motors 71 l , 71 r are driven by left and right motor drivers 29 l , 29 r under the control of the control unit 52 based on the amount of angular displacement of the accelerator lever 22 detected by the accelerator potentiometer 26 . the operation of the accelerator lever 22 and turn control levers 56 l , 56 r are identical to the operation of those 22 , 23 l , 23 r described above with reference to the first embodiment shown in fig1 - 8 , and further description thereof can be omitted . it will be appreciated from the foregoing description that by virtue of the left and right turn control levers mounted to the left and right handlebars so as to extend along the left and right handgrips , the operator can manipulate the turn control levers while keeping a grip on the handgrips . this enables the operator to steer the motorized vehicle stably and reliably in a desired direction . furthermore , the turn control levers can be easily manipulated with operator &# 39 ; s fingers of the operator . this will lessen the load on the operator . the present disclosure relates to the subject matter of japanese patent applications nos . 2000 - 331554 , 2000 - 331554 and 2001 - 134689 , filed oct . 30 , 2000 , oct . 30 , 2000 and may 1 , 2001 , respectively , the disclosures of which are expressly incorporated herein by reference in their entirety .
| 8 |
fig1 illustrates an anchor section 10 of the upper half of a wet connect having the upper connector portion 12 at its upper end . the lower half of the wet connect assembly containing the other connector mate is not shown . an upper string 14 extends into a sub 16 that defines an internal recess 18 with an outlet 20 . a hydraulic line 22 extends from outlet 20 and is connected to in the preferred embodiment to a connection 24 that actuates a lock between the upper portion of the wet connect 12 and the lower portion of the wet connect after they are pushed together and weight is set down on the upper string 14 . fig2 shows how hydraulic pressure is generated locally to lock the wet connect in fig1 in a way other than the prior design that depended on a control line run to connection 24 from the surface . top sub 28 is secured at thread 30 to the upper string 14 , which is not shown in this fig . in this embodiment , the bottom sub 16 and top sub 28 are configured to create a chamber 32 where preferably an incompressible fluid is stored to preferably fill the chamber 32 . outlet 20 communicates with chamber 32 and line 22 which leads to an anchor on the wet connect at a connection 24 . from that point on the operation of the anchor is the same as if the pressure source was from a control line that started at the surface . in essence , the pressure moves a piston in the anchor to actuate it when the wet connect segments are fully pushed together engaging the locking collet threads in the anchor section 10 of the upper connector segment with a matching profile in the lower connector segment in a manner known in the art . chamber 32 is sealed at seals 34 and 36 so that when the wet connect segments are together , setting down weight on top sub 28 will break the shear pin 38 to allow the top sub 28 to advance to reduce the volume of chamber 32 so that pressure builds up in it . that pressure passes through conduit 22 to set a downhole tool such as an anchor for a wet connect that needs to be locked together after being pushed together . it can also serve other purposes . for example , when a wet connect with two ends of a fiber optic cable is being made up , it is good to make sure the abutting exposed ends are free of debris so that the integrity of the optical connection is maintained . in another application of the embodiment shown in fig2 , fluid can be forced out to reach the fiber optic cable ends on the two parts of the wet connect as they come together to clean debris away from the end area of each fiber optic cable segment . this helps to insure the quality of signal transmission through the made up connection . as will be seen below , this can be accomplished with a single reservoir that not only builds pressure in line 22 that can actuate a tool but also ejects fluid through an orifice , for example , to keep the connection in a tool clean as it is being made up downhole . those skilled in the art will realize that wholly unrelated applications are envisioned such as shifting sleeves , holding safety valves open , setting anchors or operating lock mechanisms , to name but a few possible applications . the present invention allows elimination of one or more control lines from the surface . the mechanism of the present invention as shown in fig2 can be adapted for single application or multiple applications . without the optional passage 40 and an associated check valve 42 shown schematically in fig2 , an initial setting down weight will break the shear pin 38 and initiate a one time pressure buildup to operate a tool or perform another downhole function . in that version , once weight is set down the pressure is applied . in systems where some of the pressurized fluid is allowed to escape such as for a purpose of displacing debris before a downhole connection is made , the loss of fluid from the system could mean that an insufficient volume of incompressible fluid could remain to re - establish the initial pressure generated from the original settling down weight and reduction of the volume of chamber 32 . however , it is possible to have a system of being able to recharge the chamber 32 with well or other fluids for example stored in other compartments in sub 28 and a way to do this is to provide a passage 40 which can optionally have a check valve 42 that only allows fluid into chamber 32 when top sub 28 is picked up . in fig2 passage 40 is shown terminating in passage 44 formed by subs 28 and 46 . alternatively passage 40 can lead into the surrounding annulus 48 or to an enclosed compartment of clean fluid within sub 28 or in the string above it . using passage 40 the chamber 32 fills when sub 28 is picked up because such movement reduces pressure in chamber 32 to allow fluids to come in . even without a check valve 42 , pressure can still be built up after recharging chamber 32 through passage 40 by advancing passage 40 beyond seal 34 . this will create a vacuum upon re - charging until the port re - enters the chamber if the other end of the tube is plugged . the preferred alternative is the check valve 42 . alternatively , with the addition of the check valve 42 any subsequent setting down of the sub 28 will close the check valve 42 and allow chamber 32 to be pressurized . those skilled in the art will also appreciate that while a shear pin 38 is shown as holding the relative positions of subs 28 and 46 , other ways of holding them together can be used that also accommodate subsequent relative movement . clearly after the shear pin 38 is broken the sub 28 can be raised and lowered from the surface any number of times . alternatively , a j - slot mechanism of a type known in the art can be supplied to allow relative movement between sub 28 and sub 46 in a defined range any number of times . finally , it is worth mentioning that the embodiment of fig2 because it has seals 34 and 36 is isolated from wellbore hydrostatic pressure increase as the assembly is introduced into the wellbore . the embodiments in fig3 and 4 use a floating piston to balance out wellbore hydrostatic that is an issue in those embodiments due to the different sealing arrangements from fig2 , as will be explained below . in fig3 , a top sub 50 that is supported by a tubing string that is not shown , is inserted into a bottom sub 52 defining chambers 54 and 56 that are divided by floating piston 58 . floating piston 58 has outer seal 60 and inner seal 62 . chamber 54 is not sealed and is exposed to wellbore hydrostatic pressure . chamber 56 has an outlet 64 that goes to a tool to be operated or for flushing purposes as described above or for any other downhole use of pressurized fluid . seal 66 isolates chamber 56 from bore 68 in the subs 50 and 52 . those skilled in the art will appreciate that movement of floating piston 58 allows the increasing hydrostatic pressure to be transferred to chamber 56 to avoid any pressure imbalances from forming inside the tool prior to operation . a shear pin 70 prevents relative movement between subs 50 and 52 until enough set down weight is applied to sub 50 . movement of sub 50 with respect to sub 52 builds pressure in chambers 54 and 56 although some leakage occurs out of chamber 54 into the annulus 72 as sub 50 is moved down . pressure builds up in chamber 56 and is delivered though outlet 64 to perform the downhole operation with the various options again available as earlier described with regard to fig2 . fig4 is similar to fig3 except that in fig4 there is a second floating piston 74 and chamber 54 is isolated from annulus 72 while a new chamber 76 is provided that is not sealed from annulus 72 . setting down sub 50 pressurizes all three chambers 76 , 54 and 56 . discrete fluid paths are made available as between chambers 54 and 56 through separate outlets 64 and 77 . outlet 64 can be used to lock a wet connect together while outlet 77 can be used for a fluid flush of the ends of the fiber optic cable before they are pushed together , for example . it may be desirable to sequence the action of pressure buildup on the end user tools or devices affected by them . for example , in making up a downhole wet connect it is desirable to flush the fiber optic cable ends before the connection is fully pushed together . a way to address these conflicting needs is to put a rupture disc 78 in outlet 77 . that way if outlet 64 is used to flush the ends of the fiber optic cables it can be activated first before the wet connect is fully made up . then when that process completes and more pressure is developed with further movement of sub 50 , at some point , calculated to be when the wet connect halves are abutting and are ready to be locked together , the rupture disc 78 will fail to allow the built up pressure to be communicated through passage 77 to set the anchor that locks the wet connect together . it is worth noting that if a rupture disk is placed in outlet 64 there will be a trapped fluid volume between the disk and piston in the anchor . a better way to do this is to have a low - pressure disk in outlet 77 which shears at a relatively low pressure when compared to the pressure required to shear the commit piston in the anchor . this way there is no trapped fluid volume which cannot be hydrostatically balanced . yet another way to do this is to allow the relative motion between subs 50 and 52 to open a port communicating with outlet 77 first to allow the connection to be washed before it is fully mated up with additional movement then closing access to port 77 so that available pressure can act through port 64 to which access only opens up after access to port 77 is closed or nearly closed to avoid fluid lock in chambers 54 and 56 . fig5 is a variation on fig4 adding an undercut 80 at piston 74 so that seal 82 can initially be bypassed . chamber 54 can be filled with a viscous material such as optical index matching gel to keep it in place as the assembly is run into the hole . when the shear screw 70 is sheared the contents of chamber 54 will be pushed out passage 77 for , for example , cleaning the connection before it is fully made up so that the fiber optic cables can effectively transmit signals . eventually , piston 74 will contact piston 58 after which the contents of chamber 56 will be pushed out through connection 64 . since an actuating piston for the anchor or lock for the wet connect ( not shown ) is also shear pinned , the pressure has to build in chamber 56 with piston 80 against piston 58 and set down weight applied to sub 50 before the shear pin in the anchor or lock can break to actuate that tool . again , the concept being illustrated is sequential operation of two downhole operations the details of which can vary broadly . the invention encompasses this staged actuation as well as simultaneous actuation of different or even an identical downhole device . those skilled in the art will appreciate that the present invention allows the elimination of a control line from the surface and replaces its operation with a pressure generation system that is localized and preferably initiated with string manipulation . designs are presented that allow for single operation for a specific task or the ability to cycle as many times as needed to accomplish the same or different tasks . the reservoirs can be isolated from wellbore hydrostatic or compensated to neutralize its effects . a single or multiple reservoirs can be actuated either at once or in sequential order to meet the well conditions and the desired order of operations downhole . the chambers can be pre - filled for a single time fluid displacement or they can have the capability of being recharged using a passage that passes a seal or a passage with a check valve . recharge fluid can come from the tubing , the annulus or a storage chamber for fluid provided in the string . splines or other rotational locking features can be provided to allow for torque transmission through the subs independent of their ability to move longitudinally relative to each other to create the desired pressure to use downhole . the above description is illustrative of the preferred embodiment and many modifications may be made by those skilled in the art without departing from the invention whose scope is to be determined from the literal and equivalent scope of the claims below .
| 4 |
fig1 is a simplified schematic representation of a spectroscopic apparatus 100 constructed in accordance with the invention . as shown in this figure , a first light beam 110 and 112 are propagated to an optical circuit 115 . the light beams are propagated to respective mirrors 120 and 122 whereupon the beams are reflected to a concave reflector 125 . prior to reaching mirrors 120 and 122 , the light beams are split by respective ones of beam splitters 126 and 128 and respective portions of the light beams are redirected to respective mirrors 130 and 132 . upon being reflected by mirrors 130 and 132 , the light beams are focused by a lens 135 onto a crystal 140 , and then focused again by a further lens 142 . the refocused light beam constitutes a reference beam that is propagated in this embodiment toward a mirror 145 and onto concave reflector 125 . concave reflector 125 focuses first beam 110 , second beam 112 , and reference beam 150 onto a sample 155 . the combined beams are reflected from the sample onto a further concave reflector 160 and into a monochromator 165 via a further mirror 167 and a further lens 169 . monochromator 165 issues an optical signal ( not specifically designated ) that is viewed , in this specific illustrative embodiment of the invention , by charge coupled device ( ccd ) camera 170 . as is known , a monochromator is an optical device that transmits a mechanically selectable narrow band of wavelengths of light from a wider range of wavelengths available at the input . fig1 shows a further arrangement 200 for generating a reference beam . reference beam generating arrangement 200 is particularly advantageous as a retrofit for existing spectroscopic equipment . in the embodiment of reference beam generating arrangement 200 , first and second light beams 110 and 112 are propagated to reference beam generating arrangement 200 . first beam 110 is reflected as shown by mirrors 210 and 212 and propagated through a beam splitter 215 . the portion of first beam 110 that propagates through beam splitter 215 is reflected by a further mirror 216 . second light beam 112 is propagated through a beam splitter 220 , which also reflects a portion of first light beam 110 . the 3 second light beam and the portion of first light beam 110 that was split at beam splitter 215 are propagated to a concave reflector 222 and to a crystal 223 . crystal 223 issues the reference beam ( 225 ), which is reflected , in this specific illustrative embodiment of the invention , by reflector 227 and mirrors 229 and 230 . the broad - band vibrational sum frequency generation ( sfg ) spectroscopy arrangement described herein is based on a high power amplified femtosecond ti - sapphire laser system ( spectra physics spitfire sub - 50 fs hp ) ( not shown ). fifty percent ( 50 %) of the 2 mj fundamental output pulse ( 800 nm , fwhm 35 fs ) is used to pump an optical parametric amplifier ( opa ) followed by the signal - idler re - timing with a manual delay stage and difference frequency mixing in a 0 . 5 mm thick aggas 2 crystal producing 4 - 5 μj ir pulses centered at 2900 cm − 1 . the broad - band sfg scheme is employed that uses spectrally broad ( fwhm ˜ 250 cm − 1 ) ir and narrow - band visible pulses obtained using a high - power deposited etalon ( tecoptics ), fwhm 15 cm − 1 . the laser power at the sample 155 is 2 - 3 μj / pulse for ir and up to 10 - 15 μj / pulse for the visible at 1 khz repetition rate . fig2 ( a ) is a simplified schematic representation of a spectroscopic apparatus constructed in accordance with the invention that is useful to describe the operation of the invention , and fig2 ( b ) is a sequence of graphical representations that illustrate the process of data analysis beginning with graphical representation ( a ), which corresponds to a raw interferogram obtained after subtraction of lo , to graphical representation ( b ), which is a time domain spectrum derived by inverse fourier transformation ( ifft ). elements of structure that have previously been discussed are similarly designated . graphical representation ( c ) of fig2 ( b ) illustrates the real part of the result of a fft performed on the time domain spectrum of graphical representation ( b ). the absolute value of the real part shown in the frequency domain representation ( c ) is determined and shown in graphical representation ( d ) of fig2 ( b ). in this embodiment , the local oscillator ( lo ) beam is generated by focusing ˜ 1 % of the visible and ˜ 5 % of the ir beams into a 1 mm thick knbo 3 crystal . the intensity of lo beam is adjusted using a variable density filter ( not shown ). the desired delay between lo and the signal pulse is controlled by a manual delay stage ( not shown in this figure ). the lo beam is recombined with the visible beam , ( parallel with a slight off - set ), using a dichroic beam splitter . ir , visible , and lo beams are focused onto the sample surface in this specific illustrative embodiment of the invention by a 3 ″ diameter , 45 cm - focal length on - axis parabolic mirror 125 to a ˜ 230 μm diameter spot at the sample position . before this mirror , the beams are parallel and vertically offset , such that they spatially overlap at the sample surface with the incidence angles ˜ 65 ° and ˜ 70 ° from the surface normal of the sample . the lo beam is aligned such that the reflected portion of the beam is collinear with the sfg signal produced at the sample surface . the sfg signal is collimated after the sample with a lens 169 , focused onto an entrance slit ( not specifically designated ) of monochromator 165 , then frequency - dispersed through the 300 mm monochromator ( acton spectra - pro 300i ), and detected using a liquid nitrogen cooled ccd 170 ( princeton instruments spec - 10 : 100b , 100 × 1340 pixels ). ssp polarizations were used for the 1 - octanol experiments . the spectra were recorded at the full resolution of ccd 170 , i . e ., 1340 × 100 pixels , without binning , i . e ., without combining the information in adjacent pixels . a set of spectra was recorded for each sample . the lo spectrum ( ir beam blocked ) was measured , then hd signal was measured with visible , ir and lo opened . additionally , the homodyne spectra ( lo beam blocked ) ( and the corresponding background spectra with lo and ir are closed ) was measured for samples with 1 - octanol coverage concentrations 8 % and above . the heterodyne spectrum ( interference fringes ) is then obtained by subtracting the measured lo signal from the measured hd signal . the homodyne spectrum is similarly obtained by subtracting the measured background spectrum from the measured homodyne spectrum . this procedure guarantees that the scattered light from the strong visible pump beam as well as ccd dark noise are subtracted for homodyne and heterodyne spectra . at 100 % 1 - octanol monolayer coverage ( 1 . 0 mm bulk concentration ), the total hd - sfg detected signal was ˜ 22000 counts per pixel , the fringe depth of the spectral interferograms around the ch 3 symmetric stretch peak was 2400 counts , while the homodyne sfg signal level was ˜ 200 counts per pixel for 100 second exposure time ( no binning ). the heterodyne setup herein described was covered with a box ( not shown ) to eliminate the effects of air currents . the box cover increased the phase stability of the present arrangement to λ / 4 over 10 minutes . in this manner , the fringe depth in the spectral interferograms was not affected by the phase drifts over 100 second long ccd collection times . the broad - band vibrational sum frequency generation ( sfg ) spectroscopy set - up test system , that has octanol / deuterated octanol mixture and an air / water interface , is based on a high power amplified femtosecond ti - sapphire laser system ( spectra physics spitfire sub - 50 fs hp ). one half of the 2 mj fundamental output pulse ( 800 nm , fwhm 35 fs ) is used to pump an optical parametric amplifier ( opa ) followed by the signal - idler re - timing with a manual delay stage and difference frequency mixing in a 0 . 5 mm thick aggas 2 crystal producing 4 - 5 μj ir pulses centered at 2900 cm − 1 , temporal fwhm ˜ 80 fs . the broad - band sfg scheme is employed that uses spectrally broad ( fwhm ˜ 250 cm − 1 ) ir and narrow - band visible pulses ( fwhm 15 cm − 1 ) obtained using a high - power deposited etalon ( tecoptics ). the laser power at the sample is 2 - 3 μj / pulse for ir and up to 10 − 15 μj / pulse for the visible at 1 khz repetition rate . the sfg signal is collimated after the sample with a lens , focused onto a monochromator entrance slit , then frequency - dispersed through the 300 mm monochromator ( acton spectra - pro 300i ), and detected using a liquid nitrogen cooled ccd ( princeton instruments spec - 10 : 100b , 100 × 1340 pixels ). ssp polarizations for sfg , visible , and ir beams , respectively , were used in all 1 - octanol measurements . fig3 ( a ) is a schematic representation of the broad - band heterodyne - detected hd - sfg experiment ; fig3 ( b ) is a representation of spectral interferograms ( si , real part shown ) for samples of varying surface coverage of 1 - octanol , from 100 % to 3 % monolayer ; and fig3 ( c ) is an expanded graphical representation of the signal from the 3 % monolayer sample . the reference lo beam in the hd - sfg set - up of fig3 ( a ), 3 ( b ), and 3 ( c ) ( hereinafter fig3 ) is generated by sum - frequency mixing of small portions of the visible and ir beams (˜ 1 % of the visible and ˜ 5 % of the ir ) in a 1 mm thick knbo 3 crystal . the phase matching in the crystal has limited the spectral bandwidth of the lo to ˜ 120 cm − 1 and its time width to ˜ 250 fs . intensity of lo beam is adjusted using a variable density filter to optimize detection of the cross - term . the lo beam is recombined with the visible beam using a dichroic beam splitter . ir , visible , and lo beams are spatially overlapped at the sample surface by a 3 ″ diameter , 45 cm - focal length on - axis parabolic mirror focusing all beams into a ˜ 230 μm diameter spot at the sample with 65 ° incidence angle from surface normal . the lo beam is aligned such that after reflection off the sample surface it propagates collinearly with the sfg signal generated at the sample surface ( fig3 ). in this arrangement , e sfg ∝ x ( 2 ) ∝ n , and i sfg ∝| x ( 2 ) | 2 ∝ n 2 . heterodyne detection is performed using spectral interferometry with a time - delayed (˜ 2 . 5 ps , introduced by a manual delay stage ) lo pulse , resulting in a characteristic fringe pattern ∝ e iωr in the frequency domain referred to as spectral interferogram ( fig3 ). this allows one to utilize the broad - band sfg scheme and take advantage of multiplex detection with a ccd chip . also , the fringe pattern is used to compensate for the phase drift between acquisitions using the phasing procedure as described below . the spectral interferograms were recorded at the full resolution of the ccd ( i . e ., 1340 pixels ) without binning . the overall hd signal level was adjusted by tuning the intensity of the lo beam , and is limited only by the dynamic range of the ccd detector ( 65535 counts / pixel ). at 100 % 1 - octanol monolayer coverage ( 1 . 0 mm bulk concentration ), the total hd - sfg detected signal ( 2 ) was typically ˜ 22 , 000 counts per pixel , the fringe depth of the spectral interferograms ( 3 ) around the ch 3 symmetric stretch peak was 2 , 400 counts , while the homodyne sfg signal level ( 1 ) was ˜ 200 counts per pixel for 100 second exposure time . the heterodyne setup is covered to eliminate the air currents , allowing the phase stability of λ / 4 over 10 minutes . thus the depth of the spectral fringes was not affected by the phase drifts over 100 second long ccd collection times used in all measurements . it is demonstrated herein that the hd - sfg technique on a model system , mixed monolayers of 1 - octanol / deuterated 1 - octanol at the air / water interface . the samples were prepared using double - distilled water . 1 - octanol ( c 8 11 18 o , fisher scientific , & gt ; 99 %) and deuterated 1 - octanol ( c 8 13 17 oh , cambridge isotope laboratories , 98 %) were used as received . the overall concentration was kept constant at 1 . 0 mm , corresponding to a saturated gibbs monolayer at the air / water interface , according to literature reports . a period often minutes was allowed for the monolayer to form at the surface before the sfg measurements . evaporation , and the associated lowering of the sample surface , was controlled by covering the sample dish with a plastic film with two holes for beam access . the ch 3 stretch modes in the 2800 - 3000 cm − 1 region were monitored while varying the mole fraction of 1 - octanol , thus changing the surface coverage n of the ch 3 groups without the potential complications of changing molecular orientation and intermolecular packing of the alkane chains . for comparison , both heterodyne - detected and homodyne - detected sfg spectra obtained are presented using the same signal acquisition time on the ccd chip , 100 s . the two main transitions observed , marked by cyan shadows , are ch 3 symmetric stretch (˜ 2880 cm − 1 ) and fermi resonance ( 2940 cm − 1 ), in agreement with the previously reported measurements for ssp polarization . the broad - band hd - sfg spectral interferograms are obtained by recording the total heterodyne - detected intensity spectrum i . d .- sfg , eq . ( 2 ), then subtracting the lo intensity spectrum ( second term in eq . ( 2 )) to reveal the cross - term , eq . ( 3 ). the lo intensity spectrum is recorded on the same ccd detector , in exactly the same experimental configuration , by simply blocking the ir beam such that the sfg signal from sample is not generated . after subtraction of the lo , an inverse fourier transform into the time - domain is performed to filter out the remaining homodyne contribution centered at τ = 0 delay ( center of lo pulse ), since the desired cross - term , eq . ( 3 ), is centered around τ = 2 . 5 ps delay between the lo and sfg pulses . fourier transforming back into the frequency domain yields the “ cleaned - up ” spectral interferogram ( si ) shown in fig3 ( b ) ( real part shown ), with the lo spectral envelope completely removed . clean spectral interferograms can be recorded using the 100 s ccd acquisition time for samples ranging from 100 % 1 - octanol in the monolayer to a fully deuterated monolayer , the signal of which is referred to below as the background signal of the neat interface . fig3 ( c ) shows a blow - up of the spectral interferogram for the 3 % 1 - octanol monolayer sample , demonstrating the signal - to - noise level achievable in this technique . in fact , interferograms for samples below 1 % octanol monolayer can be recorded with similar s / n , but the analysis of the spectra is restricted due to the purity of the d - octanol . fig4 is a graphical representation of the comparison of the power spectra of 1 - octanol ch - stretch vibrations obtained from the heterodyne - detected spectral interferograms ( solid lines ) with the conventional ( homodyne - detected ) sfg spectra ( dotted lines ) for surface coverage ( a ) 100 %, ( b ) 80 %, ( c ) 60 %, and ( d ) 40 % monolayer . absolute value squared of the obtained interferograms , corrected for the spectrum of the local oscillator , accurately reproduce the homodyne - detected sfg spectra as shown in fig4 , thereby validating the hd - sfg measurements . however , the comparison can be made only for samples close to monolayer coverage . below ˜ 40 % monolayer , the homodyne - detected sfg does not produce useful spectra for the chosen 100 s acquisition time . the two main reasons for this are ( 1 ) that the resonant part of the homodyne sfg signal decreases quadratically with the surface coverage n ( see , eq . ( 1 )), quickly reducing the resonant octanol signal below the noise level , and ( 2 ) that at low coverage , the background part of the response ( nonresonant electronic contribution as well as impurities and the broad red - tail of the water oh - stretch band evident in fig6 ( a ) interferes with and masks the weak resonant ch - stretch transitions . heterodyne detection overcomes both of these problems . first , the use of the strong lo beam amplifies the overall signal , improving the signal - to - noise ratio . second , the knowledge of the absolute phase of the hd - sfg signal with respect to the background signal from neat interface ( 100 % deuterated 1 - octanol monolayer ) enables correct subtraction of the background contribution to reveal the resonant 1 - octanol signal . the value of the absolute phase cannot be preserved from experiment to experiment , due to long - term drift and especially when samples are changed . in order to lock the phases in all measurements , the following phasing procedure has been developed . neat interfaces ( in the present case , 100 % deuterated 1 - octanol monolayer at the air / water interface ) are often characterized by predominantly non - resonant response leading to a broad sfg signal spectrum . the region around 3100 cm − 1 is outside the ch 3 vibrational transitions of interest . the neat interface sfg background is nonzero in this region ( fig3 ( b )), resulting possibly from the broad red - tail of the water oh - stretch band . sfg signal in this region does not depend on the 1 - octanol surface coverage ranging from 0 % to 100 %. fig5 ( a ) shows magnified hd - sfg spectral interferograms at approximately 3100 cm − 1 for the neat interface ( n = 0 %) and for a sample with n = 10 % 1 - octanol interface coverage . the shapes of the spectral interferograms for both concentrations are similar in this spectral region , but the phases differ . by adding a phase φ adj to the complex - valued hd - sfg spectral interferogram for the 10 % sample ( i . e ., multiplying it by a e iφ adj factor ), one can achieve nearly perfect overlap in this spectral region ( fig5 ( b )), thus locking the phase of the 10 % sample to the 0 % ( neat interface ) sample ( background ). the accuracy of the obtained phase φ adj is better than ± 5 degrees . using this phasing procedure , one ensures that the absolute phases for all measured samples are locked to the spectral phase of the 0 % reference sample ( 100 % deuterated 1 - octanol ). the ability to retrieve absolute phase for each measured spectrum ( with respect to a chosen “ standard ” zero - phase signal , e . g ., neat interface background ) using simple phasing of the spectral interferograms is a consequence of the phase being locked across the spectrum of the lo pulse , a unique advantage of the broad - band spectral interferometry approach not available , e . g ., in the scanning phase - sensitive sfg detection . after the phasing procedure , the background signal of the neat interface ( 100 % deuterated 1 - octanol ) can be subtracted to reveal the spectral signatures of the analyte ( 1 - octanol ) which are otherwise masked , especially at low concentrations . the extracted background - free hd - sfg power spectra shown in fig6 ( b ) demonstrate that this technique enables vibrational spectroscopy of surfaces at coverage as low as a few % monolayer , greatly exceeding the sensitivity limits of conventional sfg spectroscopy ( fig6 ( a )). as an example , the hd - sfg spectrum for the 6 % monolayer sample ( fig6 ( c )) exhibits the same two main transitions , i . e ., the ch 3 symmetric stretch and fermi resonance , as in the higher concentration samples . the increased noise level on the wings of the spectrum results from the limited bandwidth of the lo pulse in the current set - up ( only ˜ 120 cm − 1 due to phase - matching in the knbo 3 crystal ). the time - domain representation ( fig7 ) naturally separates out the mostly nonresonant ( i . e ., instantaneous ) background signal from the resonant part of the response — the free induction decay ( fid ) which shows the characteristic vibrational quantum beats . the neat interface background signal ( fig7 , bottom trace ) was measured by performing hd - sfg on a fully deuterated monolayer . the clearly discernible non - instantaneous component in the time - dependent signal from the neat interface sample demonstrates our ability to detect impurities in the deuterated 1 - octanol ( 2 % or below , according to the manufacturer ). it is to be noted that the knowledge of the absolute phase allows one to subtract this neat interface signal , i . e ., essentially get rid of the impurities contaminating the 1 - octanol spectrum at low concentrations . for intermediate concentrations ( 8 - 25 %), the fid curves show destructive interference between the background fed signal peaked around t = 0 and the resonant octanol signal , resulting in an apparent “ dip ” in the overall hd . the linear scaling of the resonant ( background - free ) ch - stretch hd - sfg signal with the octanol mole fraction is demonstrated in fig8 which shows peak amplitude of the ch 3 symmetric stretch resonance . this allows extension of the hd - sfg spectroscopy to samples with surface coverage significantly below a single monolayer . in addition , the signal amplitude is much larger for the hd - sfg , which alleviates the problem of the electronic read - out noise . on the contrary , the homodyne - detected sfg intensity of the same transition follows the expected quadratic scaling . note that homodyne sfg signal is zero within the s / n for surface coverages 25 % monolayer and below . the signal - to - noise ratio in the spectral interferograms and the extracted spectra ( fig3 and 6 ) for lower coverage samples permits the suggestion that hd - sfg will enable the obtaining of vibrational spectra for samples at or below 1 % monolayer coverage . in fact , several spectral interferograms were recorded for the 1 - octanol mole fraction of 1 %, 0 . 5 % and 0 . 1 % ( not shown ), with s / n similar to that in fig3 . however , the isotopic purity of the deuterated 1 - octanol provided by the supplier ( cambridge isotope laboratories ) is 98 %. thus , for the chosen model system , testing of the hd - sfg technique at low surface coverages is limited by the chemical purity of the samples rather than by the sensitivity of the spectroscopic detection . heterodyne detection via broad - band spectral interferometry has herein been implemented in accordance with the invention , yielding several significant advantages . first , the reference beam does not have to be scanned across the sfg signal and the whole spectral phase and amplitude can be detected from one ccd reading . this eliminates phase fluctuations that result from wavelength tuning . second , the fft procedures used herein enable the implementation of significant noise filtering . third , the instrument of the present invention is possessed of a phase stability that is long enough to retrieve one sfg spectrum without phase drift - off , thereby enabling retrieval of the sfg spectrum . in addition , the inventive phasing procedure allows the lo phase between different measurements to be locked , thereby solving the problem of phase stability . the recovered spectral phase contains information on absolute molecular orientations and enables recovery of the temporal sfg signal profile , which contains information on molecular dynamics at interfaces . the interface sfg signal results from the second order nonlinear process of two electric fields interacting with the surface / interface . the spectral component of the sfg signal electric field at frequency ω is given by : e sfg ( ω )∝ ∫∫ x ( 2 ) ( ω = ω ir + ω vis , ω ir , ω vis ) e ir ( ω ir ) e vis ( ω vis ) dωv is dω ir , ( a ) here e vis and e ir are spectral components of the visible and ir laser beams at frequencies ω vis and ω ir respectively . x ( 2 ) is the second order nonlinear susceptibility tensor proportional to the monolayer coverage n and to the averaged molecular polarizability tensor β ( 2 ) . sfg is implemented with spectrally narrow nonresonant visible laser pulse and spectrally broad ir pulse resonant with the adsorbant so that equation ( a ) becomes e sfg ( ω )∝ n · e vis ·∫ β ( 2 ) ( ω = ω ir + ω vis , ω ir , ω vis ) . e ir ( ω ir ) dω ir = n · e vis · β ( 2 ) ( c ) i sfg homo ( ω )=| ê sfg ( ω )| 2 ∝ n 2 ·| { tilde over ( β )} |’ the integral in equation ( c ), denoted as β ( 2 ) , contains the spectral overlap of the ir laser pulse with the average molecular polarizability β ( 2 ) . depends quadratically on the monolayer coverage n . this quadratic dependence strongly limits the sensitivity of the homodyne detection technique at low adsorbant coverage . for instance , if the coverage is reduced by a factor of 10 , the signal to noise ratio would reduce by 100 , and the experimental exposure would time need to be increased by 10 4 to keep the same signal - to - noise ratio . in the heterodyne detection two collinear beams , a lo beam is made to propagate collinearly with the sfg signal generated at the sample surface , such that they interfere at the detector . the heterodyne detected signal intensity is : s sfg hd ( ω )∝ | ê sfg ( ω )+ ê lo ( ω )| 2 =| ê sfg ( ω )| 2 +| ê lo ( ω )| 2 + s sfg hd - cross • term ( ω ), ( e ) s sfg hd - cross • term ( ω )= 2 | ê sfg ( ω ) ê lo ( ω )| cos ( φ sfg ( ω )− φ lo ( ω ))∝ n · { tilde over ( β )} ( 2 ) | ( f ) contains the product of the two fields and depends on the signal phase . in heterodyne detection the cross term is extracted by separately measuring the heterodyne intensity ( e ) and the intensity of the local oscillator ( second term in ( e )), then subtracting one from the other . note that the homodyne intensity of the sfg signal is small compared to that of the lo . the cross - term ( f ) is relatively increased by using intense lo beam and its phase can be measured . the cross term scales linearly with the surface coverage n . thus if the coverage drops by a factor of 10 , as in previous example , its value also drops 10 times and the exposure would have to be increased 100 times to keep the same signal to noise ratio , i . e ., 100 times shorter than in the homodyne detection case . if the lo pulse is temporarily delayed with respect to the sfg signal pulse by a delay τ 0 , it acquires an additional phase ωτ 0 , and the cross term exhibits fast oscillations as a function of frequency , due to the φ sfg ( ω )− φ lo ( ω )− ωτ 0 phase in the cosine term , with period 2π / τ 0 — the so - called “ spectral interferogram .” by applying spectral interferometry ( si ) procedure , both the signal spectral phase and its amplitude can be recovered . moreover , the temporal profile of the signal ( fid ) can be recovered through the fourier transform . finally , most interfaces produce nonresonant sfg background signal even when the adsorbant molecule of interest is not present . this background signal e bgr interferes with the adsorbant signal and strongly limits the sensitivity of the homodyne detection . indeed , the total measured homodyne signal intensity is : | ê sfg ( ω )+ ê bgr ( ω )| 2 = ê sfg 2 ( ω )+ ê bgr 2 ( ω )+ 2 | ê sfg ( ω ) ê bgr ( ω )| cos ( φ sfg ( ω )− φ bgr ( ω )) ( g ) where e sfg and e bgr are sfg signals from the adsorbant of interest and the neat interface respectively . the phase φ sfg ( ω )− φ bgr ( ω ) is not recoverable in the homodyne experiments . at relatively low adsorbant signal levels , some of its spectral features in the measured homodyne signal may be amplified , while others suppressed due to the interference . heterodyne detection recovers the signal phase , and thus allows subtraction of the separately measured nonresonant interface signal e bgr . this enable extraction of adsorbant signals at levels well below the neat interface sfg background value . although the invention has been described in terms of specific embodiments and applications , persons skilled in the art may , in light of this teaching , generate additional embodiments without exceeding the scope or departing from the spirit of the invention described and claimed herein . accordingly , it is to be understood that the drawing and description in this disclosure are proffered to facilitate comprehension of the invention , and should not be construed to limit the scope thereof .
| 6 |
as is apparent from the following detailed disclosure , the prize delivery system of this invention is effectively usable in connection with any desired food or beverage container , holder , wrapper , instrument , or utensil , employed in the food service industry . in this regard , the present invention is equally applicable to all facets or categories of the food service industry , such as fast food outlets , restaurants , contract feeders , vending outlets , recreational outlets , and the like . in one exemplary instance , the prize delivery system of this invention can be employed in fast food outlets in connection with the sale and distribution of hamburgers , hot dogs , french fries , pancakes , eggs , popcorn , ice cream , soda , coffee , hot chocolate and the like . furthermore , products commonly distributed in the food service industry but not employed for holding food products could also incorporate the present invention , such as straws , which are distributed to consumers for drinking various beverages . in the following detailed disclosure , drinking cups , straws , a special game coupon , and food product containers are fully and completely described , as examples of the prize delivery system of the present invention . however , the scope of the present invention is not , in any way , intended to be limited to the specific embodiments , since the present invention is equally applicable to any other holders , containers , wrappers , or utensils employed in the food service industry . in fig1 - 3 , one embodiment of the prize delivery system of the present invention is depicted in the form of a food or beverage holding cup . as shown therein , cup 20 , which may be used for any beverage or food product such as yogurt , french fries , popcorn , ice cream and the like , is constructed to secretly retain prize award 21 in a manner which prevents consumers or employees of the food distributor from being able to distinguish prize bearing cup 20 from conventional non - prize bearing cups . in accordance with this invention , cup 20 is constructed to be completely indistinguishable from non - prize bearing cups , in order to enable prize bearing cup 20 to be randomly distributed with non - prize bearing cups . in this way , complete random distribution of prize award 21 to lucky consumers is assured . in this embodiment , cup 20 comprises a substantially cylindrically shaped , wall defining member 24 and a base 25 . base 25 comprises a substantially circular shaped central portion 26 and a peripherally surrounding , depending flange 27 . in addition , central portion 26 of base 25 comprises an upper surface 28 and a lower surface 29 . base 25 is securely affixed to cylindrically shaped , wall defining member 24 in the generally conventional manner . in this typical construction , the lower terminating end portion 30 of wall defining member 24 is folded about depending flange 27 of base 25 and sealingly glued thereto , thereby securely affixing base 25 to wall member 24 . in this way , an interior food or beverage retaining zone 31 is formed . in addition , upper surface 28 of base 25 is typically constructed , in a manner well known in the art , to incorporate a leak - free construction , thereby assuring the trouble - free retention of the desired food or beverage in retaining zone 31 of cup 20 , without incurring any unwanted leakage therefrom . in order to secretly retain prize award 21 in a manner which is completely undetectable by any individual , prize bearing cup 20 also incorporates a prize award holding plate 34 and a support disk 35 . both prize holding plate 34 and support disk 35 are constructed in a substantially circular shape having a diameter virtually identical to the diameter of central portion 26 of base 25 . in addition , in the preferred embodiment , prize holding plate 34 and support disk 35 are securely bonded to each other , to form a single component for purposes of manufacture , thereby enhancing the speed , efficiency , and ease of manufacturing prize award bearing container 20 of this invention . in the preferred embodiment , prize holding plate 34 incorporates a cut - out zone 36 which is dimensioned for receiving prize award 21 . in addition , the thickness of the material employed for manufacturing prize holding plate 34 is also preferably selected to be precisely equivalent to the thickness of prize award 21 when positioned for retention in cut - out zone 36 . in the preferred embodiment , prize award 21 comprises a cash award in the form of currency , preferably ranging between about $ 1 . 00 to $ 500 . 00 in face value . although any desired denomination of currency can be employed , it has been found that by providing a cash prize award , consumer excitement over the instantaneous winning of a prize is substantially heightened . with prize award 21 comprising cash awards of varying denominations , prize holding plate 34 comprises a thickness which is substantially equivalent to the thickness of the currency , when the currency is folded to a size substantially equivalent to the size of cut - out zone 36 . in this way , prize award 21 conveniently fits directly within cut - zone 36 , substantially filling zone 36 , with the resulting thickness formed by prize award 21 being virtually equivalent to the thickness of prize holding plate 34 . as a result , a smooth , convenient , uniformly shaped prize retaining package is attained for being secretly stowed in the base of cup 20 . in order to provide cost efficient automated manufacturing of prize retaining cup 20 , while also assuring that prize retaining cup 20 is completely indistinguishable from non - prize bearing cups , base 25 and support disk 36 are formed from the identical material . preferably , a large sheet of material having the desired thickness and surface coating is employed . in addition , the sheet of material is printed with the particular desired graphics or words which have been predesigned for the particular promotion . then , a plurality of circular shaped disks are cut from the sheet , with each disk incorporating the printed indicia . preferably , each substantially circular disk comprises an overall diameter which is equivalent to central portion 26 and flange 27 of base 25 . in this way , the pre - printed , pre - cut disks are employed for base 25 in the manufacture of both the prize bearing cup and non - prize bearing cups . in addition , in order to form support disk 35 in a manner which will look identical to central portion 26 of base 25 , a plurality of the cut circular disks are trimmed to remove the material which would form flange 27 . with that material removed , support disk 35 is produced , which will look visually identical to central portion 26 of base 25 . in this way , once support disk 35 has been affixed to the bottom of cup 20 , concealing the presence of prize holding plate 34 , the resulting construction provides visual identity between prize bearing cup 20 and a non - prize bearing cup . in order to further enhance the automated manufacture of prize bearing cup 20 , prize holding plates 34 are formed in a manner substantially identical to the process detailed above in reference to the pre - printed disk members . in this way , a plurality of prize holding plates 34 are formed from a substantially enlarged sheet which is formed from the desired material with the preferred thickness . during the cutting process , wherein the precisely desired dimension for prize holding plate 34 is cut from the enlarged sheet , cut - out zones 36 are also simultaneously cut . as a result , prize holding plates 34 ar formed quickly and efficiently . once prize holding plate 34 and support disk 35 have been formed , these two members are preferably glued together , forming a subassembly . once formed , the positioning and retention of prize award 21 is quickly and easily attained by merely folding the currency and positioning the folded currency in cut - out zone 36 . with the support disk 35 closing one side of cut - out zone 36 , the rapid positioning and retention of prize award 21 in cut - out zone 36 is assured . once prize award 21 has been positioned in the precisely desired manner in cut - out zone 36 of prize holding plate 34 , glue is applied to the top surface of prize holding plate 34 , and the entire subassembly is affixed to lower surface 29 of base 25 of cup 20 . once securely affixed in position , prize award 21 is secretly retained in cup 20 , in a manner which is completely undetectable from observation and comparison of prize retaining cup 20 with non - prize bearing cups . furthermore , since support disk 35 comprises the identical material and identical graphics employed on lower surface 29 of base 25 , visual identity is assured and comparison of prize retaining cup 20 with non - prize bearing cups reveals no discernible differences . in the preferred embodiment , one adjustment is made in manufacturing prize retaining cup 20 in order to further enhance the visual indistinguishable construction thereof . inasmuch as prize holding plate 34 and support disk 35 comprise a fixed overall thickness , cup 20 should be constructed to assure that this added thickness is not discoverable . as shown in fig1 distance &# 34 ; x &# 34 ; represents the substantially vertical distance between the bottom edge of flange 30 and outer visible surface of disk 35 . in nonprize bearing cups , this distance would be between the bottom edge of flange 30 and the lower surface of the cup base . in order to assure that the visual observation of distance &# 34 ; x &# 34 ; appears identical in both prize bearing cups and non - prize bearing cups , the preferred manufacturing procedure for forming prize bearing cup 20 incorporates the positioning of base 25 with the cylindrical wall defining member 24 , in the manner detailed above , at a position which is further away from the bottom edge of terminating end portion 30 than normally employed . as shown in fig1 prize retaining cup 20 is preferably constructed with the distance &# 34 ; y &# 34 ;, forming the vertical distance between lower surface 29 of base 25 and the bottom edge of terminating end portion 30 , with distance &# 34 ; y &# 34 ; being greater than the distance normally found with non - prize bearing cups . in this construction , the difference between distance &# 34 ; y &# 34 ; and distance &# 34 ; x &# 34 ; is equal to the thickness of prize holding plate 34 and support disk 35 . as a result , once prize holding plate 34 and support disk 35 have been securely affixed to base 25 of cup 20 , the distance between the bottom of support disk 35 and the bottom edge of terminating end portion 30 of cup 20 is equivalent to &# 34 ; x &# 34 ;, the precise distance normally found in non - prize bearing cups . in this way , prize bearing cups 20 are visually identical to non - prize bearing cups , and no visual clues exist which would enable someone to conclude that one of the cups retains a prize award . as a result , the precisely desired , secret , completely undetectible , retention of a prize award in cup 20 is assured . in an alternate construction , the base of each non - prize bearing cup is constructed from material having a greater thickness than base 25 of cup 20 . in this alternate embodiment , the thickness of the base of non - prize bearing cups equals the combined thickness of base 25 , holding plate 34 and disk 35 . in this way , all final dimensions of both prize bearing cups and non - prize bearing cups are identical and no discernible difference exists which would enable someone to advance detect the existence of a prize award in advance of actual opening of the cup . in the preferred embodiment , prize retaining cup 20 is seeded or intermixed with non - prize retaining cups at a convenient location , such as a manufacturing facility and then distributed in the normal channels of trade . in this way , any retail outlet desiring to benefit from the enhanced commercial sales attainable by employing the prize delivery system of the present invention would merely purchase cups , wherein prize bearing cups are randomly intermixed with non - prize bearing cups . preferably , the non - prize bearing cups , as well as the prize bearing cups , will all incorporate identical visual indicia printed on the outer surface of cylindrical wall member 24 , which promote the prize delivery system and inform the consumers of the method to use in order to access the prize award holding zone . in this way , all customers purchasing the particular food products would attain visually identical cup constructions , in which the existence of a prize delivery system would be detailed along with instructions on how to determine if a prize has been won . by employing the present invention , the excitement of winning a prize award is enhanced and shared with all of the customers in the retail outlet at the time a prize award is won . since any consumer winning a prize award would certainly exude substantial excitement , this excitement will be carried over to the non - prize winners , causing them to be excited and enticed at the prospect of winning the next time , thereby assuring repeat business for the retail outlet . in fig3 an alternate construction for producing a prize retaining cup is detailed . prize retaining cup 40 employs a dual or multi - wall cup construction to secretly retain the desired prize award . as shown fig3 prize retaining cup 40 incorporates an outer cup member 41 and an inner cup member 42 . outer cup member 41 comprises a substantially cylindrically shaped wall portion 44 and a base portion 45 securely affixed to one end of cylindrical wall portion 44 in the conventional manner detailed above . similarly , inner cup member 42 comprises a substantially cylindrically shaped wall portion 46 and a base portion 47 affixed to one end of cylindrical wall portion 46 in a conventional manner or integrally formed therewith . in order to secretly retain a prize award in cup 40 , a prize holding plate 50 is employed which is constructed substantially identical to prize holding plate 34 . in the manner detailed above , prize holding plate 50 incorporates a cut - out zone 51 in which the desired prize award 21 is securely retained . in assembling prize retaining cup 40 , prize holding plate 50 , with prize award 21 positioned in cut - out zone 51 , is placed on the top surface of base portion 45 of outer cup member 41 . then , inner cup member 42 is telescopically inserted into outer cup member 41 , bringing the bottom surface of base portion 47 into overlying concealing engagement with prize holding plate 50 . preferably , prior to telescopically inserting inner cup member 42 into outer cup member 41 , the walls of inner cup member 42 will be covered with adhesive in order to assure secure , affixed , retained , interengagement of outer cup member 41 with inner cup member 42 . alternatively , cup members 41 and 42 may be integrally affixed to each other using any desired alternate sealing means . once fully assembled , prize award 21 would be completely concealed between base portions 45 and 47 , rendering the presence of prize award 21 completely undetectible from a non - prize bearing cup . in this embodiment , in order to assure complete identity of prize retaining cup 40 with non - prize bearing cups , all of the cups during the promotional period are manufactured with the dual - wall construction described above . however , non - prize bearing cups would not incorporate prize holding plate 50 with the desired prize award . of course , if desired , a prize holding plate 50 could be employed in all cups with a particular message being used to fill cut - out zone 51 , informing the consumer that no award has been won while encouraging the consumer to continue to participate in the prize award game promotion . in this way , all cups would be completely identical and the presence of a prize award in any cup would be incapable of being undetectible . in fig4 and 5 , two alternate embodiments for the prize delivery system of the present invention are depicted . in these two embodiments , the prize delivery system employs drinking straws as the vehicle in which a prize award is randomly distributed to lucky consumers . in the embodiment depicted in fig4 a conventional , elongated , cylindrically shaped drinking straw 55 is employed . in specifically desired , pre - selected drinking straws 55 , a prize award 21 is inserted . preferably , prize award 21 comprises a cash currency award of any desired denomination . as detailed above , prize awards ranging between $ 1 . 00 and $ 500 . 00 bills are preferred . in this embodiment , the prize award is rolled and inserted into one end of drinking straw 55 . once prize award 21 has been inserted into drinking straw 55 , the rolled prize award 21 will unroll , until coming into frictional contact with the inner wall of drinking straw 55 , thereby assuring its secure , retained , frictional engagement therewith . with prize award 21 securely retained in drinking straw 55 , drinking straw 55 is enclosed within a suitable covering or wrapper 56 . wrapper 56 comprises a variety of materials such as foil , polymer films or sheets , heavy wrapping paper , or fiber reinforced paper . regardless of the type of material employed for wrapper 56 , wrapper 56 must be sufficiently dense or thick , as well as opaque , so as to prevent anyone from being able to visually or physically examine straw 55 and determine whether or not prize award 21 is contained therein . in this way , assurance is provided that no individual will be able to determine in advance whether a prize award is retained in a straw , prior to be given that particular straw as part of a purchase . in employing this embodiment , all of the drinking straws to be used during the particular promotion are manufactured in the identical manner , incorporating the identical wrapper 56 . as a result , all of the straws employed are visually identical and incapable of being analyzed in advance to determine which straw contains a prize award . in addition , by employing this prize delivery system , both prize bearing straws and non - prize bearing straws are preferably manufactured simultaneously , with the prize bearing straws being seeded with non - prize bearing straws in a randomly desired fashion , consistent with the desired ratio . as a result , totally random distribution of prize bearing straws are made to the consumers as part of their purchase of a fountain product . in fig5 another embodiment of the delivery system of the present invention is depicted . in this embodiment , an alternate construction for secretly retaining a prize award in a drinking straw is disclosed . in this embodiment , drinking straw 55 incorporates a prize award 21 , securely mounted therein , as detailed above . however , in order to assure that the presence of prize award 21 in drinking straw 55 is incapable of advance detection , drinking straw 55 is retained within elongated tube 60 , which comprises telescopically engageable , mating sections 61 and 62 . in the preferred embodiment , tube 60 comprises a rigid , heavy , opaque material in order to prevent anyone from being able to determine if prize award 21 is present , without separating sections 61 and 62 . preferably , tube 60 comprises cardboard , heavy paper , plastic or the like . however , regardless of the material employed in constructing tube 60 , tube 60 must peripherally surround and encase straw 55 in a manner which prevents any individual from being able to determine whether straw 55 incorporates prize award 21 . in this way , prize bearing straw 55 in tube 60 is randomly seeded with non - prize bearing straws in similar tubes , and distributed in the normal manner , with lucky customers randomly receiving prize bearing straws 55 in tubes 60 . in the preferred embodiment , in order to preserve the integrity of tube 60 and be certain that no individual , including employees , are capable of investigating the supply of straws to determine which straws contain a prize award , sections 61 and 62 of tube 60 are sealingly interconnected by fastening means 63 . preferably , fastening means 63 peripherally surrounds the entire outer peripheral surface of tube 60 , sealingly and integrally interconnecting telescopic sections 61 and 62 together . in this way , dislocation or separation of sections 61 and 62 of tube 60 is prevented . furthermore , if any separation of sections 61 and 62 were to occur , the separation would be immediately apparent , since the integrity of fastening means 63 would be destroyed . consequently , unwanted opening of tube 60 by any individual is prevented and the desired random distribution of prize bearing straws with non - prize bearing straws is assured . in this embodiment , all of the straws being distributed during the promotional time period would be manufactured in the identical manner . consequently , all straws being distributed as part of the promotional contest would comprise straws mounted within tubes 60 . in this way , each and every straw is visually identical in appearance , weight , and feel , with no one straw / tube assembly being capable of being analyzed by any individual as the particular straw / tube combination in which a prize award is contained . as a result , the precisely desired random distribution of prize bearing straws with non - prize bearing straws is efficiently attained and all of the features and inherent consumer excitement generated by the prize delivery system of the present invention are realized . in fig6 - 9 , final alternate embodiments of the prize delivery system of the present invention are depicted . in fig6 and 8 , the prize delivery system of the present invention is shown in one particular construction in the form of a game coupon or game card distributed with any purchase during the sales enhancement promotion . in fig9 the prize delivery system of this invention is depicted in an alternate construction as the wall of a food container , holder , or wrapper . although fig6 - 9 depict alternate structures of the prize delivery system of this invention for different end products , it should be apparent from the following detailed disclosure that the construction for the game card embodiment shown in fig6 - 8 may be employed with equal efficacy in constructing a food product container , holder or wrapper . similarly , the construction for the food product container , holder , or wrapper of fig9 may be employed with equal efficacy in constructing a game card . as a result , fig6 - 9 effectively teach two alternate embodiments for manufacturing both game cards and food containers in a manner which enable these products to incorporate therein a prize award , with the existence of the prize award being completely undetectible by any individual , regardless of extensive observation . in fig6 and 8 , the prize delivery system of the present invention is depicted as comprising a game card , ticket or coupon 70 , which incorporates two mating sections 71 and 72 . in fig7 game card sections 71 and 72 are depicted as independent components , which are integrally bonded together as detailed herein . alternatively , as shown in fig8 game card sections 71 and 72 are formed on a single sheet of material and folded to create game card 70 . regardless of which construction is employed , game card section 71 preferably comprises an outer surface 75 , and an inner surface 76 . similarly , game card section 72 comprises an outer facing surface 77 and an inside surface 78 . in addition , in the preferred construction , at least inside surface 78 of section 72 comprises a recess zone 80 , dimensioned to comprise an overall area substantially equivalent to the area required for nested receiving engagement of prize award 21 therein . if desired , a similar recess zone is formed in inside surface 76 of section 71 . as detailed above , in the preferred embodiment , prize award 21 comprises a cash award ranging between $ 1 . 00 and $ 500 . 00 . in addition , in this embodiment , in order to attain a game card 70 which is the easiest to produce and provides the thinnest construction , prize award 21 , in the form of currency , would merely be folded in half , thereby assuring a thin , overall area to be hidden within the resulting game card . consequently , recess zone 80 need only to be formed to a depth substantially equivalent to the thickness of typical currency . in this way , folded currency is easily retained within recess zone 80 without being detected . clearly , since sections 71 and 72 comprise overall dimensions which are greater than the overall dimension of prize award 21 and prize award 21 , is securely retained within mating recess zone 80 , anyone observing the edge of the game card 70 is completely incapable of determining whether prize award 21 is secretly retained therein . in order to complete the construction of game card 70 , it is preferred that sections 71 and 72 be securely affixed to each other , thereby preventing unwanted tampering with game card 70 in an attempt to determine if a prize award is present . although sections 71 and 72 can be securely fastened to each other in a plurality of alternate constructions , it has been found that one simple and inexpensive construction technique is merely to apply glue means to surface 78 , peripherally about recess zone 80 of card section 72 . then , after positioning prize award 21 in recess zone 80 , section 71 is quickly and easily securely affixed to section 72 by merely abuttingly contacting inside surface 76 with the glue means on inside surface 78 of section 72 . in this way , the final construction of card 70 is quickly and inexpensively attained and prize award 21 is secretly retained in game card 70 , completely unable to be detected prior to opening game card 70 in the manner instructed . as shown in fig7 access to prize award 21 is easily attained by merely separating sections 71 and 72 . in implementing this embodiment of the present invention , a great variety of construction and assembly techniques can be employed . however , it is intended that all of these variations are within the scope of the present invention and not patentably distinct therefrom . in this regard , a plurality of alternate arrangements can be employed for obtaining access to prize award 21 by the consumer . as shown in fig6 and 8 , one alternate technique is to employ a scored zone 85 on section 71 which would enable the consumer , upon receiving card 70 , to easily open a panel formed by score lines 85 , revealing to the consumer the presence of prize award 21 therein . in order to further heighten the excitement of winning a prize award , covered information zones 86 may also be formed on section 71 of card 70 , requiring the consumer to scrape off a concealing film , well known in the art , to reveal a message printed therebelow . this message could inform the consumer that card 70 secretly retains a cash prize award with instructions on how to obtain access to prize award 21 . if desired , scored zone 85 may be used in combination with covered sections 86 as depicted in fig6 . alternatively , these elements can be used separately , or not at all , depending upon the particular card construction desired . in fig9 an alternate embodiment for the prize delivery system of the present invention is disclosed . in this embodiment , the prize delivery system is depicted as a portion of one wall or panel 90 of a typical food product container , holder , wrapper or utensil . in this embodiment , the wall panel 90 comprises two layers 91 and 92 which are in overlying , concealing engagement with prize holding substrate 93 . preferably , prize holding substrate 93 is formed in a manner similar to prize holding plates 34 and 50 detailed above , with cut - out zone 89 formed therein . as depicted in fig9 prize award 21 is securely positioned in cut - out zone 94 of substrate layer 93 , thereby being maintained between outer sections 91 and 92 , assuring that the presence of prize award 21 is completely undiscoverable , without destroying the entire wall assembly 90 . as previously discussed , the thickness of substrate 93 is substantially equivalent to the thickness attained by folding prize award 21 into the desired shape . consequently , prize award 21 substantially fills the entire retaining zone 94 , thereby assuring that prize award 21 is incapable of being detected by either visual or manual analysis of wall panel 90 . if desired , all containers , holders , instruments , or game cards may be manufactured incorporating intermediate prize holding substrate 93 , in order to assure consistency of size , shape and form of all give - aways during the promotional period . furthermore , if desired , all game cards or packages may be manufactured in a virtually identical manner , with cut - out zone 94 of prize holding substrate 93 incorporating a pre - printed message informing the consumer that no prize award has been won , but encouraging the consumer to continue to participate in the promotional contest . in this way , complete uniformity of all game cards , food containers , holders or instruments is maintained and the secrecy of which product contains the prize award is preserved . as detailed above in reference to the game cards , outer section 91 and 92 are securely affixed to opposed surfaces of prize holding substrate 93 , thereby sandwiching prize holding substrate 93 therebetween , and securely retaining prize award 21 in complete , secrecy . in this way , complete secrecy is maintained until a consumer obtains access to the prize holding zone and discovers the presence of prize award 21 . it will thus be seen that the objects set forth above , among those made apparent from the preceding description , are efficiently attained and , since certain changes may be made in the above articles without departing from the scope of the invention , it is intended that all matter contained in the above descriptions or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention in which , as a matter of language , might be said to fall therebetween .
| 1 |
the present invention includes two main embodiments , the first embodiment is the multi - range cross - defrosting humidity control system constructed with the cross reverse refrigerant circulation , the second embodiment is the multi - range cross - defrosting humidity control system constructed with the one - body defrost condenser . now referring to fig1 a to fig1 e and table 1 for the first embodiment : the basic operation scheme is shown in fig1 a to fig1 e , the multi - range cross - defrosting humidity control system operates with a control system that change the defrosting methods according to the outdoor temperature and humidity ; when the outdoor temperature is in the range of 20 degree celsius to 0 degree celsius , the control system can apply the first defrosting method , which is also called as the cross - air defrosting process ; when the outdoor temperature is in the range of 10 degree to negative 40 degree or lower , the control system can apply the second defrosting method , which is also called as the high speed cross - reverse defrosting process ; the threshold at which the control system switch between the first defrosting method and the second defrosting method can be adjust at any point between 10 degree celsius to 0 degree celsius ; for the ease of comprehension , the threshold will be set as 5 degree celsius , it should be understood that this threshold value should be adjusted according to the heating need and the humidity of the outdoor environment for the best heating efficiency and the indoor humidity control . as shown in fig1 a , the cross reverse defrosting humidity control system comprising the following basic components : main compressor 101 , main condenser 102 , first evaporator 121 , second evaporator 122 , main expansion valve 103 , first upper - flow valve 131 , second upper - flow valve 132 , first lower - flow valve 171 , second lower - flow valve 172 , first reverse - flow valve 151 , second reverse - flow valve 152 , first expansion valve 141 , second expansion valve 142 , first one - way valve 161 , second one - way valve 162 , first venting fan 191 , second venting fan 192 , separate heat insulation for each evaporator , first indoor - air - intake fan 181 , second indoor - air - intake fan 182 , first outdoor - air - intake valve 195 , second outdoor - air - intake valve 196 , first indoor - air - intake valve 181 , second indoor - air - intake valve 182 , first temperature sensor 193 , second temperature sensor 194 , outdoor temperature sensor ( not shown ). the basic concept of the cross - air defrosting process is to block the refrigerant - flow of the frosted evaporator , and a controlled amount of the outdoor air will flow through that frosted evaporator to heat up the frost thereon , while the other evaporator will operate with the evaporation process to provide the evaporated refrigerant to the main compressor 101 for the pressurization process , the main condenser 102 will carry on the condensation process for the air - conditioning ; the cross - air defrosting process requires a defrost - cycle of alternating operation , a defrost cycle is provided as follows , the first evaporator 121 defrosts with cross - air defrosting process for 5 minute as in fig1 b , and next the second evaporator 122 defrosts with the cross - air defrosting process for 5 minute as in fig1 c , and next the first evaporator 121 and the second evaporator 122 all resume the evaporation process for 10 minute as in fig1 a , and next the control system repeats the defrost cycle or switch to another defrosting method if a change in the outdoor temperature is detected . now referring to fig1 a , in which the first evaporator 121 and the second evaporator 122 are absorbing the heat from the outdoor - air - flow with the evaporation process ; the cross reverse refrigerant circulation is disabled by shutting the first reverse - flow valve 151 and the second reverse - flow valve 152 ; now the refrigerant is circulating as follows , the refrigerant is pressurized in the main compressor 101 and condensed in the main condenser 102 , and next the first evaporator 121 and the second evaporator 122 will be evaporating refrigerant to provide the evaporated refrigerant to the main compressor 101 ; the first indoor - air - intake fan 181 and the second indoor - air - intake fan 182 are stopped to disable the indoor - air - flows of the first evaporator 121 and the second evaporator 122 ; the first outdoor - air - intake valve 131 and the second outdoor - air - intake valve 132 are open to admit the outdoor - air - flow into the first evaporator 121 and the second evaporator 122 . now referring to fig1 b and fig1 c for the first defrosting method of the cross reverse defrosting humidity control system , said first defrosting method is also called as the cross - air defrosting process ; the control system can employ said cross - air defrosting process when the outdoor temperature is between 20 degree celsius and 0 degree celsius ; during the defrost - cycle of the cross - air defrosting process , the control system will defrost each evaporator with a defrost cycle as follows ; the first evaporator 121 defrosts with the cross - air defrosting process for 5 minute as shown in fig1 b , and next the second evaporator 122 defrosts with the cross - air defrosting process for 5 minute as shown in fig1 c , and next the first evaporator 121 and the second evaporator 122 will resume the evaporation process as shown in fig1 a or repeat the defrost - cycle if the condition required . as shown in fig1 b is the cross - air defrosting process of the first evaporator 121 ; the refrigerant - flow of the first evaporator 121 is disabled by shutting the first upper - flow valve 131 and first lower - flow valve 171 , the first venting fan 191 will operate at full speed to draw the outdoor air through the first evaporator 121 to melt the frost thereon ; the second evaporator 122 will operate with the evaporation process to provide a sufficient flow of evaporated refrigerant to the main compressor 101 , the main condenser 102 will continue to generate the heat energy required for the air - conditioning . as shown in fig1 c is the cross - air defrosting process of the second evaporator 122 ; the refrigerant - flow of the second evaporator 122 is disabled by shutting the second upper - flow valve 132 and the second lower - flow valve 172 , the second venting fan 192 will operate at full speed to draw the outdoor air through the second evaporator 122 to melt the frost thereon ; the first evaporator 121 will operate with the evaporation process to provide a sufficient flow of evaporated refrigerant to the main compressor 101 , the main condenser 102 will continue to generate the heat energy required for the air - conditioning . now referring to fig1 d and fig1 e . when the outdoor temperature reaches the threshold , at which the cross - air defrosting method cannot provide enough heat energy with the outdoor air , the control system can switch to the second defrosting method as shown in fig1 d and fig1 e , and said second defrosting method is also called as the high speed cross reverse defrosting process , the applicable range of the high speed cross reverse defrosting process is from 10 degree celsius to negative 40 degree celsius and lower ; the high speed cross reverse defrosting process also operates in a similar defrost - cycle as the first defrosting method , a defrost - cycle is provided as follows ; the first evaporator 121 and the second evaporator 122 operate with the evaporation process to absorb the heat energy from the outdoor - air - flow as shown in fig1 a for 10 minute , and next the first evaporator 121 defrosts with the high speed cross reverse defrosting process as shown in fig1 d for 2 minute , and next the second evaporator 122 defrosts with the high speed cross reverse defrosting process as shown in fig1 e for 2 minute , and next the control system repeats the defrost - cycle until further change in the outdoor environment is detected . the basic concept of the high speed cross reverse defrosting process is to transfer a controlled amount of the indoor air into the heat insulated space of the evaporator that is defrosting , and at the same time a controlled amount of the pressurized refrigerant will be distributed into the evaporator that is defrosting , the accumulated frost on said evaporator will melt by the heat generated from condensation process and the heat energy of the indoor air , therefore , the required time for the defrosting process will be greatly shortened , and the indoor air will be ventilated during this process ; the other evaporator of the system will continue the evaporation process with the outdoor - air - flow , the main compressor and the main condenser will also continue their operations to generate the heat energy for the air - conditioning . the defrost - cycle of the high speed cross reverse defrosting process requires each evaporator to alternate its operation at a time interval , and the detailed control scheme is provide in fig1 d and fig1 e . as shown in fig1 d , the first evaporator 121 is defrosting with the high speed cross reverse defrosting process ; the first evaporator 121 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 103 by shutting the first upper - flow valve 131 and first lower - flow valve 171 . the cross reverse refrigerant circulation will be initiated by opening the first reverse - flow valve 151 , providing a refrigerant passage from the main compressor 101 to the first evaporator 121 , so that the pressurized refrigerant from the main compressor 101 will now be distributed to the main condenser 102 and the first evaporator 121 ; said pressurized refrigerant will condense in the first evaporator 121 to heat up and melt the accumulated ice on the first evaporator 121 , and said refrigerant - flow of the first evaporator 121 will exit through the first expansion valve 141 and the first one - way valve 161 into the second evaporator 122 ; the first outdoor - air - intake valve 195 will be shut to stop the outdoor - air - flow of the first evaporator 121 , the first venting fan 191 will stop or spin slowly to conserve the heat inside the heat insulated space of the first evaporator 121 , thus creating a hot environment inside the heat insulated space of the first evaporator 121 ; the first evaporator 121 will now be defrosting with the heat energy of the condensation process and the indoor - air - flow ; the second evaporator 122 will receive both the refrigerant - flow from the main expansion valve 103 and the refrigerant - flow from the first one - way valve 161 ; in other words , the main condenser 102 and the first evaporator 121 will be condensing refrigerant to generate heat energy for the air - conditioning and the high speed cross reverse defrosting process respectively , while the second evaporator 122 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the second venting fan 192 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the second evaporator 122 . as shown in fig1 e , the second evaporator 122 is defrosting with the high speed cross reverse defrosting process ; the second evaporator 122 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 103 by shutting the second upper - flow valve 132 and second lower - flow valve 172 . the cross reverse refrigerant circulation will be initiated by opening the second reverse - flow valve 152 , providing a refrigerant passage from the main compressor 101 to the second evaporator 122 , so the pressurized refrigerant from the main compressor 101 will now be distributed to the main condenser 102 and the second evaporator 122 ; said pressurized refrigerant will condense in the second evaporator 122 to heat up and melt the accumulated ice on the first evaporator 121 , and said refrigerant - flow of the second evaporator 122 will exit through the second expansion valve 142 and the second one - way valve 162 into the first evaporator 121 ; the second outdoor - air - intake valve 196 will be shut to stop the outdoor - air - flow into the heat insulated space of the second evaporator 122 , the second venting fan 192 will stop or spin slowly to conserve the heat inside the heat insulated space of the second evaporator 122 , thus creating a hot environment inside the heat insulated space of the second evaporator 122 ; the second evaporator 122 will now be defrosting with the heat energy of the condensation process and the indoor - air - flow ; the first evaporator 121 will receive both the refrigerant - flow from the main expansion valve 103 and the refrigerant - flow from the second one - way valve 162 ; in other words , the main condenser 102 and the second evaporator 122 will be condensing refrigerant to generate the heat energy for the air - conditioning and the high speed cross reverse defrosting process respectively , while the first evaporator 121 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the first venting fan 191 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the first evaporator 121 . the first embodiment of the present invention can be further extended with additional evaporators . and the control system can adjust accordingly to the basic concept of the present invention ; when one of the evaporators is frosted and requires to defrost with the second defrosting method , said frosted evaporator will block the refrigerant - flow from the main expansion valve and initiate the refrigerant - flow from the main compressor with its associated control valves , said frosted evaporator will initiate the condensation process with the pressurized refrigerant from the main compressor , and the heat insulated space of said frosted evaporator will block the flow of the outdoor air and admit a controlled amount of indoor air with its associated air - intake means , at the same time all other evaporators can continue the evaporation process to absorb heat energy from the outdoor - air - flow , the main compressor and the main condenser will continue their operation for the air - conditioning ; the control system will also operate in a similar defrost - cycle , a defrost - cycle is as follows , all evaporators operate with the evaporation process for 10 minute , and next the first evaporator defrosts for 2 minute , next the second evaporator defrosts for 2 minute , and next the third evaporator defrosts for 2 minute , and next the fourth evaporator defrosts for 2 minute , and next the control system repeats the defrost - cycle or adjust its operation if further change in the outdoor temperature is detected . for easier maintenance , most control valves can be combined into one single rotary valve or other multi - port control valve means . an alternative scheme of the control valve means is provided as follows , wherein the first reverse - flow valve 151 and the first upper - flow valve 131 are replaced with the first rotary upper - flow valve capable of same functions , the first lower - flow valve 171 and the first one - way valve 161 can be replaced with the first rotary lower - flow valve capable of same functions . many other construction schemes and control valve means are possible to perform the same task based on the principle of present invention and should be considered within the scope of the present invention . now referring to the second embodiment as shown in fig2 a to fig2 e for the multi - range cross - defrosting humidity control system constructed of the one - body defrost condenser . the second embodiment also operate with a control system that changes the defrosting methods according to the outdoor temperature and humidity ; when the outdoor temperature is in the range of 20 degree celsius to 0 degree celsius , the control system can apply the first defrosting method , which is also called as the cross - air defrosting process ; when the outdoor temperature is in the range of 10 degree to negative 40 degree or lower , the control system can apply the second defrosting method , which is also called as the high speed cross - defrosting process ; the threshold at which the control system switches between the cross - air defrosting process and the high speed cross - defrosting process can be adjust at any point between 10 degree celsius to 0 degree celsius . the second embodiment as shown in fig2 a , the cross - defrosting humidity control system comprising the following basic components : main compressor 201 , main condenser 202 , first evaporator 221 , second evaporator 222 , main expansion valve 203 , first upper - flow valve 231 , second upper - flow valve 232 , first defrost - flow valve 251 , second defrost - flow valve 252 , first expansion valve 241 , second expansion valve 242 , first defrost - condenser 223 , second defrost - condenser 224 , first venting fan 291 , second venting fan 292 , separate heat insulation for each evaporator , first indoor - air - intake fan 283 , second indoor - air - intake fan 284 , first outdoor - air - intake valve 295 , second outdoor - air - intake valve 296 , first indoor - air - intake valve 281 , second indoor - air - intake valve 282 , first temperature sensor 293 , second temperature sensor 294 , outdoor temperature sensor ( not shown ). the first evaporator 221 and the first defrost - condenser 223 are constructed together to maximize the heat transfer rate between each other , therefore , the heat energy will be transfer from the first defrost - condenser 223 to the first evaporator 221 through the radiator fins they shared during the high speed cross defrosting process of the first evaporator 221 . the second evaporator 222 and the second defrost - condenser 224 are also constructed together in the same manner for maximizing the heat transfer rate between each other . now referring to fig2 a for the full capacity heating operation when both the first evaporator 221 and second evaporator 222 are operating with the evaporation process ; the refrigerant - flow of the first evaporator 221 and the refrigerant - flow of the second evaporator 222 are enabled by opening the first upper - flow valve 231 and second upper - flow valve 232 ; the refrigerant circuits for the high speed cross - defrosting process are disabled by shutting the first defrost - flow valve 251 and the second defrost - flow valve 252 ; the heat insulated space of the first evaporator 221 and the second evaporator 222 will block the indoor - air - flow and admit the outdoor - air - flow for absorbing heat , the first indoor - air - intake fan 283 and the second indoor - air - intake fan 284 will be disabled to block the indoor - air - flow into the first evaporator 221 and the second evaporator 222 , the first outdoor - air - intake valve 295 and the second outdoor - air - intake valve 296 will be open , the first venting fan 291 and the second venting fan 292 will be operating to draw the outdoor - air - flow into the heat insulated space of the first evaporator 221 and the heat insulated space of the second evaporator 222 ; the main compressor 201 and the main condenser 202 will be operating with the pressurization process and the condensation process respectively to provide the heat energy for the air - conditioning . now referring to fig2 b and fig2 c for the cross - air defrosting process of the second embodiment ; the control system can employ said cross - air defrosting process when the outdoor temperature is between 20 degree celsius and 0 degree celsius ; during the defrost - cycle of the cross - air defrosting process , the control system will defrost each evaporator with a defrost - cycle as follows ; the first evaporator 221 defrosts with the cross - air defrosting process for 5 minute as shown in fig2 b , and next the second evaporator 222 defrosts with the cross - air defrosting process for 5 minute as shown in fig2 c , and next the first evaporator 221 and the second evaporator 222 will resume the evaporation process as shown in fig2 a or repeat the defrost - cycle if the condition required . as shown in fig2 b , the first evaporator 221 is defrosting with the cross - air defrosting process ; the refrigerant - flow of the first evaporator is disabled by shutting the first upper - flow valve 231 , the outdoor - air - flow will be drawn into the heat insulated space of the first evaporator 221 , and the frost on the first evaporator 221 will melt by the absorbing the heat energy of the outdoor - air - flow ; the second evaporator 222 will operate with the evaporation process to provide the evaporated refrigerant to the main compressor 201 ; the main compressor 201 and the main condenser 202 will continue the pressurization process and the condensation process respectively for the air - conditioning ; the refrigerant circuits for the high speed cross - defrosting process are disabled by shutting the first defrost - flow valve 251 and the second defrost - flow valve 252 . as shown in fig2 c , the second evaporator 222 is defrosting with the cross - air defrosting process ; the refrigerant flow of the second evaporator 222 is disabled by shutting the second upper - flow valve 232 , the outdoor - air - flow will be drawn into the heat insulated space of the second evaporator 222 , and the frost on the second evaporator 222 will melt by the absorbing the heat energy of the outdoor - air - flow ; the first evaporator 221 will operate with the evaporation process to provide the evaporated refrigerant to the main compressor 201 ; the main compressor 201 and the main condenser 202 will continue the pressurization process and the condensation process respectively for the air - conditioning ; the refrigerant circuits for the high speed cross - defrosting process are disabled by shutting the first defrost - flow valve 251 and the second defrost - flow valve 252 . now referring to fig2 d and fig2 e . when the outdoor temperature reaches the threshold for initiating the high speed cross defrosting process , the control system will operate with a defrost - cycle of the high speed cross defrosting process , a defrost - cycle is provided as follows ; the first evaporator 221 and the second evaporator 222 operate with the evaporation process to absorb the heat energy from the outdoor - air - flow as shown in fig2 a for 10 minute , and next the first evaporator 221 defrosts with the high speed cross defrosting process as shown in fig2 d for 2 minute , and next the second evaporator 222 defrosts with the high speed cross defrosting process as shown in fig2 e for 2 minute , and next the system repeats the defrost - cycle until further change in the outdoor environment is detected . the basic concept of the high speed cross defrosting process is to transfer a controlled amount of the indoor air into the heat insulated space of the evaporator that is defrosting , and at the same time a controlled amount of the pressurized refrigerant will be distributed into the defrost - condenser associated with the evaporator that is defrosting , the accumulated frost on said evaporator will melt by the heat current transferred from its associated defrost - condenser and the heat energy of the indoor air , therefore , the required time for the defrosting process will be greatly shortened , and the indoor air will be ventilated during this process ; the other evaporator of the system will continue the evaporation process with the outdoor - air - flow , the main compressor and the main condenser will also continue their operation to generate the heat energy for the air - conditioning . the defrost - cycle of the high speed cross defrosting process requires each evaporator to alternate its operation at a time interval , and the detailed control scheme is provide in fig2 d and fig2 e . as shown in fig2 d , the first evaporator 221 is defrosting with the high speed cross defrosting process ; the first evaporator 221 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 203 by shutting the first upper - flow valve 231 ; the first defrost - condenser 223 will be enabled by opening the first defrost - flow valve 251 , providing a refrigerant passage from the main compressor 201 to the first defrost - condenser 223 , so the pressurized refrigerant from the main compressor 201 will now be distributed to the main condenser 202 and the first defrost - condenser 223 ; said pressurized refrigerant will condense in the first defrost - condenser 223 to heat up and melt the accumulated frost on the first evaporator 221 , and said refrigerant - flow of the first defrost - condenser 223 will exit through the first expansion valve 241 into the second evaporator 222 ; the first outdoor - air - intake valve 295 will be shut to stop the outdoor - air - flow of the first evaporator 221 , the first venting fan 291 will stop or spin slowly to conserve the heat inside the heat insulated space of the first evaporator 221 , thus creating a hot environment inside the heat insulated space of the first evaporator 221 ; the first evaporator 221 will now be defrosting with the heat energy of the condensation process of the first defrost - condenser 223 and the indoor - air - flow ; the second evaporator 222 will receive the refrigerant - flow from the main expansion valve 103 and the refrigerant - flow from the first expansion valve 241 ; in other words , the main condenser 202 and the first defrost - condenser 223 will be condensing refrigerant to generate heat energy for the air - conditioning and the high speed cross defrosting process respectively , while the second evaporator 222 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the second venting fan 292 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the second evaporator 222 ; the second defrost - condenser 224 is disabled by shutting the second defrost - flow valve 252 . as shown in fig2 e , the second evaporator 222 is defrosting with the high speed cross defrosting process ; the second evaporator 222 will stop the evaporation process and disable the refrigerant passage from the main expansion valve 203 by shutting the second upper - flow valve 232 ; the second defrost - condenser 224 will be enabled by opening the second defrost - flow valve 252 , providing a refrigerant passage from the main compressor 201 to the second defrost - condenser 224 , so the pressurized refrigerant from the main compressor 201 will now be distributed to the main condenser 202 and the second defrost - condenser 224 ; said pressurized refrigerant will condense in the second defrost - condenser 224 to heat up and melt the accumulated frost on the second evaporator 222 , and said refrigerant - flow of the second defrost - condenser 224 will exit through the second expansion valve 242 into the first evaporator 221 ; the second outdoor - air - intake valve 296 will be shut to stop the outdoor - air - flow of the second evaporator 222 , the second venting fan 292 will stop or spin slowly to conserve the heat inside the heat insulated space of the second evaporator 222 , thus creating a hot environment inside the heat insulated space of the second evaporator 222 ; the second evaporator 222 will now be defrosting with the heat energy of the condensation process of the second defrost - condenser 224 and the indoor - air - flow ; the first evaporator 221 will receive the refrigerant - flow from the main expansion valve 203 and the refrigerant - flow from the second expansion valve 242 ; in other words , the main condenser 202 and the second defrost - condenser 224 will be condensing refrigerant to generate heat energy for the air - conditioning and the high speed cross defrosting process respectively , while the first evaporator 221 will be operating with the evaporation process by absorbing the heat from the outdoor - air - flow ; the first venting fan 291 will be operating at full speed to provide a sufficient flow of the outdoor air for the evaporating process of the first evaporator 221 ; the first defrost - condenser 223 is disabled by shutting the first defrost - flow valve 251 . the second embodiment of the present invention can be further extended with additional evaporators and additional defrost - condensers , and the control system can adjust accordingly to the basic concept of the present invention ; when one of the evaporators is frosted and requires to defrost with the high speed cross defrosting process , said frosted evaporator will block the refrigerant passage from the main expansion valve with its associated control valves , and the defrost - condenser associated with said frosted evaporator will initiate the refrigerant - flow from the main compressor with its associated control valves , said defrost condenser will initiate the condensation process with the pressurized refrigerant from the main compressor , and the heat insulated space of said frosted evaporator will block the flow of the outdoor air and admit a controlled amount of indoor air with its associated air - intake means , at the same time all other evaporators can continue the evaporation process to absorb heat energy from the outdoor - air - flow , the main compressor and the main condenser will continue their operation for the air - conditioning ; the control system will also operate in a defrost - cycle , wherein each evaporator will take turns to operate with the high speed cross defrosting process , a defrost cycle is as follows , all evaporators operate with the evaporation process for 10 minute , and next the first evaporator defrosts for 2 minute , next the second evaporator defrosts for 2 minute , and next the third evaporator defrosts for 2 minute , and next the fourth evaporator defrosts for 2 minute , and next the control system repeats the defrost - cycle or adjust its operation if further change in the outdoor temperature is detected . the control system can further employ the sensor means for the progress of the defrosting process to detect if the evaporator has melted all the frost thereon , if all the frost has melted , the control system can be reset to the next step of the defrost - cycle ; said sensor means can be a pressure or temperature sensor in the evaporator . a special ventilation operation mode can also be implanted in the control system as an additional function , said operation mode is called as the forced - ventilation mode , wherein a controlled amount of the outdoor - air - flow and a controlled amount of the indoor - air - flow are admitted into the evaporators that are operating with the evaporation process , therefore the indoor air will be drawn out of the indoor space for the ventilation purpose , while the heat insulated space of each evaporator will have an air flow of higher temperature , thus ventilating the indoor air with a high energy recovery rate . it should be understood that the threshold temperatures for initiating each stage of defrosting are different for each regions in the world , wherein the humidity and frosting condition are the main factor for selecting the appropriate threshold for each defrosting method and operation mode .
| 5 |
reference will now be made in detail to the present preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . referring now to fig1 it can be seen that the process of the present invention may be subdivided into various treatment steps or regions , namely , a mixing region a , a mixing and melting region b , a flashing zone c , an expansion and creaming zone d , and a filling region e . foodstuff such as raw cheese , generally in large hunks or pieces , is minced in special cheese mincers to an average particle size of between 1 and 4 mm and then charged using known feeding means into a mixer 1 , which is diagrammatically represented in fig1 in the mixing region a . this mincing operation is performed discontinuously or continuously as required , depending on the amount of foodstuff to be processed . while various different types of mixers having different load capacities may be used , a preferred mixer may be an open , double - screw mixer which is capable of processing up to 5000 kg . of foodstuff , such as cheese , per batch mixing session . in the mixer 1 , the minced raw cheese is intimately and homogeneously mixed with any additional ingredients at a mixing temperature of approximately between 15 ° and 30 ° c . the cheese mixture is thereafter analyzed , and the fat and water content as well as , perhaps , ph are measured and adjusted as necessary according to set standards and requirements . the treated , standardized cheese mass is pumped out of the mixer 1 by a dairy pump 2 into the intake 3 of a continuously operating mixing and melting apparatus 4 . it is possible to use a frequency - controlled motor in place of the dairy pump drive 2 for automatic control of the feed flow . fig2 and 3 show the construction of the mixing and melting apparatus 4 . the drive of the mixing and melting apparatus can be performed by means of any suitable , commercially available drive unit or motor ( not shown in detail ). the drive unit is operatively connected to a drive shaft 5 which , in turn , is operatively associated with a mixing and feeding shaft 6 . the mixing and feeding shaft 6 is fitted with radially directed mixing tools 7 which , by virtue of an appropriate angle of pitch , impart to the material to be mixed an axial feeding action in the direction of the drive unit . the mixing and feeding shaft 6 rotates within a mixing chamber 8 , and as seen in a direction against the product feeding direction , the mixing chamber is adjacent a steam blowing - in zone or steam injection chamber 9 which , in turn , is adjacent an intake chamber 3 . the steam may be introduced through steam injectors located on the circumference of the wall of the steam injection chamber 9 . the steam injectors may be in the form of nozzles , a steam ring , steam non - return valves 10 or the like . the motor or drive shaft 5 is generally rotated at speeds between 1000 and 4000 rpm . as seen in fig3 and in the product feeding direction , a rotor 11 is integrally mounted on the motor shaft 5 downstream of the mixing and feeding shaft 6 and rotates within a stationary stator 12 . an emulsifying unit , comprising the rotor 11 and the stator 12 , is arranged and housed in an emulsifying chamber 13 . the housing of the emulsifying chamber 13 is flange - mounted directly on the drive unit . a processed cheese outlet tube 14 leads out of the housing of the emulsifying chamber 13 and guides or leads the emulsifying unit 11 , 12 downstream in the radial direction . referring to fig4 to 6 , the stator 12 has axially directed teeth 16 , forming axial slits 15 between them . cutting profiles 17 designed as tips are fastened on the teeth 16 . two axial edges are provided on each cutting profile 17 . one axial edge of the cutting profile 17 is designed and adapted as a cutting edge 18 , whereas the other axial edge , together with the cutting edge of the following , adjacent cutting profile 17 forms a cutting gap 19 . the emulsifying unit may , alternatively be designed according to the form and configuration represented in ep - b1 0 005 726 , as incorporated herein by reference . steam is introduced and injected into the steam blow - in zone ( or steam injection chamber ) 9 via steam non - return valves 10 . the quality of the steam is of drinking water quality , i . e ., potable , and is preferably at a temperature of approximately 140 ° c . in principle , however , the temperature of the injected steam could also be about 170 ° c ., which higher temperature steam would require a correspondingly greater outlay and investment on apparatus and equipment . the steam injection is preferably performed immediately before the pumped - in raw cheese mass is taken up by the mixing tools 7 , rotating at high speed , and subjected to high turbulences in order that the water vapor can give off its energy through condensation to the cheese mass . the result is that the cheese mass is heated in a matter of seconds to a desired temperature of approximately 95 ° c . in accordance with the invention , the high turbulent conditions are necessary in order to quickly effect transfer of heat energy in the steam to the cheese mass . the steam pressure may in this case be up to 8 . 0 bar . the rate of steam injection into the steam blowing - in zone or chamber is regulated such that , according to the cheese mass flowing through , the condensate preferably gives off approximately 100 % of its energy , so that no free steam is available to escape from the system . in the case of a continuously operating installation , mixing and feeding shaft 6 and rotor - stator system 11 , 12 can be varied according to hourly output , recipe and expected quality as well as speed , in order to accomplish different intensities of turbulences and homogenizing effects . for example , the rotor - stator system can , depending on the desired homogenizing intensity , have homogenizing gaps of between approximately 0 . 05 to 10 mm , preferably between approximately 0 . 1 and 3 mm . by adjusting the distance of the homogenizing gaps , just as by changing the speed , the shearing forces can be varied . all these factors and possibilities for making changes have a significant influence on the emulsion , the dispersion effect , and , consequently , also directly on the appearance , the gloss , the spreadability and the texture of the cheese mass . with the technology according to the present invention , all physical , thermal and chemical factors acting in the melting process can be matched optimally with one another so that optimal end product results as desired product characteristics can be obtained . continuously operated heating and emulsifying processes can be controlled by automatic control units or devices in such a way that the quality of the end product is consistently uniform . according to fig1 the treatment of the cheese mass is followed downstream by a temperature - maintaining and reaction section 20 , which is downstream of the processed cheese outlet tube 14 and , depending on the product and the product temperature , permits the choice of a temperature - maintaining time of between about 4 to 180 seconds , for example , not only for spreadable processed cheese products but also for block and sliced cheese . according to fig1 this temperature - maintaining and reaction section 20 is adjoined by a flashing unit 21 , where the processed cheese mass is heated , for example , from about 95 ° c . to about 140 ° c ., in order to significantly prolong the shelf life of the cheese . the process is performed in the superpressure range by injection of steam via a steam line 22 similar to the steam line 23 connected to the steam non - return valves 10 of the mixing and melting apparatus 4 . referring to fig1 the flashing unit or zone c is adjoined by the expansion and creaming unit or zone d . after running through a further heat - retaining unit or section 24 , the cheese mass , now already referred to as processed cheese , passes into a vacuum - tight expansion and creaming tank 25 . a vacuum system 26 as well as a condenser 27 is attached to the expansion and creaming tank 25 for the precipitation of water vapor vacuumed out of the tank 25 . combined , the vacuum system 26 and the condenser 27 form a vacuum condenser system . in the expansion and creaming tank 25 , the temperature of the processed cheese , which may be between about 95 ° and about 140 ° c ., is lowered by a defined vacuum level within a matter of seconds to a desired product or creaming temperature of about 80 ° c . vacuum level and product temperature are kept constant by automatic control . rotatable mixing and creaming tools 28 , which can be driven at speeds of between about 5 and about 50 rpm , are provided in the tank 25 . the creaming of the processed cheese is improved by the use of these tools . moreover , additional ingredients can be added in this way so as to be mixed into the processed cheese mass . for this purpose , an ingredients tank 29 as well as a supply line 30 , which is fitted with a pump and shut - off valve and which opens out into a suction intake opening of the tank 25 , are indicated in fig1 . the expansion and creaming tank 25 is mounted on weighing cells , by means of which the amounts of precooked cheese and the filling level of the tanks can be constantly monitored and exactly determined during production . for example , the filling level which corresponds to a certain weight can be visually indicated on a display on the switch cabinet . in order to be able to carry out a cleaning of the expansion and creaming tank 25 as well as of the vacuum tank of the vacuum system 26 continuously during the process , three cleaning lines 31 , 32 and 33 , each fitted with shut - off valves , are connected to the tank 25 . the expansion and creaming tank 25 is consequently able to meet stringent hygienic and aseptic requirements with regard to its housing and its internal fittings . this means , inter alia , that dead spaces , in which residues can be deposited , are avoided . no slotted screws which could come into contact with the product may be used . the gaps of all shaft glands are cleaned directly . according to fig1 water lines 34 , 35 and a steam line 36 are also connected to the expansion and creaming tank 25 . moreover , the tank 25 has a bottom seat valve 37 for continuously pumping off the ready , produced and subsequently creamed processed cheese . the feeding of the ready , produced and subsequently creamed processed cheese is performed continuously , for example , by means of a gear pump 38 , into a buffer tank 39 and from there into a filling machine 40 . it will be apparent to those skilled in the art that various modifications and variations can be made in the process of the present invention and in the construction of this apparatus without departing from the scope or spirit of the invention . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with true scope and spirit of the invention being indicated by the following claims .
| 1 |
a synthetic substrate amide compound [ 19 or [ 4 ] for lap or γ - gtp assay of the present invention can be produced by conventional methods of peptide synthesis , for example , by reacting the carboxyl group of l - leucine or γ - carboxyl group of l - glutamic acid with amine [ 2 ] or aniline derivative [ 5 ]. in the above condensation reaction , a reactive group for not taking part in the reaction , such as amino group of l - leucine or amino group and α - carboxyl group of l - glutamic acid , should be protected . example of protected group for amino group is conventional protective group for α - amino group , such as t - butoxycarbonyl , t - amyloxycarbonyl , benzyloxycarbonyl , p - nitrobenzyloxycarbonyl or o - nitrophenylthio group . α - carboxyl group of l - glutamic acid is preferably protected by methyl ester , ethyl ester , t - butyl ester , benzyl ester , p - nitrobenzyl ester or p - methoxybenzyl ester , and the said protective group can preferably be removed together with protective group for amino group in one step removal procedure . for example , amino group is protected by benzyloxycarbonyl , and α - carboxyl group is protected by benzyl ester . examples of amine [ 2 ] used in the condensation reaction are lower alkyl , lower alkoxy , amino , substituted amino , hydroxy , carbonyl or sulfo group , for example o -( m - or p -) toluidine , o -( m - or p -) ethylaniline , 2 , 3 -( 2 , 4 -, 2 , 5 -, 2 , 6 -, 3 , 4 - or 3 , 5 -) xylidine , o -( m - or p -) anisidine , 2 , 5 - dimethoxyanilien , 2 , 5 - diethoxyaniline , o -( m - or p -) chloroaniline , o -( m - or p -) bromoaniline , o -( m - or p -) phenylenediamine , n , n - dimethyl - m - phenylenediamine , n , n - dimethyl - p - phenylenediamine , n , n - diethyl - p - phenylenediamine , n , n - dipropyl - p - phenylenediamine , o -( m - or p -) aminophenol , o -( m - or p -) aminobenzoic acid , p - aminobenzene sulfonic acid , 4 - hydroxy - 3 , 5 - dichloroaniline , 4 - hydroxy - 3 , 5 - dibromoaniline , 2 -( or 4 -) methyl - o - phenylenediamine , 2 - hydroxy - 5 - toluidine , 3 -( or 4 -) chloro - o - toluidine , 2 -( or 4 -) methyl - m - phenylenediamine , 2 -( or 4 -) chloro - m - phenylenediamine , 4 - methyl - m - aminobenzoic acid , 2 -( or 3 -) hydroxy - o - aminobenzoic acid , 4 - hydroxy - m - aminobenzoic acid , 4 - chloro - 2 - aminophenol , n - ethyl , n - hydroxyehtyl - p - phenylenediamine , 4 - methyl - 2 - aminophenol , 2 - methoxy - 5 - chloroaniline , 3 - chloro - o - toluidine or 4 - chloro - o - toluidine . further example of amine [ 2 ] is naphthylamine compound , such as α - napthylamine or 1 - amino - 6 - naphtholsufonic acid . the condensation reaction is performed by that α - carboxyl group of l - leucine in which α - amino group is protected or γ - carboxyl group of l - glutamic acid in which α - amino and α - carboxyl group are protected , is activated by an acid halide , acid anhydride , acid azide , acid imidazolide or activated ester such as cyanomethyl ester , p - nitrophenyl ester , 2 , 4 - dinitrophenyl ester , n - hydroxysuccineimide ester or n - hydroxyphthalimide ester and is reacted with amine [ 2 ] or aniline derivative [ 5 ]. or the above protected l - leucine or l - glutamic acid is reacted with amine [ 2 ] or aniline [ 5 ] in the presence of condensing agent , for example carbodiimide such as n , n &# 39 ;- dicyclohexylcarbodiimide or n , n &# 39 ;- carbonylimidazole and isoxazolium salt such as woodward reagent . the above condensation reaction is carried out in an inert organic solvent such as dimethylformamide , dimethylacetamide , dimethylsulfoxide , tetrahydrofuran , dioxane , benzene , chloroform , dichloromethane or dichloroethane , with equal amount of protected amino acid and amine [ 2 ] or aniline derivative [ 5 ] at room temperature or below . the reaction process can be traced by silica gel thin layer chromatography ( tlc ) or high performance liquid chromatography ( hplc ) and can be stopped upon checking the disappearance of starting material . the thus obtained reaction product is dissolved , with or without distilling off the reaction solvent , in water immiscible organic solvent such as chloroform , dichloromethane , ethyl acetate , butyl acetate , methylisobutyl ketone , benzene or diethyl ether , washing with acidic water and alkaline water , and removing the sovent to isolate the product . if further purification is required , recrystallization is performed from suitable recrystallizing solvent or purification is made by silica gel , active alumina or adsorption resin column chromatography . removal of protective group can be made by conventional method of peptide chemistry . for example , t - butyloxycarbonyl group of α - amino group is removed by 2n - hcl in acetic acid , trifluoroacetic acid or formic acid , and benzyloxycarbonyl is removed by catalytic reduction using palladium carbon or hbr in acetic acid . benzyl ester of α - carboxyl group of l - glutamic acid is removed by catalytic reduction using palladium - carbon . the thus obtained amide compound [ 1 ] or amide compound [ 4 ] can be isolated by neutralizing the reaction mixture in case of acid decomposition removal of protective group or removing the catalyst in case of catalytic reduction , adding water immiscible organic solvent such as chloroform , dichloromethane , dichloroethane , ehtyl acetate , butyl acetate , methylisobutyl ketone , benzene or diethyl ether , washing with acidic water and alkaline water , and removing the solvent . further purification is made by recrystallization by suitable solvent or column chromatography using silica - gel , active alumina or adsorption resin . amide compound [ 1 ] or amide compound [ 4 ] can optionally be prepared as salt thereof , for example , inorganic salt such as hydrochloride , sulfate , nitrate or phosphate , or organic salt such as formate , acetate , propionate , malate , citrate , tartrate or oxalate . in the present invention , an amide compound [ 1 ] is hydrolysed by lap or γ - gtp in sample to liberate amine [ 2 ] which is oxidatively condensed with coupler [ 3 ] by the action of oxidase to form chromogenic compound ( hereinafter designates as chromogen ) examples of coupler [ 3 ] can be an aromatic compound which forms chromogen having absorption maxima at 550 - 750 nm and oxidatively condensed with amine [ 2 ] by the action of oxidase . preferable examples are phenols , aminophenols , anilines and naphthols . examples of phenols are phenol , salicylic acid , m - hydroxybenzoic acid , p - hydroxybenzoic acid , 2 , 6 - dihydroxybenzoic acid , methyl salicylate , o -( m - or p -) cresol , o -( or m -) ethylphenol , 2 , 3 -( 2 , 4 -, 2 , 5 -, 3 , 5 - or 2 , 6 -) xylenol , o -( m - or p -) methoxyphenol , 2 , 6 - dimethoxyphenol , o -( m - or p -) chlorophenol , 2 , 4 -( or 2 , 6 -) dichlorophenol , o -( m - or p -) bromophenol , 2 , 4 -( or 2 , 6 -) dibromophenol , 2 - methyl - 6 - chlorophenol , 2 - chloro - 5 - methylphenol , o - carboxymethylphenol or 2 - hydroxy - 4 - aminoethylphenol . examples of aminophenols are 4 - chloro - 2 - aminophenol , n , n - diethyl - m - aminophenol , 4 - methyl - 2 - aminophenol , 5 - amino - 2 - hydroxybenzoic acid , 2 - amino - 3 - hydroxybenzoic acid , o -( m - or p -) aminophenol , 2 , 6 - dichloro - 4 - aminophenol or 2 , 6 - dibromo - 4 - aminophenol . examples of anilines are aniline , o -( m - or p -) toluidine , n - methylaniline , n - ethylaniline , n , n - dimethylaniline , n , n - diethylaniline , n , n - dimethyl - o - toluidine , n , n - dimethyl - p - toluidine , n , n - diethyl - o - toluidine , n , n - diethyl - p - toluidine , o -( or m -) chloroaniline , m - bromoaniline , anthranilic acid , 3 - aminobenzoic acid , p - dimethylaminobenzoic acid , 4 - chloro - o - toluidine , 3 - aminoe - 4 - methylbenzoic acid , m - phenylenediamine , n , n - dimethyl - m - phenylenediamine , 4 - methyl - o - phenylenediamine , 4 - methyl - m - phenylenediamine , 2 - chloro - m - phenylenediamine , 4 - chloro - m - phenylenediamine , 3 - chloro - o - toluidine , 2 - methoxy - 5 - chloroaniline , o - ethylaniline , 2 , 5 - diethoxyaniline , n - ethyl - n - hydroxyethylaniline or n - ethyl - n - hydroxyethyl - m - toluidine . examples of naphthols are α - naphthol , β - naphthol , 1 - naphthol - 2 - carboxylic acid , 4 - chloro - 1 - naphthol , 1 - hydroxy - 2 - naphthoic acid , 1 - naphthol - 2 - sulfonic acid , 1 - naphthol - 4 - sulfonic acid , 1 - naphthol - 8 - sulfonic acid , 2 - naphthol - 6 - sulfonic acid , 2 - naphthol - 7 - sulfonic acid , 2 - naphthol - 8 - sulfonic acid , 2 - naphthol - 3 , 6 - disulfonic acid or 2 - naphthol - 6 , 8 - disulfonic acid . examples of oxidase are oxidase which consumes oxygen and which can form chromogen by oxidizing the liberated amine [ 2 ] alone or by oxidatively coupling the liberated amine [ 2 ] with coupler [ 3 ]. for example , ascorbate oxidase , laccase , tyrosinase , aminophenol oxidase , phenol oxidase or polyphenol oxidase can be mentioned . preferable examples are ascorbate oxidase obtained from pumpkin , cucumber or chayote ( sachium edule ) [ japan . unexam . pat . publ . no . 56 - 88793 ] or laccase obtained from japan ( urushi , japanese lacquer ) or bacidiomycetes ( coriolus versicolor , rhizopus or polyporus versicolor ) [ j . biochem . 50 , 264 ( 1961 ), biochim . biophys , acta , 73 , 204 ( 1963 ), acta chem . scand ., 21 , 2367 1967 )]. embodiment of lap or γ - gtp assay using amide compound [ 1 ] is as follows . in the lap assay , amide compound [ 1 ] of synthetic substrate for lap , in which r 1 is l - leucyl group , or salt thereof is treated with lap in sample ( specimen ) to liberate amine [ 2 ]. sample is a specimen serum 0 . 01 - 5 ml . enzyme reaction is carried out at 37 ° c . for 5 minutes or more . optimum ph of the enzyme is ph 6 . 5 - 8 . 0 . example of buffer solution is phosphate , borate , barbital , carbonate or tris hydroxymethylamino ethane buffer . in the γ - gtp assay , amide compound [ 1 ] of synthetic substrate for γ - gtp , in which r 1 is γ - l - glutamyl group , or salt thereof is treated with γ - gtp in sample to liberate amine [ 2 ]. amount of sample specimen is serum 0 . 01 - 5 ml . enzyme reaction proceeds at 37 ° c . for 5 minutes or more . optimum ph of the enzyme is ph 7 . 5 - 9 . 0 . the enzymatic reaction is carried out in the buffer of ph 7 . 5 - 9 . 0 containing amino acid or peptide as an acceptor such as glycylglycine to determine amine [ 2 ] which forms relative to γ - gtp activity . examples of buffer are phosphate , borate , barbital , carbonate , triethanolamine , glycine or trishydroxymethylamino methane . quantitative determination of amine [ 2 ] can be made by teating with oxidase in the presence of coupler [ 3 ]. coloring reaction is completed at optimum ph of oxidase , generally ph 6 - 7 , to form chromogen by oxidative condensation . examples of buffer used are phosphate , borate , carbonate , acetate or trishydroxymethylamino methane buffer . enzymatic reaction proceeds at approximately 37 ° c . chromogen formed by oxidative condensation of amine [ 2 ] and coupler [ 3 ] has absorption maxima at 550 - 750 nm depending upon the kind of coupler [ 3 ]. in general , the chromogen shows blue color having absorption maxima at 570 - 700 nm , with high sensitivity and stability without deviation by temperature , and is not afforded by contaminant such as birilubin , and is preferable for lap or γ - gtp assay . in the present invention , an enzymatic reaction on amide compound [ 1 ] by lap or γ - gtp and enzymatic oxidative condensation reaction by amine [ 2 ] and coupler [ 3 ] can be proceeded simultaneously . in that case , optimum ph should be a common ph for lap or γ - gtp and oxidase such as ph 7 . 0 . buffer solution can be selected by the same as hereinbefore . quantitative determination of the thus formed chromogen can preferably be made colorimetrically at specific absorption wave length of the chromogen . determination of the specific absorption wave length can be made by conventionally measuring an absorption spectrum of the chromogen , and is performed generally at 550 - 770 nm . lap or γ - gtp activity in a sample can be measured by determining an amount of consumed oxygen and is preferably made by oxygen electrode . further , the oxidase hereinabove is immobilized by known immobilizing technique and the said immobilized enzyme is combined with electrode to set up enzyme electrode . quick , simple and repeated assay can be performed by the said enzyme electrode , and the said electrode can be assembled in automatic assay system . also , the measurement by electrochemical changes on oxygen electrode can save an amount of expensive enzyme . lap or γ - gtp activity can be determined by converting from the recorded or indicated amount of an electrochemical change measured by electrode . as hereinabove explained , the present invention is simple assay method in each reaction step and is an exact and quick lap or γ - gtp assay method . moreover the chromogen formed has absorption maxima at 550 - 750 nm which cannot be affected by the contaminant in specimens . embodiment of peptidase assay using amide compound [ 4 ] is as follows . amide compound [ 4 ] or salt thereof is treated by peptidase in sample , especially lap or γ - gtp , to liberate aniline derivative [ 5 ]. the said aniline derivative is converted to chromogen by the action of oxidizing agent or oxidase , and the coloring compound is colorimetrically measured , or amount of consumed oxygen is measured by oxidase . an oxidative coloration is preferably a colorimetric assay of chromogen which is generated by oxidative condensation of coupler [ 3 ] and aniline derivative [ 5 ]. examples of coupler are aromatic compound which forms chromogen which is oxidatively condensed with aniline derivative [ 5 ], and are preferably phenol , aminophenol , aniline or naphthol series compound of the coupler [ 3 ] hereinbefore . the oxidative condensation is carried out at ph 4 - 12 to complete coloring reaction . buffers or aqueous alkaline solution for controling the ph are carbonate , phosphate , borate buffer or alkaline hydroxide solution . the condensation proceeds in the presence of oxidizing agent or oxidase which can oxidatively condense the aniline derivative [ 5 ] with coupler [ 3 ]. examples of oxidizing agent are preferably halogen series oxidizing agent such as periodate , chloramine t or hypochlorous acid , peroxide series oxidizing agent such as persulfate or hydrogen peroxide , or cyanoferric complex , and preferable example is sodium metaperiodate . preferable examples of oxidase are laccase , ascorbate oxidase or tyrosinase . oxidation by oxidase can be carried out as the same way as that of amide compound [ 1 ]. chromogen thus formed by the oxidative condensation of aniline derivative [ 5 ] and coupler [ 3 ] has maximum absorption wave length approximately at 550 - 770 nm depending on the kind of coupler , and is generally colored pigment , having 570 - 680 nm . the said pigmentation is high sensitive and stable without affecting by temperature and contaminant in specimen such as bilirubin . therefore it does no cause positive error , and so preferable for peptidase assay such as lap or γ - gtp . another colorimetric assay method of aniline derivative [ 5 ] is colorimetry of the color which is produced by treating pentacyanoferric complex with peroxide . examples of peroxide are sodium periodate , potassium periodate , potassium permanganate or hydrogen peroxide . hydrogen peroxide is preferable . stable ferric complex reagent can be obtained by mixing the above cyanoferric complex with bicarbonate such as sodium bicarbonate , lithium bicarbonate or potassium bicarbonate and low molecular dextran . the said complex mixture is stable in freeze dried powder and is preferable for a reagent of kit for colorimetric assay . colorimetric assay using cyanoferric complex is carried out at an acidic ph , preferably at ph 3 - 7 , and most preferably ph 4 - 5 . 5 . for maintaining ph conventional buffer is used . example of buffer is 0 . 01 - 1m , preferably 0 . 05 - 0 . 4m lactate , citrate or oxalate buffer . chromogen , which is formed by the reaction of cyanoferric complex and aniline derivative [ 5 ], has maximum absorption approximately at 700 nm with stable tone , and is suitable for assaying peptidase such as lap or γ - gtp . further , assay of peptidase such as lap or γ - gtp by colorimetry of chromogen , which is formed by the reaction of sodium pentacyanoacoferriate na 2 [ fe ( cn ) 5 . h 2 o ] and liberated aniline derivative [ 5 ], can be made . furthermore , the peptidase assay can be colorimetrically made by conventional chemical colorimetric assay method , for example colorimetry of aromatic amine , such as diazocoupling method , or colorimetry of schiff base which is formed by reacting with aldehyde series compound . lap assay using amide compound [ 4 ] is illustrated in details as follows . synthetic substrate for lap , l - leucyl - 3 , 5 - dihalogeno - 4 - hydroxyanilide is enzymatically reacted with lap in sample to liberate aniline derivative [ 5 ], i . e . 3 , 5 - dihalogeno - 4 - hydroxyaniline . serum 0 . 01 - 5 ml as specimen is used , and the enzymatic reaction is carried out at 37 ° c . for over 5 minutes . optimum ph of the reaction is ph 6 . 5 - 8 . 0 , and is maintained with a buffer solution such as phosphate , barbital , borate or trishydroxyaminomethane . the thus formed aniline derivative [ 5 ] can be colorimetrically determined , in the presence of coupler such as p - xylenol and alkaline condition , the formed chromogen by oxidative condensation with oxidating reagent such as sodium metaperiodate , or alternatively , colorimetrically determined by using coloration reagent obtained by oxidation of pentacyanoaminoferroate with oxidating reagent such as hydrogen peroxide . further , colorimetric assay can be made by treating with oxidase to consume oxygen and liberate chromogen , and measuring the consumed oxygen or formed chromogen . embodiment of γ - gtp assay using amide compound [ 4 ] is illustrated in details as follows . synthetic substrate for γ - gtp , γ - l - glutamyl - 3 , 5 - dihalogeno - 4 - hydroxyanilide is enzymatically reacted with γ - gtp in sample to liberate aniline derivative [ 5 ] of 5 - dihalogeno - 4 - hyroxyaniline . amount of sample specimen is serum 0 . 01 - 5 ml . enzymatic reaction of γ - gtp is carried out at 37 ° c . for over 5 minutes at optimum ph of ph 7 . 5 - 9 . 0 . reaction can be carried out in a buffer of ph 7 . 5 - 9 . 0 containing amino acid or peptide , as an acceptor , such as glycylglycine , and aniline derivative [ 5 ], which is formed in proportion to γ - gtp activity , is determined . examples of buffer solution are phosphate , barbital , borate , carbonate , triethanolamine , glycine or tris ( hydroxymethyl ) aminomethane . determination of aniline derivative [ 5 ] can be made by the same way as of in an assay of lap . as explained hereinabove , an assay method of the present invention using synthetic substrate amide compound [ 4 ] is simple in each reaction step and so peptidase such as lap or γ - gtp can be assayed rapidly and accurately . furthermore , since the formed chromogen has maximum absorption at 550 - 750 nm , an affect of contaminant in specimen can be avoided , and hence the accurate assay of peptidase can be provide . further , an assay method of the present invention is carried out with mild enzymatic reaction step , moreover lap or γ - gtp can be enzymzatically assayed with simple single step reaction . the method can easily be set up for automatic system , and so rate assay , which has been impossible by conventional prior chemical assay method , can be possible . following examples illustrate the present invention but are not construed as limiting . a solution ( 25 ml ) of boc - leu - osu ( 3 . 28 g , 10 mm ) in dioxane was added dropwise with stirring at 0 °- 5 ° c . in 2 , 6 - dichloro - 4 - aminophenol ( 1 . 78 g , 10 mm ) and sodium bicarbonate ( 0 . 92 g , 15 mm ) dissolved in water ( 25 ml ). mixture was stirred for overnight at room temperature and dioxane was distilled off in vacuo at below 30 ° c . residue dissolved in ethyl acetate ( 200 ml ) was washed three times with saturated sodium bicarbonate , water , 1n - hcl and saturated nacl solution ( each 50 ml ). ethyl acetate layer was dried with anhydrous magnesium sulfate and concentrated in vacuo to obtain boc - l - leucyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 2 . 96 g ). the product dissolved in 2n - hcl / acoh ( 15 ml ) was stirred at room temperature and crystallized by adding dry diethyl ether ( 100 ml ) which was subjected to twice decantation with dry ether . crystals were dried in vacuo to obtain l - leucyl - 3 , 5 - dichloro - 4 - hydroxyanilide . hcl . mol . formula : c 12 h 16 n 2 o 2 cl 2 . hcl a solution ( 70 ml ) of boc - leu - osu ( 6 . 01 g , 18 . 3 mm ) in dioxane was added dropwise at 0 °- 5 ° c . in 2 , 6 - dibromo - 4 - aminophenol ( 4 . 90 g , 18 . 8 mm ) and sodium bicarbonate ( 1 . 68 g , 20 mm ) dissolved in water ( 20 ml ). mixture was stirred at room temperature for over - night and dioxane was distilled off at below 30 ° c . residue dissolved in ethyl acetate ( 400 ml ) and washed three times with saturated aqueous sodium bicarbonate , water , 1n - hcl and saturated nacl solution ( each 100 ml ). ethyl acetate layer was dried with anhydrous magnesium sulfate and concentrated in vacuo to obtain boc - l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 . 8 g ). the product dissolved in 2n - hcl / acoh ( 3 . 0 ml ) was stirred at room temperature for 2 hours , then dry ether was added therein to crystallize the product l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl . mol . formula : c 12 h 16 n 2 o 2 br 2 ( 416 . 54 ) n . n - phthaloyl - l - glutamic acid anhydride ( 5 . 16 g , 20 mm ) and 4 - amino - 2 , 6 - dichlorophenol ( 3 . 56 g , 20 mm ) dissolved in dioxane ( 50 ml ) was stirred at 60 ° c . for 2 hours . dioxane was distilled off in vacuo and hydrazine hydrate ( 1 . 5 ml ) in methanol ( 50 ml ) was added therein , then allow to stand at room temperature for 2 days . methanol was distilled off in vacuo , added water to the residue and adjusted to ph 3 by adding 0 . 5n - hcl to obtaine precipitated γ - l - glutamyl - 3 . 5 - dichloro - 4 - hydroxyanilide ( 3 . 96 g ). mol . formula : c 11 h 12 n 2 o 4 cl n , n - phthaloyl - l - glutamic acid anhydride ( 2 . 18 g , 8 . 4 mm ) and 4 - amino - 2 , 6 - dichlorophenol ( 2 . 26 g , 8 . 4 mm ) dissolved in dioxane ( 20 ml ) was stirred at 60 ° c . for 1 . 5 hour . dioxane was distilled off in vacuo , and hydroazine hydrate ( 0 . 7 ml ) in methanol ( 20 ml ) was added to the residue , then allowed to stand at room temp . for 2 days . methanol was distilled off in vacuo , added water to the residue and adjusted to ph 3 by adding 0 . 5n - hcl to obtain precipitated γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 2 . 13 g ). mol . formula : c 11 h 12 n 2 o 4 br 2 substrate solution containing 0 . 1m phosphate buffer solution ( ph 7 . 0 ) of l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl ( 2 mm ) and coupler potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) was prepared . laccase solution ( 100 μl , 330 u ) obtained from poryporus versicolor and serum ( lap : 879 g - r units / ml , 50 μl ) were added to the substrate solution ( 2 . 0 ml ) and incubated at 37 ° c . to form pigment . ( the absorption spectrum of pigment is shown in fig5 absorption maximum at 655 nm ). in the reaction , absorption at 655 nm of the formed pigment was continuously measured at each time . result is shown in fig6 . fig7 is shown the result obtained by using serum of 414 g - r units / ml . as shown in fig6 and 7 , serum lap activity can be exactly measured by an assay method of the present invention , and contrary to the prior known chemical colorimetry , reaction mixture is colored simultaneously with starting lap action , hence rate assay can be possible . substrate containing l - leucyl - 4 - n , n - diethylanilide . 2hcl ( 2 mm ) and coupler phenol ( 1 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and serum ( 50 μl , lap : 879 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . to form pigment . in the reaction , color ( maximum absorption at 670 nm ) formed each reaction time was continuously measured at 670 nm . result is shown in fig8 . as shown in fig8 an assay method of the present invention is simple and exact assay method for lap , meoreover reaction mixture became colored simultaneously with starting lap action , in which rate assay can be possible . absorption curve of the pigment formed by the above process at each wave length is shown in fig9 wherein the maximum absorption is at 670 nm . lap assay using l - leucyl - 4 - n , n - diethylaminoanilide , coupler ( 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol and 2m6 - dimethylphenol ) and laccase in example 5 , 1 - naphthol - 2 - sulfonate was replaced by 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol or 2 , 6 - dimethylphenol to prepare substrate solution containing l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl ( 2 mm ) and coupler ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ). laccase solution ( 100 μl , 330 u ) and serum ( 50 μl , lap : 879 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . after 10 minutes , absorption of pigment formed was measured at maximum absorption wave length thereof . result is shown in table 1 . table 1______________________________________ maximumcoupler absorption optical density______________________________________2 , 3 - dimethylphenol 630 nm 0 . 1682 , 4 - dimethylphenol 630 nm 0 . 1872 , 5 - dimethylphenol 650 nm 0 . 2312 , 6 - dimethylphenol 630 nm 0 . 193______________________________________ lap assay using l - leucyl - 4 - n , n - diethylaminoaniline , coupler ( 1 - naphthol - 2 - sulfonate , phenol , 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol or 2 , 6 - dimethylphenol ) and ascorbate oxidase substrate solution containing l - leucyl - 4 - n , n - diethylaminoaniline . 2hcl ( 2 mm ) and coupler ( potassium 1 - naphthol - 2 - sulfonate , phenol , 2 , 3 - dimethylphenol , 2 , 4 - dimethylphenol , 2 , 5 - dimethylphenol or 2 , 6 - dimethylphenol ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . ascorbate oxidase obtained from chayote ( sechium edule ) solution ( 100 μl , 130 u ) and serum ( 50 μl , lap : 879 g - r units / ml ) were added and incubated at 37 ° c . after 10 minutes , absorption of pigment formed was measured at maximum absorption wave length thereof . result is shown in table 2 . table 2______________________________________ maximum optical densitycoupler absorption ( od ) ______________________________________1 - naphtol - 2 - sulfonate 655 nm 0 . 411phenol 670 nm 0 . 3472 , 3 - dimethylphenol 630 nm 0 . 3562 , 4 - dimethylphenol 630 nm 0 . 2672 , 5 - dimethylphenol 650 nm 0 . 2222 , 6 - dimethylphenol 630 nm 0 . 427______________________________________ in example 5 , l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl was replaced by l - leucyl - 4 - n , n - dimethylaminoanilide . 2hcl and serum ( lap : 879 g - r units / ml ) was added , and the remaining procedure was carried out as same as in example 5 . maximum absorption of the pigment bormed was 650 nm , and absorption ratio of each reaction time was measured at 650 nm . result is shown in fig1 . as shown in fig1 , lap activity can be assayed by the method of the present invention . in example 6 , l - leucyl - 4 - n , n - diethylaminoanilide . 2hcl was replaced by l - leucyl - 4 - n , n - dimethylaminoanilide . 2hcl and operation was performed as same as in example 6 . maximu absorption wave length of the pigment formed was at 655 nm . absorption ratio at each reaction time is shown in fig1 . as shown in fig1 , lap assay of the present invention is excellent . substrate solution containing l - leucyl - 3 . 5 - dibromo - 4 - hydroxyanilide . hcl ( 2 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . a solution ( 20 μl ) containing ascorbate oxidase ( 130 u ) and arylamidase ( boehringer , 1000 g - r units / ml ) was added to the substrate solution ( 2 ml ) and incubated at 37 ° c . at each reaction time , absorption of the formed pigment was measured at 630 nm . result is shown in fig1 . as shown in fig1 , the assay method of the present invention provides excellent lap assay , and rate assay can be possible because of simultaneous coloring with starting the lap reaction . absorption curve of the pigment is shown in fig1 . substrate solution ( 1 . 0 ml ) prepared by the same as in example 11 was added in the reaction cell ( inner volume : 1 ml ) assembled with oxygen electrode and pre - heated to 37 ° c . a solution ( 100 μl ) containing ascorbate oxidase ( 350 u ) and arylamidase ( 1000 g - r units / ml ) was added thereto and incubated at 37 ° c . amount of consumed oxygen at each time was measured by oxygen electrode . result is shown in fig1 , in which assay can advantageously be made by oxygen electrode . in the same experiment , ascorbate oxidase was replaced by laccase ( 250 u ), in which excellent result was obtained as shown in fig1 . in example 11 , 1 - naphthol - 2 - sulfonate was replaced by phenol or 2 . 5 - dimethylphenol ( 0 . 5 mm ) to prepare substrate solution . a solution ( 20 μl ) containing laccase ( 330 u ) and arylamidase ( 1000 g - r units / ml ) was added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ratio of teh formed pigment was measured by maximum absorption wave length . result is shown in table 3 . table 3______________________________________ maximum optical absorption densitycoupler wave length ( od ) ______________________________________phenol 610 nm 0 . 1602 , 5 - dimethylphenol 585 nm 0 . 452______________________________________ substrate solution containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl ( 2 . 5 mm ) and phenol ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . tyrosinase solution ( 100 μl , 300 u ) and arylamidase ( 1000 g - r units / ml , 20 μl ) were added in substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 610 nm . ( od 610 = 0 . 158 ). lap can be assayed with good result . substrate solution containing l - leucyl - 2 - methyl - 4 - aminoanilide . 2hcl ( 2 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to substrate solution ( 2 ml ) and incubated at 37 ° c . for 30 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 565 nm ( od 565 = 0 . 143 ). substrate solution containing l - leucyl - 4 - aminoanilide . 2hcl ( 2 . 5 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to substrate solution ( 2 ml ) and incubated at 37 ° c . for 30 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 565 nm ( od 565 = 0 . 143 ). substrate solution containing l - leucyl - 4 - n , n - dipropylaminoanilide . 2hcl ( 2 mm ) and potassium p - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ration of the formed pigment was measured at maximum absorption wave length at 650 nm ( od 650 = 0 . 430 ). substrate solution containing l - leucyl - 3 , 5 - dichloro - 4 - hydroxyanilide . hcl ( 2 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ). laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 20 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at 630 nm . ( od 630 = 0 . 535 ). the above 1 - naphthol - 2 - sulfonate was replaced by 0 . 5 mm phenol and measured the formed pigment at 610 nm . ( od 610 = 0 . 111 ). laccase ( 100 μl , 330 u ) and arylamidase solution ( 20 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ) containing l - leucyl - 4 - n - ethyl - n - hydroxyethylaminoanilide . 2hcl ( 2 mm ) and 2 , 6 - dibromophenol ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ), and incubated at 37 ° c . for 5 minutes . absorption ratio of the formed pigment was measured at 705 nm . ( od 705 = 1 . 47 ). in example 19 , l - leucyl - 4 - n - ethyl - n - hydroxyethylaminoanilide . 2hcl was replaced by l - leucyl - anilide . hcl ( 2 mm ). absorption ratio of the formed pigment was measured at its maximum absorption wave length at 655 nm . ( od 655 = 0 . 178 ). in example 19 , l - leucyl - 4 - n - ethyl - n - hydroxyethylaminoanilide . 2hcl was replaced by l - leucyl - 2 - ethylanilide . hcl ( 2 mm ). absorption ratio of the formed pigment was measured at its maximum absorption wave length at 675 nm . ( od 675 = 0 . 428 ). laccase solution ( 100 μl , 330 u ) and arylamidase solution ( 50 μl , 1000 g - r units / ml ) were added to the substrate solution containing l - leucyl - 2 - carboxyanilide . hcl ( 2 mm ) and 3 , 5 - dibromo - 4 - hydroxyaniline ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ), and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 645 nm . ( od 645 = 0 . 397 ). in the above , 3 , 5 - dibromo - 4 - hydroxyaniline was replaced by 4 - n , n - diethylaminoaniline . 2hcl ( 0 . 5 mm ). absorption ratio of the formed pigment was measured by its maximum absorption wave length at 690 nm . ( od 690 = 0 . 613 ). substrate solution containing synthetic substrate ( 2 mm ) and coupler ( 0 . 5 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) were prepared . laccase solution ( 100 μl , 330 u ) arylamidase ( 50 μl , 1000 g - r units / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length . result is shown in table 4 . table 4______________________________________synthetic substrate for lapcoupler ( a ) ( b ) ( c ) ______________________________________ ( 1 ) od . sub . 705 = 3 . 712 od . sub . 730 = 1 . 849 ( 2 ) od . sub . 670 = 1 . 031 od . sub . 705 = 0 . 187 od . sub . 700 = 0 . 168 ( 3 ) od . sub . 660 = 0 . 508 od . sub . 695 = 0 . 259 ( 4 ) od . sub . 580 = 0 . 567 od . sub . 635 = 0 . 157 ( 5 ) od . sub . 655 = 0 . 45 od . sub . 690 = 0 . 301 od . sub . 690 = 0 . 271 ( 6 ) od . sub . 675 = 0 . 396 od . sub . 710 = 0 . 260 od . sub . 700 = 0 . 234 ( 7 ) od . sub . 645 = 0 . 401 od . sub . 690 = 0 . 244 od . sub . 690 = 0 . 219 ( 8 ) od . sub . 600 = 0 . 495 od . sub . 665 = 0 . 201 ( 9 ) od . sub . 590 = 0 . 693 od . sub . 650 = 0 . 329 ( 10 ) od . sub . 715 = 0 . 421 od . sub . 745 = 3 . 79 ( 11 ) od . sub . 740 = 3 . 54 ( 12 ) od . sub . 675 = 1 . 08 od . sub . 700 = 2 . 05 ( 13 ) od . sub . 575 = 0 . 338 od . sub . 640 = 0 . 157 ( 14 ) od . sub . 700 = 0 . 261 od . sub . 730 = 1 . 01 od . sub . 725 = 0 . 907 ( 15 ) od . sub . 705 = 0 . 536 od . sub . 730 = 1 . 22 ( 16 ) od . sub . 650 = 0 . 698 od . sub . 690 = 0 . 449 od . sub . 680 = 0 . 404 ( 17 ) od . sub . 650 = 0 . 495 od . sub . 685 = 0 . 203 ( 18 ) od . sub . 605 = 0 . 338 ( 19 ) od . sub . 590 = 0 . 468 ( 20 ) od . sub . 630 = 0 . 842 ( 21 ) od . sub . 610 = 0 . 63 ( 22 ) od . sub . 635 = 0 . 567 ( 23 ) od . sub . 580 = 0 . 356 od . sub . 640 = 0 . 05 ( 24 ) od . sub . 590 = 0 . 419______________________________________ substrate solution containing γ - l - glutamyl - 4 - n , n - diehtylaminonilide ( 5 mm ), glycylglycine ( 100 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 50 mm phosphate buffer ( ph 8 . 0 ) was prepared . laccase ( 100 μl , 1000 u / ml ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . absorption ratio of the formed pigment was measured at each reaction time at 655 nm . result is shown in fig1 . serum ( γ - gtp : 105 mu / ml ) was measured and the result is shown in fig1 . as shown in fig1 and 17 , γ - gtp activity can be excellently assayed by the method of the present invention , and reaction mixture is colored simultaneously with starting γ - gtp action and so rate assay can be possible . absorption curve of the formed pigment is shown in fig1 . substrate solution ( 1 ml ) in example 24 was added in reaction cell ( inner volume 1 ml ) set with oxygen electrode and pre - heated at 37 ° c . a solution ( 100 μl ) containing laccase ( 200 u ) and serum ( γ - gtp : 416 mu / ml ) was added thereto , then incubated at 37 ° c . amount of consumed oxygen was measured by oxygen electrode . oxygen consumed rate is shown in fig1 , in which showing γ - gtp activity can advantageously be measured . substrate solution ( 2 ml ) was prepared by the same way as in example 24 . ascorbate oxidase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added thereto and incubated at 37 ° c . for 5 minutes and 10 minutes , respectively . absorption ratio of the formed pigment was measured in each time at 655 nm ( maximum absorption wave length ). optical density at 655 nm at 5 minutes reaction is od 655 = 0 . 949 , and at 10 minutes if od 655 = 1 . 895 . substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ), glycylglycine ( 100 mm ) and potassium 1 - naphthol - 2 - sulfonate ( 0 . 5 mm ) in 50 mm borate buffer ( ph 7 . 1 ) was prepared . laccase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 10 minutes . absorption ratio of the formed pigment was measured at its maximum absorption wave length at 630 nm . ( od 630 = 1 . 044 ). laccase was replaced by tyrosinase solution ( 100 μl , 100 u ) in the above experiment , and conducted the same way as above . result was od 630 = 1 . 042 . γ - gtp assay using various synthetic substrate for γ - gtp and coupler and ascorbate oxidase substrate solution containing substrate ( 5 mm ), glycylglycine ( 100 mm ) and coupler ( 0 . 5 mm ) in 50 mm borate buffer ( ph 8 . 0 ) was prepared . ascorbate oxidase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to the substrate solution ( 2 ml ), and incubated at 37 ° c . for 5 minutes . absorption ratio of the formed pigment was measured at maximum absorption wave length thereof . result is shown in table 5 . table 5______________________________________cou - synthetic substratepler ( a ) ( b ) ( c ) ( d ) ______________________________________ ( 1 ) od . sub . 650 = 0 . 978 od . sub . 650 = 0 . 902 od . sub . 630 = 0 . 803 ( 2 ) od . sub . 585 = 0 . 645 ( 3 ) od . sub . 705 = 0 . 368 od . sub . 700 = 0 . 379 od . sub . 670 = 1 . 120 ( 4 ) od . sub . 635 = 0 . 313 od . sub . 595 = 0 . 322 od . sub . 580 = 0 . 511 ( 5 ) od . sub . 730 = 1 . 362 od . sub . 725 = 1 . 404 ( 6 ) od . sub . 730 = 1 . 627 od . sub . 705 = 1 . 907 ( 7 ) od . sub . 740 = 2 . 426 ( 8 ) od . sub . 700 = 1 . 871 od . sub . 675 = 0 . 826 ( 9 ) od . sub . 695 = 0 . 453 od . sub . 655 = 0 . 495 ( 10 ) od . sub . 650 = 0 . 331 od . sub . 590 = 0 . 622 ( 11 ) od . sub . 590 = 0 . 605 ( 12 ) od . sub . 640 = 0 . 297 ( 13 ) od . sub . 655 = 0 . 562 od . sub . 610 = 0 . 717______________________________________ substrate solution containing l - leucyl - 3 , 5 - dichloro - 4 - hydroxynilide . hcl ( 5 mm ) dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . serium specimen obtained from patient ( 20 μl , lap : 236 g - r units ) was added to the substrate solution ( 1 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 3 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . adsorption ratio of the formed color was measured at 585 nm to obtain od 585 = 0 . 18 . substrate solution containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanolide . hcl ( 5 mm ) dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . serum specimen obtained from patient ( 20 μl , lap : 250 g - r units ) was added to the substrate solution ( 1 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 3 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio of the color was measured at 585 nm . ( od 585 = 0 . 18 ). substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ) and glycyclglycine ( 5 mm ) in 5 mm tris - hcl buffer ( ph 8 . 0 ) was prepared . serum specimen ( 10 μl , γ - gtp : 130 mu / ml ) was added to the substrate solution ( 0 . 5 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 2 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio was measured at 585 nm . ( od 585 = 0 . 112 ). substrate solution containing γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ) and glycylglycine ( 100 mm dissolved in 50 mm tris - hcl buffer ( ph 8 . 0 ). patients &# 39 ; s serum specimen ( 10 μl , γ - gtp : 130 mu / ml ) was added to the substrate solution ( 0 . 5 ml ) and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 2 ml ) containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio was measured at 585 nm ( od 585 = 0 . 140 ). substrate solution ( 5 mm ) containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . patient &# 39 ; s serum specimen ( 20 μl , lap : 250 g - r units ) was added to the substrate solution ( 1 ml ) and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution ( 3 ml ) containing sodium metaperiodate ( 2 mm ) and 2 - chloro - 5 - methylphenol ( 5 mm ) in 0 . 2n - koh was added to develop color . absorption ratio of the color at 635 nm was measured . ( od 635 = 0 . 33 ). substrate solution containing γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ) and glycylglycine ( 100 mm ) dissolved in 50 mm tris - hcl buffer ( ph 8 . 0 ) was prepared . patient &# 39 ; s serum specimen ( 10 μl , γ - gtp : 130 mu / ml ) was added to the substrate solution ( 0 . 5 ml ) and incubated at 37 ° c . for 20 minutes . oxidizing reagent ( 2 ml ) containing sodium metaperiodate ( 2 mm ) and 2 - chloro - 5 - methylphenol ( 5 mm ) in 0 . 2n - koh was added to develop color . absorption ratio at 635 nm was measured to obtain od 635 = 0 . 214 . 0 . 3 % hydrogen peroxide ( 60 ml ) was added to sodium pentacyanoaminoferroate ( 2 g ) dissolved in water ( 20 ml ), and further 10 % sodium bicarbonate solution ( 20 ml ) was added . dextran t - 10 ( pharmacia , 4 g ) was added therein to prepare color developer undiluted solution . reaction stopper - color developer undiluted solution was prepared by adding 0 . 2m citrate buffer ( 50 ml , ph 4 . 5 ) containing 1 % nacl and 0 . 5 % tween 80 to the color developer undiluted solution ( 1 ml ). serum specimen obtained from patient ( 20 μl , lap : 250 g - r units ) was added to l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl ( 5 mm ) dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) ( 1ml ), mixed well and incubated at 37 ° c . for 20 minutes . reaction stopper - color developer solution ( 5 ml ) was added and allowed to stand at room temperature for 20 minutes to develop color . absorption ratio for 700 nm was measured to obtain od 700 = 0 . 21 . patient &# 39 ; s serum specimen ( 20 μl , γ - gtp : 130 mu / ml ) was added to a solution ( 1 ml ) dissolved γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ) and glycylglycine ( 100 mm ) in 50 mm tris - hcl buffer ( ph 8 . 0 ), mixed well and incubated at 37 ° c . for 20 minutes . reaction was stopped and developed as same as in example 35 to obtain the absorption ratio of od 700 = 0 . 132 . substrate solution ( 5 mm ) containing l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl dissolved in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . patient &# 39 ; s serum specimen ( 20 μl , lap : 250 g - r units ) was added to the substrate solution ( 1 ml ), mixed well and incubated at 37 ° c . for 15 minutes . a solution ( 4 ml ), prepared by adding 0 . 2m edta . 2na solution ( ph 11 , 90 ml ) in 1 % sodium pentacaynoacoferriate ( 30 ml ), was added thereto and incubated at 37 ° c . for 15 minutes . absorption ratio was measured at 730 nm to obtain od 730 = 0 . 232 . 1 % sodium pentacyanoacoferriate was prepared by uv - irradiation for 15 minutes to a solution of 1 % sodium nitroprussid na [ fe ( cn ) 5 no ]- 1 % sodium carbonate . substrate solution containing hydroxynilide ( 5 mm ) and glycylglycine ( 100 mm ) in 50 mm tris - hcl buffer ( ph 8 . 0 ) was prepared . serum γ - gtp ( 74 - 370 mu / ml , 10 μl ) was added to the substrate solution ( 0 . 5 ml ), mixed well and incubated at 37 ° c . for 20 minutes . oxidizing reagent solution containing sodium metaperiodate ( 2 mm ) and p - xylenol ( 10 mm ) in 0 . 2n - koh was added to develop color . absorption ratio of the formed color was measured at 585 nm . result is shown in fig2 in which serium γ - gtp can be measured advantageously . substrate solution containing l - leucyl - 3 . 5 - dichloro - 4 - hydroxyanilide . hcl ( 2 mm ) or l - leucyl - 3 , 5 - dibromo - 4 - hydroxyanilide . hcl ( 2 mm ) and 2 , 5 - dimethylphenol ( 2 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . ascorbate oxidase ( 130 u ) and patient &# 39 ; s serum psecimen ( 20 μl , lap : 1113 g - r units / ml ) were added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ration was measured at its maximum absorption wave length . results are : substrate solution containing l - leucyl - 3 . 5 - dichloro - 4 - hydroxyanilide . hcl ( 2 mm ) and 2 , 5 - dimethylphenol ( 2 mm ) in 0 . 1m phosphate buffer ( ph 7 . 0 ) was prepared . a solution ( 20 μl ) containing laccase ( 330 u ) and arylamidase ( 1000 g - r units / ml ) was added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 10 minutes . absorption ratio at 585 nm was od 585 = 0 . 386 . substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ), glycylglycine ( 100 mm ) and 2 , 5 - dimethylphenol ( 0 . 5 mm ) in 50 mm borate buffer ( ph 8 . 0 ) was prepared . ascorbate oxidase ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) was added to the substrate solution ( 2 ml ) and incubated at 37 ° c . for 5 minutes . absorption ratio at 585 nm was od 585 = 0 . 547 . substrate solution containing γ - l - glutamyl - 3 , 5 - dichloro - 4 - hydroxyanilide ( 5 mm ) or γ - l - glutamyl - 3 , 5 - dibromo - 4 - hydroxyanilide ( 5 mm ), glycylglycine ( 100 mm ) and 2 , 5 - dimethylphenol ( 0 . 5 mm ) in 50 mm borate buffer ( ph 8 . 0 ) was prepared . laccase solution ( 100 μl , 100 u ) and serum ( 50 μl , γ - gtp : 416 mu / ml ) were added to each substrate solution ( 2 ml ), and incubated at 37 ° c . for 5 minutes . absorption ratio of the formed color was measured . results are :
| 8 |
for a general understanding of the present invention , reference is made to the drawings . in the drawings , like reference numerals have been used throughout to designate identical elements . the low impedance radiofrequency ( rf ) shielded window is depicted as being installed in an enclosure , however , the radiofrequency shielded window of the present invention may be installed in a variety of enclosures , containers , shelters , buildings , walls , ceilings , cabinets , and the like . while the use of a screen material for radiofrequency shielding in combination with a clear material such as a glass or plastic is known , the specific arrangement of shielded window layers as disclosed herein to achieve low impedance shielding effectiveness has heretofore been unknown . specifically , each layer of screen in a typical radiofrequency shielded window only provides 20 - 40 db of rf shielding , and thus to achieve greater shielding effectiveness these layers are commonly stacked . with each layer isolated from the other , the current from the upper layer passes through the lower layer &# 39 ; s path to ground , thus effectively “ lifting ” the ground of the upper layer from true ground , making the upper layer less effective than it would be without this ground shift effect . essentially , this problem of decreased shielding effectiveness is akin to resistors in series , where each shielding layer is equivalent to a resistor in series . at higher frequencies , inductance of this ground path can be , for example , 5 - 10 nanohenries and at 2 gigahertz this is equivalent to 10 - 20 ohms ; thus the ground of the window shielding layer is diminished by this resistance . series stacking of shielded windows has diminishing returns as related to shielding effectiveness . the present invention , however , overcomes the problem of ground lifting of series stacked radiofrequency shielded windows by essentially placing the ground paths of each radiofrequency shielded window in parallel such that each layer goes to ground independently of the other . fig7 depicts a typical equivalent circuit of a two layer rf shielded window of the present invention . the physical structure and implementation of such a novel arrangement will be described in further detail below . turning now to fig1 , an exploded perspective view of a low impedance radiofrequency shielded window used with a shielded enclosure is depicted . while two window layers are depicted , in some embodiments of the present invention there may be three or more window layers interconnected in a similar manner to that which will be further described . each window layer has a conductive mesh surface and an insulating surface . the conductive mesh surface may have a conductive mesh such as copper mesh or screening attached to , bonded or printed to it . in some embodiments of the present invention , the conductive mesh may comprise more of a coating or a film than a true mesh , in such a way that radiofrequency shielding is accomplished . thus , mesh refers to any radiofrequency shielded coating that maintains optical transparency or visibility regardless of the size of the mesh openings , or lack thereof . on the opposing surface of each window layer , there is no conductive mesh and therefore it is considered an insulating surface . the conductive mesh surface and the insulating surface make up opposing sides to each window layer . in fig1 , the first window layer 109 comprises a perimeter , a conductive mesh surface and an insulating surface . a first conductive perimeter layer 115 makes ohmic contact with the conductive mesh surface of the first window layer and extends past the insulating surface of the first window layer 109 to allow contact to ground . the window layers may be made from glass , a plastic such as polycarbonate , or the like . a second window layer 111 also comprises a perimeter , a conductive mesh surface and an insulating surface . a second conductive perimeter layer 119 makes ohmic contact with the conductive mesh of the second window layer 111 and extends past the insulating surface of the first window layer , where it makes contact to ground independently of the first window layer . the first conductive perimeter layer 115 and the second conductive perimeter layer 119 make mechanical and ohmic contact along the insulating surface of the first window layer 109 , thus creating a separate path to ground for each window layer . in some embodiments of the present invention , the second conductive perimeter layer 119 makes ohmic contact with the conductive mesh of the second window layer ill and extends to the first conductive perimeter layer 115 . the first conductive perimeter layer 115 and the second conductive perimeter layer 119 make mechanical and ohmic contact along the perimeter of the first window layer 109 . the conductive mesh of each layer therefore goes independently to ground . each conductive perimeter layer folds over such that each layer contacts the grounding wall of the enclosure at the same or a similar point . while the conductive mesh may simply be a fine mesh screen attached to or otherwise connected with a glass or plastic pane , in some embodiments of the present invention , the conductive mesh may be screen printed on a polycarbonate film or similar substrate to make up the conductive mesh surface of each window layer . there are disadvantages to the use of wire mesh in radiofrequency shielding including the degradation over time of many of the wire junctions in the wire mesh , creating a high impedance junction and associated shielding degradation . the use of screen printed wire mesh on each window layer solves the problem of ground path and associated shielding degradation . in addition , thin film coatings that may be optically transparent or provide good visual clarity may also be used . an example of such a coating is indium - tin - oxide ( ito ). other conductive shielding materials may also be used . the opposing side of each window layer that does not contain conductive mesh is in turn referred to as the insulating surface . the conductive mesh surface and the insulating surface of each window layer are each a planar surface of their respective window layer . in some embodiments of the present invention , the conductive mesh is embedded or otherwise molded , sandwiched or contained within a window layer , and the terms conductive mesh surface and insulating surface may in fact be somewhat arbitrary , but still serve a useful purpose in defining the fact that each window layer has two opposing surfaces and a conductive layer integrated therein . in some embodiments of the present invention , more than two window layers may be employed . for example , three or four window layers may provide additional signal attenuation that is necessary for some applications . to further improve on shielding effectiveness , the conductive mesh of each window layer may be overlaid at an angle with the orientation of the conductive mesh of the previous layer . an overlay angle of between 30 and 60 degrees , for example , may be suitable . a protective layer 113 may also optionally be employed to protect the radiofrequency shielded window layers . the protective layer 113 may be a clear polycarbonate , acrylic , or the like . the conductive perimeter layers are , in some embodiments of the present invention , a conductive tape such as , for example , a fabric conductive tape such as a silver fabric conductive tape . to make the described window layer assembly using such a conductive tape , the tape is applied half way on to the edge of each window layer with the remaining half left free while other assembly steps are completed . the other window layers are constructed the same way . to complete the assembly , the free edges of the conductive tape are folded over so that each layer &# 39 ; s conductive tape connects at the same point , typically where the overall window assembly is fastened to an enclosure wall . using this novel arrangement , each layer has its own path to ground and one layer does not have to go through another layer to get to ground . when attaching one window layer to another window layer , the first conductive perimeter layer 115 and the second conductive perimeter layer 119 ( or additional conductive perimeter layers ) are aligned where there are no seams between the conductive perimeter layers ( for example , conductive tape ). an example of such an arrangement can be seen in fig1 as well as fig4 and 6 . the conductive tape or other conductive perimeter layer are arranged such that the seams of one layer overlap the seams of another layer , ensuring that seams of different layers are not superimposed on each other where they would permit radiofrequency signal leakage . various techniques to ensure proper mechanical and electrical connection of each layer may be used . for example , rivets , bolts , screws , clips , adhesives , wire , clamps , or the like , may be used as fasteners . in the example provided herein , fasteners 107 such as bolts may be used . to receive the fasteners 107 , mounting holes may be placed around the periphery of each window layer or at other suitable locations . for example , first window layer mounting holes 117 can be seen in fig1 along with second window layer mounting holes 121 . additional window layers would also have similar mounting holes , as well as optional protective layer mounting holes 123 . a radiofrequency shielded enclosure 101 can be seen in fig1 . the radiofrequency shielded enclosure depicted is merely an example , and should not be considered a limitation . for example , while conductive sleeves are depicted as part of the radiofrequency shielded enclosure , they may be omitted entirely , modified , or replaced with conductive gloves , mittens , probes , or the like . in the example depicted in fig1 , a radiofrequency shielded cover 103 can be seen . the radiofrequency shielded enclosure is made from a conductive material such as a metal , for example , steel or copper . the radiofrequency shielded cover 103 is also made from a conductive material 105 such as a metal , for example , steel or copper . fasteners 107 can be seen that have been attached to the radiofrequency shielded cover 103 where the opening for the low impedance radiofrequency shielded window can be seen . the radiofrequency shielded enclosure comprises a volume defined by conductive surfaces enclosing said volume to create a faraday cage enclosure . the low impedance radiofrequency shielded window is placed in the opening , and the fasteners 107 pass through the mounting holes in each window layer , and are tightened securely in place , creating a radiofrequency tight seal . of course the low impedance radiofrequency shielded window can be placed in another location on the enclosure where a sufficient opening has been fabricated . fig2 is a plan view of the low impedance radiofrequency shielded window installed in a cover for a shielded enclosure . the angled overlay of conductive mesh patterns in the window layers can be seen . also the second conductive perimeter layer 119 can be seen as well as fasteners around the perimeter of the window assembly . taking a cross section along line a - a of fig2 , fig3 depicts the resulting cross sectional view of the low impedance radiofrequency shielded window . the conductive material 105 from a cover , panel or wall of a radiofrequency shielded enclosure can be seen along with the first window layer 109 and the second window layer 111 , covered by a protective layer 113 . fig4 depicts an exploded view of the low impedance radiofrequency shielded window installed in a cover for a shielded enclosure . the skewed or staggered seams of the conductive perimeter layers can be seen along with the overlay of the conductive mesh of the window layers . it should be noted that there may be more than two window layers in some embodiments of the present invention that are interconnected with parallel ground paths as described herein . it should be noted that each layer terminates independently to ground . for example , the conductive perimeter layers are wrapped in such a way that they each have an independent path to ground ( in this case the shielded enclosure ) as seen in fig5 . the layers are not merely stacked , as this would result in each previous layer being in the path to ground for the subsequent layers . fig5 is a close up diagrammatic view of the layers of the low impedance radiofrequency shielded window . the way in which the first conductive perimeter layer 115 and the second conductive perimeter layer 119 make contact with the window layers and each layer then contacts ground independently can be clearly seen . additional window layers may be interconnected in the same manner as depicted in fig5 . a typical fastener 107 is also shown that pulls the layers together and holds them in place against conductive material 105 of a radiofrequency enclosure . fig6 depicts two exemplary layers of the low impedance radiofrequency shielded window showing the angled orientation of the conductive mesh between layers as well as the staggered seams of the conductive perimeter layers . lastly , to further depict schematically the independent path to ground for each window layer of the low impedance radiofrequency shielded window of the present invention , fig7 is an equivalent circuit of the low impedance radiofrequency shielded window having two window layers . rl 1 and rl 2 represent a first radiofrequency shielded window layer and a second radiofrequency shielded window layer respectively . merely stacking each window layer would result in a series equivalent circuit that would not have the independent ground path and improved shielding of the present invention . the low impedance radiofrequency shielded window can be installed in a radiofrequency shielded enclosure to provide visibility while still affording radiofrequency shielding . radiofrequency shielded enclosures have many uses , from testing to secure communications and military and police work . it is , therefore , apparent that there has been provided , in accordance with the various objects of the present invention , an low impedance radiofrequency shielded window . while the various objects of this invention have been described in conjunction with preferred embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , it is intended to embrace all such alternatives , modifications and variations that fall within the spirit and broad scope of this specification , drawings and claims herein .
| 7 |
wireless devices use antennas to transmit and receive radio signals . noise sources , such as other wireless devices including wireless devices that transmit on the same channel , may interfere with wireless communication . conventional wireless devices use a variety of techniques to reduce the detrimental effect of noise on communication for example , dividing the area of coverage into sectors , using directional antenna , and using multiple antennas to provide redundancy and spatial diversity . an improved wireless device , according to the various aspects of the present invention includes directional antennas positioned in such a way that the physical sectors of the antennas of the wireless device overlap and the antennas selected for communication are the antennas whose physical sectors overlap in an area in a manner that permits the antennas to operate as a multiple input multiple output (“ mimo ”) antenna . the wireless device , according to the various aspects of the present invention may select for communication any suitable combination of directional antennas that operate as a mimo antenna and are oriented in a desired direction of communication . furthermore , the wireless device may assign any available channel to the antennas to improve performance . a wireless device , according to the various aspects of the present invention includes , for example , wireless cells , access points , wireless clients , mobile computers , and handheld devices . the term “ physical sector ” is understood to mean the area of coverage in which an antenna transmits and receives signals . the size and shape of a physical sector depends on a variety of factors for example , the type of antenna , atmospheric conditions , presence of noise sources , and physical surroundings . physical sectors 58 , 60 and 62 represent the two - dimensional shape of idealized physical sectors of directional antennas . physical sectors 58 , 60 and 62 do not overlap in fig2 . physical sectors 58 , 60 and 62 substantially overlap in fig3 . physical sectors 58 , 60 and 62 partially overlap in fig4 and 5 . the term “ mimo antenna ” is understood to mean at least two antennas that each transmits and / or receives signals on the same channel in the area where the physical sectors of the antennas overlap . antennas may be positioned in such a way that their physical sectors overlap . antennas whose physical sectors overlap in the same area may be configured to operate as a mimo antenna in that area . each individual antenna of a mimo antenna operates on the same channel ( e . g ., frequency , encoding , or other method of dividing the radio spectrum for communication ). a mimo antenna provides , inter alia , spatial diversity between the antennas , redundancy , and temporal diversity to reduce the effects of noise on transmission and reception . reducing the effects of noise permits a wireless device to communicate more reliability . antennas that form a mimo antenna may be oriented to use different signal polarization for example , horizontal , vertical , and circular . antennas that form a mimo antenna may be physically separated to provide spatial diversity . mimo physical sectors are formed to provide communication with increased immunity to noise within the area of the mimo physical sector . the term “ mimo physical sector ” means the area where the physical sectors of the antennas that operate as a mimo antenna overlap . in an exemplary embodiment , referring to fig3 , physical sectors 58 , 60 , and 62 substantially overlap to form mimo physical sector 82 . physical sectors 66 , 68 , and 70 substantially overlap to form a mimo physical sector 84 . in this embodiment , each mimo physical sector has an angle of coverage of about 90 degrees . in another embodiment , referring to fig6 , each one physical sector 58 , 60 , and 62 and each one physical sector 66 , 68 , and 70 has an angle of coverage of about 180 degrees , thus the resulting mimo physical sectors 82 and 84 have an angle of coverage of about 180 degrees . fig7 represents an alternate method for diagrammatically representing physical sectors and mimo physical sectors . physical sectors 58 - 62 respectively have about a 180 degree angle of coverage and the center of each physical sector is oriented at approximately 90 degrees ( straight up on the page ). each physical sector 58 - 62 extends from wireless device 10 to the furthest extent reached by the respective antennas even though fig7 shows gaps between the physical sectors for clarity . the mimo physical sectors 82 and 84 of fig6 and 7 are equivalent ; however , the diagrammatical representation of fig7 provides greater clarity . thus , mimo physical sectors 82 and 84 respectively include three substantially overlapping physical sectors 58 - 62 and 66 - 70 . the physical sectors of the antennas that form a mimo antenna are not limited to being substantially overlapping . when physical sectors only partially overlap , the mimo physical sector is the area where the physical sectors of the antennas that form the mimo antenna overlap . referring to fig4 and 5 , the antennas associated with physical sectors 58 - 62 transmit and receive using the same channel . area 94 is the area where physical sectors 58 , 60 , and 62 overlap , thus area 94 is a mimo physical sector . the antennas associated with physical sectors 58 - 62 operate as a mimo antenna in area 94 . the mimo physical sector formed by physical sectors 66 - 70 is also shown in fig4 as mimo physical sector 82 . mimo physical sectors may be formed in a variety of ways . in one exemplary method for forming a mimo physical sector , referring to fig1 , antennas are selected to operate as a mimo antenna then the antennas are positioned in such a way that the physical sectors of the antennas overlap . in another exemplary method for forming a mimo physical sector , referring to fig2 , a plurality of antennas are positioned in such a way that the physical sectors of at least some of the antennas at least partially overlap then at least two antennas are selected to operate as a mimo antenna in the area where their physical sectors overlap to form a mimo physical sector . the plurality of antennas may be positioned in such a way that the various mimo physical sectors that are formed are oriented in different directions . at least two antennas may be selected to operate as a mimo antenna in accordance with the orientation of the mimo physical sector formed by the physical sectors of the selected antennas . the orientation of some mimo physical sectors may provide increased performance over the orientation of other mimo physical sectors . furthermore , the antennas that form the mimo antenna may be assigned any available channel . accordingly , the selected antennas , thus the mimo physical sector , may be assigned to a channel that provides improved performance . the term “ mimo virtual sector ” means the area where the physical sectors of antennas that may operate as a mimo antenna overlap . referring to fig1 , physical sectors 58 - 62 and 66 - 70 each have an angle of coverage of about 180 degrees respectively . the antennas associated with physical sectors 58 - 62 and 66 - 70 are positioned in such a way that in area 150 , physical sectors 58 , 68 , and 70 overlap . in area 152 , physical sectors 58 , 60 , and 70 overlap and so forth for areas 154 - 160 . each one area 150 - 160 comprises a mimo virtual sector because the antennas whose physical sectors overlap in the area may operate as a mimo antenna . if the antennas associated with physical sectors 58 , 68 , and 70 are selected to form a mimo antenna , then area 150 operates as a mimo physical sector . if the antennas associated with physical sectors 58 , 60 , and 70 are selected to form a mimo antenna , then area 152 operates as a mimo physical sector and so forth for the other areas . before antennas are selected to form a mimo physical sector , areas 150 - 160 are mimo virtual sectors . when antennas are selected to form a mimo antenna , the area where the physical sectors of the selected antennas overlap become a mimo physical sector while the other areas remain mimo virtual sectors . a mimo physical sector may also be referred to as a selected mimo virtual sector or an active mimo virtual sector . any criteria may be used to select a mimo virtual sector for communication . the method of positioning antennas to form mimo virtual sectors then selecting antennas to operate as a mimo antenna permits the wireless device to respond to changes in , inter alia , performance , noise sources , and the environment by communicating through the mimo physical sector that provides increased performance . positioning antennas to form mimo virtual sectors permits a wireless device with fixed antenna positions to select from a variety of mimo virtual sectors to communicate using the mimo physical sector that provides a desired level of performance . when the performance of the selected mimo physical sector deteriorates due to , inter alia , noise sources or environmental conditions , the wireless device can select different antennas to operate as a mimo antenna , thereby selecting a different mimo virtual sector to operate as a mimo physical sector where the different mimo physical sector provides increased performance . mimo physical sectors permits a wireless device to communicate with increased performance . mimo virtual sectors permits a wireless device to select an area to transmit and receive in accordance with the mimo virtual sector that provides a desired level of performance . a wireless device having multiple mimo virtual sectors may select between the various mimo virtual sectors . a wireless device may select the mimo virtual sector that provides an increased level of performance . positioning the antennas of a wireless device to form mimo virtual sectors that are oriented in different directions permits the wireless device to select a mimo physical sector based on the orientation of the virtual sector with relation to the position of noise sources . performance may be measure by , inter alia , throughput , data throughput , signal - to - noise ratio , reduced signal error , reduced data errors , reduced retransmission requests , reduced interference , rejection of multipath signals , higher transmission rates , and signal strength . a mimo system includes radios and antennas that may be configured to form mimo antennas , mimo physical sectors , and mimo virtual sectors . a mimo system may form a mimo antenna using any suitable combination of radios and antennas . a mimo system may select any suitable mimo physical sector for communication . a mimo system may have any suitable number of mimo virtual sectors and / or selected mimo virtual sectors . the mimo system may position its mimo physical sectors at any orientation . the mimo physical sectors of a mimo system may overlap other mimo physical sectors of the same mimo system . overlapping mimo physical sectors of the same mimo system may be assigned different channels . a mimo system has at least two radios and at least two antennas where at least two radios and two antennas form a mimo antenna . in another exemplary embodiment , referring to fig1 , a mimo system has three radios with two antennas interfacing with each one radio . three antennas , one antenna from each radio , may operate as a mimo antenna , thereby resulting in a mimo system having two mimo antennas . the present invention may employ various types of radios using any type of communication protocol and operating at any frequency and / or with any number of channels suitable for the application . the present invention may use any variety of antennas or groups of antennas for any purpose for example , transmission , reception , noise reduction , and multipath detection . antennas may be positioned in any manner for example , their physical sectors may be overlapping and non - overlapping . radios and antennas may operate as a mimo system , mimo antennas , mimo physical sectors , and mimo virtual sectors . any type of algorithm and / or processor may be used to enable radios and / or antennas to form and operate as mimo antennas . antennas may be selected for communication according to any criteria such as for example , data throughput , signal strength , signal quality , and signal - to - noise ratio . in one embodiment , the antennas of the wireless device are positioned to form non - overlapping mimo physical sectors and one of the non - overlapping mimo physical sectors is selected for communication with other wireless devices . in another embodiment , the antennas of the wireless device are positioned to form overlapping mimo virtual sectors and some of the mimo virtual sectors are selected for communication with other wireless devices . the antennas that form a mimo antenna may be used in any manner to transmit and / or receive signals for example , any number of antennas that operate as the mimo antenna may transmit only , receive only , and transmit and receive signals . in an exemplary embodiment , referring to fig1 , antennas 34 , 36 , and 38 , with their associated radios , form a mimo antenna in which each antenna 34 , 36 , and 38 transmits and receives the same signals . in another embodiment , antennas 34 - 38 form a mimo antenna in which antenna 34 transmits , antenna 36 receives only , and antenna 38 transmits and receives . different mimo antenna configurations may provide different communication characteristics . for example , a configuration where all antennas of the mimo antenna transmit and receive the same information may provide increased error correction . a configuration where antennas transmit and / or receive different information may provide increased data throughput . in an configuration where each antenna of the mimo antenna receives some version of the same signal , the information content of the various signal versions received by the antennas of the mimo antenna may be highly similar and / or less similar depending on environmental conditions for example , the presence of noise sources , multipath reflections , and spatial diversity of the antennas . advanced algorithms may be used to process the signal received by each antenna that form the mimo antenna to construct a resultant receive signal that contains as much of the receive signal information as can be extracted . the antennas of a mimo antenna may be configured to receive signals from a common source by positioning the antennas such that their physical sectors overlap . the number of antennas used to form a mimo physical sector and the overlap of the physical sectors of the antennas may affect performance . for example , referring to fig1 and 5 , area 90 receives coverage from only physical sector 62 , thus communications within area 90 are transmitted and received by only antenna 38 . likewise , area 98 receives coverage only from physical sector 60 and antenna 36 . even when antennas 36 and 38 are selected to operate as a mimo antennas , areas 90 and 98 are not mimo physical sectors because only one antenna operates in the area . when only one antenna of the antennas selected to operate as a mimo antenna transmits and receives in an area , the performance may not be as high as in the areas where the physical sectors of the antennas overlap to form a mimo physical sector . areas 92 and 96 receive coverage from physical sectors 58 , 62 and 58 , 60 respectively . areas 92 and 96 are mimo physical sectors because at least two antennas operate as a mimo antenna in the areas . communication using at least two antennas of the antennas selected to operate as a mimo antenna may improve performance . area 94 , a mimo physical sector formed by the overlap of the physical sectors of three antennas , receives coverage from physical sectors 58 , 60 and 62 and their related antennas 34 - 38 . antennas 34 - 38 operate as a mimo antenna , thus reception and / or transmission through all three antennas in area 94 may provide higher performance than reception and / or transmission through areas 90 - 92 and 96 - 98 . the mimo physical sector in area 94 is most likely to provide improved performance because all antennas of the mimo antenna communicate in area 94 . mimo physical sectors formed using directional antennas may use conventional antenna select methods to reduce interference from noise sources . for example , referring to fig1 and 8 , wireless device 10 comprises processor 12 , radios 18 - 22 , rf switches 26 - 30 , and antennas 34 - 38 and 42 - 46 where two antennas interfacing with each one rf switch respectively . antennas 34 - 38 and 42 - 46 operate as a first mimo antenna and a second mimo antenna respectively . radios 18 - 22 use the 802 . 11a / b / g / n communication protocols . antenna physical sectors 58 - 62 , associated with antennas 34 - 38 respectively , substantially overlap to form mimo physical sector 82 . antenna physical sectors 66 - 70 , associated with antennas 42 - 46 respectively , substantially overlap to form mimo physical sector 84 . in this embodiment , each radio is set to the same channel . the physical sectors and the mimo physical sectors 82 - 84 extend farther than shown in fig8 to enable wireless device 10 to communicate with wireless device 102 and receive interference from noise sources 106 and 108 . wireless device 10 uses rf switches 26 - 30 to select between antennas 34 - 38 and 42 - 46 . in this embodiment , the rf switches select between one of two groups of antennas ; either antennas 34 - 38 or antennas 42 - 46 are selected , thus only one mimo physical sector , either 82 or 84 , is active at any given time . in the embodiment and the scenario described in fig8 , wireless device 10 selects mimo antennas physical sector 84 to reduce interference from noise sources 106 and 108 while communicating with wireless device 102 . wireless device 104 of fig8 may also be implemented using mimo physical sectors similar to those of wireless device 10 . wireless device 104 may select the mimo physical sector that provides the best performance while communicating with wireless device 102 and reduces interference from noise source 110 . in another embodiment of a mimo system , referring to fig9 , wireless device 10 comprises a processor 12 , three radios 18 - 22 , three rf switches 26 - 30 , and three antennas interfacing with each rf switch . antennas 34 - 38 , 42 - 46 , and 50 - 54 may have any angle of coverage , be oriented in any direction , form mimo antennas , and form mimo virtual sectors in any manner . in an exemplary embodiment , referring to fig1 , each antenna 34 - 38 , 42 - 46 , and 50 - 54 has an angle of coverage of about 120 degrees . antennas 34 - 38 are oriented so that their associated physical sectors , 58 - 62 respectively , substantially overlap to form mimo physical sector 82 . antennas 42 - 46 are oriented so that their associated physical sectors , 66 - 70 respectively , substantially overlap to form mimo physical sector 84 . antennas 50 - 54 are oriented so that their associated physical sectors , 74 - 78 respectively , substantially overlap to form mimo physical sector 86 . physical sectors 58 - 62 , 66 - 70 , and 74 - 78 are oriented such that the center of mimo physical sectors 82 , 84 , and 86 are respectively oriented at about 60 , 180 , and 300 degrees respectively . in this embodiment , the mimo physical sectors do not substantial overlap . each radio is set to the same channel , thus the mimo physical sectors 82 - 86 each use the same channel . the wireless device embodiment of fig9 and 10 may also be used to reduce interference with noise sources by selected one of the three mimo physical sectors for communication . in another embodiment , not shown , wireless device 10 comprises a processor , four radios , an rf switch interfacing with each one radio , and four directional antennas interfacing with each one rf switch . each antenna has an angle of coverage of about 90 degrees . the physical sectors of one antenna from each rf switch substantially overlap to form a mimo physical sector resulting in a mimo system having four mimo virtual sectors . each mimo physical sector receives coverage from each one of the four radios . the physical sectors of the antennas are oriented in such a way that the mimo physical sectors do not overlap and the mimo physical sectors provide a combined angle of coverage of about 360 degrees . all radios are set to the same channel . in another embodiment , not shown , wireless device 10 comprises a processor , two radios interfacing with the processor , an rf switch interfacing with each one of the radios , and three directional antennas interfacing with each one rf switch . each antenna has an angle of coverage of about 120 degrees . the physical sectors of one antenna from each one rf switch substantially overlap to form a mimo physical sector resulting in a mimo system having three mimo virtual sectors . each mimo physical sector receives coverage from each one of the two radios . the physical sectors of the antenna are oriented in such a way that the mimo physical sectors do not overlap and the mimo physical sectors provide a combined angle of coverage of about 360 degrees . all radios are set to the same channel . in another embodiment , not shown , wireless device 10 comprises a processor , two radios interfacing with the processor , an rf switch interfacing with each one of the radios , and “ n ” directional antennas interfacing with each one rf switch . each antenna has an angle of coverage of about 360 degrees divided by n . two antennas , one from each rf switch , form a mimo antenna , thereby forming n mimo antennas . the physical sectors of the antennas that form each mimo antenna substantially overlap to form n mimo physical sectors . the mimo physical sectors are oriented in such a way that the mimo physical sectors do not substantially overlap , thereby providing a combined angle of coverage of about 360 degrees . all radios are set to the same channel . radios , antennas , and mimo physical sectors are not limited to using a single channel for communication or to forming mimo physical sectors that are substantially non - overlapping . radios may be grouped to provide mimo physical sectors that use different channels . mimo physical sectors that communicate on different channels may be positioned to overlap . overlapping mimo physical sectors that use different channels may simultaneously communicate less mutual interference . in one embodiment , referring to fig1 , wireless device 10 comprises a process 12 , controllers 14 , 16 interfaces with processor 10 , two radios 18 , 20 interface with controller 14 thereby forming a first radio group , two radios 22 , 24 interface with controller 16 thereby forming a second radio group , an rf switch 26 , 28 , 30 , 32 interfaces with radio 18 , 20 , 22 , 24 respectively , antennas 34 - 48 interface with the rf switches in such a manner that two antennas interface with each one rf switch . the antennas may form mimo antennas any manner ; however , forming mimo antennas using antennas from the same group enables mimo physical sectors from different groups to operate on different channels . in one embodiment , antennas 34 and 36 form a first mimo antenna . antennas 42 and 44 form a second mimo antenna . the first and second mimo antennas belong to the first radio group . antennas 38 and 40 form a third mimo antenna . antennas 46 and 48 form a fourth mimo antenna . the third and fourth mimo antennas belong to the second radio group . in another embodiment , antennas 34 - 40 form a first mimo antenna and antennas 42 - 48 form a second mimo antenna . the antennas and their respective physical sectors may have any angle of coverage and be oriented in any direction . the antennas of the various groups may form mimo antennas in any manner . the resulting mimo physical sectors may be overlapping or non - overlapping . in an exemplary embodiment , antennas 34 , 36 , 38 , 40 , 42 , 44 , 46 , and 48 and their respective physical sectors 58 , 60 , 62 , 64 , 66 , 68 , 70 , and 72 each have an angle of coverage of about 180 degrees . referring to fig1 and 12 , physical sector 58 substantially overlaps physical sector 60 to form mimo physical sector 82 . physical sectors 62 and 64 substantially overlap , 66 and 68 substantially overlap , and 70 and 72 substantially overlap to form mimo physical sectors 84 , 86 , and 88 respectively . the center of the angles of coverage of antennas 34 , 36 and 38 , 40 are oriented at about 90 degrees ( e . g ., up the page ), thus mimo physical sectors 82 and 84 overlap . the center of the angles of coverage of antennas 42 , 44 and 46 , 48 are oriented at about 270 degrees ( e . g ., down the page ), thus mimo physical sectors 86 and 88 substantially overlap . radios 18 and 20 belong to the first radio group and radios 22 and 24 belong to the second radio group . assigning channel c 1 to the first radio group and channel c 2 to the second radio group results in mimo physical sectors 82 and 86 using channel c 1 and mimo physical sectors 84 and 88 using channel c 2 . thus , the channel assignment , the antenna orientation , and the mimo antenna configurations provide overlapping mimo physical sectors that use different channels . referring to fig1 , mimo physical sector 82 is assigned to c 1 , mimo physical sector 84 is assigned to c 2 , and mimo physical sector 82 substantially overlaps mimo physical sector 84 . because mimo physical sectors 82 and 84 are assigned different channels , they may communicate with different wireless devices simultaneously with less mutual interference . mimo physical sectors formed using antennas from different radio groups enables the mimo physical sectors to overlap , be assigned different channels , and communicate simultaneously . mimo antennas of the same radio group use the same channel . interference between mimo physical sectors formed using antennas from the same group may be reduced by , for example , positioning the mimo physical sectors in such a way that they do not overlap and communicating using only one mimo physical sector from the same group at any one time . in another embodiment , referring to fig1 , each one antenna 34 - 48 has a physical sector with an angle of coverage of about 90 degrees . antennas are organized , as described above , to form four mimo antennas . antenna physical sectors are positioned such that the center of the angle of coverage for antennas pairs 34 and 36 , 38 and 40 , 42 and 44 , and 46 and 48 and their respective physical sectors are oriented at 45 , 135 , 225 , and 315 degrees respectively . channel c 1 is assigned to the first group radios and channel c 2 is assigned to the second group radios . the resulting four mimo physical sectors are positioned to not substantially overlap and adjacent mimo physical sectors are assigned a different channel . one mimo physical sector from the first radio group and one mimo physical sector from the second radio group may operate simultaneously . the antennas of wireless device 10 may be oriented to form mimo virtual sectors . mimo virtual sectors may have any angle of coverage and be oriented in any manner . a mimo virtual sector may be selected for communication to decrease interference . in one embodiment , referring to fig1 and 13 , antennas 34 - 38 and 42 - 46 have an angle of coverage of about 180 degrees . antennas 34 , 36 , 38 , 42 , 44 , 46 and the center of the angle of coverage of their respective physical sectors 58 , 60 , 62 , 66 , 68 , 70 are oriented at 90 , 150 , 210 , 270 , 300 , and 30 degrees respectively . the area between 0 and 60 degrees , marked as area 150 in fig1 , is covered by physical sectors 58 , 68 , and 70 . antennas 34 , 44 , and 46 may function together as a mimo antenna to transmit signals to and receive signals from any wireless device within area 150 . areas 152 , 154 , 156 , 158 , and 160 are respectively positioned between about 60 - 120 degrees , about 120 - 180 degrees , about 180 - 240 degrees , about 240 - 300 degrees , and about 300 - 0 degrees and are serviced respectively by antennas 34 , 36 , and 46 ; 34 , 36 and 38 ; 42 , 36 and 38 ; 42 , 44 and 38 ; and 42 , 44 and 46 . each one area 150 - 160 comprises a mimo virtual sector . in an exemplary embodiment , referring to fig1 and 13 , area 150 operates as a mimo physical sector by forming a mimo antenna using antennas 34 , 44 , and 46 . area 152 operates as a mimo physical sector by forming a mimo antenna using antennas 34 , 36 , and 46 , and so forth for areas 154 - 160 . in this embodiment , areas 158 and 160 may not be combined to operate as a mimo physical sector because area 158 requires antennas 42 , 44 , and 38 to form a mimo antenna while area 160 requires antennas 42 , 44 , and 46 to form a mimo antenna . because rf switch 30 selects only one antenna at a time , mimo physical sectors , for this embodiment , are limited to any combination of any one antenna associated with each rf switch . in this embodiment , wireless device 10 may select and communicate through any one mimo virtual sector at any given time . the method of selecting the mimo virtual sector consists of setting the rf switches to select the antennas that service the desired mimo virtual sector . in another embodiment , an rf switch with its associated antennas may be replaced by a phased array . antenna elements of each phased array may form mimo antennas . antennas may be oriented in any manner to form mimo virtual sectors of any size . in an exemplary embodiment , referring to fig1 , each mimo virtual sector 150 - 160 has an angle of coverage of about 60 degrees . in another embodiment , referring to fig1 , mimo virtual sectors 150 , 152 , 154 , 156 , 158 , and 160 lie between 0 - 30 degrees , 30 - 60 degrees , 60 - 180 degrees , 180 - 210 degrees , 210 - 240 degrees , and 240 - 0 degrees respectively . in another embodiment , referring to fig1 , each mimo virtual sector has an angle of coverage of about 40 degrees . mimo virtual sectors 150 - 166 lie between 0 - 40 degrees , 40 - 80 degrees , 80 - 120 degrees , 120 - 160 degrees , 160 - 200 degrees , 200 - 240 degrees , 240 - 280 degrees , 280 - 320 degrees , and 320 - 0 degrees respectively . in another embodiment , referring to fig1 and 18 , each mimo virtual sector has an angle of coverage of about 90 degrees . channel c 1 is assigned to the first group radios and channel c 2 is assigned to the second group radios . antenna pairs 34 and 36 , 38 and 40 , 42 and 44 , and 46 and 48 respectively form mimo antennas . mimo virtual sectors formed by antennas 34 , 36 and 42 , 44 extend from 0 - 180 and 180 - 0 degrees respectively and are assigned channel c 1 . mimo virtual sectors formed by antennas 38 , 40 and 46 , 48 extend from 90 - 270 and 270 - 90 degrees respectively and are assigned channel c 2 . the mimo virtual sectors are positioned to form areas 150 - 156 which each receive coverage from two mimo virtual sectors that operate on different channels . a wireless device may select and communicate through a mimo virtual sector to improve performance . a wireless device may use any criteria for selecting a mimo virtual sector for communication such as , for example , the presence of noise sources , noise source channels used , signal - to - strength ratio , direction of primary data flow , signal quality , signal strength , and data throughput . in one embodiment , referring to fig9 and 17 , wireless device 10 desires to communicate with wireless device 102 . wireless device 10 successively enables each antenna combination that forms each mimo virtual sector 150 - 160 . through each mimo virtual sector , wireless device 10 measures its ability to communicate with wireless device 102 . through at least mimo virtual sector 150 , wireless device 10 detects the presence of noise source 110 . through at least mimo virtual sectors 154 and 156 , wireless device 10 detects the presence of noise sources 106 and 108 respectively . while communicating with wireless device 102 , wireless device 10 may reduce interference from noise sources 106 and 108 by selecting and communicating through mimo virtual sector 150 . in the embodiment of wireless device 10 shown in fig1 and 17 , areas adjacent to the selected mimo virtual sector have at least one antenna in common , thus selecting a mimo virtual sector does not disable all communication in other sectors , but communication within the selected mimo virtual sector may provide increased performance than adjacent areas because it transmits and / or receives using all the antennas that form the mimo antenna . referring still to fig1 and 17 , wireless device 10 may reduce interference from noise source 110 by selecting a channel that is different from the channel used by noise source 110 . in the event that wireless device 102 cannot switch to a channel that is not used by noise source 110 , communication with wireless device 102 may proceed using mimo virtual sector 150 if it provides a desired level of performance . a wireless device may select any mimo virtual sector that provides a desired level of performance . in this embodiment , wireless device 10 may select mimo virtual sector 152 to communicate with wireless device 102 . wireless device 10 may detect less interference from noise source 110 through mimo virtual sector 152 than it detects through mimo virtual sector 150 , but wireless device 10 may also receive a less desirable signal from wireless cell 102 . in the event that wireless device 10 desires to communicate with wireless device 104 and noise sources 106 , 108 , and 110 all operate on the same channel as wireless device 104 , wireless cell 10 may reduce interference from the noise sources by selecting mimo virtual sector 160 for communicating with wireless device 104 . a wireless device may select and use any mimo virtual sector for any duration of time . a wireless device may switch from using one mimo virtual sector to using any other mimo virtual sector at any time and for any purpose . in an exemplary embodiment , referring to fig1 , wireless device 10 switches between mimo virtual sectors 150 and 160 to communicate with wireless devices 102 and 104 respectively . additionally , a wireless device may transmit through one mimo virtual sector and receive through a different mimo virtual sector . in another embodiment , referring to fig1 and 18 , wireless device 10 may select the mimo virtual sector that provides a desired level of communication for each area . additionally , wireless device 10 may communicate with two wireless devices 104 and 120 , both in area 156 , simultaneously on different channels ; for example , wireless device 104 communicates using channel c 1 while wireless device 120 communicates using channel c 2 . unless contrary to physical possibility , the inventor envisions the methods and systems described herein : ( i ) may be performed in any sequence and / or combination ; and ( ii ) the components of respective embodiments combined in any manner . this application incorporates by reference u . s . provisional application ser . no . 60 / 484 , 800 filed on jul . 3 , 2003 ; u . s . provisional application ser . no . 60 / 493 , 663 filed on aug . 8 , 2003 ; u . s . provisional application ser . no . 60 / 692 , 490 filed on jun . 21 , 2005 ; u . s . utility application ser . no . 10 / 869 , 201 filed on jun . 15 , 2004 and issued under u . s . pat . no . 7 , 302 , 278 ; and u . s . utility application ser . no . 10 / 880 , 387 filed on jun . 29 , 2004 and issued under u . s . pat . no . 7 , 359 , 675 , in their entirety for the teachings taught therein . the wireless cell can ask the advanced client to measure and report communication statistics such as , but not limited to , bit error rate , signal - to - noise ratio , dropped bits , signal strength , number of retransmission requests or any other environmental or communication parameter . each antenna and antenna controller functions independently of the other antennas and controllers . the antenna controller sets the beam width , beam azimuth , beam steering , gain of the antenna and any other parameter available on adjustable antennas . the antennas are also capable of high - speed switching . the controllable characteristics of the antenna are dynamically modifiable . the antenna beam can steer directly at one receiving client during transmission then pointed at a second client when transmission to the second client begins . the beam width of the antenna can be increased or decreased as necessary ; however , it is preferable to not increase the beam width to provide antenna coverage beyond the width of a sector . if the beam width is adjusted to provide coverage wider than a sector , the radio signal may interfere with adjacent or opposing sectors or wireless cells or detect clients not associated with the sector or wireless cell . the processor is responsible for tracking the antenna characteristics best suited to service each client in the sector covered by the antenna and to set the antenna controller to the parameters best suite for the particular client when communicating with the client . the use of an adjustable antenna , an antenna controller and a processor capable of controlling the antenna controller is not limited to the six - sector embodiment of a wireless network , but can also be used in a four - sector wireless cell or other wireless cell types . preferably , the beam width would not exceed the width of the sector of the wireless cell in which it is used . mimo antennas may use any combination of spatial , polarization , or angle antenna diversity . the mimo antenna array may be fixed or adaptive for either transmit , receive , or both . when receiving , the mimo antenna may use , for example , a maximum ratio combiner , an optimal linear combiner , selection diversity , or any combination of these methods or other methods for combining the signals from multiple antennas into a single signal . when transmitting , the mimo antenna may use any type of encoding including , for example , ofdm , space - time - codes , or weighting of the antenna signals in the array to accomplish beam steering . during transmission or reception , all or any subset of antennas in the mimo array may be used or selection diversity may be used to limit the number of antennas used . antenna diversity may be used in the transmit path , in the receive path , or in both transmit and receive paths . the signal from each antenna , transmitted or received , may or may not be weighted . servicing a physical sector with a mimo antenna means that all antennas in the mimo array use the channel assigned to the physical sector . signal attenuation may be added after each antenna , after the signal combiner , or in the signal processor that manipulates the incoming signals . although mimo antennas are arrays of antennas , any antenna array may be used as a single antenna or a mimo antenna may be used . for example , a directional antenna with about 120 - degree angle of coverage may be replaced by an antenna array that provides similar coverage . the array may be fixed or adaptive . adaptive arrays may use adaptive array weights to transmit directional beams within the angle and area of coverage to send a stronger signal to a desired client . during reception , an adaptive array may use array weights to direct a beam substantially towards the transmitting client and substantially null out any sources of interference . the processor , in exemplary embodiments , in addition to getting receive data from and sending transmit data to the radios , may also send instructions to control the radios such as , for example , instructing a radio to change channels or getting control information from the radios . in exemplary embodiments , the processor may also be capable of , for example , varying attenuation , controlling any or all rf switches , maintaining route tables , maintaining client specific information , and handing off mobile clients . in an exemplary embodiment , the processor may also control , for example , the attenuation or rf switches on a transmit or receive basis , a per client basis , a fixed period basis , and on a per demand basis . some embodiments may have a network connection that may enable the wireless cell to communicate with a wired network . some embodiments may have local storage to store , for example , transmit and receive date , relay data , video or audio data , environmental conditions data , and any other type of data required to service clients , function as a network , handoff or receive mobile clients , and forward information . when receiving , the mimo antenna may use , for example , a maximum ratio combiner , an optimal linear combiner , selection diversity , or any combination of these methods or other methods for combining the signals from multiple antennas into a single signal . assume for this example that the communication protocol uses packetized data and that the clients must transmit rts and await a cts before transmitting a single packet . it is possible to switch a client , or multiple clients , from a packet based communication protocol to a data stream protocol to increase the efficiency of long data transfers between clients . another aspect of the invention is the use of multiple directional antennas , at least one radio , at least one attenuator and other electronic devices such as rf switches , packet switches , antenna sharing devices and other electronic and electrical components to generate various embodiments of wireless cells and wireless networks with differing characteristics and capabilities . although there have been described preferred embodiments of this novel invention , many variations and modifications are possible and the embodiments described herein are not limited by the specific disclosure above , but rather should be limited only by the scope of the appended claims .
| 7 |
reference throughout this specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , the appearances of the phrases “ in one embodiment ” or “ in an embodiment ” in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures , or characteristics may be combined in any suitable manner in one or more embodiments . same elements have been designated with same references in the different drawings . for clarity , only those elements and those method operations which are necessary to the understanding of the present invention have been shown in the drawings and will be described hereafter . in particular , the different calculations and processings upstream and downstream of the storages and of the reading of the range blocks have not been detailed and are no object of the present invention . further , the sequencing of the processings of loading and unloading of the range blocks depends on the application and is no object of the present invention either . fig3 very schematically shows the seven possible isometries in a fractal image coding for a range block 1 of four by four pixels . the choice of the number of 16 pixels for the range block is arbitrary . the present invention applies whatever the number of pixels of the range blocks , provided that the blocks are square . in particular , most often , these blocks are blocks of eight by eight pixels , their size depending on the size of the obtained sub - sampled blocks ( dbi , fig2 ). reference block 1 is taken arbitrarily as the identity block , that is , in the case where pixels p 1 to p 16 of range block 1 correspond in values and arrangements to the pixels of the domain block being compared . in fig3 , the pixels of the range block have been numbered as p 1 to p 16 and arranged line by line from left to right from the bottom of the block in the position of the drawing . a first isometry 2 corresponds to a symmetry with respect to vertical axis y centered in the middle of the range block . if a domain block corresponds to the arrangement shown in isometry 2 of fig3 , it will be considered that it is possible to transmit it in the form of the number of range block 1 , associated with the parameter defining the isometry of vertical axis . a second isometry 3 corresponds to a symmetry with respect to horizontal axis x centered in the middle of the reference image . a third isometry 4 corresponds to a symmetry of axis y = x . this amounts to a symmetry with respect to diagonal d xy . a fourth isometry 5 corresponds to a 180 ° rotation of the range block . a seventh isometry 8 corresponds to a symmetry of axis y =− x , that is , a reflection with respect to diagonal d − xy . a feature of an embodiment of the present invention is to only use four memory areas having a size corresponding to the size of the range block to store all the isometries necessary to the comparison . another feature of an embodiment of the present invention is to provide a reading of the isometries in reverse directions so that each memory area actually contains two isometries of the range block . fig4 illustrates , in a simplified view to be compared to that of fig3 , four memory areas m 1 , m 2 , m 3 , and m 4 storing range block 1 shown in fig3 and its isometries . according to an embodiment of the present invention , a first memory area m 1 contains arrangements 1 and 3 , that is , the identity and the symmetry with respect to the horizontal axis . a second memory area m 2 contains isometries 2 and 4 , that is , the symmetry with respect to the vertical axis and the 180 ° rotation . a third memory area m 3 contains isometries 5 and 6 , that is , the symmetry of axis y = x and the 270 ° rotation . a fourth memory area m 4 contains isometries 7 and 8 , that is , the 90 ° rotation and the symmetry of axis y =− x . as appears from fig4 , to obtain the different isometries , it is enough to organize the reading from the corresponding memory area , once from top to bottom , then , from bottom to top . such a reading is easily implementable by means of a memory addressing circuit 10 , parameterized according to the type of isometry with which the current domain block is desired to be compared . an advantage of the present invention is that it divides by two the memory space necessary for the storage of the range blocks and of their respective isometries . another advantage of the present invention is that it results in no complexity of the memory selectors . the only counterpart is a read - adapted programming of memory areas m 1 to m 4 containing the range block isometries . of course , the present invention is likely to have various alterations , modifications , and improvements which will readily occur to those skilled in the art . in particular , although an embodiment of the present invention has been described in reference to isometries of range blocks of 4 × 4 pixels , it applies to any square range block and its isometries . further , the present invention more generally applies to any image processing method requiring storage of image block isometries , similar to those used in a fractal compression . moreover , the practical implementation of the circuits necessary to the implementation of the present invention and the control signals of addressing of the different memory areas are within the abilities of those skilled in the art based on the function indications given hereabove . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and the scope of the present invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the present invention is limited only as defined in the following claims and the equivalents thereto . all of the above u . s . patents , u . s . patent application publications , u . s . patent applications , foreign patents , foreign patent applications and non - patent publications referred to in this specification and / or listed in the application data sheet , are incorporated herein by reference , in their entirety .
| 6 |
referring to fig1 to 3 , one embodiment of a battery latching device 60 ( fig3 ) used in a portable electronic device 100 such as a mobile phone , includes a first housing 10 , a second housing 20 mounted to the first housing 10 , a battery 30 receivable in the first housing 10 , a stopping member 40 secured to the first housing 10 , and a sealing member 50 rotationally latched to the first housing 10 . the stopping member 40 is substantially a sheet member , and includes a body section 42 , two hook - shaped retaining sections 44 extending from opposite ends of the body section 42 , and a guiding section 46 perpendicularly extending from the middle of the body section 42 . the body section 42 is elastic and substantially arched . the retaining sections 44 are elastic and located on one side of the body section 42 . the guiding section 46 is substantially arched and bent toward the body section 42 . the sealing member 50 includes a rectangular base 52 , a mating portion 54 extending from one side of the base 52 , a pivot portion 56 located at the side of the base 52 with the mating portion 54 . the mating portion 54 is a hollow frame and has a plurality of resisting members 542 protruding from an outer side . the resisting members 542 are located away from the base 52 and configured for latching the sealing member 50 to the first housing 10 . the pivot portion 56 is a column protruding from the base 52 and adjacent to the mating portion 54 . the pivot portion 56 has a circular flange 562 around a peripheral wall thereof . the circular flange 562 is located apart from the base 52 and used for latching the pivot portion 56 to the first housing 10 . the first housing 10 includes a bottom wall 12 and sidewalls connecting with the bottom wall 12 . the sidewalls include a first sidewall 14 , a second sidewall 16 located opposite to the first sidewall 14 , and a third sidewall 18 perpendicularly connects the first sidewall 14 with the second sidewall 16 . the bottom wall 12 has two latching portions 122 protruding outwards and parallel to the first sidewall 14 . one of the latching portions 122 is adjacent to the first sidewall 14 , and another latching portion 122 is adjacent to the second sidewall 16 . each latching portion 122 is l - shaped and includes a rectangular first sheet 1222 and a rectangular second sheet 1224 . the first sheet 1222 extends perpendicularly from the bottom wall 12 . the second sheet 1224 extends perpendicularly from a distal end of the first sheet 1222 towards the center of the first housing 10 , thus , a receiving space 124 is enclosed by the first sheet 1222 , the second sheet 1224 , and the bottom wall 12 of the housing 10 . the receiving space 124 is configured for receiving the battery 30 . the bottom wall 12 has a plurality of projection sliders 126 formed between the latching portions 122 . the projection sliders 126 are parallel with the latching portions 122 . the function of the projection sliders 126 is as follows : when the battery 30 is received in the receiving space 124 , the bottom wall of the battery 30 can contact with the projection sliders 126 to prevent bottom wall of the battery 30 from directly contacting the bottom wall 12 of the first housing 10 , so as to decrease frictional area of the battery 30 thus , decreasing friction force acted on the battery 30 , and further facilitate detaching the battery 30 from the receiving space 124 . the bottom wall 12 has a resisting portion 128 protruding parallel to the third sidewall 18 . the resisting portion 128 is opposite to the third sidewall 18 , i . e ., the third sidewall 18 is located adjacent to one end of latching portion 122 , and the resisting portion 128 is positioned adjacent to another end of the latching portion 122 . the resisting portion 128 has an electric connector 1282 mounted for electrically connecting to the battery 30 when the battery 30 is resisting the resisting portion 128 . the bottom wall 12 has two brackets 129 protruding therefrom and positioned between the third sidewall 18 and the latching portions 122 . each block 129 has a retaining groove 1292 defined in one side of the block facing another block 129 . the retaining sections 44 of the stopping member 40 are fixed in the retaining grooves 1292 to assemble the stopping member 40 to the first housing 10 . the bottom wall 12 defines a slot 130 between the two brackets 129 . the slot 130 corresponds to and configured for receiving the guiding section 46 . the third sidewall 18 defines an opening 182 and a hole 184 , and the opening 182 is adjacent to the hole 184 . the opening 182 corresponds to the mating portion 54 of the sealing member 50 , and has the same size and shape as the mating portion 54 . the opening 182 is configured for accommodating the mating portion 54 . the hole 184 corresponds to the pivot portion 56 of the sealing member 50 , and has the same size and shape as the pivot portion 56 . referring to fig1 to 3 , to assemble the portable electronic device 100 , firstly , the stopping member 40 is bent to shortened its length , and thereby , accumulating an elastic force . then , the stopping member 40 is inserted between the two brackets 129 of the first housing 10 , and the retaining sections 44 of the stopping member 40 are aligned with the retaining grooves 1292 of the brackets 129 . after that , the bending of the stopping member 40 is released / stopped such that the stopping member 40 stretches outwardly under the accumulated elastic force until the retaining sections 44 are fully accommodated into the retaining grooves 1292 correspondingly . at this time , the guiding section 46 is located over and bent toward the slot 130 of the first housing 10 , the retaining sections 44 are compressed in the retaining grooves 1292 , i . e ., the retaining sections 44 tend to straighten and tightly secure the stopping member 40 to the first housing 10 . then , the mating portion 54 of the sealing member 50 is aligned with the opening 182 of the first housing 10 with the pivot portion 56 of the sealing member 50 is aligned with the hole 184 of the first housing 10 . the sealing member 50 is pressed into the first housing 10 to snap the mating portion 54 in the opening 182 and latch the pivot portion 56 in the hole 184 . at this stage , as the mating portion 54 gradually enter into the opening 182 , the side wall of the opening 182 pushes the resisting members 542 so that the mating portion 54 is bent toward the center until the resisting members 542 pass through the opening 182 . once the resisting members 542 passes through the opening 182 , the mating portion 54 restores to a normal state , as a result , the securing portion 542 restricts against the inner wall of the third sidewall 18 to prevent the mating portion 54 from disengaging from the first housing 10 . because the pivot portion 56 has the same size and shape as the hole 184 , and the pivot portion 56 has the circular flange 562 surrounding the peripheral wall thereof , the circular flange 562 has the same shape as the hole 184 with a larger size than the hole 184 . thus , the sealing member 50 becomes slidably restricted between the circular flange 562 and the base 52 of the sealing member 50 once the circular flange 562 is squeezed through the hole 184 , as a result that the pivot portion 56 is stably latched in the hole 184 . then , the second housing 20 is mounted on the first housing 10 to form the portable electronic device 100 . referring to fig4 and 6 , to insert the battery 30 into the first housing 10 , firstly , the mating portion 54 is pulled away from the opening 182 until the securing portion 542 is freed from the first housing 10 . then , the sealing member 50 is rotated about the pivot portion 56 until the opening 182 is fully exposed . after that , the battery 30 is aligned with the opening 182 . then , the battery 30 is pushed into the opening 182 . at this time , the battery 30 moves along the guiding section 46 and pushes the guiding section 46 into the slot 130 , as a result , the body section 42 of the stopping member 40 is bent towards the bottom wall 12 of the first housing 10 , and the battery 30 can slide through the opening 182 into the receiving space 124 of the latching portion 122 . once the battery 30 is slid pass the stopping member 40 , the stopping member 40 restores to an original state , and the battery 30 is fully received in the receiving space 124 . at this time , the opposite ends of the battery 30 is limited between the resisting portion 128 and the stopping member 40 , and the opposite sides of the battery 30 is limited between the latching portions 122 . thus the battery 30 is stably secured in the first housing 10 by the battery latching device 60 composed of the first housing 10 , the resisting portion 128 , the stopping member 40 and the latching portions 122 . finally , the sealing member 50 is reversely rotated about the pivot portion 56 until the mating portion 54 is aligned with the opening 182 again , then push the sealing member 50 to make the mating portion 54 accommodated in the opening 182 , at this time , the resisting members 542 resist against the first housing 10 again . when detaching the battery 30 from the first housing 10 , firstly , the mating portion 54 is pulled away from the opening 182 until the resisting engagement between the securing portion 542 and the first housing 10 is released . then , the sealing member 50 is rotated about the pivot portion 56 until the opening 182 is exposed . the stopping member 40 is pressed toward the bottom wall 12 of the first housing 10 , e . g ., the stopping member 40 is leveled with the projection sliders 126 . at this time , the battery 30 is freed to slide out of the opening 182 . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .
| 7 |
the milkweed oil starting material for use herein may be any milkweed seedmeal pressing or refined fraction thereof . though the current primary source of milkweed oil is seed from the common milkweed ( asclepias syriaca l . ), oil from other species of milkweed having a similar fatty acid profile ( high in linoleic acid ) could also be used . the sunscreen compounds of the invention are produced by derivatizing the milkweed oil with a cinnamic acid selected from the group of ferulic , coumaric , sinapic , and o - methylsinapic acids to form esters at or near the sites of unsaturation . these acids are illustrated by formula i , below . esterification is conducted through an epoxy intermediate formed by epoxidizing one or more of the olefinic groups ( sites of unsaturation ) present in the acyl substituents ( fatty acid side chains ) of the milkweed triglyceride . the milkweed oil fatty acid profile as reported by natural fibers corporation ( www . buymilkweed . com / oil profile . htm ) is reproduced in table i , below . a total of 42 % of the fatty acids are monounsaturated , 47 % are diunsaturated ( predominantly linoleic acid ), and the level of triunsaturated fatty acids ( linolenic ) is minimal . this fatty acid profile offers a platform for unique distribution of the cinnamic acid functionality . in a preferred embodiment of the invention , all , or nearly all , the available sites of unsaturation are derivatized with two cinnamate moieties per original site of unsaturation . however , if desired , the stoichiometry of the reactants or conditions of reaction ( as described below ), may be selected for achieving only partial derivatization . epoxidation may be carried out as described by qureshi et al . [ polymer science and technology , vol . 17 , plenum press , p . 250 ] or by any other method as known in the art . for example , the epoxidation may be carried out by reaction of the milkweed oil with formic acid and hydrogen peroxide at an elevated temperature on the order of 75 ° c . the degree of epoxidation should be such that there is at least 2 , and preferably at 3 , or even 4 , oxirane rings per triglyceride molecule . typically , the epoxidation is carried to completion . conversion of the oxirane rings of the epoxidized oil to hydroxy substituents is readily conducted in the presence of a strong acid , such as hcl , hno 3 , h 2 so 4 , etc . at a temperature ranging from about 50 ° c . to about 200 ° c . esterification of hydroxy or epoxy fatty acid moieties with the cinnamic acid is optimally conducted in the absence of oxygen at a temperature ranging from about 150 ° c . to about 250 ° c . for a period of time ranging from about 12 to 72 hours . alternatively , esterification of hydroxy or epoxy fatty acid moieties may be carried out with the use of acid catalyst such as zncl 2 , p - toluenesulfonic acid , tin ( ii ) 2 - ethylhexanoate , tin octanoate , tin chloride and bf 3 in toluene , tetrahydroxyfuran , dimethylformamide or another suitable solvent for the reactants at a temperature in the range of about 80 ° c . to about 150 ° c . for a period of time ranging from about 1 to 3 hours . scheme 1 , illustrated below , shows the esterification of milkweed oil with ferulic acid via the epoxide and hydroxyl derivatives to produce the ferulyl - milkweed oil ester . formic acid in the presence of peroxide is reacted with the unsaturated triglyceride at a temperature on the order of 75 ° c . the epoxide may then be directly esterified with ferulic acid in the presence of zncl 2 at 110 ° c . alternatively , each oxirane ring is opened by means of a strong acid catalyst to yield a dihydroxy intermediate , and then reacted with ferulic acid using zncl 2 or other acid catalyst ( as described above ) to yield the ferulated milkweed ester . the milkweed oil cinnamate esters of this invention , having at least 4 , preferably at least 6 , and more preferably at least 8 cinnamate moieties per triglyceride molecule , are characterized by the water - insoluble properties of a lipid that resists being washed off in water . the uv absorbance of these products extends from about 280 nm to about 350 nm , and they are particularly effective in absorbing uv in the range of about 310 to about 350 nm . this is predominantly in the uva range , but also covers part of the uvb range . for additional uvb protection , the subject compounds may be formulated with other sunscreen agents as discussed , below . the sunscreen agents of the invention may be formulated into any cosmetic preparations that are especially designed to be water - resistant . the total level of sunscreen agent in these preparations will typically be on the order of about 0 . 1 to 20 %, by weight , and preferably within the range of about 1 to about 15 %, by weight . the amount of sunscreen agent currently approved in the united states for inclusion in a topical skin treatment formulation is 15 % by weight . it is contemplated that the agents of this invention will be incorporated into formulations that are both effective and safe . an effective amount ( or photoprotective amount ) is that amount which is sufficient to significantly induce a positive effect of protection against uv sunlight as compared to a control . one measure of the effectiveness of the sunscreen agent is the sun protection factor ( spf ) of the composition . spf is a commonly - used measure of photoprotection of a sunscreen against sunburn . the spf is defined as the ratio of the uv energy required to produce minimal erythema on protected skin to that required to produce the same minimal erythema on unprotected skin in the same individual ( see federal register , 43 , no . 166 , pp . 38206 - 38269 , aug . 25 , 1978 ). a safe amount is that which does not produce serious side effects . the cosmetic preparations according to the invention can be formulated as a lotion , cream , gel , stick or aerosol . the base of the formulation may be a water - in - oil emulsion , an oil - in - water emulsion , an oil - in - oil alcohol lotion , a vesicular dispersion , or as an emulsifier - free starch / lipid dispersions as described in u . s . pat . nos . 5 , 676 , 994 and 5 , 882 , 713 , both herein incorporated by reference . the term “ oil ” is used herein to be inclusive of all lipids . the term “ lipid ” ( or fat ) is a comprehensive term referring to substances which are found in living cells and which are comprised of only a non polar hydrocarbon moiety or a hydrocarbon moiety with polar functional groups ( see the encyclopedia of chemistry , 3rd edition , c . a . hampel and g . g . hawley , eds ., 1973 , p . 632 , herein incorporated by reference ). most lipids are insoluble in water and are soluble in fat solvents such as ether and chloroform . commonly used oils for cosmetic formulations include coconut oil , silicone oil and jojoba oil . other components that may be included in the sunscreen formulations of the invention include : other uva and uvb sunscreen agents , such as 2 - phenyl - benzimidazole - 5 - sulfonic acid , tea salicylate , octyl dimethyl paba , padimate - o ( 2 - ethylhexyl 4 -( dimethylamino ) benzoate ) and octyl methyl cinnamate ; inorganic physical sunblocks , such as zinc oxide and tio 2 ; artificial tanning agents ; abrasives ; absorbents ; fragrances ; pigments ; colorings / colorants ; essential oils ; skin sensates ; astringents carriers and vehicles ; thickening / structuring agents ; emollients ; emulsion stabilizers ; excipients and auxiliaries commonly incorporated into cosmetic formulations ; humectants ; moisturizers ; skin conditioners ; anti - caking agents ; antifoaming agents ; antimicrobial agents ; antioxidants ; binders ; buffering agents ; bulking agents ; chelating agents ; chemical additives ; film formers ; humectants ; opacifying agents ; skin - conditioning agents ; vitamins ; and the like . suitable emulsifiers include any of those conventionally used for cosmetic formulations , including for example , ethoxylated esters of natural derivatives , such as polyethoxylated esters of hydrogenated castor oil , a silicone oil emulsifier such as silicone polyol , free or ethoxylated fatty acid soap , an ethoxylated fatty alcohol , a free or ethoxylated sorbitan ester , an ethoxylated fatty acid or an ethoxylated glyceride . exemplary agents and additives that could be included in formulations comprising the sunscreen agents of the invention , as well as suggested levels of addition , are given in u . s . pat . no . 5 , 989 , 528 ( tanner et al . ), which is herein incorporated by reference . as previously indicated , the compositions of the invention are useful as sunscreen agents to provide protection from adverse effects of uv radiation . the principal application is as a topical sunburn protectant for human skin . however , it is envisioned that the compositions and formulations of the invention would also have veterinary applications as a skin protectant . the sunscreen formulations contemplated herein may be applied to the skin by spreading or spraying a thin layer thereof over the skin surface intended to be protected . it is envisioned that the compounds of this invention may also have certain industrial applications , such as a uv protectant for epoxies , paints , and other consumer products . for these applications , the compounds could either be formulated into the material to be protected , such as by blending into a paint , or they could be applied as a separate coating . the following example is intended to further illustrate the invention , without any intent for the invention to be limited to the specific embodiments described therein . in a typical process , refined milkweed oil 582 . 0 g ( 673 . 76 mmol , iodine value , iv = 111 . 4 ) was placed in a 1 l 3 - necked jacketed flask equipped with a mechanical stirrer and heated to 45 . 5 ° c . formic acid ( 96 %, 39 . 7 g , 0 . 3 equiv ./ mol of c ═ c ) was added and the mixture stirred to homogeneity . hydrogen peroxide ( 50 %, 320 ml , 6 . 74 mol ) was added slowly ( i . e . drop wise ). at the end of hydrogen peroxide addition , the temperature was raised to 70 ° c . and vigorous stirring was continued for 7 hours . the heat source was then removed , the reaction mixture allowed to cool and transferred to a separatory funnel with ethyl acetate as diluent . the material was washed with saturated nacl ( 300 ml × 4 ) followed by saturated na 2 co 3 ( 35 ml ) in more nacl solution . when ph 7 . 5 was reached , the organic phase was then washed with deionized water . the wet organic layer was separated from a turbid aqueous phase and was concentrated at 60 ° c . in vacuo to remove the solvent and water . yield of epoxy triglyceride was 558 . 4 g ; the kinematic viscosities , measured were : η 40 ° c . = 1208 . 95 cs and η 100 ° c . = 81 . 3 cs , that is , a viscosity index of 18 . 79 cs /° c . pv = 9 . 4 , iv = 1 . 79 . specific rotation [ α ] d 20 =+ 0 . 17 ° ( 0 . 065 , ch 2 cl 2 ). an aqueous fraction ( 42 . 0 g ) was reclaimed from the final water - wash following concentration at 70 ° c ., thus giving a total yield of 600 . 6 g ( 97 %). in a 1 l jacketed flask as described above , reprocessed milkweed oil ( 648 . 0 g , 759 . 9 mmol ) was introduced . the oil was stirred vigorously at 40 ° c . and formic acid ( 90 . 4 %, 62 . 2 g , 1 . 22 mol ) was added in one portion followed with a slow ( drop wise ) addition of h 2 o 2 ( 50 %, 203 . 0 g , 2 . 98 mol ). at the end of peroxide addition , the temperature was increased to 70 ° c . after 15 h , the heat source was removed but stirring was continued , allowing the reaction mixture to cool to room temperature and the aqueous phase removed . deionized water ( 300 ml ) was added followed by 6 m hcl ( 100 ml ). the nearly colorless sludge was stirred at 70 ° c . overnight . the cream colored product was transferred into a separatory funnel using ethyl acetate as diluent . the aqueous layer was discarded and the organic phase washed sequentially with brine , saturated nahco 3 to ph 7 . 5 , and deionized water . ethanol was added to facilitate separation of the phases . after removal of the aqueous layer , the product was concentrated in vacuo at 70 ° c . to yield 711 . 6 g ( 94 . 7 %) of the polyhydroxyl triglyceride with an oxirane value = 1 . 35 ; iodine value = 14 compared to an iodine value of 114 in the starting milkweed oil . the measured kinematic viscosities were : η 40 ° c . = 2332 . 5 centistokes and η 100 ° c . = 75 . 53 centistokes , that is , a viscosity index of 37 . 62 centistokes /° c . specific rotation [ α ] d 20 =+ 0 . 37 °. milkweed polyhydroxytriglyceride 34 . 40 g ( 38 . 5 mmol ), glacial acetic acid ( 150 ml ), 4 - hydroxy - 3 - methoxycinnamic acid ( ferulic acid , 45 . 0 g , 231 . 7 mmol ), hcl ( 12 . 1 m , 4 . 5 ml ), ethyl acetate ( 250 ml ) were placed in a 1 l three - necked round bottomed flask equipped with a mechanical stirrer . the contents of the reaction flask were stirred and heated to gentle reflux . progress of the reaction was monitored by tlc ( hexanes / ethyl acetate : 1 : 1 v / v ) on precoated silica gel . after 36 h , the reaction mixture was allowed to cool to room temperature , diluted with more ethyl acetate and transferred into a separatory funnel . the solution was washed with deionized water ( 300 ml × 4 ) to remove most of the acetic acid . the organic phase was then washed with saturated disodium monohydrogen phosphate solution and deionized water until the washings were about ph 7 . the reddish tinged organic solution was dried ( na 2 so 4 ) and concentrated in vacuo to give a crude product , 64 . 0 g ( 81 %). the crude product was purified by volume liquid chromatographic ( vlc ) technique on silica gel with hexanes / ethyl acetate ( 1 : 1 ) as the eluting solvent . the desired fraction yield was 44 . 50 g ( 56 . 5 %) based on the hexaferuloyl ester . all references disclosed herein or relied upon in whole or in part in the description of the invention are incorporated by reference .
| 0 |
hereinafter , exemplary embodiments of the present invention will be described in detail with reference to the accompanying drawings . it is to be noted that in giving reference numerals to components of each of the accompanying drawing , like reference numerals refer to like elements even though the like components are shown in different drawings . further , in describing exemplary embodiments of the present invention , well - known functions or constructions will not be described in detail since they may unnecessarily obscure the understanding of the present invention . further , exemplary embodiments of the present invention are described below , but may be variously modified and practiced by those skilled in the art without departing from the technical spirit of the present invention . according to an exemplary embodiment of the present invention , in order for a user to login in a web service , the user stores all the used ids and passwords in a device ( for example , mobile phone ) which is always carried by him / her and the corresponding device performs an authentication process , such that the user does not require to memorize his / her id and password . conditions required by the device storing the id and password are as follows . { circle around ( 2 )} the device should have computing capability . ( the device should be able to perform an encoding operation ). { circle around ( 3 )} the device should be able to be accessed through the internet . { circle around ( 4 )} the device should be always carried by a user . a representative device satisfying all the conditions described above is a smart phone . a level of the camera is enough to analyze a two - dimensional barcode ( or , two - dimensional code ) such as qr code . in the computing capability , an encoding and decoding operation should be able to be performed . an encoding technology used herein needs to use a public key scheme , and therefore the computing capability enough to perform rsa or dsa within a short period of time is required and the internet access should be able to be made . according to the scheme proposed by the present invention , since an authentication device may directly access an authentication server of a web site , when the authentication device may not be connected to the internet , user authentication may not be made . for the user authentication of a web service , a user needs to create his / her own account in a service and after the account is created , the user authentication is made through a login procedure and the user may receive a personalized service . an account creation method and a login method will be sequentially described below . fig1 is a diagram sequentially illustrating a procedure of creating an account when a user wants to join a web site and fig2 is a diagram illustrating a message exchange procedure between a user and a web service at the time of creating an account . the account creation method will be described in detail below with reference to fig1 and 2 . first , when a user wants to join any web service , a web service provides a joining form to a user ( s 101 ). next , when the user prepares all forms in addition to his / her own id , the web service needs to confirm an authentication device carried by the user so that the user may perform a login through the authentication device later . that is , an operation to bind the user with the authentication device is required . therefore , the web service transmits a bit string to the user to confirm the authentication device . a method for transmitting a bit string may be diverse , but in the case of a smart phone , it is most convenient to use sms . when the sms may not be used ( for example , in the case of using a device such ipod touch ), any bit string is transmitted to a user through e - mail , and the like . in describing below the exemplary embodiment of the present invention , the bit string is marked by nonce1 ( s 102 ). next , the web service creates the two - dimensional barcode and shows the created barcode through a web browser . any two - dimensional barcode may be used , but the qr code is most generally used . the tow - dimensional barcode includes a url of the web service , a public key of the web service , and any new bit string different from the nonce1 . in describing below the exemplary embodiment of the present invention , the bit string is marked by nonce2 . as the public key of the web service , any public key algorithm within a range included in a gist of the present invention may be used . in describing below the present invention , the public key of the web service is marked by wpub ( s 103 ). next , the user uses information received from the two - dimensional barcode to confirm whether he / she joins the corresponding web site in advance ( that is , whether an account is created ). one user may be permitted to have a plurality of accounts depending on characteristics of the web service . in this case , it is preferable to go through a process of confirming whether a new account is additionally opened ( s 104 ). next , if it is confirmed that the user joins the corresponding web site in advance or wants to additionally open a new account , a warning message is shown to the user and an account creation process stops . on the other hand , if it is confirmed that the user does not previously hold an account or wants to additionally open a new account , the account creation process continuously proceeds . new confidential is configured of an id and a public key of a newly created key pair ( a public key and a secret key ). hereinafter , in describing the present invention , the public key and the secret key are marked by dpub and dpriv . of the created key pair , the public key may be reckoned to replace a password . a user id may be transmitted to the authentication device while being included in the qr code or the user may directly input the user id to the authentication device . a scheme for transmitting a user id to an authentication device while being included in the qr code may be convenient but may expose the user id and a scheme for directly inputting a user id may lower the exposure possibility of the user id but may make the user inconvenient . when the key pair creation is completed , the authentication device encodes the user id , the newly created public keys dpub , nonce1 , and nonce2 , and a signature for the nonce1 and nonce2 based on the public key wpub of the web service which is received beforehand . at the time of performing the signature , the newly created secret key dpriv is utilized . the encoded message is transmitted to the web service . at the time of transmitting the encoded message , url received through the qr code is utilized ( s 105 ). next , the web service resolves the message received from the authentication device of the user using his / her own secret key wpriv and confirms whether the signature is right . the user has two accesses to the web service , in which one is an access using a computer at an early stage and the other is an access transmitting the encoded confidential using the authentication device . the web service should be able to find out whether the two accesses come from the same user . for this purpose , the nonce2 is used . since the authentication device copies and takes the nonce2 using a camera , the computer and the authentication device share the same nonce2 value ( s 106 ). next , the web service stores contents input by the user and the user public key dpub obtained by decoding in its own database to complete the account creation operation ( s 107 ). fig3 and 4 illustrate procedures of performing a login using the previously held account . a login method will be described in detail below with reference to fig3 and 4 . first , when the user accesses the web service through the web browser to request a login , the web service shows the qr code through the web browser . the qr code includes the url of the authentication server of the web service , the public key wpub of the web service , and any bit string . the nonce is newly created whenever the user requests a login and a timer is operated as soon as the login request of the user is received . a web server of the web site previously sets time as a time limit showing the qr code in the timer . for example , when the user sets the timer to perform the authentication within 60 seconds , the qr code is shown only for 60 seconds and is automatically hidden after the elapse of 60 seconds . the reason for setting the timer is to prevent the nonce value from being reused . after the qr code is hidden , when the user wants the authentication , he / she needs to again request the authentication . in this case , the nonce value is renewed . the web server of the web site knows what user wants a login , and therefore is subscribed in an authentication server to let the authentication server inform when the authentication is completed ( s 201 ). next , the user photographs the qr code on a web browser screen using the authentication device . when the authentication device is a smart phone , the authentication device drives a separate application ( hereinafter , app ) for authentication and photographs the qr code . the authentication device confirms the url included in the qr code to check whether the confidential is already present in the authentication device ( s 102 , s 103 ). next , if it is confirmed that the confidential is not stored , an error message is output ( that is , authentication failure ) ( s 214 ). on the other hand , if it is confirmed that the confidential is stored , an authentication token is created and then transmitted to the url included in the qr code . the authentication token includes the confidential ( that is , the user id and the public key dpub of the key pair created by the user ) and the nonce obtained from the qr code . further , the authentication token includes the signature for the nonce and the signature uses the secret key dpriv . when all the contents are encoded by using the public key wpub of the web server , the encoded contents become the authentication token ( s 204 ). next , when receiving the authentication token , the authentication server of the web service decodes the received authentication token and then confirms the signature to check whether a message is normal and if it is confirmed that the message is normal , the authentication server sees the confidential to determine whether the normal user attempts a login and if it is confirmed that the user is the normal user , informs the web server of the web service that the normal authentication is made . as described above , the web server of the web service is subscribed in the authentication server to receive the message for a set time and the authentication server responds thereto and thus the web server may perform the login processing on the corresponding user ( s 205 ). as described above , according to the exemplary embodiment of the present invention , the communication between the web server of the web service and the authentication server may use a message queue , but the present invention is not limited thereto and the communication between the web server of the web service and the authentication server may use any method within a range included in the gist of the present invention . when the authentication server of the web service confirms the confidential , the size of the public key is much larger than that of the password at the time of confirming whether the public key agrees and therefore a cost increase is expected , but the authentication server calculates and stores hash values ( digests ) for the public key at the time of the account creation , and then uses the hash values at the time of confirming whether the public key agree to minimize the costs , such that it may be appreciated that the problem of cost increase may not occur . as described above , according to the exemplary embodiments of the present invention , it is possible to perform the user authentication only by holding the camera on the web browser screen when the dedicated device is present and improve the user convenience by driving applications which may be authenticated and then performing only the photographing even in the case of using a smart phone . in the case of a handicapped person who is difficult to perform the input through the keyboard , convenience may be more increased . according to the exemplary embodiments of the present invention , it is possible to effectively cope with the brute force attack or the premeditated attack by using an encryption key instead of using the password . the existing 8 to 12 digit password which is combined only by alphabet and figures requires the attack attempts a maximum of 62 8 (≈ 2 47 ) to 62 12 (≠ 2 71 ) times , but according to the exemplary embodiment of the present invention , the encryption key usually uses 512 bits , 1024 bits , and 2048 bits , and therefore at the time of the brute force attack search , the attack attempts are required a maximum of 2 512 , 2 1024 , and 2 2048 times , such that the present invention may provide the high security strength . according to the exemplary embodiments of the present invention , the secret key essential for authentication is not stored in the authentication server , and therefore even though the specific web service is hacked to expose all the contents of database included in the authentication server , it is possible to prevent the login from being made in the user name . according to the exemplary embodiments of the present invention , different confidential for each web service is used , and therefore even though the specific web service is exposed to hacking , no account of other services is damaged , each web service uses different keys at all times and thus security may be secured , and the user does not require to memorize even his / her own id and thus the user id may be differently set for each web service , such that even though several web services maliciously gain agreement , it is difficult to find out a correlation between users . according to the exemplary embodiments of the present invention , the user never directly inputs contents at the time of a login , and therefore the contents are safe from a keylogger ( keyboard hacking ). according to the exemplary embodiments of the present invention , since all the security related information is stored in the smart phone of the user and the smart phone directly communicates with the web server , even when the stability of the used pc is not secured ( for example , shared computer of a pc room , and the like ), security may be secured . meanwhile , the embodiments according to the present invention may be implemented in the form of program instructions that can be executed by computers , and may be recorded in computer readable media . the computer readable media may include program instructions , a data file , a data structure , or a combination thereof . by way of example , and not limitation , computer readable media may comprise computer storage media and communication media . computer storage media includes both volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules or other data . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical disk storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can accessed by computer . communication media typically embodies computer readable instructions , data structures , program modules or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared and other wireless media . combinations of any of the above should also be included within the scope of computer readable media . as described above , the exemplary embodiments have been described and illustrated in the drawings and the specification . the exemplary embodiments were chosen and described in order to explain certain principles of the invention and their practical application , to thereby enable others skilled in the art to make and utilize various exemplary embodiments of the present invention , as well as various alternatives and modifications thereof . as is evident from the foregoing description , certain aspects of the present invention are not limited by the particular details of the examples illustrated herein , and it is therefore contemplated that other modifications and applications , or equivalents thereof , will occur to those skilled in the art . many changes , modifications , variations and other uses and applications of the present construction will , however , become apparent to those skilled in the art after considering the specification and the accompanying drawings . all such changes , modifications , variations and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention which is limited only by the claims which follow .
| 7 |
the aim the invention is to connect the exchange 1 to another exchange 6 of the same type when the link 7 for connecting the two exchanges is of a different type and operates in accordance with a protocol other than that of the isdn standard . in the example shown in fig1 , the link 7 uses an internet protocol conforming to the udp - ip standard . more generally , the link includes channels ( not shown ) for transmitting the message content parts 5 and a channel to the udp - ip standard for transmitting the signaling parts 4 relating to the message content parts 5 . the invention converts the signaling information 4 , which consists of data in the format of the isdn standard , into a signaling message 8 in a format accepted by the channel 7 to the other standard . for example , signaling messages 4 , 41 , 42 and 43 can be encapsulated in udp - ip packets 9 to 12 . the packets 9 to 12 are encapsulated by control bits conforming to the udp - ip standard . under the udp - ip standard , one message is inserted into each udp - ip packet . there cannot be more than one signaling message in a udp - ip packet . moreover , a signaling message is not divided into several parts . according to the invention , the messages 8 encapsulated in this way are sent on the channel 7 and received in the exchange 6 . in the exchange 6 the received messages 8 are converted into information of the signaling part 4 type conforming to the isdn standard which can then be processed in the exchange 6 to enable the units 2 and 3 to be connected to other units 13 and 14 ( possibly on another channel ). because the udp - ip protocol involves the risk of loss of packets , and most importantly the risk of the order of the packets 9 to 12 being reversed , an improvement to the invention modifies the message 8 formatted to the udp - ip standard by adding packet order information to it . in the structure of the message 8 , the construction of the successive data blocks ( blocks 9 to 12 ) is modified . packet order information is added to each block . the packet order information occupies one byte , for example , covering packet numbers from 0 to 255 . the packet number is then incorporated into the message 8 in a respective area 15 to 18 placed before or after each block 9 to 12 . the packet number forms an integral part of each send block ( i . e . each block to be sent ). in this case , in accordance with the invention , it is the send block consisting of a block 9 and its number 15 that must conform to the udp - ip standard . the successive send blocks are then sent to the other exchange 6 . the latter receives them and sends back to the exchange 1 an acknowledgment essentially representing the number of the last send block that has been received and corresponding to a continuous stream of send packets that have been received . in one example , this sending is affected by means of a circular memory 19 which has four locations for loading four send blocks , for example . thus send blocks 1 , 2 , 3 and 4 are loaded . the four send blocks are then sent in turn to the exchange 6 via the channel 7 . the memory 19 can be loaded as and when the blocks are sent . the exchange 6 may then , for example , depending on transmission conditions that apply , determine that it has received blocks 1 and 2 , that it has not received block 3 and that it has received block 4 . in this case , the exchange 6 sends an acknowledgment to the exchange 1 indicating the block number 2 ( n = 2 ). this means that the blocks have been received continuously up to block 2 . in this case the exchange 1 can load the circular memory 19 with subsequent blocks 5 and 6 instead of the blocks 1 and 2 already received . the content of the memory 19 will then consist of the blocks 3 , 4 , 5 and 6 . accordingly , when the exchange 1 loads the circular memory 19 with the blocks 5 and 6 , only these two blocks are sent . after block 6 is sent , it is necessary to send block 3 again if no acknowledgment citing a block number greater than or equal to 3 has been received after a time - out . a block is sent when it is present in the circular memory and the block already sent has not been acknowledged after a time - out . in this way the block 3 is sent , and possibly the block 4 . note that the block 4 can be sent a second time , even though it has already been received ( after it was sent the first time ), because the time - out can end before the acknowledgment for block 3 is received ( or even for block 6 , as both these blocks have been sent ). thus the circular memory 19 is loaded and blocks are sent as and when acknowledgments are received . if no acknowledgment is received after a given time - out all of the content of the circular memory is sent again . thus , if no other acknowledgment has been received since the acknowledgment citing block number 2 , blocks 3 , 4 , 5 and 6 can be sent a second time . it is also possible for block 3 , which has not previously been received in time , to reach the exchange 6 late , although by then the exchange has already received block 3 ( after it was sent the second time ). in this case , the block that was sent is merely received twice over . it is set aside and is not processed a second time . according to another improvement to the invention , the functionality of the channel 7 is tested continuously by sending surveillance messages 20 which simply take the form of a signaling block 1 that is sent at a period adopted for testing the functionality of the channel 7 . for example , it can be sent approximately every 15 seconds . if the acknowledgment 1 which concerns it is received , the channel is deemed to be functional . if not , after a particular number of attempts , the channel 7 is declared deficient and an alert procedure is undertaken . the same applies if an expected block n is never received . given that only one byte is used to convey the block order information , the number of a send block cannot be greater than 255 . this is not a problem because if the number of blocks is greater than 255 it is sufficient to start counting again from 0 when 255 is reached . in this case , the circular memory need only include a number of blocks significantly less than 256 . fig2 shows similar elements to fig1 , but for the qsig - gf protocol , which does not conform to the isdn standard either . the figure also shows the exchange 1 in a little more detail . the exchange includes a microprocessor 21 connected by a bus 22 to the units 2 – 3 , a qsig - gf format interface 23 and a program memory 24 containing in particular a program for formatting messages to the format conforming to the qsig - gf standard . the same applies to fig1 with regard to the udp - ip standard . the program 24 provides a particular mode of use including a call request procedure , a connection procedure , a procedure for sending free messages ( facility messages ) and a disconnection procedure . in accordance with the invention , the microprocessor 21 launches a working session of the interface 23 so that it calls the exchange 6 by setting up a call with no b channel , connects to it and remains connected to it . automatic disconnection time - outs are eliminated if necessary . the call set up with no b channel is set up via the d channel of the qsig - gf bundle . it is referred to as a support call . in accordance with the invention , facility messages are sent on the d channel by encapsulating the isdn signaling ( sapi s and sapi p messages ) in facility messages carried by the support call . facility messages are exchanged between the exchange 1 and the exchange 6 transparently . the transfer can continue for as long as the support call is active . in this mode , messages to be sent on the qsig - gf format channel must essentially include a header 25 . in practice , the header 25 occupies one byte . this first byte is a facility information element ( ei facility ). it contains four types of information . a first type of information advises the length of the facility message . the header also contains a protocol discriminator , references of the support call request and the message type . in fact , in this instance , the message type is always the facility type . an area 26 of the facility message following on from the header area 25 contains a header specific to the message . in a subsequent area 27 , the nature of the message ( sapi s or sapi p ) is indicated by a code corresponding to s or p . signaling messages 4 are sent in a subsequent free area 28 , and consist of the information previously referred to . if the resulting message conforming to the qsig - gf protocol is longer than the 128 bytes available in a normal facility message frame ( from which the headers and areas 26 and 27 must be deducted , incidentally ), the length indicated in the part 25 must include an indication that the facility message continues beyond the 128 bytes . in this case , the message includes a part 29 and a part 30 . the part 29 is identical to the part 26 . the part 30 is substituted for the indication relating to the nature of the message ( sapi s or sapi p ). however , it includes in practice an indicator of the order of the length extension ( the additional length over and above the normal length ). in this example , the part 30 could contain information a , then information b , and so on ; depending on the length of the signaling message to be transmitted , length information 25 is provided and markers a , b are inserted into the message . the signaling data to be transmitted in accordance with the invention comprises flow control data , security data and , essentially , message scheduling data . according to the invention , the information part 5 can be sent between the exchanges 1 and 6 via other channels , in a manner that is known or unknown . the units 2 and 3 can also be connected to the units 13 and 14 by udp - ip or qsig - gf channels . the channels , although of the same type as the channels used to transmit signaling , are nevertheless different . thus signaling and messages are not sent at the same time on the same channel .
| 7 |
for the purposes of promoting an understanding of the principles in accordance with the embodiments of the present invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended . any alterations and further modifications of the inventive features illustrated herein , and any additional applications of the principles of the invention as illustrated herein , which would occur to one skilled in the relevant art and having possession of this disclosure , are to be considered within the scope of the invention claimed . initial reference is made to fig1 - 8 illustrating a clubhead and hosel arrangement generally referred to by reference numeral 100 . the clubhead 110 and hosel 120 are normally cast , but in limited circumstances may also be forged , from a suitable alloy such as any combination of aluminum , steel , beryllium , nickel , copper , titanium , or other metals in varying combinations . the clubhead 110 comprises a clubface 111 , club back 112 , toe 113 and heel 114 . while not shown , a first end 125 of the hosel 120 includes an opening for receipt of a golf club shaft 130 ( shown in dotted lines ). the shaft 130 is typically held in place with an adhesive like epoxy or similar substance . to accommodate the shaft 130 , the first end 125 and upper segment 135 of the hosel 120 have a circular cross - section and the upper segment 135 of the hosel 120 is in alignment with the corresponding received shaft 125 . the hosel 120 is termed a dog - leg hosel based on its configuration . the hosel 120 begins to diverge near a lower segment 140 thereof . the divergence extends the hosel 120 in a rearward direction or in a direction of a golfer &# 39 ; s backswing . along with the divergence , the cross - section of the hosel 120 transforms from circular to elliptical . the elliptical cross - section of the hosel 120 near the clubface 111 is flattened such that a lower hosel surface 145 is elevated out of the way of the clubface 111 . fig9 shows a cross - sectional view along a in fig1 of the lower segment 140 of the hosel 120 showing flattened surface 145 on a clubface 111 side of the club . now referring to fig5 , each club in a set ( e . g ., 1 - iron , 2 - iron , 3 - iron , 4 - iron , 5 - iron , 6 - iron , 7 - iron , 8 - iron , 9 - iron , wedge and pitching wedge ) has a cavity 115 with a different such that each club &# 39 ; s weight distribution is different . the cavity 115 of each club is designed according to the hosel 120 position and orientation for the subject club . in so doing , a club &# 39 ; s center of gravity is positioned optimally for player performance . the hosel 120 becomes integral with the clubhead 110 at an elevated point near the golf club heel 114 . the divergence of the hosel 120 provides for an unobstructed clubhead face 111 to prevent shanks . that is , more surface area of the clubface 111 is available to hit the golf ball and the hosel 120 is out of the way of the striking surface of the clubface 111 . in addition , by integrating the hosel 120 at an elevated point on the clubhead 110 , swing energy is transferred to a position at the rear of the clubhead 110 . with conventional clubs , swing energy is transferred to the leading edge where the hosel joins the clubhead . consequently , the swing energy transferred with the present clubs provides a player with additional golf ball travel distance in response to the same swing magnitude . accordingly , a player does not feel the desire to over swing . now referring to fig1 b , a chart 200 details two measurements ( a ) 210 and ( b ) 220 in millimeters and an angle ( c ) 230 in degrees ( as identified in fig1 a ) for an exemplary set of irons ( i . e ., 4 iron through pitching wedge ) 240 in accordance with the embodiments of the present invention . the chart 200 shows that ( a ) 210 and ( b ) 220 have an inverse relationship . that is , as ( a ) 210 increases from the 4 iron to the pitching wedge , ( b ) 220 decreases . angle ( c ) 230 decreases from the 4 iron to the pitching wedge . consequently , a width of the sole of the club increases from 4 iron to pw . fig1 a shows a chart 300 detailing iron dimensions , including an offset 310 , for an exemplary set of irons ( i . e ., 4 iron through pitching wedge ). the offset 310 , as shown in fig1 b , is measured from a leading edge 320 of the hosel 120 and a leading edge 330 of the clubface 111 . a positive offset 310 signifies that the leading edge 320 of the hosel 120 is ahead of the leading edge 330 of the clubface 111 while a negative offset signifies that the leading edge 320 of the hosel 120 is behind the leading edge 330 of the clubface 111 . the offset hosel 120 of the present clubs helps players maintain their hands in the proper position through the hitting zone , including at time of impact . hand position is a significant problem faced by all golfers . the offset hosel 120 of the embodiments of the present invention keeps a player &# 39 ; s hands in a forward position thus causing the player to release and square up their hand position as their swing progresses through the hitting zone . the additional useful surface area of the clubface 111 and the proper hand position not only reduces shanks , it also , through repetition , teaches a player a more consistent and proper swing . also , the hosel 120 orientation further brings the energy of the clubhead 110 to a center - point on the clubface 111 rather than conventional clubs which , based on their hosel orientation , direct energy closer to a toe than the heel . as disclosed above , the back side of the clubs of the embodiments of the present invention include cavities 115 for distributing weight differently to fully utilize the benefits of the hosel 120 . although the invention has been described in detail with reference to several embodiments , additional variations and modifications exist within the scope and spirit of the invention as described and defined in the following claims .
| 0 |
fig1 is an elevational view of an electrosurgical apparatus 10 comprising an electronic control power source typically a radio frequency generator 12 connected by an electrical connector 14 to an electrode holder 16 . in this embodiment , the electronic control power source 12 is a monopolar device with one polarity of electrical voltage being furnished through electrical connector 14 and with a second electrical connector ( not shown ) normally connected through a dispersive electrode to the patient . although a specific example has been shown for the electronic control power source , the power source , per se , does not form a part of the invention as will be apparent hereinafter . the electrode holder 16 is electrically connected to an electrode 20 through activating switches shown as push button switches 22 and 24 . first switch 24 provides sufficient power to electrode 20 for cutting tissue whereas second switch 22 provides limited power to electrode 20 for coagulation . multiple switches 22 and 24 on the electrode holder 16 enable cutting or coagulating by the surgeon with the electrosurgical electrode 20 . fig2 is an enlarged exploded sectional view generally along the line 2 -- 2 of fig1 illustrating the electrode holder 16 having an external taper 26 and an axial aperture 28 . the electrode holder 16 is preferably made of an insulating plastic material with a resilient metallic electrical connector 30 connected to switches 22 and 24 ( not shown ) and disposed within the electrode holder 16 . shaft connecting means comprising a rounded first end 31 of a solid electrode shaft 34 is received within an aperture 36 of an insulating hub 38 preferably made of an insulating plastic material . the insulating hub 38 includes an internal taper 40 which cooperates in a sealing relationship with the external taper 26 of the electrode holder 16 when the first end 31 of solid electrode shaft 34 is inserted within axial aperture 28 of the electrode holder 16 to electrically contact electrical connector 30 . a substantially waterproof seal is established between the internal taper 40 and external taper 26 . the insulating hub 38 includes an undercut portion 42 comprising a surface 44 extending generally axially along solid shaft 34 and defined by a shoulder 46 . the undercut portion 42 is established to receive shaft insulation means 50 shown as a first shaft tubing 51 in direct engagement with the solid electrode shaft 34 and a second shaft tubing 52 which overlays the first shaft tubing 51 . the shaft insulation means 50 extends upon surface 44 and engages shoulder 46 to provide a watertight seal between the shaft tubing insulation means 50 and insulating hub 38 . preferably , the shaft tubing insulation is a heat shrinkable tubing as will be described in greater detail hereinafter . furthermore , although the shaft tubing insulation has been disclosed as a first and second shaft tubing insulation , it should be appreciated that a single tubing insulation may be incorporated within the present invention . irrespective of whether a single or multiple shaft tubing insulation is utilized , it is important that the outer surface of the shaft tubing insulation be resistant to abrasion normally encountered in the surgical procedure . this abrasion resistance will maintain the electrical insulation characteristic of the shaft tubing insulation and reduce the possibility of undesired electrical leakage through the insulation due to abrasion occuring during the operating procedure . fig3 is an enlarged elevational view of a first embodiment of an improved electrosurgical electrode 20a . the insulating hub portion 38 is identical to the embodiment shown in fig2 . the solid electrode shaft 34 within the shaft tubing insulation means 50 includes a second end 32 receiving an electrode tip 60 which will be described in greater detail in reference to fig4 - 6 . fig4 is an enlarged sectional view of a portion of the electrode shown in fig3 with fig5 being an elevational view along line 5 -- 5 in fig4 . the solid electrode shaft 34 is tapered by a taper 62 at the second end 32 . the second end 32 includes an axial bore 64 for receiving an electrode tip base ( proximal end ) 66 . the electrode tip base ( proximal end ) 66 is secured from axial movement from the axial bore 64 by a deformation 68 in the outer surface of the second end 32 . the deformation 68 may be obtained by a swaging operation , the use of a center punch or the like . the electrode tip base ( proximal end ) 66 may be optionally deformed or crimped at 69 to receive the deformation 68 . the electrode tip 60 is tapered along the length thereof as shown in fig4 - 5 and includes a bend at 70 forming and angle of approximately 10 ° from an axis 72 extending through the solid electrode shaft 34 . the electrode tip 60 also includes a bend at 74 of approximately 100 ° establishing the distal end 76 of the electrode tip 60 to have an axis thereof 78 established approximately 90 ° relative to the axis 72 extending through the solid electrode shaft 34 . a tip insulator 82 insulates the tapered electrode tip 60 from an area approximate the base 66 to expose only a portion of electrode tip 60 adjacent the distal end 76 as shown in fig4 . the tip insulator 82 is overlayed by the shaft insulation means 50a and specifically first shaft tubing 51a and second shaft tubing 52a to provide a watertight electrical seal of the electrode tip 60 and electrode shaft 34 with only the distal end 76 of the electrode tip 60 being exposed . in a specific example of the electrode 20 shown in fig3 - 5 , the solid shaft 34 is preferably made of type 300 series stainless steel with the electrode tip 60 fashioned from a conical blank of a cobalt chromium alloy material . the distal end 76 preferably has a spherical radius of 0 . 007 inches with a teflon tip insulator 82 exposing from approximately 0 . 040 inches to 0 . 050 inches . this exposure has been found to be optimal since a much greater exposure will cause the electrical energy to dissipate whereas a much lesser exposure will concentrate the electrical energy in a confined area . the embodiment shown in fig4 utilizes a soft polyolefin shrink tubing for the first shaft tubing 51a and a polyvinylidene fluoride sold under the trademark kynar by raychem corporation for the second shaft tubing 52a . the first shaft tubing prevents leakage of electrical energy especially radio frequency power along the solid shaft 34 . additionally , the first shaft tubing seals the first and second ends 31 and 32 of solid shaft 34 to provide a water tight seal . the second shaft tubing 52a overlays the first shaft tubing 51a to provide additional resistance to abrasion . fig6 is an enlarged sectional view similar to fig4 illustrating a variation of the electrode of fig3 . in this embodiment , a single shaft tubing 50b is utilized for effecting the insulation of solid shaft 34 . the single shaft tubing 50b may be a semi - rigid polyolefin tubing as described in raychem specification rt - 1190 / 3 . the thickness of the shaft tubing 50 should be sufficient to prevent electrical leakage of the radio frequency signal generated by the power source 12 . preferably this thickness may be in the range of 0 . 013 inch to 0 . 017 inch . the distal end 76 as illustrated by phantom line 84 extends beyond the surface of the electrode 20 as illustrated by the phantom line 86 a distance less than the radius of the electrode 20 as represented by the distance between axis 72 and phantom line 86 . this diameter of the configuration enables the electrode tip 60 to have a low axial profile to provide strength and rigidity while permitting passage through an introducer cannula . fig7 is an enlarged elevational view of a second embodiment of an improved electrosurgical electrode 20c . the insulating hub portion 38 is identical to the embodiment shown in fig2 . the solid electrode shaft 34 within the shaft tubing insulation means 50c includes a second end 32 receiving an electrode tip 60c which will be described in greater detail in reference to fig8 - 14 . fig8 is an enlarged sectional view of a portion of the electrode shown in fig7 with fig9 being an elevational view along the line 9 -- 9 in fig8 . the solid electrode shaft 34 is tapered by a taper 62 at the second end 32 . the second end 32 includes an axial bore 64 for receiving an electrode tip base ( proximal end ) 66c . the electrode tip base ( proximal end ) 66c is secured in the axial bore 64 by suitable means as set forth in reference to fig4 . the electrode tip 60c is tapered along the length thereof as shown in fig8 and includes a bend at 71 of approximately 90 ° establishing the distal end 76c of the electrode tip 60c to have an axis thereof 79 established approximately 90 ° relative to the axis 72 extending through the electrode shaft 34 . the electrode tip 60c is formed in a hooked configuration having a blade 81 . in a specific embodiment of the electrode 20c shown in fig7 - 9 , the solid shaft 34 and conical shaped blade blank are made of series 300 stainless steel . the distal end 76c has a spherical radius approximately of 0 . 007 inches . the embodiment of fig7 - 9 utilizes a soft polyolefin shrink tubing for the first shaft tubing 51c and a polyvinylidene fluoride tubing for the second shaft tubing 52c in a manner similar to fig4 . fig1 is essentially identical to fig8 but utilizes a single shaft tubing of semi - rigid polyolefin tubing in a manner similar to fig6 . the distal end 76c as illustrated by the phantom line 84c extends beyond the surface of electrode 20c as illustrated by the phantom line 86c a distance generally equal to the radius of the electrode 20c as represented by the distance between axis 72 and phanton line 86 . this diameter of the configuration enables the electrode tip 60c to be passed through an introducer catheter . fig1 - 14 illustrate the steps of making the electrode tip 60c shown in fig7 - 10 . although the process is shown with the electrode tip 60c attached to the electrode shaft 34 , it should be understood that the process may be performed prior to securing the electrode tip 60c to the solid shaft 34 . fig1 shows the bending of the conical blank electrode 60c at 71 to provide a substantially 90 ° bend with the axis 79 of the distal end 76 being perpendicular to the axis 72 of solid shaft 34 as shown in fig8 . fig1 illustrates dies 91 and 92 comprising the bent conical blank to provide the blade 81 having a substantially uniform thickness as shown in fig1 . fig1 shows the complete electrode tip 60c awaiting the application of the shaft tubing 50c or 50d . although the two embodiments of the improved electrodes shown in fig3 - 6 and fig7 - 10 may find a wide variety of applications , the electrode shown in fig3 - 6 finds particular value in meniscectomy procedures whereas the electrode shown in fig7 - 10 finds particular value in a subcutaneous lateral release . fig1 illustrates the interior knee joint 100 of a patient undergoing examination by an arthroscope 102 revealing a meniscal defect 104 . fig1 shows the entry of the electrode 20a of fig3 - 6 with the electrode tip 60 excising the defect through electrosurgery to enable the subsequent removal of excised tissue from the joint . the specific configuration of the electrode tip 60 facilitates an easy excision of the tough cartilaginous tissue . fig1 illustrates the interior knee joint and muscle tissue 110 with a landmark needle 112 marking the proximal limit of lateral release at the margin of the vastus lateralis . fig1 shows the electrode shown in fig7 - 10 effecting release distally to the level of the tibial tubercle with the line of incision disposed approximately one centimeter to the border of the patella . the improved hemostasis as a result of the electrode accelerates rapid recovery of the patient and lowers patient morbidity . the present disclosure includes that contained in the appended claims as well as that of the foregoing description . although this invention has been described in its preferred form with a certain degree of particularity , it is understood that the present disclosure of the preferred form has been made only by way of example and that numerous changes in the details of construction and the combination and arrangement of parts may be resorted to without departing from the spirit and scope of the invention .
| 0 |
referring to the drawings , a preferred form of the present invention comprises a source of dc analog voltage 4 which may be a potentiometer 6 that is connected between a source of voltage 10 and a current sink 5 at ground potential . source 10 produces a reference voltage which is the difference in potential between the voltage produced by source 10 and the voltage established by current sink 5 . any desired dc analog voltage between the value of the reference voltage and ground potential may be selected by moving a slider 8 along potentiometer 6 . according to this arrangement , the reference voltage and analog voltage have the same polarity , and current sink 5 has a neutral polarity and voltage . an integrating circuit 12 comprises a conventional operational amplifier 14 having an inverting input 15 , a non - inverting input 16 , and an output terminal 17 which produces an output signal vo . the integrating circuit also comprises a feedback capacitor 18 and input resistors 19 and 20 . a conventional comparator 22 compares output signal vo with a signal transmitted over a conductor 23 . when the voltage of the signals becomes identical , the comparator produces an indicating pulse which stops the operation of a digital counter 24 . counter 24 produces a digital output signal on an output cable 25 comprising a plurality of conductors in which each conductor represents one bit of a digital number . the counter sums clock pulses generated by a clock 26 in a well known manner . the output of counter 24 is transmitted to a latch circuit 28 which is loaded in response to the indicating pulse produced by comparator 22 . the latch is capable of storing a digital number which is available on digital output terminals 29 . the connection of the reference voltage , analog voltage and current sink to integrating circuit 12 is controlled by a switch circuit 30 . the switch circuit comprises mos field effect transistors 32 - 35 having gates 38 - 41 , drains 44 - 47 and sources 50 - 53 , respectively . referring to fig3 a , source 10 more specifically comprises an operational amplifier 70 , a zener diode 72 and resistors 74 , 75 and 77 connected as shown . conductor 79 is connected to a source of positive voltage . referring to fig3 b , counter 24 more specifically comprises identical counter modules 81 and 82 , such as type sn74193 manufactured by texas instruments , inc ., and identical counter modules 84 and 85 , such as type sn7493 manufactured by texas instruments , inc . counter 24 also comprises a nand gate 86 , an inverter 88 , and conductors 90 - 93 connected as shown . and gate 62 ( fig1 ) is fabricated within counter module 81 . still referring to fig3 b , latch 28 more specifically comprises d - type flipflops 96 - 103 , diodes 106 - 113 and resistors 116 - 123 , respectively . the latch also includes a conductor 125 connector to a source of positive 5 volts potential and a conductor 126 connected to the clock ( clk ) inputs of flipflops 96 - 103 . referring to fig3 a , control logic circuit 60 more specifically comprises d - type flipflops 130 - 135 having clear inputs ( clr ), clock inputs ( clk ), d inputs ( d ), a preset input ( pre ), q outputs ( q ) and q outputs ( q ). the logic circuit also comprises and gates 138 - 141 used for signal level shifting , nand gates 142 - 144 , inverters 146 - 148 , 150 - 151 , and a resistor 153 . flipflops 132 , 133 , 134 and 135 have their d inputs connected to a logical 1 voltage level . a bipolar transistor 155 is used as a zener diode to provide a nonprecision negative voltage to comparator 22 . operational amplifier 14 and comparator 22 are each supplied with nonprecision sources of positive and negative voltage as shown in fig3 a . a resistor 157 is used to protect comparator 22 from start - up transients . the voltage drop across resistor 157 is negligible during normal operation . the circuitry operates in the following manner . referring to fig2 at the beginning of a cycle of operation , such as time t o , capacitor 18 has no charge stored on it , and the gates of transistors 32 - 35 are biased in the manner shown by the waveforms a - d in fig2 . when the gate of a transistor is biased on , the transistor is switched into its saturated condition so that current is readily conducted from the drain to the source . when the transistor is biased in its off condition , the drain - to - source junction presents a relatively high resistance to the flow of electrical current . as a result , at time t o transistor 32 is switched on or acts as a switch which connects the analog voltage to inverting input 15 and transistor 34 is switched on or acts as a switch which connects ground potential to non - inverting input 16 . ( the small voltage drop across resistors 19 and 20 will be ignored for purposes of the present explanation .) at time t o , counter 24 is reset and gate 62 is enabled so that clock pulses are transmitted from clock 26 to counter 24 . as the counter advances , capacitor 18 charges in the manner shown by waveform v c until the counter overflows at time t 1 . the output of counter 24 is transmitted to control logic circuit 60 over cable 63 . at time t 1 , the overflow condition of the counter is detected by control logic circuit 60 and the operation of switch circuit 30 is altered . transistor 32 is switched off and transistor 35 is switched on so that non - inverting input 16 is connected to the reference potential . this mode of operation causes the output signal v o of the integrating circuit to shift positively or slew by the magnitude of the reference voltage vref . the change in voltage and polarity of the output signal is illustrated by waveform v o , fig2 in which the difference in voltages v1 and v2 equals vref . once integrating circuit 12 has slewed to its new output level by time t2 , as determined by counter 24 , transistor 33 is switched on so that inverting input 15 is connected to ground potential . since integrating circuit 12 responds to differences in input signals , this condition causes the voltage v c across capacitor 18 to decrease in a linear manner and the output signal v o to increase in linear manner . at time t2 , clock pulses are again allowed to flow into counter 24 which had previously overflowed so that pulses are again counted . alternatively , the counter may be reset at time t2 so that it is in the same condition as time t o . the output signal voltage continues to increase until the reference voltage vref is reached . at this point in time ( i . e ., time t3 ), comparator 22 produces a change in output state which loads the number in counter 24 into latch circuit 28 , resets counter 24 , and causes control logic circuit 60 to switch the transistors in switching circuit 30 in the manner shown by waveforms a - d in fig2 . more specifically , transistors 33 and 35 are switched off and transistor 34 is switched on so that inverting input 15 floats and non - inverting input 16 is connected to ground potential . output signal v o then slews back to ground potential at time t4 so that the circuit is ready for another cycle of operation . this slewing of output signal v o also causes the output of comparator 22 to revert to its original state . since capacitor 18 is allowed to float while the integrating circuit is slewing , the charge stored on the capacitor changes by only a negligible amount during the slew period . this mode of operation is shown by waveform v c in fig2 between time periods t1 and t2 . as a result of this operation , the reference voltage and dc analog voltage may have the same polarity , thereby drastically simplifying the design and complexity of the power supply which furnishes the voltage needed to operate the circuitry . voltage waveforms v c and v o are somewhat idealized in fig2 in order to clarify the explanation of operation . the actual voltages may be offset slightly from the values shown due to the internal biasing voltages of operational amplifier 14 . those skilled in the art will recognize that only a preferred embodiment of the invention is shown herein and that the embodiment may be altered and modified without departing from the spirit and scope of the invention as defined in the appended claims .
| 7 |
referring now to fig1 there is illustrated a conventional autopilot control surface servomotor apparatus employing pulse width modulation ( pwm ) control and incorporating the base current compensation circuit of the present invention . the basic pwm servomotor control apparatus is generally the same as that disclosed in the above - referenced u . s . pat . no . 3 , 848 , 833 . since its structure and operation are described fully therein , only its general characteristics need be repeated herein . an electric motor 10 is mechanically coupled to drive the aircraft control surface through coupling 11 which may include a convention engage / disengage clutch , reduction gearing and control cable capstan ( none shown ). control surface position and velocity are conventionally provided by position sensor 12 , such as a potentiometer or synchro and tachometer 13 . the autopilot control surface command is provided at the input terminal 14 where it is compared with existing control surface position from position sensor 12 to generate a position error signal at the input of first stage or error amplifier 15 . the output of error amplifier 15 is combined with the servomotor velocity damping signal from tachometer 13 and supplied to a second stage amplifier 16 , the output of which constitutes the servomotor input command signal on lead 17 . in accordance with conventional pwm control techniques , the motor command signal on lead 17 is supplied to positive and negative pwm comparators 18 and 19 supplied by a triangular reference waveform , the normal zero references of which are raised and lowered by the positive and negative - going output of amplifier 16 to generate positive pulses on leads 20 or 21 having a pulse width proportional magnitude of the control signal on lead 17 . these pulses are supplied to a conventional transistor switched bridge power amplifier 22 , 23 to drive motor 10 in one direction or the other . for the purpose of disclosing the present invention as briefly and succinctly as possible , only the positive half of bridge amplifier 22 for positive direction of motor drive need be described , it being understood by those skilled in this art that motor drive by the other half of the bridge amplifier is essentially identical . in accordance with the teachings of the reference &# 39 ; 833 patent , torque limiting is achieved by monitoring the current drawn by the servomotor , the voltage produced by this current being compared with a reference voltage corresponding to a predetermined not - to - exceed motor current . if motor current exceeds the limiting current , the input to the bridge amplifier is disabled or alternatively reduced to reduce motor current until it is within limits . however , in this prior art current limiting technique included an error produced by the base drive current of the bridge transistor supplying drive current to the motor . since motor drive current is dependent upon pulse width and since it is not possible to calculate the current pulse width due to its dependence upon motor loading , its effect on current or torque limiting had to be compromised by lowering the torque limit reference . the uncompensated base drive current can produce an error of as much as about 7 % of the total motor current measurement . the present invention provides circuitry for compensating for the power bridge base drive current so as to provide an accurate measure of total motor current . the foregoing is illustrated in fig2 which illustrates graphically the contribution of the base drive current to total motor current under various pulse width duty cycles . it will be noted that the ratio of bridge drive current i d to actual motor current i m is significant at lower duty cycles and decreases only slightly for higher duty cycles . the present invention can be demonstrated mathematically as follows . the current i t is the sum of the bridge drive current i d , the actual motor current i m and the power transistor base drive current i b : let the current i s be the sum of the motor winding inductive current i i and the base drive compensating current i c : the voltages produced by the currents of equations ( 1 ) and ( 2 ) flowing through equal value resistances r s may be amplified in a differential amplifier having a gain letting v i = i t r s and v 2 = i s r s , the output of the differential amplifier is which is the true motor current and is used to more precisely control current or torque limiting for the servosystem . this is graphically illustrated in fig3 wherein the compensation or cancellation of the base current of the transistor bridge results in a true measure of motor current only . the circuit for accomplishing this base drive compensation of the present invention is illustrated in fig1 wherein the pulse output of pwm amplifier 18 turns on transistor 25 which results in current flow from power supply v cc through transistor 26 , motor 10 , transistor 27 and resistor r s . sbsb . 1 to ground . in addition , the base current bridge transistor 25 also flows through resistor 28 , transistors 25 and 27 together with the drive current from pwm amplifier through resistor 29 . thus , as illustrated in fig1 the current i t flowing through resistor r s . sbsb . 1 to ground is the sum of the motor current i m , the bridge drive current i d and the power amplifier base drive current i b of the bridge transistor 27 as set forth in equation ( 1 ) above . in accordance with the present invention , the output of pwm amplifier 18 is also supplied via lead 30 to a base drive compensation circuit 31 comprising transistor switch 32 , its base resistor 33 , blocking diode 34 , and scaling resistor 35 connected between transistor 32 and power supply v cc . it should be noted that the base drive conpensation circuit is supplied from the same power supply as the power bridge so that any fluctations in power supply voltage do not effect the compensation . when the power bridge is turned on , the compensation circuit is also turned on resulting in compensation current flow i c from supply v cc through resistor r s . sbsb . 2 to ground . the compensation circuit component values are selected such that i c = i b + i d in accordance with equation ( 3 ) above . also , motor winding inductive current i i also flows through resistor r s . sbsb . 2 . thus , the current flow i s through resistor r s . sbsb . 2 is the sum of compensation current i c and motor inductive current i i in accordance with equation ( 2 ) above . the voltage v 1 resulting from the current flow i t is applied via lead 40 to the other input of differential amplifier 41 while the voltage v 2 resulting from current flow i s is applied via lead 43 to the other input thereof ; the value of resistors r s . sbsb . 1 and r s . sbsb . 2 is the same . the gain k of differential amplifier 41 is such that its output v i on lead 44 is equal to v i = kr s ( i m + i i ) as derived above , this voltage representing only the actual motor current which , of course , represents motor torque . now the motor torque can be precisely limited , uncontaminated by other currents in the bridge drive amplifier , particularly the base current required to drive the bridge . therefore , the voltage on lead 44 representing motor current is supplied to a voltage comparator 45 where it is compared with a predetermined reference voltage from power supply 46 . the reference voltage is selected to be proportional to the torque limit imposed on the motor 10 . thus , if the voltage v i exceeds the reference voltage , and output will appear on comparator output lead 47 and 48 which is used to disable both pwm amplifiers 18 and 19 . while the invention has been described in its preferred embodiment , it is to be understood that the words which have been used are words of description rather than limitation and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects .
| 6 |
described herein is a method and apparatus for maintaining a file system is described . in one embodiment , a method to reduce duplication of data blocks is described . an allocation module receives a request from a kernel module to allocate a block of the file system to a file . the allocation module examines another block of the file system to determine whether the other block contains a same data as the first block . the allocation module also determines an external reference count of the other block containing the same data . the other block is then allocated to the file and the external reference count is updated accordingly . in another embodiment , to avoid duplication of file systems , an allocation module manages the allocation of blocks to a file so that if the block contains the same data as an already allocated block , the file gets allocated the already allocated and written block . the present application is applicable to deduplicating blocks . in a first application , blocks that are duplicates take up extra storage space . in this instance , the present application provides for a technique to reduce such block duplication . in a second application , creating or editing a file may be performed in such a way as to reduce or minimize the number of blocks used to store data . if data from the file is already stored in a pre - existing block , there would be no need to create another block for that file . those of ordinary skills in the art will recognize that the concept presented in this application is not solely limited to unix - based operating system but may also be applicable to other operating file systems . fig1 is a block diagram illustrating a block 102 of a file system of a unix based operating system . block 102 includes an inode 104 and a data block 106 . inodes 104 and data block 106 are logically and physically separate entities . a disk ( or disk partition ) is formatted to contain a set of block groups ( i . e . groups of sector clusters called blocks , each group can be n blocks in length , each block can be up to 4 kb ), each of which contains a superblock ( 1 block ), group descriptor information ( n blocks ), a data block bitmap 106 ( 1 block ), inode bitmap 104 ( 1 block ), a table of inodes ( information nodes , each of which is a data record of 128 bytes in length ) for the files in the block group ( n blocks ), and the data blocks ( n blocks or clusters of sectors ). block groups are like logical sub - partitions that are used to reduce file fragmentation as linux stores individual files within a block group . a block descriptor holds descriptions of blocks within a block group . block sizes may be 512 - 4096 bytes . a single block may contain descriptions for up to 8 , 192 blocks . each file in the system is described with an inode data structure . an inode is a data record in the inode table that describes which blocks on the device are occupied by a particular file , as well as the access rights , modification times , and type of the file . every file in the file system is represented by a single inode ( an entry in the block group &# 39 ; s inode table ). each inode is referenced by a single unique identifying number , called the inode number , which is used to link the file &# 39 ; s name / entry in a directory file , to the inode structure in the inode table in the group block . each inode is 128 bytes in length and contains information such as file mode ( a 16 bit entry that indicates the file type ( regular , directory , character , et .) owner / group / other read / write / execute permissions ) owner id , group id , file size , time / date last modified , time / date last accessed , and the file ( block ) addresses , which consist of pointers to the data blocks . file data blocks are referenced directly by the inode , and the remainder ( up to 1074791424 ) indirectly by data blocks acting as index pointers . in one embodiment , allocated blocks are changed according to the following process : for example , if file a has data blocks 1 , 2 , and 3 , and file b has data blocks 2 and 3 , when something writes to data block 2 from the context of file a ( say , a text editor program , which is being used to edit file a ), the system needs to allocate a new block matching the content to be written , decrement the reference count on block 2 , and update a &# 39 ; s mode to point to the new block ( call it block # 4 ), making a &# 39 ; s data blocks 1 , 4 , and 3 . fig2 is a block diagram illustrating one embodiment of allocating blocks to a file 202 of a file system . to begin with , since a block may be allocated to more than one file , an external reference count 208 for the block would be needed . also , to speed up searching for a block to allocate , hash values for allocated blocks should be maintained . the reference count could replace the current allocation bitmap used in the ext2 file system , or it could be stored separately . on a 32 bit system using 4 k blocks , it would take 256 blocks ( 1 mb ) of reference counts to track a gigabyte of allocatable blocks . the hash values would be a more complicated matter — for efficient searching , they would need to be stored in a more complicated structure than an unsorted list . also , to be effective , the hashes would need to take significantly more room than a simple pointer , so an unsorted list would be prohibitively large in any case . in one embodiment , a two - level hashing process is used where each allocated block 206 is hashed using a fast algorithm with a small result ( e . g . a crc - 16 variant ), as well as a longer , more industrial - strength hashing algorithm ( e . g . sha1 , or sha256 or 512 ). the first hash 210 would be used as an index into a list of b - tree structures , where the b - tree structures are each ordered by the second hash 212 , with values being the block numbers . with a 16 - bit first level hash , this would require a minimum of 65 , 536 blocks for second level b - trees ( 256 mb , on a system that uses 4 k blocks ). however , on a large disk , the overhead would be small in relative terms . fig3 is a flow diagram illustrating one embodiment of a method for allocating blocks to a file of a file system . at 302 , a request to allocate a block to a file is received . at 304 , a search for a block to allocate is performed by computing the two hashes of the block at 306 to see if there &# 39 ; s a match already allocated by using the first hash to find the appropriate b - tree at 308 , and then using the second hash to look up any matching blocks at 310 . if matching blocks are found at 312 , a byte - by - byte comparison of the matches is performed against the block to be allocated at 314 . and if it matches one of the found blocks at 316 , that block is allocated at 318 , and its reference count is incremented at 320 . if there are no matching blocks at 312 and 316 , a new previously unallocated block is allocated . fig4 is a flow diagram illustrating one embodiment of a method for de - allocating blocks to a file of a file system . a request to de - allocate a block to a file is received at 402 . deallocating a block would require decrementing the reference count in the reference count map at 404 . if the reference count goes to zero at 406 , the deallocator computes the two block hashes at 408 to delete it from the appropriate b - tree at 410 . fig5 is a block diagram illustrating one embodiment of logical components of a computer system . a unix based operating system 502 includes a file system having software for controlling the transfer of data . a kernel module 504 communicates with the os 502 to maintain various system services such as memory management , timer , synchronization , and task creation . an allocation module 506 and a processing module 508 interact with the kernel module 504 to carry out block allocation and processing operations . allocation modules 506 and processing modules 508 may either be integral to os 502 or operate as independent modules and may be implemented in hardware and / or software . fig6 illustrates a diagrammatic representation of a machine in the exemplary form of a computer system 600 within which a set of instructions , for causing the machine to perform any one or more of the methodologies discussed herein , may be executed . in alternative embodiments , the machine may be connected ( e . g ., networked ) to other machines in a lan , an intranet , an extranet , or the internet . the machine may operate in the capacity of a server or a client machine in client - server network environment , or as a peer machine in a peer - to - peer ( or distributed ) network environment . the machine may be a personal computer ( pc ), a tablet pc , a set - top box ( stb ), a personal digital assistant ( pda ), a cellular telephone , a web appliance , a server , a network router , switch or bridge , or any machine capable of executing a set of instructions ( sequential or otherwise ) that specify actions to be taken by that machine . further , while only a single machine is illustrated , the term “ machine ” shall also be taken to include any collection of machines that individually or jointly execute a set ( or multiple sets ) of instructions to perform any one or more of the methodologies discussed herein . the exemplary computer system 600 includes a processing device 602 , a main memory 604 ( e . g ., read - only memory ( rom ), flash memory , dynamic random access memory ( dram ) such as synchronous dram ( sdram ), a static memory 606 ( e . g ., flash memory , static random access memory ( sram ), etc . ), and a data storage device 618 , which communicate with each other via a bus 630 . processing device 602 represents one or more general - purpose processing devices such as a microprocessor , central processing unit , or the like . more particularly , the processing device may be complex instruction set computing ( cisc ) microprocessor , reduced instruction set computing ( risc ) microprocessor , very long instruction word ( vliw ) microprocessor , or processor implementing other instruction sets , or processors implementing a combination of instruction sets . processing device 602 may also be one or more special - purpose processing devices such as an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ), a digital signal processor ( dsp ), network processor , or the like . the processing device 602 is configured to execute modules 626 ( previously described with respect to fig1 ) for performing the operations and steps discussed herein with . in one embodiment , the modules may include hardware or software or a combination of both . the computer system 600 may further include a network interface device 608 . the computer system 600 also may include a video display unit 610 ( e . g ., a liquid crystal display ( lcd ) or a cathode ray tube ( crt )), an alphanumeric input device 612 ( e . g ., a keyboard ), a cursor control device 614 ( e . g ., a mouse ), and a signal generation device 616 ( e . g ., a speaker ). the data storage device 618 may include a computer - accessible storage medium 630 on which is stored one or more sets of instructions ( e . g ., software 622 ) embodying any one or more of the methodologies or functions described herein . the software 622 may also reside , completely or at least partially , within the main memory 604 and / or within the processing device 602 during execution thereof by the computer system 600 , the main memory 604 and the processing device 602 also constituting computer - accessible storage media . the software 622 may further be transmitted or received over a network 620 via the network interface device 608 . the computer - accessible storage medium 630 may also be used to store the allocation module 624 as presently described . the allocation module 624 may also be stored in other sections of computer system 600 , such as static memory 606 . while the computer - accessible storage medium 630 is shown in an exemplary embodiment to be a single medium , the term “ computer - accessible storage medium ” should be taken to include a single medium or multiple media ( e . g ., a centralized or distributed database , and / or associated caches and servers ) that store the one or more sets of instructions . the term “ computer - accessible storage medium ” shall also be taken to include any medium that is capable of storing , encoding or carrying a set of instructions for execution by the machine and that cause the machine to perform any one or more of the methodologies of the present invention . the term “ computer - accessible storage medium ” shall accordingly be taken to include , but not be limited to , solid - state memories , optical and magnetic media . in the above description , numerous details are set forth . it will be apparent , however , to one skilled in the art , that the present invention may be practiced without these specific details . in some instances , well - known structures and devices are shown in block diagram form , rather than in detail , in order to avoid obscuring the present invention . some portions of the detailed descriptions above are presented in terms of algorithms and symbolic representations of operations on data bits within a computer memory . these algorithmic descriptions and representations are the means used by those skilled in the data processing arts to most effectively convey the substance of their work to others skilled in the art . an algorithm is here , and generally , conceived to be a self - consistent sequence of steps leading to a desired result . the steps are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the following discussion , it is appreciated that throughout the description , discussions utilizing terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . the present invention also relates to apparatus for performing the operations herein . this apparatus may be specially constructed for the required purposes , or it may comprise a general purpose computer selectively activated or reconfigured by a computer program stored in the computer . such a computer program may be stored in a computer readable storage medium , such as , but is not limited to , any type of disk including floppy disks , optical disks , cd - roms , and magnetic - optical disks , read - only memories ( roms ), random access memories ( rams ), eproms , eeproms , magnetic or optical cards , or any type of media suitable for storing electronic instructions , and each coupled to a computer system bus . the algorithms and displays presented herein are not inherently related to any particular computer or other apparatus . various general purpose systems may be used with programs in accordance with the teachings herein , or it may prove convenient to construct more specialized apparatus to perform the required method steps . the required structure for a variety of these systems will appear from the description below . in addition , the present invention is not described with reference to any particular programming language . it will be appreciated that a variety of programming languages may be used to implement the teachings of the invention as described herein . the present method for deduplicated file system may be particularly useful for a system that is used to mirror several software repositories , particularly one that is used to mirror several versions of several software repositories . a great deal of space could be saved as a result of implementing the deduplicated file system . it is to be understood that the above description is intended to be illustrative , and not restrictive . many other embodiments will be apparent to those of skill in the art upon reading and understanding the above description . the scope of the invention should , therefore , be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled .
| 6 |
referring to the drawings , fig1 shows an air turbine starter 10 embodying the present invention to selectively engage with an engine 11 . the air turbine starter 10 is comprised of a first housing assembly 12 and a second housing assembly 13 . the housing assembly 12 defines a flow path 14 extending from an inlet 16 to an outlet 18 . the housing assembly 13 includes a mounting flange 19 for mounting the air turbine starter to the engine 11 . within the starter 10 , the housing assemblies 12 and 13 support a turbine section 20 , a compound planetary gear train 40 and an overrunning first clutch 60 described in greater detail below . the turbine section 20 is comprised of a turbine wheel 22 having rotatable shaft 24 extending in an axial direction 23 and journaled in bearings 26 . a gear 25 is secured to the shaft 24 for transferring torque . a plurality of turbine blades 28 radially extend from the turbine wheel 22 into the flow path 14 . upstream of the blades 28 are a plurality of nozzles 29 mounted to the housing assembly 12 for veering the air flow before it traverses the turbine blades 28 . in operation , pressurized air enters through the inlet 16 , is angled by the nozzles 29 , is expanded across the blades 28 , and exits through the outlet 18 . the blades 28 convert the pressure energy of the air into rotary motion causing the turbine wheel 22 , the shaft 24 , and the gear 25 to rotate at the same speed as the blades 28 . the compound planetary gear train 40 is comprised of a plurality of circumferentially - spaced shafts 42 each having a gear 44 that meshes with the gear 25 . a gear 45 integral with the shaft 42 engages a ring gear 48 which in turn engages a hub gear 62 . the hub gear 62 is supported by bearings 64 and has a hollow cylindrical hub portion 63 encircling the overrunning first clutch 60 . in operation , the gear train 40 converts the high speed , low torque output of the turbine section 20 into low speed , high torque input for the first clutch 60 . the first clutch 60 is preferably a sprag type clutch , but any overrunning type clutch would accomplish the objectives of the invention . a pawl and ratchet clutch with the pawls attached to an inner diameter driving member and the ratchets attached to an outer diameter driven member would be an alternative . the hub gear 62 operates as an output member to transfer torque to the input side of clutch 60 through the hub portion 63 . as shown in the drawings , a clutch drive shaft 70 is operative as a power transfer member and receives the torque from the output side of clutch 60 . in the preferred embodiment , the clutch drive shaft 70 is supported by bearings 66 and extends outside of the housing 13 . the first clutch 60 is positively engaged and transfers torque when the hub portion 63 rotates at the same speed or begins to exceed the speed of the clutch drive shaft 70 . engine start up begins with the flow of pressurized air rotating the turbine wheel 22 which transfers torque through the planetary geartrain 40 to the hub gear 62 . at this point , the hub portion 63 begins to rotate faster than the stationary clutch drive shaft 70 so the first clutch 60 engages and transfers torque therebetween . the clutch drive shaft 70 is connected to the input side of a second clutch 68 . connected to the output side of the second clutch 68 is a driven assembly 71 which is coupled to the engine 11 . in the preferred embodiment , the second clutch 68 and the driven assembly 71 are located outside of housing 13 such that when the second clutch 68 disengages , all components within the starter 10 can come to a complete rest . the second clutch 68 is a jaw clutch which is comprised of two clutch jaws , in this case jaws 72 and 74 . clutch jaw 72 is connected to the clutch drive shaft 70 and clutch jaw 74 is connected to a slidable disk 76 which is part of the driven assembly 71 . the slidable disk 76 is connected to rotate with the output shaft 78 , which is also part of the driven assembly 71 , through three equiangularly - spaced torque teeth 84 . equiangularly - spaced between the torque teeth are three flyweights 80 ( only one shown ) connected to the output shaft 78 by three pins 86 ( only one shown ) and have essentially radially inward extending portions 90 that abut the slidable disk 76 . to urge clutch jaw 74 axially into clutch jaw 72 , a spring 82 is interposed between the output shaft 78 and the slidable disk 76 by abutting a retaining ring 88 as shown . at initial start up , the second clutch 68 , urged into engagement by the spring 82 , transfers torque from the clutch drive shaft 70 to the slidable disk 76 . the torque teeth 84 transfer the torque between the slidable disk 76 and the output shaft 78 . the driven assembly 71 is connected to rotate with the engine 11 through a tie bolt 91 and transfers the torque to the engine 11 through engaging means ( not shown ). torque is transferred to the engine 11 until engine starter assist speed when the engine 11 begins to accelerate on its own power . at this time , gas flow to the starter is shut off and the engine 11 rotates the driven assembly 71 . at this point disengagement of the second clutch 68 will allow all components within the starter 10 to come to rest . thus , an operating range of the second clutch 68 is defined from initial start up ( zero rpm ) to a speed greater than engine starter assist speed at which disengagement is desired . fig2 depicts the second clutch 68 when the driven assembly 71 is being rotated by the engine 11 beyond its operating range . as the driven assembly 71 accelerates with engine 11 from starter assist speed , the flyweights 80 pivot about the pins 86 due to centrifugal forces . once the driven assembly 71 is rotating beyond the operating range , the centrifugal force exerted on the flyweights 80 overcomes the biasing force exerted by the spring 82 . the radially inward extending portions 90 of the flyweights 80 abut the slidable disk 76 and slide it in the axial direction 23 such that the second clutch 68 is disengaged . during engine rolldown , the engine 11 speed is decreased until the centrifugal force on the flyweights 80 is overcome by the biasing force of spring 82 and the slidable disk 76 is urged to engage the second clutch 68 . the clutch drive shaft 70 begins to rotate with the driven assembly 71 . if the starter 10 is not operating , the hub gear 62 is not rotating . thus , the clutch drive shaft 70 will be rotating faster than the hub gear 62 and the first clutch 60 will overrun and prevent the torque transfer to the hub gear 62 . to perfect an engine restart , the starter 10 begins acceleration until the hub gear 62 rotates at the same speed as the clutch drive shaft 70 . then the first clutch 60 switches from overrunning mode to positive engagement and begins transferring torque . the engine 11 reaches starter assist speed again and accelerates the driven assembly 71 beyond the second clutch 68 operating range . the second clutch 68 disengages and the starter 10 is shut off and coasts to rest . the foregoing description of the preferred embodiment is intended as illustrative rather than restrictive . the full scope of the invention should be construed by reference to the following claims , as reasonably interpreted in view of the teaching herein .
| 5 |
with reference to such figures an automatic device made according to an embodiment of the present invention for the ignition and control of a gas apparatus 1 is globally and schematically indicated with 10 . the gas apparatus 1 is in particular a gas fireplace , schematically represented in fig1 , but the automatic device 10 can be used in other apparatuses like for example gas stoves and gas braziers and similar . the gas apparatus 1 is equipped with a pilot burner 11 and with a main burner 12 and suitable electrically controlled valve means 7 , for regulating the flow of gas from a main pipe 28 for the gas towards a first nozzle 8 , coupled with the pilot burner 11 and to a second nozzle 13 , coupled with the main burner 12 , respectively . the pilot burner 11 and the main burner 12 are coupled in the usual way , so that the flame at the pilot burner 11 can act as ignition source for the gas released by the nozzle 13 to the main burner 12 . a supply voltage provided by electricity main 2 , through a transformer 3 , and by battery pack 4 supplies the automatic device 10 ; the automatic device 10 is coupled through a ground terminal 59 to a constant reference voltage gnd that in the present embodiment is a ground voltage . moreover , the valve means 7 are supplied by a supply voltage and are of the type with the valve normally closed . in particular , the valve means 7 comprise a first solenoid 17 , which actuates a first shutter associated with the first nozzle 8 so that when the solenoid is crossed by an electric current the first shutter opens allowing the gas to flow , whereas , when the solenoid is not crossed by an electric current the shutter closes blocking the flow of gas . similarly , a second solenoid 18 actuates a second shutter associated with the second nozzle 13 . the automatic device 10 comprises a spark circuit 80 suitable for generating a flame on the pilot burner 11 , close to the first nozzle 8 , upon receipt of a start signal start . according to an embodiment of the present invention , the automatic device 10 comprises an electrical microprocessor unit 5 that actuates and electrically controls both the spark circuit 80 and such valve means 7 , so as to uniformly and totally burn all of the gas put out exploiting to the highest degree the thermal value as well as in complete safety . advantageously , according to an embodiment of the present invention the valve means 7 are activated by the electrical unit 5 and are coupled to the ground terminal 59 . the automatic device 10 , as illustrated in fig4 , comprises a first actuator circuit 40 and a second actuator circuit 45 , structurally similar , dynamically activated by the electrical unit 5 , through a first activation signal 21 and a second activation signal 22 , respectively . the first activation signal 21 and the second activation signal 22 are signals having a pulse train with a predetermined charge factor or duty cycle . such actuator circuits 40 , 45 are suitable for dynamically polarizing the valve means 7 to regulate its charge state according to the duty cycle of the pulse train . in particular , according to an embodiment of the present invention , the automatic device 10 and in particular the electrical unit 5 is substantially a circuit operating at low voltage that dynamically drives such valve means 7 , with a low power consumption and a substantial saving of energy . the electricity main 2 that supplies a voltage vac to the transformer rectifier 3 , which through a first terminal 16 provides a first supply voltage vdc ; and battery pack 4 that supply a second supply voltage vbb through a second terminal 20 . according to an embodiment , the transformer rectifier 3 comprises a graetz bridge rectifier or else a modern switching voltage regulator , for example of the step - down or buck type . a remote control panel 6 allows the electrical unit 5 to be activated upon receipt of the start signal start . the start signal start is transmitted through a set of terminals 27 and can consist of a protocol , in the form of an encoded signal , or else the reading of a switch or contact open and closed state . according to an embodiment , the remote control panel 6 comprises a pair of switches coupled to the array of terminals 27 . a diagnostic circuit 14 interacts with the electrical unit 5 through suitable connection terminals 15 and allows the user to keep the automatic device 10 constantly under remote observation , allowing possible anomalies to be diagnosed . according to an embodiment of the present invention , in the case of anomalies the automatic device 10 acts autonomously intervening to restore its functionality or to place it under safe conditions . the control panel 6 and the diagnostic circuit 14 could in some cases be incorporated directly in the electrical unit 5 . in particular , the electrical unit 5 comprises a programmable microcontroller 30 capable of storing a management program that analyzes the received signals , generating suitable signals for the operation and for the safety of the automatic device 10 itself . the automatic device 10 also comprises a selector 50 that is supplied in input by the first supply voltage vdc and by the second supply voltage vbb to supply in output a third constant voltage vcc_pos , which is substantially the greater of the input supply voltages . as shall be specified hereafter , the selector 50 uses the battery pack 4 as a buffer battery both in the case of a total lack of the first supply voltage vdc , and in the case in which the electricity main 2 supplies sporadic low voltages compared to a nominal voltage . in particular , the selector 50 feeds an enable circuit 46 , a regulator circuit 60 and a high voltage generator circuit 85 . the enable circuit 46 provides in output a fourth voltage vcc which is a voltage substantially translated in level compared to the third voltage vcc_pos and suitable for feeding the first 40 and the second actuator circuit 45 and defined arranged control peripherals . the regulation circuit 60 carries out a first filtering for possible over voltages in the third supply voltage vcc_pos supplying in output a substantially stabilised fifth supply voltage vdd suitable for feeding the electrical unit 5 . according to an embodiment of the present invention , as highlighted in fig4 , the first actuator circuit 40 and the second actuator circuit 45 are supplied by the fourth supply voltage vcc respectively through a first supply terminal 47 and a second supply terminal 48 and they are also coupled to the ground terminal 59 . moreover , they are activated by the first activation signal 21 and by the second activation signal 22 received , respectively , at a first input terminal 23 and at a second input terminal 24 . the first activation signal 21 and the second activation signal 22 having a pulse train have regular pulses of rectangular wave shape with a particular and predetermined charge factor or duty cycle , so as to dynamically activate the valve means 7 coupled to a respective output terminal 34 , 35 . in particular , according to an embodiment , the first actuator circuit 40 comprises a first inductance l 1 , arranged between the first supply terminal 47 and an inner node a , a first capacitance c 1 , arranged between the inner node a and an output node e , which is coupled with the ground terminal 59 through a first diode d 1 that , for greater efficiency , is of the schottky type . a first resistance r 33 is also arranged between the output node e and the first output terminal 34 . a first switch q 1 is arranged between the inner node a and the ground terminal 59 and is suitably activated at a command terminal g by the first activation signal 21 . the first switch q 1 can be a fet or mosfet transistor or else a bjt transistor . a first resistive divider r 7 - r 8 is coupled with the first input terminal 23 and is coupled to the ground terminal 59 and allows the voltage of the first activation signal 21 to be adjusted in a predetermined way . furthermore , the first actuator circuit 40 comprises a first filtering element f 1 arranged between the inner node a and the ground terminal 59 capable of filtering the signal present at the inner node a . in particular , the first filtering element f 1 comprises , coupled in series , a resistance r 4 coupled to the inner node a and to a capacitance c 9 . in an embodiment , at the first actuator circuit 40 a zener diode dz 3 is arranged between the inner node b and the command terminal g of the first switch q 1 , to make a further protection of the first actuator circuit 40 against over voltages that could reach the fourth supply voltage vcc through the first supply terminal 47 . the first impulsive activation signal 21 , based upon the provided duty cycle , has an activation time period t on and a deactivation time period t off and dynamically biases the first inductance l 1 and the first capacitance c 1 . in particular , the first actuator circuit 40 absorbs electrical energy discontinuously from the fourth supply voltage vcc only during the activation time period t on and returns it by taking a substantially continuous current from such valve means 7 . the first activation signal 21 generates a potential at the output node e that is kept below the potentials of the other nodes of the first actuator circuit 40 . in particular , the potential of the output node e is less than the ground voltage gnd of the ground terminal 59 . the activation time period t on of the first activation signal 21 is substantially less than the deactivation time period t off . in other words , unlike the prior art , the first actuator circuit 40 : during the activation time period t on , receives a charge current , i . e . from the first solenoid 17 , keeping the flow of gas to the first burner 11 open ; during the deactivation time period t off , the output node e is coupled to the ground terminal 59 through the first diode d 1 and thus also the first solenoid 17 and the first solenoid 17 as a effect of its own inductance is crossed by a current still coming out towards the output terminal e , keeping the flow of gas to the first burner 11 open . this allows , in particular , the energy required by the first actuator circuit 40 during its operation to been substantially reduced with a substantial reduction of the power absorbed . with reference to fig1 , the duty cycle of the first activation signal 21 is defined by the formula : where t on is the activation time period and t off is the deactivation time period . with reference to fig1 - 18 , the operation of the first actuator circuit 40 is analyzed in particular . fig1 shows the first actuator circuit 40 in a rest state , in which the fourth supply voltage vcc is present whereas the first activation signal 21 is absent , i . e . the electrical unit 5 enables the enable circuit 46 but still does not command the first actuator circuit 40 . in this case , the first switch q 1 is in open state and the first capacitance c 1 is charged at the fourth supply voltage vcc through a current that , from the first supply terminal 47 slips through the first inductance l 1 , the first capacitance c 1 and the first diode d 1 towards the ground terminal 59 . fig1 and 18 illustrate the first actuator circuit 40 activated by the first activation signal 21 , in a first and a second operative condition , respectively . in particular , in the first operative condition , the first activation signal 21 is active for the activation time period t on and the first switch q 1 closes connecting the inner node a to the ground terminal 59 . the first inductance l 1 accumulates inductive energy , whereas the first capacitance c 1 discharges absorbing current from the first solenoid 17 whilst the first diode d 1 is electrically blocked . in such a first operative condition , for the brief activation time period t on , the first actuator circuit 40 absorbs a current from the first solenoid 17 and in particular a current slips from the charge towards the inner node a making the voltage at the output node e negative with respect to the reference voltage gnd present at the ground terminal 59 . in such a first operative condition , the first solenoid 17 , crossed by the electric current , allows the first shutter to open allowing the gas to flow to the pilot burner 11 , whereas the power required by the first actuator circuit 40 is given by the energy accumulated by the first inductance l 1 during the brief activation time period t on . in the second operative condition , the first switch q 1 is kept open for the passive time period t off . the first inductance l 1 discharges the inductive energy accumulated during the activation time period t on , recharging the first capacitance c 1 through the first diode d 1 which is also brought into conduction and a current continues to flow from the first solenoid 17 to the first diode d 1 . therefore , also during the deactivation time period t off , the output node e is kept at a negative voltage with respect to the reference voltage gnd of the ground terminal 59 . the first solenoid 17 , crossed by substantially continuous current , allows the first shutter to be kept open allowing the gas to flow to the pilot burner 11 without any power requirement from the supply and therefore with a substantial saving of energy . substantially , therefore , the first actuator circuit 40 activated by the first activation signal 21 keeps the transfer of energy from the to the charge operative with a transfer factor that depends upon the duty cycle of the first activation signal 21 . furthermore , when the first activation signal 21 is deactivated the first switch q 1 is kept open and the first actuator circuit 40 is taken back into rest state . moreover , according to an embodiment of the present invention , the first activation signal 21 has the duty cycle regulated so that the current that crosses the first solenoid 17 for each activation time period t on and for each deactivation time period t off , is greater than a minimum opening current suitable for keeping the first shutter open making the gas flow to the pilot burner 11 . according to an embodiment of the present invention , the electrical unit 5 modulates the duty cycle of the first activation signal 21 according to some parameters , like for example : value of the fifth supply voltage vcc ; value of the minimum opening current of the first solenoid 17 ; value of a temperature of the first solenoid 17 , as shall become clearer hereafter . in particular , there is substantially a retroaction between the first actuator circuit 40 and the electrical unit 5 . a value of the measured current i_measure , proportional to the current present at the first output terminal 34 , is detected through a detection terminal 31 coupled to the first output node e . such a value is suitably processed by the electrical unit 5 based upon suitable reference values stored and possible corrective compensations of the duty cycle of the first activation signal 21 can be foreseen , in relation to the specific parameters of the first solenoid 17 , indicated above . this allows a substantial saving of energy at the automatic circuit 10 . moreover , in the case in which the first solenoid 17 undergoes variations due to the environment temperature that can change the electrical characteristics , for example such as to generate undesired deactivation thereof , the value of the measured current i_measure undergoes variations which are intercepted by the electrical unit 5 and are compensated correctively by varying the duty cycle of the first activation signal 21 . similarly , as highlighted in fig4 , the second actuator circuit 45 comprises a second inductance l 2 arranged between the second supply terminal 48 and an inner node a ′, a second capacitance c 2 arranged between the inner node a ′ and an output node e ′ which is coupled with the ground terminal 59 through a second schottky diode d 2 . a second resistance r 72 is coupled in series between the output node e ′ and through a second output terminal 35 to the charge or else to the second solenoid 18 . a second switch q 3 , arranged between the inner node a ′ and the ground terminal 59 , is driven dynamically by the second activation signal 22 which is suitably regulated in voltage by a second divider r 12 - r 14 . in an embodiment , the second actuator circuit 45 has a zener diode dz 6 that is arranged between the inner node b ′ and the command terminal g ′ of the second switch q 3 , to make a further protection against excessive voltages that could reach the fourth supply voltage vcc through the terminal 48 . the second impulsive activation signal 22 , based upon the provided duty cycle , regulates a charge time t on ′ and a discharging time t off ′ of the second capacitance c 2 keeping the second output node e ′ at a potential that is less than any potential present at the other nodes of the second actuator circuit 45 and in particular of the voltage at the ground terminal 59 . a second filtering element f 2 is arranged between the inner node a ′ and the ground terminal 59 allowing the signal to be filtered at the inner node a ′ and has , coupled in series , a resistance r 12 and a capacitance c 19 . similarly to the first actuator circuit 40 , the second actuator circuit 45 biases the second solenoid 18 in relation to the duty signal of the second activation signal 22 , providing , in particular , a current to the actuator circuit 40 during the charge time period t on ′ . this allows a low energy consumption improving the performance of the automatic device 10 itself . furthermore , the first actuator circuit 40 and the second actuator circuit 45 to satisfy defined control and safety regulations can , instead of a first capacitance c 1 and a second capacitance c 2 , have many capacitances c 1 ′, c 2 ′, c 3 ′ and c 10 , c 11 and c 12 , respectively , arranged in series and placed between the respective inner node a and a ′ and the output node e and e ′ as highlighted in fig4 . similarly , the first actuator circuit 40 and the second actuator circuit 45 to increase efficiency of energy conversion can , as an alternative to the first diode d 1 and the second diode d 2 , have two or more diodes , d 3 and d 4 , as well as d 5 and d 6 , respectively , arranged in parallel and coupled between the output node e , e ′ and the ground terminal 59 . such diodes can , in some cases , be schottky diodes . it is worth noting that the first resistance r 33 and the second resistance r 72 , in series respectively with the output nodes e , e ′, could be replaced by a pair of inductances of a value similar to the first and second inductance l 1 and l 2 , without for this reason jeopardizing the operation of the actuator circuits 40 and 45 , as well as of the automatic device 10 . therefore , it is possible to improve the attenuation of possible interferences conducted from and towards the nodes e , e ′ at the first drive signal 41 and at the second drive signal 42 , also allowing current specific regulations to be respected , like for example the regulations known by the acronym emc ( electro - magnetic compatibility ). furthermore , the diode dz 3 and the diode dz 6 may not be present without for this reason jeopardizing the operation of the actuator circuits 40 and 45 , as well as of the automatic device 10 . moreover , according an embodiment there is retroaction between the first actuator circuit 40 and the electrical unit 5 . according to this embodiment , the automatic device 10 comprises an unique connector cn 1 , shown repeatedly in fig4 , 6 and 13 , which represents a unitary and main connection interface between the electrical unit 5 and the peripherals of the automatic device 10 , allowing quick and easy connection . in particular , the connector cn 1 receives the first supply voltage vdc through the first terminal 16 and the second supply voltage vbb through the second terminal 20 , and it is suitably coupled to the ground terminal 59 . in particular , the connector cn 1 has three successive terminals that contact a command reading circuit 100 , shown in fig1 , which receives respective signals 101 , 103 coming through the set of terminals 27 from the command panel 6 . such signals 101 , 103 are interpreted by the microcontroller 30 so as to generate the activation signal for the enable circuit 46 for driving the first actuator circuit 40 and the second actuator circuit 45 . finally , the connector cn 1 has three further terminals that contact the valve means 7 respectively coupling the output terminals 34 , 35 and the ground reference terminal 59 of the first 40 and of the second actuator circuit 45 , to respective terminals 41 and 42 of the first solenoid 17 and of the second solenoid 18 . even more specifically , a fourth input terminal of the connector cn 1 is arranged to receive a switching signal command_switch , a fifth input terminal of the connector cn 1 is arranged to receive a selection signal mode_switch and a sixth terminal of the connector cn 1 is arranged to receive the return signal switch_gnd provided by the connection with the set of terminals 27 towards a command panel 6 . the selector 50 , illustrated in fig6 , receives , in particular through the connector cn 1 , the first supply voltage vdc and the second supply voltage vbb respectively at a second input terminal 51 and at a first input terminal 52 , and it is coupled to the ground terminal 59 to supply , to an output terminal , the third supply voltage vcc_pos . in particular , the third supply voltage vcc_pos is the maximum voltage between the input supply voltages . according to an embodiment , the selector 50 comprises a first diode d 12 , in series with the first input terminal 51 , and a second diode d 13 , in series with the second input terminal 52 , as well as a filter f 3 suitably coupled in series with the first diode d 12 and with the second diode d 13 and coupled to the output terminal 56 . advantageously , the first diode d 12 and the second diode d 13 are of the schottky type and in particular go into blocking mode in the presence of possible inverse voltages at the respective input terminals , blocking the passage of current . the first filter f 3 comprises a first capacitance c 8 , a first inductance l 6 and a second inductance l 7 and attenuates possible interferences conducted , from and towards the first input terminal 51 and the second input terminal 52 , in particular respecting current specific regulations , like for example the regulations known by the acronym emc ( electro - magnetic compatibility ). a fuse rt 1 and a third diode dz 2 , zener type , are coupled to the output terminal 56 and make a protection from possible over voltages and over currents . indeed , when there are over voltages the third diode dz 2 goes into inverse conduction , whereas the fuse rt 1 is activated once a so - called marker current has been exceeded . it is worth noting that the first inductance l 6 and the second inductance l 7 of the filter f 3 could be replaced by a pair of short - circuits , without for this reason jeopardising the operation of the selector 50 , as well as of the automatic device 10 . in the most general form , the selector 50 operates in the presence of the first supply voltage vdc and the second supply voltage vbb and the battery pack 4 take care of possible supply voltage drops of the electricity main 2 , as a buffer battery . in particular , during operation , the first diode d 12 and the second diode d 13 automatically impose upon an inner node x of the selector 50 a voltage that in value is the greater from the first supply voltage vdc and the second supply voltage vbb . a possible temporary or extended drop in the first supply voltage vdc makes just the first diode d 12 conduct automatically connecting the battery pack 4 and offering a low direct voltage drop at the output terminal 56 . therefore , the first diode d 12 and the second diode d 13 allow a non - conflicting connection between the first supply voltage vdc and the second supply voltage vbb avoiding the first supply voltage vdc from overloading the battery pack 4 damaging them and at the same time avoiding the battery pack 4 being needlessly consumed . according to a possible embodiment , such battery pack 4 provide a voltage of 6v , with four 1 . 5v batteries arranged in series , whereas the voltage in output from the transformer provides a nominal voltage equal to 7v . in further embodiments , the second supply voltage vbb has a field of variation of between 4v and 6 . 4 v according to the level of charge of the battery pack , whereas the first supply voltage vdc has a field of variation of between 4v and 8 . 5 v . the enable circuit 46 , illustrated in fig5 , is supplied at a supply terminal 43 by the third supply voltage vcc_pos and is enabled at an input terminal 44 by an enabling signal 49 , provided by the microcontroller 30 , to generate the fourth supply voltage vcc at an output terminal 147 . in particular , the enable circuit 46 comprises a first transistor q 2 coupled between the supply terminal 43 and the output terminal 147 with a command terminal coupled to the input terminal 44 through the interposition of a second transistor q 4 , which is suitably coupled to the ground terminal 59 and has a command terminal coupled to the input terminal 44 . preferably , the first transistor q 2 is of the bipolar pnp type and is coupled to a common emitter through the interposition of a first resistance r 11 . moreover , a first resistive divider r 15 - r 16 allows the voltage of the enabling signal to be regulated at the command terminal of the second transistor q 4 , whereas a second resistance r 13 arranged between the second transistor q 4 and the first transistor q 2 allows the bias voltage at the latter to be regulated . a buffer capacitance c 14 is coupled in parallel between the output terminal 147 and the ground terminal 59 , allowing the voltage at the output terminal 147 to be stabilized . it is worth noting that the enabling circuit 46 is substantially a safety circuit made to satisfy defined current regulations . alternatively , a replacement resistance r 9 could be arranged between the input terminal 43 and the output terminal 147 of the enable circuit 46 , supplying the fourth supply voltage vcc directly and permanently to the first actuator circuit 40 and to the second actuator circuit 45 . according to the present embodiment , the regulation circuit 60 , shown in fig7 , at an input terminal 61 receives the third supply voltage vcc_pos and supplies the fifth supply voltage vdd , which is substantially a stabilised voltage suitable for feeding the electrical unit 5 , to an output terminal 65 . the regulation circuit 60 is also coupled to the ground terminal 59 . an integrated linear regulator u 2 is arranged between the input terminal 61 and the output terminal 65 , a first capacitance c 15 and a second capacitance c 17 are coupled in parallel arranged between the input terminal 61 and the ground terminal 59 , whereas a third capacitance c 18 , a fourth capacitance c 16 and a pair of zener diodes dz 4 and dz 5 are coupled in parallel between the output terminal 65 and the ground terminal 59 . in the present embodiment , the electrical unit 5 comprises , as shown in fig8 , a stabilization network 37 associated with the microcontroller 30 , which comprises passive components able to stabilise the operation . in particular , the stabilisation network 37 , supplied at a first node 65 by the fifth supply voltage vdd , has a second node 66 coupled to the ground terminal 59 , a first capacitance c 4 and a second capacitance c 5 coupled in parallel with each other between the first node 65 and the second node 66 , with the ends coupled to respective supply pins vdd and vss , vdd ′ and vss ′ of the microcontroller 30 . in particular , the first capacitance c 4 and the second capacitance c 5 absorb possible variations in current that can be generated by sources either inside or outside the electrical unit 5 due to quick switching of electrical currents and voltages . moreover , a delayed circuit comprising a first resistance r 1 and a third capacitance c 7 arranged in series between the first node 65 and the second node 66 , as well as a second resistance r 5 coupled between a third node 64 and a pin mclr_icd of the microcontroller 30 , allows the fifth supply voltage vdd to be stabilized ensuring that the microcontroller 30 starts up with a voltage that is as stable as possible . a first clock reference circuit 38 coupled with two terminals i and l , to two different pins osc 1 and osc 2 of the microcontroller 30 and coupled to the ground terminal 59 that comprises a ceramic resonator y 1 . the ceramic resonator y 1 , in particular , allows an onboard timer installed in the microcontroller 30 to be oscillated at an appropriate frequency allowing a correct operation of a logic part installed in the microcontroller 30 and allowing the microcontroller 30 to carry out timed functions . according to the present embodiment , a second reference circuit 39 is present in the electrical unit 5 and comprises a timer used as independent source for checking the operation of the first clock reference circuit 38 and vice - versa . in particular , the second reference circuit 39 , as illustrated in fig2 and 21 , comprises a switch s arranged between the fifth supply voltage vdd and the ground terminal 59 activated by a command signal 62 coming from the microcontroller 30 . the switch s suitably drives an schmitt trigger inverter tr , coupled in cascade , which has a lower threshold voltage v ml and an upper threshold voltage v mh . a suitable resistance r 76 is arranged between an output terminal rc 0 of the switch s and an input terminal rc 1 of the inverter tr whereas a capacitance c 44 is coupled between the input terminal rc 1 and the ground terminal 59 . in particular , when the command signal 62 of the switch s switches in relation to a third signal v p present at the output terminal p of the inverter tr , a first signal v n at the output terminal rc 0 switches . based upon the value of the resistance r 76 and of the capacitance c 44 , a second signal v m with exponential ramp is generated at the input terminal rc 1 . the second signal v m drives the inverter tr and the third signal v p has a waveform substantially analogous to that of the first signal v n but suitably shifted in time . the time sequences of the first signal v n , of the second signal v m and of the third signal v p are shown in fig2 . the first signal v n has a duty cycle substantially independent from the inner peripherals of the microcontroller 30 , in particular it has a period t ref equal to : where t h is the time with presence of high logic level signal the period t ref is compared by the microcontroller 30 with a period of the clock generated by the ceramic resonator y 1 to satisfy defined control and safety regulations . a comparison between the magnitudes provided by the first ceramic resonator y 1 and by the first reference circuit 38 as well as a suitable management of the signals of the second reference circuit 39 allows the microcontroller 30 to recognize possible deviations between the magnitudes provided , placing if necessary the electrical unit 5 in a stop state and the electronic device 10 in a safety state . the switch s and the inverter tr can be integrated directly into the microcontroller 30 and , in this case , the output terminal rc 0 and the input terminal rc 1 are pins of the microcontroller 30 . the microcontroller 30 , as shown in fig8 , has a plurality of further input pins ra 0 , ra 1 , ra 2 , ra 3 , ra 5 , re 0 coupled to a plurality of control peripherals suitable for providing analogue signals , as well as further pins provided to receive digital signals or rather signals with a significant interpretation only based upon two levels of discrete voltages , of the “ high ” or “ low ” or “ 0 ” or “ 1 ” type and that shall be described hereafter . according to the present embodiment , the voltage generator 85 , shown in fig9 , is supplied at a supply terminal 32 by the third supply voltage vcc_pos and is activated by a first command signal 86 received at an enabling terminal 33 to supply a high voltage impulsive bias signal 83 to an output terminal 89 . the first command signal 86 is generated by the microcontroller 30 and is of the impulsive type regulated according to the fourth supply voltage vcc , suitably measured by said microcontroller 30 through a fifth voltage measurer 160 , which is described hereafter . in particular , the voltage generator 85 comprises a first transformer t 1 with a primary winding the terminals i 1 - i 2 of which are respectively coupled to the supply terminal 32 and to a switch q 6 which is suitably coupled to the ground terminal 59 and is activated by the first command signal 86 . the first transformer t 1 has a secondary winding the terminals o 1 - o 2 of which are respectively coupled with the output terminal 89 and with the ground terminal 59 . according to an embodiment , the first transformer t 1 has a transformation ratio equal to 10 . a filtered divider element 88 is arranged between the first enabling terminal 33 and the switch q 6 to process the first command signal 86 and dynamically actuate the switch q 6 . the filtered divider element 88 is an r - c network and has a first resistance r 29 as well as a second resistance r 31 and a first capacitance c 29 , coupled in parallel with each other , arranged between the enabling circuit 33 and the ground terminal 59 . moreover , a second capacitance c 24 and a third capacitance c 25 , for filtering , coupled in parallel to each other , and arranged between the input terminal 32 and the ground terminal 59 allow possible interferences present in the third supply voltage vcc_pos to be filtered . furthermore , a first diode dz 1 , zener type , and a second diode d 8 are coupled in parallel to the primary winding i 1 - i 2 of the first transformer t 1 . finally , a resistance r 73 is arranged between the ground terminal 59 and a conducting terminal of the switch q 6 to limit the maximum reachable value by the conducting current of the switch q 6 . the bias signal 83 generated at the output terminal 89 is a high voltage alternating pulse train signal suitable for actuating the flame detector 90 as well as for feeding the spark circuit 80 . the spark circuit 80 receives the bias signal 83 at an input terminal 79 coupled to the output terminal 89 of the voltage generator 85 , and is activated by the microcontroller 30 through a second command signal 57 , suitably having a pulse train , received at a second enabling terminal 78 . the spark circuit 80 , between a first output terminal 25 and a second output terminal 26 provides a suitable discharge signal 84 with a high voltage difference , that is sufficient to generate sparks or electrical discharges , to generate the pilot flame , in a suitable first electrode 29 at the first nozzle 8 of the pilot burner 11 . according to the present embodiment , the second output terminal 26 is coupled to a further ground terminal 36 . in particular , the spark circuit 80 comprises a second transformer t 2 with a primary winding the terminals i 3 - i 4 of which are coupled between the input terminal 79 and the ground terminal 59 and a secondary winding with the terminals o 3 - o 4 coupled to the first output terminal 25 and to the second output terminal 26 . according to an embodiment , the first output terminal 25 is coupled to a third connector cn 3 and the second output terminal 26 is coupled to a second connector cn 2 . moreover , the spark circuit 80 comprises a third diode d 7 a first resistance r 21 and a second resistance r 22 , in series , coupled between the input terminal 79 and the primary winding i 3 - i 4 of the second transformer t 2 , whereas a first capacitance c 26 is coupled between the second transformer t 2 and the ground terminal 59 . a triggering element 82 is arranged between the second transformer t 2 and the ground terminal 59 and comprises a thyristor q 7 of the scr triggering type and a fourth diode d 9 , arranged in antiparallel with each other . the thyristor q 7 is activated by the second command signal 57 suitably regulated in voltage by a filtered divider r 30 - r 32 - c 43 coupled between the enabling terminal 78 and the ground terminal 59 . as regards the operation of the voltage generator 85 as well as of the spark circuit 80 , the first impulsive command signal 86 with a predetermined duty cycle , dynamically activates the switch q 6 between a closed operative condition , i . e . coupled to the reference voltage gnd , and an open operative condition for a predetermined number of switches per second . when the switch q 6 is in the closed operative condition an electric current crosses the primary winding i 1 - i 2 of the first transformer t 1 and a suitable energy is accumulated , a portion of such energy transfers to the secondary winding o 1 - o 2 , generating a negative semi - wave of the bias signal 83 . when the switch q 6 is in the open operative condition , a mesh is suitably formed between the primary winding i 1 - i 2 of the first transformer t 1 , the first diode dz 1 and the second diode d 8 . in particular , a current crosses the first diode dz 1 , which is taken into inverse conduction , and the second diode d 8 , which is taken into direct conduction . in such an open operative condition , the remaining portion of the energy accumulated by the first transformer t 1 transferred to the secondary winding o 1 - o 2 generates the remaining positive semi - wave of the bias signal 83 . this semi - wave charges the fourth capacitance c 26 of the spark circuit 80 through the third diode d 7 , the resistance r 21 and the resistance r 22 . after the defined number of switches of the first command signal 86 , the fourth capacitance c 26 of the spark circuit 80 suitably charges to a predetermined high voltage value . when the thyristor q 7 goes into conduction , activated by the second command signal 57 , a mesh is formed between the primary winding i 3 - i 4 of the second transformer t 2 and the fourth capacitance c 26 . at the same time , the second transformer t 2 , with a high transformation ratio , generates the discharge signal 84 at the secondary winding o 3 - o 4 with a high voltage and in particular able to overcome the dielectric rigidity of air , producing sparks , at the first electrode 29 arranged near to the first nozzle 8 of the pilot burner 11 , of sufficient energy to ignite the gas and generate the pilot flame . the output terminal 25 is advantageously connected to a discharge terminal associated with the first electrode 29 through the second connector cn 2 and the third connector cn 3 , both of the type suitable for high voltages . a suitable conductive return mesh of the discharge current is formed through the pilot burner 11 , the first nozzle 8 and the discharge terminal connected to the second connector cn 2 , as well as through the further ground terminal 36 and the output terminal o 3 of the secondary of the second transformer t 2 . according to an embodiment , the fourth capacitance c 26 is charged to a voltage of about 120 - 140v and through the second transformer t 2 causes a spark having a voltage of about 15 - 30 kv near the first electrode 29 . the spark circuit 80 , in some embodiments , could be integrated in the electrical unit 5 . a connection block 190 , represented in fig9 , is arranged between the ground terminal 59 and the further ground terminal 36 to make a star network and thus ensure the electrical continuity in the automatic device 10 minimising the propagation of the interferences generated by the discharge signal 84 , respecting defined current regulations , in particular emc ( electro - magnetic compatibility ). for functional purposes , the connection block 190 can be replaced by a resistance of sufficiently high value respecting current regulations . the detector 90 , illustrated in fig1 , is supplied by the bias signal 83 received at an input terminal 93 and allows it to be checked whether there is a pilot flame in the pilot burner 11 , exploiting an ionization detection principle . in particular , through such an ionization detection principle , the detector 90 detects the presence of a flame by analyzinq a current received at a control terminal 91 which is coupled to a second ionization electrode 19 introduced in the pilot flame and suitable biased through the bias signal 83 . the detector 90 , suitably sized , has sensitivity and a rate of response that satisfy the current regulations . the detector 90 , connected to the ground terminal 59 , receives the flame detection signal 94 at the control terminal 91 . moreover , the detector 90 comprises an activation terminal 95 that receives an activation signal 96 , generated by the microcontroller 30 , and an output terminal 92 that provides a verification signal 99 having a pulse train . the verification signal 99 is suitably analyzed by the microcontroller 30 within a predetermined time period . as known to the skilled in the art , the ionization detection principle makes it possible to check for the presence of a flame surrounding two electrodes subject to a potential difference . in such a condition , the two electrodes are , indeed , crossed by a weak electric current whereas , by inverting the polarity of the voltage in the presence of a flame between the two electrodes , the current becomes substantially zero . the behaviour of two electrodes introduced in the flame can be simulated with a circuit comprising a rectifying diode with high direct resistance . in particular , in the present embodiment , the first nozzle 8 being metallic and being coupled to the further ground terminal 36 defines the second electrode . therefore , in the presence of a flame , when the ionization electrode 19 has a positive voltage with respect to the first nozzle 8 there is a passage of current and the flame is recognized as lit . on the other hand , when by inverting the polarity of the voltage , the voltage difference between the ionization electrode 19 and the first nozzle 8 is negative there is no passage of current even if the flame is lit . furthermore , in the absence of a flame , when the electrode 19 has a positive or negative voltage with respect to the first nozzle 8 , there is no passage of current since the mixture of air and fire - proof gas is an electrical insulator at the voltage values used . the detector 90 comprises a first capacitance c 35 arranged between the input terminal 93 and a first inner node w , a first resistance r 41 and a second resistance r 42 , in series , coupled between the first inner node w and the control terminal 91 . moreover , the detector 90 comprises a first filtering element 97 and a second filtering element 98 , consisting of r - c circuits , coupled together in series and arranged between the first inner node w and a second inner node y . the first filtering element 97 comprises a third resistance r 46 coupled to the first inner node w and coupled to a second capacitance c 34 in turn connected to the ground terminal 59 . similarly , the second filtering element 98 comprises a fourth resistance r 45 coupled to a third capacitance c 33 in turn connected to the ground terminal 59 . a divider comprising a fifth resistance r 39 and a sixth resistance r 48 , arranged between the activation terminal 95 and the ground terminal 59 , allows the rest voltage of the inner node y to be suitably regulated from the level of the activation signal 96 . furthermore , a first bipolar transistor q 9 arranged between the output terminal 92 and the ground terminal 59 is commanded by a signal coming from the second inner node y . finally , a seventh resistance r 38 is arranged between the activation terminal 95 and the output terminal 92 . the detector 90 can have a protection and compensation network for the temperature variation that comprises a second transistor q 10 , suitably diode - connected , arranged between the second inner node y and the ground terminal 59 through an eighth resistance r 47 of high resistive value . as regards the operation of the detector 90 , a current that averages out at zero detected by the detection signal 94 keeps the average value of the alternating voltage present at the first inner node w practically unchanged , also keeping the second inner node y at a continuous voltage level upper than a conduction voltage of the first transistor q 9 . therefore , the first transistor q 9 is kept in a conduction area and provides the output terminal 92 with a voltage that the microcontroller 30 interprets as low logic level , i . e . “ 0 ” or absence of flame . on the other hand , a current of positive average value detected by the detection signal 94 lowers the average value of the alternating voltage present at the first inner node w , also lowering the continuous voltage present at the second inner node y . in this way , the first transistor q 9 comes out from the conduction area zeroing the current through the seventh resistance r 38 that is no longer crossed by current and the voltage at the output terminal 92 increases . the microcontroller 30 interprets such a voltage as high logic level , i . e . “ 1 ” detecting a presence of flame . advantageously , the verification signal 99 is of the type with rectangular wave and is generated by the detection signal 94 which is suitably alternated and generated by the bias signal 83 having a pulse train . moreover , thanks to the fact that the verification signal 99 is analyzed through the microcontroller 30 in a predetermined time period , it is possible to distinguish a real presence of a flame from an anomalous or parasite conductive pathway that could give false flame detection . indeed , possible conductive pathways created in the presence of carbon residues deposited due to poor combustion or else in the presence of foreign bodies in the pilot burner 11 , or even in the presence of aesthetic embers of mineral substance that are often scattered in the combustion chamber , can easily be detected by the microcontroller 30 . moreover , it is worth noting that since the bias signal 83 alternates with a succession of pulse trains , equipped with a suitably defined duration and frequency , as well as a peak voltage of around one hundred volts , it allows the voltage generator circuit 85 to ensure a transfer to the detector 90 of a peak current of the detection signal 94 with a value around the unit of microamperes , adequate for normal requirements . the time sequences of the bias signal 83 , of the detection signal 94 and of the verification signal 99 are schematically shown in fig2 . in particular , the detection signal 94 has a first active time period t s and a second passive time period t o that are defined by the bias signal 83 . even more particular , the electrical unit 5 through the first command signal 86 activates in pulses the voltage generator 85 , which generates the high voltage alternating bias signal 83 at the output terminal 89 for the first time period t s that is transferred as detection signal 94 and biases the second ionization electrode 19 . at the same time , the microcontroller 30 , through the activation signal 96 , activates the detector 90 and measures the verification signal 99 for the same first time period t s . after such a predetermined time window t s , the electrical unit 5 deactivates the first command signal 86 and the voltage generator 85 stops providing the bias signal 83 that cancels out like the detection signal 94 and stops biasing the second ionization electrode 19 . simultaneously , even if the detector 90 shows for the second time period t o the ( desired ) loss of detection signal 94 , the microcontroller 30 suspends the acquisition of the verification signal 99 . advantageously , the second time period t o is greater than the first time period t s . the measurement of the presence of flame is detected through the electrical unit 5 only during the first active time period t s . advantageously such a time period t s is reduced to fractions of the order of a tenth of a second that substantially is the period in which the pulse train of the bias signal 83 is kept active at the voltage generator 85 . a substantial saving in energy is thus obtained . indeed , during the second time period t o , the bias signal 83 is deactivated with a substantial saving of energy especially in the case in which the electronic device 10 is supplied exclusively by the battery pack 4 . the bias signal 83 has a time sequence of alternating voltage pulse trains that has frequency and duty cycle equal to : frequency detection f r = 1 / t r = 1 /( t s + t o ) duty cycle detection d r = t s /( t s + t o ) which advantageously allows the consumption to be kept low whilst still ensuring a real and immediate recognition following the real loss of flame with a maximum reaction time of less than the one second that fully satisfies the regulations of the regulations . a control peripheral of the automatic device 10 is a current measurer 110 , illustrated in fig1 , which when activated by the microcontroller 30 , through an enabling signal 115 , at a first input terminal 112 , coupled to the detection terminal 31 of the first actuator circuit 40 , detects a signal proportional to the current present at the first output terminal 34 . the current measurer 110 provides such a measured current value i_measure to an output terminal re 0 coupled to the microcontroller 30 to carry out some checks . in particular , the current measurer 110 comprises an amplifier with common collector , coupled to suitable resistive and capacitive elements , which is enabled by the enabling signal 115 . the automatic device 10 comprises further voltage measurers , illustrated in fig1 , activated by a single enabling signal 122 , generated by the same microcontroller 30 , and suitable for providing the microcontroller 30 with a measurement of the voltages present in the automatic device 10 for specific checks and necessary comparisons and regulation . in particular , a first voltage measurer 120 measures the fifth supply voltage vdd present at the output terminal 65 of the detection circuit 60 , using a resistance r 71 and providing such a measurement to a first analogue input ra 2 of the microcontroller 30 . a second voltage measurer 130 implicitly measures the reference voltage gnd of the ground terminal 59 and provides it to a second analogue input ra 5 of the microcontroller 30 . a third voltage measurer 140 measures the supply voltage vbb supplied by the battery pack 4 and through a network of substantially r - c passive elements generates a measured supply voltage vbb_measure that is supplied to a third analogue input ra 0 of the microcontroller 30 . a fourth voltage measurer 150 takes the fifth supply voltage vdd and , through a network of substantially r - c passive elements and a bipolar transistor coupled with diode , generates a reference voltage vref_measure that is supplied to a fourth analogue input ra 1 of the microcontroller 30 . in particular , the measured reference voltage vref_measure is acquired at an input independent both from the fifth supply voltage vdd measured through the first voltage measurer 120 , and from the reference voltage gnd detected through the second voltage measurer 130 . therefore , the microcontroller 30 uses the three distinct magnitudes that are compared with each other in the safety checks for self - diagnosis and in the satisfaction of the regulations of the regulations . finally , a fifth voltage measurer 160 detects the fourth supply voltage vcc and through a network of substantially r - c passive elements generates a voltage vcc_measure that is supplied to a fifth analogue input ra 3 of the microcontroller 30 . in particular , it is worth highlighting that through a suitable activation of the transistor q 16 by the microcontroller 30 all of the measuring blocks 140 , 150 and 160 , shown in fig1 , are able to be deactivated / activated simultaneously . more in particular , the deactivation of such measuring blocks saves a few hundred microamperes of supply current . further suitable blocks and peripherals can be coupled or present in the automatic device 10 to satisfy specific requirements . a suitable interface block 180 , shown in fig1 , comprises a fifth connector j o , connected to the fifth supply voltage vdd and to the ground terminal 59 as well as to the microcontroller 30 through three command terminals 181 , 182 , 183 and allows rapid connection to the microcontroller 30 for rapid programming . finally , the automatic device 10 comprises a diagnostic block 170 , shown in fig1 , which is supplied by the fifth supply voltage vdd and is coupled to the ground terminal 59 as well as receives a first diagnostic signal 172 and a second diagnostic signal 171 from the microcontroller 30 suitable for providing the diagnostic circuit 14 with four interface signals + vdd , txd , − gnd , rxd , through a sixth connector cn 6 . the diagnostic circuit 14 can comprise an acoustic element for emitting encoded sounds , or else it can consist of a luminous device for emitting encoded flashes or it can be a serial communication interface for exchanging data through a suitable protocol . as regards the operation of the automatic device 10 , according to the present embodiment , for ignition of the automatic device 10 the electrical unit 5 from the command circuit 6 receives the start signal start , which can be generated by an external command signal , or received from a user , or from means for detecting the room temperature . in the ignition step , the electrical unit 5 commands the voltage generator 85 in pulses through the first command signal 86 , which , at the output terminal 89 , generates the high voltage alternating bias signal 83 suitable for commanding the spark circuit 80 and for driving the detector 90 both enabled by the microcontroller 30 . the detector 90 detects the detection signal 94 from the second ionization electrode 19 close to the pilot burner 11 and through the flame detection principle provides the microcontroller 30 with the verification signal 99 , detecting an initial absence of flame . once it has been verified that there is no flame , otherwise a breakdown symptom , since the commands to open the gas are still inactive , the electrical unit 5 enables the enable circuit 46 with activation of the enabling signal 49 and the actuator circuit 40 with the activation of the first activation signal 21 . simultaneously , the electrical unit 5 with the second command signal 57 activates the spark circuit 80 , which generates the discharge signal 84 through the formation of an electrical discharge repeated over time at the corresponding output terminals 25 and 26 to make a series of sparks in a suitable first electrode 29 at the first nozzle 8 to generate the pilot flame in the pilot burner 11 . simultaneously , the first actuator circuit 40 suitably biases the first solenoid 17 in relation to the duty cycle of the first activation signal 21 , regulating the passage of the gas through the pilot burner 11 . the ignition sequence of the pilot flame is completed when the verification signal 99 generated by the detector 90 and analyzed by the microcontroller 30 in the predetermined time window detects a continuous flame that hits the second ionization electrode . in this case , it is deactivated the second command signal 57 at the spark circuit 80 and the discharges at the first electrode 29 are stopped . the detector 90 continues to check the pilot flame in the pilot burner 11 thanks to the second ionization electrode 19 and the electrical unit 5 is ready for the ignition of a flame in the main burner 12 , if required , with the activation of the second activation signal 22 and the corresponding bias of the second solenoid 18 . simultaneously , the microcontroller 30 through the peripherals checks the correct operation of the automatic device 10 . in the case of anomalies , the microcontroller 30 activates the diagnostic interface block 170 that provides respective signals that can be processed by the diagnostic circuit 14 , coupled to the electrical unit 5 , which according to the requirements and the design specifications , allows suitable and specific alarm signals to in turn be generated . an embodiment of the present invention also refers to a method for driving an automatic device for the ignition and control of a gas apparatus , of the type described previously for which details and cooperating parts having the same structure and function shall be indicated with the same reference numbers and symbols . a method according to an embodiment of the present invention refers to an automatic device 10 of a gas apparatus 1 which is equipped with a pilot burner 11 and a main burner 12 , coupled in the usual way . moreover , suitable electrically controlled valve means 7 allow the flow of gas to be regulated from a main pipe 28 towards a first nozzle 8 , associated with the pilot burner 11 , and to a second nozzle 13 , associated with the main burner 12 . such a driving method is basically based upon the dynamic actuator of a first actuator circuit 40 and of a second actuator circuit 45 through , respectively , a first activation signal 21 and a second activation signal 22 having a pulse train , generated by an electrical unit 5 with a microcontroller . the pulses of such activation signals 21 , 22 have a predetermined duty cycle the valve means 7 are dynamically polarized by such actuator circuits 40 , 45 regulating the charge state according to the duty cycle of the pulse train of such activation signals 21 , 22 , allowing a substantial saving of energy . the actuator circuits 40 , 45 are made so that , during the actuator of the respective activation signal 21 , 22 , the voltage at a respective output node e , e ′ is less than the voltages of any inner node , and in particular less than the voltage of the ground terminal 59 . substantially , according to an embodiment of the present method the actuator circuits 40 , 45 are structurally and functionally similar . preferably , a first inductance l 1 and a first capacitance c 1 , arranged in series between a first supply terminal 47 , which receives a fourth supply voltage vcc , and the output node e associated with a first output terminal 34 , as well as a first diode d 1 arranged between the output node e and an ground terminal 59 , are used to make the first actuator circuit 40 . a first switch q 1 , coupled between an intermediate inner node a and the ground terminal 59 , is suitably dynamically commanded by the electrical unit 5 through the first activation signal 21 having a pulse train . the intermediate node a is arranged between the first inductance l 1 and the first capacitance c 1 . the valve means 7 and in particular a first solenoid 17 is connected to the first output terminal 34 , the first solenoid 17 also being connected to the ground terminal 59 . in particular , in order to suitably actuate the first actuator circuit 40 , the method provides a preliminary step supplying the fourth supply voltage vcc and keeping the first switch q 1 open . thereafter , the method provides actuating the first actuator circuit 40 through the first activation signal 21 having a pulse train , to dynamically polarize the valve means 7 and in particular the first solenoid 17 . for the dynamic bias of the first solenoid 17 , during the activation time period t on the first capacitance c 1 is advantageously connected to the ground terminal 59 through the first switch q 1 . therefore , the first actuator circuit 40 absorbs current from the first solenoid 17 making the voltage at the output node e negative . consequently , during the deactivation time period t off , the output node e is connected to the ground terminal 59 through the first diode d 1 which is taken into conduction and also absorbs a recirculation current coming from the first solenoid 17 . the activation time period t on is foreseen to be substantially shorter than the deactivation time period t off . therefore , the first actuator circuit 40 provides a power transfer from the power supply , fourth supply voltage vcc , to the valve means 7 that is defined based upon the value of the duty cycle of the pulse train . in particular , there is an absorption of energy just during the activation time period t on of the first activation signal 21 . the method provides modulating the duty cycle of the first activation signal 21 according to some parameters , like for example : value of the fourth supply voltage vcc ; value of the minimum current relative to an active condition of the first solenoid 17 to open the corresponding shutter ; temperature value of the first solenoid 17 . preferably , according to an embodiment of the present invention , a method provides at least one feedback measuring step which provides taking a measured current value i_measure , proportional to the current value present at the first output terminal 34 , through a detection terminal 31 . the detection terminal 31 is connected near to the first output node e and suitably connected to the electrical unit 5 . the method thus provides analyzing the measured current value i_measure through the electrical unit 5 , comparing it with suitable reference values stored in the microcontroller and modulating the duty cycle of the first activation signal 21 , providing possible corrective compensations . similarly , to suitably actuate the second actuator circuit 45 , the method provides a preliminary step supplying the fourth supply voltage vcc and keeping a second switch q 2 open . thereafter , the method provides actuating the second actuator circuit 45 providing the activation signal 22 having a pulse train to dynamically polarize the valve means 7 and in particular a second solenoid 18 . the fourth supply voltage vcc is generated by an enable circuit 46 arranged in series with a selector 50 which is supplied by a first supply voltage vdc , supplied by a rectifying transformer 3 coupled in series and supplied by the network voltage vac of the electricity main 2 , as well as by a second supply voltage vbb supplied by battery pack 4 . a method provides equipping the selector 50 with a first diode 12 and with a second diode 13 , suitably arranged in series with the input terminals to supply an inner node x with the third continuous supply voltage vcc_pos allowing a non - conflicting connection between the first supply voltage vdc and the second supply voltage vbb to avoid the first supply voltage vdc from overloading the battery pack 4 damaging them and consequently preventing the battery pack 4 from being needlessly consumed . in particular , a method according to an embodiment of the present invention provides the steps of : initial automatic ignition , activating an spark circuit 80 suitable for generating a pilot flame at the first nozzle 8 of the pilot burner 11 when a start signal start is received , through the electrical unit 5 . more in particular , according to an embodiment of the present invention , the initial automatic ignition step provides the following preliminary steps : receiving and interpreting the start signal start by the electrical unit 5 according to a specific and provided protocol , the start signal start being emitted by a remote control panel 6 ; activating a voltage generator 85 and activating a flame detector 90 and verifying an initial condition of pilot flame not present ; activating the voltage generator 85 to generate a spark through a discharge signal 84 near to the first nozzle 8 . activating the voltage generator 85 through a first command signal 86 with pulse train and with a predetermined duty cycle , generated by the electrical unit 5 , to generate the bias signal 83 , advantageously with alternating pulse train and having a high voltage , at the output terminal ; activating the spark circuit 80 through a second command signal 57 , also with pulse train with a predetermined duty cycle , generated by the electrical unit 5 , to generate the high voltage discharge signal 84 at the output terminal . the discharge signal 84 , compared to the voltage present at the ground terminal 59 , has a voltage difference suitable for generating suitable sparks at the first nozzle 8 . according to an embodiment of the present invention , the electrical unit 5 according to a measured supply voltage vcc_measure through a fifth voltage measurer 160 regulates the first command signal 86 . moreover , a method provides : activating the detector 90 with a suitably timed activation signal 95 generated by the electrical unit 5 to control the pilot flame in the pilot burner 11 . the method provides detecting the flame at the first burner 11 , through the ionization principle , receiving a detection signal 94 of a flame coming from a second ionization electrode 19 at a control terminal 91 and then providing a verification signal 99 to the electrical unit 5 . the method then provides the step of analyzing the verification signal 99 in a predetermined time period through the electrical unit 5 . according to an embodiment of the present invention , the flame detection signal 94 is an alternating signal with a negative voltage part and a positive voltage part to allow a real presence of flame to be distinguished from a parasite conductive pathway . once the pilot flame at the first nozzle 8 of the burner 11 has been generated and controlled , the method provides using the pilot flame as ignition source for a main flame near to the second nozzle 13 of the main burner 12 . a method according to an embodiment of the present invention provides suitably actuating the second actuator circuit 45 , through the activation by the electrical unit 5 of the second activation signal 22 with pulse train to dynamically bias the valve means and in particular the second solenoid 18 and regulate the gas flow from the main pipe 28 to the main burner 12 . a second inductance l 2 and a second capacitance c 2 , in series between a second supply terminal 48 and a second output terminal 35 , as well as a second diode d 2 , arranged between the output terminal 35 and the ground terminal 59 , and a second switch q 2 suitably dynamically commanded by the electrical unit 5 through the second activation signal 22 having a pulse train , are used to make the second actuator circuit 45 . in an analogous way to what generally occurs , the method then provides the steps of : constantly checking the pilot flame in the pilot burner 11 through the detector 90 and the electrical unit 5 . the method provides further steps of detection of the voltages and of the currents present in the automatic device 10 , through special blocks ; such steps are suitably timed by the electrical unit 5 with a microcontroller in a logic suitable for instantaneously detecting possible anomalies of the automatic device 10 as well as for minimising the energy consumption of the automatic device 10 . such steps , for example , provide the use of a first current measurer 110 , as well as of a first 120 , a second 130 , a third 140 , a fourth 150 and a fifth 160 voltage measurer , these being enabled simultaneously by the same enabling signal 122 provided by the electrical unit 5 . further detection blocks can be present to satisfy specific regulatory or requirements or specific and detailed needs . an advantage of an automatic device according to an embodiment of the invention is its low energy consumption as well as its automatic management in terms of the flame ignition command , in terms of the flame control , and in terms of the safe restoring of the device in the presence of anomalies . indeed , the actuator circuits , dynamically activated through the pulse train by the electrical unit with a microprocessor , bias the valve means with an energy transfer from the power supply just in the activation time period defined by the duty cycle of the pulse train of the respective activation signals . a further advantage is given by the fact that thanks to the feedback between the first actuator circuit and the electrical unit it is possible to regulate the duty cycle of the pulse train of the activation signals activating the first actuator circuit and biasing the valve means with less use of energy . another advantage is given by the energy saving due to the timed actuation between the voltage generator , the spark circuit and the detector and by the fact that the detection of a flame through the verification signal is timed . such advantages , in particular , allow extremely low energy consumption with a substantial and unusual saving of energy , in this way allowing the automatic device to be suitably supplied with just the battery means for a significant period of time . a further advantage of an automatic device according to an embodiment of the present invention is the versatility of use ; indeed , the spark circuit can be commanded remotely for flame ignition and completely automatic control of the entire device . another advantage of the automatic device is given by the safety provided ; indeed , the detector allows automatic quick checking of the flame leaving the electrical unit to safely manage the entire automatic device and in particular the valve means . a further advantage of the automatic device is given by the speed of response to possible anomalies of the pilot flame and to the capability to distinguish a real flame from another conductive pathway . in particular , the possible loss of the pilot flame is detected by the electrical unit 5 allowing resetting for safe management of the automatic device . indeed , the detector uses the ionization flame detection principle and uses the alternating voltage pulse train detection signal . another advantage of the automatic device is given by the opportunity to activate the gas apparatus in complete safety through remote command , with a remote control or with a radio control . another advantage is the versatility of the present electronic device . thanks to the fact that the valve means are biased through the actuator circuit activated by the activation signal with pulse train with duty cycle that can be regulated by the electrical unit , the automatic device can be adapted to a wider range of valve means equipped with substantially inductive solenoids with low supply voltage . in particular , the automatic device can replace other devices in existing apparatuses . another advantage of a pilot method according to an embodiment of the present invention is its efficiency linked to the low energy consumption required and to the completely electronic management in terms of the command to the spark circuit , in terms of the flame control and in terms of the control of the operation of the automatic device . moreover , such a method allows the device to be completely automatical and to be quickly restored or made safe . from the foregoing it will be appreciated that , although specific embodiments of the invention have been described herein for purposes of illustration , various modifications may be made without deviating from the spirit and scope of the invention .
| 5 |
fig1 shows a bleacher or stadium seat 12 attachable cup holding device 10 which can be constructed or molded in separate connectable pieces of a resilient plastic or other suitable structural material . a first piece is a bracket clip / shaft 3 which includes lip clip 5 . the bottom leg of clip 5 extends horizontally away from clip 5 and far enough out to contain a small angled flange 11 . flange 11 is emanating from this bottom leg and raises up . its open end extends back towards clip 5 . clip / shaft bracket 3 then extends downwardly ( from slightly beyond emanation point of angled flange 11 ) as a vertical flat shaft before transition or morphing into cylindrical shaft 16 . shaft or post 16 allows connection to a second piece , a cup / bottle holding support 1 . the clip / shaft bracket 3 also has an upward curved flange 4 protruding out of the vertical flat shaft for holding shakers . the second piece , cup / bottle holding support 1 comprises a cup holding ring 13 housing a hole 6 at its connecting ( to cylindrical shaft 16 ) end through which passes the slightly smaller diametrically cylindrical shaft 16 . shaft 16 can be secured after passage through hole 6 by a connectable ( e . g . adhesive , glued on ) ring cap 2 . the hole 6 can be larger slightly than the cylindrical shaft 16 to allow ring 13 to rotate about 180 degrees from a position in front of bleacher to a position under a bleacher 12 , as illustrated by arrows 36 in fig2 , 6 , and 7 . support 1 can optionally contain two pair ( one on left side of ring and one on right side of ring ) of curved flanges 8 , 9 extending off of the ring 13 horizontally . these flanges 8 , 9 are set apart far enough and are curved enough to allow a narrowed portion of a bottleneck 14 of bottle 27 to securely rest in them ( see fig3 and 9 ). another part of apparatus 10 can be a short , but wide trash bag mount or hanger 7 extending horizontally off of the ring 13 and directly between the two pair of bottle holding curved flanges 8 , 9 and directly opposite the hole 6 at apex of ring 13 ( see fig1 ). fig2 shows bleacher attachable cupholding device 10 assembled and ready for attachment to bleacher or stadium seat 12 . assembly is simply passing the cylindrical shaft 16 through the hole 6 of the support apparatus 1 and connecting ( e . g . adhesive , gluing ) the ring cap 2 in place at the tip of the shaft 16 . in fig7 , bleacher or stadium seat 12 has an upper panel 38 having grooves 39 , front and rear flanges or panels 40 , 41 and bottom flanges or panels 42 , 43 . panel 42 is a front bottom panel . panel 43 is a rear bottom panel . in order to attach the clip / shaft bracket 3 to seat or bleacher 12 , recess 44 in between clip 5 and flange 11 is receptive of front bottom panel 42 of bleacher seat 12 ( see fig7 ). in this position , flange 11 engages front panel 40 . fig6 shows device 30 assembled with shaft 35 connected through hole 32 to cap 33 . fig7 shows device 30 attached to inner lip 17 of bleacher 12 via clip 31 which has been secured to front bottom flange 42 . fig8 shows cup 15 being supported by device 30 which is attached to a bleacher 12 . fig9 shows bottle 27 supported by device 30 which is attached to a bleacher 12 . in fig5 , ring 13 is attached to vertical flat shaft 35 which is attached to cylindrical shaft 34 . the parts 13 , 34 , 35 can be single piece , for example injection molded plastic . shaft 34 extends through hole or opening 32 and is rotatably mounted in hole or opening 32 , secured with cap 33 ( using a fastener , bolt , screw , adhesive , etc .). fig1 shows another embodiment of bleacher attachable cupholding device 20 in an exploded view . device 20 comprising a clip 23 attached at the bottom in the center of clip 23 to a thin vertical shaft which attaches to the top middle section of a rail 21 which extends a few inches backward . on the rail 21 rides a snugly fitting car 25 attached to a ring 13 , the rail 21 held on by a stop cap 26 . fig1 shows device 20 assembled with the car 25 attached to ring 13 riding on a rail 21 which is affixed to a clip 23 and held on by a stop cap 26 . fig1 shows device 20 attached to a bleacher 12 via the bleacher 12 front panel 40 and front bottom panels 42 with the car 25 and ring 13 combination able to move from a position in front of bleacher 12 ( fig1 ) to a position directly under bleacher 12 . in fig1 , device 20 is attached to bleacher 12 and supporting cup 15 in its ring 13 in an extended position . fig1 shows device 20 comprising a clip 23 attached at middle of bottom to a rail 21 supporting a sliding car 25 which is affixed to a ring 13 holding a bottle 27 held by extending flanges 9 encircling its neck 14 . the device 20 is secured to a bleacher 12 via front panel 40 and front bottom panel 42 of bleacher 12 . the car 25 slides between an extended position of fig1 and a retracted or storage position wherein the car engages stop 22 . thus car 25 travels between stop 22 and stop cap 26 as illustrated by arrows 37 in fig1 . thus any of the embodiments of the apparatus of the present invention provides a holder that enables a cup , bottle , and or bag to be moved between an extended position and a stored position . in the extended position , the cup , bottle and or bag is placed toward the front of the stadium seat or bleacher 12 as shown in fig3 , 4 , 7 , 8 , 9 , 11 , 12 , 13 , 14 . in the retracted position , the cup , bottle , bar or other similar object is moved to a storage position under the stadium seat 12 . in one embodiment , a pivotal connection is formed between a bracket or clip that is attached to a seat and the holder which supports the cup , bottle , or bag . in another embodiment , the cup , bottle or bag is mounted to a support which includes a car that can slide between an extended and a retracted or storage position . the present invention thus provides an improvement over prior art systems in that a user can access a cup , bottle or bag when desired . that same user can store the cup , bottle and or bag under his or her position in a stadium seat when the user does not wish to use the cup , bottle or bag . when supporting a cup , the cup would desirably have a larger diameter upper end 46 which is larger than the diameter or opening 45 of ring 13 , thus a portion of the cup 15 extends through the opening 45 while the upper end portion which is of a larger diameter 46 than the opening 45 extends above ring 13 ( see fig4 ). it should be understood that the rail 21 and car 25 could have many different configurations . for example , the rail 21 could be cylindrically shaped with the car 25 having a circular opening that fits the cylindrical rail . it should also be understood that other linkages could be used in addition to the pivotal linkage of fig1 - 9 or the sliding linkages of 10 - 14 . for example , the linkages could employ multiple arms or multiple segments or joints which might pivot one upon another . a fourth embodiment of the present invention , cup holder 110 ( fig1 - 22 ) is similar to cup holder 10 , and varies in just a few details . it includes a perimeter support rib 150 . rib 150 starts at the midpoint of the top of clip / shaft combination / bracket 103 and goes to back of clip 103 , proceeds down back of clip 103 and all the way on underside of clip 103 to the flat part of the vertical component 170 . the purpose of rib 150 is to strengthen the clip 103 . there is a downward projection 155 on the underside of top leg 160 of clip 103 . the purpose of downward projection 155 is to hug the top part 117 of the bleacher lip on bleachers 112 that have a little nub 117 on the end of the lip , as shown in fig1 . there is a metal spring 165 received in clip 103 . this spring 165 serves the same purpose as the plastic stop 11 in fig1 and is a movable projection . however , spring 165 rises from the side instead of in front and going back toward clip . the spring 165 can also be made as part of the mold ( in which case it would be the same plastic ) instead of being a separate metal piece inserted into slit 166 as shown in fig1 - 20 . though not shown in fig2 - 26 , clip 203 preferably has such a molded spring in roughly the same position as metal spring 165 on clip 103 . instead of gluing ring 2 to shaft 16 , one could instead for example : ( 1 ) provide a form fitting cap which could be sonically welded to end of cylindrical shaft 16 ; ( 2 ) provide a retaining ring ( made of metal , for example ) with three prongs which are inserted into three holes made toward the end of cylindrical shaft 16 and are at evenly spaced intervals circumnavigating shaft 16 . ( 3 ) provide a modified end of shaft 16 in the form of a barbed lock which is inserted through the sleeve ( hole ) 6 in the apex of the cupholding ring using a mechanical press . it pops out of the bottom of the sleeve and can not go back thus securing the cupholding ring to the shaft . ( 4 ) provide a four - pronged cored out barbed lock which operates similarly but does not have to be mechanically pressed . ( 5 ) provide a two - pronged split tail barbed lock which serves the same purpose only using two prongs instead of four . tab 171 is connected to the top of shaft 16 and contacts ring 113 when shaft 16 is inserted through the sleeve ( hole ) 6 ( see fig1 - 22 ). clip 203 shown in fig2 - 26 is similar to clip 103 . it differs primarily in that vertical component 170 is shorter and rib 250 is wider than rib 150 and does not extend as far . also , a molded plastic spring ( not shown ) is preferably used . curved flange / hangers 108 , 109 shown in fig1 - 22 are similar to flanges 8 , 9 . they differ primarily in that flanges 108 , 109 have flange ears 111 located at the end of each flange . flange ears 111 can be used to assist the narrowed portion of a bottleneck 14 of bottle 27 to enter into and securely rest in flanges 108 , 109 . to attached cup holder 110 to bleacher 112 , clip 103 is moved forward and around bleacher 112 so that downward projection 155 hugs the top part 117 of the bleacher lip . to detach cup holder 110 , clip 103 is moved away from the bleacher forward panel 40 . spring 165 engages front panel 40 . the following is a list of parts and materials suitable for use in the present invention : 1 cup / bottle support 2 retainer / ring cap 3 clip / shaft combination / bracket 4 upwardly curved shaker holding flange 5 lip clip 6 opening / hole 7 trash bag mount / hanger 8 curved flange / hanger 9 curved flange / hanger 10 bleacher attachable cup holding device 11 angled flange 12 bleacher rail / stadium seat 13 ring 14 bottle neck 15 cup 16 cylindrical shaft / post 17 inner lip 19 cup / bottle holding apparatus 20 bleacher attachable cup holding device 21 rail 22 stop 23 clip 25 car 26 stop cap 27 bottle 30 bleacher attachable cup holding device 31 clip 32 hole / opening 33 cap 34 cylindrical shaft 35 vertical flat shaft 36 arrow indicating rotation of ring 13 37 arrow indicating sliding movement of car 25 38 upper panel 39 groove 40 forward flange or panel 41 rear flange or panel 42 front bottom panel 43 rear bottom panel 44 recess 45 opening 46 larger diameter upper end 103 clip / shaft combination / bracket 108 curved flange / hanger 109 curved flange / hanger 110 bleacher attachable cup holding device 111 flange ears 112 bleacher 113 ring 117 inner lip of bleacher 112 142 front bottom panel 143 rear bottom panel 150 perimeter support rib 155 downward projection 160 top leg 165 spring 166 slit 170 vertical component 171 tab 203 clip 250 perimeter support rib all measurements disclosed herein are at standard temperature and pressure , at sea level on earth , unless indicated otherwise . the foregoing embodiments are presented by way of example only ; the scope of the present invention is to be limited only by the following claims .
| 0 |
referring to fig1 there is shown a typical walk - behind rotary lawn mower designated 10 . lawn mower 10 includes an engine 12 mounted on a base 14 that is supported by two pairs of opposed wheels , of which only two wheels 16 and 18 are shown . a handle 22 is attached to the base 14 for manually guiding and / or pushing the lawn mower . base 14 includes a housing , shroud , or cowling 20 that extends around the wheels and a rotatable blade 23 . an interior surface 25 of housing 20 encloses the blade 23 and defines a blade chamber 21 within which the blade 23 rotates and the lawn clippings whirl . it should be understood that any type of lawn mower may utilize the present invention , thus , although a rotary , walk - behind mower is depicted in fig1 the present invention is not limited to such use , and therefore may be used with riding lawn mowers , garden tractors , and other propelled or self - propelled lawn mowers . in accordance with the present invention , a washer ring 24 is positioned on the surface of the ground and is coupled to a garden hose 26 . the garden hose 26 is shown coupled to a water faucet , however , it should be understood that any water source of adequate pressure may suffice . placement of the water ring 24 is preferably directly underneath or below the blade 23 , but can be placed anywhere underneath the housing 20 where the water will be directed into the blade chamber 21 . positioning the water ring 24 directly below the blade 23 allows full utilization of the rotating blade during the cleansing process . although the washer ring 24 is oriented in fig1 such that the water hose 26 connects with washer ring 24 from the rear of the mower 10 , it should be understood that washer ring 24 may be oriented in any direction relative to the mower 10 and not degrade the performance of the washer ring 24 . referring now to fig2 and 3 there is depicted an enlarged view of the present washer ring 24 . washer ring 24 includes an annular conduit 30 , preferably fabricated from a metal , typical of current lawn sprinklers and the like , such as stainless steel , aluminum , etc , but which can be a pvc or other material suitable as a water conduit for pressurized water . it has been found that the diameter of annular conduit 30 should , preferably , not exceed eight inches ( 8 &# 34 ;), and can be less . a support or brace 31 is disposed radially inwardly of annular conduit 30 . support 31 includes four arms 32 , 33 , 34 , 35 , each of which extend radially inwardly from a respective point on the inner periphery of annular conduit 30 , the respective points being equidistant along the annular periphery or 90 ° from each other . it should here be appreciated that support 31 may include more arms or less arms than shown , or may constitute a plate or plate - like structure . each arm 32 , 33 , 34 , 35 , terminates at a ring 49 that forms a part of spike or stake 46 . since annular conduit 30 is rigid , support 31 essentially provides a central position for stake 46 and retains the same . attached to a periphery of annular conduit 30 is a conduit extension 38 that is preferably fashioned from like materials as annular conduit 30 . conduit extension 38 is approximately twelve inches ( 12 &# 34 ;) in length , and terminates in a hose coupler 40 or like connector adapted to releasably attach to a typical garden hose or other water supply conduit . since annular conduit 30 is preferably eight or less inches in diameter , conduit extension 38 allows an operator to connect and disconnect the water supply hose 26 and operate the valve 42 while the mower 10 is positioned over the washer ring 24 . disposed within conduit extension 38 and proximate hose coupler 40 is a conventional type ball valve 42 or the like , with an actuating handle or lever 43 positioned on the surface of extension conduit 38 . the ball valve 42 permits a range of water flow rates into annular conduit 30 from a maximum flow rate determined by the water supply to zero flow , such that the operator may turn on the flow of water from the faucet 28 and completely control the water from washer ring 24 . it should be appreciated that valve 43 may be any type of suitable fluid valve that includes the ability to provide a range of flows varying from no flow to a maximum flow . specifically referring now to fig3 annular conduit 30 is shown in cross - section . annular conduit 30 defines an annular d - shaped interior chamber 50 that is in communication with passageway 44 defined by extension conduit 38 . as can be appreciated from fig3 annular conduit 30 includes an annular flat surface or portion 52 on one axial end , that essentially defines a cross - section of annular conduit 30 as a d - shaped toroid . annular flat surface 52 is adapted to abut the surface of the ground when washer ring 24 is in operation , and provides stability thereto . annular flat 52 also creates a low profile in order to allow the mower 10 to be placed thereover . a stake 46 is centrally located relative to annular conduit 30 and as indicated above , is retained by support 31 through ring 49 . stake 46 includes a knob 48 that enables an operator to grasp and insert stake 46 into the ground in order to releasably retain or immobilize washer ring 24 onto the ground . knob 48 also assists in the removal of stake 46 and thus washer ring 24 . stake 46 is oriented such that annular flat 52 abuts or is disposed adjacent the ground in order to achieve a low overall profile when inserted into the ground . annular conduit 30 includes a semicircular wall 54 in which there are disposed a plurality of orifices or apertures collectively designated 56 and 58 . apertures 56 form a first annular pattern or formation about annular conduit 30 , while apertures 58 form a second annular pattern or formation about annular conduit 30 . each annular pattern 56 , 58 includes a select number of apertures , preferably twelve , equally annularly spaced about annular conduit 30 . each annular pattern 56 , 58 thus forms or defines an annular spray pattern or formation . with particular reference to fig6 each of the apertures collectively designated 56 and 58 includes respective spray nozzles collectively designated 60 and 62 that includes respective nozzle bores 64 and 66 , collectively . the nozzles may be standard brass spray nozzles as is well known in the sprinkler or fluid spraying arts , or similar structures that allow for a controlled spray . apertures 58 that define the second annular spray pattern are preferably disposed in wall 54 perpendicular to the ground or parallel to a vertical axis of washer ring 24 , such that the spray emanating from each nozzle 62 is essentially directed upwardly . apertures 56 that define the first annular pattern are situated at an angle φ ( φ °) from the perpendicular to the ground or parallel to the vertical axis of between 0 ° to 46 °, and preferably , as depicted , at a φ ° of 45 °. the perpendicular annular spray pattern defined by collective apertures 58 directs the cleansing water spray essentially vertically upwards into the blade chamber 21 and blade 23 , while the angled annular spray pattern defined by collective apertures 56 directs the cleansing water spray essentially outwardly towards the corners of the interior surface 25 of housing 20 . the angled annular spray pattern thus directs the cleansing water towards the area within the blade chamber 21 that generally clogs and compacts with clippings the most . it should also here be noted that the present washer ring is designed to operate with the mower running and the blade rotating in order to most effectively distribute the water and swirl it at sufficient velocity to dislodge the compacted clippings and thoroughly cleanse the blade chamber 21 . referring to fig4 and 5 there is shown an alternative embodiment of the washer ring depicted in fig2 and 3 , and described hereinabove . washer ring 70 of fig4 includes an annular conduit 72 with a support structure or brace 73 having four arms 74 , 75 , 76 , 77 that each radially inwardly extend from an inner periphery of the annular conduit 72 in like manner to the washer ring 24 of fig2 and 3 . the arms 74 , 75 , 76 , 77 terminate at ring 78 of a spike or stake 80 . a knob 82 is disposed on the upper part of ring 78 for grasping the spike 80 for inserting and removing the spike 80 as described hereinabove with reference to washer ring 24 . annular conduit 72 is likewise connected to an extension conduit 84 so as to be in fluid communication therewith . extension conduit 84 terminates in a hose coupler 86 that is adapted to couple to a hose or other water supply conduit . a valve ( not shown ) is disposed in extension conduit 84 proximate hose coupler 86 , in like manner to washer ring 24 , and includes a valve actuator handle or lever 88 for permitting the operator the control the flow of water from a no flow to a full flow at the washer ring 72 itself rather than at the water source or faucet . annular conduit 72 further includes a plurality of apertures collectively designated 94 and 96 . in like manner , function , and form to collective apertures 56 and 58 of washer ring 24 , collective apertures 94 forms or defines a first annular spray pattern or formation that directs water upwardly perpendicular to the ground or parallel to a vertical axis of the washer ring , while collective apertures 96 forms or defines a second annular spray pattern or formation that directs water upwardly and radially outwardly at an angle defined from the perpendicular ( see fig6 ). this angle is defined by and follows the same criteria as that for washer ring 24 , above . washer ring 72 includes a stand or guard 92 that essentially encompasses and conforms to the outer surface of annular conduit 72 , and may be fabricated from a plastic such as is common to current sprinklers and known in the art . in this manner an annular flat portion 92 of stand 92 is disposed adjacent annular flat portion 89 of annular conduit 72 . stand or guard 72 thus protects annular conduit 72 from puncture or otherwise . it should be appreciated that in both embodiments , only one annular spray pattern or formation is necessary for the efficient functioning of the present invention . it is preferred that the single pattern be the angled annular spray pattern defined by the radially outwardly disposed apertures ( 56 of fig2 and 3 ; 96 of fig4 and 5 ). in operation , when the operator decides to cleanse the mower , preferably a short time after finishing the mowing , the washer ring is placed onto the ground . this may be accomplished virtually anywhere , but preferably where the ground is flat and a hose or other water supply conduit is available . referring to the embodiment depicted in fig2 and 3 , the operator grasps knob 48 and pushes or drives stake 46 fully into the ground until the annular flat portion 52 abuts the surface of the ground . at this point valve 42 should be closed . a hose is connected to hose coupler 40 and the water supply is commenced to flow . the operator may then either actuate lever 43 to open the valve 42 to the desired flow and position the running mower over washer ring 24 , or actuate the valve 42 after positioning the mower thereover . although the present washer ring 24 can operate without the mower running , it is more effective if the blade is rotating to help circulate and throw the water or cleansing fluid into the blade chamber . the procedure is reversed in order to cease cleansing the mower . while the foregoing is directed towards the preferred embodiment of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims which follow .
| 8 |
suitable bioactive materials include triclosan , chlorhexidine , iodopropargyl butyl carbamate ( ipbc ), orthophenyl phenol , parachlorometaxylenol ( pcmx ), parachloro ortho benzyl phenol , tertiary amyl phenol , pine oil , mixed phenol disinfectants , mixed phenol and quats . suitable water soluble polymers for forming the polymer - surfactant complex in the matrix of the invention includes pvp , alkylated pvp copolymers , pva - vinyl acetate copolymers , and the like . suitable anionic sulfactants include sulfonic acid derivatives , such as sodium dodecyl sulfate , laureth sulfate , alkyl sulfonate , sarcosinate , alkyl phosphate ester , and the like . the presence of the water soluble pvp polymer in the matrix is essential for forming a polymer - surfactant complex which can dissolve the bioactive material even with low amounts of surfactant present in the composition . both the use of a low level of anionic surfactant and the complexing polymer like pvp provides a substantially irritant - free composition . the amount of sds to solubilize the active in water depends on the active to be solubilized and concentration of the active ingredient . the higher the active ingredient concentration , the higher the amount of sds to be added . for compositions of the polymer - surfactant - complex and hydrophobic bioactive materials the weight ratio of bioactive material to polymer suitably is 1 : 5 to 5 : 0 . 5 , preferably 1 : 0 . 2 to 1 : 2 . the weight ratio of bioactive material to surfactant suitably is 1 : 10 to 2 : 1 , preferably 1 : 3 to 1 : 5 . the use level of bioactive suitably is 10 ppm to 10 %, preferably 100 ppm to 5 %, and most preferably 0 . 05 % to 0 . 2 %. the rest is water . 3 % triclosan was dissolved in water containing , by weight , 3 % polyvinylpyrrolidone ( pvp k - 30 ) and 10 % sodium dodecyl sulfate ( sds ). the aqueous concentrate was diluted at 1 / 10 , 1 / 30 , 1 / 60 , and 1 / 120 to produce optically clear , ready - to - use disinfectant compositions . triclosan in these compositions were in the nano - particle range . compositions with lower than 10 % sds or with 10 % sds in the absence of pvp did not dissolve the triclosan . a use formulation containing , by weight , 3 % triclosan , 3 % pvp k - 30 and 10 . 5 % sds was diluted with water at a weight ratio of 1 / 450 to a final concentration of 66 ppm triclosan , 66 ppm pvp k - 30 and 230 ppm sds . the diluted sample remained clear without any precipitate . while the amount of sds at this dilution is below the cmc of sds itself , it was above the critical aggregation concentration of an insitu formed pvp - sds complex . thus , the disinfectant active triclosan ingredients were maintained soluble in water at this low surfactant content because it was present in the polymer - surfactant complex . 5 . 4 % 2 - phenylphenol was dissolved in water containing , by weight , 2 . 3 % pvp k - 30 and 16 . 6 % sds . the aqueous concentrate was diluted at 3 . 6 / 100 and 1 . 9 / 100 to produce optically clear , ready - to - use disinfectant compositions . 2 - phenylphenol in these compositions was in the nanoparticle range . 4 . 2 % triclosan was dissolved in water containing , by weight , 3 . 2 % pvp k - 30 and 17 % sds . the aqueous concentrate was diluted at 4 . 6 / 100 and 2 . 3 / 100 to produce optically clear , ready - to - use disinfectant compositions . triclosan in these compositions was in the nanoparticle range . 2 % triclosan was dissolved in water containing , by weight , 2 % pvp k - 30 and 7 % sds . the optically clear aqueous concentrate was diluted at 1 / 10 and 1 / 20 to produce optically clear , ready - to - use disinfectant compositions . triclosan in these compositions was in the nanoparticle range . 2 % triclosan was added to water containing , by weight , 2 % pvp k - 30 . triclosan remained undissolved in the aqueous concentrate . 2 % triclosan was added to water containing , by weight , 7 % sds . the sample was heated to 60 ° c . for 3 days . triclosan remained undissolved in the aqueous concentrate . 1 % ferulic acid was dissolved in water containing , by weight , 2 . 8 % pvp k - 30 and 6 . 3 % sds . the aqueous solution was optically clear and in the nanoparticle range . 5 . 4 % pcmx was dissolved in water containing , by weight , 16 . 5 % sds and 2 . 3 % pvp k - 30 . the aqueous concentrate was diluted at 1 / 10 , 1 / 20 , 1 / 40 , 1 / 100 , and 1 / 450 to produce optically clear , ready - to - use disinfectant compositions . pcmx in these compositions was found to be in nanoparticle range . 2 % pcmx was dissolved in water containing , by weight , 6 % sds and 1 % pvp k - 30 . the aqueous concentrate was diluted at 1 / 10 , 1 / 20 to produce optically clear , ready - to - use disinfectant compositions . pcmx in these compositions was found to be in nanoparticle range . the formulation described in example 10 was diluted in di water to contain 1000 ppm of pcmx . antimicrobial activity was demonostrated against pseudomonas aeruginosa ( atcc 10145 ) and bacillus subtilis ( atcc 27328 ). one hundred microliters of an overnight culture of each bacterial cell suspension were inoculated into the diluted sample to a final concentration of about 10 7 cfu / ml . the same bacterial suspension was also added to di water to serve as a control . after 5 minutes incubation time at room temperature , the samples were serially diluted in modified letheen broth and plated onto modified letheen agar . plates were incubated at 32 ° c . for 24 hours and bacterial growth enumerated . log reduction was calculated based on the log difference in bacterial counts between the control sample ( no pcmx ) and pcmx containing sample . the results are presented in the following table . 2 % pcmx was added to water containing , by weight , 2 % pvp k - 30 . pcmx remained undissolved in the aqueous concentrate . 4 . 9 % pcmx was dissolved in water containing , by weight , 13 . 8 % sds and 4 % pvp k - 30 . this clear aqueous concentrate was diluted at 1 / 10 , 1 / 20 to produce optically clear , ready - to - use disinfectant compositions at rt ( 18 ° c .). pcmx in these compositions was found to be in nanoparticle range . 4 . 9 % pcmx was added to water containing , by weight , 14 . 4 % sds . the sample was heated and cooled to rt ( 18 ° c .). pcmx remained undissolved in the aqueous concentrate . while the invention has been described with particular reference to certain embodiments thereof , it will be understood that changes and modifications may be made which are within the skill of the art .
| 0 |
the base plate 4 is disposed in a retained or latched condition between two abutments 5 , 6 , referring to the latching region 10 . when the travelling pad 3 with the base plate 4 is pushed into the guide grooves 1 the base plate 4 slides over the abutment 6 . upon that occurrence , the base plate 4 is elastically deformed . when the travelling pad 3 is worn the base plate 4 is adapted to be lifted over the abutment 6 through an opening indicated by a phantom line at 7 , by means of a tool represented by line 11 ( not shown ), and is to be levered out by way of a further tool ( also not shown ) which is to be inserted as indicated by the arrow 8 . the base plate 4 is disposed in a main plane 9 , and is free of any incisions , in essence it is in the form of a tongueless base plate 4 . referring to fig2 in a departure from fig1 a base plate 14 is provided with a deformation or shaping 15 formed by non - cutting shaping . the main plane 9 and the tongue plane 16 form an angle 17 . that results in frictional contact when the travelling pad 13 is pushed in or out of the tubular body 2 , only between the deformation 15 and the abutment 6 . the shaping zones in the latching region 10 which result in the formation of the tongue 15 are described with reference to fig7 . referring to fig3 and 4 , in the case of a travelling pad 23 — similarly to fig2 and 7 — a base plate 24 with a tongue 25 which is formed therefrom by non - cutting shaping or deformation is provided in the latching region 10 . the base plate 24 extends in terms of surface area with the major part thereof over the travelling pad 23 . an elastomer layer 26 is disposed between a wearable steel body 27 which engages into the guide grooves 1 in a tubular body 22 , which is shown in dash - dotted line . similarly to the abutments 5 , 6 shown in fig1 and 2 , the base plate 24 is also disposed between abutments 28 and 29 . an opening for lifting the tongue 25 out of the tubular body 22 is identified by reference numeral 30 . as shown in fig5 to 7 , a travelling pad 33 which is fixed in a tubular body 32 has a base plate 34 corresponding to that of fig2 and 4 . the base plate 34 has two shaped or deformation zones 36 in the retaining region 10 . those shaped zones 36 provide for the formation of a deformation 35 corresponding to the angle 17 with respect to the main plane 9 , as shown in fig2 . the base plate 34 , which extends between abutments 38 and 39 , is the carrier of the travelling pad 33 and at the same time it serves to form a positively locking connection with the tubular body 32 by engagement into the guide grooves 31 of the tubular body 32 . an opening 40 serves for disengagement of the deformation 35 at the abutment 39 . in the case of a crawler track 50 as shown in fig8 tubular bodies 51 with guide teeth 52 are hingedly connected together by means of rubber - mounted pins 53 which are arranged in the tubular bodies 51 , and connectors 54 which are fixed on the pins 53 . each tubular body 51 has guide grooves 55 and abutments 56 , 57 for fixing a travelling pad 63 . the abutment at the insertion side is denoted by reference numeral 56 and the abutment at the rear side is denoted by reference numeral 57 . as shown in fig9 an intermediate plate 64 with guide bars 65 for the guide grooves 55 and a base plate 74 with a deformations or shaped portion 75 are joined to the travelling pad 63 through vulcanizing . the deformation or shaped portion 75 has rubber disposed therebeneath in the latching region 10 . as shown in fig8 the tongue 75 of the base plate 74 has a double corrugated shape . that is afforded by the three shaped zones 76 and 77 as shown in fig1 . in addition the base plate 74 has an end abutment 78 which corresponds with a rear wall 79 with the abutment 57 of the tubular body 51 . the abutment 56 of the tubular body 51 is provided with a central recess 80 which corresponds to an oppositely disposed recess 81 in of the travelling pad 63 . finally , the base plate 74 has stiffening beads or corrugations 81 which are disposed in the direction of travel 80 of the crawler track 50 , as shown in fig1 .
| 1 |
preferred embodiments of the present invention will be described hereinafter in detail with reference to the accompanying drawings . a communication system according to a first embodiment of the present invention starts a communication by causing a switchboard to transmit information on addresses of switchboard terminals other than a switchboard terminal of the switchboard , and the switchboard terminal that has received the addresses to select a communication partner from among the switchboard terminals at the received addresses , and to pass the address of the selected switchboard terminal to independent general - purpose p2p communication software incorporated in the switchboard terminal . furthermore , while the switchboard terminal is holding a voice communication , a communication starts by passing address information on a voice output destination to the general - purpose communication software . if the switchboard terminal separates from the p2p general - purpose communication software and differs in address , a communication starts by registering information for coupling them with each other in the switchboard and passing the information to the switchboard terminal in response to a request from the switchboard terminal . moreover , if the switchboard terminal is holding a voice conference , a communication starts by passing address information on a voice conference partner to the switchboard terminal . a configuration of the communication system using voice lines ( i . e ., an internal voice line and an external voice line ) and a lan line in an office as shown in fig1 will be described . it is assumed that a communication method realized by the p2p communication software is a video communication . in the office , a voice switchboard 101 ( hereinafter , simply “ switchboard ”) switching voice communication , a voice and video terminal 102 used by a user a and connected to a lan line , a voice and video terminal 103 used by a user b and connected to the lan line , a video terminal 104 used by a user c and connected to the lan line , a voice terminal 107 connected to a voice internal line , a voice terminal 105 used by a user d and connected to the lan line , a video terminal 106 connected to the lan line , a cti ( computer telephony integration ) server 109 connected to the switchboard 101 and realizing cti , and a presence server 110 managing and notifying status information ( presence ) of the terminals 102 to 107 are present . further , the switchboard 101 is connected to a voice communication network 108 via a voice external line . in this way , the switchboard 101 is connected to the voice communication network 108 and the terminals 102 to 107 , and controls connection of voice communications held by the terminals 102 to 107 . the cti server 109 mediates a communication between cti client software mounted in each of the terminals 102 to 106 connected to the lan line and the switchboard 101 . the presence server 110 communicates with the switchboard 101 and the terminals 102 to 106 connected to the lan line , constantly updates and holds the status information ( presences ) of the terminals 102 to 107 , and transmits a notification to each of the terminals 102 to 106 and the switchboard 101 in response to a request . referring now to fig2 , operations performed by respective constituent elements of each of the terminals 102 to 107 will be outlined . a user interface (“ i / f ”) 201 receives input signals from a keyboard , a mouse or the like and outputs video signals to a display . a voice source i / f 202 transmits and receives voice data to and from a voice source 208 connected to the voice source i / f 202 . a voice internal line i / f 203 transmits and receives signals to and from the voice communication line . a lan line i / f 204 transmits and receives signals to and from the lan line . a cpu 205 controls entirety of the terminal . a memory 206 is used as a work area when software or data necessary to control the terminal is used . a terminal software 211 is software stored in the memory 206 and executed by the cpu 205 . a video i / f 209 receives signals input from a video camera 210 connected to the video i / f 209 . referring to fig3 , operations performed by respective constituent elements of the switchboard 101 will be outlined . a voice internal line i / f 301 transmits and receives signals to and from the voice communication line . a lan line i / f 302 transmits and receives signals to and from the lan line . a voice external line i / f 303 transmits and receives signals to and from the voice external line . a cpu 304 controls entirety of the switchboard 101 . a memory 305 is used as a work area when software or data necessary to control the switchboard 101 is used . a database 306 is an area for holding various setting data stored in the memory 305 . fig4 is a schematic diagram showing a module configuration of software 211 stored in the memory 206 in each of the voice and video terminals 102 and 103 . switchboard terminal software 402 and video communication software 408 are application software operating on an os ( operating system ) 401 . the switchboard terminal software 402 is constituted by various software modules . a switchboard i / f 403 controls communication with the switchboard 101 . a voice communication control unit 404 controls voice signal communication by communicating with the voice source i / f 202 , the voice internal line i / f 203 , and the lan line i / f 204 . a cti server i / f 405 controls communication with the cti server 109 by communicating with the lan line i / f 204 . a presence server i / f 406 controls communication with the presence server 110 by communicating with the lan line i / f 204 . user setting data 407 stores therein a user id and a password of the user of the terminal , information on a current communication partner and the like . the video communication software 408 is a general - purpose p2p communication software and has a video communication capability to start communication between the terminals in which the video communication software is mounted , to transmit and receive video data , and to perform a communication end processing in the first embodiment . the video communication software 408 includes a function of receiving address information on a communication partner , i . e ., the other software mounted in the same terminal , and starting a communication with the partner according to the address information . fig5 shows an example of contents of the database 306 stored in the memory 305 of the switchboard 101 . in a “ switchboard user id ” area 501 , id information on each of the users using the switchboard 101 is stored . in a “ switchboard user password ” area 502 , a password corresponding to the user id is stored . in a “ possible communication method : address : port ” area 503 , a possible communication method of the terminal used by each user , an address of the terminal , and a port number used by the communication method in the terminal are stored . if the terminal supports a plurality of communication methods , a plurality of information is stored in the “ possible communication method : address : port ” area 503 . in a “ communication partner user id ” area 504 , a user id or an external line number of a communication partner is stored if the user is holding a communication . in an “ external line ” area 505 , the number of each voice external line connected to the switchboard 101 is stored . in a “ communication partner number ” area 506 , a telephone number of the communication partner on a voice external line having the external line number is stored . fig6 shows an example of contents of the terminal software 211 stored in the memory 206 of each of the voice and video terminals 102 and 103 . in a “ switchboard user id ” area 601 , a switchboard user id of a user using the terminal 102 or 103 is stored . in a “ switchboard user password ” area 602 , a password corresponding to the user id is stored . in a “ possible communication method : address : port ” area 603 , a possible communicate method of the terminal , the address of the terminal , and the port number used by the communication method in the terminal are stored . if the terminal supports a plurality of communication methods , a plurality of information is stored per user id . if the terminal is connected to the voice line , an internal line number is stored in place of the address and the port number . a “ communication partner ” area 604 is an area in which information on the communication partner is stored during a voice or video communication of the terminal . namely , in the “ communication partner ” area 604 , a user id , an address , and a port number of the communication partner are stored . if the communication partner is a terminal that does not include a lan line i / f and that is connected to the voice line or a terminal that is connected to the voice external line , an internal line number or an external line number is stored in the “ communication partner ” area 604 in place of the address , and the port number of the communication partner . in a “ communication destination port initial value ” area 605 , a default destination port used if the communication port of the communication partner is unknown for every communication method is stored . first , an instance in which the user a starts a video communication with the user b while the user a is not on the phone will be described with reference to the flowchart of fig7 . it is assumed herein that only the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 in the terminal software 211 stored in the memory 206 of each of the voice and video terminals 102 and 103 . it is also assumed that the terminal configuration of each of the voice and video terminals 102 and 103 is such that the voice internal line i / f 203 is not present in the configuration of the voice and video terminal shown in fig2 . first , the user a input a user id and a password using the keyboard and display 207 of the voice and video terminal 102 . in response to the input , the cpu 205 and the switchboard terminal software 402 operating in the memory 206 receive information on the user id and the password of the user a via the user i / f 201 and the os 401 , respectively . further , the input user id is stored in the “ switchboard user id ” area 601 and the password is stored in the “ switchboard user password ” area 602 . the user id and the password as well as the information stored in the “ possible communication method : address : port ” area 603 of the voice and video terminal 102 are passed to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan i / f 204 . when receiving the information via the lan line i / f 302 , the switchboard 101 searches the received user id from the areas 501 in the database 306 , and checks whether the password stored in the area 502 corresponding to the hit area 501 is identical with the received password . if the switchboard 101 confirms that the both passwords are identical , the switchboard 101 stores the received information of “ possible communication method : address : port ” in the corresponding area 503 . likewise , the user b registers the voice and video terminal 103 in the switchboard 101 ( step 701 ). the user a performs an operation for calling a video communication partner list using the keyboard and display 207 of the voice and video terminal 102 . in response to the operation , a user list disclosure request is passed from the switchboard terminal software 402 to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan i / f 204 . when receiving the information via the lan line i / f 302 , the switchboard 101 extracts all the information stored in “ switchboard user id ” areas 501 and “ possible communication method : address : port ” areas 503 corresponding to all the users in the database 306 included in the switchboard 101 , and transmits the information to the voice and video terminal 102 . the switchboard i / f 403 of the switchboard terminal software 402 in the voice and video terminal 102 receives the information via the lan line i / f 204 and the os 401 , and the voice and video terminal 102 displays the information on the display 207 via the user i / f 201 ( step 702 ). the user a performs an operation for selecting the video communication partner using the keyboard and display 207 of the voice and video terminal 102 . in response to the operation , the user id of the selected video communication partner is passed from the switchboard terminal software 402 to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the information via the lan line i / f 302 , the switchboard 101 searches the received user id from the “ switchboard user id ” areas 501 in the database 306 of the switchboard 101 , extracts information described in the “ possible communication method : address : port ” area 503 corresponding to the hit record ( area 501 ), and transmits the extracted information to the voice and video terminal 102 . the switchboard i / f 403 of the switchboard terminal software 402 in the voice and video terminal 102 receives the information via the lan line i / f 204 and the os 401 ( step 703 ). the switchboard terminal software 402 checks the received possible communication method , address , and port to confirm whether video communication is present in the area 603 . in the first embodiment , since the address and the port for the video communication are not described in the area 603 , the switchboard terminal software 402 extracts only the address for the voice communication , extracts a video communication port ( port 101 ) described in the “ communication destination port initial value ” area 605 as the port , and passes the address and the port to the video communication software 408 . at the same time , the switchboard terminal software 402 writes contents of the information in the “ communication partner ” area 604 in the user setting data 211 as video communication partner information ( step 704 ). the video communication software 408 starts a video communication by setting the received address and port as the communication destination ( step 705 ). in the first embodiment , it is assumed that only the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 in the terminal software 211 stored in the memory 206 of each of the voice and video terminals 102 and 103 . alternatively , not only the address and the port for the voice communication but also the address and the port for the video communication may be stored in the “ possible communication method : address : port ” area 603 . in this alternative , the user a can confirm whether the communication partner is a video - communicable terminal in advance at the step 703 . moreover , at the step 704 , the switchboard terminal software 402 passes the address and the port for the video communication among the information of the possible communication method , address , and port received from the switchboard 101 to the video communication software 408 . it is thereby possible for the terminal 102 to flexibly set the video communication port . furthermore , in the first embodiment , the p2p communication software has been described while taking that for the video communication as an example . however , as long as the software enables communication only by receiving the address and the port , the software is not limited to the video communication software . by changing the video communication software 408 to arbitrary p2p communication software , the present invention is applicable to various communication methods such as mail communication , instant message communication , file sharing communication , whiteboard sharing communication , and application sharing communication . in the first embodiment , it is necessary for each user to manually select the video communication partner by operating the terminal of the user . however , during a conversation , the communication partner may be automatically selected so as to be able to start a video communication . an instance of automatically selecting the communication partner will be described with reference to the flowchart of fig8 . it is assumed herein that the address and the port for the voice communication and those for the video communication are stored in the “ possible communication method : address : port ” area 603 of each of the voice and video terminals 102 and 103 . a step 801 is the same as the step 701 according to the first embodiment . the voice and video terminal 102 transmits signals to the voice and video terminal 103 using the voice internal line , thereby establishing a voice communication . at this time , the address and the communication method ( voice communication ) of the voice signal destination ( i . e ., the terminal of the voice communication partner ) are stored in the “ communication partner ” area 604 in the user setting data 211 . further , the switchboard software 402 writes the user id of the communication partner in the “ communication partner user id ” area 504 corresponding to each user in the database 306 of the switchboard 101 ( step 802 ). the user a performs an operation for staring a video communication with the current voice communication partner using the keyboard and display 207 of the voice and video terminal 102 . in response to the operation , a current communication partner information request is passed from the switchboard terminal software 402 to the os 401 via the switchboard i / f 403 , and transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the current communication partner information request via the lan line i / f 302 , the switchboard 101 reads information described in the “ communication partner user id ” area 504 corresponding to the user a in the database 306 , and searches the “ switchboard user id ” area 501 corresponding to the user id described in the area 504 . further , the switchboard 101 extracts the possible communication method , address , and port from the “ possible communication method : address : port ” area 503 corresponding to the hit area 501 , and transmits the extracted information to the voice and video terminal 102 . the switchboard i / f 403 of the switchboard terminal software 402 of the voice and video terminal 102 receives the information via the lan line i / f 204 and the os 401 ( step 803 ). the switchboard terminal software 402 checks the received possible communication method , address , and port , and confirms whether the video communication is present in the “ possible communication method : address : port ” area 503 . if the video communication is present , the switchboard terminal software 402 passes the address and the port for the video communication to the video communication software 408 , and at the same time , writes contents of the address and the port for the video communication in the “ communication partner ” area 604 in the user setting data 211 stored in the voice and video terminal 102 as the video communication partner information ( step 804 ). the video communication software 408 starts a video communication while setting the received address and port as the communication destination ( step 805 ). in the second embodiment , the switchboard 101 is inquired about the communication partner information at the step 803 . alternatively , if the communication partner information stored in the terminal 102 is used , there is no need to inquire the switchboard 101 about the communication partner information . in this alternative , the switchboard terminal software 402 reads the information described in the “ communication partner ” area 604 in the user setting data 211 at the step 803 . the switchboard terminal software 402 passes the address and the port described in the area 604 to the video communication software 408 at the step 804 . it is thereby possible to control the video communication without using the switchboard 101 at all . in the preceding first and second embodiments , the voice terminal is identical with the video terminal and the voice and video terminals have the same address . however , the video terminal and the voice and video terminals may be different terminals . an instance in which the video terminal and the voice and video terminals are different will be described with reference to the flowchart of fig9 . it is assumed herein that the address and the port for the video communication are stored in the “ possible communication method : address : port ” area 603 of each of the video terminals 104 and 106 , that the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 of the video terminal 105 , and that the “ possible communication method : address : port ” area 603 of the voice terminal 107 is blank . it is also assumed that the internal line number of the voice terminal 107 is set in the “ possible communication method : address : port ” area 503 corresponding to the user c described in the “ user id area ” 501 of the database 306 of the switchboard 101 , as the address for the voice communication in advance , and that no port is described in the same “ possible communication method : address : port ” area 503 . it is further assumed that the voice terminal 107 is already activated and on standby . moreover , it is assumed that the terminal configuration of each of the video terminals 104 and 106 is such that the voice internal line i / f 203 and the voice source i / f 202 are not present in the configuration of the voice and video terminal shown in fig2 , the terminal configuration of the voice terminal 105 is such that the voice internal line i / f 203 and the video i / f 209 are not present in the configuration of the voice and video terminal shown in fig2 , and that the terminal configuration of the voice terminal 107 is such that the video i / f 209 and the lan line i / f 204 are not present in the configuration of the voice and video terminal shown in fig2 . first , the user c registers the video terminal 104 and the voice terminal 107 in the switchboard 101 , and the user d registers the voice terminal 105 and the video terminal 106 in the switchboard 101 using their respective user ids and passwords , respectively through procedures similar to that of the step 701 in the first embodiment ( step 901 ). the voice terminal 107 transmits signals to the voice terminal 105 using the voice internal line , thereby establishing a voice communication . at this time , the address and the communication method ( voice communication ) of the voice signal destination ( i . e ., the terminal of the voice communication partner ) are stored in the “ communication partner ” area 604 in the user setting data 211 stored in the terminal 107 . further , the switchboard software 402 writes the user id of the communication partner in the “ communication partner user id ” area 504 corresponding to each of the users c and d in the database 306 of the switchboard 101 when establishing the voice communication between them ( step 902 ). the user c performs an operation for staring a video communication with the current voice communication partner using the keyboard and display 207 of the voice and video terminal 104 ( step 903 ). in response to the operation , the switchboard terminal software 402 passes a current communication partner information request to the os 401 via the switchboard i / f 403 , and the current communication partner information request is transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the current communication partner information request via the lan line i / f 302 , the switchboard 101 reads information described in the “ communication partner user id ” area 504 corresponding to the user c in the database 306 , and searches the “ switchboard user id ” area 501 corresponding to the user id described in the area 504 . further , the switchboard 101 extracts the possible communication method , address , and port from the “ possible communication method : address : port ” area 503 corresponding to the hit area 501 , and transmits the extracted information to the video terminal 104 . the switchboard i / f 403 of the switchboard terminal software 402 of the video terminal 104 receives the information via the lan line i / f 204 and the os 401 ( step 904 ). the switchboard terminal software 402 checks the received possible communication method , address , and port , and confirms whether the video communication is present in the “ possible communication method : address : port ” area 503 . if the video communication is present , the switchboard terminal software 402 passes the address and the port for the video communication to the video communication software 408 , and at the same time , writes contents of the address and the port for the video communication in the “ communication partner ” area 604 in the user setting data 211 stored in the video terminal 104 as the video communication partner information ( step 905 ). the video communication software 408 starts a video communication while setting the received address and port as the communication destination ( step 906 ). in the preceding first to third embodiments , the address and the port of the communication partner are passed to the video communication software 408 at the start of the video communication , and the video communication software 408 is entrusted with the subsequent video communication control . due to this , even if the voice communication is finished , the user is forced to manually instruct the video communication software 408 for the video communication . alternatively , the switchboard terminal software 402 may detect end of the voice communication using the cti server i / f 405 , and instruct the video communication software 408 to finish a video communication , thereby automatically finishing the video communication simultaneously with the end of the voice communication . an instance of automatically finishing the video communication simultaneously with the end of the voice communication using the cti server i / f 405 will be described with reference to the flowchart of fig1 . it is assumed herein that the switchboard terminal software 402 of the video terminal 104 is connected to the cti server 109 via the cti server i / f 405 and that the voice terminal 107 is registered as a cti control target . it is also assumed that the cti server 109 acquires a status ( presence ) of the voice terminal 107 by communicating with the voice switchboard 101 and transmits the status information to the cti server i / f 405 of the video terminal 104 . further , it is assumed that all the procedures at the steps 901 to 906 are already carried out . first , a voice communication between the voice terminal 107 of the user c and the voice terminal 105 of the user d is finished ( step 1001 ). the switchboard 101 notifies the cti server 109 of the end of the voice communication between the voice terminals 105 and 107 via the ian line i / f 302 simultaneously with the end of the voice communication . the cti server 109 notifies the cti server i / f 405 of the video terminal 104 that the voice terminal 107 finishes the voice communication ( step 1002 ). the switchboard terminal software 402 of the video terminal 104 reads video communication partner information from the “ communication partner ” area 604 corresponding to the user c in the user setting data 211 , deletes the information from the area 604 , and then passes a video communication end instruction as well as the information to the video communication software 408 ( step 1003 ). the video communication software 408 finishes the video communication for which the received address and port are set as the communication destination ( step 1004 ). in the fourth embodiment , the switchboard terminal software 402 detects the end of the voice communication by using the cti server i / f 405 . alternatively , the switchboard terminal software 402 may detect the end of the voice communication using the presence server i / f 406 , and instruct the video communication software 408 to finish a video communication , thereby automatically finishing the video communication simultaneously with the end of the voice communication . an instance of automatically finishing the video communication simultaneously with the end of the voice communication using the presence server i / f 406 will be described with reference to the flowchart of fig1 . it is assumed herein that the switchboard terminal software 402 of the video terminal 104 is connected to the presence server 110 via the presence server i / f 406 and that the voice terminal 107 is registered as a presence watching target . it is also assumed that the presence server 110 acquires a status ( presence ) of the voice terminal 107 by communicating with the switchboard 101 and transmits the status information to the presence server i / f 406 of the video terminal 104 . further , it is assumed that all the procedures at the steps 901 to 906 are already carried out . first , a voice communication between the voice terminal 107 of the user c and the voice terminal 105 of the user d is finished ( step 1101 ). the switchboard 101 notifies the presence server 110 that the presence of the voice terminal 107 changes from a state of holding a voice communication to a standby state , via the lan line i / f 302 simultaneously with the end of the voice communication . the presence server 110 notifies the presence server i / f 406 of the video terminal 104 that the voice terminal 107 finishes the voice communication ( step 1102 ). the switchboard terminal software 402 of the video terminal 104 regards the information as the end of the voice communication , reads video communication partner information from the “ communication partner ” area 604 corresponding to the user c in the user setting data 211 , deletes the information from the area 604 , and then passes a video communication end instruction as well as the information to the video communication software 408 ( step 1103 ). the video communication software 408 finishes the video communication for which the received address and port are set as the communication destination ( step 1104 ). in the preceding first to fifth embodiments , one - to - one voice or video communication is held . alternatively , a video conference communication may be held by interlocking the voice or video communication with a voice conference by a plurality of terminals . an instance of holding a video conference communication will be described with reference to the flowchart of fig1 . it is assumed herein that the address and the port for the voice communication and the address and the port for the video communication are stored in the “ possible communication method : address : port ” area 603 of the voice and video terminal 102 , that the address and the port for the video communication are stored in the “ possible communication method : address : port ” area 603 of each of the video terminals 104 and 106 , that the address and the port for the voice communication are stored in the “ possible communication method : address : port ” area 603 of the voice terminal 105 , and that the “ possible communication method : address : port ” area 603 of the voice terminal 107 is blank . it is also assumed that the internal line number of the voice terminal 107 is set in the “ possible communication method : address : port ” area 503 corresponding to the user c described in the “ user id area ” 501 of the database 306 of the switchboard 101 , as the address for the voice communication in advance , and that no port is described in the same “ possible communication method : address : port ” area 503 . it is further assumed that the voice terminal 107 is already activated and on standby . further , it is assumed that the video communication software 408 can simultaneously hold video communications with a plurality of communication partners . moreover , it is assumed that the terminal configuration of each of the video terminals 104 and 106 is such that the voice internal line i / f 203 and the voice source i / f 202 are not present in the configuration of the voice and video terminal shown in fig2 , the terminal configuration of the voice terminal 105 is such that the voice internal line i / f 203 and the video i / f 209 are not present in the configuration of the voice and video terminal shown in fig2 , and that the terminal configuration of the voice terminal 107 is such that the video i / f 209 and the lan line i / f 204 are not present in the configuration of the voice and video terminal shown in fig2 . first , the user a registers the voice and video terminal 102 , the user c registers the video terminal 104 and the voice terminal 107 , and the user d registers the voice terminal 105 and the video terminal 106 in the switchboard 101 using their respective user ids and passwords , respectively through procedures similar to that of the step 701 in the first embodiment ( step 1201 ). a conference communication is established among the voice and video terminal 102 , the voice terminal 107 , and the voice terminal 105 . at this time , the addresses and the communication methods ( voice communication ) of the voice signal destinations ( i . e ., the terminals of the voice communication partners ) are stored in the “ communication partner ” area 604 in the user setting data 211 in each of the terminals 102 , 105 , and 107 . further , the switchboard software 402 of each of the terminals 102 , 105 , and 107 writes the user ids of the communication partners in the “ communication partner user id ” area 504 corresponding to each of the users a , c , and d in the database 306 of the switchboard 101 when the conference communication is held among them ( step 1202 ). the user c performs an operation for staring a video communication with the current voice communication partners using the keyboard and display 207 of the voice and video terminal 104 ( step 1203 ). in response to the operation , the switchboard terminal software 402 of the voice and video terminal 104 passes a current communication partner information request to the os 401 via the switchboard i / f 403 , and the current communication partner information request is transmitted to the switchboard 101 via the lan line i / f 204 . when receiving the current communication partner information request via the lan line i / f 302 , the switchboard 101 reads information described in the “ communication partner user id ” area 504 corresponding to the user c in the database 306 , and searches a plurality of “ switchboard user id ” areas 501 corresponding to the user ids described in the areas 504 , respectively . further , the switchboard 101 extracts the possible communication methods , addresses , and ports from the “ possible communication method : address : port ” areas 503 corresponding to the hit plural areas 501 , and transmits all the extracted information as well as the user ids to the video terminal 104 . the switchboard i / f 403 of the switchboard terminal software 402 of the video terminal 104 receives the information via the lan line i / f 204 and the os 401 ( step 1204 ). the switchboard terminal software 402 checks all the received possible communication methods , addresses , and ports , and confirms whether the video communication is present in each of the “ possible communication method : address : port ” areas 503 . if the video communication is present in each of the “ possible communication method : address : port ” areas 503 , the switchboard terminal software 402 displays the user ids of a plurality of video - communicable video communication partner candidates on the display 207 via the user i / f 201 . thereafter , the user c performs an operation for selecting an arbitrary video communication partner from among the displayed user ids using the keyboard and display 207 of the video terminal 104 ( step 1205 ). in response to the selection operation , the switchboard terminal software 402 passes the address and the port of the selected user id for the video communication to the video communication software 408 , and at the same time , writes contents of the address and the port for the video communication in the “ communication partner ” area 604 in the user setting data 604 stored in the video terminal 104 as the video communication partner information ( step 1206 ). the video communication software 408 starts a video communication while setting the received address and port as the communication destination ( step 1207 ). the user c can additionally perform the operation for selecting a video communication partner from among the displayed user ids using the keyboard and display 207 of the video terminal 104 if the user wants to hold a video communication with another user . in this case , the procedures at the steps 1206 to 1208 are repeatedly carried out whenever the selection operation is performed ( step 1208 ). although the exemplary embodiments of the present invention have been described in detail , it should be understood that various changes , substitutions and alternatives can be made therein without departing from the sprit and scope of the invention as defined by the appended claims . further , it is the inventor &# 39 ; s intent to retain all equivalents of the claimed invention even if the claims are amended during prosecution .
| 7 |
in general , the following transformer fault symptoms can be attributed to the failure modes listed thereafter : the three dominant types of winding faults are an open winding , a turn or layer bypass and a winding short circuit . any of these faults can occur in either the primary or secondary windings , but the majority will occur in the primary winding . most such faults are due to corruption of the winding insulation , involving a flashover or dielectric puncture of the insulation , which establishes a fault path through an electric arc . this will generally cause melting of the conductors with resulting displacement of conductor material through globulation and vaporization , interrupting the continuity of the winding and causing an open winding condition which can be readily detected by resistance measurement . occasionally the gap will be bridged by carbon and metallic particles , noticeably increasing the resistance of the winding . detectability will then depend upon the resistance of the bridged path . moreover , in most cases the fault punctures the insulation between winding layers and welds together conductors in the adjacent layers , creating a short circuited winding or , if turns of the shorted layer burn open , a layer bypass . these conditions cannot be reliably detected by resistance measurements alone , since the resulting resistance differs by only a few percent from the nominal value , which has a substantial tolerance . the present invention provides a method and apparatus for analyzing a faulty distribution transformer and ascertaining which failure mode is responsible for the fault . in a preferred embodiment , the analysis covers three parameters : 1 . winding resistance : every transformer winding consists of a finite length of metal conductor which therefore has a measurable dc resistance . measurement is accomplished using a portable multimeter capable of measuring resistances of less than 1 kω . 2 . magnetizing impedance : this consists of two components , the magnetizing reactance and the core losses . magnetizing reactance represents the energy that is periodically stored and recovered with each half cycle of the applied 60 hz voltage in orienting the magnetic domains of the transformer core . the core losses are represented by equivalent resistance model of the power losses due to the rotation of the magnetic domains and eddy current losses in the core . magnetizing impedance is measured by energizing the transformer from one of the windings while the other is disconnected from all load . the impedance is the ratio of the voltage and the current into the energized winding . the reactance and resistance values can be determined by measuring the angular displacement between the current and voltage traces . because it is normally very high , magnetizing impedance is quite sensitive to even relatively minor defects in the transformer such as shorted turns . this measurement is taken from both windings , each while the other is disconnected from all load , to obtain a measure of the impedance balance . 3 . winding ratio : this is the ratio of turns on the primary and secondary windings . the effective ratio will be affected by the loading of the transformer and the presence of shorted turns . thus , a transformer in good condition with no load connected to its secondary terminals should provide an effective winding ratio value which is very close to the nominal design value given by the turns ratio . this ratio is also measured from both windings , to obtain a measure of the winding ratio balance . fig1 illustrates a distribution transformer analyzer embodying the subject invention , connected to a dual - secondary transformer . a test power supply supplies a low voltage signal through current shunts and shunt switches to a supply switch selector , which selects between a dc test voltage ( preferably 6 v ) and one of two ac test voltages ( preferably 2 v for testing the low voltage winding and 80 v for testing the high voltage winding ) produced by an ac converter . the analyzer thus selectively energizes combinations of the primary and secondary windings through the four test leads using the supply select switches , with minimal battery drain because the duration of each test can be less than one second . the test leads for connection to the low voltage bushings are each provided with separate power and measuring wires , to eliminate the effects of conductor resistance , and all leads are appropriately fused . the transformer analyzer in a preferred embodiment incorporates the functions of an ohmmeter , ratiometer and impedance meter , controlled by a microprocessor . the measuring circuitry , illustrated in fig2 includes an analog - to - digital ( a - d ) converter , a scaling circuit , an ac - dc converter , shunts for measuring currents and a switching network . the microprocessor conventionally sets all switches and iteratively adjusts scales to obtain the most accurate reading for any selected test , and the a - d converter output is passed directly to the microprocessor for processing . fig3 schematically illustrates the digital components of the transformer analyzer circuitry . the microprocessor is connected to the output and input multiplexers that allow for data entry and control of the analogue functional blocks . the switch configurations are determined by registers loaded from the output bus . data from the a - d converter is routed through the input bus . the several operator interface input / output devices include a small keypad for scan - list type data entry , requiring no more than 5 keys . for example , the operator could scan through a list of transformer kva sizes using &# 34 ; up &# 34 ; and &# 34 ; down &# 34 ; scan keys , and select the appropriate size using an &# 34 ; enter &# 34 ; key . the preferred data scan - list is as follows : primary voltages : 19 . 92 , 16 , 14 . 4 , 13 . 86 , 12 . 42 , 8 . 32 , 8 , 7 . 2 , 4 . 8 , 2 . 4 kv kva ratings : 167 , 100 , 75 , 50 , 37 . 5 , 25 , 15 , 10 , 5 , 3 kva all programming , scan - lists and pass fail criteria are contained in a single rom chip , which can be easily replaced to upgrade , expand or modify the device . the analyzer may optionally include a non - volatile ram to retain records of tests and test results which , used in conjunction with means for entering transformer system location data and downloading to a larger computer system , could also produce a useful transformer / fuse failure survey instrument . in use , the operator scans through the scan - lists and enters required data from the transformer nameplate . this can be done on the ground or in the service vehicle . the analyzer is then carried up to the transformer and the test leads are clamped to the designated transformer bushings . the operator then simply depresses the &# 34 ; test &# 34 ; button to initiate a test sequence that will acquire and evaluate all test data , over a period of about 20 seconds . the analyzer output will then indicate a fault / no fault condition through a pass / fail light system , with an optional audible alarm in the case of a fault condition , and may identify the type of fault on a small alpha - numeric display such as a 40 character lcd window . initially , the transformer is tested with the secondary load still connected . therefore the analyzer &# 34 ; load &# 34 ; selector is initially set at &# 34 ; connected &# 34 ;. if the analysis indicates no fault , the transformer is simply re - energized . if the analysis indicates a fault , the secondary load is disconnected for replacement of the transformer . at this point a second analysis may be conducted , with the &# 34 ; load &# 34 ; selector set to &# 34 ; not connected &# 34 ;. in this configuration the analyzer can use more refined pass / fail criteria to positively confirm the existence of a fault and identify its type . if this second analysis indicates a no fault condition , contrary to the initial analysis , then service personnel must inspect the secondary conductors or service equipment to detect a fault that may have escaped an initial visual inspection . the method of the present invention will now be described with reference to a transformer having two secondary ( low voltage ) windings , which is typical of distribution transformers currently in use in north america . for the small minority of transformers having only a single secondary winding , only parameters or data preceded by an asterisk (*) are required to perform the analysis . the method of the present invention , in a preferred embodiment , involves calculation of the following transformer parameters : * r sw1 = secondary winding resistance between terminals x 1 and x 2 [ ω ] r sw2 = secondary winding resistance between terminals x 3 and x 2 [ ω ] r sw3 = secondary winding resistance between terminals x 1 and x 3 [ ω ] * n p1 = primary to secondary ( x 1 - x 2 ) ratio [ per unit of nominal ratio ] n p2 = primary to secondary ( x 2 - x 3 ) ratio [ per unit of nominal ratio ] * n ps1 = secondary ( x 1 - x 2 ) to primary ratio [ per unit of nominal ratio ] n ps2 = secondary ( x 2 - x 3 ) to primary ratio [ per unit of nominal ratio ] n s12 = secondary ( x 1 - x 2 ) to secondary ( x 2 - x 3 ) ratio [ per unit ] n s21 = secondary ( x 3 - x 2 ) to secondary ( x 1 - x 2 ) ratio [ per unit ] n s23 = secondary ( x 3 - x 2 ) to secondary ( x 1 - x 3 ) ratio [ per unit ] * k n1 = primary to secondary ( x 1 - x 2 ) ratio balance k n2 = primary to secondary ( x 3 - x 2 ) ratio balance k ns =( x 1 - x 2 ) to ( x 2 - x 3 ) ratio balance * z mp = shunt impedance measured from the primary [ p . u . of base impedance ] * z ms1 = shunt impedance from the ( x 1 - x 2 ) secondary [ p . u . of base impedance ] z ms2 = shunt impedance from the ( x 3 - x 2 ) secondary [ p . u . of base impedance ] * k z1 = impedance balance between the primary and the ( x 1 - x 2 ) secondary k z2 = impedance balance between the primary and the ( x 3 - x 2 ) secondary k zs = impedance balance between the ( x 1 - x 2 ) and the ( x 3 - x 2 ) secondaries the raw data required to be measured in order to calculate these transformer parameters is as follows : v pdc = dc voltage applied to the high voltage winding [ v ] i pdc = dc current flowing as a result of voltage application v pdc [ a ] v 1dc = dc voltage applied to the x 1 - x 2 secondary winding [ v ] v 2dc = dc voltage applied to the x 3 - x 2 secondary winding [ v ] i 1dc = dc current flowing as a result of voltage application v 1dc [ a ] i 2dc = dc current flowing as a result of voltage application v 2dc [ a ] v p = test voltage applied to the high voltage winding [ v ] i p = current flowing into the winding as a result of v p [ a ] v sp1 = voltage between secondary terminals x 1 and x 2 due to v p [ v ] v sp2 = voltage between secondary terminals x 3 and x 2 due to v p [ v ] v s1 = test voltage applied between secondary terminals x 1 and x 2 [ v ] i s1 = current flowing into the winding as a result of v s1 [ a ] v ps1 = voltage across the high voltage winding due to v s1 [ v ] v s2 = test voltage applied between secondary terminals x 3 and x 2 [ v ] i s2 = current flowing into the winding as a result of v s2 [ a ] v ps2 = voltage across the high voltage winding due to v s2 [ v ] fig8 and 9 illustrate relay contact positions for measuring each of these values . v hr = voltage rating of the high voltage winding [ kv ] ( in case of transformers with multiple taps , this is the currently selected tap ) v sr = principal voltage rating of the secondary winding [ v ] ( 120 v for 240 / 120 v secondaries ) v sv = combined voltage rating of all secondary windings [ v ] ( 240 v for 240 / 120 v secondaries , for all other cases v sv = v sr ) based on the input of transformer nameplate data prior to testing , the analyzer calculates the following data : ## equ1 ## resistances are calculated from the raw data using ohm &# 39 ; s law . since resistance varies substantially as between transformers of different manufacturers , and is not provided on the transformer nameplate , a comparison can be made to upper and lower limits as provided in the table of fig6 . determining secondary winding resistance is somewhat more complicated , because resistance must be determined from each leg of the secondary , but the same general approach of determining resistance limits from the specified transformer impedance is followed . the presence of a load on the secondary has no effect on the dc resistance measurements in the primary , but the load resistance will appear in parallel with the secondary winding resistance . however , even in the most extreme cases the load resistance is unlikely to be less than four times the maximum resistance of the secondary winding , which is typically in the range of a fraction of an ohm . since the test instrument might only be capable of measuring resistances above 50 mω , the utility of this measurement is limited to detecting open winding conditions by ascertaining that the total resistance is less than , for example , 25 % of the minimum load resistance . thus , a faulty transformer is identified by the following criterion : if r . sub . sl & lt ; 50 mω then r . sub . sw1 & gt ; 0 . 5z . sub . b / n . sub . 12 or r . sub . sw2 & gt ; 0 . 5 z . sub . b / n . sub . 12 the transformer ratio is defined as the ratio of high voltage winding turns to low voltage winding turns . it is measured with no load on the transformer , by exciting one winding to its rated voltage and measuring the output voltage on the others . in a fault - free transformer , this measurement should be within ± 0 . 5 % of the nameplate data . this requires a voltage measurement accuracy greater than ± 0 . 1 %, which may be difficult to attain in a field instrument . the transformer ratio parameters are determined from the raw data using the following equations : ## equ2 ## based on an assumed instrument accuracy of ± 0 . 25 %, the total transformer ratio error is the allowable ratio error ( 0 . 5 %) plus the instrument error for each voltage measurement ( 2 × 0 . 25 %), or ± 1 %. the maximum allowable ratio balance error is four times the instrument error , or ± 1 %. ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : the presence of a load on the secondary produces a voltage drop on the transformer leakage impedance , which affects the apparent ratio . for a transformer connected to its secondary load : ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balance is : these broad criteria are unlikely to detect many small layer - to - layer faults , and can be narrowed by compensating for transformer and load impedances . to compensate for the effects of transformer and load impedances , the total impedance reflected into the primary terminals of the transformer is computed as follows : ## equ3 ## where : z t = total impedance [%] changes in apparent winding ratio and magnetizing impedance are related , because of the equivalent circuit of a faulty transformer , which is illustrated in fig5 x p = leakage reactance portion assigned to the primary winding [ ω ] x s = leakage reactance portion assigned to the secondary winding [ ω ] x f = leakage reactance portion assigned to the faulted winding section [ ω ] r m = resistance representing excitation losses of the transformer [ ω ] from fig6 it will be evident that the faulted winding will appear as a low impedance branch in parallel with the actual magnetizing impedance of the transformer . thus , the effective magnetizing impedance of the transformer , as measured at the winding terminals , will be lower than for an unfaulted transformer . the effective magnetizing impedance of a faulted transformer is the apparent ratio measured under these conditions is higher than the actual ratio , because of the voltage drop in the transformer leakage impedance caused by the load current . since there is no way of determining from the measured data the extent to which the load is balanced , it is necessary to assume the worst case condition for any given parameter . this compensation can only be applied to ratios measured from the primary . for secondary measurements the following compensating equation is used : ## equ6 ## where : n px = corrected transformer ratio of subscript &# 34 ; x &# 34 ; θ t = measured or assumed angular displacement of i p [ degrees ] this gives rise to the practical problem of determining the values of z l % and k xr , because problems of providing a low impedance shorting connection across the secondary terminals cannot be readily solved in a portable instrument . three options for deriving these parameters are as follows : ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : a ) calculation based on assumed z l % , k xr , and measured θ t the angular displacement of the current into the load through the transformer can be measured directly , but the arrangement will increase significantly the complexity of the measuring system . however , the benefit will be an increased accuracy of the corrected value of the ratio . the errors of this approach have been evaluated for the extremes of all the parameters using correction factors based on the maximum k xr and z l % = 1 . 7 %. the following test criteria have been derived . ( i ) the criterion to detect a faulty transformer by individual secondary winding ratios is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : b ) calculations based on assumed k r , θ t and on nameplate specified z l % most transformers in service today include the leakage impedance in the nameplate data . based on the transformer failure study , the nameplate can be missing or it is illegible in some 20 % of all cases . in the remaining 80 % of transformers , the value could be determined and input to the tester , increasing somewhat the complexity of the test . c ) calculation based on assumed k xr , measured θ t and on nameplate specified z l % this is the most complex and also the most accurate method of determining the ratio of a loaded transformer . the test criteria are as follows . ( i ) the criterion to detect a faulty transformer by individual secondary winding ratio is : ( ii ) the criterion to detect a faulty transformer by the ratio balances is : a particularly useful criterion for ascertaining certain types of faults , such as layer and turn faults when the secondary load is connected to transformer terminals , is the ratio balance . the winding ratios as determined in the primary and secondary windings should balance , i . e . be substantially equal . the ratio balance is essentially the ratio of the winding ratio measured from the primary ( forward ) to the winding ratio measured from the secondary ( reverse ). the ratio balance can be tested under load , and is accordingly quite a useful criterion for transformer analysis . ( i ) the criterion to detect a faulty transformer by the magnetizing impedance is : ( ii ) the criterion to detect a faulty transformer by the impedance balance is : an impedance test on an unloaded transformer will detect all fault conditions except layer bypass or special open winding conditions . as established through failure survey measurements , in a properly working transformer the minimum impedance limit is 25 p . u . of z b ( 4 % magnetizing current ) and the maximum is 200 p . u . of z b ( 0 . 5 % magnetizing current ). ( i ) the criterion to detect a faulty transformer by the magnetizing impedance is : ( ii ) the criterion to detect a faulty transformer by the impedance balance is : when the secondary load is still connected , the measured impedances include the load impedance . thus , impedance values can be as low as 0 . 25 p . u . of z b ( base impedance of the transformer ) even in a good transformer , due to cold load pickup . the test is still useful since many faulty transformers exhibit impedance values well below this level . however , because of the uncertain disposition of the load , the impedance balances are unlikely to provide a useful indication of the transformers condition . ( i ) the criterion to detect a faulty transformer by impedance measurement in the presence of a load is : as in the case of the ratio balance , the impedance balance can be a very useful criterion for determining certain types of fault conditions such as layer and turn faults , with no load connected to the transformer . the impedance balance is calculated in both the forward and reverse directions , i . e . from the perspective of the primary winding and then the secondary winding , and the ratio of these two calculations , the impedance balance , should be approximately one . a different result indicates a fault condition . determination of the above criteria and comparison with known values for a fault - free transformer , examples of which are given in fig6 and 7 , will provide a transformer profile which will indicate the fault conditions listed above in most cases of faulty transformers . combining the comparisons in the three parameters winding resistance , magnetizing impedance and winding ratio increases the accuracy of the analysis to the extent that results will often be corroborative . the winding ratio balance and the impedance balance each provide a high degree of accuracy in fault analysis , and are useful even apart from other results in determining the presence of a fault ; it is nevertheless expected that in most cases a comparative study of all parameters will help to determine the specific fault in any given case . the invention having thus been described by way of a preferred embodiment , it will be obvious to those skilled in the art that certain modifications and adaptations may be made without departing from the scope of the invention as set out in the appended claims .
| 6 |
reference is now had to fig2 through 5 illustrating a preferred embodiment of the present invention . the fluid jet loom embodying the present invention is different from the conventional device as to the structure of the weft yarn cutter 10 which is substituted for the cutter 5 , but is otherwise the same as the aforementioned conventional device . therefore , the same parts or components are designated by the same reference numerals . a fixed blade 11 placed towards the selvedge is fitted to a fixed support shaft 12 on a machine frame , not shown , and is secured at the rear end to a fixed shaft 11a projecting away from the selvedge so as to be unrotatable relative to the machine frame . a movable blade 13 is carried for free rotation by said support shaft 12 and has an arm 13a extending obliquely down in the opposite direction to the cutting edge and carrying a drive pin 14 . an l - shaped lever 16 is mounted by a shaft 15 for rotation relative to the loom frame and has one end connected through said drive pin 14 to said movable blade 13 . the lever 16 is biased by a tension spring 17 for rotation counterclockwise in fig2 . a cam follower 20 is mounted for rotation about its own axis towards the distal end of the lever 16 and contacts by a rolling motion with a cam 19 secured to a rotary shaft 18 . a weft yarn guide 23 formed by a cylindrical boss 21 and a triangular guide plate 22 is fitted on the support shaft 12 externally of the rotary blade 13 . a guide groove 22a is formed on the upper edge of the guide plate 22 while a tapped hole 21a is formed in the boss 21 . the weft yarn guide 23 is secured to the support shaft 12 by a presser screw 24 threaded to said tapped hole so that the guide groove 22a is positioned slightly above the edge end of the fixed blade 11 , as seen in fig2 . a weft yarn deflector 25 is mounted to the support shaft 12 externally of the weft yarn guide 23 and for rotation about said support shaft . a weft yarn deflecting portion 25a is provided to the foremost part of the weft yarn deflector 25 for extending forwardly of the guide groove 22a of the guide plate 22 . the weft yarn deflector 25 has its upper end formed with an engaging hole 25b for engagement by a boss 27a at the foremost part of a movable iron core 27 of a solenoid 26 mounted for rotation relative to the loom frame . this solenoid 26 comes into operation when a trouble caused in inserting the weft yarn has been detected by the weft yarn sensor 8 ( fig1 ). the weft yarn cutter 10 thus far described operates as follows . in the weft yarn cutter 10 , the solenoid 26 is normally inoperative and the weft yarn deflector 25 is positioned so that the upper edge of the weft yarn deflective portion 25a is at a lower level than the guide groove 22a of the guide plate 22 of the weft yarn guide 23 . when the loom is driven into operation in this state and the weft yarn is laid down in the open warp shed , the weft yarn end towards the weft yarn inserting nozzle 3 ( fig1 ) is introduced into the guide groove 22a of the weft yarn guide 23 . as the cam 19 is rotated clockwise in fig2 along with the rotary shaft 18 with progress in the loom operation , the lever 16 is kept in the fixed position as long as the lesser diameter portion of the cam 19 contacts the cam follower 29 . when the contact portion has passed the lesser diameter portion , the lever 16 is turned clockwise against the force of the tensile spring 17 . when the lever 16 has turned from the solid - line position to the double - dotted chain line position in fig2 the rotary blade 13 is also rotated counterclockwise from the solid - line position to the double - dotted chain line position in fig2 for cutting the weft yarn disposed in the guide groove 22a . with continued rotation of the cam 19 , the lever 16 is turned counterclockwise under the force of the tensile spring 17 and returned to the starting position , the rotary blade 13 being similarly returned to the starting position . rotation of the cam 19 is synchronized to the swinging movement of the sley 1 so that the rotary blade 13 is rotated in the weft yarn cutting direction as soon as the reed beats up the preceding weft yarn . thus , in normal loom operation , the weft yarn is cut for each weft inserting operation as soon as the reed beats up the preceding weft yarn . when a trouble in the weft inserting operation is sensed by the sensor 8 during loom operation , the solenoid 26 is energized via the control circuit 41 and the movable iron core 27 is retracted into the solenoid 26 against the force of a spring ( not shown ) enclosed in the solenoid 26 . the weft yarn deflector 25 is rotated to a position shown in fig4 wherein the upper edge of the deflective portion 25a is at the same level as the upper edge of the guide plate 22 . in this state , the end of the weft yarn being inserted is not introduced into the guide groove 22a of the weft yarn guide 23 when the sley 1 is swung towards the cloth fell , but rides on the upper edge of the deflective portion 25a . thus , when the sley 1 is turned in a direction away from the cloth fell after beating , the weft yarn end slides on the upper edge of the weft yarn deflective portion 25a and is not engaged at the cutting point , that is , the guide groove 22a , so that the weft yarn is not cut in spite of rotation of the rotary blade 13 . in this manner , in the fluid jet loom provided with the weft yarn cutter 10 , the weft yarn deflector 25 is energized through solenoid 26 via a control circuit 41 immediately after the weft yarn sensor 8 has sensed the trouble in weft yarn insertion during loop operation for disabling the weft yarn cutting function of the weft yarn cutter 10 . the weft yarn inserted after beating the defective weft yarn length y 1 and until the loom is halted by operation of the loom stop mechanism 42 takes the form of a letter u with one end y 2 contiguous to the defective weft yarn y 1 , as shown in fig5 . hence the defective weft yarn y 1 may be extracted by pulling the weft yarn y 2 layed down in the form of the letter u , while the loom is operated slowly in reverse by manual operation or by actuation of a push button associated with inching . in this manner , the complicated operation of removing the defective weft yarn as required in the conventional practice may be dispensed with . extraction of the weft yarn may also be effected through suction by using an air suction gun or the conventional vacuum sucker 40 . for disabling the weft yarn cutting function of the weft yarn cutter 10 , the weft yarn may be deflected away from the weft yarn guide 23 by direct operation from the solenoid and hence the yarn deflector 25 may be dispensed with . alternatively , the rotary blade 13 may be designed to rotate in the direction of the support shaft 12 or the rotation of the rotary blade 13 may be disabled when the defect has been sensed in the insertion of the weft yarn . in the above preferred embodiment , the succeeding uncut weft yarn portion y 2 which is inserted into the shed contiguous to the sensed defective weft yarn y 1 is not gripped , so that the loom operation is stopped , via the loom stop mechanism 42 which is also actuated by the control circuit 41 , with the uncut weft yarn y 2 inserted in the shed in the u shape by the weft insertion nozzle , as illustrated in fig5 . however , the loom operation may be stopped while inhibiting the insertion of the uncut weft yarn contiguous to the defective weft yarn . in this case , there is no weft yarn supplied in the u - shape from the weft insertion nozzle , so that the amount of the weft yarn to be extracted with the defective weft yarn may be reduced and the operation of extracting the defective weft yarn may be facilitated . insertion of the uncut weft yarn may be inhibited by providing a conventional vacuum sucker 40 between the weft insertion nozzle 3 and the shed so that the sucker 40 is energized , via the control circuit 41 as illustrated in fig5 upon detection of trouble in the weft insertion for sucking the weft yarn . vacuum sucker 40 may also be used to remove the defective yarn length y 1 , by drawing in the yarn length y 2 to which the length y 1 is attached . alternatively , the weft yarn may be gripped by a gripper 37 ( fig1 ) between a length measuring device 33 and the nozzle 3 or the operation of the device 33 may be stopped for inhibiting the operation of weft yarn insertion . it is seen from the foregoing description of the preferred embodiment that the weft yarn cutting function of the weft yarn cutter adjacent to the weft insertion nozzle may be disabled temporarily upon trouble detection in the weft yarn insertion and subsequently the loom operation may be stopped while the weft yarn portion to be inserted next time is still uncut and contiguous to the defective yarn for promoting convenience in extracting the defective weft yarn , preferably by using the vacuum sucker 40 . thus the complicated manual operation of pulling out several points of the defective weft yarn into the warp shed by using a tapered needle as required in the conventional device may be dispensed with and the defective yarn may be removed by simply pulling the readily accessible uncut weft yarn portion contiguous to the defective yarn .
| 3 |
there are several ways of improving alignment between a fiber optic bundle and an awg . in some cases , quick coarse alignment is followed up with finely aligning the fiber optic bundle and awg afterwards . fig4 shows a first embodiment for aligning a fiber optic bundle to an awg . in this embodiment , the awg 142 is mounted to a base 110 . the fiber optic bundle &# 39 ; s termination head 140 is also mounted to the base 110 via a high viscosity epoxy 120 . in one embodiment , a spacer 122 attached to the base 110 may be used to reduce the thickness of epoxy 120 employed . typical epoxies such as that used in prior art fig3 shrink when cured . this post - bond shrinkage is not a problem in the prior art fig3 since it pulls the termination head 40 closer to the awg 42 . however , if the epoxy of fig4 shrinks , alignment of the fiber optic bundle with the awg will suffer , as the termination block 140 is pulled toward the base 110 . an epoxy having a silicate content of over 70 % by volume has been found to reduce shrinkage . additionally , the high silicate content makes the epoxy very viscous allowing for manual alignment being maintained after being achieved . thus , alignment of the termination head 140 and the awg 142 can be achieved without significant post - bond shrinkage as the epoxy is cured by heat or other methods . raising the silicate content of the epoxy to up to 90 % by volume reduces the post - bond shrinkage even more . however , as the silicate content is increased , the shear strength of the bond is reduced , so a balancing between post - bond shrinkage and shear strength should be performed . the alignment method using the high viscosity epoxy described provides a robust bond area for achieving and maintaining alignment between the fiber optic bundle and the awg . additionally , a gel having a refractive index matching the optical fibers and the awg channels may be dispensed between the fiber optic bundle and the awg . this helps to prevent light from scattering at an air gap between the fiber optic bundle and the awg . fig5 a shows a second embodiment for aligning a fiber optic bundle with an awg using pins ( or dowels / rods ). in one embodiment , the termination head is made with optical fibers filling all of the grooves except for a groove at each end . the ends of the optical fibers are then polished , as usual . pins 200 can then be inserted into the open grooves in the termination block of the fiber optic bundle . fig5 b shows an awg corresponding to the fiber optic bundle of fig5 a . the awg has recesses 202 . in one embodiment , the awg recesses are initially filled with materials different from the rest of the awg . this allows selective etching to form the recesses 202 . however , other methods of making the recesses are possible . the pins 200 of the fiber optic bundle fit snugly into the recesses 202 of the awg to provide coarse alignment . additional manual adjustment to more finely align the fiber optic bundle to the awg may be performed . fig6 shows a cross section of a fiber optic block and an awg joined with pins 200 to perform a coarse alignment . a gel can be dispensed between the fiber optic bundle and the awg to provide better photonic coupling , and an epoxy is used to permanently fix the alignment . fig7 shows a third embodiment for aligning optical fibers to an awg . in this embodiment only one retainer 300 is used in the termination block of the fiber optic bundle , and the optical fibers are attached into the one retainer 300 . v - grooves are etched into the awg &# 39 ; s substrate in the same way that the retainer was etched , however the v - grooves on the awg extend only a predetermined distance across the awg from an edge of the awg . the one retainer 300 is placed over the v - grooves on the awg 320 to sandwich the optical fibers between the retainer 300 and the awg 320 . the optical fibers come to rest within the v - grooves of the awg 320 . the ends of the optical fibers 322 are butted up against the ends of the awg &# 39 ; s v - grooves 324 . the interlocking compatibility between the retainer 300 and the v - grooves of the awg 320 provide for quick coarse alignment of the optical fibers with the channels 350 of the awg . manual adjustment may then be performed to more finely align the optical fibers with the awg . fig8 shows a side view of the retainer 300 placed over the etched awg 320 having channels 350 within . fig9 shows another embodiment in which the awg 325 is etched a predetermined depth below the awg surface before etching the v - grooves . this allows a better coupling to channels 355 that are deeper below the awg surface . in one embodiment , over - etching the awg provides for a better ability to manually align the optical fibers and the awg afterwards . as previously described , gel or epoxy having a refractive index matching the optical fibers and the channels of the awg can be dispensed between the retainer and awg . thus , a device and method of aligning optical fibers in a fiber optic bundle to a waveguide is disclosed . however , the specific embodiments and methods described herein are merely illustrative . numerous modifications in form and detail may be made without departing from the scope of the invention as claimed below . rather , the invention is limited only by the scope of the appended claims .
| 6 |
preferred embodiments of the invention will now be described . in drawings referred to below , like reference numerals used in the conventional technique ( shown in fig9 through 13 ) are used to refer to elements having like functions so as to omit the description . a contactless ic card according to embodiment 1 of the invention will now be described with reference to fig1 . the contactless ic card of this embodiment is different from the conventional ic card ( shown in fig9 ) in including a shunt regulator 10 having a frequency characteristic against the power vdd . the shunt regulator 10 includes , as shown in fig2 a low - pass filter ( lpf ) 11 and an nmos transistor m 1 . the lpf 11 allows merely a low frequency component of the power vdd to pass therethrough . a signal having passed through the lpf 11 is supplied to the gate of the transistor m 1 . the drain and the source of the transistor m 1 are respectively connected to the power vdd and the ground vss . as shown in fig2 the lpf 11 is herein composed of resistors r 1 and r 2 and a capacitor c 1 . when it is assumed , for example , that the resistors r 1 and r 2 respectively have resistance of 100 kω and 400 kω and the capacitor c 1 has capacitance of 50 pf , the cutoff frequency of the lpf 11 is approximately 30 khz . at this point , the power consumption of the shunt regulator 10 is , as shown in fig3 large in a low frequency region ( of 30 khz or less ) of the power vdd and is small in a high frequency region including a signal band of an rx signal ( of 100 khz through several mhz ). this means that even when the power consumption of the shunt regulator 10 is increased to suppress the increase of the power vdd , the rx signal is not affected . therefore , degradation of communication quality derived from device variation and temperature change can be suppressed , so as to realize a high performance contactless ic card . it is noted that the modulator circuit 8 , the rectifier 3 , the shunt regulator 10 , the rx signal frequency , the transfer rate , the carrier frequency and the modulation method employed in this embodiment are described merely as specific examples , which do not limit the invention . for example , although a full - wave rectifying circuit is used as the rectifier 3 , any circuit capable of rectifying an ac signal may be used instead . furthermore , although the modulator 8 is connected in parallel to the antenna coil , it may be connected between the power vdd and the ground vss . also , any modulator capable of modulating impedance between the ends of the antenna coil may be used . in a system where there is no need to send a signal , the modulator 8 is not necessary . moreover , although the shunt regulator 10 includes the mos transistor m 1 , a bipolar transistor may be included instead . also , the modulation method may be any of the ask modulation , psk modulation and fsk modulation . in short , the present invention covers all contactless ic cards each including a shunt regulator whose power consumption is large in a low frequency region of the power vdd and is small in a signal band of an rx signal . a contactless ic card according to embodiment 2 of the invention will now be described with reference to fig4 . the contactless ic card of fig4 includes a shunt regulator 40 instead of the shunt regulator 10 of fig1 . the structure apart from the shunt regulator 40 is the same as that of the contactless ic card of fig1 . the contactless ic card of this embodiment is different from that of embodiment 1 in the shunt regulator 40 further consuming power in a high frequency region of the power vdd . the shunt regulator 40 includes , in addition to the elements of the shunt regulator 10 of fig1 ( namely , the lpf 11 and the nmos transistor m 1 ), a lpf 41 and a pmos transistor m 2 . the lpf 41 allows merely a low frequency component of the power vdd to pass therethrough . a signal having passed through the lpf 41 is supplied to the gate of the transistor m 2 . the source and the drain of the transistor m 2 are respectively connected to the power vdd and the ground vss . as shown in fig5 the lpf 41 is herein composed of resistors r 3 and r 4 and a capacitor c 2 . when it is assumed , for example , that the resistors r 3 and r 4 respectively have resistance of 10 kω and 40 kω and the capacitor c 2 has capacitance of 5 pf , the cutoff frequency of the lpf 41 is approximately 3 mz . therefore , the power consumption of the shunt regulator 40 is , as shown in fig6 large in a low frequency region ( of 30 khz or less ) and a high frequency region ( of 3 mhz or more ) of the power vdd and is small in a signal band of an rx signal ( of 100 khz through 3 mhz ). thus , the power vdd can be prevented from increasing and noise caused in a carrier signal and another frequency can be reduced . herein , the noise caused in another frequency means noise generated in the memory , the cpu or the like of the digital signal processor 7 . in this manner , the degradation of the communication quality derived from process variation and temperature change can be reduced , so as to realize a high performance contactless ic card . the shunt regulator 40 used in this embodiment is described merely as a specific example , which does not limit the invention . for example , the shunt regulator 40 may be replaced with a shunt regulator 70 shown in fig7 . the shunt regulator 70 of fig7 uses a band rejection filter ( brf ) 71 instead of the lpf 11 of the shunt regulator 10 of fig1 and 2 . also in such a case , the shunt regulator has a frequency characteristic as shown in fig6 so that a signal component in a carrier wave band can be filtered off . in short , the present invention covers all contactless ic cards each including a shunt regulator whose power consumption is large in low and high frequency regions of the power vdd . furthermore , the power consumption in the rx signal band and that in the high frequency region may be at the same level . in this case , the power consumption in the high frequency region is lowered , so as to reduce the degradation of the signal quality in the rx signal band . thus , the present invention is very useful for realizing a high performance contactless ic card . a contactless ic card according to embodiment 3 of the invention will now be described with reference to fig8 . the contactless ic card of this embodiment is different from those of embodiments 1 and 2 in including an rx demodulator 80 and a signal processor 90 in the semiconductor integrated circuit 2 . the rx demodulator 80 includes a rectifier 3 , a shunt regulator 81 , a charging capacitor ca and a demodulator 6 . the signal processor 90 includes a rectifier 30 , a charging capacitor cb , a shunt regulator 91 and a digital signal processor 7 . the inputs of the rectifier 3 and the rectifier 30 are connected to an antenna coil l 1 . a signal having been rectified by the rectifier 3 is supplied to the charging capacitor ca and the shunt regulator 81 , so as to generate power vdd 1 . the demodulator 6 extracts an rx signal from the power vdd 1 . a signal having been rectified by the rectifier 30 is supplied to the charging capacitor cb and the shunt regulator 91 , so as to generate power vdd 2 for the digital signal processor 7 . the digital signal processor 7 processes the rx signal extracted by the demodulator 6 . as the shunt regulator 81 of this embodiment , the shunt regulator used in any of embodiments 1 and 2 is used . as a result , a contactless ic card free from the degradation of the communication quality can be realized in the same manner as in embodiments 1 and 2 . furthermore , since the signal processor 90 and the rx demodulator 80 are separated from each other , the influence of digital noise generated in the digital signal processor 7 on the demodulator 6 can be further reduced . in this manner , the present invention is very useful for realizing a high performance contactless ic card .
| 6 |
the present invention is related to processes for preparing imatinib , intermediates thereof , and pharmaceutical acceptable salts thereof . these processes of the present invention provide imatinib in high yields and purity . also , these processes can be adapted easily to industrial scale because , when using pyridine as a solvent , it is present in small amounts , and the recovery of a substantially pure product is simple and not time consuming . wherein x is cl , br , i , mesyloxy or tosyloxy , preferably x is cl ; n is 0 , 1 or 2 , preferably n = 0 ; hx is an acid selected form the group consisting of : hcl , hbr , hi , methanesulfonic acid , and para - toluenesulofinic acid , preferably hx is hcl ; r 1 is a leaving group selected from the group consisting of : h , cl , and br ; and r is either h or a hydrocarbon group , preferably , h . preferably , the hydrocarbon group is an alkyl or aryl group . preferably , the alkyl group is optionally , substituted by a hetero atom . more preferably , the alkyl group is a c 3 - 8 cyclo - alkyl , a c 4 - 8 cyclo alkenyl , or a c 3 - 8 alkoxy . preferably , the aryl group is phenyl . the first step in these processes comprises preparing a 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii . b ) optionally recovering 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii ; wherein x is a leaving group selected from the group consisting of cl , br , i , mesyl or tosyl , preferably x is cl , n is 0 , and hx is an acid selected form the group consisting of : hcl , hbr , hi , methanesulfonic acid , and para - toluenesulofinic acid , preferably hx is hcl . the amount of n - methylpiperazine in the reaction of step a ) is about 3 to about 6 , preferably about 4 to about 5 equivalents of the amount of the benzoic acid derivative with which it is reacted . in the above process of the present invention , the reaction is done in the presence of an organic solvent . preferably , the organic solvent is a protic organic solvent , more preferably , an alcohol , even more preferably , a c 1 - 6 alcohol , more preferably , methanol , ethanol , n - propanol , iso - propanol , n - butanol , iso - butanol , sec - butanol , n - pentanol , iso - pentanol , sec - pentanol , n - hexanol , and mixtures thereof , most preferably , n - butanol . combining the two reactants and the solvent provides a solution . the solution is maintained at a temperature of about 15 ° c . to about 30 ° c ., preferably of about 20 ° c . to about 25 ° c . preferably , the solution is maintained for about 2 to about 10 hours , more preferably for about 3 to about 6 hours ; during this time 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii is expected to be formed . the compound of formula ii may be recovered by any known process , preferably by evaporating the solvent from the above mixture ; adding a protic organic solvent to obtain a second mixture ; heating the second mixture at a temperature of about 70 ° c . to about 90 ° c ., preferably of about 70 ° c . to about 82 ° c ., more preferably , to a temperature of about 80 ° c . to about 82 ° c . ; cooling the heated second mixture to obtain a precipitate , and filtering the precipitate . preferably , the organic solvent is a protic organic solvent , more preferably , an alcohol , even more preferably , a c 1 - 6 alcohol , most preferably , methanol , ethanol , n - propanol , iso - propanol , n - butanol , iso - butanol , sec - butanol , n - pentanol , iso - pentanol , sec - pentanol , n - hexanol , and mixtures thereof , and even most preferably , iso - propanol . preferably , the heated second mixture is cooled to a temperature of about 15 ° c . to about 30 ° c ., more preferably of about 20 ° c . to about 25 ° c ., to obtain a precipitate . the recovery may further comprise washing the filtered precipitate , and drying . the process for preparing 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii may further comprise the conversion of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid of formula ii to an imatinib salt of the following formula ; wherein hb is an acid , preferably , methanesulfonic acid . the use of the compound of formula ii instead of its acid salt form improves the performance of the process for preparing imatinib or salt thereof due to its solubility in the reaction medium . the conversion of the compound of formula ii to imatinib salt can be carried out for example , by the process disclosed in european patent 208404 , preparation p . this process includes a step where a hydrochloride salt of the acid of formula ii is converted to the activated acid derivative 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv or salt thereof of the following formula , where x and r 1 are described before and the compound of formula is isolated . in a preferred embodiment , the reaction for preparing imatinib from the 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv or salt thereof comprises and about 2 to about 10 volumes ( 7 to 35 equivalents ) preferably about 4 to about 7 volumes , more preferably about 5 to about 6 volumes per gram of pyridine per gram of the compound of formula iii ; and wherein n is 0 , 1 , or 2 ; r 1 is a leaving group selected from the group consisting of : h , cl , br , mesyl and tosyl , preferably , r 1 is cl ; r is either h or a hydrocarbon group , preferably , h , and ha is an acid selected form the group consisting of : hcl , hbr , hi , methanesulfonic acid , para - toluenesulofinic acid , preferably , the acid is hcl . the reaction is done in the presence of a minimum amount of pyridine , which is about 2 to about 10 volumes ( 7 to 35 equivalents ) preferably about 4 to about 7 volumes , more preferably about 5 to about 6 volumes per gram , which may serve as a solvent and as a base . the amine of formula iii is combined with pyridine to obtain a solution . to this solution a 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv is then added . this addition may be done at low temperatures to avoid the formation of impurities . preferably , the addition is done at a temperature of about 0 ° c . to about 25 ° c ., more preferably of about 15 ° c . to about 25 ° c . the addition provides a reaction mixture . preferably , the reaction mixture is maintained at a temperature of about 10 ° c . to about 30 ° c ., more preferably of about 15 ° c . to about 25 ° c . preferably , the reaction mixture is maintained for about 30 minutes to about 4 hours , more preferably for about 1 hour ; during this time the formation of imatinib salt of having the following formula , occurs ; wherein r 1 is derived from the compound of formula iv , preferably , cl . imatinib is recovered from the said mixture by a process comprising : admixing water with the reaction mixture comprising the imatinib salt , and reacting with a base . preferably , an aqueous solution of the base is used . preferably , the base is selected from the group consisting of ammonium hydroxide , sodium hydroxide , and potassium hydroxide , preferably ammonium . preferably , before the addition of the base heating to a temperature of about 30 ° c . to about 50 ° c ., more preferably of about 40 ° c ., is conducted . heating may be carried out to obtain a solution . the addition of the base provides imatinib , which precipitates by the addition of an additional amount of water . preferably , after adding the second amount of water , the mixture is maintained at 15 ° c . to about 25 ° c ., to increase the yield of the precipitated imatinib . in addition , to increase the yield even more , the mixture is maintained for an overnight period , preferably the overnight period is about 12 hours to about 16 hours the recovery process of imatinib may further comprise filtering off the precipitated imatinib , washing and drying . the starting material , 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative , can be the free base when n is 0 , or the corresponding salt derivative when n is either 1 or 2 . accordingly , when n when n is 2 , and x is cl , the compound of formula iv corresponds 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl dihydrochloride of the following formula . r 1 in the compound of formula iv is a leaving group as defined above , preferably r 1 is cl . accordingly , when n is 0 and r 1 is cl , the compound of formula iv corresponds to 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl chloride of the following formula . when n is 2 , and r 1 is cl , the compound of formula iv corresponds to 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl chloride dihydrochloride of the following formula . the free base , 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl derivative of formula iv , may be obtained according to the process described before in the present application or by any process known to one skilled in the art . the salt is , usually , a hydrochloride salt , preferably , dihydrochloride . the dihydrochloride salt can be obtained from a commercial source . the process for preparing imatinib can further comprise the conversion of imatinib to imatinib salt . preferably , the salt is a mesylate salt . the conversion of imatinib to imatinib salt can be done by reacting imatinib with an acid , as exemplified in u . s . application ser . no . 11 / 796 , 573 , filed apr . 27 , 2007 . the conversion can be carried out for example by combining imatinib base with a mixture of a c 1 - c 4 alcohol , preferably ethanol , and water . the temperature can be lowered to below room temperature , such as about − 10 ° c .- 0 ° c . a source of meso 3 h , such as a solution of meso 3 h in a c 1 - c 4 alcohol is then added . the reaction mixture can be seeded . the reaction mixture can then be maintained to increase the yield of the mesylate . the mesylate can be recovered by evaporating solvents from the reaction mixture to obtain a residue . having described the invention with reference to certain preferred embodiments , other embodiments will become apparent to one skilled in the art from consideration of the specification . the disclosures of the references referred to in this patent application are incorporated herein by reference . the invention is further defined by reference to the following examples describing in detail the process and compositions of the invention . it will be apparent to those skilled in the art that many modifications , both to materials and methods , may be practiced without departing from the scope of the invention . to a solution of n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 80 g ) in pyridine ( 400 g ) at 0 ° c ., 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoyl chloride dihydrochloride ( 1 . 1 eq ) is added . the reaction is kept under stirring at 15 - 20 ° c . for 1 h , then water ( 400 ml ) is added . the mixture is heated up to 40 ° c ., then 26 % nh 4 oh ( 200 g ) and water ( 900 g ) are added . the reaction mixture is kept under stirring at room temperature overnight . the solid is filtered off , washed with water and dried at 75 ° c . under vacuum for 3 - 4 h . imatinib is obtained as a yellowish powder ( 135 g , 95 % yield , & gt ; 98 % purity ). to a suspension of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid ( 84 g ) in pyridine ( 400 g ) at 0 ° c ., socl 2 ( 44 . 8 g , 1 . 05 eq ) is added and the mixture is kept under stirring at 30 - 50 ° c . for 1 - 2 h . after cooling at 0 ° c ., n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 80 g ) is added . the reaction is kept under stirring at 15 - 20 ° c . for 1 h , then water ( 400 ml ) is added . the mixture is heated up to 40 ° c ., then 26 % nh 4 oh ( 200 g ) and water ( 900 ml ) are added . the reaction mixture is kept under stirring at room temperature overnight . the solid is filtered off , washed with water and dried at 75 ° c . under vacuum overnight . imatinib is obtained as a yellowish powder ( 125 g , 88 % yield , & gt ; 98 % purity ). to a suspension of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid dihydrochloride ( 30 g ) in pyridine ( 100 g ) at 20 ° c ., socl 2 ( 11 . 5 g , 1 . 05 eq ) is added and the mixture is kept under stirring at 45 - 50 ° c . for 1 - 2 h . after cooling at 0 ° c ., n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 20 g ) is added . the reaction is kept under stirring at 15 - 25 ° c . for 1 h , then water ( 100 ml ) is added . the mixture is heated up to 40 ° c ., then 26 % nh 4 oh ( 50 g ) and water ( 225 ml ) are added . the reaction mixture is kept under stirring at room temperature overnight . the solid is filtered off , washed with water and dried at 75 ° c . under vacuum overnight . imatinib is obtained as a yellowish powder ( 32 g , 90 % yield , & lt ; 98 % purity ). to a suspension of 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ] benzoic acid ( 10 g ) in ch 2 cl 2 ( 400 g ) at room temperature , dcc ( 9 . 6 g ) and hobt ( 9 g ) are added . after 18 h stirring , the solid is filtered off and washed with ch 2 cl 2 ( 100 g ). n -( 5 - amino - 2 - methylphenyl )- 4 -( 3 - pyridyl )- 2 - pyridineamine ( 9 . 5 g ) is added to the combined filtrates , the solution is stirred at 15 - 25 ° c . for 1 h , then dmap ( 1 g ) is added and stirring is continued for 2 days . after addition of water ( 200 g ) and 26 % nh 4 oh ( 20 g ), the organic phase is separated and evaporated . the residue is taken up with ipa ( 100 g ). the product is filtered , washed with epa and dried ( 13 . 5 g , 77 % yield , 96 . 3 % purity ). 4 -( chloromethyl ) benzoic acid ( 58 g ) is added to a solution of n - methylpiperazine ( 150 g ) in n - buoh ( 580 g ) at room temperature . after stirring for 3 - 6 h , the solvent is evaporated under reduced pressure and the residue is taken up with ipa ( 440 g ). the mixture is refluxed for 15 min under stirring , then stirred for 24 h at room temperature . the solid is filtered off , washed with ipa ( 2 × 58 g ) and dried under vacuum at 70 ° c . overnight . the desired product is obtained as a white solid ( 59 . 5 g , 75 % yield ). 4 -[( 4 - methyl - 1 - piperazinyl ) methyl ]- n -[ 4 - methyl - 3 -[[ 4 -( 3 - pyridinyl )- 2 - pyrimidinyl ] aminophenyl ] benzamide ( 98 . 2 g ) is added to etoh ( 1 . 4 l ). to the suspension methanesulfonic acid ( 19 . 2 g ) is added dropwise . the solution is filtered clear at 65 ° c . the solvent is evaporated and the residue is taken up with etoh ( 2 . 2 l ) and dissolved under reflux with addition of water ( 30 ml ). the solution is cooled down and kept overnight at 25 ° c . the solid is filtered off and dried at 65 ° c . the title product is obtained as light beige crystals . to a suspension of compound ii ( n = 2 , a = cl ) ( 20 g ) in toluene ( 35 ml ) and dmf ( 1 ml ) under n2 at 60 ° c ., ( 20 g ) was added over a period of 1 h socl2 . the mixture was kept under stirring at 62 ° c . for 20 h . after cooling at 20 ° c ., toluene ( 20 ml ) was added and the mixture was stirred for 0 . 5 h . the solid was filtered off , washed with toluene ( 50 ml ) and dried at 65 ° c . under vacuum for 15 h . the product was obtained as a white powder ( 21 g ). imatinib base ( 60 g , 0 . 1216 mol ) was suspended in etoh ( 900 - 1200 ml ) and water ( 2 - 5 % v / v vs etoh ) was added under stirring . the temperature was adjusted to − 10 /− 5 ° c . and a solution of meso 3 h in etoh ( 79 . 8 ml 10 % v / v ; 0 . 1213 mol ) was added in 2 min , keeping the temperature at − 10 /− 5 ° c . the reaction mixture was seeded with imatinib mesylate form x ( 300 - 500 mg ) and kept under stirring at − 5 ° c . for 3 h . the suspension was diluted with mtbe ( 750 - 1000 ml ) keeping the temperature below 0 ° c . the solid was filtered off , washed with mtbe and dried under vacuum onto the filter in a nitrogen atmosphere to remove free etoh . crystalline imatinib mesylate containing about 7 % etoh was obtained in 92 - 95 % yield . imatinib base ( 60 g ; 0 . 1216 mole ) was suspended in 1200 ml of ethanol and stirred . reactor was kept under flow of nitrogen during all of the experiment ( 6 litres per hour ). then , 24 ml of water was added to the suspension and the temperature was adjusted at − 15 ° c . an ethanolic solution of methanesulfonic acid ( 79 . 8 ml 10 % v / v ; 0 . 1213 mole ) was added during 2 minutes to the reaction mixture . temperature of the solution was set at − 10 ° c . during 10 minutes , imatinib base was dissolved and seeding material of form x ( 2 g ) was added . the crystallization process was continued under stirring for 190 minutes and temperature was continuously increased to − 5 ° c . the suspension was stored overnight in a freezer at approx . − 27 ° c . than , suspension was diluted by 1000 ml tbme , filtered by nitrogen pressure and obtained crystalline portion was washed with 400 ml tbme . the resulted crystalline form was dried by flow of nitrogen through the filter to remove free ethanol . ethanol content was about 7 . 5 %. ( yield was 67 . 95 g ; 85 %)
| 2 |
an electrochromic device ( fig1 ), e . g . a window , comprises a first electrode 3 and a second electrode 5 , out of which at least one becomes colored under reducing or oxidizing conditions . the electrodes 3 , 5 are separated by an electrolyte 4 . each of the two electrodes is typically supported by a conducting transparent plate 1 , 7 or the like , e . g . a glass plate covered with a transparent conductive coating 2 , 6 , such as doped tin oxide . furthermore , the conductive coatings 2 , 6 are connected to an external electric circuit by means of contacts 8 . the electrochemical capacitance of a conducting ( or semiconducting ) surface in contact with an electrolyte is typically about 10 μfcm − 2 to 40 μfcm − 2 ( the electrical double layer or helmholtz capacitance ). by using a nanostructured conducting film with a roughness factor of about 1000 ( described more in detail below ), it has been found that the total capacitance is raised to about 10 mfcm − 2 to 40 mfcm − 2 ( the relationship between the roughness factor and the capacitance is proportional ). this raise in capacitance makes it possible to use such a nanostructured film as an electrode in an electrochromic device , as it has the ability to provide the charge needed to color a coloring electrode in an electrochromic device , ( which is in the range of 5 mccm − 2 to 20 mccm − 2 ). furthermore , since no intercalation is involved , such an electrode is “ fast ” enough to be used in any fast color switching electrochromic device in a nanostructured electrode it is essential that the particles are electrically connected with each other and the conducting substrate . they can be sintered together ( heated ), pressed together , chemically connected , connected with some kind of inorganic or organic binder particles in the film , etc . the porosity in the film must be high . essential is that the pores in the film also form a 3 - d network with nano - dimensions ( 1 - 100 nm pore size ). this open porous structure makes the ion transport rapid when immersed in an electrolyte . to improve the conductivity of electrons and ions in the film , the film may contain particles of larger size than nanoparticles . for example , micrometer - size zno rods that are grown from the substrate , as disclosed in wo 9800035 - 9 or graphite . in the same way the porous network may contain micron - size “ pore channels ” to speed up the ion transport . one could also imagine other additives , like light - scattering particles and the “ binder particles ” discussed above . essential is that the main contact between the electrode and the electrolyte is located at the surface of the nanoparticles , and that this interface is easily accessible ( e . g . not via long narrow pores within a particle ) from the 3d - networks of both the particles and the pores . examples of suitable materials for such nanostructured conducting films are semiconducting metal oxides , carbon , metals and other semiconducting materials . a suitable semiconducting metal oxide may be an oxide of any suitable metal , such as , titanium , zirconium , hafnium , chromium , molybdenum , tungsten , vanadium , niobium , tantalum , silver , zinc , tin , strontium , iron , cobalt or nickel or a perovskite thereof . the present inventors have discovered that certain semiconducting metal oxides ( specified below ), when prepared as nanostructured films with a roughness factor of at least 20 , exhibit color - change characteristics that are not dependent upon intercalation of ions into the material . the main mechanism in these cases is instead capacitive charging ( or double layer charging ) at the surface of the nanostructured material . this capacitive behavior leads to much faster color switching , as there is essentially no intercalation involved . for a nanostructured coloring electrode nio ( in the crystalline form bunsenite ), coo , wo 3 and moo 3 are particularly preferred . out of these , nio and coo become colored under oxidizing conditions and the others under reducing conditions . for a nanostructured non coloring electrode tio 2 , in 2 o 3 , sno 2 , ruo 2 and carbon are particularly preferred . the electrolyte is preferably in liquid form and preferably comprises at least one electrochemically inert salt , either as a molten salt or dissolved in a solvent . suitable salts are composed of cations such as lithium , sodium , potassium , magnesium , tetraalkylammonium and dialkylimidazolium ions , and anions such as chloride , perchlorate , trifluoromethanesulfonate , bis ( trifluoromethysulfonyl ) amide , tetrafluoroborate and hexafluorophosphate ions . suitable solvents are electrochemically inert such as water , acetonitrile , methoxyacetonitrile , butyronitrile , propionitrile , 3 - methoxypropionitrile , glutaronitrile , - butyrolactone , propylenecarbonate , ethylenecarbonate , dimethylsulfoxide , dimethylformamide , dimethylacetamide , and n - methyloxazolidinone , or mixtures thereof . in one preferred embodiment , the first electrode 3 is a nanostructured electrode with a type n electrochromophore added to the surface . the second electrode 5 is a non - coloring electrode , comprising a nanostructured film of a conducting or semiconducting material as defined above . it should be noted that this second electrode 5 in this device does not have an adsorbed monolayer of electrochromophore or the like on the surface , whereby the production step of adding an electrochromophore to this electrode is omitted . systems of this type utilize the fast color switching characteristics of the electrochromophore and the capacitive behavior of the nanostructured electrode . such a system exhibits as fast color switching as the prior art systems based on electrochromophores , but has substantially better long - term stability ( and cyclability ). these improvements are due to the fact that no electrochemical reactions , other than ( pseudo -) capacitive charging , are taking place at the counter electrode . in another embodiment both the first electrode 3 and the second electrode 5 lack adsorbed monolayers of electrochromophores or the like on the surface . in this embodiment the second electrode 5 is a nanostructured coloring electrode of the type described above , i . e . a nanostructured nio electrode or the like . in a third embodiment both the first electrode 3 and the second electrode 5 are nanostructured coloring electrodes , i . e . one of the electrodes becomes colored under reducing conditions , and the other electrode becomes colored under oxidizing conditions . as both electrodes in the last two embodiments lack adsorbed monolayers of electrochromophores or the like on the surface , production of such systems will be faster and less complicated . the adsorption of electrochromophores at the nanostructured electrode is a time consuming step in the fabrication of nanostructured electrochromic devices . the adsorption process may also negatively affect the properties of the electrode material . such systems will further exhibit enhanced long - term stability since there are no intercalation or electrodepostion reactions at the electrodes and problems associated with desorption of electrochromophores are avoided . by avoiding intercalation or electrodepostion reactions and adsorbed electrochromophores , one reduces the risk for competing destructive reactions ( electrochemically and photo - induced ). supercapacitors with pure double - layer capacity are generally believed to have the highest electrochemical stability , in fact , electrochromic devices with two nanostructurednanoporous electrodes are “ colouring supercapacitors ”. even though the color switch in the two last embodiments is not dependent upon intercalation , there will still exist intercalation to , some degree if small ions such as lithium ions are present in the electrolyte . one way to minimize the intercalation , which may slow down the color switch process , is to use an electrolyte that does not comprise such ions . therefore , it is preferred to use an electrolyte that only comprises larger ions such as for example tetraalkylammonium ions . the electrolyte thus supports capacitive charge compensation when capacitive charge compensation processes are dominant in relation to existing intercalation processes , in particular under change of colour of the electrode . an electrochromic display according to the invention may be provided as described in detail below . bis -( 2 - phosphonoethyl )- 4 , 4 ′- bipyridinium dichloride is adsorbed to the surface of a 4 m thick nanostructured film of tio2 on a conducting glass plate ( 0 . 5 μm fluorine - doped sno2 on 2 mm glass ). this electrode is transparent , but colours blue upon reduction . a nanostructured carbon film ( 10 - 50 μm thick ), comprising carbon black and graphite particles , is deposited on a second conducting plate . on top of this film a porous white light - scattering film is deposited as a reflector . the two plates are assembled face - to - face using a hot - melting plastic at the uncovered edges of the two plates . electrolyte ( 0 . 2 m tetrabutylammonium trifluoromethanesulfonate in 3 - methoxypropionitrile ) is introduced in the space between the two electrodes . the resulting electrochromic display has a good memory effect and stability (& gt ; 100 , 000 cycles without severe degradation ). above a number of embodiments have been described . however , it is obvious that the design could be varied without deviating from the inventive idea , of providing an improved electrochromic device . therefore the present invention should not be regarded as restricted to the above disclosed embodiments , but can be varied within the scope of the appended claims .
| 6 |
the present invention relates to methods for treating or preventing pain in a human or non - human animal patient in need thereof , which the method comprises administering to said patient a therapeutically effective amount of at least one compound represented by formula i : r 5 and r 5 ′ are independently — h , — oh or — or 6 , wherein r 6 is a linear or branched c 1 - c 4 alkyl ; z is — ch 2 ch 2 o —, — ch ( ch 3 ) ch 2 o — or — ch 2 ch ( ch 3 ) o —; n is an integer of 1 , 2 , 3 , 4 , or 5 ; the present invention relates to a method for the treatment of acute or chronic pain . the present invention relates to a method for the treatment of nociceptive pain or neuropathic pain . the present invention relates to a method for the treatment or prevention of pain , wherein the compound administered is represented by formula ii : or a pharmaceutically acceptable salt prodrug , metabolite , or hydrate thereof . the present invention relates to a method , wherein z is — ch 2 ch ( ch 3 ) o —. the present invention relates to a method , wherein the compound administered is represented by formula iii : the present invention relates to a method , wherein r 5 is h or oh . the present invention relates to a method , wherein r 5 ′ is h or oh . the present invention relates to a method , wherein n is 1 or 2 . the present invention relates to a method , wherein the compound is represented by formula iv , v , vi or vii : wherein r is a polyalkylene glycol polymer having n units , wherein n is an integer of 1 , 2 , 3 , 4 , or 5 . the present invention relates to a method , wherein the compound is administered as a pharmaceutical composition comprising a therapeutically effective amount of one or more of the compounds represented by formulae i , ii , iii , iv , v , vi , or vii together with one or more pharmaceutically acceptable excipients . the present invention relates to a method , wherein the composition administered comprises said one or more compounds in substantially pure form , said substantially pure form consisting of at least 95 % wt of said one or more compounds and up to 5 % wt . of free polyalkylene glycol , with the total amount in said form of said one or more compounds and said free polyalkylene glycol being 100 % wt . the present invention relates to a method , wherein the composition administered comprises said one or more compounds in partially pure form , said partially pure form consisting of about 5 - 60 % wt . of the one or more compounds and about 95 - 40 % wt . of free polyalkylene glycol , the total amount being 100 % wt . the present invention relates to a method , wherein the composition is formulated as a unit dosage form . the present invention relates to a method , wherein the composition is formulated for oral administration . the present invention relates to a method , wherein the composition is formulated as a unit dosage form comprising from 0 . 1 to about 500 mg of the one or more compounds . the present invention relates to a method , wherein a daily dose of 1 . 0 mg to 15 g of said one or more compounds is administered . the present invention relates to a method , wherein the one or more compounds are administered orally . polyalkylene glycol compounds were generally synthesised by preparation of the appropriate alcohol compound followed by conjugation of the alcohol with a polyalkylene glycol ( pag ) polymer ( e . g ., polyethylene glycol ( peg ) or polypropylene glycol ( ppg )) of the desired length . 1 . 2 g , 32 mm , of lialh 4 were added to 2 . 3 g , 10 mm , phenyl alanine ethyl ester hcl in 50 ml dry ether . after stirring for 2 hours at room temperature , water and koh were added and the reaction product was extracted with ethyl acetate . after evaporation , 0 . 8 g of compound a , a light yellow oil , was obtained . nmr cdcl 3 7 . 30 ( 5h , m ), 3 . 64 ( 1h , dd , j = 10 . 5 , 3 . 8 hz ) 3 . 40 ( 1h , dd , j = 10 . 5 , 7 . 2 hz ) 3 . 12 ( 1h , m ), 2 . 81 ( 1h , dd , j = 13 . 2 , 5 . 2 hz ), 2 . 52 ( 1h , dd , j = 13 . 2 , 8 . 6 hz ) nmr acetone d 6 7 . 30 ( 5h , m ), 3 . 76 ( 1h , dt ) 3 . 60 ( 1h , m ) 3 . 30 ( 1h , t ), 2 . 85 ( 2h , m ). helv . chim . acta , 31 , 1617 ( 1948 ). biels . - e3 , vol . 13 , p 1757 . to 3 g , 12 mm , l - tyrosine ethyl ester hcl in 50 ml dry ether was added 1 . 2 g 32 mm lialh 4 . after stirring 3 hours at room temperature , water and koh were added and the reaction was extracted with ethyl acetate . evaporation gave 1 . 1 g of a light yellow oil , 54 % yield , which on standing crystallized . mp - 85 . nmr cdcl 3 7 . 20 ( 4h , ab q , j = 8 . 6 hz ), 3 . 50 ( 2h , m ) 3 . 20 ( 1h , m ), 2 . 81 ( 2h , m ). nmr tyrosine ethyl ester free base cdcl 3 7 . 0 , 6 . 56 ( 4h , ab q , j = 8 . 8 hz ), 4 . 20 ( 2h , q , j = 7 , 0 hz ), 3 . 70 , 10 , 2 . 80 ( 3h , 12 line abxm ), 1 . 28 ( 3h , t , j = 7 . 0 hz ). jacs 71 , 305 ( 1949 ). biels . - e3 , vol . 13 , p 2263 , compound 2 ( nrd135 ) has the structure of general formula iv , with r ═ ppg and n = 1 . mw = 354 l - tyrosinol ( 24 . 4 g ) was reacted with hydrocinnamic acid ( hca , 1 . 02 eq ), dcc ( 1 . 1 eq ), hobt ( 1 . 1 eq ) and nahco 3 ( 4 . 0 eq ) at room temperature overnight . reaction was completed overnight at rt . the reaction was filtered and a solvent swap from thf to ea was performed . the ea layer was washed with 1n hcl , sat nahco 3 , brine , and organic layer dried over na 2 so 4 . removal of a portion of ea was conducted via distillation , then slow addition of heptane afforded 33 . 82 g ( 94 . 1 % yield ) of desired product . hplc : purity =≧ 92 %. the benzyl ether of av74s was prepared . 1 . 33 eq benzyl chloride was charged to av74s ( 50 . 90 g ), 1 . 33 eq potassium carbonate , 0 . 1 eq potassium iodide in acetone at 50 ° c . after 20 hours at 50 ° c ., the reaction was heated to reflux for an additional 7 hours to consume all the starting material . the reaction was cooled to room temperature and quenched with water . the slurry was cooled to & lt ; 5 ° c . and stirred for 1 . 5 hours , then filtered . the solids were dried in vacuo ( 70 ° c .) over the weekend to afford 62 . 98 g of crude solids . the auc purity was 94 . 4 %. 1 h nmr analysis supports the assigned structure . a 5 - fold excess of propylene glycol was treated with trityl - cl ( 246 . 7 g , 885 mmol ) in the presence of pyridine and dmap in dmf at rt . the reaction was allowed to stir over the weekend at rt . the mixture was diluted with 3 vol of water and extracted with ea . the recrystallization from acetonitrile / water afforded 235 . 04 g ( 83 . 4 % yield , purity = 98 . 7 %) of desired product . the trityl ether ( 99 . 82 g , 313 . 5 mmol ) was converted into the orthogonally protected bis ether . to a & lt ; 10 ° c . slurry of 2 equiv of nah in dmf was added dropwise trityl ether at a rate to control gas evolution . after stirring for 15 minutes at & lt ; 10 ° c ., p - methoxybenzyl chloride was added via syringe . the mixture was warmed to rt ( mildly exothermic ) and allowed to stir at rt for 1 . 5 hours . hplc analysis indicated complete consumption of starting material . workup consisted of careful quenching of the mixture with 3 volumes of water and ea extraction . the ea layers were washed with water to remove dmf and dried over na 2 so 4 to give a hazy oil ( 150 . 95 g .). the protected bis ether was exposed to a catalytic amount of para - toluenesulfonic acid to detritylate the trityl group . to the protected bis ether ( 150 . 95 g , pr030 - 084 - 2 ) in methanol and thf was added a catalytic amount ( 0 . 1 eq ) of para - toluenesulfonic acid . after 60 minutes at room temperature , thin layer chromatography and hplc analysis indicated that the reaction was complete . triethylamine was added to quench the reaction and the solvent was removed via durp . the desired product was isolated from a silica gel plug to afford 51 . 74 g ( 84 % yield , purity = 98 . 4 %). 1 h nmr analysis supported the assigned structure . the mesylation of ppg - 1 - hydroxy - 2 - opmb ( 20 . 1 g ) was conducted using 2 . 0 eq of methanesulfonyl chloride and 2 . 25 eq of triethylamine at & lt ; 5 ° c . to give a clean conversion to desired product in 108 % crude yield as an oil . this material was sufficiently pure to use for next steps . 20 . 13 g obn - tyrosinol core ( from step a ) and 2 . 25 eq ppg - 1 - omesyl - 2 - opmb ( from step b ) in dmso was added 2 . 0 eq of 1m potassium tert - butoxide ( in thf ) over 1 . 6 hours at room temperature . after 15 . 5 hours at room temperature , 91 . 9 % of desired product had formed and 8 . 1 % of obn - tyrosinol core was not fully consumed . an additional 0 . 3 eq of 1m potassium tert - butoxide was added and the reaction was allowed to stir at 45 ° c . after an additional 18 hours at 45 ° c ., 98 . 3 % of desired product had formed and 1 . 7 % of obn - tyrosinol core was not fully consumed . the reaction mixture was quenched with usp water at room temperature and extracted with ethyl acetate . the combined organic layers were successively washed with usp water , saturated aqueous nahco3 solution , brine , and dried over sodium sulfate to afford 39 . 00 g of an oil . an attempt to recrystallize from toluene / heptane proved to be unsuccessful and provided 25 . 8 g of solids that were 77 . 4 % pure of desired product . celite was added to 25 . 3 grams of pr030 - 114 - 12 dissolved in hot mtbe / heptane ( 1 : 1 ). this mixture was filtered hot over a bed of celite . the filtrate was cooled to room temperature and the solids were collected via vacuum filtration to provide 13 . 1 g of white solids ( 52 . 4 % yield ). a second crop was obtained giving an additional 2 . 75 g of white solids ( an additional 11 % yield ). the purity of these two crops was 98 . 8 % and 98 . 1 %, respectively . 1h nmr and mass spec analysis supported the assigned structure for desired product . the combined yield was 63 . 5 %. the bis - protected ether ( 15 . 7 g ) was exposed to one - pot hydrogenation - debenzylation conditions ( 10 % loading of 10 % pd / c and 0 . 25 eq of p - toluenesulfonic acid ) in methanol . after 2 hours at 60 ° c . under a hydrogen atmosphere , hplc analysis indicated that the hydrogenation of the benzyl and the debenzylation of pmb ring was complete . the reaction mixture was filtered over celite and concentrated under reduced pressure . the residue was dissolve in ethyl acetate and a saturated aqueous sodium bicarbonate treatment was conducted to effectively remove p - toluenesulfonic acid , then durp to provide 12 . 13 g of an oil ( pr030 - 120 - 4 ). desired product was isolated from an ea / heptane recrystallization to provide 8 . 83 g of a white solid ( pr030 - 120 - 6 , 89 . 4 % yield ). the purity of pr030 - 120 - 6 was 99 . 3 % via hplc analysis . 1 h nmr and mass spec analysis supported the assigned structure for desired pro duct . compound 1 has the structure of general formula iv , with r ═ ppg and n = 2 . mw = 413 compound 1 was prepared using the same procedure as described above in synthesis 1 , with the substitution of the ppg , n = 1 for ppg , n = 2 . it will be understood that the procedures of synthesis 1 can therefore be applied to produce compounds of formula vii in which z is ppg . alternative compounds falling within formula i can be produced by substitution of l - tyrosinol in step ( a ) with the appropriate amino alcohol ( e . g . phenyl alaninol as produced in synthesis a )). the procedures of synthesis 1 can also be adapted as described below in synthesis 3 so that they result in the production of a compound of formula 1 in which z is peg . compound 3 has the structure of general formula iv , with r = peg and mw = 413 a 5 - fold excess of ethylene glycol was treated with trityl - cl ( 22 . 9 g , 82 . 13 mmol ) in the presence of pyridine and dmap in dmf at rt . the reaction was allowed to stir overnight at room temperature . the mixture was diluted with 3 vol of water and extracted with ea . isolation of desired product via recrystallization from acetonitrile / water gave 22 . 87 g of solids ( 91 . 5 % yield ). the purity determined by hplc was 97 . 8 %. 1 h nmr and mass spec analysis supported the assigned structure for desired product . the mesylation of compound a - 1 ( 11 . 00 g ) was conducted using 2 . 0 eq of methanesulfonyl chloride and 2 . 25 eq of triethylamine at & lt ; 5 ° c . to give a clean conversion to desired product in quantitative yield as a solid ( 13 . 85 g ). auc purity = 97 . 5 %. mass spec and 1 h nmr analysis supported the assigned structure . c ) i ) 2 . 29 g of obn - tyrosinol core ( from step a ) and 2 . 25 eq of compound b - 1 ( from step b ) in dmso was added 2 . 0 eq of 1m potassium tert - butoxide ( in thf ) over 45 mins at room temperature . after 12 . 25 hours at 35 ° c ., the reaction mixture was quenched with usp water at room temperature and extracted with ethyl acetate . the combined organic layers were successively washed with usp water , saturated aqueous nahco 3 solution , brine , and dried over sodium sulfate to afford 5 . 05 g as an oil . this product was purified via column chromatography to isolate the desired product as a solid ( 2 . 07 g ). auc purity = 97 . 5 %. 1 h nmr analysis supported the assigned structure for desired product . 2 . 07 g c - 1 , c - 1 was dissolved in 30 vol methanol at 60 c . 10 wt % pd / c then 0 . 25 eq ptsa was added while at 60 c . hydrogen atmosphere was maintained for 3 hours . the catalyst was removed by hot filtration . the filtrate was durp to obtain a solid . the solids were dissolved in ethyl acetate and washed with sodium bicarbonate . the organic was dried over sodium sulfate and durp to give gooey solids . the experiments described below were conducted to demonstrate the utility of compounds of the invention in the treatment of pain . the objective of the study was to assess antinociceptive activity of tested items in the hot plate tests in mice , when administered sub - chronically . measuring paw licking or jumping response time elapses following placement on heated surface ( hot plate ) was used to determine potential antinociceptive effect in mice . a total of 42 balb / c mice ( 12 weeks old ) were utilized . the mice were approximately 25 g males at study initiation . the minimum and maximum weights of the group were within a range of ± 10 % of group mean weight . compounds 2 and 3 were tested and compared with diclofenac ® ( perigo ). dmso solutions were used . six groups of mice ( each having n = 7 or n = 8 mice ) were tested , the last group receiving diclofenac ®. formulations according to the following table were prepared for administration to the groups of mice . control - 0 . 02 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 0 . 6 μl dmso + 2999 . 4 μl compound 2 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), n = 8 compound 2 , 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 1 . 5 mg ( stock 50 mg / 1 ml dmso ) 30 μl + 2970 μl ddw ), n = 8 compound 3 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), n = 8 compound 3 , 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 1 . 5 mg ( stock 50 mg / 1 ml dmso 30 μl + 2970 μl ddw ), n = 8 diclofenac ® 10 mg / kg = 0 . 3 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) from stock all groups received the drugs daily po for 16 days . hot plate experiments were performed on days ; 1 , 8 and 15 . the following parameters were examined : body weight ( days 1 , 8 15 ); open field on day 16 including distance moved , velocity , immobility , rearings , time in center and other parameters . after the last experiment ( i . e ., open field day 16 ), animals were sacrificed by decapitation and blood was collected 24 hr after last drug administration . the following organs were dissected : liver ( gall bladder ), spleen , lungs , brain , heart and kidney for toxicity examination ( formaldehyde 4 %). the hot plate is maintained thermostatically at a temperature of 52 ° c . one hour before the administration of the drugs , mice are tested in the hot plate . at time 0 the mice are administered with the test compound and the response to the hot plate is measured again at different times : 60 , 120 , 180 , 240 , 300 and 360 min . results are expressed as : delta from maximum response [ baseline vs . maximum response ]; absolute measures over time ; and accumulated time . fig1 a and 1 b provide graphical results showing a comparison of compounds 2 and 3 with diclofenac ® at days 1 , 8 , and 15 . fig1 c shows internal organ weight data after administration of the tests . additional data showed that compositions 2 - 5 significantly increased the time to reaction as compared with the control . a sample of such data is provided in fig1 d . these data show that compounds 2 and 3 are effective as pain relievers . using the procedure outlined in example 1 , 40 male mice ( balb / c , 9 weeks old , naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - 0 . 2 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 6 μl dmso + 2994 μl compound 2 , 0 . 01 mg / kg = 0 . 0003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 003 mg ( stock 50 mg / 1 ml dmso ) 0 . 06 μl + 2999 . 94 μl compound 2 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl compound 2 , 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 , 0 . 3 mg ( stock 50 mg / 1 ml dmso ) 6 μl + 2994 μl ddw ), n = 8 compound 2 , 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , i . p . ( 3 ml / 10 mice ) ( compound 2 , 0 . 03 mg ( stock 50 mg / 1 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), the animals were determined on the hotplate at : − 60 , 0 , 120 , 240 , 360 , 420 and 480 min . the hotplate mean temperature was 52 degrees ± 1 . fig2 a and 2 b provide data for these tests . using the procedure outlined in example 1 , 40 male mice ( balb / c , 9 weeks old , naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 2 . 5 % dmso 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( 63 μl dmso + compound 2 , eqm 25 ( 12 . 5 ) mg / kg = 0 . 3125 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 3 . 125 mg ( stock 50 mg / 1 ml dmso ) 63 μl + 2437 μl ddw ) compound 2 eqm 12 . 5 ( 6 . 25 ) mg / kg = 0 . 15625 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 1 . 5625 mg ( stock50 mg / 1 ml dmso ) 32 μl + 2468 μl ddw ) compound 2 eqm 6 . 25 ( 3 . 125 ) mg / kg = 0 . 078 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 0 . 78 mg ( stock50 mg / 1 ml dmso ) 16 μl + 2484 μl ddw ) the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min . the hot - plate means the temperature of 52 degrees ± 1 . fig3 a , 3 b , and 3 c provide data for this test . using the procedure outlined in example 1 , 40 male mice ( balb / c , 13 weeks old , not naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table , control - ddw + 0 . 2 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 6 μl dmso + compound 2 ( mw 357 ) 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 3 mg ( stock50 mg / 1 ml dmso ) 6 μl + 2994 μl ddw ) compound 2 ( mw 357 ) 0 . 2 mg / kg = 0 . 006 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 06 mg ( stock50 ml / 1 ml dmso ) 1 . 2 μl + 2998 . 8 μl ddw ) compound 2 ( mw 357 ) 0 . 04 mg / kg = 0 . 0012 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 012 mg ( stock 50 mg / 1 ml dmso ) 0 . 24 μl + 2999 . 76 μl ddw ) compound 2 ( mw 357 ) 0 . 008 mg / kg = 0 . 00024 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 0024 mg ( stock 50 mg / 1 ml dmso ) 0 . 048 ( 0 . 05 ) μl + the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig4 a and 4 b provide data for this test . using the procedure outlined in example 1 , 40 male mice ( balb / c , 15 weeks old , not naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 0 . 02 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 0 . 06 μl compound 2 ( mw = 357 ) 0 . 01 mg / kg = 0 . 0003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 0 . 003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 06 μl + 2999 . 94 μl compound 2 0 . 001 mg / kg = 0 . 00003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 0 . 0003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 006 μl + 2999 . 994 μl compound 3 ( mw = 343 ) 0 . 01 mg / kg = 0 . 0003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice )( compound 3 0 . 003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 06 μl + 2999 . 94 compound 3 0 . 001 mg / kg = 0 . 00003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 0 . 0003 mg ( stock 50 mg / 1000 μl dmso ) 0 . 006 μl + 2999 . 994 the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig5 a and 5 b provide data for this experiment . using the procedure outlined in example 1 , 40 male mice ( balb / c , 9 weeks old , not naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , po .) with the formulations shown in the following table . control - ddw + 1 . 24 % dmso 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( 31 μl compound 2 ( mw 357 ) 6 . 25 mg / kg = 0 . 15625 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 1 . 5625 mg ( stock50 mg / 1 ml dmso ) 31 . 25 ( 31 ) μl + 2469 μl compound 2 ( mw 357 ) 2 . 083 ( 2 . 1 ) mg / kg = 0 . 052 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 0 . 52 mg ( stock50 mg / 1 ml dmso ) 10 . 415 ( 10 ) μl + compound 2 ( mw 357 ) 0 . 694 ( 0 . 7 ) mg / kg = 0 . 01735 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) (( compound 2 0 . 1735 mg ( stock 50 mg / 1 ml dmso ) 3 . 47 ( 3 ) μl + gabapentine ( gbp ) 30 mg / kg = 7 . 5 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( gbp the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min , and 24 h after treatment . the hot - plate means the temperature of 52 degrees ± 1 fig6 a - e provide the data from this test . using the procedure outlined in example 1 , 40 male mice ( balb / c , 12 weeks old , naïve ), were divided in 5 groups ( 8 mice per group ) and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 5 % dmso 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( 125 μl dmso + compound 1 25 mg / kg = 0 . 625 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice ) ( compound 1 1 . 5625 mg ( stock 30 mg / 0 . 6 ml dmso ) 32 μl + 2468 μl ddw ) compound 1 ( mw 415 ) eqm 25 mg / kg ( 15 mg / kg ) = 3 . 75 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice )( compound 1 3 . 75 mg ( stock 30 mg / 0 . 6 ml dmso ) 75 μl + compound 1 ( mw 415 ) eqm 12 . 5 mg / kg ( 7 . 5 mg / kg ) = 1 . 875 mg / 0 . 25 ml / mouse , po ( 2 . 5 ml / 10 mice )( compound 1 1 . 875 mg ( stock 30 mg / 0 . 6 ml dmso ) 37 . 5 ( 38 ) the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min , and 24 h . fig7 a - d provide data for this experiment . using the procedure outlined in example 1 , 37 male mice ( balb / c , 16 weeks old , not naïve ), were divided in 5 groups and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 1 . 2 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 36 μl dmso + compound 3 ( mw = 343 ) 0 . 06 mg / kg = 0 . 0018 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 0 . 018 mg ( stock 4 . 6 mg / 92 μl dmso ) 0 . 36 μl + 2999 . 64 μl compound 3 0 . 6 mg / kg = 0 . 018 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 0 . 18 mg ( stock 4 . 6 mg / 92 μl dmso ) 3 . 6 μl + 2996 . 4 μl ddw ), n = 7 compound 3 6 mg / kg = 0 . 18 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 3 1 . 8 mg ( stock 4 . 6 mg / 92 μl dmso ) 36 μl + 2964 μl ddw ), n = 8 diclofenac 50 mg / kg = 1 . 25 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) diclofenac 14 . 4 the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig8 a and 8 b provide data for this experiment . using the procedure outlined in example 1 , 40 male mice ( balb / c , 13 weeks old , not naïve ), were divided in 5 groups and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 0 . 8 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 24 μl dmso + compound 2 ( mw 357 ) 4 mg / kg = 0 . 12 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 1 . 2 mg ( stock50 mg / 1 ml dmso ) 24 μl + 2976 μl ddw ) compound 2 ( mw 357 ) 0 . 04 mg / kg = 0 . 0012 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 2 0 . 012 mg ( stock50 mg / 1 ml dmso ) 0 . 24 μl + 2999 . 76 μl ddw ) compound 1 ( mw 415 ) eq . 4 ( 4 . 65 ) mg / kg = 0 . 14 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 1 1 . 395 mg ( stock 30 mg / 0 . 6 ml dmso ) 27 . 9 ( 28 ) μl + 2972 compound 1 ( mw 415 ) eq . 0 . 04 ( 0 . 05 ) mg / kg = 0 . 0014 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) (( compound 1 0 . 014 mg ( stock 60 mg / 0 . 6 ml dmso ) 0 . 279 ( 0 . 28 ) μl + the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig9 a - e provide data for this experiment . using the procedure outlined in example 1 , 40 male mice ( balb / c , 13 weeks old , not naïve ), were divided in 5 groups and treated daily ( 0 min , p . o .) with the formulations shown in the following table . control - ddw + 0 . 04 % dmso 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( 1 . 2 μl dmso + compound 1 0 . 125 mg / kg = 0 . 00375 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 1 0 . 0375 mg ( stock 60 mg / 1 . 2 ml dmso ) 0 . 75 μl + 2999 . 25 μl ddw ), compound 2 0 . 1 mg / kg = 0 . 003 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) ( compound 2 0 . 03 mg ( stock 60 mg / 1 . 2 ml dmso ) 0 . 6 μl + 2999 . 4 μl ddw ), n = 8 diclofenac 50 mg / kg = 1 . 25 mg / 0 . 3 ml / mouse , po ( 3 ml / 10 mice ) diclofenac 12 . 5 mg + 0 . 25 μl dmso + 2999 . 75 μl ddw ), n = 8 the animals were determined on hp at : − 60 , 0 , 60 , 120 , 180 , 240 , 300 and 360 min after treatment . the hot - plate means the temperature of 52 degrees ± 1 . fig1 a , 10 b , and 10 c provide data for this experiment . male sd rats ( 9 weeks old , naïve ), were divided into 5 groups ( 6 mice in each group ) and treated (− 120 min , p . o .) with the formulations shown in the following table . control - ddw + 10 % dmso 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( 241 μl dmso + compound 2 , 1 mg / kg = 0 . 3 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 2 , 2 . 4 ( stock 21 . 5 mg / 0 . 43 ml dmso ) 32 μl + 2352 μl ddw ) compound 2 , 5 mg / kg = 1 . 5 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 2 , 12 mg ( stock 21 . 5 mg / 0 . 43 ml dmso ) 241 μl + 2159 μl ddw ) compound 3 1 mg / kg = 0 . 3 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 3 2 . 4 mg ( stock 19 . 1 mg / 0 . 382 ml dmso ) 32 μl + 2352 μl ddw ) compound 3 5 mg / kg = 1 . 5 mg / 0 . 3 ml / rat , po ( 2 . 4 ml / 8 rats ) ( compound 3 , 12 mg ( stock 19 . 1 mg / 0 . 382 ml dmso ) 241 μl + 2159 μl ddw ) formalin test . the method used was similar to that described by hunscaar and hole ( 1987 ) “ the formalin test in mice : dissociation between inflammatory and non - inflammatory pain ,” pain 30 , pp . 103 - 104 . five animals are used in each group and two to three hours after oral administration of the conjugates , 40 μl or 20 μl ( rats or mice , respectively ) of a 1 % formalin ( in 0 . 9 % saline ) solution is injected subcutaneously into the dorsal surface hind paw . the formalin induced typical flinching behaviour of the injected paw which was counted . the animals were returned to a glass chamber and the total time spent by the animal licking or biting the injected paw was measured . formalin induced pain behaviour is biphasic . the duration of paw licking was determined during the following two time periods : 0 - 5 min ( first - neurogenic phase ) and 20 - 30 min ( second - inflammatory phase ) after formalin injection . part a . male mice ( balb / c mice , 27 weeks old , not naïve ), were divided in 4 groups ( 5 mice per group ) and treated ( 0 min , i . p .) with the following formulations , respectively : control - ( 0 . 2 ml dmso + 3 . 52 saline ) i . p . 0 . 3 ml / mouse . n = 5 . compound 2 , 0 . 2 mg / kg = 0 . 006 mg / 0 . 3 ml / mouse , 6 mice / 0 . 036 mg / 1 . 8 ml = ( 0 . 72 μl ( 2 mg compound 2 + 40 μl dmso ) + 1799 . 28 μl ddw ) n = 5 . compound 2 , 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , 6 mice / 0 . 18 mg / 1 . 8 ml = ( 3 . 6 μl ( 2 mg compound 2 + 40 μl dmso ) + 1796 . 4 μl ddw ) n = 5 . compound 2 , 2 . 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , 6 mice / 0 . 9 mg / 1 . 8 ml = ( 9 μl ( 2 mg stock compound 2 + 40 μl dmso ) + 1782 μl ddw ) n = 5 . part b . male mice ( balb / c mice , 27 weeks old , not naïve ), were divided in 4 groups ( 5 mice in groups ) and treated ( 0 min , i . p .) with the following formulations , respectively : control - ( 0 . 2 ml dmso + 3 . 52 saline ) i . p . 0 . 3 ml / mouse . n = 5 . compound 2 0 . 2 mg / kg = 0 . 006 mg / 0 . 3 ml / mouse , 6 mice / 0 . 036 mg / 1 . 8 ml = ( 0 . 72 μl ( 1 . 3 mg compound 2 + 26 μl dmso ) + 1799 . 28 μl ddw ) n = 5 . compound 2 1 mg / kg = 0 . 03 mg / 0 . 3 ml / mouse , 6 mice / 0 . 18 mg / 1 . 8 ml = ( 3 . 6 μl ( 1 . 3 mg compound 2 + 26 μl dmso ) + 1796 . 4 μl ddw ) n = 5 . compound 2 2 . 5 mg / kg = 0 . 15 mg / 0 . 3 ml / mouse , 6 mice / 0 . 9 mg / 1 . 8 ml = ( 9 μl ( 1 . 3 mg compound 2 + 26 μl dmso ) + 1782 μl ddw ) n = 5 . results from these tests are plotted in fig1 a and 12 b respectively . fig1 c , 12 d , and 12 e provide further data based on measurement time . these data further confirm the anti - inflammatory properties of compound 2 .
| 0 |
the present invention relates to a combination of n - methyl - 2 - pyrrolidone ( nmp ) and resorbable polymers or copolymers . the invention is based on the unexpected realization that by combining a resorbable matrix material and nmp in a certain ratio , an implant having osteogenic properties is achieved . the implant thus induces bone growth due to the osteogenic properties of the polymer composition and enhances bone healing after osteotomies and bone fractures . the implant forms include , but are not limited to , membranes , films , plates , mesh plates , screws , taps or other formed pieces . the implant can be prepared for example of polyglycolide , polylactides , polycaprolactones , polytrimethylenecarbonates , polyhydroxybutyrates , polyhydroxyvalerates , polydioxanones , polyorthoesters , polycarbonates , polytyrosinecarbonates , polyorthocarbonates , polyalkylene oxalates , polyalkylene succinates , poly ( malic acid ), poly ( maleic anhydride ), polypeptides , polydepsipeptides , polyvinylalcohol , polyesteramides , polyamides , polyanhydrides , polyurethanes , polyphosphazenes , polycyanoacrylates , polyfumarates , poly ( amino acids ), modified polysaccharides ( like cellulose , starch , dextran , chitin , chitosan , etc . ), modified proteins ( like collagen , casein , fibrin , etc .) and their copolymers , terpolymers or combinations or mixtures or polymer blends thereof . polyglycolide , poly ( l - lactide - co - glycolide ), poly ( d , l - lactide - co - glycolide ), poly ( l - lactide ), poly ( d , l - lactide ), poly ( l - lactide - co - d , l - lactide ), polycaprolactone , poly ( l - lactide - co - caprolactone ), poly ( d , l - lactide - co - caprolactone ) polytrimethylenecarbonate , poly ( l - lactide - co - trimethylenecarbonate ), poly ( d , l - lactide - co - trimethylenecarbonate ), polydioxanone and copolymers , terpolymers and polymer blends thereof are highly preferred polymers . polylactide / polyglycolide / trimethylene carbonate copolymer ( pla / pga / tmc ), with a composition of 80 / 10 / 10 , granulates were compression moulded to form a film with a thickness of 0 . 2 mm . used compression temperature was 180 ° c . and pressure 130 bar . from the film 10 rectangular pieces were cut , each with a width of 20 mm . the weight of the individual film pieces were measured with balance with an accuracy of 1 mg . the film pieces were then immersed individually into nmp for 30 seconds . after immersion the film pieces were air dried for 20 minutes and the weight of the pieces was measured again . the weight of the film pieces before and after immersion into nmp are shown in table 1 . the average amount of nmp diffused into polymeric film was 44 . 19 %. this rabbit study shows the osteogenetic effect of pla / pga / tmc and pldla / pla / tmc membranes when treated with nmp . the details of the tested membranes can be found in the following table 2 . the study design included eight rabbits with four 6 - mm artificial craniotomy defects each . the defects were treated with biodegradable membranes and a commercial biodegradable osseoquest membrane as shown in table 2 . controls treated without any membranes were included , too . the matrixes of the resorbable membranes are also presented in table 2 . the rabbits were sacrificed 4 weeks after the operation and the calvarial bone excised . thorough histological analysis was performed in order to assess the degree and type of bone regeneration . fig1 a to 1 c illustrate examples of some histological sections from the middle of the defect . it is clearly evident that the bone formed during the 4 - week repair phase is more a cancellous bone than a cortical bone . a cellular interaction with the membrane was not observed . fig2 shows the percentage of a full - thickness repair of rabbit calvarial bone defects . the middle sections of the defects , 6 mm in diameter in the calvarial bone were evaluated . the percentage of repair was determined by pixel number of the defect filled with bone × 100 / pixel number of the defect area . the different membranes are specified by name . ‘ control ’ means the defect without the application of a membrane . evaluation of the level of a full - thickness repair of the bone defect revealed that the use of membranes improved bone healing . the percentage of repair without a membrane , i . e . ‘ control ’, was 31 . 3 ± 4 . 1 % of the defect area of the middle section . essential improvement of bone healing as compared with the control was achieved with osseoquest ( 55 . 78 ± 9 . 9 %), and e1m - 11 nmp ( 77 . 6 ± 8 . 8 %). a direct comparison of bone healing enhanced by osseoquest and e1m - 11 nmp shows a clearly better healing with e1m - 11 nmp . furthermore , e1m - 3nmp shows a healing effect essentially similar to osseoquest . as shown in fig2 the membranes of the present invention , i . e . e1m - 3 nmp and e1m - 11 nmp , increase markedly the healing response in the defect as compared with the membranes with an identical polymeric composition , i . e . e1m - 3 , e1m - 11 , that do not comprise nmp . according to one embodiment of the method of the present invention , nmp is added to the polymer matrix that has been already fashioned into the form of a medical implant . polymer compositions were prepared by dry - mixing commercially available granular - form base materials with commercially available copolymer additives . the material composition was 80 wt -% p ( l / dl ) la ( 70 / 30 ) and 20 wt -% plla / tmc ( 70 / 30 ). the components were weighed according to a desired weight ratio into a container which was then rotated in a turbula t2f shaker mixer for 30 minutes until a homogenous dry mixture was obtained . the resulting mixture was then dried in vacuum at 60 ° c . for 8 to 12 hours and thereafter melt - blended and injection - moulded in to plate - shaped test pieces . the injection - moulding machine used was a fully electric fanuc roboshot alpha i30a injection - moulding machine with a mould clamping force of 300 kn . the injection unit was equipped with high speed ( max . 66 cm 3 / s to 330 mm / s ), high pressure ( max . 2500 bar ) injection options . the barrel diameter was 16 mm and it was equipped with three - band heater zones , a standard profile anticorrosion screw and a standard open nozzle with a 2 . 5 mm hole . the extruder melt - blending and homogenization conditions of the material during the metering phase of the process included a back pressure of 40 to 60 bar , a screw speed of 60 to 100 rpm and barrel temperatures of 160 to 230 ° c . injection moulding conditions included a nozzle temperature of 180 to 230 ° c ., an injection speed of 80 to 300 mm / s , a maximum injection pressure of 2500 bar , a pack pressure of 1000 to 2300 bar for 3 to 8 s , a cooling time of 10 to 22 s and a mould temperature of 20 to 30 ° c . the total cycle time was 20 to 40 s consisting of the following phases during one injection - moulding process cycle : closing of the mould , injection of the molten polymer into the mould , pack pressure , cooling while extruder was metering for the next cycle during cooling phase , opening the mould and ejection of article from the mould . the plates were sterilized by gamma irradiation with a nominal dose of 25 kgy . after sterilisation , the plates were submerged in nmp ( 1 - methyl - 2 - pyrrolidinone , 99 %, acros organics , inc ., usa ) for 30 seconds . after submerging the plates were set for 30 minutes on a plastic holder at room conditions at 20 ° c . thickness , length and mass of the plates were measured before submerging and 30 minutes thereafter . dimensions were measured with a slide gauge and mass with an analysis balance . additionally , 30 , 60 and 120 minutes after the submerging of the plate , it was bent to 45 ° angle to find out softening and bending characteristics of the plate . the diffusion depth of the nmp was analysed with smartscope flash optical 3d - measuring device . approximately 1 mm of the material was cut off from the edge of the plate . the depth of the diffusion was measured from the cut cross - section of the plate 120 minutes after submerging . the results of the nmp diffusion after 30 min of submerging are shown in table 3 . the thickness of the plate was increased 13 % and its mass was increased 22 % due to the submerging of the plate in nmp . the increase of the mass can be seen as the diffusion of nmp into the plate . the increase of the thickness is due to the swelling of the outer layer of the plate . the thickness of the swollen outer layer of the plate was ca . 0 . 15 mm . the length was not changed due to the submerging . moreover , 30 minutes after submerging the plate was softened and bendable by hand . resorbable polymer matrix absorbs nmp when immersed into it . thereafter , an implant loaded with nmp is implanted into the body , and nmp is released gradually during a certain period of time . if the rate of releasing is appropriate , nmp owns osteogenic properties . as with almost any pharmaceuticals , the concentration of nmp must be within certain limits , called a therapeutic window . below the window , nmp is inefficacious . correspondingly , above the window , nmp presents an adverse event by inhibiting certain proteins , other molecules or cell lines . the nmp content is preferably between 0 . 05 and 50 weight - %, more preferably between 0 . 1 and 10 weight -%. according to one preferred embodiment of the method of the present invention , nmp is mixed with a polymer matrix or one of its components before the polymer matrix is fashioned into the form of a medical implant . the mixing can take place in an extruder , in a mixer or similar equipment known per se . nmp may be applied to the implant as well by packing said implant into a container with nmp already in the production process . nmp will be absorbed to the polymer matrix of the implant during storage in said container . the polymer composition of the present invention can be fashioned into implants by injection moulding , compression moulding , extrusion or with another melt - moulding process known by persons skilled in the art . example 4 presents one preferred embodiment of the present invention , where the implant is a barrier membrane in guided tissue regeneration ( gtr ) to treat a periodontal defect . the membrane comprises pla / pga - matrix polymers . the membrane is packaged in a slot of a package , such as a plastic blister . the preparation of the membrane is conducted as one stage of surgical operation as follows : 1 . after opening the package , a proper amount of nmp is poured into the membrane slot . the membrane is fully immersed in nmp for an adequate period , for example 30 seconds to 3 minutes , preferably for 30 seconds . 3 . nmp is allowed to diffuse into the polymer matrix of the membrane for 15 to 20 minutes . 4 . the membrane is ready for use as a barrier between the gingival soft tissue and the healing bone tissue and / or periodontal tissues in order to prevent the gingival soft tissue filling the defect side . in the conditions of a normal operating theater temperature and humidity , the membrane stays malleable for several hours . implants of the invention can be used for example in guided bone regeneration applications , where the effect of a nmp loaded barrier membrane is required to avoid soft tissue ingrowth in the area where new bone formation is required , and to enhance bone regeneration . it will be obvious to a person skilled in the art that , as the technology advances , the inventive concept can be implemented in various ways . the invention and its embodiments are not limited to the examples described above but may vary within the scope of the claims .
| 0 |
solids loaded , extrudable , solventless , double - base propellants , also known as composite - modified double - base propellants are formulated by combining liquid plasticizers , solid binders , a high percentage of solid oxidizers , and fillers . initially , an equilibrium saturation solution of a liquid aliphatic hydrocarbon solvent and solutes of soluble and partially soluble liquid plasticizers and fillers is prepared . it is important to recognize that some of the solutes are completely soluble in the liquid aliphatic hydrocarbon solvent while other solutes are only partially soluble . additionally , it must be recognized that during the processing of this propellant some of the solutes will be partially extracted from the solution while other solutes will be extracted from the propellant mix and go into solution . thus , the final solution decanted from the undried and uncured propellant composition will have either the desired equilibrium saturation or it will be close to the desired solution depending on the condition of the initial solvent . there are basically three ways to prepare the equilibrium solution . in the first method , a virgin liquid aliphatic hydrocarbon is used and it is run through the entire process . at the completion of the first run the intermediate solution is decanted from the propellant , the propellant is discarded , and the intermediate solution is saved . this intermediate solution is then run through the entire process a second time . as before , the propellant is discarded but this time the solution decanted at the end of the process contains the proper equilibrium concentrations and it is saved for future use . the second method which can be used in the preparation of the first equilibrium solution is merely estimating the precentages of the various solutes which will utimately be found in the final liquid aliphatic hydrocarbon solution , adding those amounts of liquid plasticizers and fillers to the solvent and mixing these ingredients with the solvent until they are all fully dissolved . the third method , and that which is generally preferred , starts by using the estimation method , described above , and then uses that solution in place of the intermediate solution of method one . although most any liquid aliphatic hydrocarbon will work well in this process , those of heptane , hexane , and octane are preferred , and heptane is most preferred . the soluble and partially soluble liquid plasticizers and fillers which will ultimately be found in the equilibrium solution are only limited by those used in preparing the desired solids loaded propellant . therefore , if a propellant having metriol trinitrate , thiethylene glycol dinitrate , dinormal propyl adipate and ethyl centralite is desired , they should be first dissolved in the liquid aliphatic hydrocarbon . the percentage of each ingredient to be dissolved in the solvent will vary depending on the desired propellant and thus the only way to determine the amount to be initially dissolved will be through experience . once the equilibrium solution has been readied , the solid binder ingredient is mixed into the solution so as to form a first slurry and deagglomerate and bruise the surface of the solid binder ingredient . proper mixing breaks large clumps of binder so as to subsequently allow the plasticizer to evenly coat and penetrate the binder . mixing times and rates vary broadly and depend in many cases on the type of mixing system used . however , it has been found that a good slurry will be formed if the ingredients are mixed for between about 30 and about 60 minutes at between about 3500 and 5000 revolutions per minute . the preferred mixing conditions for preparing this first slurry are about a 30 minute mixing time at about 4000 revolutions per minute . solids binders may range from about 10 to about 40 total weight percent of the propellant although a range from about 15 to about 30 total weight perecent is preferred . appropriate solids binders may be , from 12 - 14 . 14 percent nitrogen nitrocellulose ,. mixed into this first slurry is a first portion of a plasticizer . depending on the desired propellant composition various plasticizers such as metriol trinitrate , triethylene glycol dinitrate , nitroglycerin , and pentaerythritol trinitrate may be used . however , a relatively non - active plasticizer such as metriol trinitrate is preferred . the object of this is to evenly coat the slurried solid binder ingredient with the plasticizer , and thereby prepare it for drying . a ratio which ranges from about one part plasticizer to about five parts binder to about a ratio of about one part plasticizer to about three parts binder is considered functional , however , a ratio of about one part plasticizer to about 4 parts binder is preferred . mixing should take between about 15 and 30 minutes at between about 1000 and about 3000 revolutions per minute . the preferred mixing conditions are about 15 minutes at a rate of about 2000 revolutions per minute . after obtaining the evenly coated slurried solid binder , the excess liquid aliphatic hydrocarbon solution is then separated from the solid binder and saved for future use . the plasticizer coated solid binder is then thoroughly dried to remove all traces of water and make it relatively non - sensative to static electric charges . although the preferred drying conditions are about 24 hours at about 140 ° f ., actual times and temperature may vary from about 24 to about 72 hours and from about 120 to about 140 ° f . the dry coated solid binder is now ready for re - slurrying in a mixture of the previously saved liquid aliphatic hydrocarbon solution and enough liquid aliphatic hydrocarbon to replace that lost during decanting and drying . to properly re - slurry , mixing will range from about 10 to about 30 minutes at about 2000 to about 4000 revolutions per minute . preferred mixing conditions for this step are 10 minutes at 2000 revolutions per minute . after formation of the second slurry , a solid oxidizer is added to the slurry while mixing at about 2000 revolutions per minute . mixing is then continued until a good dispersion is obtained . this should take about 30 minutes at about 4000 revolutions per minute . actual mixing times and rates may however range from about 20 to about 60 minutes at about 3500 to about 5000 revolutions per minute . it is important to carefully mix the oxidizer into the slurry to insure that a good dispersion is obtained . solid oxidizers can vary from about 10 to about 75 total weight percent , however a range from about 40 to about 60 total weight percent is preferred . these oxidizers include nitroguanidine , ammonium perchlorate , ammonium nitrate , hydroxylammonium nitrate , hydroxylammonium perchlorate , cyclotetramethylenetetranitramine and cyclotrimethylenetrinitramine . a preferred group of solid oxidizers includes ammonium perchlorate and ammonium nitrate . after achieving a complete dispersion of solid oxidizers in the slurry , the remaining plasticizer and fillers are mixed into the propellant system . the specific mixing conditions will vary according to the desired propellant , but a mixing time ranging from about 40 to about 100 minutes at about 3500 to about 5000 revolutions per minute will satisfy most requirements . the preferred conditions are about 40 minutes at about 4000 revolutions per minute . depending upon the specific ballistic and tensile requirements , almost any common liquid plasticizers and fillers in almost any combination may be added . the plasticizers may be metriol trinitrate , triethylene glycol dinitrate , nitroglycerin , pentaerythritol trinitrate , dinormal propyl adipate , dibutyl phthalate , dimethyl phthalate , diethyl phthalate , dioctyl phthalate , diisobutyl azelate , dimethyl sebacate , dibutyl sebacate and mixtures thereof . the fillers may be any one or any combination of ballistic additives used in the art , however those of candelilla wax , ethyl centralite , resorcinol , 2 - nitro diphenyl amine , aluminum , lead oxide , lead stamate , lead salicylate , lead β resorcylate , copper salicylate , copper β resorcylate and mixtures thereof are preferred . fillers can vary from greater than 0 to about 15 total weight percent although a range of about 0 . 1 to about 5 total weight percent is preferred . as these plasticizers and fillers are mixed into the propellant system they coat the solid oxidizer and begin to penetrate the coated binder . if insufficiently mixed , the coated solid binder and solid oxidizer will not receive an even coating of plasticizer and fillers , and undesirable ballistic and physical properties may result . after throughly mixing all propellant ingredients the excess liquid aliphatic hydrocarbon solution is decanted from the wet propellant and saved for future use . the propellant is then dried and cured until the binder is fully plasticized and the mix is extruded into strands . by way of example not by limitation the following process and formulations are given . in a cowles 5vtv dissolver , 1 . 54 pounds of dibutyl phthalate , 0 . 94 pounds of metriol trinitrate ( mtn ), 0 . 20 pound of ethyl centralite ( ec ), 0 . 10 pound of triethylene glycol dinitrate ( tegdn ), and 48 . 0 pounds of pure heptane are mixed for 5 minutes at 2000 rpm . to this is added 3 . 83 pounds of water - wet , 12 . 0 % n nitrocellulose and this combination is mixed for 30 minutes at 4000 rpm ; then 0 . 83 pound of mtn is added and mixing is continued for 15 minutes at 2000 rpm . the heptane is decanted and saved . the plasticizer coated nc is dried one day at 140 ° f . the dried coated nc , used heptane and 7 . 6 pounds of new heptane is mixed for ten minutes at 2000 rpm in the cowles 5vtv mixer . while the mixer is still operating , 4 . 8 pounds of ammonium perchlorate ( ap ) is added and mixed for 10 minutes at 2000 rpm and 30 minutes at 4000 rpm . still while the mixer is in operation , a mixture of 2 . 53 pounds of mtn , 0 . 228 pound of tegdn , 0 . 18 pound of ec , 0 . 26 pound of resorcinol , 20 grams of candelilla wax and 0 . 60 pound of dibutyl phthalate are added slowly . the mix is continued for 40 minutes at 4000 rpm . the heptane is then decanted for use in another mix and the mix is dried for 4 days at ambient temperature , 1 day at 120 ° f ., 3 days at 140 ° f . and 1 day at 170 ° f . the mix is then extruded into 1 / 4 inch strands . ______________________________________other formulations include : i ii iii______________________________________ ( 12 . 0 % n ) nc 16 . 2 % 21 . 3 % 26 . 4 % mtn 18 . 5 % 22 . 3 % 26 . 0 % tegdn 1 . 7 % 3 . 1 % 4 . 5 % dinormal propyl adipate 1 . 0 % 1 . 0 % 1 . 0 % ec 2 . 0 % 1 . 7 % 1 . 5 % resorcinol 0 . 5 % 0 . 5 % 0 . 5 % candelilla wax 0 . 1 % 0 . 1 % 0 . 1 % ap 60 . 0 % 50 . 0 % 40 . 0 % ______________________________________ thus it is apparent that there is provided by this invention a solid loaded , extrudable , solventless , double - base propellant having a high percentage of solids and the method of making this propellant . it is to be understood that what has been described is merely illustrative of the principles of the invention and that numerous arrangements in accordance with this invention may be devised by one skilled in the art without departing from the spirit and scope thereof .
| 2 |
the invention shall be described in detail below , but it is not to be construed as being limited thereto . proof in mouse and human showing that the gene responsible for systemic carnitine deficiency ( scd ) is octn2 the inventors have previously isolated human cdna encoding a protein having an activity to transport carnitine in a sodium - ion dependent manner , and also the corresponding mouse cdna ( japanese patent application no . hei 9 - 260972 , japanese patent application no . hei 10 - 156660 ). the nucleotide sequences of the human and mouse octn2 cdna isolated by the inventors are shown in seq id no : 2 and 4 , respectively , and the amino acid sequences of the proteins encoded by these cdnas are shown in seq id no : 1 and 3 , respectively . the inventors drew up a working hypothesis that octn2 might be the gene responsible for systemic carnitine deficiency , and conducted experiments to prove this . the juvenile visceral steatosis ( jvs ) mouse was generated due to a mutation in the c3h . oh mouse . this jvs mouse shows symptoms similar to systemic carnitine deficiency patients , and shows an extremely low carnitine concentration within its blood and tissues . this phenotype is inherited by autosomal inheritance . from the above facts , the jvs mouse is considered to be a mouse model for systemic carnitine deficiency ( hashimoto , n . et al ., gene - dose effect on carnitine transport activity in embryonic fibroblasts of jvs mice as a model of human carnitine transporter deficiency , biochem pharmacol , 1998 , 55 : 1729 - 1732 ). the inventors examined the octn2 gene arrangement of the jvs mouse . specifically , whole rna was extracted from the kidney of a jvs homologous mouse , cdna was synthesized , jvs mouse octn2 cdna was amplified using this synthesized cdna as the template by rt - pcr , and the sequence was examined by direct sequencing . the amplification reaction by pcr was conducted as follows . for the 5 ′ side fragment , the primers monb 31 ( 5 ′- gataagcttacggtgtccccttattcccatacg - 3 ′/ seq id no : 22 ) and monb 20 ( 5 ′- cccatgccaacaaggacaaaaagc - 3 ′/ seq id no : 23 ) were prepared . then , amplification was done within a reaction solution ( 50 μl ) containing , cdna , 5 μl of 10 × kod buffer ( toyobo ), 5 μl of 2 mm dntps , 2 μl of 25 mm mgcl 2 , 0 . 5 μl of kod dna polymerase ( toyobo ), 1 μl of 20 μm monb 31 primer , and 1 μl of 20 μm monb 20 primer at 94 ° c . for 3 min , 30 cycles of “ 94 ° c . for 30 sec , 50 ° c . for 30 sec , and 74 ° c . for 1 min ”, and 72 ° c . for 10 min . as for the 3 ′ side fragment , the primers monb 6 ( 5 ′- tgtttttcgtgggtgtgctgatgg - 3 ′/ seq id no : 24 ) and monb 26 ( 5 ′- acagaacagaaaagccctcagtca - 3 ′/ seq id no : 25 ) were prepared , and amplification was done within a reaction solution ( 50 μl ) containing cdna , 5 μl of 10 × extaq buffer ( takara ), 4 μl of 2 . 5 mm dntps , 1 μl of a mixture of extaq dna polymerase ( takara ) and anti taq antibody ( taqstart antibody ™, clontech ), 1 μl of 20 μm monb 6 primer , and 1 μl of 20 μm monb 26 primer , at 94 ° c . for 2 min , 30 cycles of “ 94 ° c . for 30 sec , 60 ° c . for 30 sec , and 74 ° c . for 2 min ”, and 72 ° c . for 10 min . sequencing revealed that the codon encoding the 352 nd leucine ( ctg ) was mutated to a codon encoding arginine ( cgg ) ( fig1 ). this mutation can be detected by restriction fragment length polymorphism ( pcr - rflp ) due to the presence of the cfr13i restriction enzyme site . this method revealed that the jvs homologous mouse ( jvs / jvs ) had this mutation in both alleles , and that the heterologous mouse ( wt / jvs ) has both the mutated and wild type alleles ( fig2 left ). this mutation was also found in the c57bl jvs mouse in which the genetic background has been replaced with that of the c57bl / 6 mouse by backcrossing 12 times or more ( fig2 right ). since the c57bl jvs mouse was constructed after a series of selections using the jvs phenotype as an index , the jvs phenotype and octn2 mutations are considered to be very closely associated . next , the effect this mutation has on the carnitine transporting activity was examined . plasmid dna expressing wild - type mouse octn2 , and those expressing mutated octn2 were separately introduced into bek293 cells , and then , carnitine transporting ability was measured similar to the assay of human octn2 described in japanese patent application hei 10 - 156660 ( fig3 ). this revealed that although wild - type mouse octn2 shows a carnitine transporting activity similar to human octn2 , the mutated octn2 has absolutely no activity . however , both proteins were confirmed to be expressed at a similar amount by a western blotting using an antibody against the c - myc epitope sequence ( nh2 - eqkliseedl - cooh ; seq id no : 26 ) added to the c terminus ( fig4 ). thus , the jvs mouse is thought to have developed the disease due to a functional deletion mutation of the octn2 gene . a database search using human octn2 cdna sequence revealed that the human octn2 genomic dna sequence has been decoded by lawrence berkeley national laboratory ( lbnl ) of the united states as a part of the human genome project . however , it was only recorded as several cosmid clone sequences , therefore , the inventors determined a complete human octn2 genomic dna sequence ( seq id no : 5 ) by comparing with human octn2 cdna sequence and suitably combining the clone sequences . the human octn2 gene is an about 26 kb gene comprising ten exons and nine introns . the eight pairs of primers shown below , which can amplify all the exons as eight fragments , were prepared from this gene arrangement . specifically , ocn2 43 ( 5 ′- gcaggaccaaggcggcggtgtcag - 3 ′, seq id no : 6 ) and ocn2 44 ( 5 ′- agactagaggaaaaacgggatagc - 3 ′, seq id no : 7 ) for exon one ; ocn2 25 ( 5 ′- agatttttaggagcaagcgttaga - 3 ′ seq id no : 8 ) and ocn2 26 ( 5 ′- gaggcagacaccgtggcactacta - 3 ′, seq id no : 9 ) for exon two ; ocn2 27 ( 5 ′- ttcacacccacttactggatggat - 3 ′ seq id no : 10 ) and ocn2 50 ( 5 ′- attctgttttgttttggctctttt - 3 ′, seq id no : 11 ) for exons three and four ; ocn2 31 ( 5 ′- agcagggcctgggctgacatagac - 3 ′, seq id no : 12 ) and ocn2 32 ( 5 ′- aaaggacctgactccaagatgata - 3 ′, seq id no : 13 ) for exon five ; ocn2 33 ( 5 ′- tctgaccacctcttcttcccatac - 3 ′, seq id no : 14 ) and ocn2 34 ( 5 ′- gcctcctcagccactgtcggtaac - 3 ′, seq id no : 15 ) for exon six ; ocn2 35 ( 5 ′- atgttgttccttttgttatcttat - 3 ′, seq id no : 16 ) and ocn2 36 ( 5 ′- cttgttttcttgtgtatcgttatc - 3 ′, seq id no : 17 ) for exon seven ; ocn2 37 ( 5 ′- tatgtttgttttgctctcaatagc - 3 ′, seq id no : 18 ) and ocn2 40 ( 5 ′- tctgtgagagggagtttgcgagta - 3 ′, seq id no : 19 ) for exon eight and nine ; and , ocn2 41 ( 5 ′- tacgaccgcttcctgccctacatt - 3 ′, seq id no : 20 ) and ocn2 42 ( 5 ′- tcattctgctccatcttcattacc - 3 ′, seq id no : 21 ) for exon 10 . next , human octn2 gene mutations in three families that have systemic carnitine deficiency patients , but no blood relationships were examined . the analysis is done by amplifying all the exons using the above primers and genomic dna prepared from blood cells as the template , and subjecting the amplified products into direct sequencing . the amplification reaction by pcr was done within a reaction solution ( 50 μl ) containing 100 ng of genomic dna , 5 μl of 10 × extaq buffer ( takara ), 4 μl of 2 . 5 mm dntps , 1 μl of a mixture of extaq dna polymerase ( takara ) and anti taq antibody ( taqstart antibody ™, clontech ), and 1 μl of each of the 20 μm primers . the reaction conditions were , 94 ° c . for 2 min , 36 cycles of “ 94 ° c . for 30 sec , 60 ° c . for 30 sec , and 74 ° c . for 2 min ”, and 72 ° c . for 10 min . however , in the case of exon one and exon five amplification , a reaction solution ( 50 μl ) containing 100 ng genomic dna , 25 μl of 2 × gc buffer 1 ( takara ), 8 μl of 2 . 5 mm dntps , 0 . 5 μl of la taq dna polymerase ( takara ), and 1 μl of each of the 20 μm primers , was used . in the first family ( kr family ), a 113 bp deletion was found in first exon of the octn2 gene of a systemic carnitine deficiency patient ( fig5 ). this deletion affects the initiation codon and thus , a complete protein will not be produced . the next usable atg codon present in the correct frame is at nucleotide no . 177 , and in this case , it is thought that at least two transmembrane regions will be deleted . the two systemic carnitine deficiency patients in this family were found to contain this mutated octn2 gene in both alleles . on the other hand , the parents and the two brothers of the patient , who have not developed the disease , carry the mutation on just one allele . in the second family ( ak family ), the systemic carnitine patients were found to contain two types of mutated octn2 genes . one mutation was a cytosine insertion just after the initiation codon , which is thought to cause a frame shift and prevent the proper protein from being produced ( fig6 ). the other mutation is a single base substitution ( g to a ) in the codon encoding the 132 nd tryptophan ( tgg ). this mutation had altered the codon into a stop codon ( tga ) ( fig7 ). these mutations are thought to prevent the production of active octn2 proteins in patients . these mutations can be detected by pcr - rflp analysis using bcni , nlaiv restriction enzymes , respectively , which revealed that the patient &# 39 ; s parents who have not developed the disease , had one of each of the mutations , and the patient &# 39 ; s sisters who have not developed the disease , do not have any mutated genes ( fig8 ). in the third family ( th family ), a mutation ( ag to aa ) was found in the splicing site in the 3 ′ end of the intron eight of the octn2 gene ( fig9 ). this mutation prevents the gene from undergoing normal splicing , and thus , it is expected that the normal protein would not be produced . sequencing analysis showed that the systemic carnitine deficiency patient belonging to this family had this mutation in both alleles . on the other hand , the patient &# 39 ; s parents and one of the brothers who have not developed the disease had one mutated allele . the above results revealed that systemic carnitine deficiency is a genetic disease caused by mutations in the octn2 gene . thus , the present invention enables definitive diagnosis , prenatal diagnosis and such , of systemic carnitine deficiency by examining mutations in the octn2 gene using analyses described herein , as well as other methods . the present invention also enables treatment of systemic carnitine deficiency by treatments such as gene therapy using the octn2 gene . the present invention revealed that the octn2 gene is the gene responsible for systemic carnitine deficiency , thus enabling tests for the disease by detecting mutations in the octn2 gene and its protein . moreover , the present invention facilitates treatment of systemic carnitine deficiency by utilizing the octn2 gene and its protein .
| 2 |
with reference to fig1 , a schematic of the present invention shows a 180 degree lengthwise cross - section of the packer . a mandrel 1 has a running thread 16 with a tension or shear parting point , or connection , 17 located below the running thread . the mandrel 1 may be shortened by more than one means at point 17 , i . e ., any type of shear , tension , or locking device that can be separated in a fashion to shorten the mandrel . a setting tool ( not shown ) is made up to running thread 16 in order to convey the packer into the well . a millable , frangible or disintegrable disc 14 is a fluid barrier and is part of mandrel 1 or can be attached and sealed to mandrel 1 in some fashion . cone surface 3 is shown of the o . d . of mandrel 1 . slip segments 4 are expandable by sliding up coned surfaces at 2 and 3 . seal 5 , commonly known as a packing element , is located between slip segments 4 and extrusion barriers 6 . seal 5 is compressed and expanded between slip segments 4 . the slip segments 4 have gaps between them that increase in size as the slip segments travel up the cones 2 and 3 . the extrusion barriers 6 are segmented and attached to the slip segments 4 so that the gaps between the slip segments 4 are always bridged to prevent extrusion of seal 5 as the slip segments 4 travel outward to meet the i . d . of the casing . as an alternative , the extrusion barriers 6 may be manufactured as part of the slip segments 4 so that the slip segments 4 themselves bridge the gaps between the slip segments as the slip segments expand outward . shear pins 7 secure the slip segments 4 in the retracted position while the packer is run into the well . the slip segments 4 have dovetail shaped runners 12 that slide in dovetail grooves 11 at cone surfaces 3 and 2 . the runners 12 and grooves 11 may be of any profile and serve to retain the slip segments to both mandrel 1 and cone 8 . furthermore , the runners and grooves provide a means to equally space the slip segments 4 around the perimeter of the plug . additionally , the runners and grooves provide a means to rotationally lock the slip segments 4 , the mandrel 1 , the cone 8 , and the lock ring 9 together during milling operations . when the slip segments engage the inner casing wall , all components become rotationally locked together to help prevent spinning of the packer parts . the lock ring 9 threads are arranged in a manner so if right - hand rotation during milling rotates lock ring 9 to the right , the lock ring 9 rotates down thread 10 , until it bottoms out at the end of thread 10 . once bottomed out , it 9 becomes rotationally locked to the mandrel 1 , rotationally locked to the cone 8 , which is rotationally locked to slip segment 4 , while the teeth 19 of slip segment 4 are penetrated into the inner casing wall . the slip segments 4 are positioned almost 360 degrees around the o . d . of the mandrel 1 . each slip segment has a series of teeth 19 , or some other casing penetrating profiles such as hard inserts positioned on the o . d . of the slip segments as shown in fig4 . in fig4 the slip segment 4 is shown without teeth 19 , but instead inserts or coating 25 . inserts or coating 25 may be ceramic balls , carbide balls , other geometries made of carbide or ceramic , proppant or sand , or other materials . inserts or coatings 25 may be of any pattern on the o . d . of slip segment 4 and can be either a structured or random pattern . sand or proppant , for example 20 - 40 or larger sizes , gravel pack sand or fracturing proppant made by santrol or hexion , or carboceramics , can be used in or on the surface of slip segment 4 and can be attached to the surface with bonding materials or imbedded into the base material . those in the gravel pack or frac pack business know that sand or proppant can stick downhole tools in the well , so it would be obvious that sand or proppant can be used on packer slips to hold tools in place relative to pipe or casing . the objective of using inserts or coatings 25 is to improve millability of the slip segments whereby the base material of the slip segments are easily machined and the inserts or coating 25 are hard enough to penetrate the casing i . d . another objective to inserts or coating 25 is to minimize casing damage on the i . d . of the casing . teeth marks from slips can increase susceptibility of the casing to corrosion and other failure mechanisms , especially in chrome based materials . the teeth , inserts , or coatings are sufficiently hard to penetrate the inside of the casing wall in order to grip the wall and prevent the packer from moving relative to the casing . the slip segments have an o . d . that is machined to be almost equal to the i . d . of the casing . the slip segments are machined to minimize any gaps between the o . d . of the slip segments and the i . d . of the casing . similarly , the angles on the i . d . of the slip segments are machined to almost match the o . d . of the cone surfaces 2 and 3 when the slip is fully expanded , in order to minimize gaps between the parts . the cone 8 has a surface 2 . the setting tool ( not shown ) pushes against surface 18 while pulling on threads 16 during the setting operation . the cone 8 has an internal thread that engages body lock ring 9 . body lock ring 9 can ratchet freely toward the slip segments 4 but engages and prevents movement away from the slip segments 4 by engaging the threads 10 on the top o . d . of the mandrel 1 . lugs 13 engage slots 15 if plugs stack during milling so the relative plugs don &# 39 ; t spin during milling . fig2 shows the packer in the “ set position ”. in operation , also see fig1 , the setting tool ( not shown ) pushes on cone 8 , at or near surface 18 , and simultaneously pulls on thread 16 of mandrel 1 . cone 8 moves toward the slip segments 4 and seal 5 and in the process expands the slip segments 4 up cones 2 and 3 and compresses seal 5 between slip segments 4 and extrusion barriers 6 . expansion of slip segments 4 and seal 5 continues until sufficient contact is made with the i . d . of the casing to achieve slip tooth 19 penetration in the inner wall of the casing . at this point the teeth of the slip segments have nearly closed any seal 5 extrusion gaps between the o . d . of the slip segments 4 and the i . d . of the casing . extrusion gaps have been minimized nearly 360 degrees around the packer . additionally , slip load has been nearly evenly distributed around the i . d . of the casing to minimize distortion of the casing . slip segment 4 distribution around the o . d . of the mandrel 1 is more uniform due to the rails 12 and grooves 11 keeping the slip segments equally spaced around the packer . also , extrusion gaps have been closed where the i . d . of the slip segments contact the surfaces of the cones at 20 and 21 . at this point , the extrusion gaps between the slip segments 4 are bridged with the extrusion barriers 6 . in the set position , fig2 , the lock ring 9 has traveled over thread 10 . thread 10 is designed to prevent reverse movement of lock ring 9 , so that lock ring 9 holds cone 8 in a firm position under slip segment 4 while maintaining compression on seal 5 and keeping the slip segments 4 expanded into the i . d . of the casing . once sufficient load is applied to cone 8 and thread 16 of mandrel 1 , in order the drive teeth 19 into the i . d . of the casing and create an adequate seal with seal 5 , the upper portion of mandrel 1 with thread 16 , disconnects at point 17 . the upper portion 22 of mandrel 1 comes out of the hole with the setting tool ( not shown ) and leaves a short section of mandrel 1 in the well . obviously , with the outer packer components 4 , 5 , and 8 compressed closely together in combination with the short section of mandrel 1 , the remaining portion of the plug is not only very short , but requires less material and length to mill out . the amount of material to mill out is minimized by taking as much material out of the packer components as possible , while still maintaining enough strength to hold well pressure differentials . for example , notice on mandrel 1 that the i . d . is bored out and at the lower end of mandrel 1 below the angled surface 3 , material has been removed at location 23 . as a result , the packer becomes a minimum material packer by removing material that is not needed to structurally maintain a pressure differential in the well bore . also , to enhance millability of the packer , highly millable materials may be used , such as cast iron , or some other easily machinable material . fig3 shows a cross - sectional end view of the slip segments 4 in the expanded position . in the expanded and set position , gaps exist between each slip segment 4 . an extrusion barrier 6 is attached to the slip segment 4 by an attachment means , such as drive - loc pins 24 . the extrusion barriers 6 cover the gaps between each slip segment 4 to form a seal 5 backup surface to prevent seal 5 extrusion past the slip segments 4 . since the teeth 19 of the slip segments penetrate the inside of the casing wall , any extrusion gaps are closed off on the outside of the slip segments 4 . since the i . d . of the slip segments 4 closely matched the o . d . of the tapered surfaces 2 and 3 , the extrusion gaps on the inside of the slip segments 4 are reduced to a minimum . this described geometry forms a near metal - to - metal seal backup system in the packer which is very desirable for high pressure and temperature well conditions . fig5 shows a similar packer , or frac disc , to fig1 . the fig5 packer has the same features mentioned above except it does not have an upper set of slip segments 4 , therefore , it would normally be used in situations where the packer is only required to hold pressure from above . this version would be a lower cost version than the one shown in fig1 and cone 8 could be replaced with lock ring housing 26 . in order to further simplify the packer design , the extrusion rings 6 could be eliminated and the packing element , or seal 5 , could have a backup built into the seal system 5 . in low pressure applications , or in cases where a positive seal with the i . d . of the casing is not needed , extrusion backup 6 and other backups in the packing element could be eliminated . fig6 shows a similar packer , or frac disc , to fig1 . the fig6 packer has many of the same features mentioned above except it does not have the upper set of slip segments 4 , or the packing element 5 , or the anti - extrusion devices 6 . the cone 8 is replaced with cup retainer 27 and the packing element 5 is replaced with the packing cup 28 . obviously the packing cup 28 only holds pressure from above generated from pressure operations occurring above the cup . this design allows opportunities to further minimize the material left in the well for milling out , for example , by eliminating the upper slip segments 4 and leaving a shorter mandrel 1 by moving separation point 17 downward .
| 4 |
referring now to fig1 there is shown a portion of a thin film test sampling chamber which is denoted generally by the numeral 2 . the test sample being assayed in this case is blood plasma or serum and it is being assayed for the presence of tsh ( thyroid specific hormone ). the chamber 2 has a surface or wall 4 to which a plurality of ligands 6 is affixed . in this case the ligands 6 will be specific to a first surface epitope of the tsh molecules being assayed . fig2 shows the chamber 2 after it has been filled with a mixture of the plasma being assayed and fluorescent reporter particles 8 . the particles 8 include ligands that are specific to a second epitope on the target analyte so that some of the particles will bond with target analyte molecules prior to being placed in the testing chamber 2 . fluorescent reporter particles that bond to the target analyte molecules 12 are designated by the numeral 10 . the free unbound fluorescent reporter particles are designated by the numeral 8 in fig2 . the target analytes , in this case tsh , are designated by the numeral 12 in fig2 . fig2 shows several of the captured analytes 12 and a number of the free unbound fluorescent reporter particles 8 . the unbound particles 8 tend to move in the sample 4 as indicated schematically by arrows 14 . this being the case , when the sampling chamber 2 is imaged as shown schematically in fig3 , the fluorescent signal from the captured reporter particles ( on the target analytes ) will be relatively bright in the sample , as indicated by the numeral 10 ′ in fig3 , and the fluorescent signal from the free reporter particles will be relatively dim or blurry , as indicated by the numeral 8 ′ in fig3 . thus the number of captured target analytes in the sample 4 can be easily determined by imaging the sample 4 . since the volume of the sampling chamber 2 is controlled , the volume of the sample 4 in the chamber 2 is known and the target analyte count can be measured in target analyte / sample volume units . referring now to fig4 - 6 , there is shown an embodiment of the device of this invention which is able to sample a larger volume of the sample being assayed . this embodiment includes a sample reservoir 16 in which a larger sample of the plasma or serum to be assayed is placed . the reservoir 16 can hold up to 1 ml , for example , of the sample . the reservoir 16 can have a flexible upper surface which can be depressed so as to compress the sample and pump it through the sample testing chamber component 2 of the assembly . the testing chamber 2 includes a control area 20 which is devoid of capture ligands 6 and the sampling area 2 ′. this control area is not shown to scale and is much smaller than the capture area or if desired may be connected with a diffusion barrier from the capture area , which includes the analyte capture ligands 6 . when the reservoir 16 is compressed , the sample will move in the direction of the arrows a through the sampling area 2 ′ and the control area 20 at the same time . after passing through the areas 2 ′ and 20 , the sample will be deposited in a reception reservoir 18 which may contain a sample absorbent , if so desired . fig6 illustrates the image that will be detected in the sample chamber 2 ′ after the sample has been moved there through . the image will show the bright images 10 of the captured reporter particles , and will show the dimmer and blurrier fluorescent signals 8 from the free or non - captured reporter particles . if the sample test is proven to be valid , then the control area 20 will only include the blurry fluorescent signals 8 . the inclusion of the reservoirs 16 and 18 will allow a greater amount of the sample to be assayed , and therefore can provide more valid test results . the broken line 11 in fig4 - 6 indicates an impermeable barrier between the sampling area 2 ′ and the control area 20 which prevents sample crossover between the two areas . many modifications of this invention with respect to its construction are possible within the description of the invention . they include the area of the assay chamber ranging from 1 mm 2 to 400 mm 2 , with a height of 2 microns to 10 microns . the localized bound antibodies are preferably placed in a homogeneous pattern , with the adjacent control area having antibodies with no affinity for the desired analyte , or no antibodies at all . it is the control area that is desirable to assure the absence of , or to control for nonspecific detection of , points of higher intensity that do not correspond to a labeled analyte . it is preferable to limit the diffusion of the sample from the control area to the capture area in order to obtain a more accurate volume determination of the amount of sample that is exposed to the capture antibody . it is also possible , if desired to perform as standard curve where multiple concentrations of known analyte are placed in the analysis chamber and analyzed under similar conditions . the number of detectable discrete signal areas per area imaged in the capture area minus the detectable discrete signals per area imaged in the control area are plotted against the known concentrations of analyte to obtain the standard curve . the results may be used to calculate the concentration of analyte in unknown samples that are analyzed under identical conditions as the standard curve . probe signal amplification such as rcat ( rolling circle amplification technology ) could be used in place of the nanoparticles since they have the effect of producing localized fluorescent particles . since many changes and variations of the disclosed embodiment of the invention may be made without departing from the inventive concept , it is not intended to limit the invention except as required by the appended claims .
| 6 |
the detailed description provided below in connection with the accompanying drawings is intended as a description of the present examples and is not intended to represent the only forms in which the present examples may be constructed or utilized . the description sets forth at least some of the functions of the examples and / or the sequence of steps for constructing and operating the examples . however , the same or equivalent functions and sequences may be accomplished by different examples . although the present examples are described and illustrated herein as being implemented for building construction , the techniques described are provided as examples and not limitations . as those skilled in the art will appreciate , the present examples are suitable for application in a variety of different types of construction or the like . fig1 a is a diagram showing an end view 100 a of an example fabricated timber with a 3 - dimensional view 100 b of the same example fabricated timber illustrated in fig1 b . such a timber according to this example is typically fabricated with two vertical members ( e . g ., members 110 and 120 ) of thickness t v and height h disposed on a horizontal member ( e . g ., member 130 ) of thickness t h and width w , each of the three members having substantially the same length l . in one example , the length l of the various members is from one to thirty feet , the height of the vertical members is from three to fifty inches , the width of the horizontal member is from three to thirty inches , and the thickness of the various members is from one to four inches . in other examples , the lengths l of the members may vary from one another , as may the thicknesses t v of 110 , t v of 120 , and t h of 130 . the surface measured by height h of the vertical members ( e . g ., 110 and 120 ) may represent a vertical plane of the members , and the surface measured by width w of the horizontal member ( e . g ., 130 ) may represent a horizontal plane of the member . the term “ substantially ” as used herein typically indicates “ according to plan ”, “ nominally ”, “ conventionally ”, and “ customary ” in relation to the arts of house - scale building construction as known to those of average skill in the art . the term “ from n to m & lt ; units & gt ;” as used herein ( e . g ., from one to thirty feet ) typically refers to a specific measurement based on a particular unit of measure ( e . g ., feet or inches or the like ) that is ≧ n and ≦ m . for example , eight feet is a distance in feet that is from one to thirty feet . thirty - nine feet , on the other hand , is not from one to thirty feet . one vertical member 110 is typically disposed length - wise atop the left side l of horizontal member 130 , and the other vertical member 120 is typically disposed length - wise atop the right side r of horizontal member 130 , as illustrated in fig1 b . vertical members 110 and 120 typically have substantially the same height h . each vertical member ( e . g . 110 and 120 ) sits atop the horizontal member ( e . g ., 130 ) such that its height h is at an angle that is substantially perpendicular to or at a substantially 90 degree angle to the width w of the horizontal member ( e . g ., 130 ). the length l of supported vertical member 110 typically extends down the length l of horizontal member 130 , and the length l of supported vertical member 120 also typically extends down the length l of horizontal member 130 . vertical members 110 and 120 are typically disposed length - wise atop horizontal member 130 so as to be substantially parallel with each other ( e . g ., 160 ), and to be substantially parallel with outer sides l and r of horizontal member 130 . in one example , the shape of each member may generally be described as cuboid comprising three opposing pairs of rectangular faces . in some examples , vertical members 110 and 120 are fastened to horizontal member 130 using fasteners ( e . g ., 150 ) such as nails , screws , bolts , staples , pins , dowels , pegs , spikes , ties , strapping , adhesive , or the like . in one particular example , fastener 150 represents conventional 16d nails every n inches on center . the term “ every n inches on center ” as used herein refers to a fastener ( e . g ., a nail ) installed so as to fasten the vertical member to the horizontal member as illustrated in fig1 a , with such a fastener installed at least every n inches along the length l of the vertical and horizontal members , each such fastener approximately centered between the inner vertical face f i of the vertical member ( e . g ., 110 and 120 ) and the outer vertical face f o of the horizontal member ( e . g ., 130 ). one example of n may be 8 . in other examples , other types or sizes of fasteners may be installed at other increments along the length l of the vertical and horizontal members . in further examples , a fabricated timber may be cast , extruded , molded , hewn , carved , cut , milled , or otherwise fabricated as a single piece rather than fabricated of separate members 110 , 120 , and 130 as shown in the examples of fig1 a and 1 b . note that the horizontal and vertical members of a fabricated timber form a channel 180 . this channel may be used for installing utilities such as electrical wires , gas and / or water lines , ducting , and the like . this channel may optionally be filled with insulation . blocking may be added at the ends to keep insulation in , or ends may be covered with plastic , cardboard , or any other suitable material or the like to retail any insulation inside the fabricated timber . the term “ blocking ” as used herein typically refers to pieces of wood or other material ( e . g ., 224 ) disposed between members ( e . g ., 110 and 120 ) to provide support , attachment sites , or brace against lateral - torsion buckling , or the like . the composition of fabricated timbers ( e . g ., 100 ) as described herein is not limited to wood , but may be plastic , fiber - cement , metal , laminated materials , composites , or the like , or any combination of such . in one example , conventional 2 × lumber has been shown to be an inexpensive and readily available choice of materials that is simple to work with and that only requires commonly - available skills and tools . the term “ 2 × lumber ” or “ two - by lumber ” as used herein generally refers to softwood or conifer sized to nominal standardized dimensions as commonly used in construction of wood - buildings and the like , where the number ‘ 2 ’ in “ 2 ×” typically refers to the nominal pre - dried 2 - inch thickness of the lumber which typically measures about 1 . 5 inches once dried . such 2 × lumber used in the construction of fabricated timbers and the like is typically kiln dried or the like . note that other types and sizes of lumber may also be used in fabricated timbers , including hardwood , rough - cut wood , or wood of thicknesses less than or greater than about 1 . 5 inches , etc . the only factor limiting the composition of a fabricated timber 100 is that it should possess certain attributes as described herein below . in the example where members 110 , 120 , and 130 are each separate members , one attribute that these members should possess is a common shrinkage characteristic . the term “ shrinkage characteristic ” as used herein refers to expected amounts and directions of shrinkage over time and / or under particular conditions for a particular material ( e . g ., wood , etc ). further , should the material from which members ( e . g ., 110 , 120 , and 130 ) are fabricated include a grain ( as with e . g ., wood , fiber - cement , etc ), the grain of each member should be oriented in substantially the same plane , such as a horizontal plane . such grain alignment may result in shrinkage over time that is relatively consistent in direction and amount between each of the members . further , any given member ( e . g ., 110 , 120 , and 130 ) may actually comprise multiple separate members of various lengths positioned end - to - end resulting in an overall length of l . the term “ grain ” as used herein typically refers to an overall direction of a pattern of fibers or the like of a material such as that from which members of a fabricated timber are comprised . the term “ fabricated timber ” as used herein refers to a statutory article ( s ) of manufacture constructed according to various example methods described herein and that is configured for possessing various attributes specified herein . the term “ fabricated timber ” does not refer to any pre - existing article ( s ) of manufacture or the like . nor does it suggest any pre - existing method ( s ) of construction or the like . in one example of a fabricated timber 100 , a vertical member ( e . g . 120 ) is disposed atop a horizontal member ( e . g ., 130 ) such that the outer portion of the vertical member overhangs the horizontal member resulting in a reveal , such as reveal r 140 . either or both vertical members may be disposed to provide such a reveal r 140 . such a reveal is typically from 0 % up to about 50 % of the thickness t v of the vertical member . such a reveal can be used for , among other things , a location for chinking or the like and / or running wiring , plumbing , and / or other utilities or the like as described below . in one example , a reveal up to ¾ inch ( about ¼ inch being preferred ) is provided for chinking or the like . the term “ reveal ” as used herein typically refers to a side of an opening between an outer surface and an inner surface . an example of such a side of an opening is provided by r 140 with respect to the outer surface of member 120 ( opposite f i ) and to the inner surface f o of member 130 . in another example of a fabricated timber 100 , a vertical member ( e . g . 120 ) is positioned atop a horizontal member ( e . g ., 130 ) such that no reveal is provided , but such that the outer face of the vertical member is substantially flush with the outer side of the horizontal member instead . such a “ no reveal ” configuration may provide for stacked timbers that have an appearance of a square log with a height that is the combined height of the stacked timbers where the horizontal interfaces between the stacked logs are dressed so as to be substantially non - visible . other “ no reveal ” configurations are also acceptable , as described below . the term “ dressed ” (“ dressing ”, “ dress ”, and the like ) as used herein typically indicates treating the outside faces of individual or stacked fabricated timbers and / or interfaces of stacked fabricated timbers to have a desired appearance . for example , it may be desirable for the outside faces of fabricated timbers to have the appearance of a square log , a peeled log , and / or a rough - hewn log , or the like . in one example , the outside faces and / or interfaces of such timbers may be distressed using a chainsaw or the like to produce an appearance of a rough - hewn log . interfaces may be filled with wood filler or the like to hide them before or after distressing . such dressing or distressing may be performed prior to timbers being stacked , or after stacking , or both . the term “ desired ” as used herein typically refers to some quality or characteristic or the like that is expected as a result of some action , design , planning , or the like . other aspects of the term “ dressed ” as used herein may include staining , tinting , painting , or otherwise coloring , finishing , and / or otherwise treating the faces , visible portions , and / or interfaces of fabricated timbers . other examples may include sealing and / or waterproofing or the like . another example may include chinking , such as with conventional chinking , cement , sand mortar , flexible vinyl chinking , or the like . conventionally , chinking is used to seal gaps between logs . in the case of fabricated timbers , chinking is primarily used for aesthetic reasons and to obtain a conventional chinked appearance or the like . various attributes that a fabricated timber 100 configured for building construction should possess include the capability of sustaining various loads including at least dead loads , live loads , and environmental loads . the noun “ building ” as used herein typically refers to a structure ( generally enclosed by walls and a roof ) constructed to provide support and shelter for an intended occupancy . the term “ occupancy ” as used herein typically refers to the purpose for which a building or other structure , or portion thereof , is used or intended to be used . the term “ load ” as used herein typically refers to forces or other actions upon a building that result from the weight of building materials and the like , building occupants and / or their possessions , objects supported by the building , environmental effects , differential movement , restrained dimensional changes , and the like . the term “ dead loads ” as used herein typically refers to substantially permanent loads such as the weight of materials of construction incorporated into a building or structure including but not limited to walls , floors , roofs , ceilings , stairways , built - in partitions , finishes , and all other similarly incorporated construction materials , and all equipment and the like affixed to the building or structure , but not including live loads or environmental loads . in one example , a fabricated timber may be configured to sustain a desired dead load of at least fifteen pounds per square foot . the term “ live loads ” as used herein typically refers to loads produced by occupancy of a building or structure that do not include dead loads or environmental loads . in one example , a fabricated timber may be configured to support a desired live load of at least thirty pounds per square foot . the term “ environmental loads ” as used herein typically refers to loads that act on a building or structure as a result of weather , topography , or other natural phenomena including but not limited to wind , snow , rain , ice , seismic activity , temperature variations leading to thermal expansion or the like , ponding , dust , fluids , floods , and lateral pressures from soil , ground water , bulk materials against the building , and the like , but not including dead loads or live loads . in one example , a fabricated timber may be configured to support a desired environmental load of at least ten pounds per square foot . in another example , a fabricated timber may be configured to support at least the desired dead load , live load , and environmental load combined . the term “ support ” as used herein with respect to a fabricated timbers typically indicates a capability to bear desired loads plus a safety factor without exceeding a yield strength of the fabricated timber or , in other words , while maintaining its elasticity . fig2 a is a diagram showing a top view of an example fabricated timber 100 . this top view shows portions of example horizontal member 130 and example vertical members 110 and 120 , as also shown in fig1 a and 1 b . also shown in fig2 a are holes ( e . g ., 220 ) of sufficient diameter to allow tie - down fasteners to pass through horizontal member 130 via the holes , as well as blocking ( e . g ., 224 ) optionally disposed on one or both sides of each hole . in one example , holes ( e . g ., 220 ) in the horizontal member are located approximately every m feet on center . the term “ every m feet on center ” as used herein refers to a hole at least every m feet along the length l of the horizontal member , each such hole approximately centered within the width w of the horizontal member ( e . g ., 130 ). in another example , holes ( e . g ., 220 ) may be provided at other increments ( e . g ., every b units ) along the length l of the horizontal member . in other examples , a fabricated timber 100 may be fabricated to include the holes ( e . g ., 220 ) and optional blocking ( e . g ., 224 ) as a single member . note that any blocking ( e . g ., 224 ) may comprise holes and / or notches ( e . g ., 225 ) to facilitate utility runs such as wiring , plumbing , etc . any one block may comprise from one to four corner notches ( only one 225 shown in fig2 b ) and / or any number of holes . generally all blocking in a fabricated timber would comprise the same hole / notch number and pattern . the size of the holes / notches ( e . g ., 225 ) is typically sufficient for desired runs of wiring , plumbing , and other utilities and the like . such blocking holes / notches ( e . g ., 225 ) may alternatively be referred to as “ blocking utility ports ”. fig2 b is a diagram showing an end view of the example fabricated timber 100 . this end view shows portions of example horizontal member 130 and example vertical members 110 and 120 , as also shown in fig1 a and 1 b . also shown in fig2 b is an end view of example blocking 224 . the composition of the blocking ( e . g ., 224 ) is typically the same as that of the fabricated timber &# 39 ; s members ( e . g ., 110 , 120 , and 130 ). further , should the material from which members 110 , 120 , 130 , and 224 are fabricated include a grain ( as with e . g ., wood , fiber - cement , etc ), the grain of each member , including blocking members ( e . g ., 224 ), should be oriented in substantially the same plane . such grain alignment may result in shrinkage over time that is relatively consistent between each of the members . in one example , blocking ( e . g ., 224 ) is attached to vertical member ( e . g ., 110 and 120 ) with fasteners ( e . g ., 226 ) as illustrated in fig2 b . in a particular example , blocking is fastened by installing two nails on each side ( e . g ., 110 and 120 ), as illustrated . alternatively or additionally , the fasteners ( e . g ., 226 ) may be installed on the bottom ( e . g ., 130 ) and / or through the bottom of a next timber ( e . g ., fig3 , 330 ), leaving the outer faces of the vertical members free from any appearance of fasteners . in another example , other types or sizes of fasteners may be installed to fasten blocking . note that the height h of the blocking is substantially the same as the height h of vertical members 110 and 120 . preferably , the blocking height is not greater than , but may be the same as or somewhat less than the height of the vertical members . fig3 is a diagram showing an example wall 300 constructed from a plurality of example fabricated timbers ( e . g ., 100 i , 100 , and 100 t ). in this example , bottom fabricated timber 100 i is attached atop foundation 310 . alternatively , the bottom fabricated timber 100 i may be positioned atop any other type of foundation suitable for a building or structure . the term “ foundation ” as used herein typically refers to the lowest load - bearing portion of a building which may comprise any suitable design and material . in this example , tie - down fasteners ( e . g ., 312 ) may be embedded in or attached to the foundation using conventional techniques . the tie - down fasteners may be comprised of multiple components ( e . g ., 312 , 320 , and 322 ) and may continue upward via holes in the horizontal member ( e . g ., 130 ) of each fabricated timber ( e . g ., 100 i , 100 , and 100 t , as well as all other fabricated timbers ). the term “ tie - down fastener ” as used herein typically refers to a fastening device or mechanism configured to secure some object ( s ) ( e . g ., a fabricated timber ( s )) against a base of some kind ( e . g ., a foundation ). in one example , bottom fabricated timber 100 i may include an optional additional member ( e . g ., 316 ) that may be fastened to the top of its horizontal member inside the timber via fasteners ( e . g ., 314 ) and further attached to the foundation via a nut and washer or the like ( e . g , 318 ), thus locking down the bottom fabricated timber 100 i to the foundation . example wall 300 extends upward to the desired height by stacking and attaching fabricated timbers one atop another starting with a bottom fabricated timber ( e . g ., 100 i ) up through the top fabricated timber ( e . g ., 100 t ). the fabricated timbers are typically stacked so as to be level horizontally and to be substantially plumb . such stacking can typically be performed by two or three people ( workers ) without the use of a crane or other heavy equipment or the like . the holes in the horizontal members may be sufficiently aligned vertically so as to allow tie - down fasteners ( e . g ., 312 & amp ; 320 ) to pass through each stacked fabricated timber while remaining substantially plumb vertically . in one example , the holes are drilled or otherwise formed by the workers as the timbers are stacked . one method of finding the correct location for each hole is to place the next timber in the desired horizontal position above the lower timber and atop the applicable and substantially plumb tie - down fasteners , beat the horizontal member of the next timber against the tops of the tie - down fasteners so as to form discernible marks on its bottom at the locations where the tie - down fasteners touch the horizontal member , and then drill or otherwise form the holes according to the marks . this method typically allows for the holes to be formed by the workers at the required locations along the horizontal member of the next timber at the job site without complex design or measurements or the like . regarding the tie - down fasteners , these fasteners may be attached to or embedded in foundation 310 at their lower ends , that extend through the courses of stacked fabricated timbers forming a wall , and that are fastened to the top of the wall thus maintaining the wall in a high degree of force over time against the foundation ( e . g ., 310 ). such tie - down fasteners may be configured to maintain the high degree of force on the wall , even in the event of shrinkage of the wall &# 39 ; s fabricated timbers and in the event that various forces are applied to the wall , including environmental forces such as wind , earthquake , shifting , flooding , and the like . in one example , each tie - down fastener may be a threaded rod , or a plurality of threaded rods ( e . g ., 320 ) coupled together by coupler nuts ( e . g ., 322 ). a bottom rod , also known as an anchor bolt , ( e . g ., 312 ) may be embedded in or otherwise attached to the building &# 39 ; s foundation ( e . g ., 310 ) via conventional means . the bottom rod may be sufficiently long to pass through the first course of fabricated timbers ( e . g ., 100 i ) and may be coupled via a coupling nut ( e . g ., 322 ) or the like to a second rod ( e . g ., 320 ) that is sufficiently long to pass through at least a second course of fabricated timbers , etc ., until a final rod or top portion of a single rod passes into and / or through a top fabricated timber ( e . g ., 100 t ). in one example , a tie - down fastener and related components may terminate against the horizontal member of the top fabricated timber . in another example , wall cap members 332 and 334 may cap the final course of fabricated timbers and allow for the tie - down fastener ( s ) to hold the stacked courses of fabricated timbers against the building foundation ( e . g ., 310 ). member 332 may be optional . member 334 may be the same width as a horizontal member ( e . g ., 130 ) or extend up to the entire width of a fabricated timber ( e . g ., 100 t ). the desired holding force may be achieved via a tensioner mechanism ( e . g ., 333 ) such as a spring or the like positioned atop a washer or plate ( e . g ., 331 ) locked in position via the rod ( e . g ., 320 ) by a nut ( e . g ., 336 ) and washer ( e . g ., 335 ) or other suitable locking device ( s ). any other suitable tensioner mechanism may alternatively / additionally be used to provide the desired force on the wall 300 . in one example ( not illustrated ), the tensioner mechanism may be installed on top of wall top cap ( e . g ., 332 and 334 ). in another example , the tensioner mechanism may be installed inside the top fabricated timber 100 t against its horizontal member as illustrated in fig3 . in one example of a wall constructed using fabricated timbers , the tie - down fasteners comprise threaded metal rods ( e . g ., 320 ) ⅝ inches in diameter joined by coupler nuts ( e . g ., 322 ) as needed , the bottom rods or anchor bolts ( e . g ., 312 ) embedded at least 6 inches in a conventional concrete foundation ( e . g ., 310 ), the tie - down fasteners spaced at least every 4 feet along the horizontal length of the wall ( e . g ., 300 ), with the top ends attached via tensioner mechanisms ( e . g ., 333 ) and associated components ( e . g ., 331 , 335 , and 336 ), and where each combination of tie - down fastener , tensioner mechanism , and associated components ( e . g ., 331 , 335 , and 336 ) has a tension capacity of at least 2 , 500 lbs . the term “ tension capacity ” as used herein is related to a material &# 39 ; s or object ( s )&# 39 ; s “ tensile strength ” and indicates a rated usage value below such a tensile strength . the term “ associated components ” as used herein typically refers to various pieces of hardware or the like required to complete , secure , and / or retain a tie - down fastener and / or tensioner mechanism , pieces of hardware such as washers , plates , nuts , pins , and the like . each course of fabricated timbers of a wall is typically attached to the previous course . fig3 shows an example of how one course can be attached to the previous course . in this example , fasteners ( e . g ., 328 and 330 ) are installed to attach a next fabricated timber that is being stacked atop a previously stacked fabricated timber . fasteners ( e . g ., 328 ) are installed so as to attach the horizontal member of the next fabricated timber to the vertical members ( e . g ., 110 and 120 ) of the previous fabricated timber ( e . g ., 110 ). further , additional fasteners ( e . g ., 330 ) may be installed so as to attach the horizontal member of the next fabricated timber to some or all of the blocking ( e . g ., 224 ) of the previous fabricated timber ( e . g ., 110 ). prior to attaching a next fabricated timber to the previous fabricated timber , gaps and the like between the two may be substantially removed . in one example , this is done by compressing the next fabricated timber against the previous fabricated timber sufficient to remove such gaps . such may be accomplished using existing tie - down fasteners to force the next fabricated timber toward the foundation until gaps and the like between the next fabricated timber and the previous fabricated timber are substantially eliminated . given a threaded rod tie - down fastener , a plate or the like may be slid down the rod against the top of the next fabricated timber , and a nut tightened against the plate to remove any gaps . then , while under compression with gaps substantially removed , the next fabricated timber may be attached to the previous fabricated timber . as one fabricated timber is stacked atop another , one or more beads of caulking and / or glue or the like may be applied . in one example , a bead of caulking may be applied along the length of a top of a fabricated timber &# 39 ; s vertical members ( e . g ., 110 and 120 ) prior to stacking another fabricated timber on top of it . such a bead may be applied along the inside and / or outside edge ( s ) of the vertical members , or along any other portion of the vertical members . one such bead may be formed from a caulking or the like that is configured to remain flexible over time , though cycles of hot and cold seasons , and to seal out moisture , bugs , air , and / or other substances and / or objects , and be further configured to maintain such a seal given settling , movement , shrinkage , or the like of the fabricated timbers . another such bead may be similarly applied that is formed of glue or construction adhesive or the like . a wall constructed of fabricated timbers that supports angled trusses may also include weight distribution members that typically approximate the shape of a right triangle , as illustrated in fig3 by element 340 . in one example , one such weight distribution member ( e . g ., 340 ) is installed atop the wall ( e . g ., 300 ) under each truss ( e . g ., 338 ). each such weight distribution member is typically disposed and configured to evenly distribute the various loads imposed by the truss across the top surface of the top course of fabricated timbers ( e . g ., 100 t ). the width of such a weight distribution member is typically about the same as the width of the wall top cap or the like that it is disposed upon . the height and hypotenuse of the weight distribution member are typically configured to support the truss by contact along the length of the hypotenuse . such a weight distribution member may be fabricated any of the materials suitable for members of a fabricated timber . fig4 is a diagram showing an example method 400 for constructing a fabricated timber . such timbers may be partially or completely assembled as pre - manufactured timbers off - site at a factory or the like , or they may be partially or entirely assembled on - site . in both cases , the basic process of construction is typically the same . block 402 typically indicates determining a total desired load plus a safety factor that the fabricated timber should support without exceeding its yield strength . the total desired load may be a minimum , and is typically comprised of a determined desired minimum dead load ( block 410 ) plus a determined desired minimum live load ( block 420 ) plus a determined desired minimum environmental load ( block 430 ). each of these determined loads may be based at least on the overall design , occupancy , and physical environment of the building . alternatively , desired average , maximum , or other loads may be used instead of desired minimum loads . block 440 typically indicates determining a composition of each of the various members of the fabricated timber . such determining may be based at least on the determined desired loads ( e . g ., block 402 ) and aspects of the design , occupancy , and physical environment of the building comprising the fabricated timber . such determining may also take into account a desired outside dressing and / or desired inside dressing of the fabricated timber . note that the various members of a fabricated timber need not be of the same composition . nor need one fabricated timber ( or various members thereof ) used in a building be of the same composition as another fabricated timber ( or various members thereof ) used in the building . block 440 also typically indicates determining a thickness of the various members of the fabricated timber , such as members 110 , 120 , 130 , and 224 . such determining may be based at least on the determined desired loads ( e . g ., block 402 ) and aspects of the design , occupancy , and physical environment of the building comprising the fabricated timber . such determining may also take into account a desired outside dressing and / or desired inside dressing of the fabricated timber . note that the various members of a fabricated timber need not be of the same thickness . nor need one fabricated timber ( or various members thereof ) used in a building be of the same thickness as another fabricated timber ( or various members thereof ) used in the building . the end result of the determinings indicated by block 440 is generally that the compositions and thicknesses of the various members of the fabricated timber have been determined . another aspect ( not explicitly indicated in fig4 ) is determining the length of the fabricated timber or each of the fabricated timbers used in a building or wall or the like . generally the length of each fabricated timber is based upon it position in a wall of a building or the like , the position of windows , doors , and other opening , the length of the wall , etc . a typical fabricated timber may generally be between approximately one and thirty feet in length . should a wall require greater lengths , two or more such fabricated timbers may be disposed end - to - end to obtain the desired overall length . yet another aspect ( not explicitly indicated in fig4 ) is determining the width of the horizontal member and the height of the vertical members of the fabricated timber or of each of the fabricated timbers used in a building or wall or the like . the width may be determined based on a desired thickness of a wall or portion thereof . the desired thickness may be based on a desired amount of insulating value , a desired appearance , or other factors that may impact the width of a wall or portion thereof . the desired height may be determined based on a desired timber height , desired appearance , desired locations of windows and / or other openings , desired wall heights , roof heights , and floor heights ( such as in multi - level structures ), and the like . block 442 typically indicates various aspects of constructing a fabricated timber . block 450 typically indicates disposing a first vertical member atop a horizontal member . in one example , the first vertical member 110 is typically disposed length - wise atop the left side l ( or the right side r ) of horizontal member 130 , as illustrated in fig1 b . the first vertical member may be disposed to provide a reveal r 140 , as illustrated in fig1 b . the first vertical member 110 may be fastened to the horizontal member 130 using fasteners installed every n inches on center or the like , and / or the horizontal member and the first vertical member may be fabricated as a single piece . the disposing of the first vertical member atop the horizontal member may take place at a job site as part of the construction of a wall of a building , or as part of a process of construction a plurality of fabricated timbers such as for later use in constructing walls or the like . block 460 typically indicates disposing a second vertical member atop a horizontal member . in one example , the second vertical member 110 is typically disposed length - wise atop the right side r ( or the left side l , whichever side the first vertical member is not disposed on ), of horizontal member 130 , as illustrated in fig1 b . the second vertical member may be disposed to provide a reveal r 140 , as illustrated in fig1 b . the second vertical member 110 may be fastened to the horizontal member 130 using fasteners installed every n inches on center or the like , and / or the horizontal member and the second vertical member may be fabricated as a single piece . the disposing of the second vertical member atop the horizontal member may take place at a job site as part of construction of a wall of a building or the like , or as part of a process of construction a plurality of fabricated timbers for later use at another site in constructing walls or the like . block 470 typically indicates forming one or more holes in a horizontal member of a fabricated timber . in one example , each hole is formed so as to enable a tie - down fastener to pass through the fabricated timber via the hole . as fabricated timbers are stacked to form a wall , holes formed in each timber are typically aligned with holes formed in any timbers above and below such that a tie - down fastener can to pass through each set of aligned holes in a substantially vertical orientation , as partially illustrated in fig3 . such holes may be formed off - site during timber fabrication in advance of wall construction , or as part of wall construction at a job site ( the location of building construction ). holes are typically formed to allow for tie - down fasteners to be installed at approximately two foot or greater intervals along the length of a wall constructed of fabricated timbers . in one example , holes are formed to allow for a tie - down fastener to be installed at approximately four foot intervals along the length of a wall . block 480 typically indicates installing a fabricated timber &# 39 ; s blocking . one example of such blocking is illustrated in fig2 a wherein a block is optionally installed on one or both sides of a formed hole . in one example , a block is installed about two to six inches on one or both sides of a formed hole &# 39 ; s center . such optional blocking is typically installed in each timber such that , when stacked , the blocking of the stacked timbers is substantially aligned vertically . that is , the optional hole blocking of one timber tends to be vertically aligned with that of any timbers above and / or below it . in another example , blocking may additionally or alternatively be installed at intervals unrelated to the location of formed holes . such blocking of stacked timbers may be installed so as to be substantially aligned vertically . as with forming holes , blocking may be installed off - site during timber fabrication in advance of wall construction , or as part of wall construction at a job site . fig5 is a diagram showing an example method 500 for constructing a wall from fabricated timbers . block 510 typically indicates attaching a timber used in constructing the wall . in one example , the first or bottom fabricated timber of a wall is typically attached to a foundation as described in connection with at least fig3 , elements 100 i and 316 . in another example , a fabricated timber that is stacked upon another fabricated timber is attached as described in connection with at least fig3 , element 328 . further , holes are typically formed in fabricated timbers so as to enable tie - down fasteners to pass through the fabricated timber via the holes . further , one or more beads of caulking or glue or the like may be applied as a part of the attaching . in one example , a bead of caulking may be applied along the length of a top of a fabricated timber &# 39 ; s vertical members ( e . g ., 110 and 120 ) prior to stacking another fabricated timber on top of it . such a bead may be applied along the inside and / or outside edge ( s ) of the vertical members , or along any other portion of the vertical members . one such bead may be formed from a caulking or the like that is designed to remain flexible over time , cycles of hot and cold , and to seal out moisture , bugs , air , and or other substances and / or objects , and be further designed to maintain a seal given settling , movement , and / or shrinkage of the fabricated timbers . another such bead may be formed from glue or construction adhesive or the like . block 520 typically indicates optionally extending a tie - down fastener ( s ) to pass through a next fabricated timber used to construct the wall . in one example , tie - down fasteners may be extended as described in connection with fig3 , elements 320 and 322 . in another example , a tie - down fastener ( s ) may not require extending , such as in the case of using full wall height tie - down fasteners . block 530 typically indicates optionally installing utilities such as electrical wires , gas and / or water lines , ducting , and the like . in one example , electrical wires , water lines , gas lines , ducting , etc , may be run horizontally through the channel ( fig1 a , 180 ) formed by a fabricated timber . such may require forming holes / notches ( e . g ., 225 ) in blocking of the fabricated timber ( s ) to allow the utilities to pass through . in another example , electrical wires , water lines , gas lines , ducting , etc , may also be run vertically from one course of fabricated timbers to another . such may require forming hole ( s ) in a horizontal member ( s ) of the fabricated timber ( s ) to allow the utilities to pass through . further , holes may be formed in vertical member ( s ) of the fabricated timber ( s ) to allow the utilities to be accesses from the outside surface ( s ) of the fabricated timber ( s ). such holes may be formed to allow for outlets , valves , vents , receptacles , etc . block 540 typically indicates optionally installing insulation . in one example , insulation is installed in the channel ( fig1 a , 180 ) formed by a fabricated timber . any form of insulation may be installed , or no insulation at all depending on the application of the wall and / or preferences of the builder . generally , a sufficient quantity of a particular type of insulation is used to provide an insulation r - value ( conventional measure of thermal resistance ) sufficient for the purpose and location of the wall . once a particular course of fabricated timbers have been stacked and attached , any desired utilities have been run , and any tie - down fasteners have been installed and / or extended , then that course of fabricated timbers is typically complete and a next course may be attached . block 550 typically indicates determining if there is at least one additional course to be added to the wall being constructed . if so , method 500 continues again at block 510 . otherwise method 500 continues at block 560 . block 560 typically indicates installing a wall cap at the top of a fabricated timber - based wall . in one example , a wall cap may be fabricated and installed as described in connection with fig3 , elements 332 , 334 , and 336 . installing wall caps may include forming holes so as to enable tie - down fasteners to pass through the wall caps via the holes . further , installing wall caps may include applying a bead ( s ) of caulking and / or glue or the like along the length of a top of the top fabricated timber &# 39 ; s vertical members ( e . g ., 110 and 120 ) prior to installing a wall cap on top of it . such a bead may be applied along the inside and / or outside edge ( s ) of the vertical members , or along any other portion of the vertical members . one such bead may be formed from a caulking or the like that is designed to remain flexible over time , through cycles of hot and cold , and to seal out moisture , bugs , air , and / or other substances and / or objects , and be further designed to maintain a seal given settling , movement , and / or shrinkage of the fabricated timbers and / or wall cap . another such bead may be similarly applied that is formed of glue or construction adhesive or the like . block 570 typically indicates installing tensioner mechanisms to any tie - down fasteners . in one example , such may be installed inside a fabricated timber . in another example , such may be installed on wall caps at the top of a wall . block 580 typically indicates optionally installing chinking in any reveals of the constructed wall , such as reveal 140 of fig1 a that may be provided by fabricated timbers of the wall . such chinking may comprise material that is intended to be functional and / or decorative in nature . conventional chinking materials may be used , and / or other non - conventional chinking materials . for example , mortar , stucco , caulk , grout , and / or the like may be used for chinking . any such materials may be applied using conventional means . in one example , wire mesh may be installed in the reveal area and the chinking material applied over the installed wire mesh . in another example , chinking material may be applied directly to the reveal areas of the stacked fabricated timbers . in another example , electrical wiring may be run along the reveal areas , nail guards installed to protect the electrical wiring , and chinking installed over the nail guard with or without wire mesh . fig6 a is a diagram showing an end view 600 a of an example alternate fabricated timber with a 3 - dimensional view 600 b of the same example alternate fabricated timber illustrated in fig6 b . such a timber according to this example is typically fabricated in a similar manner to that of example fabricated timber of fig1 a and 1 b , with the additional of top horizontal member 190 that may have similar properties , attributes , uses , and characteristics to those of bottom horizontal timber 130 . further , such a timber according to this example can be used in conjunction with fabricated timbers ( e . g ., 100 ). in one example , alternate fabricated timbers ( e . g ., 600 ) may be used for the outside walls of a building while fabricated timbers ( e . g ., 100 ) may be used for inside walls of the same building . the two types of timbers may even both be used in the same wall . other combinations of the two timbers are also acceptable . regarding construction of an alternate fabricated timber ( e . g ., 600 ), top horizontal member 190 may be attached to the tops of vertical members 110 and 120 in a manner similar to that of bottom horizontal member 130 . alternate fabricated timbers ( e . g ., 600 ) may be fabricated to be insulated and fully enclosed either at a fabrication site or on a job site . holes for tie - down fasteners may also be formed either at the fabrication site or on the job site . blocking may be used to enclose the ends of an alternate fabricated timber , and may be built in at approximately two foot or greater intervals along the length of the timber . blocking in both fabricated timbers and alternate fabricated timbers may also include holes configured to provide runs for utilities along the length of the inside of alternate fabricated timbers . an alternate fabricated timber may include conduit ( s ) installed in one or more sets of utility holes in the blocking , the conduit ( s ) typically extending from one end of the timber to the other . such conduits may be used to run utilities through alternate fabricated timbers . blocking in alternate fabricated timbers need not be included on either side of holes formed for tie - down fasteners . further , horizontal members 130 and / or 190 may include channels or grooves along the length of their outer faces ( not shown ), the channels configured to provide a run for electrical wiring or the like . fig7 is a diagram showing an example wall 700 constructed from a plurality of example alternate fabricated timbers ( e . g ., 600 ). like reference numbers refer to like elements within fig7 and between figures . wall 700 is constructed in much the same way as wall 300 , with some variations to account for the use of alternate fabricated timbers ( e . g ., 600 ) versus fabricated timbers ( e . g ., 100 ). one variation may be how one course of alternate fabricated timbers is attached to another course . in one example , strapping 720 is run along adjoining reveals of two stacked courses of alternate fabricated timbers and attached with fasteners 710 at regular intervals , such as approximately every twenty - four inches . strapping 720 may be formed of solid or perforated metal or the like configured for using nails or the like as fasteners 710 . alternatively , strapping 720 may be formed of various sized plates or the like , or of construction tape or the like with adhesive or the like performing the function of fasteners 710 . in another example , individual brackets or the like may be used at intervals along the length of courses . other mechanisms may alternatively and / or additionally be utilized to lock one course to another course when using alternate fabricated timbers . in one example , the tensioner mechanism and related components may be installed on top of the wall top cap . in another example , the tensioner mechanism may be installed inside the top fabricated timber 600 t against its bottom horizontal member . another variation may be how blocking is locked into place in an alternate fabricated timber . in one example , blocking in alternate fabricated timbers may be installed at four - foot or less intervals . fasteners may be installed via the top and bottom horizontal members of an alternate fabricated timber as opposed to via the vertical members . this approach has the advantage of fasteners not being visible on the outside vertical faces of an alternate fabricated timber . another variation may be how a tensioner mechanism and related components are configured . in one example , a plate 733 or the like may be used in conjunction with a tensioner mechanism and a washer 335 and nut 336 . plate 335 is typically configured to distribute forces from any tensioner mechanism ( s ) ( e . g ., 734 ) down the vertical members of alternate fabricated timbers to the foundation . plate 335 may be made of metal or any other material configured to provide the required force distribution . in one example , plate 335 is a steel plate between ⅛ ″ and ½ ″ in thickness that extends substantially across the width of the mating surface of the bottom horizontal member . in another example , plate 335 may alternatively be formed of angle iron or the like , or i - beam or channel or the like . other variations may also include how a bottom course of alternate fabricated timbers is attached to a foundation , how a tie - down fastener is attached to an alternate fabricated timber , etc . further , alternate fabricated timbers ( e . g ., 600 ) may be used in combination with fabricated timbers ( e . g ., fig3 , 100 ). in one example , regular fabricated timbers ( e . g ., fig3 , 100 ) may be used against a foundation as described in connection with fig3 , 100 i , and a top horizontal member may optionally be added . in another example , regular fabricated timbers ( e . g ., fig3 , 100 ) may be used for a top course along with regular wall cap members ( e . g ., fig3 , 332 / 334 ). in another example , a member ( e . g ., 714 ) similar to a horizontal member of a fabricated timber may be disposed atop the foundation ( e . g ., 310 ) and a first alternate fabricated timber be stacked and attached atop the member ( e . g ., 714 ). in one example , such a member ( e . g ., 714 ) may be made of pressure - treated 2 × lumber or the like . such a configuration may provide a reveal at as bottom course that is consistent in depth and height with that resulting from two alternate fabricated timbers stacked one atop the other . solid tall wood timbers tend to be very expensive because old growth trees of sufficient size are scarce . therefore , tall timbers tend to be desirable . fig8 illustrates an example of construction of a tall fabricated timber that has the appearance of an expensive solid tall wood timber . such a tall fabricated timber may be constructed for use as a fabricated timber ( e . g ., 100 ) or as an alternate fabricated timber ( e . g ., 600 ). fig8 illustrates construction of a tall fabricated timber comprising three sections . in one example , section 1 is a fabricated timber ( e . g ., 100 ). sections 2 and 3 are tall fabricated timber sections . section 2 is shown stacked upon and attached ( e . g ., by fasteners 840 on both sides ) to section 1 . arrows 890 indicates stacking section 3 on section 2 . in one example , as illustrated by section 3 , a tall fabricated timber section comprises vertical members 810 and 820 that are typically formed of the same material as vertical members 110 and 120 . the height of vertical members 810 and 820 need not be the same as that of 110 and 120 . in one example , the base member ( e . g ., 830 + 831 ) of each tall fabricated timber section is typically made of two pieces of 2 × lumber attached together as illustrated using any suitable means . alternatively , the base member may be made of a single piece of lumber or other material . typically , the base member extends along the length of the section . such sections may be stacked , compressed , and attached as described elsewhere herein , resulting in a tall fabricated timber . such a tall fabricated timber may be up to the height of a wall it is used to form . fig9 illustrates an example of construction of a single - reveal fabricated timber ( e . g ., 900 i , 900 , and 900 t ) that has the appearance of an expensive solid tall wood timber on one side and a reveal on the other side . either side may be used on the inside or outside of a building . such a single - reveal fabricated timber may be constructed in much the same manner as a fabricated timber ( e . g ., 100 ) and / or an alternate fabricated timber ( e . g ., 600 ). vertical member 920 varies from vertical member 120 in that its height is the same as that of the entire timber . horizontal member 930 varies from horizontal member 130 in that its width is sufficient to provide a desired reveal on one side while the end of the other side abuts the inside bottom face of vertical member 920 such that the bottom face of horizontal member 930 is even with and parallel to the bottom end of vertical member 920 , as illustrated . such single - reveal fabricated timbers may be stacked , compressed , and attached using fasteners ( e . g ., 840 ) as described elsewhere herein . fig1 illustrates an example of construction of a single - reveal alternate fabricated timber ( e . g ., 1000 i , 1000 , and 1000 t ) that has the appearance of an expensive solid tall wood timber on one side and a reveal on the other side . either side may be used on the inside or outside of a building . such a single - reveal alternate fabricated timber may be constructed in much the same manner as a fabricated timber ( e . g ., 100 ) and / or an alternate fabricated timber ( e . g ., 600 ). vertical member 920 varies from vertical member 120 in that its height is the same as that of the entire timber . top and bottom horizontal members 930 vary from horizontal member 130 in that their width is sufficient to provide a desired reveal on one side while the end of the other side abuts the corresponding inside top or bottom face of vertical member 920 such that the corresponding top or bottom face of horizontal member 930 is even with and parallel to the corresponding top or bottom end of vertical member 920 , as illustrated . such single - reveal alte4rnate fabricated timbers may be stacked , compressed , and attached using fasteners ( e . g ., 710 , 720 , and 840 ) as described elsewhere herein . fig1 illustrates front and side views of an example fabricated timber end cap ( e . g ., 1100 ). such end caps may be attached to exposed ends of wall timbers where the height and width of each end cap is typically equal to the height and width of its corresponding timber end . any suitable method of attachment may be used , including fasteners such as nails , glue , and / or any others indicated herein and / or the like . each end cap may be beveled , as illustrated , or otherwise shaped as desired . further , such end caps may be dressed , either prior to or after attachment , so as to match the appearance of their timbers and / or to create the appearance of being integral portions of their timbers .
| 4 |
referring to fig1 , an embodiment 10 of a wireless system in accordance with the invention uses a local medium reservation technique to schedule access to a wireless transmission medium . in this manner , the wireless system 10 includes local stations 20 ( stations 20 a and 20 b , as examples ) that may each reserve exclusive access to the wireless transmission medium for a scheduled time slot . during this scheduled time slot , the local station 20 that holds the reservation may communicate several frames without being interrupted by another one of the local stations 20 . as a result of this arrangement , the system 10 supports high bandwidth wireless communications that are well suited for real time data , such as voice and / or video traffic . to accomplish these features , the system 10 is designed to maintain information regarding future traffic over the wireless medium , prioritize real time traffic over non - real time data and schedule access to the shared medium , as described below . more particularly , in some embodiments of the invention , the system 10 may include cells 50 that each includes a group of the local stations 20 . thus , as an example , a cell 50 a may include the three local stations 20 a that are depicted in fig1 , and another cell 50 b may include the three local stations 20 b that are also depicted in fig1 . each cell 50 , in turn , may include an access point ( ap ) 30 that establishes communication between the local stations 20 of the cell 50 and a wired network 40 , such as an ethernet network , for example , or the aps 30 may communicate with each other through the wireless interface . in some embodiments of the invention , the stations 20 and 30 use a contention protocol , such as a carrier sense multiple access / collision avoidance ( csma / ca ) protocol , for purposes of avoiding collisions for contention access to the wireless transmission medium . in some embodiments of the invention , the ieee 802 . 11 wireless local area network ( wlan ) standard may generally govern communication across the wireless medium . for purposes of reserving a time slot ( i . e ., for purposes of reserving bandwidth ) to the wireless medium for real time access , the system 10 uses carrier sense information and properties of the real time traffic ( voice , streaming video , etc .) in its medium reservation policy , as described below . in this manner , in some embodiments of the invention , each cell 50 includes a central authority 42 ( that may be located within the ap 30 of the cell 50 , for example ) that interacts with a particular local station 20 to reserve bandwidth using a technique 60 that is depicted in fig2 . referring to fig2 , more particularly , a local station 20 may request ( block 61 of fig2 ) that a particular bandwidth be reserved for a given traffic type over a defined period of time . this reservation request is received and analyzed ( block 62 ) by the central authority 42 ; and depending upon the underlying network properties , desired traffic characteristics and the policy applicable to the requesting real time station , the central authority 42 determines ( diamond 66 ) whether the central authority 42 will grant or deny the request . based on this determination , the central authority 42 communicates a frame to the requesting station 20 indicating either denial ( block 76 ) or the grant ( block 78 ) of the request . if the request is granted , the central authority 42 calculates ( block 74 ) the duration and the periodicity of the transmissions for the requesting station 20 to meet the throughput and delay requirements of the real time traffic and indicates the reserved time slot in the frame that is transmitted ( block 78 ) to the requesting station . for purposes of tracking the reserved time slots and for purposes of determining which time slots are available , the central authority 42 uses a reservation vector that is described below . in some embodiments of the invention , the system 10 uses the properties of carrier sense functions that determine the state of the wireless transmission medium to ensure that no other local station 20 attempts to transmit during a reserved time slot . for example , in some embodiments of the invention , the system 10 uses the csma / ca protocol , a protocol that uses physical and virtual carrier sense functions are used to determine the state of the wireless medium . when either the physical or the virtual carrier sense functions of a local station 20 that needs to transmit indicate that the wireless transmission medium is busy , transmission is deferred . the virtual carrier sense mechanism in csma / ca takes the form of a network allocation vector ( nav ) that indicates the busy status and the duration of transmission over the wireless medium . the central authority 42 uses this virtual carrier sense mechanism and before each reserved time slot begins ( as indicated by the reservation vector ), it transmits frames that include information to populate the navs ( that are maintained locally by all stations 20 within the cell 50 ) with indication that the wireless transmission medium is busy during the upcoming reserved timeslot . this action causes the virtual carrier sense function , provided by the medium access control ( mac ) layer in each station 20 , to conclude that the wireless transmission medium is busy during the reserved period . therefore , in the scheme described herein , each local station 20 makes the medium access decision locally but the medium reservation control is carried out centrally by the central authority 42 . in some embodiments of the invention , the scheme may be used across multiple cells 50 in the following manner . first , the requesting local station 20 transmits the initial reservation request to the local central authority that , in turn , transits the request across all cells 50 where bandwidth reservation is required . for example , the cells 50 in which this occurs may be all cells 50 that are adjacent to and including the cell 50 of the requesting station 20 . next , the central authorities 42 of these cells 50 reserve the time slots ( if possible ) and update their reservation vectors . reserving the bandwidth across adjacent cells 50 provides a solution to prevent interference from adjoining cells . fig3 depicts a reservation request frame ( rrf ) 100 that is transmitted by a local station 20 to reserve a specified bandwidth over a predefined period of time . one field 102 of the rrf 100 indicates a type of the frame . in this manner , the rrf 100 may be a reservation , cancellation , or refresh frame . a local station 20 transmits a reservation type rrf 100 for purposes of requesting the reservation of bandwidth for a particular time slot . a local station 20 transmits a cancellation type rrf to cancel a previously reserved time slot . a local station 20 transmits a refresh type rrf to renew a reserved time slot . a central authority 42 may also transmit a refresh type rrf after a particular reserved time slot expires to alert the corresponding local station 20 that renewal of the time is required , as further described below . another field 104 of the rrf 100 indicates a type of the traffic to be transmitted during the reserved time slot . for example , the field 104 may indicate whether the traffic to be transmitted during the reserved time slot is voice or streaming video traffic . a field 106 of the rrf 100 indicates a priority of the traffic . another field 108 of the rrf 100 indicates the required throughput for the given type of traffic . use of the field 108 , in some embodiments of the invention , is optional and may be used only if the traffic type is unknown . the rrf 100 may also include a field 110 to indicate the periodicity , the maximum time interval between successive transmissions . in some embodiments , the field 110 is optional and may be used only if the traffic type is unknown . upon reception of an rrf 100 , the central authority 42 examines the parameters indicated by the rrf 100 and the central authority &# 39 ; s reservation vector to determine if a time slot may be reserved . an exemplary reservation vector 150 is depicted in fig4 . as shown , the reservation vector 150 indicates a bandwidth reservation window 151 that includes time slots 160 that are reserved for the local stations 20 . for example , a particular local station 20 may have time slots 160 in that are denoted by “ sta 1 ”, and another station 20 may have time slots 160 ( in the reservation vector 150 ) that are denoted by “ sta 2 .” as shown , in some embodiments , any two adjacent reserved time slots 160 are separated from each other by a contention time slot 162 , a time slot in which the local stations 20 that do not have reserved periods may transmit using the csma / ca contention protocol . once the central authority 42 receives an rrf that requests a reservation , the central authority 42 ascertains if sufficient resources are available based on the throughput offered by the underlying network , the latency , carrier sense information , the amount of requested bandwidth , and the policy that is applicable to the requesting local station 20 . if resources are available , then the central authority 42 calculates the duration ( called “ ι ”) of each transmission according to the following formula : t = ρ · r t a t + λ , equation 1 where “ r t ” is the required throughput , “ a t ” is the throughput offered by the underlying network , “ ρ ” is the periodicity and “ λ ” is the network latency . once the central authority 42 fulfills the request , the central authority 42 transmits an acknowledgment frame to the requesting station 20 , a frame that indicates the time at which the reserved time slot begins . the central authority 42 includes a scheduler that performs a technique 180 that is depicted in fig5 . in the technique 180 , the scheduler “ wakes ” up ( block 182 ) before each scheduled transmission period and transmits ( block 184 ) a frame that populates the navs of the local stations 20 that are not going to transmit during the reserved time slot with the duration of the next reserved transmission . this event causes the virtual carrier sense mechanism that is provided by the mac layer of each local station 20 to conclude that the medium is busy and defer transmission . therefore , the medium access decision is taken by the virtual carrier sense mechanism local to each station 20 , and the reservation control information is sent by the central authority 42 . the central authority 42 grants a reserved time slot only for a determined period of time , and the duration of this time may be negotiated with the requesting station 20 when the requesting station 20 transmits a reservation request ( in the form of an rrf ) for the first time . basing the duration of the time slot on the available resources ( as described above ), the central authority 42 responds to the request with an indication of the actual period of time for which the reservation is granted . at the expiration of a reservation period , the central authority 42 sends out a refresh notice ( via an rrf frame 100 ) to the appropriate local station 20 . if the local station 20 does not respond with a refresh request ( via an rrf frame 100 ), the central authority 42 frees up any resources that are allocated to the local station 20 and removes the associated time slot from its reservation vector . reservation periods may be cancelled by local stations 20 ( via an rrf frame 100 ), and upon reception of a reservation cancellation frame from a particular local station 20 , the central authority frees up the time slot 160 ( and thus , the bandwidth ) that is allocated to the station 20 and adds the additional time to the contention free time slots 162 . in some embodiments , the central authority 42 may free up the time slots 160 that are allocated to a particular local station 20 if that local station 20 does not transmit during one of its allocated time slots 160 . the scheme described above has the added advantage of working well even when adjacent cells 50 share the same frequency . in this manner , the frame transmitted by the central authority 42 to populate the navs would also be received by stations in the adjacent cell 50 , which would lead to them defer transmissions during the reserved period . thus , interference from neighboring cells 50 is minimized in the above - described scheme . referring to fig6 , in some embodiments of the invention , the central authority 42 may include a control unit 202 ( a computer , a computer unit , a microprocessor or any other type of processor , as examples ) that may execute routines in the form of a program 200 to perform the scheduling and reservation techniques that are described herein . the central authority 42 may include a storage unit 204 ( a hard disk drive or a cd - rom drive , as examples ) that may store a copy of the program 200 . other arrangements are possible . other embodiments are within the scope of the following claims . for example , in cases where multiple access points are present within the same cell 50 , in some embodiments of the invention , the central authority 42 may dynamically choose to route real time traffic through the access point that has the least existing traffic . as another example , in cases where carrier frequencies overlap in the same cell 50 , in some embodiments of the invention , the central authority 42 may choose to transmit real time traffic using the carrier frequency that best meets a predefined criteria , such as the carrier frequency in which previous communications had the least error rate or the carrier frequency in which previsous communications had the shortest latencies , as examples . while the invention has been disclosed with respect to a limited number of embodiments , those skilled in the art , having the benefit of this disclosure , will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of the invention .
| 7 |
referring to fig1 , the workpiece transfer system 10 includes a bar 12 that moves a workpiece 20 between workstations ( not shown ). an adaptor 14 is attached to the bar 12 and supports the tools 18 . the tools 18 extend from removable rails 16 attached to the adaptor 14 . the tools 18 illustrated are pneumatically actuated suction cups . however , other tools as are known would also benefit from the disclosures of this invention , for example mechanical grippers and part present sensing devices . the rail 16 is part of a rail assembly . there are four rail assemblies 42 , 44 , 46 and 48 illustrated . the tools 18 are mounted to arms 22 that are in turn mounted to the rail 16 of each rail assembly 42 , 44 , 46 and 48 . the position of the tools 18 along the rail 16 is infinitely adjustable such that the configuration and placement of the tools 18 can be tailored to the requirements of a specific application and workpiece 20 . each of the rail assemblies 42 , 44 , 46 and 48 include a mount plug 25 that is attachable to selectively releasable mount connector 24 attached to the adaptor 14 . the mount plug 25 is affixed to a first end of the rail 16 for each of the rail assemblies 42 , 44 , 46 and 48 . the mount plug 25 interfaces with the mount connector 24 to communicate pressurized air and provide an electrical connection for any electrical devices mounted to the rail 16 . the mount connector 24 includes a locking device 27 movable between a released position where the rail 16 may be removed and a secured position where the rail 16 is rigidly held into the mount connector 24 , and the desired electrical and pneumatic connections are completed . the example rail assembly 42 includes a sensor 38 for detecting the presence of the workpiece 20 . the sensor 38 is electrically attached through the interface between the mount plug 25 and the mount connector 24 . the mount connector 24 is in turn in communication with a source of electrical energy and pressurized air . further , the mount connector 24 is adaptable for providing communication of control signals to the tools 18 mounted to the rail 16 . the mount connector 24 also provides support of an end of the rail 16 . the second end 28 of the rail 16 is supported by a lug 32 that fits within a lug mount 30 . the lug 32 on the rail 16 is first placed within the lug mount 30 and slid axially into full engagement with the mount connector 24 . the lug mount 30 receives the lug 32 within a slot 35 that includes a vertical portion 37 and horizontal portion 39 . the lug 32 drops within the vertical portion 37 of the slot 35 and is slid axially within the horizontal portion 39 of the slot to facilitate axial engagement and securement of the mount plug 25 within the mount connector 24 . although a mount connector 24 and mount plug 25 are illustrated , it is within the contemplation of this invention to utilize other mounting devices that are known in the art . the rail assemblies 42 , 44 , 46 and 48 are installed to the adaptor 14 in a specific location . each of the rail assemblies 42 , 44 , 46 and 48 are adapted to fit only one location to assure a desired orientation of the rail assemblies 42 , 44 , 46 and 48 to comply with application specific requirements . each of the rail assemblies 42 , 44 , 46 and 48 are identified by a color code . the color of the lug 32 corresponds to a color on the lug mount 30 to provide a determination of the correct position for mounting of the rail assembly . the color code in the illustrated example is green for the rail assembly 42 and is indicated schematically by shading 17 b on the the rail assembly 42 and shading 17 a on the lug mount 30 . the rail assembly 46 includes a gold color code schematically indicated at 19 a on the rail 16 and a matching gold color indicated at 19 b on the lug mount 30 . the rail assembly 44 includes a silver color code ( not shown ) and the rail assembly 46 includes a black color code ( not shown ). the color - codes 17 a and 19 a disposed on the rail 16 of each rail assembly 42 , 46 comprise a colored tape . the color - codes 17 b and 19 b on the lug mounts 30 are provided by a desired plating color . as appreciated , other colors and method of adhering that color to the lug mount and the rail may be utilized to identify each position on the adaptor 14 with the corresponding one of the rail assemblies 42 , 44 , 46 and 48 . the different color codes provide for easy identification of the proper location for the rail assembly . referring to fig2 , the rail assembly 42 is illustrated removed from the rail adaptor 14 . the rail assembly 42 , like the other rail assemblies 44 , 46 and 48 includes a length 50 between the lug 32 and a portion of the mount plug 25 . the length 50 for each of the rail assemblies is unique such that one rail assembly cannot be assembled into the place of another rail assembly . in the example illustrated in fig2 , the rail assembly 46 includes a length 54 that is different than the length 50 such that the rail assembly 46 cannot be assembled in place of the rail assembly 42 . the length 50 between the lug 32 and the end of the mount plug 25 corresponds to a length 52 between the mount connector 24 and the lug mount 30 . the length 52 is measured from a stop of the mount connector 24 and a position within the horizontal portion 39 of the slot 35 within the lug mount 30 . the length 50 between the lug 32 and the end of the mount plug 25 is a dimension that is fabricated within desired tolerances to provide the desired fit once mounted . as appreciated , some prior art tool mounting devices include multiple critical dimensions that must be closely controlled to provide the desired fit , or event to allow assembly . the instant tool mounting system includes only a single closely held dimension , thereby simplifying assembly , and fabrication . the rail assembly 42 is easily removable by unlocking the mount plug 25 from the mount connector 24 and moving the entire rail axially away from the mount plug 25 until the lug 32 is free to move vertically within the slot 35 of the lug mount 30 . another rail assembly including tooling for a differently shaped and configured workpiece can then be installed to provide a relatively quick and easy tooling change over . in operation , several sets of rail assemblies will be provided that correspond to various and differently configured workpieces . change over is conducted by removing one set of color - coded rail assemblies and installing another set in the proper color coded locations . rail assemblies can only be properly installed into corresponding locations due to the different lengths 50 and 54 between the mount connector 24 and the lug mount 30 . referring to fig3 , the lug mount 30 is shown without the rail and adaptor for clarity . the lug mount 30 includes the slot 35 having the vertical portion 37 and the horizontal portion 39 . the drop down feature provided by the lug 32 being received in the slot 35 facilitates quick assembly of a rail assembly . the lug 32 includes a bushing 33 that supports the tool and prevents twisting during installation . the drop down feature thereby prevents twisting of the rail assembly during assembly , thereby substantially eliminating the need for an assembler to support the rail assembly during the entire assembly process . referring to fig4 , the lug mount 30 is shown schematically that correspond to mounting arrangements for the rail assembly 42 and the rail assembly 46 . the slot 35 includes a width 58 for the lug 32 . the lug 32 includes the bushing 33 supported on a shaft 31 . the shaft 31 includes a diameter 60 that corresponds with the width 58 that provides for assembly of the lug 32 within the slot 35 . the width 58 is tailored to each of the rail assemblies 42 , 44 , 46 and 48 such that each of the rail assemblies 42 , 44 , 46 and 48 includes a tailored width 58 unique to that particular rail assembly . accordingly , the rail assembly 46 is partially shown with the lug 32 having a shaft 31 of a diameter 64 different than the diameter 60 for the rail assembly 42 . the lug mount 30 for the rail assembly 46 includes a width 62 of the slot 35 ′ that prevents another rail assembly , such as for example the rail assembly 42 from being installed within the lug mount 30 instead of the rail assembly 46 . accordingly , the different diameters for each shaft 31 of each of the rail assemblies 42 , 44 , 46 and 48 substantially prevent assembly of a rail assembly in a non - desired orientation . referring to fig5 , a cross - section of the transfer system 10 is shown with the adaptor 14 attached to the bar 12 . as appreciated , the transfer system 10 operates within a space - restricted environment . in some applications , it is desired to limit or eliminate mounting of devices or objects to the top of the bar 12 . such applications may not allow the mounting of electrical wire harnesses and airlines to the top surface of the bar 12 . in such applications , the instant adaptor 14 provides the necessary mounting and communication of air and electric to the tooling without extending substantially beyond the top surface of the bar 12 . the addition of the adaptor 14 adds only the minimal thickness of the adaptor 14 to the overall height of the bar 12 . accordingly , the inventive workpiece transfer system 10 includes several features that assure proper configuration of the several rail assemblies 42 , 44 , 46 and 48 that expedite and facilitate quick tool changeover . different lengths between mounting points for each rail assembly and tailored diameters of shafts for each lug accompanied by color - coded parts provides for fail safe and efficient tool change over . further , the drop down mounting provided by the lug and lug mount tool mount configuration eases mounting by eliminating awkward and difficult maneuvering of the rail assemblies during the mounting process . although a preferred embodiment of this invention has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this invention . for that reason , the following claims should be studied to determine the true scope and content of this invention .
| 8 |
the distributor of this invention can be used in conjunction with any type of particle bed . typically , the particle bed and inlet distributor will be located inside a vessel for a catalytic reaction or an adsorption process . this invention finds greatest advantage when used with a vessel having a downward flow of fluid from an inlet nozzle through an unconfined bed of particles . the invention can also be used with confined particle beds . in confined particle beds , large scale shifting of the upstream bed surface is not a concern due to restraint by a screen or other confining device but plugging of the bed surface can still cause excessive pressure drop and poor utilization of the particle bed . this invention is more fully explained in the context of a typical downflow vessel arrangement as shown in fig1 . fluid entering the distributor of this invention may be gaseous phase , liquid phase , or a combination of the two . greatest advantage is obtained when the fluid stream entering through the inlet distributors is in gas phase . the remainder of this description refers to the fluid as a gas . this reference is not meant to limit the invention to gas phase flow . referring again to fig1 an upper pipe 10 delivers a gas phase fluid to a vessel 12 through an inlet nozzle 14 which is connected to pipe 10 through a straight conduit 16 and an elbow 18 . all of the gas flow that enters vessel 12 is intercepted first by distributor 20 . distributor 20 has an inlet plate 22 flanged to the top of inlet nozzle 14 . plate 22 secures distributor 20 to vessel 12 and provides a seal between nozzle 14 and inlet plate 22 that prevents fluid from entering vessel 12 without first passing through distributor 20 . other well - known means of attaching distributor 20 to vessel 12 can be used . nevertheless , whatever method of attachment is used , it is important that the method prevent bypassing of fluid around distributor 20 and into the vessel 12 . distributor 20 disperses the gas over the cross - section of vessel 12 . the dispersed gas enters a particle bed 24 having an upper surface 25 . bed 24 is composed of solid particles which can be in the form of pills , spheres , cylinders , or other extruded shapes . the actual properties of the particles will depend upon the process which is carried out in the containment vessel . generally , particles will consist of an adsorbent or a catalyst . as a further means of preventing bed disturbances , a layer of support material , usually comprising ceramic balls , may be added and comprise the upper surface of the particle bed . bed surface 25 will in most cases simply consist of particles that have been leveled at the time of loading . as gas passes across upper surface 25 , it proceeds down through the remainder of bed 24 . if the top surface of the bed remains level and open , a complete redistribution of the gas is usually effected such that it will pass uniformly through the remainder of the bed . therefore , it is not essential that distributor 20 provide a completely uniform distribution of gas across the bed surface 25 . in the past , the distributor 20 was to provide a fluid , or in this case gas dispersion , that has enough uniformity to eliminate any concentrated jets of fluid having sufficient velocity to disrupt surface 25 . after a predetermined contact time , gas leaves the catalyst bed 24 by passing through a porous support member 26 . member 26 can be screen or any other rigid layer of porous material having sufficient strength to support the weight and pressure loading of catalyst bed 24 . exiting gases pass through an outlet screen 28 that collects any fine particles that have passed out of a catalyst bed and through support member 26 . from screen 28 , exiting gases leave the vessel 12 through an outlet nozzle 30 which is connected to a lower pipe 32 . fig1 also shows one of the prior art methods for collecting debris that would gather at the top of a downflow reactor . debris collectors , or baskets 34 , are shown having an opening 36 for admitting gas into the collector and downwardly extended sidewalls 38 for distributing gas from the interior volume 40 of the basket into the adjacent portions of the bed . the bottom of the basket has end closure 42 to prevent bed particles from moving upward into the interior 40 of the basket . with the distributor of this invention , baskets 34 are no longer necessary and would not be present at the top of the bed . fig2 illustrates one form of the apparatus and method of this invention . a gas stream containing solid debris enters the top of vessel 12 &# 39 ; through a conduit 16 &# 39 ;. conduit 16 &# 39 ; directs the gas downwardly into a fluid distributor 44 . fluid distributor 44 has perforated sidewalls 46 that are located between the bottom of the inlet nozzle 14 &# 39 ; and a baffle 48 located inside the distributor 44 and arranged in the form of a series of diagonal vanes 49 . as gas flows downwardly in the distributor , the momentum of the solid particles carries them through baffle 48 while the lighter gases are diverted radially outward through the sidewall 46 . the openings in the perforated portion of the distributor sidewall need not be smaller than the debris that is sought to be trapped within the inlet distributor . the primary mechanism for the removal of the particles in this arrangement is the downwardly directed momentum of the particles which carries the particles out of the gas flow and past the baffle 44 . the sidewall 50 and bottom 52 of the distributor form a collection zone 53 below the baffle 48 . the sidewalls 50 and bottom 52 are at least closed to any flow of the solid particles out of the bottom of the distributor and are typically completely closed to fluid flow . when the bottoms and sidewalls 50 and 52 are completely sealed , the volume of the distributor around and below the baffles has no net fluid flow and is essentially dead space . as the particles enter the space below the baffle 48 , they come to rest at the bottom of the distributor . baffles 48 prevent any eddy current from the redirection of the fluid above the baffles from disturbing the particles below the baffle and reentraining them with the outgoing flow of gas from the distributor . it may be desirable in some cases to have some fluid flow through sidewalls 50 and bottom 52 in the collection zone of the distributor . in such cases , the bottoms and sidewalls can be composed of very fine screen that will not permit solid particles to escape from the collection zone . such an arrangement may be advantageous where the debris is very fine and some small fluid flow through the collection zone would serve to prevent any migration of fine dust debris back into the space of the distributor above baffle 48 . however , such an arrangement is not desired where the debris comprises heavy viscous liquids that may eventually seep through any permeable surface in sidewall 50 or bottom 52 . however , any fluid flow that passes through the distributor below the baffle 48 must be kept low in order to achieve the objectives of this invention . the directing of particles into the collection zone of the distributor may be further improved by the arrangement of the invention shown in fig3 . in this arrangement gases enter the contacting vessel 12 &# 34 ; through a conduit 16 &# 34 ;. conduit 16 &# 34 ; discharges the particles into an inlet distributor 44 &# 39 ; that has a perforated portion 46 &# 39 ; of a sidewall through which the gases exit the inlet distributor . particles and debris collect below baffle 48 &# 39 ; in a collection zone 53 &# 39 ;. the outlet end of conduit 16 &# 34 ; extends downwardly into the inlet distributor past the lower extent of the perforated portion of the sidewall 46 &# 39 ;. the extension of conduit 16 &# 34 ; prevents the deflection or migration of any of solid particles to the outside of the distributor in the region of the perforated sidewall . in the arrangement of fig3 the flow is thereby confined to direct more of the particles on to the baffles 48 &# 39 ;. the arrangement of fig3 is most suitable for lower flow velocities where the gas flow through conduit 16 &# 39 ; will not create large cross - currents that could reentrain particles into the gas flow exiting through perforated portion 46 &# 39 ;. a variety of different arrangements can be used for the baffle in the bottom of the distributor . the sloped vanes of fig2 and 3 are shown in fig4 where parallel vanes 49 are spaced transversely across the cross - section of the inlet distributor . the plates 49 are spaced apart and extend in a parallel direction and cover essentially the entire transverse cross - section of the inlet distributor to shield the collection zone from direct gas flow . those skilled in the art are aware of a variety of suitable plate configurations such as conical or annular plate sections .
| 1 |
before the present composition for wound healing is disclosed and described , it is to be understood that this invention is not limited to the particular configurations , process steps , and materials disclosed herein as such configurations , process steps , and materials may vary somewhat . it is also to be understood that the terminology employed herein is used for the purpose of describing particular embodiments only and is not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof . as described above , the present invention is directed to a composition for stimulating cell growth and the healing of wounds by administering a pharmacologically effective amount of grown factors directly to the affected tissue . the composition may be used to treat any type of non - healing wound whereby fibroblast activity is reduced or ineffective . such wounds include diabetic non - healing wounds , burns , osteomyelitis , trauma wounds , subcutaneous trauma and various forms of dermatitis . the composition may also be employed to stimulate hair growth on the scalp and other body areas . the growth factors of the present invention have been identified in hen &# 39 ; s egg whites . ovalbumin is the major constituent of egg whites from the hen comprising about 75 % by weight of the egg white . the molecular weight of ovalbumin is approximately 4 , 500 , and ovalbumin is produced under hormonal control by the bird oviduct . it may be isolated and crystallized readily from the filtrate of an acidified mixture of egg white and an equal volume of saturated ammonium sulfate . sorensen et al ., c . r . trav . lab . carlsberg 12 , 12 ( 1917 ). alternative methods of isolation of ovalbumin are disclosed by kekwick et al ., biochem journal 30 : 227 ( 1930 ). ovalbumin can also be separated by electrophoresis and chromatography from about 10 other minor components found in egg whites including avidin ( qv ), lysozyme ( qv ), conalbumin ( qv ), and ovomucoid . the structure of ovalbumin is that of a complex protein consisting of a single polypeptide chain of about 460 residues ( about half of which are hydrophobic ), a maximum of 2 phosphate residues per mole , and a oligosaccharide side chain composed of only mannose and glucosamine residues . see narita , j . biochem . 52 : 367 ( 1962 ); thompson et al ., aust . j . biol . science 24 : 525 ( 1971 ). ovalbumin is soluble in electrolyte free water and combines with salts , acids and bases . denaturation can be induced by heating to 56 ° c ., by vigorous shaking , by electric current and by various chemicals such as acids , ammonium salts , heavy metal salts and alcohols . such methods produce complete and irreversible denaturation . the isoelectric point of ovalbumin is 4 . 63 . see merck index ( 12 th ed . 1996 ). in accordance with the compositions and method of the present invention , ovalbumin may be administered in the form of a pharmaceutical composition additionally comprising pharmaceutically acceptable carrier . one skilled in the art will appreciate that suitable methods of administering the ovalbumin compositions to an animal , such as a mammal , are available and , although more than one method can be used to administer a particular composition , a particular method and dosage can provide a more immediate and more effective reaction than others . pharmaceutically acceptable carriers are also well known to those skilled in the art . the choice of carrier will be determined , in part , both by the particular composition and by the particular method used to administer the composition . accordingly , there is a wide variety of suitable formulations of the pharmaceutical compositions of the present invention . the present invention is preferable in the form of a topical dosage form such as creams , ointments , lotions , gels or powders . the present invention may be formulated as necessary with additives used commonly in the pharmaceutical sciences , such as surfactants , oils and fats , polyhydric alcohols , lower alcohols , thickening agents , uv absorbents , light scattering agents , preservatives , antioxidants , antibiotics , chelating agents , ph regulators , flavoring agents , pigments and water . examples of surfactants include polyoxyethylene ( hereinafter abbreviated as poe -) branched alkyl ethers such as poe - octyldodecyl alcohol and poe - 2 - decyltetradecyl alcohol , poe - alkyl ethers such as poe - oleyl alcohol ether and poe - cetyl alcohol ether , sorbitan esters such as sorbitan monooleate , sorbitan monoisostearate and sorbitan monolaurate , poe - sorbitan esters such as poe - sorbitan monooleate , poe - sorbitan monoisostearate and poe - sorbitan monolaurate , fatty acid esters of glycerol such as glyceryl monooleate , glyceryl monostearate and glyceryl monomyristate , poe - fatty acid esters of glycerol such as poe - glyceryl monooleate , poe - glyceryl monostearate and poe - glyceryl monomyristate , poe - dihydrocholesterol ester , poe - hardened castor oil , poe - hardened castor oil fatty acid esters such as poe - hardened castor oil isostearate , poe - alkylaryl ethers such as poe - octylphenol ether , glycerol esters such as glycerol monoisostearate and glycerol monomyristate , poe - glycerol ethers such as poe - glycerol monoisostearate and poe - glycerol monomyristate , polyglycerol fatty acid esters such as diglyceryl monostearate , decaglyceryl decastearate , decaglyceryl decaisostearate and diglyceryl diisostearte and other nonionic surfactants ; potassium salts , sodium salts , diethanolamine salts , triethanolamine salts , amino acid salts and other salts of higher fatty acids such as myristic acid , stearic acid , palmitic acid , behenic acid , isostearic acid and oleic acid , the above alkali salts of ether carboxylic acids , salts of n - acylamino acids , n - acylsalconates , higher alkylsulfonates and other anionic surfactants ; alkylamine salts , polyamine , aminoalcohol fatty acids , organic silicone resin , alkyl quaternary ammonium salts and other cationic surfactants ; and lecithin , betaine derivatives and other amphoteric surfactants . examples of oils and fats include vegetable oils and fats such as castor - oil , olive oil , cacao oil , camellia oil , coconut oil , wood wax , jojoba oil , grape seed oil and avocado oil ; animal oils and fats such as mink oil and egg yolk oil ; waxes such as beeswax , whale wax , lanolin , carnauba wax and candelilla wax ; hydrocarbons such as liquid paraffin , squalene , microcrystalline wax , ceresine wax ; paraffin wax and vaseline ; natural or synthetic fatty acids such as lauric acid , myristic acid , stearic acid , oleic acid , isostearic acid and behenic acid ; natural or higher alcohols such as cetanol , stearyl alcohol , hexyldecanol , octyldecanol and lauryl alcohol ; and esters such as isopropyl myristate , isopropyl palmitate , octyldodecyl myristate , octyldodecyl oleate and cholesterol oleate . examples of polyhydric alcohols include ethylene glycol , polyethylene glycol , propylene glycol , 1 , 3 - butyrene glycol , 1 , 4 - butyrene glycol , diprophylene glycol , glycerol , diglycerol , triglycerol , tetraglycerol and other polyglycerols , glucose , maltose , maltitose , sucrose , fructose , xylitose , sorbitol , maltotriose , threitol and erythritol . examples of thickening agents include naturally - occurring high molecular substances such as sodium alginate , xanthene gum , aluminum silicate , quince seed extract , gum tragacanth , starch , collagen and sodium hyaluronate ; semi - synthetic high molecular substances such as methyl cellulose , hydroxyethyl cellulose , carboxymethyl cellulose , soluble starch and cationized cellulose ; and synthetic high molecular substances such as carboxyvinyl polymer and polyvinyl alcohol . examples of uv absorbents include p - amnobenzoic acid , 2 - ethoxyethyl p - methoxycinnamate , isopropyl p - methoxycinnamate , butylmethoxybenzoylmethane , glyceryl - mono - 2 - ethylhexanoyl - di - p - methoxybenzophenone , digalloyl trileate , 2 , 2 ′- dihydroxy - 4 - methoxybenzophenone , ethyl - 4 - bishydroxypropylaminobenzoate , 2 - ethylhexyl - 2 - cyano - 3 , 3 ′- diphenyl acrylate , ethylhexyl p - methoxycinnamate , 2 - ethylhexyl salicylate , glyceryl p - aminobenzoate , homomethyl salicylate , methyl o - aminobenzoate , 2 - hydroxy - 4 - methoxybenzophenone , amyl p - dimethylaminobenzoate , 2 - phenylbenzoimidazole - 5 - sulfonic acid and 2 - hydroxy - 4 - methoxybenzophenone - 5 - sulfonic acid . examples of preservatives include benzoates , salicylates , sorbates , dehydroacetates , p - oxybenzoates , 2 , 4 , 4 ′- trichloro - 2 ′- hydroxydiphenyl ether , 3 , 4 , 4 ′- trichlorocarbanilide , benzalkonium chloride , hinokitiol , resorcinol and ethanol . examples of antioxidants include tocopherol , ascorbic acid , butylhydroxyanisole , dibutylhydroxytoluene , nordihydroguaiaretic acid and propyl gallate . examples of antibiotics include penicillin , neomycin , cephalothin , potassium permanganate , selenium sulfide , erythromycin , bacitracin , tethacyclin , chloramphenicol , vancomycin , nitrofurantoin , acrisorcin , chlorodontoin , and flucytosine . some of these additives function to enhance the efficacy of the composition by increasing the stability or percutaneous absorbability of the essential components of the present invention . also , any dosage form is acceptable , whether in solution , emulsion , powder dispersion , or others . applicability is wide , including fundamental dosage forms such as lotions , emulsions , creams and gels . the composition of the present invention is preferably formulated according to formula 1 : the method for processing and pasteurizing hen egg whites is well known in the art and generally involves reverse osmosis , heating , and drying steps resulting in solid egg whites ready for compounding . in addition to those stated above , suitable vehicles , carriers and adjuvants include water , vaseline , petrolatum , mineral oil , vegetable oil , animal oil , organic and inorganic waxes , polymers such as xanthanes , gelatin , cellulose , collagen , starch , kaolin , carregeenan , gum arabic , synthetic polymers , alcohols , polyols , and the like . the carrier can also include sustained release carrier such as lypizomes , microsponges , microspheres , or microcapsules , aqueous base ointments , water in oil or oil in water emulsions , gels or the like . the dose administered to an animal , particularly a human , in the context of the present invention should be sufficient to effect a therapeutic response over a reasonable time frame . the dose will be determined by the strength of the particular compositions employed and the condition of the person . the size of the dose and the frequency of application also will be determined by the existence , nature , and extent of any adverse side effects that may accompany the administration of a particular composition . the composition of the present invention may be employed to treat diabetic ulcers , healing resistant wounds , bed sores , burns , osteomyelitis , trauma wounds , subcutaneous trauma and various forms of dermatitis . the following examples illustrate the inventive compositions and methods , but should not be regarded as limiting the invention in any manner . additional studies are in progress as of the filing date of this application . in march 1998 a female patient who underwent laminectomy and fusion of t3 and t4 began applying the inventive composition to the surgical wound . this patient experienced no scaring from the surgical wounds and continued to be without scars 10 months post surgery . this patient had a previous history of radical surgery in may 1960 for removal of a right breast tumor . the wound from that surgery healed in approximately one month , but left a large scar . eighteen months after the may 1960 surgery she had major abdominal surgery , and in 1985 had reconstructive of the right and left breast , but with both surgeries experienced significant scaring . thus , with the recent surgery , the inventive composition prevented scaring . the wound healing characteristics of the inventive composition was demonstrated on sprague - dawley rats using a cream according to formula 1 applied to a wound once daily for five days per week . the percentage of wound acceleration in days and in size was compared to control . the percent of wound acceleration in days was determined to be 5 . 19 , and the percent of acceleration in size was determined to be 22 . 07 . note : percentage wound acceleration in days =( 1 − td / cd )× 100 %, where td and cd are the days required for 80 % wound healing in the treatment and control animals , respectively . percent wound acceleration in size =( 1 − ta / ca )× 100 %, where ta and ca are the areas of the wounds in the treatment in control animals , when 80 % wound healing is reached on the former . a male patient routinely plagued by muscle and joint soreness and stiffness related to sports activities on the morning following such activities , applied the inventive composition to the affected areas and found that he experienced no joint soreness the mornings following the sports activities . patient number 964885 has been applying the inventive compositions to a diabetic ulcer on the left foot and has experienced a shrinkage of the wound . a female applied the inventive composition in a cream form to a third degree burn on her left inner forearm . after daily application of the cream to the affected area , the blister reabsorbed readily , and the area healed within seven days with no residual scar tissue . an 88 - year - old patient sustained a fall resulting in several facial abrasions and a 1 . 5 inch laceration over the right eyebrow . with the use of the inventive cream to the affected area , these lacerations healed in about 72 hours leaving no scar tissue . a male who has had diabetes for more than 30 years sustained various skin tears and small ulcers on his upper and lower extremities . daily application of the inventive composition in a cream form has kept the affected areas clean and painfree and healing took place in a relatively short time frame . a wound on a dog &# 39 ; s hind leg was so extensive that the pad of the paw was almost detached . the inventive composition cream was applied and the wound bandaged . a few days later , the veterinarian noticed remarkable healing in that the wound was clean and dry with a good granulation bed , and there was the beginning of granulation across the wound . the extent of the healing was so great that the dog was able to go home with no bandage on its paw . similarly , a filly who had experienced a cut foreleg to the cannon bone was administered the inventive cream and the wound was wrapped . two days later , upon removal of the bandage and checking of the wound , it had healed nicely across with a base of granulation over the periosteum and showed a good , clean , dry wound bed with moist , supple edges . several patients have used the inventive composition for arthritis , foot calluses , dry skin , back pain , bruises , allergies ( including latex allergies ), and inflammation . all such patients reported symptomatic relief using the inventive composition . the composition of the invention ( formula 1 ) was tested using antibodies directed against bovine and other mammalan derived growth factors . in particular , the antibodies used were targeted toward pdgf , fgf a , fgf b , tgfβ , tgfα , and egf . the following antibodies were used for detection of the growth factors . unless noted otherwise the antibodies were purchased from research diagnostics inc ., flanders , n . j . antibodies specificity catalog number identification according to label rdi - pdgfababg goat anti - pdgf recognizes pdgf - aa , - ab , - bb chains of human , primate , bovine and porcine . rdi - bfgfaabm mouse anti - fgf recognizes bovine acidic acidic fgf , human acidic fgf and human basic fgf . rdi - brgfbabm2 mouse anti - bovine recognizes bovine , rat , b . mouse and human fgf - fgf basic rdi - tgfbabmx mouse anti - human recognizes human , mouse tgf - b and bovine tgfb1 and b2 , also xenopus tgfb3 . rdi - tgfaabmb mouse anti - human recognizes mouse , rat and tgf - a human tcg - a rdi - msegfcabg goat anti mouse egf recognized mouse and c - term human egf at carboxy terminus donkey anti - goat igg ( h & amp ; l ) linked to biotin sp used for egf and pdgf antibodies . horse anti - mouse ( igg ( h & amp ; l ) linked to biotin used for all other antibodies . protein concentration was determined by the bca assay ( pierce ) according to manufacture &# 39 ; s instructions . ppt mg54 - 2 — 21 mg / ml 1 mg54 - 2 jul . 24 , 1997 115 mg / ml 2 mg54 - 3 sep . 8 , 1997 55 mg / ml for control samples crude rat brain homogenates were generated and run in adjacent lanes to samples of the inventive composition . separation of proteins was carried out in modified form from the procedures of laemmli ( nature 227 : 680 - 685 ( 1970 )). samples and controls were electrophoresed on a 15 % sds - page gel . 40 μg of sample or - control was loaded onto each lane . samples to test for pdgf and tgfb were run under non - reducing conditions as specified by the supplier of the primary antibody . all other samples and controls were run under reducing conditions . the samples were electrophoresed for 45 minutes at 200 v . the gel was placed on a pvdf membrane and electrophorectically transferred for one hour at 25 - 30 amps . the membrane was blocked for one hour in pbs containing 5 % nonfat dry milk . the primary antibodies were diluted in preparation for incubation with the membrane . unless otherwise noted the antibodies were diluted in pbs . the concentration of the antibodies used was as follows : goat anti - human pdgf - ab 10 ug / ml mouse anti - human tgfb 1 ug / ml in pbs with 1 mg / ml bsa mouse anti - bovine basic fgf1 ug / ml mouse anti - bovine acidic fgf 1 ug / ml in pbs with 5 mg / ml bsa mouse anti - human tgf a 10 ug / ml mouse anti - goat egf 10 ug / ml lanes were cut from the membrane and incubated overnight at 4 ° c . with the primary antibody of interest . the membrane strips were washed for one hour in pbs - tween ( 0 . 05 % tween 20 ) and incubated for two hours with the secondary antibody of choice diluted in pbs . for landes incubated with goat derived primary antibodies , biotin linked donkey anti - goat igg at 1 : 10 , 000 dilution was used as secondary antibody . for lanes incubated with mouse derived primary antibody , biotin linked horse anti - mouse igg at 7 . 5 μg / ml diluted in pbs ( 1 : 200 ) with 1 % normal horse serum was used as secondary antibody . the membrane strips were washed for one our in pbs and incubated with either streptavidin - hrp for one hour ( zymed 1 : 4000 , for donkey anti - goat igg stained strips ) or vectastain ab reagent ( avidin dh linked to biotinylated peroxidase ) for 30 minutes ( for horse anti - mouse igg stained strips ). the strips were washed for 30 minutes in pbs and developed using diaminobenzadine tetrahydrochloride ( dab ). the membrane strips were washed for 10 minutes in pbs and air dried . a preliminary western run to test the response of the antibodies was run without controls . antibodies to pdgf and tgf β showed little activity against the inventive composition ( lane 6 pdgf , 7 tgf β ). antibodies to egf , tgf α , fgf α , fgf β , ( lanes 1 - 4 , respectively ) had identical binding to the invention with bands at 70 kda , 32 - 34 kda and 15 - 17 kda . while the specific invention has been described with an emphasis upon preferred embodiments , it will be obvious to those of ordinary skill in the art that variations in the preferred methods of the present invention may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the following claims .
| 0 |
fig1 shows a heat exchanger plate 1 . the heat exchanger plate 1 comprises bulges 2 which are raised by a given height over the plane of the heat exchanger plate 1 . furthermore , the heat exchanger plate 1 comprises hollows 3 which are sunk to a given depth in this heat exchanger plate 1 . the bulges 2 are symbolized by white circles while the hollows 3 are symbolized by circles with a cross . as it is known in the art , two such heat exchanger plates 1 form a pair of plates when stacked upon each other . two such neighbouring plates usually will with be slightly differently shaped , such that when they are stacked , the bulge 2 of one plate meets with hollows 3 of the neighbouring plate , etc . flow paths are in this manner formed within such pairs . typically the flow path formed on one side of a heat exchanger plate 1 will belong to a first flow path , and the flow path formed on the opposite side will belong to a second flow path being sealed from the first flow path . the heat exchanger plate 1 is made of sheet metal . a sheet metal is a material having a good thermal conductivity and can be formed in a press or die . it is also possible to use plastic materials as sheet metal . the bulges 2 and the hollows 3 form a three - dimensional structured profile or pattern . this pattern is produced in said press or die . however , any other suitable pattern can be used , e . g . a herringbone pattern , as they are well established in the art . the heat exchanger plate 1 of the illustration comprises four through - openings 5 - 8 . these through - openings 5 - 8 are used to form channels or connections to the first and second flow paths respectively . for example , the through - openings 5 , 7 forms a supply and a return for the first flow path and the through - openings 6 , 8 form a supply and a return for the second fluid path . in order to separate the two flow paths from each other a gasket 9 is introduced between two heat exchanger plates . this is shown in fig2 a , 2 b . fig2 shows three heat exchanger plates 1 a , 1 b , 1 c . to simplify the further explanation the heat exchanger plate 1 b is simply termed as “ heat exchanger plate ” or “ first heat exchanger plate ”. the heat exchanger plate 1 a is termed as “ adjacent heat exchanger plate ” or “ second heat exchanger plate ”. the gasket 9 has a form that a first set of through - openings 5 , 7 is arranged outside a space sealed by the gasket 9 and a second set of through - openings 6 , 8 is arranged within the sealing , thus forming e . g . second flow path . the corresponding gasket between the first heat exchanger plate 1 b and a third heat exchanger plate 1 c is positioned such the openings 5 , 7 are sealed , and the openings 6 , 8 are left free to the external . in this way it is possible to use the through - openings 5 , 7 as supply and return for the first flow path and the through - openings 6 , 8 as supply and return for the second flow path . the gasket 9 is arranged within a groove 10 . this groove is shown in more detail in fig2 . the groove 10 has a inner surface 11 , in the present illustration being a bottom , and two side walls 12 , 13 . two protrusions 14 , 15 of the groove 10 of the first heat exchanger plate 1 b are directed to the adjacent or second heat exchanger plate 1 a . in its opposite or lower side the first heat exchanger plate 1 b comprises two recesses 16 , 17 in the form of which corresponds to the form of the protrusions 14 , 15 which is in the present case a triangle . however , it is possible that only the top of the protrusions is formed as a triangle . when two heat exchanger plates 1 a , 1 b are stacked onto each other and the gasket 9 is positioned in the groove 10 of the first heat exchanger plate 1 b , the gasket 9 is deformed in the region of the protrusions 14 , 15 . this deformation results in a compression of the gasket 9 which is stronger in the region of the protrusions 14 , 15 than in other regions . to this end the protrusions 14 , 15 have a height which ensures a significant deformation of the gasket 9 , such as at least 10 % 25 % of the thickness of the gasket 9 , or more preferably at least 20 %, or even more preferably at least 25 %. the gasket 9 is deformed into the recesses 16 , 17 on the lower side of the second heat exchanger plate 1 a . therefore , the gasket has a wave like form with regions of stronger compression and regions of a less strong compression . the inner surface 11 of the groove 10 is flat between the side walls 12 , 13 and the protrusions 14 , 15 . the bottom 11 of the groove 10 is flat as well as between the protrusions 14 , 15 . in these flat regions ( the lower side of the bottom 11 of the groove 10 is flat as well as in these regions ) have the effect that the gasket 9 is only slightly compressed in these regions as it is known from the art . the effect of the protrusions 14 , 15 is shown in fig2 b . even when the first heat exchanger plate 1 b is deformed under the pressure between the heat exchanger plates 1 a , 1 b the gasket 9 ensures a tight sealing . although the heat exchanger plate 1 b has been deformed , the protrusions 14 , 15 are still positioned within the gasket 9 . the elasticity of the material forming the gasket will just follow the protrusions 14 , 15 still forming a fluid tight barrier . the protrusions 14 , 15 will push at the gasket 9 thus still squeezing it against the second heat exchanger plate 1 a , even at a significant deformation of the heat exchanger plate 1 b . fig3 shows a detail iii of fig1 in a larger scale without the gasket 9 . it can be seen that the protrusions 14 , 15 in the groove 10 are restricted to a section of the groove 10 surrounding the through - opening 5 partly . therefore , the protrusions 14 , 15 run along a curved path thus strengthening the heat exchanger plate 1 . the groove 10 has at least a linear section 18 , 19 running along the edges of the heat exchanger plate 1 . the protrusions 14 , 15 are restricted to an area out of said linear sections 18 , 19 . in fig4 a slightly modified embodiment is shown . the same elements have the same reference numerals . in fig4 the gasket is not shown . auxiliary protrusions 20 are arranged in the groove 10 . these auxiliary protrusions 20 traverse the groove 10 orthogonal to the protrusions 14 , 15 . these auxiliary protrusions 20 serve to strengthen the heat exchanger plate 1 in the orthogonal direction too . fig5 shows an alternative embodiment where the grooves 10 instead are ‘ up - wards ’ hollows within the walls 12 , 13 forming a raised section , the inner surface 11 being a top . the gasket 9 then rests on this raised section , being the top 11 of the raised section of the lower heat exchanger plate , and this lower section then has protrusions 14 , 15 reaching into the hollows forming the grooves 10 , thus pressing the gaskets 9 into the hollows deforming it as described above . any of the embodiments of the fig1 - 4 also applies to this embodiment of fig5 . while the present invention has been illustrated and described with respect to a particular embodiment thereof , it should be appreciated by those of ordinary skill in the art that various modifications to this invention may be made without departing from the spirit and scope of the present .
| 5 |
referring to fig1 , the vehicle seat 10 is supported on a frame 12 , and includes foam cushions 14 and 16 on the seat bottom and back . the seat 10 is equipped with a conventional shoulder / lap seat belt 18 anchored to the vehicle floor ( not shown ) and b - pillar 20 . in use , the belt 18 is drawn around an occupant or through the frame of a child or infant seat , and a clip 22 slidably mounted on the belt 18 is inserted into the buckle 24 to fasten the belt 18 in place . a retractor assembly ( not shown ) mounted in the b - pillar 20 maintains a desired tension on the belt 18 , and locks the belt 18 in place when the vehicle experiences significant deceleration . according to this invention , the presence of a rfis on the seat cushion 14 is detected based on the operating state and tension of the seat belt 18 , and the position of the seat belt 18 relative to a bight region 26 where the seat bottom and back cushions 14 , 16 meet . the operating state of the seat belt 18 — i . e ., buckled or un - buckled — is detected by a switch within the buckle 24 that is closes or opens on insertion of the clip 22 into the buckle 24 . one side of the switch is connected to an electrical ground or power terminal , while the other side is coupled to the conductor 28 to provide an electrical signal ( state ) indicative of the belt state . the seat belt tension is detected by a belt tension sensor 30 that may be located in the b - pillar 20 as shown , near the floor on the outboard side of seat 10 , or in any other convenient location . the tension sensor 30 may be constructed as disclosed , for example , in the aforementioned u . s . pat . no . 6 , 605 , 877 to patterson et al ., incorporated herein by reference , and produces an electrical signal ( tension ) on line 32 indicative of the seat belt tension . the proximity of the seat belt 18 relative to the bight region 26 is detected magnetically using a seat belt magnetic strip 34 a and a first hall effect seat sensor 36 . the first hall effect sensor 36 is disposed in the seat back or bottom cushion 14 , 16 in the vicinity of the central portion of the bight region 26 , and the magnetic strip 34 a is embedded in the fabric of the seat belt 18 . when the seat belt 18 is in proximity to the central portion of the bight region 26 as shown in fig1 , the strip 34 a is magnetically coupled with the sensor 36 , and an electrical signal ( pos 1 ) produced by sensor 36 on line 38 indicates that the seat belt 18 is near the bight region 26 ; in other positions of the seat belt 18 , there is only weak magnetic coupling between the strip 34 a and the sensor 36 , and the pos 1 signal indicates that the seat belt 18 is disposed away from the bight region 26 . optionally , a second hall effect sensor 40 is disposed in the middle of the seat back cushion 16 , and detects proximity of the seat belt 18 to the seat back cushion 16 by virtue of a magnetic strip 34 b embedded in the fabric of the seat belt 18 . when the seat belt 18 is in proximity to the back cushion 14 as shown in fig1 , the strip 34 a is magnetically coupled with the sensor 40 , and an electrical signal ( pos 2 ) produced by sensor 40 on line 42 indicates that the seat belt 18 is close to the back cushion 16 ; in other positions of the seat belt 18 , there is only weak magnetic coupling between the strip 34 b and the sensor 40 , and the pos 2 signal indicates that the seat belt 18 is disposed away from the back cushion 16 . the magnetic strips 34 a and 34 b may be constituted by individual lap and shoulder portions as shown , or by a single continuous strip of magnetic material if desired . in any event , portions of the seat belt 18 containing the magnetic strips 34 a and 34 b will be in proximity to the first and second sensors 34 and 40 when a rfis is present , much the same as when the seat belt 18 is buckled with an empty seat as depicted in fig1 ; and no part of the seat belt 18 will be in proximity to the sensors 34 or 40 when the seat belt 18 is used to properly secure a normally seated person or a forward - facing infant seat . the electrical signals on lines 28 , 32 and 38 ( and optionally , line 42 ) are provided as inputs to a passive occupant detection system electronic control unit ( pods ecu ) 50 , which in turn , is coupled to an airbag control module ( acm ) 52 via bi - directional communication bus 54 . the acm 52 may be conventional in nature , and operates to deploy one or more airbags or other restraint devices ( not shown ) for vehicle occupant protection based on acceleration data and occupant characterization data obtained from pods ecu 50 . in general , acm 52 deploys the restraints if the acceleration signals indicate the occurrence of a severe crash , unless the pods ecu 50 indicates that a rfis is present . also , acm 52 communicates the suppression status and driver warnings to a driver display device 56 . in general , the pods ecu 50 characterizes the inputs on lines 28 , 32 and 38 ( and optionally , line 42 ), and applies them to a decision matrix such as depicted by the chart of fig3 to determine if a rfis is present . the flow diagram of fig2 represents a software routine that is periodically executed by the pods ecu 50 according to this invention . the block 60 is first executed to read the inputs including the seat belt tension ( tension ), the seat belt status ( status ), and the seat belt position ( pos 1 ). as indicated above and explained below , the inputs may optionally include the position signal pos 2 . the block 62 then characterizes the analog inputs ( tension and pos 1 ) by comparing them to various predefined thresholds , and applies the inputs to the decision matrix of fig3 . in the illustrated embodiment , tension is characterized as being either high ( above a tension threshold ) or low ( below the tension threshold ), and the position pos 1 of the seat belt relative to the bight area of the seat is characterized as being either near ( above a proximity threshold ) or far ( below a proximity threshold ). the decision matrix of fig3 provides an rfis present output ( yes or no ) and a driver warning output , and the block 64 causes the pods ecu 50 to supply the outputs to acm 52 . the acm 52 allows or suppresses air bag deployment based on the supplied outputs , and visually communicates the occupant status and any driver warnings via display 56 . referring to fig3 , the decision matrix of the illustrated embodiment comprehends the eight possible output combinations of tension , status and pos 1 . states 1 and 2 result in a yes condition of the rfis present output ; in each case , status = buckled and pos 1 = near . in state 1 , tension = high , and no driver warning is produced ; in state 2 , tension = low , and a driver warning ( warning 1 ) is produced to indicate that the seat belt tension should be increased in order to properly restrain the infant seat . state 1 can also occur when the seat 10 is occupied by a normally seated person while the seat belt 18 buckled but positioned behind the occupant ; accordingly , the driver warning ( warning 1 ) should be broad enough to encompass either an improperly tensioned infant seat or an improperly restrained but normally seated person . the other states ( 3 – 8 ) result in a no condition of the rfis present output , because status = unbuckled and / or pos 1 = far . in systems where the seat belt position signal pos 2 is provided as an additional input , the decision matrix may detect additional conditions of improper seat belt usage by a normally seated person . for example , an occupant may be utilizing the lap portion of the seat belt 28 properly , with the shoulder portion of the seat belt 28 improperly disposed between the occupant and the seat back cushion 16 ; in this case , pos 1 = far but pos 2 = near . if this combination of position inputs occurs while status = buckled , the pods ecu 50 may issue a suitable driver warning . another improper condition can also occur when an occupant is improperly sitting on the lap portion of the seat belt 28 , with the shoulder portion of the seat belt 28 properly positioned in front of the torso ; in this case , pos 1 = near but pos 2 = far . this has the benefit of distinguishing between an improperly tensioned infant seat and a normally seated but improperly belted occupant . in summary , the present invention provides a simple and cost - effective way of reliably detecting the presence of a rfis without requiring special equipment on the infant seat . the addition of the optional seat back belt proximity sensor provides further occupant detection capability , and the ability to distinguish between an improperly tensioned infant seat and a normally seated but improperly belted occupant . while the present invention has been described with respect to the illustrated embodiment , it is recognized that numerous modifications and variations in addition to those mentioned herein will occur to those skilled in the art . for example , the system may include additional sensors if desired , or a proximity sensor other than a hall effect sensor , and so on . accordingly , it is intended that the invention not be limited to the disclosed embodiment , but that it have the full scope permitted by the language of the following claims .
| 1 |
the following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . the words “ rest ” or “ pause ” or “ retracted ” are used interchangeably herein to refer to the position or status of the wipers generally when motion is temporarily stopped during intermittent operation and the word “ stowage ” is used generally to refer to the wiper position or status when the wipers are off . fig3 - 4 are simplified representations of the windshield wiping - washing and wiper de - icing system 50 of the present invention for different wiper arm positions 34 , 35 . in fig3 , wiper assemblies 24 , 24 ′ are shown in standard wiping - washing state 34 , similar to that shown in fig1 , that is , wiper assemblies 24 , 24 ′ are up on the windshield moving according to arrows 32 , 32 ′ and emitting washing fluid sprays 30 . this is analogous to the normal wiping - washing mode illustrated in fig1 . however , system 50 differs from prior art system 20 in that , among other things , auxiliary de - icing spray nozzles 36 , 36 ′ are provided . auxiliary de - icing spray nozzles 36 , 36 ′ spray wiper assemblies 24 , 24 ′ when they are in pause or stowage position 35 illustrated in fig4 . the washer fluid emitted as sprays 37 , 37 ′ contains an antifreeze compound and therefore acts to melt ice that has accumulated on wiper assemblies 24 , 24 ′. when wiper assemblies 24 , 24 ′ are in retracted or stowage position 35 , windshield washing sprays 30 are desirably turned off , but this is not essential . fig5 - 6 are simplified schematic piping diagrams of windshield wiping - washing and wiper de - icing system 50 of the present invention showing further details and illustrating washing fluid flow during different modes of operation . for clarity , the details of wiper arm spindle 25 , wiper arm 26 , wiper blade support bracket 27 and wiper blade 28 are omitted in fig5 - 6 . as shown in fig5 - 6 , system 50 of the present invention includes washing fluid reservoir 52 , washing fluid pump 54 , valve 56 , and : ( i ) tubing or conduit 57 leading to wiper assemblies 24 , 24 ′ with spray nozzles 29 emitting washing fluid sprays 30 ( see fig5 ), and ( ii ) tubing or conduit 58 leading to nozzles 36 emitting washing fluid sprays 37 ( see fig6 ). for convenience of explanation and not intended to be limiting , it is assumed that wiper assembly 24 ′ is like assembly 24 and operates in substantially the same way and likewise for nozzles 36 ′, 36 and sprays 37 ′, 37 . for convenience of description , unless otherwise expressly indicated , reference numbers 24 , 36 , 37 are intended to include their primed equivalents 24 ′, 36 ′, 37 ′. in fig5 - 6 heavier dark lines are used to illustrate the paths followed by windshield washing fluid 53 from reservoir 52 , through pump 54 and valve 56 to wiper assembly spray nozzles 29 in fig5 or auxiliary de - icing spray nozzles 36 in fig6 . fig5 illustrates washing fluid flow during normal wiping - washing mode of operation . in fig5 washing fluid 53 flows from pump 54 through valve 56 through channel 57 to wiper assembly 24 and nozzles 29 , which produce sprays 30 . fig6 illustrates the arrangement of parts and washing fluid flow during the wiper de - icing operation of the present invention . in fig6 washing fluid 53 flows from reservoir 52 through pump 54 , through valve 56 and conduit 58 to nozzles 36 , which produce sprays 37 . nozzles 36 are arranged with respect to wiper assembly 24 in retracted or rest position 35 so as to maximize coverage of wiper assemblies 24 by sprays 37 , especially coverage of support brackets 27 and blades 28 where ice formation can have the largest impact . in fig5 - 6 valve 56 is assumed to be a two position exclusive or valve , that is , washing fluid 53 flows either to nozzles 29 or nozzles 36 but not to both nozzles 29 and 36 at the same time . however , this is merely for convenience of description and not intended to be limiting . persons of skill in the art will understand based on the description herein that valve 56 may , alternatively , be such that washing fluid 53 flows to nozzles 29 for sprays 30 whenever pump 54 is on and that valve 56 only switches on and off sprays 37 . either arrangement is useful . still further , persons of skill in the art will understand based on the description herein that valve 56 may embody two independent valves , one for nozzles 36 and sprays 37 and another for nozzles 29 and sprays 30 , but this is not essential . a dual valve arrangement has the advantage of flexibility of operation since sprays 30 and 37 may be independently controlled . in the preferred mode of operation sprays 37 come on when wiper assembly 24 is in retracted position 35 and sprays 30 come on when wiper assembly 24 is in wiping position 34 and the user has activated the “ wash ” mode switch . fig7 is a simplified electrical schematic diagram of control system 70 useful for wiping - washing and wiper de - icing system 50 of the present invention . system 70 comprises washer - on switch 72 ( the “ wash ” mode switch ) coupled to controller 74 by bus or leads 73 , memory 76 coupled to controller 74 by bus or leads 75 , temperature sensor 78 coupled to controller 74 by bus or leads 77 , washer fluid pump switch 80 coupled to controller 74 by bus or leads 81 , wiper actuator 82 coupled to controller 74 by bus or leads 83 , de - ice valve activator 84 coupled to processor 74 by bus or leads 85 and wiper position sensor 86 coupled to processor 74 by bus or leads 87 . wiper actuator 82 and wiper position sensor 86 may be integrated in the same housing or interconnected as shown by bus or leads 89 . washer - on switch 72 is what the operator uses to initiate a windshield washing operation , that is , to launch a wash cycle or wash mode . memory 76 stores operating programs ( e . g ., see fig7 ), predetermined constants ( e . g ., t 1 , tp , tc , etc .) and intermediate variable values used by controller 74 of control system 70 in operating system 50 . pump switch 80 energizes pump 54 of fig5 - 6 . controller 74 manages overall operation of washer / wiper / de - icing system 50 . wiper actuator 82 , e . g ., a motor or motor assembly , causes wiper assembly 24 to move across windshield 22 in directions 32 and return to rest , pause and / or stowage position 35 , under the control of controller 74 . de - ice valve activator 84 opens and closes valve ( s ) 56 and wiper position sensor 86 monitors or determines the position of wiper assembly 24 , that is , whether it is in wiping position 34 or in retracted or stowage position 35 . person of skill in the art will understand that the pause or rest position of wiper assembly 24 may be somewhat different than the stowage position . in general , in the rest or pause position , assembly 24 usually does not retracted as far toward or at the base of the windshield as in the stowage position . for the purposes of this invention , nozzles 36 may be located so that sprays 37 contact wiper assemblies 24 in either the pause or stowage positions or both according to the needs of the designer . persons of skill in the art will also understand that different types valves may be used for valve ( s ) 56 and , as used herein , the words “ de - ice valve actuator 84 ” are not intended to be limiting and are intended to include any type of mechanism as may be appropriate to operate the type of valve ( s ) 56 being used . the operation of system 70 will be more fully understood by reference to fig8 . control system 70 may be a fully software programmable system wherein program instructions are stored in memory 76 and executed by controller 74 or it may be a hardwired logic system or a combination thereof control system 70 may be a dedicated controller substantially dealing only with washing / wiping / de - icing system 50 or may be part of an overall or shared vehicle electronic system dealing with system 50 on a part time basis , or a combination thereof the various elements of system 70 may be dumb , that is , operating entirely under the direction of controller 74 or may be smart , that is , containing some logical functions and / or timers . the various elements in system 70 may operate under the general direction of controller 74 but provide certain sub - functions ( e . g ., timing , critical value comparisons , etc .) on their own . either arrangement is useful . various time intervals or time durations mentioned herein , e . g ., t 1 , tp , etc . may be measured using software loops or other programmable means or may be measured by separate hardware timers or combinations thereof . for example , dry - mode time duration t 1 may be determined by controller 74 or may be determined by a timer built actuator 82 or elsewhere and the signals sent by controller 74 to operate actuator 82 adapted accordingly . any and all of these variations are useful and persons of skill in the art will understand based on the description herein how to implement them depending upon the needs of their particular application . fig8 is a simplified process flow chart of method 100 of operating wiping - washing and wiper de - icing system 50 of the present invention , according to a preferred embodiment . method 100 is executed by control system 50 of fig7 in combination with reservoir 52 , pump 54 and valve ( s ) 56 of fig5 - 6 . method 100 begins with start 102 that desirably occurs at vehicle power - up , that is , when system 70 is energized when the vehicle is turned on . system 70 and method 100 are quiescent until the operator or other vehicle operator pushes or otherwise activates switch 72 to initiate a wash cycle , whereupon wash switch on ? query 104 results in a yes ( true ) outcome . ( prior to that query 104 returns a no ( false ) outcome and loops back to start 102 .) method 100 then progresses to start pump step 106 wherein , for example , controller 74 retrieves a “ start wash ” signal from switch 72 and sends an appropriate signal over bus or leads 81 to pump switch 80 thereby causing washing fluid pump 54 to start pumping fluid 53 from reservoir 52 through washing / de - icing system 50 . this initiates the windshield washing process . as will be subsequently explained , washing fluid pump stays on as long as the operator continues to activate switch 72 . following start pump step 106 , method 100 executes outside temp & gt ; tc ? query 108 wherein it is determined whether or not the outside air temperature measured by temperature sensor 78 is greater than a predetermined critical tc . tc is the temperature at which there is a significant probability of ice formation on wiper assembly 24 , and is generally in the range of 0 ° c . to − 39 ° c ., usually about 0 ° c . to − 20 ° c . and more likely about − 7 ° c . however , some ice formation may occur even though the average ambient temperature is ≧ 0 ° c . because heat loss from evaporation may lower the temperature of residual water on wiper assembly 24 or wiper assembly 24 itself to below 0 ° c . therefore , setting tc in the range about + 5 ° c . to − 5 ° c . is convenient , with about 0 ° c . preferred . tc may be retrieved from memory 76 by controller 74 or may be stored in sensor 78 . either arrangement is useful . if the outcome of query 108 is yes ( true ) meaning that the outside air temperature is high enough that ice formation on wiper assembly 24 is unlikely , then method 100 proceeds to steps 110 - 118 . steps 110 - 118 are analogous to conventional wash cycle steps 64 - 68 , respectively . ww on in windshield wash mode step 110 is executed . ( the abbreviation “ ww ” stands for “ windshield wiper ”.). step 110 causes the wipers to begin moving across the windshield , usually in a low speed mode , suitable for a wash cycle . wash switch still on ? query 112 is then executed to determine whether the operator is still activating the “ wash ” switch . if the outcome of query 112 is yes ( true ) then method 60 loops back as shown by path 112 a and the pump and windshield wipers remain on . if the outcome of query 112 is no ( false ), then stop pump step 114 is executed and the washing fluid pump shuts off , thereby terminating spraying of the windshield with washing fluid . the combination of steps 106 - 114 cause nozzles 29 to emit washing fluid spray 30 onto the windshield as long as the operator is activating the “ wash ” switch and the ambient temperature t & gt ; tc . after stop pump step 114 washing fluid no longer flows to nozzles 29 and ww on in windshield dry mode for time t 1 step 116 is executed to dry the windshield for time duration t 1 . in step 116 the windshield wipers may be left in the same mode set in step 110 or changed to a different operating mode . the duration t 1 may be selected by the designer , depending upon the particular vehicle &# 39 ; s requirements . approximately 10 seconds is a non - limiting example of a useful time duration for t 1 , but larger or smaller values can also be used . following the expiration of time duration t 1 , method 100 executes return ww to prior mode step 118 whereby it returns operation of the wipers to whatever state or mode they were in prior to initial query 104 . method 100 then returns to start 102 and initial query 104 as shown by path 119 . most modern wiper systems can operate continuously at various speeds or in a pause or delay mode . in the delay mode , wiper assembly 24 operates in wiping position 34 for a predetermined wiping time and pauses in rest position 35 for a predetermined ‘ pause ’ time tp , and then repeats the sequence wipe - pause - wipe , etc . returning now to query 108 , if the outcome of query 108 is no ( false ), then method 100 proceeds to ww on in de - ice mode step 120 . the de - ice mode is preferably a minimum pause time operating mode , that is tp has its smallest value . pause time tp may , for example , be retrieved by controller 74 from memory 76 or maybe built into actuator 82 or a combination thereof . either arrangement is useful . minimum pause times tp are conveniently in the range of 0 to 2 seconds , typically in the range of 0 . 1 to 1 seconds and preferably in the range of 0 . 25 to 0 . 50 seconds . following step 120 , system 50 prepares to de - ice wiper assemblies 24 by executing ww moving ? query 122 . in step 122 , system 70 determines whether wiper assembly 24 is moving or not , e . g ., stuck in the ice or temporarily paused . if the outcome of query 122 is yes ( true ) indicating that wiper assemblies 24 are moving , then method 100 proceeds to step 124 . in step 124 if de - ice valve 56 is already open to permit washer fluid 53 to flow to nozzles 36 , then valve 56 is closed . if valve 54 is already closed , then in step 124 , it remains closed . this is accomplished by controller 74 sending an appropriate signal to de - icing valve activator 84 controlling valve ( s ) 56 . if the outcome of query 122 is no ( false ) indicating that wiper assemblies 24 are not moving , e . g ., one or both of assemblies 24 , 24 ′ are held fast by ice or in a temporary pause , then in step 126 , de - icing valve activator 84 is energized to open valve 56 causing washer fluid 53 to flow to nozzles 36 so that sprays 37 are directed toward wiper assemblies 24 while in retracted or paused position 35 . following steps 124 or 126 , wash switch still on ? query 128 is executed wherein controller 74 determines the state of switch 72 ( or 80 ). if the outcome of query 128 is no ( false ) indicating that the operator has released switch 72 , then method 100 proceeds to stop pump step 114 , ww on in windshield dry mode for time t 1 step 116 , return ww to prior mode step 118 and return to start 102 via path 119 , as already discussed . if the outcome of query 128 is yes ( true ) indicating that the operator has ‘ wash ’ switch 72 ( and therefore pump switch 80 ) still activated , then method 100 loops back to step 122 as shown by path 129 . as long as the operator continues to depress or otherwise activate switch 72 , method 100 will activate sprays 37 whenever wiper assemblies 24 are paused or stuck in position 35 and thereby provide de - icing fluid to assemblies 24 . there are two scenarios of interest : first , if wiper assembly 24 is frozen , unable to move and is stuck in the pause or rest or stowage position , method 100 continues to bathe wiper assembly 24 in washing fluid de - icing spray 73 as long as switch 72 is activated ; and second , if wiper assembly 24 can move and shuttle back and forth in the direction of arrows 32 , then in the de - ice mode provided by step 120 , each time wiper assembly 24 stops in pause or rest position 35 , valve 56 opens in response to step 126 and wiper assemblies 24 are bathed with washing fluid de - icing spray 73 during the pause interval . this serves to retard or prevent further ice buildup when the wipers are operating in cold weather conditions . method 100 continues around this loop ( steps 120 , 122 , 124 / 126 , 128 ) until the operator releases switch 72 and pump 54 shuts off in step 114 . then , as already discussed , method 100 proceeds to ww on in windshield dry mode for time t 1 step 116 , return ww to prior mode step 118 and then returns to start 102 as shown by path 119 . in the preferred embodiment , the operator controls the amount of windshield washer fluid by maintaining the switch 72 in the active position , but this is not essential . alternatively , controller 74 or the vehicle computer can control the amount of windshield washer fluid delivered during the wash cycle and / or the de - ice cycle . this has the advantage that the state of the vehicle can be used to determine the time required for the various steps executed in method 100 . for example and not intended to be limiting , the pump - on time and the wash and / or de - ice time can be made dependant on vehicle geometry , vehicle speed , wind speed , wiper speed , wiper motor feedback , windshield size , pump flow , ambient temperature , wash fluid composition , washer fluid temperature , other factors and / or combinations thereof this allows the system to deliver an appropriate amount of fluid and wiper and / or de - ice cycle times as function of the current vehicle state . for example , when the vehicle is parked , the de - ice mode spray interval and the wipe intervals can be lengthened to help combat accumulating snow or other adverse conditions . while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . for example , while operation of system 50 has been described in terms of nozzles 29 being mounted on wiper assemblies 24 , this is not essential . alternatively , nozzles 29 may be mounted on the vehicle itself , for example , at the periphery of windshield 22 and spray onto windshield 22 during the windshield washing cycle before or during wiper motion 32 . either arrangement is useful . it will also be noted that , in contrast to prior art wiper de - icing arrangements such as are described for example in u . s . pat . no . 6 , 438 , 789 b1 , nozzles 36 are preferably fixed and that a pop - up blade de - icing arrangement is not necessary . this significantly simplifies blade de - icing and is a significant advantage over the prior art . it will be further noted that although in the preferred embodiment sensor 78 is used to measure ambient air temperature t and query 108 is executed in preferred method 100 to determine whether t & gt ; tc , this is not essential . the present invention will also operate if temperature sensor 78 is omitted and query 108 is replaced with a timing or randomizing step that toggles method 100 between branches 110 - 112 and branch 120 - 128 ( the branches rejoin at step 114 ) at periodic or random intervals . some washing fluid will be wasted when freezing is unlikely , but this alternative arrangement provides a useful backup in case sensor 78 fails . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing the exemplary embodiment or exemplary embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the invention as set forth in the appended claims and the legal equivalents thereof
| 1 |
a magnetic separation device 10 to separate non - magnetic components from magnetic components in a wet or dry mixture , as shown in fig1 - 5 , the device comprising a non - magnetic cylindrical housing 20 defining an inner longitudinal cylindrical channel 22 , an outer surface 24 , a central radial hilt 30 , a closed end tool section 25 and a handle section 27 defining an opening 29 to the inner longitudinal channel 22 , a handle section grommet 40 having a central aperture 42 , the handle section grommet 40 inserting within the opening 29 of the handle section 27 , a drive shaft 60 defining a tool end 62 , a cylindrical neck 64 and a drill attaching end 66 , the tool end 62 attaching a strong cylindrical bipolar magnet 50 encased within a slip sleeve 55 , the slip sleeve 55 slidably engaged within the inner longitudinal cylindrical channel 22 , the drill attaching end 66 extending beyond the central aperture 42 of the handle section grommet 40 further secured to a rotary drive apparatus a , fig1 , delivering rotation to the 60 drive shaft , the bipolar magnet 50 upon the tool end 62 rotating within the inner longitudinal cylindrical channel 22 of the cylindrical housing 20 and being movable between the tool section 25 and the handle section 27 as drive shaft 60 is pulled or pushed with the neck 64 moving within the central aperture 42 of the grommet 40 , the bipolar magnet 50 producing an alternating and rotating magnetic field around the outer surface 24 of the cylindrical housing 20 attracting magnetic components from a mixture of magnetic and non - magnetic particles against the outer surface 24 of the cylindrical housing 20 , spinning the particle mixture upon the outer surface 24 of the tool section 25 of the cylindrical housing 20 while the bipolar magnet 50 is positioned within the tool section 25 , fig2 . this spinning action urges , liberates and releases the non - magnetic particles outward while spinning , grinding and agitating the magnetic particles against one another while rotating upon the outer surface 24 , wherein the non - magnetic particles are expelled and collected from the spinning mixture while the magnetic particles remain bound to the outer surface 24 at the tool section 25 of the cylindrical housing 20 . once the user has cleaned the quantity of mixed materials to their satisfaction , the device 10 is then transferred to a disposal location where the magnetic material is removed from the outer surface 24 of the tool section 25 of the cylindrical tube 20 by withdrawing the bipolar magnet 50 by sliding the drive shaft 60 from the tool section 25 into the handle section 27 , fig3 , the magnetic material removed from the outer surface 24 as the bipolar magnet 50 is passed by the radial hilt 30 into the handle section 27 , withdrawing the magnetic attraction retaining the magnetic material from the tool section 25 , the radial hilt 30 blocking the magnetic material from transfer onto the outer surface 24 of the handle section 27 within which the bipolar magnet 50 is now positioned . it would be beneficial for the cylindrical housing 20 to be made of a smooth , non - stick material for ease of removal of the magnetic materials from the tool section 25 during disposal . the device 10 is then ready for further use in processing more of the mixture , or reprocessing the same material for more complete separation by returning the bipolar magnet 50 to the tool section 25 of the cylindrical housing , fig2 . the slip sleeve 55 surrounding the bipolar magnet 50 is made of a non - magnetic friction reducing material which allows the encased bipolar magnet 50 to rotate and slide freely within the inner longitudinal cylindrical channel 22 . the bi - polar magnet 50 is a strong earth magnet having a positive portion n and a negative portion s which may be provided in several polar configurations embodiments including a radial polar and a diametric polar configuration , as shown in fig4 and 5 . this bi - polar magnet 50 would configure the positive portion n and negative portion s in a manner which would produce a shifting or alternating magnetic field during rotation . this rotation causes the magnetic particles to also rotate around the outer surface of the cylindrical housing 20 at the same speed as the rotary drive apparatus a would turn the attached drive shaft 60 . the higher the rotational speed of the drive shaft 60 , the greater the rotational speed of the bipolar magnet 50 and its resulting alternating magnetic field , further causing greater rotation and grinding movement of the magnetic particles , separating the non - magnetic particles from confinement within the magnetic particles and producing a greater amount of rotational force or inertia upon the non - magnetic particles , spinning those non - magnetic particles outward and releasing them from the mixture , preferably into a container for further processing . the retained magnetic particles are then transferred to an appropriate waste disposal container while still attached upon the device 10 and released from the device 10 into the waste disposal container by withdrawing the bipolar magnet 50 within the cylindrical housing 20 from the tool section 25 to the handle section 27 thereby removing the magnetic attraction from the tool section 25 . the radial hilt 30 would be attached to the outer surface 24 of the cylindrical housing 20 along a linear axis between the tool section 25 and the handle section 27 introducing a barrier between the tool section 25 and handle section 27 and also a hand grip stop for the user to hold during operation and use , with the positioning of the radial hilt 30 dependant on the manufactured length desired for the tool section 25 . it is contemplated that the radial hilt 30 may be incorporated into a handle section sleeve 28 which inserts over the outer surface 24 of the handle section 27 of the cylindrical housing 20 , fig3 and 4 , the handle section sleeve 28 being also made of a non - magnetic material and could also be constructed with the radial hilt 30 as an integrated component . as currently constructed , the tool section 25 beyond the radial hilt 30 is provided in a short version and a long version , with the handle section 27 being provided in both versions at approximately the same size and length . the radial hilt 30 would further provide a tool side surface 32 and a handle side surface 34 , with the radial hilt 30 aligning the tool side surface 32 and handle side surface 34 at right angles with the outer surface 24 , as shown in fig2 and 3 , for better deterrent to the passage of magnetic materials during withdrawal of the bipolar magnet 50 from the tool section 25 to the handle section 27 of the cylindrical housing 20 . it is contemplated within the scope of this device 10 that its use may be in conjunction with mining and prospecting , ideally suited for use in the separation of black sand mixtures containing precious metals , and also in applications involving plastics and foundries , oil and petroleum refinement , oil and petroleum extraction , chemical and pharmaceutical processing , agricultural and food processing or any other industrial use requiring the separation or extraction of magnetic particles . additionally , the rotary drive apparatus a may be proportionally sized to the application employed , from as small as the hand held rotary drill shown in fig1 , above , to an independent drive mechanism , not shown , which is supplied to the device or provided locally within the industrially application or appliance to compel the required rotational force and speed . a mechanical means , also not shown , may also be provided within a large industrial section to move the magnet from the tool section to the handle section , not under human hand control as is implied in the present device employing the hand held drill of fig1 , the handle section 27 alternatively being referenced as a base section , an anchor section , or a dormant section , depending on the size of the magnet , its orientation and the magnitude of the correlating components . it is contemplated that the device 10 may be used in conjunction with other mining and prospecting application , such as incorporation of the device into a trammel , wet or dry sluice , roller cage , swarf , air or water spinning devices , barrels or drums , or into a conveyor drive mechanism , as observed in the prior art and as determined by those skilled in the art who might substitute the novel features of the current device into other technologies . additionally , the cylindrical housing 20 is intended to be used as a hand held device , held in one hand against the handle side surface 34 by the handle section 27 , with the other hand being used to operate the rotary drive apparatus a while controlling the position location of the bipolar magnet 50 within the longitudinal cylindrical channel 22 . it is essential that the cylindrical housing 20 be of an appropriate circumference to be comfortably and securely held by a user . thus , the cylindrical housing 20 may be presented in more than one circumference for the comfort to various users , with the bipolar magnet 50 and other components accordingly sized to maintain the intended function of the device 10 . the cylindrical bi - polar magnet 50 would preferably be no longer than the length of the tool section 25 , the tool side surface 32 of the radial hilt 30 imposing a separation barrier between the tool section 25 of the cylindrical housing 20 and the handle section 27 of the cylindrical housing 20 , while completely withdrawing any magnetic attraction to the tool section 25 when the bipolar magnet 50 is completely withdrawn into the handle section 27 to release the magnetic particles from the tool section 25 , fig3 . without the radial hilt 30 , the magnetic particles would simply pass along the cylindrical housing 20 without the ability to release the magnetic particles from the cylindrical housing 20 . with the inclusion of the radial hilt 50 , the attracted and attached magnetic particles are prevented from passing along the cylindrical housing 20 and , when the bipolar magnet 50 is withdrawn past the radial hilt 30 , the magnetic particles are released and fall away from the outer surface 24 of the cylindrical housing 20 . while the separation device 10 has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that changes in form and detail may be made therein without departing from the spirit and scope of the invention .
| 1 |
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration specific embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the present invention . some portions of the detailed descriptions which follow are presented in terms of algorithms and symbolic representations of operations on data bits within a computer memory . these algorithmic descriptions and representations are the means used by those skilled in the data processing arts to most effectively convey the substance of their work to others skilled in the art . an algorithm is here , and generally , conceived to be a self - consistent sequence of steps leading to a desired result . the steps are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the following discussions , it is appreciated that throughout the present invention , discussions utilizing terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . [ 0022 ] fig1 illustrates a medical device system 10 with the inventive parameter interaction detection and display feature . medical device system 10 includes a medical device 12 and a programmer 14 . programmer 14 includes an input device 16 and a display 18 and is connected to medical device 12 via communications link 20 . communications link 20 may embody any form of communications protocol , including wired , wireless , optical and other forms of communication protocols . input device 16 , display 18 and the underlying hardware and software make up the programming interface . features of medical device 12 are displayed on display 18 and may be modified through the use of input device 16 . parameter interactions between these features are also displayed on display 18 in the manner described below . [ 0024 ] fig2 illustrates a medical device system 30 with the inventive parameter interaction detection and display feature . medical device system 30 includes a medical device 32 with a built - in programming interface 34 . programming interface 34 includes an input device 36 and a display 38 . features of medical device 32 are displayed on display 38 and may be modified through the use of input device 36 . parameter interactions between these features are also displayed on display 38 in the manner described below . in one embodiment , medical device system 10 is an implantable shock therapy system . such a medical device system 10 is shown in fig3 . in fig3 medical device system 10 includes a defibrillator 40 , a power supply 42 and a programmer 44 . power supply 42 is connected to defibrillator 40 and supplies power to defibrillator 40 . defibrillator 40 is connected to programmer 44 via communications link 20 . in one such embodiment , defibrillator 40 includes a telemetry system 46 for communicating with programmer 44 . in addition , defibrillator 40 supplies the requisite therapy to the heart via leads 48 . programmer 44 includes an input device 52 such as a keyboard or mouse , a display 54 and telemetry system 55 . features selected or programmed by physicians into programmer 44 are communicated through telemetry to defibrillator 40 , where they control shock and pacing therapy applied to the patient &# 39 ; s heart . in one embodiment , systems 10 and 20 include interactive programming feedback . interactive programming feedback is a feature that is designed to assist the user in programming the medical device appropriately . in one such embodiment , a set of rules govern the universe of possibilities that the various parameters may be programmed to . the rules ensure that incompatibilities among features are caught and prevented and that programming conflicts cannot exist . in one such embodiment , if a user programs a parameter in such a way that an incompatibility exists , programmer 14 or 44 , or programming interface 34 , provides a visual indication on the respective display to inform the user of the situation , and provides on - screen guidance as to how to correct the situation . in addition , when the user attempts to correct the programming error , systems 10 and 20 provide immediate feedback as to the success of the correction . a display which could be used to control systems 10 and 20 is shown in fig4 . the display in fig4 is geared toward the defibrillator system shown in fig3 but can be generalized to control of any medical device 12 or 32 . representative three zone configurations are shown in fig4 . in the embodiment shown in fig4 system 10 includes up to three tachyarrhythmia zones ( labeled as vt - 1 , vt , and vf ). in one such embodiment , such as is shown in fig4 each zone is identified on display 24 with its label 70 and its rate threshold 72 . in the embodiment shown in fig4 label 70 and its associated rate threshold 72 are displayed within a zone rate bar 74 . in addition , a detection summary for each zone is displayed within detection button 76 for that zone and a therapy summary for each zone is displayed within therapy button 78 for that zone . in one embodiment , the user accesses the detection parameters for a zone by selecting the respective detection button 76 and accesses the therapy parameters for a zone by selecting the respective therapy button 78 . if a zone &# 39 ; s detection button 76 has been selected , the initial and redetection parameters 88 are displayed for that zone . for example , fig4 illustrates the initial and redetection parameters associated with the vt - 1 zone , while fig5 illustrates the initial and redetection parameters associated with the vt zone . detection enhancement rhythm discrimination categories 90 ( see fig4 and 5 ) are displayed as well for those zones in which enhancements are available . in one embodiment , the user selects rate threshold value 72 in order to change the rate threshold for that zone . in the embodiment shown in fig4 and 5 , the number of zones tachyarrhythmia zones can be modified by selecting one of the number buttons beneath the “# zones ” label . in one embodiment , if parameter settings have changed but have not yet been programmed into the pulse generator , hatch marks (////) will appear in the summary area . when the values are programmed , the hatch marks disappear . in one embodiment , a subset of zone configuration information is displayed when the system summary and quick check screens are visible , which allows a shortcut to the detection and / or therapy parameters screens . ( only presently programmed values are displayed ; it does not display changed data that has not yet been programmed into the device nor hatch marks .) in one embodiment , the user selects a shortcut icon to navigate to the tachy parameters screen , which displays detailed information . if a shortcut icon appears dim , it indicates that a change to the number of zones has not been programmed ; thus a shortcut is not available to the parameter screens . a brady therapy summary 80 is also visible in fig4 and 5 . this area displays the normal and post - shock bradycardia modes and rates . additional bradycardia parameter settings may be viewed and changed by selecting the brady summary button when a shortcut icon is visible , or the brady parameters tool . depending on which toolbox screen is visible , this summary button may show just the rate / zone bar or may include additional information as is shown in fig4 and 5 . toolbox 82 displays various features depending on the chosen toolbox button . the features allow interaction with the pulse generator as well as a review of data in pulse generator memory . only one tool may be selected at a time . ( in one embodiment , the system summary tool is selected when the application is initially accessed . however , if an episode is in progress at initial interrogation , the ep test screen will be displayed .) in the embodiment shown in fig4 and 5 , windows contain information relevant to a particular function . they may include names of pulse generator parameters and functions , value boxes to accommodate value changes , buttons to open additional windows , and buttons to cancel changes or close the window . to remove the window from the display , select the button that initiates activity or select the close or cancel button . message windows are used to provide feedback during communication sessions . some require action as indicated in the window before continuing the session , while others simply relay information without requiring further action or show status of an activity . many message windows have a cancel or close button ; select the desired button to cancel the action being performed as explained in the message and / or close the window . in the embodiment shown in fig4 and 5 , ecg display 84 is always visible . ecg display 84 shows real - time surface ecg traces , as well as real - time electrograms ( egms ) and event markers , which are useful in ascertaining system performance . in one such embodiment , a 20 - second snapshot of the ecg trace , electrograms , and markers can be printed automatically ; when the cursor is positioned over the ecg display the cursor changes to a camera icon ; click the left trackball key to “ capture ” the trace . the printed trace shows 10 seconds before and 10 seconds after the moment of command . in one embodiment , annotated event markers identify certain intrinsic cardiac and device - related events , and provide information such as sensed / paced events , decision of detection criteria , and therapy delivery . the markers are displayed on ecg display 84 . in one embodiment , real - time electrograms can be transmitted from the pace / sense or shocking electrodes to evaluate lead system integrity such as lead fractures , insulation breaks , or dislodgments . the number of zones , the zones &# 39 ; rate thresholds , and values for detection , redetection , and detection enhancement parameters can be programmed from the zone configuration display in fig4 and 5 in the following manner . first , select tachy parameters button 86 from toolbox 82 to display the zone configuration area and the selected zone &# 39 ; s parameters . next , change the number of zones by selecting the desired number ( 1 , 2 , or 3 ) from the # zones column . the zone configuration will display the selected number of zones with hatch marks overlaying the new zones , which have not been programmed into the device yet . third , change the rate threshold using either select box 72 from zone / rate bar 74 or via the zone &# 39 ; s detection button 76 . next , change any of the desired initial or redetection parameters . in one embodiment , hatch marks overlay the zone &# 39 ; s detection button 76 until the changed parameters have been programmed into the pulse generator . note : as parameter values are changed , the information icon and / or stop sign icon may appear at the top of the main application screen to inform of potential parameter interactions . modify parameters as required to get around these objections . detection and display of parameter interaction will be further discussed below . magnifying - glass icon 94 can be used ro display feature parameters . in addition , a number of details are shown in fig4 and 5 . for instance , detection enhancement details for vt - 1 zone are shown in fig4 while detection enhancement details for vt zone are shown in fig5 . detection enhancement parameters can be more easily programmed by identifying the type of rhythm discrimination desired and associating the clinical rhythms with particular detection enhancements . in one embodiment , the types of clinical rhythms include : atrial tachyarrhythmia , sinus tachycardia , and polymorphic vt . see “ system and method for detection enhancement programming ,” filed herewith , for more information on detection enhancement programming through the use of clinical rhythms . when a rhythm discrimination is selected , preselected values are displayed for the parameters that are suitable for discriminating that rhythm . from a zone &# 39 ; s detection screen ( window 92 in fig6 and 7 ), detection parameters can be turned on by selecting the detection enhancements on or off value box , or by selecting the individual rhythm types . window 92 is closed when the parameters values are as desired . as noted above , systems 10 and 20 provide almost immediate feedback of parameters interactions and how to correct them . in one embodiment , once the user has attempted to program an incompatible setting , systems 10 and 20 display a written message that describes the problem to the user . the written description of the programming conflict describes why the programming change is not allowed , and what specific parameters need to be changed in order to correct the problem . if more than one option is available to correct the incompatibility , all choices are displayed . in one embodiment , systems 10 and 20 list each of the parameters in question that may need to be adjusted , and a status icon for each . in one such embodiment , the visual display of the interactive feedback includes the use of icons to signify the status of the programming change . if a red stop sign is displayed , the programming change violates a rule of programming , and thus needs to be corrected before the system will allow programming of the medical device . if a yellow warning sign is displayed , the programming change is allowable , but caution should be used as to the limitations that may occur when the device is programmed as such . on seeing a red stop sign or a yellow warning sign , the user has the opportunity to change one or more programming parameter values . if the user does so and a green check mark or exclamation point is displayed , the programming change has corrected the issue , and thus no further programming is necessary . one visual display which can be used to provide such feedback is shown in fig8 . the example in fig8 is based on the defibrillator example of fig3 but could be extended to other medical devices . in display 100 of fig8 feedback is provided to the user in the form of a warning 102 , an icon 104 and one or more parameters 106 . in addition , display 100 may include parameters 108 . warning 102 gives the reason why the suggested programming settings are not allowed . icon 104 designated the status of the suggested programming change ( in this scenario , icon 104 is a yellow warning icon as described above ). parameters 106 are the parameters in question while parameters 108 are the additional parameters which may need to be adjusted . finally , there is a present value 110 and a change box 112 for each parameter 106 and 108 . in one embodiment , changes to parameters 106 and 108 are displayed immediately , with a visual confirmation of the success or failure of the change in programming . an example of a successful change in programming is shown in fig9 . in fig9 a change to the post - shock brady max tracking rate ( from 140 ppm in fig8 to 120 ppm in fig9 ) results in an acceptable post - shock brady minimum dynamic vrp parameter 116 . as a result , a positive icon 114 is displayed next to parameter 116 . ( in this scenario , icon 114 is a green check icon as described above . other symbols of correctness could also be used .) note that the possible problem with normal brady minimum dynamic vrp parameter 106 remains uncorrected at this time . another example of parameter interaction is shown in fig1 . in fig1 , feedback is provided to the user in the form of a warning 102 , an icon 104 and one or more parameters 106 . in addition , display 100 may include parameters 108 . as in fig8 warning 102 gives the reason why the suggested programming settings are not allowed . icon 104 designated the status of the suggested programming change ( in this scenario , the first icon 104 is a red stop sign icon while the second icon 104 is a yellow warning icon ). parameters 106 are the parameters in question while parameters 108 are the additional parameters which may need to be adjusted . finally , there is a present value 110 and a change box 112 for each parameter 106 and 108 . in one embodiment , when a new parameter is entered in the change column of display 100 , it is immediately checked for interactions with other parameters . this may be done , for example , by a review of the set of rules discussed above . if the new value violates interactive limits within the application , a parameter interaction stop sign is displayed as discussed above . in one such embodiment , this icon can be selected to access a parameter interaction screen such as is displayed in fig8 - 10 . once the parameter interaction screen is accessed , the user can make changes directly from within the window . similarly , if the new value creates a situation where the value is not forbidden but more information should be presented to the clinician , the warning sign icon is displayed . in one such embodiment , this icon can be selected to access a parameter interaction screen such as is displayed in fig8 - 10 . changes to the affected parameter or parameters need not be made in order to proceed . physician discretion is , however , advised depending on the type of patient or on other circumstances relating to the device . one should be careful when writing the rules which detect and display parameter interactions . each warning should include a description of the present clinical situation , the present equation at issue and suggestions for resolving the issue . the rules and the warnings must be coordinated to present meaningful warnings for all combinations of parameter interactions . in contrast to previous devices , this method of handling parameter interaction provides a more intuitive approach coupled with the capability to provide the user immediate feedback on the choices they have made . this saves time for the user . in addition , by allowing the user to make all necessary changes from one screen , rather than having to navigate through multiple screens , ease of use is improved . although specific embodiments have been illustrated and described herein , it will be appreciated by those of ordinary skill in the art that any arrangement which is calculated to achieve the same purpose may be substituted for the specific embodiment shown . this application is intended to cover any adaptations or variations of the present invention . therefore , it is intended that this invention be limited only by the claims and the equivalents thereof .
| 0 |
referring to fig2 , a power amplifier of the present invention includes : a comparator 1 , a bridge circuit 2 , and a low - pass filter 3 . referring to fig2 , the comparator 1 receives a first analog signal , compares the first analog signal with a reference signal , and then exports a square wave signal . the first analog signal refers in particular to an audio signal in all the embodiments hereinafter . referring to fig2 and fig3 , the bridge circuit includes : an inverter 23 , a first mems switch 24 and a second mems switch 25 . the inverter 23 is connected to the output end of the comparator 1 . referring to fig2 and fig3 , the first mems switch 24 connected to the output end of the comparator 1 receives a first voltage signal , which is a high voltage hv in this embodiment . the first mems switch 24 is also connected to the input end of the low - pass filter 3 . specifically , the first mems switch 24 comprises a first electrode 241 and a second electrode 242 . the first electrode 241 comprises a first basal plate 2411 , a first insulating layer 2412 , a first conductor 2413 and a second conductor 2414 . the first basal plate 2411 receives a first control signal ( not shown in the figures ), which controls the polarity of the first basal plate 2411 . the first insulating layer 2412 is upon the first basal plate 2411 , and the first conductor 2413 and the second conductor 2414 are arranged upon the first insulating layer 2412 with some interval . the first conductor 2413 is connected to the high voltage hv , and the second conductor 2414 is connected to the input end of the low - pass filter 3 . the second electrode 242 is connected to the input end of the comparator 1 . to be specific , the second electrode 242 comprises a first connecting conductor 2421 , a second insulating layer 2422 , a second polar plate 2423 , the second polar plate 2423 is connected to the input end of the comparator 1 , and the first connecting conductor 2421 and the second polar plate 2423 are arranged upon the opposite surface of the second insulating layer 2422 . referring to fig3 , the input end of the inverter 23 is connected to the output end of the comparator 1 . the second mems switch 25 connected to the output end of the inverter 23 receives a second voltage signal , which is a ground signal , in this embodiment . the second mems switch 25 is also connected to the input end of the low - pass filter 3 . specifically , the second mems switch 25 comprises a third electrode 251 and a fourth electrode 252 . the third electrode 251 comprises a third conductor 2511 and a fourth conductor 2512 . the third conductor 2511 is connected to the second voltage signal , and the fourth conductor 2512 is connected to the input end of the low - pass filter 3 . the third electrode 251 further comprises a second basal plate 2513 and a third insulating layer 2514 . the third insulating layer 2514 is upon the second basal plate 2513 , and the third conductor 2511 and the fourth conductor 2512 are arranged upon the third insulating layer 2514 with some interval . the second basal plate 2513 receives a second control signal ( not shown in the figures ), which controls the polarity of the second basal plate 2513 . the fourth electrode 252 is connected to the output end of the inverter 23 . to be specific , the fourth electrode 252 comprises a second connecting conductor 2521 , a third polar plate 2322 and a fourth insulating layer 2523 . the third polar plate 2522 is connected to the output end of the inverter 23 . the second connecting conductor 2521 and the third polar plate 2522 are arranged upon the opposite surface of the fourth insulating layer 2523 . what is more , the first mems switch 24 and the second mems switch 25 both comprise a spring arm 26 . the spring arm 26 of the first mems switch 24 is set on the first electrode 241 and connected to the second electrode 242 , so the first electrode 241 and the second electrode 242 can shift away from or close to each other . the spring arm 26 of the second mems switch 25 is set on the third electrode 251 and connected to the fourth electrode 252 , so the third electrode 251 and the fourth electrode 252 can shift away from or close to each other . referring to fig3 , the working process of the power amplifier in this embodiment is as follows . ordinarily , the first analog signal ( an audio signal ) is a sine wave , and the reference signal 5 is a triangular wave , which is generated by a triangular wave generator . the comparator 1 compares the audio signal with the reference signal 5 , and then outputs a square wave signal . the square wave signal is composed of alternate a third voltage and a fourth voltage , and the third voltage is higher than the fourth voltage . that the polarity of the square wave signal is positive means the square wave signal is the third voltage , and that the polarity of the square wave signal is negative means the square wave signal is the fourth voltage . in this embodiment , the polarity of the first control signal put on the first basal plate 2411 of the first mems switch 24 and the polarity of the second control signal put on the second basal plate 2513 of the second mems switch 25 are the same , for example , the polarity is negative ( the first control signal and the second control signal both are the fourth voltage ). the comparator 1 compares the audio signal with the reference signal 5 , and then outputs a square wave signal . when the polarity of the square wave signal is positive , the polarity of the second polar plate 2423 is positive too . because the polarity of the second polar plate 2423 and the first basal plate 2411 are opposite to each other , static pull - in working on the second polar plate 2423 draws it near to the first conductor 2413 and the second conductor 2414 of the first electrode 241 , in this way , the first conductor 2413 , the second conductor 2414 , and the first connecting conductor 2421 will bring into contact with each other and be activated , whereby the high voltage hv can be transmitted into the low - pass filter 3 . moreover , the polarity of the square wave signal is changed to negative after running through the inverter 23 , as well as the polarity of the third polar plate 2522 . because the polarity of the third polar plate 2522 and the second basal plate 2513 are the same , the third polar plate 2522 will not move to the second basal plate 2513 , so the second connecting conductor 2521 , the third conductor 2511 and the fourth conductor 2512 will not be activated . when the polarity of the square wave signal is negative , the polarity of the second polar plate 2423 is negative too , that is to say , the polarity of the second polar plate 2423 and the first basal plate 2411 are the same , thereby they will repel each other , and the second basal plate 2513 will depart from the second polar plate 2423 . moreover , the polarity of the square wave signal is changed to positive after running through the inverter 23 , as well as the polarity of the third polar plate 2522 . because the polarity of the third polar plate 2522 and the second basal plate 2513 are opposite to each other , the third polar plate 2522 will move to the third conductor 2511 and the fourth conductor 2512 , in this way , the third conductor 2511 and the fourth conductor 2512 will be connected through the second connecting conductor 2521 , and the ground signal will be transmitted to the input end of the low - pass filter 3 . thereby , the input end of the low - pass filter 3 will receive alternate hv and ground signal because of the output of the comparator 1 . that is to say , the amplitude value of the square wave signal which is output by the comparator 1 is amplified to hv after running through the first mems switch 24 and the second mems switch 25 . the square wave signal will be changed to an amplified audio signal ( the second analog signal ), and then transmitted to the input end of the loudhailer 4 . in addition , when the first control signal put on the first basal plate 2411 of the first mems switch 24 and the second control signal put on the second basal plate 2513 of the second mems switch 25 is positive ( for example , they are the third voltage ), the system can get the same effect . simply the difference is as follows . when the square wave signal output by the comparator 1 is positive , the second mems switch 25 turns on , while the first mems switch 24 turns off . when the square wave signal output by the comparator 1 is negative , the first mems switch 24 turns on , while the second mems switch 25 turns off . some variations to this embodiment of the present invention are as follows . the first control signal is put on the first basal plate 2411 , the output end of the comparator 1 is connected to the second polar plate 2423 , the second control signal is put on the third polar plate 2522 , and the output end of the inverter 23 is connected to the second basal plate 2513 . or , the first control signal is put on the second polar plate 2423 , the output end of the comparator 1 is connected to the first basal plate 2411 , the second control signal is put on the second basal plate 2513 , and the output end of the inverter , 23 is connected to the third polar plate 2522 . or , the first control signal is put on the second polar plate 2423 , the output end of the comparator 1 is connected to the first basal plate 2411 , the second control signal is put on the third polar plate 2522 , and the output end of the inverter 23 is connected to the second basal plate 2513 . in this embodiment , when the polarity of the first control signal and the second control signal both are negative , while the output signal of the comparator is positive , the first mems switch 24 will be switched on and the second mems switch 25 will be switched off . however , if the output signal of the comparator is negative , the first mems switch 24 will be switched off and the second mems switch 25 will be switched on . therefore , the first mems switch 24 and the second mems switch 25 will just be switched on when the polarity of the square wave signal is opposite . in conclusion , the present invention substitutes the transistors with surface mems switches whose on - off are under the control of a comparator , the power consumption is reduced . what is more , mems switches , comparators and low - pass filters all can adopt cmos technology , that is to say , mems switches , comparators and low - pass filters can be overlapped , which can reduce the size of all components and the manufacture costs . referring to fig4 , it is structural sketch of the power amplifier according to the second embodiment of the present invention . in this embodiment , the power amplifier comprises : a comparator 1 , a bridge circuit 2 , and a low - pass filter 3 . the difference between this embodiment and the first embodiment is as follows : the structure of a first mems switch 34 and a second mems switch 35 in this embodiment is different from the structure of the first mems switch 24 and the second mems switch 25 in the first embodiment . the first mems switch 34 comprises a first electrode 341 and a second electrode 342 which are arranged opposite to each other . the first electrode 341 comprises a first polar plate 3411 which receives a first control signal , a first conductor 3412 which connects to a high voltage hv , and a second conductor 3413 which connects to the input end of the low - pass filter 3 . in this embodiment , the first electrode 341 further comprises a first basal plate 3414 and a first insulating layer 3415 . the first basal plate 3414 is a semiconductor substrate such as silicon substrate , and the first insulating layer 3415 is a silicon dioxide layer . the first insulating layer 3415 is formed on the first basal plate 3414 . the first polar plate 3411 , the first conductor 3412 and the second conductor 3413 are formed on the first insulating layer 3415 . in this embodiment , the second electrode 342 comprises a first connecting conductor 3421 , a second polar plate 3422 and a second insulating layer 3423 . the second polar plate 3422 connects to the output end of the comparator 1 . the second polar plate 3422 and the first connecting conductor 3421 are formed on the opposite surface of the second insulating layer 3423 . referring to fig4 , the second mems switch 35 in the second embodiment comprises a third electrode 351 and a fourth electrode 352 which are arranged opposite to each other . the third electrode 351 comprises a fourth polar plate 3511 which receives a second control signal , a third conductor 3512 which connects to the ground , and a fourth conductor 3513 which connects to the input end of the low - pass filter 3 . in this embodiment , the third electrode 351 further comprises a second basal plate 3514 and a third insulating layer 3515 . the second basal plate 3514 is a semiconductor substrate such as silicon substrate , and the third insulating layer 3515 is a silicon dioxide layer . the third insulating layer 3515 is formed on the second basal plate 3514 . the fourth polar plate 3511 , the third conductor 3512 and the fourth conductor 3513 are formed on the third insulating layer 3515 . in this embodiment , the fourth electrode 352 comprises a second connecting conductor 3521 , a third polar plate 3522 and a fourth insulating layer 3523 . the third polar plate 3522 connects to the output end of the inverter 3 . the third polar plate 3522 and the second connecting conductor 3521 are formed on the opposite surface of the fourth insulating layer 3523 . in this embodiment , the first mems switch 34 and the second mems switch 35 both comprises a spring arm 36 , and it makes that the fourth electrode 352 shifts away from or close to the third electrode 351 , or the second electrode 342 shifts away from or close to the first electrode 341 , possible . referring to fig4 , the working process of this embodiment and the first embodiment are similar to each other . it is illustrated briefly thereafter . when the first mems switch 34 and the second mems switch 35 works , the polarity of the first control signal put on the first polar plate 3411 and the polarity of the second control signal put on the fourth polar plate 3511 are the same . when the polarity of the output signal of the comparator 1 is opposite to the first polar plate 3411 , the polarity of the first polar plate 3411 is also opposite to the second polar plate 3422 . the static pull - in between the first polar plate 3411 and the second polar plate 3422 draws the first connecting conductor 3421 near to the first conductor 3412 and the second conductor 3413 , in this way , the high voltage hv connected to the first connecting conductor 3421 can be transmitted into the input end of the low - pass filter 3 . moreover , because of the inverter 23 , the polarity of the fourth polar plate 3511 and the third polar plate 3522 are the same , the fourth electrode 352 will not move to the third electrode 351 , so the second connecting conductor 3521 , the third conductor 3512 and the fourth conductor 3513 will not be activated , and the ground signal will not be transmitted to the input end of the low - pass filter 3 . similarly , when the polarity of the output signal of the comparator 1 and the first polar plate 3411 are the same , the second electrode 342 of the first mems switch 34 will not move to the first electrode 341 , then the high voltage hv will not be transmitted to the input end of the low - pass filter 3 . the second electrode 352 of the second mems switch 35 will move to the first electrode 351 because of static pull - in , whereby the third conductor 3512 and the fourth conductor 3513 will be connected through the second connecting conductor 3521 , and the ground signal gnd will be transmitted to the input end of the low - pass filter 3 . again and again , the input end of the low - pass filter 3 receives a square wave signal whose amplitude value is hv because of the output signal of the comparator 1 . in other words , the square wave signal output by the comparator 1 is amplified to a square wave signal whose amplitude value is hv after transmitting through the first mems switch 34 and the second mems switch 35 . next the amplified square wave signal is amplified and converted into an audio signal by the low - pass filter 3 , and then transmitted to the loudhailer 4 . likewise , some variations to this embodiment of the present invention are as follows . the first control signal is put on the first polar plate 3411 , the output end of the comparator 1 is connected to the second polar plate 3422 , the second control signal is put on the third polar plate 3522 , and the output end of the inverter 23 is connected to the fourth polar plate 3511 . or , the first control signal is put on the second polar plate 3422 , the output end of the comparator 1 is connected to the first polar plate 3411 , the second control signal is put on fourth polar plate 3511 , and the output end of the inverter 23 is connected to the third polar plate 3522 . or , the first control signal is put on the second polar plate 3422 , the output end of the comparator 1 is connected to the first polar plate 3411 , the second control signal is put on the third polar plate 3522 , and the output end of the inverter 23 is connected to the fourth polar plate 3511 . these variations have the same effect . it is understandable that the first mems switch 34 and the second mems switch 35 used in a power amplifier can reduce the power consumption and the percentage area of the devices . referring to fig5 , the present invention is not necessarily comprising an inverter . the difference between the power amplifier in this solution and the power amplifier shown in fig2 is that the bridge circuit has different structure . in this solution , the bridge circuit 2 comprises a first mems switch 24 and a second mems switch 25 . the first mems switch 24 is under the control of a first control signal , connected to the output end of a comparator 1 , a low - pass filter 3 , and a high voltage hv . the second mems switch 25 is under the control of a second control signal , connected to the output end of a comparator 1 , a low - pass filter 3 , and a ground signal gnu . the first mems switch 24 and the second mems switch 25 switch on alternately when the polarity of the first control signal or the second control signal is opposite to the polarity of the output signal of the comparator 1 , and output the high voltage hv or the ground signal gnd accordingly to the low - pass filter 3 . then the low - pass filter 3 converts the hv or gnd signal into an audio signal and transmits the audio signal to a loudhailer 4 . referring to fig6 , how the invention adopts mems switches realizing power amplifying without an inverter is illustrated hereafter . the first mems switch 24 and the second mems switch 25 still adopt the structure shown in fig3 , but the opposite of the first control signal and the second control signal are opposite to each other . the first control signal is put on the first basal plate 2411 of the first mems switch 24 . the second control signal is put on the second basal plate 2513 of the second mems switch 25 . the working principle is the same as the power amplifier with an inverter . likewise , some variations to this embodiment of the present invention are as follows . the first control signal is put on the first basal plate 2411 , the output end of the comparator 1 is connected to the second polar plate 2423 , the second control signal is put on the third polar plate 2522 , and the output end of the comparator 1 is connected to the second basal plate 2513 . or , the first control signal is put on the second polar plate 2423 , the output end of the comparator 1 is connected to the first basal plate 2411 , the second control signal is put on the second basal plate 2513 , and the output end of the comparator 1 is connected to the third polar plate 2522 . or , the first control signal is put on the second polar plate 2423 , the output end of the comparator 1 is connected to the first basal plate 2411 , the second control signal is put on the third polar plate 2522 , and the output end of the comparator 1 is connected to the second basal plate 2513 . the working process is similar to the first embodiment . referring to fig7 , how the invention adopts mems switches realizing power amplifying without an inverter is illustrated hereafter . the first mems switch 34 and the second mems switch 35 still adopt the structure shown in fig4 , but the polarity of the first control signal and the second control signal are opposite to each other . the first control signal is put on the first polar plate 3411 of the first mems switch 34 . the second control signal is put on the fourth polar plate 3511 of the second mems switch 35 . the working principle is the same as the power amplifier with an inverter . likewise , some variations to this embodiment of the present invention are as follows . the first control signal is put on the first polar plate 3411 , the output end of the comparator 1 is connected to the second polar plate 3422 , the second control signal is put on the third polar plate 3522 , and the output end of the comparator 1 is connected to the fourth polar plate 3511 . or , the first control signal is put on the second polar plate 3422 , the output end of the comparator 1 is connected to the first polar plate 3411 , the second control signal is put on the fourth polar plate 3511 , and the output end of the comparator 1 is connected to the third polar plate 3522 . or , the first control signal is put on the second polar plate 3422 , the output end of the comparator 1 is connected to the first polar plate 3411 , the second control signal is put on the third polar plate 3522 , and the output end of the comparator 1 is connected to the fourth polar plate 3511 . the working process is similar to the first embodiment . in addition , the mems switch can be formed with other types of structures , such as three - electrode mems switches . in this three - electrode scheme , the middle electrode is a movable part , and the polarity of the up electrode is opposite to the down electrode . if different voltages are put on the middle electrode , the up and down electrode will generate an attractive force and a repelling force , and perform switching on - off function by this means . in a word , this kind of switch also can achieve the purpose that using mems switches realize power amplifying . the detailed working principle is the same as adopting the first mems switch 24 and the second mems switch 25 . in the end , although the above descriptions take an audio signal as example , the present invention is also fit for other analog signals . although the present invention has been disclosed as above with reference to preferred embodiments thereof but will not be limited thereto . those skilled in the art can modify and vary the embodiments without departing from the spirit and scope of the present invention . accordingly , the scope of the present invention shall be defined in the appended claims .
| 7 |
in fig1 - 4 , an f type coupler head is shown generally at 10 . the knuckle side of the coupler is shown at 12 , and the guard arm side at 14 . as best seen in fig1 coupler front face 16 has a generally flat , vertical planar section . coupler face 16 includes throat portion 18 extending toward knuckle side 12 in a curved manner toward pivot lugs 20 having pin holes 22 . it is within pivot lugs 20 that a knuckle 24 is received and retained in a pivotal manner with a pin ( not shown ) that extends through pin holes 22 and a corresponding hole 26 in knuckle 24 . located behind pivot lugs 20 are buffing shoulders 28 which form a pocket for receiving knuckle 24 . projecting from buffing shoulders 28 are pulling lugs 30 behind which are engaged by ccrresponding pulling surfaces 32 of knuckle 24 . fig4 shows the prior art design profile of a bottom pulling lug 30 . it is to be understood that the design profile in top and bottom pulling lugs 30 are similar . pulling lug 30 includes a knuckle interface comprising a substantially vertical pulling surface 34 which extends into a radial fillet 36 having a constant radius . coupler head 10 also includes a second fillet 38 also of constant radius which forms the left - half portion of a raised boss 40 for a thrower hole 42 . thrower hole 42 receives a pivot portion of a thrower ( not shown ) which rotates around to throw open knuckle 24 during uncoupling . located between and separating radial fillet 36 from raised boss 40 is a substantially flat surface 44 . it is at the junction between radial fillet 36 and flat surface 44 where fatigue cracks have been found to form . fig5 shows a bottom pulling lug 46 embodying the improved design of the present invention . the radial fillet of constant radius has been replaced with a parabolic fillet 48 having a variable radius that increases with the distance away from an unchanged substantially vertical surface 50 . in addition , substantially flat surface 44 which was located between radial fillet 36 and raised boss 40 in the prior art design profile of fig4 has been eliminated . in the improved design , parabolic fillet 48 extends into a second fillet 52 of constant radius at a raised boss 54 for thrower hole 56 , said boss 54 and thrower hole 56 being unchanged over the prior art design profile . the prior art design profile is shown in dashed lines in fig5 to illustrate the modifications in said improved design profile . the substitution of parabolic fillet 48 and the resulting elimination of substantially flat surface 44 from the prior art design profile greatly reduces the stress concentration between substantially vertical surface 50 and raised boss 54 by distributing the load over a larger , smoother curved surface area , namely along the entire parabolic curve 48 , instead of the mere radial fillet 36 of the prior art design profile . this reduction in stress concentration reduces the likelihood of fatigue cracks forming behind the pulling lugs . a parabolic fillet is preferred due to the small space envelope which is available along the x and y axes as shown in fig5 . the distance along the y axis remains unchanged over the prior art pulling lug design because the fillet may not extend any higher into substantially vertical surface 50 which interfaces with a corresponding pulling surface on a knuckle . such an extension of the fillet would result in the loss of interchangeability with knuckles of standard design . the distance along the x axis is greater in the improved design , however , as the parabolic fillet 48 eliminates substantially flat surface 44 of the prior art design profile of fig4 . to construct an approximate parabolic fillet 48 profile , the distances along the x and y axes may be divided into the same number of segments and identically numbered from top to bottom and from left to right as shown in fig6 . points having the same number are then connected by straight lines resulting in an envelope of gradually increasing radius which approximates a parabolic curve . the parabolic fillet can also be constructed using the parabolic equation y 2 = 2fx with the origin of the parabola located at point 58 where the substantially vertical surface 50 meets the fillet 48 as shown in fig5 . the constant f in the parabolic equation is selected in accordance with the x and y space limits for the given pulling lug . while a parabolic fillet is preferred , other compound curves of variable radii such as ellipses or catanaries would also reduce the stress concentration . furthermore , while an f type coupler head is shown in the drawings , identical modifications could be made to the pulling lugs of an e type coupler to achieve the same result . the foregoing description and drawings explain and illustrate the best known mode of the invention and those skilled in the art who have the disclosure before them will be able to make modifications and variations therein without departing from the scope of the invention which is defined in the following claims .
| 1 |
fig1 a - 1c show a process for fabricating an embodiment of a channel region 100 of a transistor 10 . in fig1 a , channel region 100 is implanted with a dopant selected to provide a relatively low threshold voltage for transistor 10 . in fig1 b , a photoresist mask 102 is formed over channel region 100 to establish a first portion 120 and leave a second portion 122 exposed . the second portion 122 of channel region 100 is implanted with a dopant selected to provide a relatively high threshold voltage . in fig1 c , a finished channel region 100 is shown with first portion 120 and second portion 122 . the remainder of transistor 10 to include a gate region 104 , a source region 106 , and a drain region 108 can be formed in a conventional manner . fig2 a - 2c show an alternative process for fabricating an embodiment of channel region 100 of transistor 10 . in fig2 a , channel region 100 is implanted with a first dopant selected to provide a relatively low threshold voltage for transistor 10 . in fig2 b , a gate region 104 is formed over channel region 100 . a photoresist mask 102 is formed over channel region 100 and gate region 104 to establish a first portion 120 and leave a second portion 122 exposed . the second portion 122 of channel region 100 is implanted with a second dopant selected to provide a relatively high threshold voltage . the implanting of the second dopant may be performed at an angle relative to transistor 10 to assist in establishing second portion 122 and first portion 120 . in fig2 c , a finished channel region 100 is shown with first portion 120 and second portion 122 . the remainder of transistor 10 to include gate region 104 , source region 106 , and drain region 106 can be formed in a conventional manner . in one embodiment , second portion 122 is shown in closer proximity to source region 106 of transistor 10 than first portion 120 . though shown in this manner , transistor 10 can also be fabricated with second portion 122 being in closer proximity to drain region 108 than first portion 120 . fig3 shows a schematic circuit diagram of transistor 10 . by establishing first portion 120 and second portion 122 within channel region 100 , transistor 10 logically becomes a dual transistor device with a lower threshold voltage transistor 112 serially connected with a higher threshold voltage transistor 114 . the total length of channel region 100 is similar to channel lengths of conventional transistors . higher threshold voltage transistor 114 has a channel length of α × l , where l is the total channel length of channel region 100 and a is a fraction less than one . lower threshold voltage transistor 112 has a channel length of l −( α × l ). by optimizing a to be a small fraction ( such as approximately 0 . 1 to 0 . 15 ), the on current can mainly be determined by lower threshold voltage transistor 112 having a longer channel length and the off current can mainly be determined by higher threshold voltage transistor 114 having the shorter channel length . higher threshold voltage transistor 114 reduces leakage current exponentially as the threshold voltage is increased . however , this has a minimal affect on the on current of transistor 10 because the on current is a quadrature or linear function of threshold voltage as well as from higher threshold transistor 114 having a smaller channel length . the increase resistance provided by higher threshold transistor 114 enables the threshold voltage of lower threshold transistor 112 to become even lower and still maintain a lower off current than a traditional transistor design with a uniform channel region . thereby , the on current can be further increased . in addition , the off leakage current from lower threshold voltage transistor 112 is essentially blocked by higher threshold voltage transistor 114 . in essence , higher threshold voltage transistor 114 acts somewhat as an insulator in the off state to absorb the leakage current flowing through lower threshold voltage transistor 112 . if maintaining low leakage current is of primary interest , then a can be larger ( e . g ., greater than 0 . 5 ). fig4 shows an alternate embodiment of channel region 100 of transistor 10 . though shown in fig3 as having higher threshold voltage transistor 114 in series with lower threshold voltage transistor 112 , channel region 100 may be implanted in a manner to provide any number of transistors within physical transistor 10 . for example , channel region 100 may have a first portion 220 , a second portion 222 , and a third portion 224 . second portion 222 may establish a lower threshold voltage transistor 212 . first portion 220 and third portion 224 may establish higher threshold transistors 214 and 216 . first portion 220 and third portion 224 may be of equal or different lengths . similarly , second portion 222 may establish a higher threshold voltage transistor 212 . first portion 220 and third portion 224 may establish lower threshold transistors 214 and 216 . in essence , this is an extension of the configuration discussed above with reference to fig1 a - 1c and 2 a - 2 c , where second portion 122 can be formed to separate first portion 120 into two sub - portions with each sub - portion having a similar doping profile or further processed to have different doping profiles . further , second portion 122 may be positioned such that each sub - portion may have similar or different lengths . fig5 shows an alternative embodiment of channel region 100 of transistor 10 . in this embodiment , second portion 122 has a lesser depth than first portion 120 . second portion 122 may be implanted to provide a relatively higher threshold voltage . second portion 122 may also be formed to include a relatively same number of dopants as it would have if it were fabricated with the same depth as first portion 120 . the amount of dopant in second portion 122 is merely confined to a smaller area , resulting in higher dopant concentration . this provides an advantage when the drain voltage of second portion 122 becomes higher . without this embodiment , the higher drain voltage will cause more dibl ( drain induced barrier lowering ) and clm ( channel length modulation ) effects . by selecting dopants to establish different threshold voltages in transistor 10 , the on current for transistor 10 can be increased without causing a corresponding increase in the off leakage current of transistor 10 . in one example embodiment having a 100 nm length for second portion 122 and an 800 nm length for first portion 120 providing a 900 nm length for channel region 100 , second portion 122 can provide a 150 mv higher threshold voltage and first portion 120 can provide a 150 mv lower threshold voltage than a single dopant implanted channel region . the off leakage current may be reduced by a factor of five with a corresponding 35 % increase in on current . moreover , this technique can be applicable for any type of transistor , including junction field effect and metal oxide semiconductor field effect transistor designs . thus , it is apparent that there has been provided , in accordance with the present invention , a transistor with dual threshold voltages and method of fabrication thereof that satisfies the advantages set forth above . although the present invention has been described in detail , various changes , substitutions , and alterations may be readily ascertainable by those skilled in the art and may be made herein without departing from the spirit and scope of the present invention as set out in the appended claims . moreover , the present invention is not intended to be limited in any way by any statement made herein that is not otherwise reflected in the following claims .
| 7 |
the present invention provides an alternative approach to improving transfection reagents . the compositions and methods of the present invention were shown to be unusually effective . in preferred embodiments , the present invention provides the combination of two or more cationic lipoids to provide improved transfection reagents . in some embodiments , the first cationic lipoid is a standard cationic lipoid used in transfection reagents and the second cationic lipoid is of the nature where , when combined with the first cationic lipoid in transfection reagents , alters the hydrophobicity of the hydrophobic mass either in the extent of hydrophobicity of the lipoids or in the organization of the lipoids compared to the reagents in the absence of the second cationic lipoid , and wherein such change in hydrophobicity increases the ability of the transfection reagents to transfect cells . in some embodiments , the second cationic lipoid is a lipoid that has higher water solubility than the first lipoid and / or that increases the exposure of the hydrophobic core of the lipoid structure to an aqueous environment ( e . g ., disrupt the bilayer of a liposome ) as compared to the same structure in the absence of the second cationic lipoid . the degree of increase in water solubility and / or increased exposure of the hydrophobic core that finds use in the present invention can readily be measured by detecting transfection efficiency with and without the second cationic lipoid or by comparing the transfection reagents having the second cationic lipoid to other transfection reagents ( see e . g ., example 1 for such a method ). optimization to increase water solubility and / or increased exposure of the hydrophobic core can be achieved by a variety a methods . for example , in some embodiments , the second cationic lipoid has a smaller hydrophobic mass ( e . g ., shorter hydrophobic tail ). in some embodiments , the second cationic lipoid is functionalized to add hydrophilicity ( e . g ., canceling some of the hydrophobic mass ). in some embodiments , the functionalization comprises addition of one or more polar groups . in some embodiments , a polar fluorophore is added ( e . g ., nbd ), providing the added feature of fluorescent detectability . for example , particularly efficient transfection reagents were produced by the combination of dilauroyl ( 12 carbon chain ) and dioleoyl ( 18 carbon chain ) homologues of o - ethylphosphatidylcholine . this mixture transfected dna into human umbilical artery endothelial cells ( huaecs ) more than 30 - fold more efficiently than either compound separately . a unique advantage of this kind of combination agent is that transfection can be optimized either in the presence or absence of serum by adjusting the component ratio . in some embodiments , the second lipoid has chains that are not significantly different in length from those of the first lipoid , but the second lipoid has chains that have a larger cross - sectional area . in some embodiments , the second lipoid has chains that are differently shaped from those of the first lipoid , so as to occupy space in the bilayer in a different way than those of the first lipoid . cationic lipids have been widely used for the delivery of plasmid and antisense dna into eukaryotic cells ; however , inefficiency of transfection is a major problem confronting their use in gene therapy . vascular endothelial cells act as an interface between circulating blood and various tissues and organs of the body , and are known to be involved in inflammatory processes such as leukocyte recruitment , cytokine production ( see , e . g ., koning g a , et al ., endothelium 2002 , 9 : 161 - 171 ; neuhaus t et al ., clinical science 2000 ; 98 : 461 - 470 ; stier s et al ., febs letters 2000 ; 467 : 299 - 304 ; each herein incorporated by reference in their entireties ), and to play a major role in the pathogenesis of atherosclerosis ( see , e . g ., behrendt d , and ganz p ., am j cardiol 2002 ; 90 : 40l - 48l ; ulrich - merzenich g , et al ., european journal of nutrition 2002 ; 41 : 27 - 34 ; each herein incorporated by reference in their entireties ), as well as angiogenesis ( see , e . g ., ellis l m . am surg 2003 ; 69 : 3 - 10 ; nam n h , parang k . curr drug targets 2003 ; 4 : 159 - 179 ; ranieri g , and gasparini g ., curr drug targets immune endocr metabol disord 2001 ; 1 : 241 - 253 ; sylven c . drugs today ( barc ) 2002 ; 38 : 819 - 827 ; each herein incorporated by reference in their entireties ), on which the growth and spread of tumors are dependent . hence , they are of considerable interest as a gene therapy target ( see , e . g ., baker ah ., j card surg 2002 ; 17 : 543 - 548 ; morishita r ., circ j 2002 ; 66 : 1077 - 1086 ; each herein incorporated by reference in their entireties ). even though they are readily accessible , gene therapy with nonviral vectors of endothelial tissue has been seriously hampered by the fact that endothelial cells are very difficult to transfect . according to struck et al ., biochemistry 1981 , 20 : 4093 - 4099 , the transfection efficiency of vascular endothelial cells with cationic lipids was only 2 %. it is known that the cytotoxicity of cationic lipids increases with the shortening of acyl groups and so cationic lipids used in transfection invariably have alkyl chains that are 14 or more carbon long . the present invention provides solutions to such problems . for example , in one embodiment , a short chain cationic phosphocholine ( 1 , 2 - dilauroyl - sn - glycero - 3 - ethylphosphocholine , edlpc ), when combined with longer chain compounds ( 1 , 2 - dioleoyl - sn - glycero - 3 - ethylphosphocholine , edopc , or 1 , 2 - dimyristol - sn - glycero - 3 - ethylphosphocholine , edmpc ) dramatically enhances ( up to 30 - fold ) the transfection efficiency of human umbilical artery endothelial cells ( huaecs ) even though , individually , edlpc , edopc or edmpc are quite weak transfection reagents . moreover , transfection efficiency can be adjusted to be optimal either in the presence or absence of serum by changing the edlpc / edopc ratio and the ratio of total lipids to dna . under optimal conditions , transfection efficiency can be achieved up to 15 % both in the presence and absence of serum . thus , these formulations constitute a novel form of cellular transfection reagent and offer entirely new formulations for optimizing in vivo gene delivery . at present , only phosphatidylethanolamine and cholesterol are used as the helper lipids to improve the transfection properties of cationic lipids . unlike these prior methods ( although they may be used in conjunction with the present invention ), the present invention employs compounds with different hydrophobicity - hydrophilicity balance to improve the gene delivery properties of lipoplexes . the properties of lipoplexes can be tuned by changing the ratio of the different lipoids ( e . g ., the ratio of medium chain to long chain cationic lipoids and the ratio of lipoid to dna ). in some preferred embodiments , one or more agents may be added to the cationic lipoid mixtures so as to further increase transfection efficiency . examples of agents include , but are not limited to , cholesterol , polyamidoamine dendrons , histidylated lipids , octylglucoside , phycoerythrin , and non - cationic lipids . in some preferred embodiments , the cationic lipoid mixtures may be transfected with additional transfection reagent systems so as to further increase transfection efficiency . examples of transfection reagent systems include , but are not limited to , lipofectamine ( invitrogen ), optifect ( invitrogen ), 293fectin ( invitrogen ), oligofectamine ( invitrogen ), cellfectin ( invitrogen ), lipofectin ( invitrogen ), dmrie - c ( invitrogen ), exgen 500 ( euromedex ), octylglucoside , fugene ( roche ), effectgene ( qiagen ), and superfect ( qiagen ). in some embodiments , the first or second lipoids are not cationic but are configured to have a structural impact on the bilayer into which they are incorporated ( e . g ., to impact the water solubility than a cationic lipoid used alone , to increase the exposure of the hydrophobic core of the lipoid structure to an acqueous environment , or to disrupt the packing of the bilayer of a liposome or other structure as compared to the same structure in the absence of a second cationic lipoid ). the transfection system described herein is useful to express any polypeptide of interest or to transfect any nucleic acid of interest ( e . g ., sirnas , antisense oligonucleotides , expression vectors , etc .). the transgene will generally encode a native or recombinant protein , although the expression of other polypeptides , such as epitopes or other immunologically active polypeptides , are contemplated within the scope of this invention . examples of proteins that can be expressed using the method of the present invention are hormones ; cytokines , such as growth factors ; enzymes ; receptors ; oncogenes ; polypeptide vaccines , viral proteins , and structural and secretory proteins . the transgene employed in the constructs of the invention can be cloned sequences that retain intronic regions . if the exonic structure of the gene is known , the coding exons can be inserted in the constructs . expression of the polypeptide of interest can be directed by a promoter homologous to the polypeptide coding sequences ( for example , human glucose - 6 - phosphate dehydrogenase under the control of its own transcription promoter sequences ). further , other homologous or heterologous expression control elements ( e . g ., affecting transcription , translation , or post - translational events ) may be used . it should be understood that expression of the transgene in the mammalian cells of the invention can be stable or transient . even transient expression , at a higher than normal level , is useful for functional studies in the cells or for the production and recovery of proteins of interest . in addition to selectable markers and transgenes , the constructs described herein may contain suitable regulatory elements . regulatory elements ( or control elements ) are selected for use in the host cell of interest ; for example , selectable markers may be included to allow propagation in microorganisms , ( e . g ., f1 origin of replication and ampicillin resistance encoding sequences ). such regulatory elements include , but are not limited to , transcription promoters , transcription enhancer elements , transcription termination signals , polyadenylation sequences ( located 3 ′ to the translation stop codon ), sequences for optimization of initiation of translation ( located 5 ′ to the coding sequence ), translation termination sequences , secretion signal sequences , and sequences that direct post - translational modification ( e . g ., glycosylation sites ). transcription promoters can include inducible promoters ( where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte , cofactor , regulatory protein , etc . ), repressible promoters ( where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte , cofactor , regulatory protein , etc . ), and constitutive promoters . the cells ( e . g ., host cells ) employed in this invention include all eukaryotic cells including mammalian cells ( in vivo or in vitro ), cell lines , and cell cultures . the cells can be derived from mammals , such as mice , rats , or other rodents , or from primates , such as humans or monkeys . mammalian germ cells or somatic cells can be employed for this purpose . it will be understood that primary cell cultures or immortalized cells can be employed in carrying out the techniques of the present invention . the cells may also reside in vivo . examples of cells used in the present invention include , but are not limited to , huaaec cells , human dermal fibroblast cells , cancer cells ( e . g ., myeloma cells ). the transformed cells obtained by some embodiments of the present invention can be employed for the preparation of continuous cell lines in which the cells are essentially immortal , or for the preparation of established cell lines that have the potential to be subcultured in vitro . continuous cell lines and established cell lines can be obtained from a variety of organisms and organs , such as rodent embryos ; primate kidneys ; rodent and human tumors ; and fibroblast , epithelial , or lymphoid cells . cells exhibiting the highest levels of expression can be cloned , if desired . the following examples are provided to demonstrate and further illustrate certain preferred embodiments of the present invention and are not to be construed as limiting the scope thereof . experiments conducted during the development of the present invention found that attention to the hydrophobic portions of medium and long - chain cationic lipids synergistically enhance transfection . it was found that a combination of two cationic lipid derivatives with the same head group but tails of different chain lengths behave considerably differently as transfection agents than the separate molecules . for example , the combination of the dilauroyl ( 12 carbon chain ) and the dioleoyl ( 18 carbon chain ) homologues of o - ethylphosphatidylcholine transfected dna into primary human umbilical artery endothelial cells ( huaecs ) more than 30 - fold more efficiently than either compound separately . the present invention is not limited to a particular mechanism . indeed , an understanding of the mechanism is not necessary to practice the present invention . nonetheless , these results suggest that the hydrophobic portions of medium and long - chain cationic lipids is far more important than previously assumed . an advantage of this kind of combination agent is that transfection is optimized either in the presence or absence of serum by adjusting the component ratio . considering that there are more opportunities to modify and combine the hydrophobic moieties on cationic lipoids than there are for variation of the head groups , a study of the transfection efficiency of lipids with different kinds of tails and different kinds of combinations of those tails leads to new and improved nonviral vectors was conducted . a unique advantage of the cationic phospholipoids for hydrophobic structure modification is that they allow use of specific enzymes in their synthesis , a feature not exhibited by the other cationic lipoids described in the literature because those compounds are not based on a natural product . fig1 shows that combining edlpc with edopc enhances by ˜ 30 - fold of the extent of transfection of huaecs , compared to edlpc or edopc alone . the ratio of edlpc to edopc affected performance , with different ratios optimal , depending upon whether serum is present or absent . the edlpc / edmpc mixture exhibits the similar pattern to that of edlpc / edopc , but the extent of transfection is lower than that of edlpc / edopc . on the basis of the results presented above , edlpc / edopc ( 80 / 20 ) and edlpc / edopc ( 60 / 40 ) were chosen to further optimize transfection ; the ratio of lipids to dna and the amount of dna were used as optimization parameters . fig2 depicts the change of transfection with the ratio of edlpc to edopc and the ratio of total lipids to dna . for some formulations , transfection without serum was better than that in serum ; but for others , transfection in serum was better than that in the absence of serum . the highest transfection in the absence of serum was obtained when edlpc / edopc = 80 / 20 and lipid / dna = 4 / 1 , with 0 . 5 μg dna / well ; under these conditions the extent of expression was 8 × higher than that in the presence of serum . in contrast , the most efficient transfection in the presence of serum was when edlpc / edopc = 60 / 40 and lipid / dna = 6 / 1 , with 1 . 0 μg dna / well , under which condition the expression was 20 × that in the absence of serum . according to x - gal staining , 15 % of the cells treated under both of these conditions were positive . this efficiency of transfection is more than an order of magnitude higher than has been previously reported for transfection of these primary cells . these two formulations were thus used in the subsequent studies . such assays can be used to readily determine optimal ratios and optimal components of the transfection reagents of the present invention . the cell viability and the percentage of cells transfected for the two formulations were determined using the mtt method and x - gal staining , respectively ( table 1 ). those data revealed that the low transfection efficiency in the absence of serum for edlpc / edopc = 60 / 40 and lipid / dna = 6 / 1 was due to high cytotoxicity . while the present invention is not limited to any particular mechanism of action and an understanding of the mechanism of action is not necessary to practice the present invention , it is contemplated that the medium chain lipid facilitates mixing of the lipoplex lipid with cellular lipid , which could lead to the neutralizing of the positive charge of the cationic lipid and facilitate release of dna from the complex . under such circumstances , edlpc could facilitate fusion ( or at least lipid mixing ) of cationic liposomes with anionic liposomes . the fusion of edlpc / edopc ( 80 / 20 ), edlpc / edopc ( 60 / 40 ) and pure edopc lipoplexes were compared to phosphatidylglycerol - containing ( anionic ) liposomes . membrane fusion was measured using a fret assay ( see , e . g ., struck d k , et al ., biochemistry 1981 ; 20 : 4093 - 4099 ; herein incorporated by reference in its entirety ) that measures reduction of energy transfer between nbd - pe and rh - pe in cationic lipids of the lipoplexes as they fuse with egg - pc liposomes containing 20 % dopg . from fig3 , it is seen that the extent of fusion of edlpc / edopc ( 80 / 20 ) and edlpc / edopc ( 60 / 40 ) lipoplexes is significantly higher than that of pure edopc . the present invention is not limited to a particular mechanism . indeed , an understanding of the mechanism is not necessary to practice the present invention . nonetheless , these results indicate that increased transfection efficiency is associated with membrane fusion characteristics . in order to determine if this pattern of fusion is also observed within cells ( e . g ., the mixture is more prone to fuse with endosomal membranes facilitating escape of dna from endosomal degradation and nuclei entrance ) the intracellular distribution of fluorescent lipid and oligonucleotide in edopc and edlpc / edopc ( 60 / 40 ) lipoplexes was investigated . it was found that both lipid and oligonucleotide in edopc lipoplexes remained in the cytoplasm for at least 20 hours , whereas a large amount of the oligonucleotide from edlpc / edopc ( 60 / 40 ) lipoplexes entered the nuclei , in particular at the early time point of 2 h , although lipid in edlpc / edopc ( 60 / 40 ) lipoplexes remained in the cytoplasm at this and all other time points . fig4 shows oligonucleotide distribution of edopc and edlpc / edopc / dna ( 60 / 40 / 16 . 7 ) lipoplexes in huaecss . lipoplexes were labeled with a fluorescein derivative of a double - stranded dodecameric oligonucleotide . cells were incubated with the resulting lipoplexes in the presence of serum for 2 h and imaged under a fluorescence microscope after being washed in hbss . as shown in fig4 , the results of these experiments indicated that in the presense of the lipoid mixture there was an increase in the nuclear distribution of highly fluorescent oligonucleotides . similar images were obtained with fluorescent plasmid dna , although the fluorescence of the nucleus was less intense . escape of lipoplexes from endosomes prior to their entry into lysosomes is important for transgene efficient expression . it is contemplated that fusion of lipoplexes with endosomal membranes facilitates dna release from endosomes into cytoplasm , and thus increase dna expression . while the present invention is not limited to any particular mechanism of action and an understanding of the mechanism of action is not necessary to practice the present invention , it is contemplated that this may be one reason that transfection by the mixtures of lipid is much higher than that of pure edopc . the present invention is not limited to a particular mechanism . indeed , an understanding of the mechanism is not necessary to practice the present invention . nonetheless , it is contemplated that dissociation of dna from the surface of a lipoid is caused by neutralization of the lipoid by cellular anionic lipids . such neutralization implies fusion or transfer of lipids as a necessary prerequisite of efficient transfection , and implies that the dna must become sufficiently free of the lipid - lipoid array to be transcribed in the nucleus . unlike normal cellular lipids , the combination of cationic lipoids and anionic lipids gives rise to a variety of non - lamellar phases which may or may not be capable of retaining a molecule as large as a typical plasmid . generally , generation of lipid phases through combination of cationic and anionic lipids is dependent upon lipids ( see , e . g ., tarahovsky , y . s ., et al ., 2004 , biophysical journal 87 : 1054 - 1064 ; herein incorporated by reference in its entirety ). for example , mixtures such as edopc - edlpc , when reconstituted with anionic lipids such as phosphatidylglycerol , give rise to a highly curved inverted micellar cubic phase . this phase is characterized by a cubic array of balls ( shells ) in which amphipathic molecules are organized with their polar portion facing a small aqueous core and their hydrophobic tails facing those of other shells . these phases have aqueous spaces too small to entrap either a plasmid or other dna molecule . separate experiments have revealed that treatment of edopc - edlpc lipoplexes with the anionic lipid , phosphatidylserine , releases more dna by far that does treatment of edopc lipoplexes with phoshatidylserine . the present invention is not limited to a particular mechanism . indeed , an understanding of the mechanism is not necessary to practice the present invention . nonetheless , it is contemplated that there are at least two important effects involved when certain kinds of lipoid mixtures are used to prepare lipoplexes . first , the mixed lipoid lipoplex may acquire anionic lipid from the cell ( e . g ., perhaps by membrane fusion or molecular exchange ) faster and / or to a larger extent than do lipoplexes composed of lipoids of a single type . second , the phase or 3 - dimensional array assumed after the cellular anionic lipid and the lipoplex lipoid may have such a structure as to release faster and / or to a greater extent its cargo of dna than do conventional lipoplexes . serum strongly influences properties of lipoplexes , so experiments were conducted to examine the effect of serum on the composition of these two formulations . in fig5 , one sees that during 90 min incubation in serum , for edlpc / edopc = 60 / 40 , 20 % of the edopc and 10 % of the edlpc were extracted from the lipoplexes ; in the case of edlpc / edopc = 80 / 20 , 30 % of the edopc and 50 % of the edlpc are extracted . furthermore , at early times ( 30 min ), which are contemplated to be more important for endocytosis , the extraction of edlpc and edopc from edlpc / edopc = 80 / 20 was much larger than that from edlpc / edopc = 60 / 40 . gene expression in delipidated serum was tested ( fig6 ). transgene expression of both two formulations decreased significantly in delipidated serum , in which ˜ 80 % lipids ( including cholesterol , hdl cholesterol , ldl cholesterol and phospholipids ) are absent relative to normal serum . while the present invention is not limited to any particular mechanism of action and an understanding of the mechanism of action is not necessary to practice the present invention , it is contemplated that this indirectly confirms serum extraction of lipids , since delipidated serum , with a higher lipid binding capacity than normal serum , would also extract more lipids from the lipoplex . human dermal fibroblasts are another medically important cell type through participation in wound healing . it was contemplated that human dermal fibroblasts would be useful in gene therapy to accelerate wound healing . it was therefore of interest to determine if the “ mixed lipid ” effect also operates in these primary cells . it was found that the “ mixed lipid ” effect is more pronounced than with huaecs . the response in serum was not as pronounced , but efforts were not made to optimize the conditions for this system . a human multiple myeloma cell line that is extremely difficult to transfect was also investigated and the “ mixing effect ” was observed , although the transfection efficiency was very low ( 1 - 2 %). the mixed lipoid effect is not limited to cationic phospholipoids . as shown in fig7 , the effect is seen when a dimethylammonium with two c14 chains is mixed with edopc and when the c 18 phospholipoid is replaced with a dimethylammonium having two c 18 chains . the tap compounds , dotap and dmtap in various combinations , were investigated with each other and with edopc . in all cases substantial increases at intermediate compositions was observed . the present invention is not limited to a particular mechanism . indeed , an understanding of the mechanism is not necessary to practice the present invention . nonetheless , the mixed lipoid effect appears quite general , as would be anticipated if some aspect of the hydrophobicity of the lipoplex needs to be matched to the cell and the transfection conditions . although other lipoids can be synthesized to have chain length differences , it is unlikely that any other such compounds offer the flexibility of structural variation as the cationic phospholipoids . thus , while the present invention is not limited to the use of cationic lipoids , cationic lipoids are a preferred material . these compounds offer enormous flexibility in constructing molecules with varied amount and configuration of hydrophobic moieties . transfection of human dermal fibroblasts with edopc / epopc and edopc / ediphytanoyl pc transfection reagents fig8 shows that combining edopc with epopc ( one oleoyl chain , which is 18c &# 39 ; s with one double bond , and one palmitoyl chain , which is 16c &# 39 ; s without any double bond ) shows little mixing effect in transfection of human dermal fibroblast cells in the absence of serum . fig9 shows that combining edopc with ediphytanoyl pc ( two phytanoyl chains , 16 carbon chains with 4 methyl branches ) shows marked mixing effect in the transfection of human dermal fibroblast cells in the absence of serum . fig1 shows the results of transfecting huaecs with edopc / epopc , edopc / ediphytanoylpc , edopc / sdopc ( dopc with an 18 carbon chain instead of an ethyl group on the phosphate oxygen ), and edopc / ec18c10pc mixtures . new cationic phospholipids ( derivatives of phosphatidylcholine ) are contemplated including , but not limited to , medium chain cationic pc &# 39 ; s with phosphate oxygen alkyl substituents ranging in length from 2 to 24 c &# 39 ; s ); lyso cationic pc &# 39 ; s with one long chain ( c24 ) and a phosphate oxygen alkyl substituent with 2 to 12 c &# 39 ; s ; cationic pc &# 39 ; s with acyl groups having very much different chain lengths ; tetra - acyl cationic pc &# 39 ; s with short acyl chains ; and lipoids with very long (& gt ; 18 carbons ) acyl chains . in some cases , acyl or alky substituents may be branched so as to effectively increase the number of chains without increasing the number of attachment points to the hydrophilic cationic head group . all publications and patents mentioned are herein incorporated by reference . various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims .
| 2 |
a detailed description of embodiments of the present invention is presented below . while the disclosure will be described in connection with these drawings , there is no intent to limit it to the embodiment or embodiments disclosed herein . on the contrary , the intent is to cover all alternatives , modifications and equivalents included within the spirit and scope of the disclosure as defined by the appended claims . fig2 illustrates an embodiment of one of the wireless devices / stations shown in fig1 . it can be configured to receive and process messages as disclosed below . generally speaking , station 120 can comprise any one of a wide variety of wireless computing devices , such as a desktop computer , portable computer , dedicated server computer , multiprocessor computing device , cellular telephone , pda , handheld or pen based computer , embedded appliance , and so forth . irrespective of its specific arrangement , station 120 can , for instance , comprise memory 212 , processing device 202 , a number of input / output interfaces 204 , wireless network interface device 206 , display 208 , and mass storage 222 , wherein each of these devices is connected across one or more data buses 210 . optionally , station 120 can also comprise a network interface device 220 also connected across one or more data buses 210 . processing device 202 can include any custom made or commercially available processor , a central processing unit ( cpu ) or an auxiliary processor among several processors associated with the computing device 120 , a semiconductor based microprocessor ( in the form of a microchip ), a macroprocessor , one or more application specific integrated circuits ( asics ), a plurality of suitably configured digital logic gates , or generally any device for executing instructions . input / output interfaces 204 provide any number of interfaces for the input and output of data . for example , where station 120 comprises a pc , these components may interface with user input device 204 , which may be a keyboard or a mouse . where station 120 comprises a handheld device ( e . g ., pda , mobile telephone ), these components may interface with function keys or buttons , a touch sensitive screen , a stylist , etc . display 208 can comprise a computer monitor or a plasma screen for a pc or a liquid crystal display ( lcd ) on a hand held device , for example . wireless network interface device 206 and optionally network interface device 220 comprises various components used to transmit and / or receive data over a network environment . by way of example , these may include a device that can communicate with both inputs and outputs , for instance , a modulator / demodulator ( e . g ., a modem ), wireless ( e . g ., rf ) transceiver , a telephonic interface , a bridge , a router , network card , etc . station 120 can use wireless network interface device 206 to communicate with access point 130 . with further reference to fig2 , memory 212 can include any one of a combination of volatile memory elements ( e . g ., random - access memory ( ram ), such as dram , and sram , etc .) and nonvolatile memory elements ( e . g ., flash , read only memory ( rom ), nonvolatile ram , etc .). mass storage 222 can also include nonvolatile memory elements ( e . g ., flash , hard drive , tape , cdrom , etc .) memory 212 comprises software which may include one or more separate programs , each of which includes an ordered listing of executable instructions for implementing logical functions . often , the executable code can be loaded from nonvolatile memory elements including from components of memory 212 and mass storage 222 . specifically , the software can include native operating system 214 , one or more native applications , emulation systems , or emulated applications for any of a variety of operating systems and / or emulated hardware platforms , emulated operating systems , etc . these may further include networking related software 216 which can further comprise a communications protocol stack comprising a physical layer , a link layer , a network layer and a transport layer . network related software 216 can be used by processing device 202 to communicate with access point 130 through wireless network interface 206 and can further include logic that causes the processor to receive instructions from an access point while disassociated with access point 130 . in particular , the software can receive a wakeup instruction from the access point even in a protected wireless network . the software can comprise logic that maps the length of encrypted payloads of protected frames into a message . it should be noted , however , that the logic for performing these processes can also be implemented in hardware or a combination of software and hardware . one of ordinary skill in the art will appreciate that the memory 212 can , and typically will , comprise other components which have been omitted for purposes of brevity . fig3 illustrates an embodiment of one of the access points shown in fig1 . it can be configured to receive and process messages as disclosed below . generally speaking , station 120 can comprise any one of a wide variety of network functions , including network address translation ( nat ), routing , dynamic host configuration protocol ( dhcp ), domain name services ( dns ) and firewall functions . irrespective of its specific arrangement , the stations 120 can , for instance , comprise memory 312 , a processing device 302 , wireless network interface 304 , network interface 306 , and nonvolatile storage 324 , wherein each of these devices is connected across one or more data buses 310 . processing device 302 can include any custom made or commercially available processor , a cpu or an auxiliary processor among several processors associated with access point 130 , a semiconductor based microprocessor ( in the form of a microchip ), a macroprocessor , one or more asics , a plurality of suitably configured digital logic gates , or generally any device for executing instructions . wireless network interface device 304 and network interface device 306 comprise various components used to transmit and / or receive data over a network environment . by way of example , either interface may include a device that can communicate with both inputs and outputs , for instance , a modulator / demodulator ( e . g ., a modem ), wireless ( e . g ., rf ) transceiver , a telephonic interface , a bridge , a router , network card , etc . access point 130 typically uses wireless network interface device 304 to communicate with nearby stations , and network interface device 306 to communicate with network 140 . in some implementation , the two devices can be combined into one physical unit . with further reference to fig3 , memory 312 can include any one of a combination of volatile memory elements ( e . g ., ram , such as dram , and sram , etc .) and nonvolatile memory elements ( e . g ., flash , rom , nonvolatile ram , hard drive , tape , cdrom , etc .). memory 312 comprises software which may include one or more separate programs , each of which includes an ordered listing of executable instructions for implementing logical functions . often , the executable code and persistent configuration parameters can be loaded from nonvolatile memory elements including from components of memory 312 . specifically , the software can include native operating system 314 , one or more native applications , emulation systems , or emulated applications for any of a variety of operating systems and / or emulated hardware platforms , emulated operating systems , etc . these may further include networking related software 322 which can further comprise a communications protocol stack comprising a physical layer , a link layer , a network layer and a transport layer . these may further include networking related software 316 which can further comprise a communications protocol stack comprising a physical layer , a link layer , a network layer and a transport layer . network related software 316 can be used by processing device 302 to communicate with access point 130 through wireless network interface 306 and can further include logic that causes the processor to receive messages broadcast to a special multicast address and retransmit the messages to nearby stations in unencrypted form regardless of whether access point 130 is operating on a protected wlan . it should be noted , however , that the logic for performing these processes can also be implemented in hardware or a combination of software and hardware . one of ordinary skill in the art will appreciate that the memory 312 can , and typically will , comprise other components which have been omitted for purposes of brevity . fig4 shows the format for a data frame . fields 402 , 404 , 406 , 408 , 410 , 412 , 414 and 416 are collectively referred to as the media access control ( mac ) header . frame control field 402 is a two octet fixed field indicative of properties of the frame as defined by the particular standard . it comprises a bit which when set indicates the frame is protected . duration / id field 404 is a two octet fixed field which comprises either duration information or identification information depending on the frame use as defined by the particular standard . address fields 406 , 408 , 410 , and 414 are used to specify various address parameters . typically in a multicast or broadcast application , address field 406 which is the receiver address is set to a multicast or broadcast address . address field 408 which is the sender address is usually set to the bssid . address field 410 which is the source address is set to the address of the sender of the frame . address field 414 is optional and is not used in a typical multicast or broadcast application . sequence control field 412 is a two octet fixed field which comprises a fragment number and a sequence number . the fragment number is used when a frame is fragmented to keep track of the fragments . the sequence number is incremented each time a station transmits a message . quality of service ( qos ) control field 416 is a two octet field used to carry qos parameters . after the mac header , the data frame includes frame body 418 which contains the payload . frame body 418 is encrypted as specified by the standard if the frame is protected . finally , frame check sequence field 420 is a four octet fixed field indicative of the integrity of the frame . the specific integrity check is specified by the standard , but as an example , some standards use a cyclic redundancy code ( crc ). referring to the architecture in fig1 , central computer 150 located somewhere on network 140 needs to wake up station 110 . the central computer prepares a multicast message and transmits it to a multicast address . access point 130 receives the multicast message addressed to multicast address and transmits it to stations within its range . if access point 130 is not a protected access point , then prior art methods to wake up station 110 could be used . however , if access point 130 is protected , if station 110 is in standby mode and disassociated with access point 130 , it cannot decrypt messages from access point 130 without reassociating with access point 130 which is costly in energy consumption as the station would have to roam and scan . due to the cost in resources , it is desirable to reassociate only if access point 130 has traffic for station 110 . this results in a vicious circle , that is , a station should not reassociate unless traffic is waiting for the station , but the station cannot know if there is traffic waiting for the station unless it reassociates . one solution uses a specially designated multicast address . many multicast addresses are designated for many purposes . for example , some are used for broadcast of media . there are also multicast addresses that are designated for specific purposes . these special multicast addresses are typical designated by a standards body and are used for a specific purpose . for example , there is a multicast address that is used for the specific purpose of address resolution . for this solution , there could be a multicast address specifically for waking up disassociated stations or generally for communicating with disassociated stations . this address could be any multicast address agreed upon by convention or at least agreed upon by the central computer and the stations , but preferably would be an address that is designated with a special purpose . while for the purposes of this disclosure , this address will be referred to as the wakeup multicast address , it is understood that the address could apply to the more general purpose of communicating with disassociated stations . in one embodiment , the access point upon receiving a multicast request through a network from a central computer , recognizes the destination address as a wakeup multicast address , that is , address frame 406 contains the wakeup multicast address . rather than encrypting the payload and transmitting a multicast data frame , the access point creates a multicast frame without encrypting the payload . a station in standby mode wakes up and checks the multicast frames . this wake up can take place periodically at predetermined times , such as in the usually broadcast and multicast opportunity that occurs after a delivery traffic indication map ( dtim ) beacon frame . when it sees a multicast frame with the destination address matching the wakeup multicast address , it recognizes the frame as a special multicast frame that is designated for disassociated stations . the station recognizes that the payload is not encrypted and can read the message . if the message is a wakeup message , the station can determine if it must wake up from the payload of the wakeup message . if so , the station reassociates with the access point and can now receive encrypted data designated for it . if the station determines it is not the intended recipient of the wakeup message , it can return to standby mode . one drawback of this embodiment is that the access points must be aware of the wakeup multicast address and conditionally apply encryption not to data frames destined for the wakeup multicast address . this would require the aps to be upgraded . this amounts to requiring an upgrade in the infrastructure . while this may be done through software / firmware updates . it is likely a change in the standards would need to be established to implement this approach . thus , it is desirable to have a solution where only the stations and the central computer need to be aware of the wakeup multicast frame , because such a solution would not require any infrastructure changes to be made . in another embodiment , a central computer transmits a multicast message to the access point . the payload of the message is a dummy message , however , the length of the payload is indicative of the station or group of stations to wake up , or in general the length of the payload is a message or part of a message to be transmitted to one or more disassociated clients . the central computer sends the message to all connected access point ( s ) with the wakeup multicast address as the destination . in the example of fig1 , central computer 150 would broadcast the wakeup message to access points 130 and 132 . the access point ( s ) receives the message but only recognizes the message as destined to a multicast address and not necessarily a multicast address with a special purpose . the access point encrypts the payload and transmits the multicast frame . when the station then receives the frame , it recognizes the wakeup multicast address and determines the length of the payload . depending on the implementation , the payload size may exclude header and encryption information added by the access point to encrypt the payload . in this manner , the central computer does not need to be aware of the added length created by the encryption process . the length can then be mapped to a station or group of stations for which the wakeup message is intended . the payload length can typically be varied between the order of 0 and 1500 bytes , or between 64 and 1500 bytes when the minimum ethernet packet size is taken into account , or between 8 and 1500 bytes when the logical link control / subnetwork access protocol ( llc / snap ) header is taken into account ( which is always present in 802 . 11 frames ), or between 28 and 1500 if the wakeup message is sent as an ip packet ( the ip header is 20 bytes , plus 8 for the llc / snap header ). therefore , to be more agnostic to the higher protocol layers , a range of 64 to 1500 should used . for the sake of the specific examples , a minimum of 64 and a maximum of 1500 are used . the use of these values should in no way be construed to limit the embodiments to this value . there are several approaches to mapping the payload length to a station . the most basic is to take the length and subtract the minimum length to obtain the index . for example , as depicted in fig5 , suppose the payload length is 121 and by convention the agreed minimum length is 64 , then station 57 ( 121 − 64 ) should wake up , where station 57 is the 57 th entry in a station list . another approach is to map the mac address through some function to yield a value between the minimum and maximum length . for example , the length can be associated with 64 + mac address mod 1436 to yield a length between 64 and 1500 . this runs the risk that by coincidence more than one station maps to the same length . under this situation , a station may awaken and reassociate unnecessarily . as the odds of this happening should be small , this mapping may be preferable as it eliminates the need to keep track of and maintain stations list . although the odds of coincidentally two stations on the same network being mapped to the same length should be remote , due to commonalities in the portions of the mac addresses , for example , there is a portion unique to each manufacturer , the probabilities may not be as remote . this can be resolved by first running the mac address through a cryptographic hash . thus , in the example above , the length is associated with 64 + hash ( mac address ) mod 1436 . fig6 a - d illustrate a multiple frame approach that can be used in the unlikely event 1436 values is not sufficient to convey the message to the desired station . the minimum length 64 is reserved as a continuation symbol . while the choice of the minimum length as a continuation symbol is used here , it is understood that equivalently any symbol between the minimum length and the maximum length could be used . fig6 a and 6b illustrate representations of values from 1 to 1435 . the mapping is similar to that given above except the minimum is set to 65 because the length 64 is reserved . fig6 a shows the representation of the value 57 . fig6 b shows the representation of the value 1435 . fig6 c illustrates how the value 1436 can be represented as 1436 is too large to be represented in a single frame . two frames are required . as the value is greater than 1435 , the first frame payload has a length of 64 which represents a continuation in counting from 1435 in the next frame payload . the length of the next frame payload is 65 which boils down to an offset value of 1 , but since the frame is a continuation frame , the value is 1435 plus the offset value . fig6 d illustrates the representation of the value 1600 . again since the value 1600 is greater than 1435 , a second frame is needed . frame 1 would comprise a payload of length 64 and frame 2 a payload of length 1600 − 1435 plus the 64 minimum that is 229 . the process could be extended to a third frame if the value to be represented is greater than 2870 , and so on . however , with the use of multiple frames it can be more efficient to set a smaller maximum value rather than 1500 and use more frames . for strings of more than two frames , a specific length value could be designated to demarcate the beginning of a sequence . fig7 is a flowchart describing the method of encoding a message based on the approach of fig6 a - d . the message in question is encoded as a number . one of ordinary skill in the art would recognize the equivalence between a message and its representation as a number . notationally , the number m is initially the representation of the message , and a maximum payload length and minimum payload length are represented by l max and l min , respectively . furthermore , to avoid cumbersome repetition in notation , the quantity l max − l min − 1 will be referred to as the encoding range . the encoding process begins at step 702 , where m is compared to the encoding range . if m is less than the encoding range , a dummy payload is created with length m + l min + 1 at step 704 , the payload can then be included in a protected frame possibly as part of a frame burst . this would end the encoding process . however , if m is greater than or equal to the encoding range , a dummy payload is created with length l min which can then be included in a protected frame possibly as part of a frame burst at step 706 . at step 708 , m is decremented by the encoding range . the process then repeats at step 702 . fig8 is a flowchart describing the corresponding method of decoding a message encoded in accordance with fig7 . the same notation is adopted for clarity . as each frame is received perhaps within the same burst . initially , m is set to zero at step 802 . at step 804 , the payload length from the next frame is derived shown as l payload . if l payload matches the continuation symbol which is l min in this example at step 806 , then m is incremented by the encoding range at step 810 and the process repeats at step 804 . however , if l payload is not equal to the continuation symbol , the process ends after m is incremented by l payload − l min − 1 at step 808 . the multiple frame approach of fig6 a - d is additive , that is , each additional frame gives the ability to address and add fixed number of values ( e . g . an additional 1435 values ). fig9 a - c show a multiplicative approach where each payload length encompasses 8 values representing three bits of information . a ninth value can be used as an end of message symbol . this shorter format enables the transmission of more data using shorter messages . specifically , in fig9 a , the value 411 which is 635 in octal needs to be expressed . the first frame has length 70 which corresponds to an offset of 6 from the minimum payload length , hence represents the octal digit 6 in the first digit of the octal value . the second frame has length 67 which corresponds to an offset of 3 from the minimum payload length , hence represents the octal digit 3 in the second digit of the octal value . the third frame has length 69 which corresponds to an offset of 5 from the minimum payload length , hence represents the octal digit 5 in the second digit of the octal value . finally a fourth frame has length 72 which corresponds to an offset of 8 from the minimum payload length which represents the end of value symbol . similarly , fig9 b and 9c illustrate the formatting of the values 56 and 98 , respectively . in general , the multiplicative approach splits the message into pieces based on some numeric base , ( e . g ., base 8 in the previous example ). while it is tempting for those skilled in the art to use a power of 2 for the base , any numeric base can be used . each piece is then encoded by adding the minimum payload length as an offset . the message is then terminated by an end of message symbol . alternatively , rather than specifying an end of message symbol the first frame could contain the number of frames representing the message . the general approach is similar to that illustrated in fig9 a - 9c . the message is split into pieces based on some numeric base . however , rather than expressing an end of message symbol in the last frame of the encoded message , the length of the message in frames is encoded in the payload of the first frame . examples that are counterparts to the examples of fig9 a - 9c are illustrated as fig1 a - 10c . the drawback to the multiple frame approaches is that sequence of the frames need to be tracked to insure the right information is tracked , but can be tracked by the sequence control frame 412 . while all the approaches above can transmit data to a disassociated station , the information rate for the amount of traffic generated is very low . the tradeoff between power usage , reassociation time and urgency of the message should be weighed . however , one of the most suitable uses is for breaking the encryption / reassociation dilemma by altering the station in standby mode to wake up , reassociate and receive an important encrypted message . it should be emphasized that the above - described embodiments are merely examples of possible implementations . many variations and modifications may be made to the above - described embodiments without departing from the principles of the present disclosure . all such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims .
| 8 |
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout . according to fig3 , a first driver 311 in a first integrated circuit 301 compares the respective logic levels of data d 0 and data d 1 , and generates a transmit signal vd 1 . when the logic levels of the data d 0 and d 1 are different , the first driver 311 generates the transmit signal vd 1 as a high voltage level . if the logic levels of the data d 0 and d 1 are the same , the first driver 311 generates the transmit signal vd 1 as a low voltage level . for example , when the logic level of the data d 0 is low and the logic level of the data d 1 is high , the first driver 311 generates the transmit signal vd 1 as a high voltage level . when both the logic levels of the data d 0 and d 1 are low , the first driver 311 generates the transmit signal vd 1 as a low voltage level . the transmit signal vd 1 generated by the first driver 311 is transmitted to a transmission line 331 via a pad 321 . the integrated circuit device 301 transmits data d 0 on a dummy transmission line 330 via the pad 320 . a first receiver 351 in a second integrated circuit 341 compares the data d 0 and the transmit signal vd 1 received as input via pads 361 and 362 , respectively , and recovers the data d 1 . the first receiver 351 calculates the absolute value of the difference between the voltage levels of the data d 0 and transmit signal vd 1 , and compares the absolute value of the difference with a threshold voltage . in a preferred embodiment , the voltage threshold is about 0 . 8 volts . when the absolute value is greater than the threshold voltage , the first receiver 351 outputs data of high voltage level . when the absolute value is less than the threshold voltage , the first receiver 351 outputs data of low voltage level . alternatively , the first driver 311 can generate a transmit signal vd 1 of low voltage level when the voltage levels of the data d 0 and d 1 are different , and generate a transmit signal vd 1 of high voltage level when they are the same . in this case , the first receiver 351 outputs the data d 1 as a low voltage level when the absolute value of the difference between the voltage levels of the data d 0 and the signal vd 1 input via the pads 361 and 362 , respectively , is greater than the threshold voltage . when the absolute value is less than the threshold voltage , the receiver 351 outputs the data d 1 as a high voltage level . a second driver 312 compares the voltage levels of the transmit signal vd 1 and data d 2 , and outputs the result as a transmit signal vd 2 . a third driver 313 compares the voltage levels of the transmit signal vd 2 and data d 3 with each other , and outputs the result as a transmit signal vd 3 . the operation of the second and third drivers 312 313 is analogous to the operation of the first driver 311 . the second receiver 352 compares the transmit signal vd 1 to the transmit signal vd 2 , and recovers the data d 2 , and a third receiver 353 compares the transmit signal vd 2 to the transmit signal vd 3 , and generates data d 3 . the operation of the second and third receivers 352 353 is analogous to the operation of the first receiver 351 . it will be understood that more drivers and receivers can be used . in another embodiment , the dummy transmission line 330 may be eliminated . in such an embodiment , for example , the first driver 311 receives the data d 1 and generates the transmit signal vd 1 either as the same voltage level as the data d 1 or as a different voltage level . also , the first receiver 351 receives only the transmit signal vd 1 and produces the data d 1 according to the voltage level of the signal vd 1 . fig4 is a circuit schematic diagram of the driver 311 of fig3 . a first detector circuit 411 receives data d 0 and d 1 , and includes a nand gate for performing a nand operation on the received data . a second detector circuit 421 receives the data d 0 and d 1 , and performs an or operation on the received data . that is , the second detector circuit 421 outputs a logic high when either the data d 0 and d 1 is logic high , and outputs a logic low when both the data d 0 and d 1 are logic low . the second detector circuit 421 includes a nor gate 423 and an inverter 425 . a transmit generator circuit 431 performs an and operation on the outputs of the first and second detector circuits 411 and 421 , and generates a signal vd 1 . that is , the transmit generator 431 generates the signal vd 1 as logic low when any one of the outputs of the first and second detector circuits 411 421 is a low logic level . when both of the outputs of the first and second detector circuits 411 421 are a high logic level , the transmit generator circuit 431 generates the signal vd 1 as a high logic level . as shown in fig3 , the transmit generator circuit 431 can include a nand gate 433 and an inverter 435 . referring to fig5 , the first receiver circuit 351 receives the data d 0 and the transmit signal vd 1 via resistors 521 , 523 , 525 and 527 , and provides the output data d 1 via an inverter 541 . the data d 0 is input to the gate of the nmos transistor 511 via the resistor 521 , and the transmit signal vd 1 is input to the gate of the nmos transistor 512 via the resistor 525 . accordingly , the nmos transistor 511 is turned on when the voltage level of the data d 0 is high , and is turned off when it is low . the nmos transistor 512 is turned on when the voltage level of the signal vd 1 is high , and is turned off when it is low . the output data d 1 is determined by the voltage level of the data d 0 and the voltage level of the transmit signal vd 1 . when the voltage levels of the data d 0 and transmit signal vd 1 are both low , the nmos transistors 511 and 512 are both turned off . the voltage level of a node n 1 becomes high via a supply voltage vcc , and is inverted by an inverter 541 , thereby causing the voltage level of the output data d 1 to become low . when the voltage level of the data d 0 is low , and the voltage level of the transmit signal vd 1 is high , the nmos transistor 511 is turned off , and the nmos transistor 512 is turned on . thus , the node n 1 is electrically coupled to the junction of the resistors 527 and 528 . the voltage level of the node n 1 becomes low , and is inverted by the inverter 541 , and thus the voltage level of the output data d 1 becomes high . when the voltage level of the data d 0 is high , and the voltage level of the signal vd 1 is low , the nmos transistor 511 is turned on , and the nmos transistor 512 is turned off . thus , the node n 1 is electrically coupled to the junction of the resistors 523 and 524 . the voltage level of the node n 1 becomes low , and is inverted by the inverter 541 , thereby causing the voltage level of the output data d 1 to become high . when the voltage levels of the data d 0 and vd 1 are both high , the nmos transistors 511 and 512 are both turned on . in this case , the sources of the nmos transistors 511 and 512 are each maintained at a high voltage level by the high voltage level signal vd 1 and data d 0 so that the voltage of the node n 1 is kept high when both the nmos transistors 511 and 512 are turned on . the voltage of the node n 1 is inverted by the inverter 541 , thereby causing the voltage level of the output data d 1 to become low . in operation of the first receiver 351 , if the absolute value of the difference between the voltage levels of the data d 0 and the signal vd 1 is higher than the voltage threshold , the voltage level of the output data d 1 becomes high . if the absolute value of the difference between the voltage levels of the data d 0 and the signal vd 1 is lower than the voltage threshold , the output data d 1 becomes logic low . when the inverter 541 is not used , if the absolute value of the difference between the voltage levels of the data d 0 and the signal vd 1 is higher than the voltage threshold , the voltage level of the output data d 1 becomes low . if the absolute value of the difference between the voltage levels of the data d 0 and the transmit signal vd 1 is lower than the voltage threshold , the voltage level of the output data d 1 becomes high . the voltage levels of the data d 2 and d 3 output by the second and third receivers 352 , 353 of fig3 can be the same or different depending on the characteristics of the second and third drivers 312 , 313 . the operation of the first receiver circuit 351 can , therefore , be summarized as shown below . accordingly , the likelihood of data loss can be reduced despite the presence of common mode noise . the use of one transmission line per receiver may simplify the structure of an embodiment according to the present invention . for example , as shown in fig3 , the first - third transmission lines 331 – 333 electrically couple the first - third drivers 311 – 313 and to the first – third receivers 351 – 353 respectively , which may simplify an embodiment according to the present invention , thereby allowing a reduction in manufacturing costs . in the drawings and specification , there have been disclosed typical preferred embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims .
| 7 |
treatment of tobacco plants with cell wall - degrading enzymes ( i . e . cellulases and pectinases ) leads to the induction of a subset of pr genes involved in the plant defence response ( palva et al ., 1993 ; vidal et al ., 1998 ). this induction occurs both in the local treated leaf and the distal uninfected leaves . furthermore , it has been shown that during plant - pathogen interactions there is er lumenal gene induction ( walter - larsen et al ., 1993 ; denecke et al ., 1995 ). the present invention is concerned primarily with the exact timing of chaperone induction in plants subjected to pathogen stress , which is simulated by treatment with cell wall - degrading enzymes ( cdes ). er chaperone gene induction occurs rapidly upon cde treatment on a local as well as systemic level which is faster than the pr gene activation . the invention is also concerned with elucidating the role of sa and its signal transduction pathway in this fast - acting induction mechanism , as this molecule is known to play an important role in establishing the pathogen defence mechanism ( ward et al ., 1991 ; delaney et al ., 1994 ; gaffney et al ., 1993 ). the parallel induction of er chaperones in the local and distal untreated leaves suggests the presence of a signal molecule or other such mechanism whereby a signal can be quickly transported throughout the whole plant . the results show that the systemic induction of er chaperones is not triggered by a feedback signal mechanism resulting from accumulation of newly synthesised proteins ( i . e . the upr ) in the local treated leaf . the early induction of bip is likely to depend on a feedforward mechanism in which the plant prepares itself for the folding of newly synthesised pr proteins exogenously applied sa leads to an induced resistance to erwinia carotovora subsp . carotovora in tobacco ( palva et al ., 1994 ). arabidopsis thaliana saii mutants which are abolished in their pr1 gene expression during sa treatment due to a mutation in the sa signal transduction pathway ( shah et al ., 1997 ) showed a normal cde - mediated bip induction . furthermore , transgenic nahg plants which contain the enzyme salicylate hydroxylase that converts sa into a non - active form showed similar cde - mediated bip gene expression as in the wt plants . this clearly demonstrates that sa is not involved in the local and systemic bip induction during cde treatment . other molecules like ethylene and jasmonate might be involved in the rapid induction of er chaperones as it is known that these compounds accumulate upon wounding and during pathogen attack thereby inducing a distinct set of genes which are thought to play a role in plant defence ( hyodo , 1991 ; reviewed by boller , 1991 ; creelman et al ., 1992 ; farmer et al ., 1992 ). it has been shown that the cde - induced defence response involves both the ethylene and signal transduction pathways ( vidal et al ., in preparation ). as ethylene and methyl jasmonate are both volatile , possible diffusion from the site of synthesis might occur , thereby acting in its gaseous form as the long distance signal . however , the role of both compounds in the early induction of bip gene expression has still to be established . therefore characterisation of bip gene induction in ethylene - insensitive mutants of arabidopsis would be a novel way to obtain more insight in the role of ethylene during cde treatment . the cde signal transduction pathway leading to the bip gene induction is independent of the β - 1 , 3 - glucanase signal transduction pathway as overproduction of the bip protein does not lead to induced β - 1 , 3 - glucanase transcript levels . this suggests that early in the cde signal transduction pathway bip differentiates from the β - 1 , 3 - glucanase signal transduction route leading to a rapid bip gene induction before that of pr genes . the plant therefore anticipates the need for more er chaperones necessary for the expected pr gene transcripts encoding secretory defence proteins on the rough er during defence reactions . the signal involved in the cde - mediated initiation of bip gene expression is still unknown although it is most likely to be independent of the upr and sa - mediated signal transduction pathway . besides cde treatment , sa also rapidly induces bip genes well before the pr genes . the sa - dependent induction of bip is distinct from that of the cde - mediated bip induction . the results show that the induction of bip upon pathogen attack is not merely a consequence of the increased synthesis of proteins on the rough er , but an early response of plant cells in order to prepare an adequate machinery for pr protein synthesis . the most crucial part of the invention concerns the contribution of the er chaperone bip in plant pathogen interactions and sar . bip induction occurs rapidly via an sa - mediated signal which also induces sar and pr protein synthesis , but the signal transduction pathway leading to bip is faster and independent of pr gene activation . this process operates in tobacco as well as aracbidopsis thaliana and is likely to be a conserved mechanism among plants . the sail mutant is incapable of sa - mediated pr1 induction but shows a normal sa - mediated rapid bip induction . artificially increased bip levels do not lead to pr1 induction in the absence of sa , which demonstrates that bip is not an earlier element of the sa - mediated signal transduction cascade leading to pr1 . however , artificially increased bip levels do have a synergistic action on the sa signal and accelerate pr1 induction to a give much faster response . working model for the role of bip in sa - mediated pr gene induction a model for the contribution of bip in the early response of plant cells to pathogen attack is illustrated in fig1 . when plants are attacked by a range of pathogens . sa levels increase and mediate sar and pr gene induction ( durner et al , 1997 ). many pr proteins such as chitinases , β - 1 , 3 ,- glucanases , pr1 , extension and pgip are secreted or vacuolar and are synthesised on the rough er . leaf mesophyll or epidermal cells in fully developed leaves do not secrete significant amounts of protein and have low levels of er chaperones ( vitale et al , 1993 ). therefore plants anticipate the need for more er protein folding machinery to accommodate the drastically increased concentration of transcripts encoding secretory defence proteins on the rough er during defence reactions . sa induces bip independently of pr genes via a branched signal transduction pathway , with the branching point being located upstream of saii . downstream of the branching point , elements of the signal transduction pathway leading to pr1 such as saii ( and others ) must be influenced by light and cell wall - degrading enzymes , none of which have an effect on the sa - mediated bip induction . in addition , a regulatory cross - talk between the two branches of the pathway exists to provide an additional regulatory mechanism to delay pr gene induction until bip levels are adequate . pr gene induction is either inhibited by low bip levels or induced by high bip levels in combination with sa . such a regulatory mechanism is beneficial to the plant cell as it ensures an upregulated er function before increased secretory protein synthesis commences in the defence response . this avoids an accumulation of translocation and folding intermediates of pr proteins in the er due to a lack of bip . bip is a key element in the early responses of plants to pathogen attack due to its requirement for the translocation and folding of proteins in the er and to constitute an important regulatory mechanism that delays pr protein synthesis on the rough er until the er lumen is adequately prepared with chaperones and folding enzymes . other er resident proteins such as pdi and calreticulin may be important as well as they too are induced , but since bip overexpression alone accelerates pr gene induction , bip is the key element in the regulation . bip should therefore be regarded as a novel target gene in early responses of plants to pathogen attack . bip overproducing plants have a higher viability and are more vigorous than the untransformed plants . overexpression of bip may have either positive effects on the ability to produce proteins , to grow faster and to resist a range of abiotic stresses such as frost , drought and salt stress . the inhibitory effect of low bip levels on pr gene expression is probably part of a more general regulatory mechanism to regulate protein synthesis on the rough er . synthesis of the secretory protein α - amylase is inhibited by er stress which limits the level of free bip . artificially increased bip levels do not show such an inhibition , demonstrating that high levels of bip are required for efficient α - amylase synthesis under stress . this phenomenon could be related to the retardation of pr gene induction until sufficient bip molecules are available . further results suggest that a novel negative pathway leads to a specific reduction of transcript levels corresponding to genes encoding secretory proteins , which means proteins synthesised by the rough er . overexpression of bip could thus have additional benefits besides increased pathogen resistance , for example in the production of secretory proteins in general ( of which pr proteins are merely a subset ). our experiments have shown that bip over - producers exhibit resistance to the bacteria causing soft rot in potatoes ( erwinia ), in that the bacteria has a reduced division rate in wounded parts of bip over - producers and so infection is reduced as compared to controls . in the field , where infection usually starts with just one bacterium , this difference may be crucial . additionally , we have observed that bip over - producers grow more rapidly , set seeds more rapidly and germinate more rapidly compared to controls , moreover cells prepared from bip over - producing plants have a higher capacity to produce protein than control plant cells . the following examples are provided to fully illustrate the present invention and should not be construed as limiting thereof . details of the materials and methods used are included after the specific examples . we have shown that treatment of tobacco plants with cell wall - degrading enzymes ( cde ) leads to the rapid induction of β - 1 , 3 - glucanase and other pr genes , both locally and systemically ( vidal et al , 1997 ). we have now repeated these experiments and monitored the er chaperone bip as well as β - 1 , 3 - glucanase , which was the most rapidly induced pr protein in this experimental system ( vidal et al , 1997 ). we used a commercial preparation of fungal cdes instead of custom made erwinia - derived hydrolases to increase reproducibility . one leaf from each tobacco plant was treated with cdes and the induction of bip gene expression was analysed in the treated ( local ) and untreated ( systemic ) leaves from the same plant . fig1 shows that bip transcripts accumulate rapidly , reaching a maximum after just 2 hours of incubation . this induction was observed locally as well systemically with the same timing and intensity . β - 1 , 3 - glucanase transcript accumulation is detectable only after 4 hours of incubation and reaches its plateau after 8 hours as described previously ( vidal et al , 1997 ). whereas bip induction is transient , β - 1 , 3 - glucanase mrna levels continue to be high after prolonged incubation times ( 24 - 48 hours ). similar patterns were obtained for pdi and calreticulin ( data not shown ) indicating that other reticuloplasmins are also induced both locally and systemically . our results clearly show that bip gene expression is induced locally as well systemically prior to the pr gene β - 1 , 3 - glucanase . the signal involved in the systemic response of bip gene expression must therefore be transported very rapidly from the local leaf to the distal leaves . as sa was shown to induce er chaperone expression ( denecke et al , 1995 ), we wanted to test if sa plays a role in the bip gene induction during treatment with cell wall - degrading enzymes . we used as sa - insensitive mutant of arabidopsis thaliana ( saii ) which no longer shows an induction of pr1 in the presence of sa ( shah et al , 1997 ). wt and saii mutants of the same ecotype were treated with cell wall - degrading enzymes and incubated for 6 hours . as a control ( con ), leaves were mock - infected with h 2 o . total rna was extracted and northern blot analysis was performed for bip and a hevein - like protein ( hel ) which is known to be induced by cdes of erwinia carotovora ( vidal et al , in preparation ). fig2 shows that wt arabidopsis thaliana plants show a specific cde - induced accumulation of bip transcripts ( compare with the mock infection ) as in tobacco plants . in the arabidopsis saii mutant , the bip gene expression exhibits exactly the same profile as seen in arabidopsis wt plants . transcripts of hel were also induced in wild - type plants . this demonstrates that either the mutation in the saii is downstream of the bip gene induction in an sa signal transduction pathway or that sa and the saii - dependent signal transduction pathway is not involved at all in the cde - mediated bip gene induction . both local and systemic induction of bip and glucanase by cell wall - degrading enzymes is sa independent although saii mutants are insensitive to sa it is known that they are still able to accumulate sa upon pathogen infection ( shah et al ., 1997 ). the previous experiment could not rule out completely the involvement of sa in the cde - mediated bip gene expression . to test this possibility , we used transgenic tobacco plants ( nahg ) that overexpress the enzyme salicylate hydroxylase which inactivates sa . it is clearly established that such plants are unable to accumulate sa ( gaffney et al ., 1993 ). after 6 and 24 hours of cde treatment , local and systemic leaves were harvested from unstransformed tobacco plants ( wt ) and nahg plants for rna extraction . as a positive control , the expression of β - 1 , 3 - glucanase was monitored because cde treatment will lead to its local and systemic induction independently of sa ( vidal et al ., 1997 ). our results clearly demonstrate that the presence of the nahg geneproduct has no influence on the cde - mediated bip induction ( fig3 ). this shows that sa is not involved in the signal transduction mechanism for both the local and the systemic induction of bip in this experimental system . as expected β - 1 , 3 - glucanase was induced locally and systemically in both wt and nahg plants when treated with cde as shown before ( vidal et al ., 1997 ). systemic induction of er chaperones is independent of the upr in local leaves even though bip induction occurs prior to β - 1 , 3 glucanase induction , we cannot rule out that other , as yet unidentified defence related proteins are induced more rapidly and perhaps before bip in our experimental system . if this were the case , it would still be possible that the rapid induction of bip is the result of a feedback mechanism due to er stress resulting from the increased synthesis of proteins on the rough er , the unfolded protein response ( upr ). in addition , a unique feature of the plant er is its continuity through the entire plant through the numerous plasmodesmata . we thus wanted to test if a upr triggered locally could result in a systemic upr in cells that do not suffer from er stress . we treated one leaf of a tobacco plant with the drug tunicamycin , which inhibits n - glycosylation of proteins in the er and causes the accumulation of malfolded proteins and the upr ( kosutsumi et al ., 1988 ; shamu et al ., 1997 ). as a negative control , tobacco leaves were mock - infected with h 2 o to examine possible induction of reticuloplasmin gene expression upon wounding whereas the positive control was the infection with cdes . total rna was extracted from the treated ( local ) leaves and the distal untreated ( systemic ) leaves after 3 and 8 hours of incubation . bip gene expression during mock - infection shows a slight induction after 3 hours of treatment in the local and systemic . this induction is shown to be transient and bip mrna levels return to their basic steady state levels after 8 hours ( fig4 ). β - 1 , 3 - glucanase mrna levels , however , do not increase at all during the mock - infection , confirming a minor influence of the wound response in our experimental system . treatment of tobacco leaves with cell wall - degrading enzymes shows a local and systemic induction of bip and β - 1 , 3 - glucanase genes , with the bip induction being the fastest response as seen in fig1 . when tobacco leaves are treated with tunicamycin a strong increase of bip mrna levels is observed after 3 and 8 hours in the treated leaf , but not the systemic leaf . this shows that the upr alone cannot constitute a systemic signal to induce bip in plants . the sytemic signal must thus be a novel compound that has yet to be identified . in addition , the expression of β - 1 , 3 - glucanase was neither locally nor systemically induced upon tunicamycin treatment , demonstrating that the upr is not involved in the production of defence related proteins either . we postulated that bip gene induction occurs via a feedforward mechanism in which the plant anticipates the need for more er chaperones for the folding of newly synthesised pr proteins . overexpression of bip is not sufficient to trigger the induction β - 1 , 3 - glucanase the more rapid induction of bip compared to β - 1 , 3 - glucanase and the otherwise similar expression profiles could suggest that bip is an element of the signal transduction cascade leading to the defence genes . to test this , we used transgenic plants which overproduce bip under the control of the strong constitutive cauliflower mosaic virus ( camv ) 35s promoter . these plants show a 142 - fold increase in bip transcript levels and a 5 - fold increased bip steady state protein level . if bip were part of the signal transduction cascade leading to the target gene β 1 , 3 - glucanase , bip overexpression alone should trigger β - 1 , 3 - glucanase gene induction . rna was extracted from untreated ( t = 0 ) and cde - treated ( 6 hours ) plants after which bip and β - 1 , 3 - glucanase are detected . fig5 shows that bip overproduction alone does not lead to the induction of β - 1 , 3 - glucanase ( compare lanes 0 with each other ). otherwise , β - 1 , 3 - glucanase was induced after 6 hours of cde treatment in both the wt and bip overproducing plants ( lane 6 wt and 89 ). the figure also illustrates the higher bip mrna levels in bip overproducing plants ( compare lanes 0 with each other ). the data clearly demonstrate that high bip protein levels do not replace the signal which leads to the β - 1 , 3 - glucanase gene induction during cde treatment . thus , bip is not part of the signal transduction pathway leading to β - 1 , 3 - glucanase . the unfolded protein response is additive to the cde response of bip and inhibits the expression of β - 1 , 3glucanase . to compare the cde - and upr - mediated induction of bip , we wanted to test if both stimuli are additive . for this purpose , we prepared protoplasts which are known to exhibit induced levels of β - 1 , 3 - glucanase ( denecke et al ., 1995 ). this is not surprising as protoplasts are prepared with cdes . these protoplasts were then treated with tunicanycin , to superimpose the upr onto the cde response . fig7 shows that both stimuli are additive , exhibited by a further induction of bip by tunicamycin . this suggests that both mechanisms are different . interestingly , β1 , 3 - glucanase expression is inhibited by tunicamycin . the additional er stress could trap bip in malfolded protein complexes , thus making it unavailable to promote pr protein synthesis on the rough er . the results suggested that although bip induction alone is not sufficient to trigger pr protein synthesis , sufficient bip levels are required to promote pr gene expression . it has been shown that sa is involved in the induction of pr genes ( reviewed by malamy and klessig , 1992 ) and that this signal molecule also induces the expression of er chaperones ( denecke et al , 1995 ). we wanted to investigate whether er chaperone induction is a consequence of the high synthesis rates of pr genes and used bip as a model system . tobacco plants were sprayed with sa ( 5 mm ) and the exact timing of the sa - mediated induction of pr - gene pri was compared to that of bip . pr1 was chosen as a representative marker for sa - mediated induction of pr genes as its response to sa is faster and more pronounced than that of acidic chitinase , basic chitinase and basic β - 1 . 3 glucanase ( vidal et al , 1997 ). fig7 a shows that the bip mrna levels are induced after 2 hours of treatment with sa and reach a plateau after 4 hours . in contrast sa - induced transcription of pr1 starts only after 6 - 8 hours and continues to accumulate upto 16 hours after treatment . at this time - point , bip mrna levels start to decrease again . we have shown previously that pr1 continuous to accumulate until 48 hours after sa treatment using the same experimental system ( vidal et al , 1997 ). similar patterns where obtained for pdi and calreticulin ( data not shown ) indicating that other reticuloplasmins are upregulated as well . the data also show that bip expression during sa - treatment is unlikely to be triggered by a feedback mechanism resulting from the presence of newly synthesised and perhaps malfolded or partially folded pr proteins in the er . bip protein levels were also shown to increase ( fig7 b ), with a significant increase noticeable after 4 - 6 hours of induction . to investigate further similarities and differences in the sa - mediated induction of bip and pr genes , we tested if the presence of light is required for the induction . the rationale for this experiment was derived from the observation that sa inhibits catalase , resulting in an increase of active oxygen species in the plant , which would then induce pr genes such as pr1 ( chen et al , 1993 ). despite the fact that the inhibition of catalase activity alone is not the key route by which pr1 is induced during sa - treatment ( chamnongpol et al , 1996 ), a cooperative interaction of sa and h 2 o 2 might lead to the strong induction of pr1 ( leon et al , 1995 , chen et al , 1995 ). since photorespiration is a major source of hydrogen peroxide in plant cells , sa would be a less effective inducer during darkness . tobacco plants were thus sprayed with sa ( 5 mm ) and incubated in the presence and absence of light for 6 and 16 hours . in the absence of light , bip showed hardly any reduction in the accumulation of mrna transcripts during sa - treatment whereas pr1 induction was almost completely abolished ( fig8 ). these data demonstrate that the sa - mediated induction of bip differs from that of pr1 . the data also confirm that bip mrna levels increase transiently and a significant decrease in mrna levels is detectable after 16 hours of treatment ( see also fig7 ). cell wall - degrading enzymes antagonise sa - mediated induction of pr1 but not bip we have shown that the sa - induced expression of pr1 is inhibited in a concentration dependent fashion by the presence of erwinia carotovora culture filtrate containing cell wall - degrading enzymes ( vidal et al , 1997 ). plant cell wall - degrading enzymes antagonise the effect of sa - dependent pr - gene expression via an unknown mechanism , and we wanted to test if cell wall - degrading enzymes had a similar antagonistic effect on sa - mediated bip expression . tobacco plants were therefore treated with a solution of 5 mm sa with or without cell wall - degrading enzymes ( 0 . 2 % macerozyme , 0 . 4 % cellulose ) as antagonists followed by a 6 and 16 hours incubation in the light . total rna was extracted and the expression of chaperones was determined in relation to pr1 . the results confirm that cell wall - degrading enzymes inhibit the sa - mediated pr1 expression ( fig9 ). quantification via phosphoimaging reveals that at 16 hours of incubation only 36 % of the signal is detected in the presence of cell wall - degrading enzymes , which corresponds well with previous findings ( vidal et al , 1997 ). in contrast , bip expression is not antagonised by the cell wall - degrading enzymes and appears even to be induced cooperatively after prolonged incubations ( 16 hours ). obviously , cell wall - degrading enzymes do not have a inhibitory effect on the sa - mediated bip expression . this suggests that bip is controlled by a different sa - dependent regulatory mechanism to pr1 . the unfolded protein response is additive to the sa response of bip in example 6 we have shown that the upr - induced bip gene expression is additive to the cell wall - degrading enzyme ( cde ) response . we now tested whether the sa - and upr - mediated induction of bip expression were additive as well . for this purpose , plants were sprayed with 5 mm sa and incubated for 12 h . to superimpose the upr onto the sa response , the sa - treated leaves were transferred to petridishes which contained ms medium with and without tunicamycin . after floating of the leaves for 2 . 5 h on this medium , rna was extracted and bip gene expression was analysed by northern blotting . fig1 shows that bip gene expression is strongly induced in the sa - treated plants ( compare lane con with lane sa − tu ). in addition , a further induction of bip transcription is established by tunicamycin treatment ( compare lane sa − tu with lane sa + tu ). this induction is due to the presence of tunicamycin in the ms medium and is not an artefact due to prolonged floating ( 2 . 5 h ) of the leaves on the medium as the negative control leaves ( sa − tu ) have floated as well 2 . 5 h on ms - medium without tunicamycin . the fact that , upon sa treatment , tunicamycin is still able to induce bip gene expression shows that both stimuli are additive which suggests that the two induction mechanisms are different . example 11 different signal transduction pathway are used for the induction of pr genes and bip to gain further insight into the signal transduction pathways leading to the induction of bip and pr1 , an sa non - responsive mutant of arabidopsis thaliana ( saii ) was used which does not express pr1 in the presence of sa ( shah et al , 1997 ). wt and saii mutants of the same ecotype were sprayed with sa ( 5 mm ) and incubated in the light . total rna was extracted and probed with the pr1 and bip gene from arabidopsis . the induction of pr1 in wt arabidopsis was detected 3 hours after sa - treatment and continued to increase until 8 hours ( fig1 ). bip showed the same expression profile as seen in tobacco plants when treated with sa . as in tobacco plants , bip mrna levels increase prior to pr1 transcripts in sa treated arabidopsis plants ( fig1 ) and diminish after prolonged incubations ( data not shown ). in the arabidopsis saii mutant , the pr1 induction was completely abolished during sa - treatment as expected ( shah et al , 1997 ). in contrast , bip mrna levels in the mutants showed exactly the same induction pattern as in the wild - type plant . this demonstrates that either a different sa - dependent signal transduction pathway is used to induce the bip gene , or that the regulatory protein which is defective in saii mutants is located downstream of the bip gene in the signal transduction pathway leading from sa to induced pr1 or bip gene induction . to distinguish between the two possible working models , we tested pr1 gene expression in transgenic plants carrying the bip coding region under the control of the strong constitutive cauliflower mosaic virus ( camv ) 35s promoter . if bip is simply located on the signal transduction pathway upstream of the saii mutation . bip overproduction alone should lead to induced pr1 gene expression . transgenic plants which show 5 - fold increased bip steady state protein levels and 142 - fold increased bip transcript levels were used to test basal pr1 mrna levels and sa - mediated pr1 induction . as shown in fig1 , basal bip mrna levels are much higher in the bip overproducing plants the weak induction by sa was unexpected but could be due to the influence of sa on the camv35s promoter itself ( qin et al , 1994 ). fig1 shows that the overproduction of bip alone does not replace the sa signal because it does not lead to induction of the pr1 gene ( compare lanes 0 with each other ). however , the bip overproducing plants show a more rapid pr1 induction upon sa treatment compared to the wild - type plant . together the results show that high bip levels in the er promote the sa - mediated pr1 induction but cannot replace the sa signal . this suggest that a branched signal transduction pathway leads to the induction of bip and pr1 upon sa treatment and that there is cross - talk between the two branches of the pathway . we have established a model system based on the comparison of protein biosynthesis in the cytosol and on the rough er using transient expression . a plasmid was constructed ( pnl200 , fig1 a ) containing two genes , one encoding the secreted barley α - amylase ( rogers , 1985 ) and the other encoding the cytosolic marker β - glucuronidase ( gus ; jefferson et al ., 1987 ). α - amylase was used to measure secretory protein biosynthesis , and gus was used to control for transfection efficiency and overall cell viability . we compared cells under normal culture conditions with cells subjected to er stress by treatment with tunicamycin . fig1 b shows that tunicamycin does not affect cell viability during the course of the experiment , as monitored with the internal marker gus , confirming previous results ( denecke et al ., 1990 ). in contrast , total α - amylase activity in the cell suspension was greatly reduced . since α - amylase is not glycosylated , tunicamycin should not have a direct effect on this protein . the tunicamycin effect is protein - specific and not dependent on the promoter used . therefore , we postulated that during tunicamycin stress , α - amylase synthesis , translocation , or folding is compromised . artificially increased bip levels alleviate er stress as measured by secretory protein production one possible explanation for the tunicamycin effect could be that bip is recruited by other malfolded proteins and is not available in sufficient quantities to promote optimal α - amylase synthesis , translocation , and folding . to test this hypothesis , we coexpressed bip to determine whether increased bip levels would alleviate the er stress and restore efficient α - amylase production . the protoplasts were coelectroporated with pnl200 and plasmids carrying ( 1 ) a gene encoding the bulk flow secretory marker phosphinothricin acetyltransferase ( sspat ; denecke et al ., 1990 ), ( 2 ) a bip overexpression construct ( pde800 ), or ( 3 ) a bip antisense construct ( pnl100 ). the bip isoform used in these experiments was the one that complemented the yeast kar2 mutant ( denecke et al ., 1991 ), whereas sspat is a neutral secretory protein used for control purposes . the protoplasts were incubated for 20 hours with and without tunicamycin and the activities of α - amylase and gus were measured . experiments were conducted in such a manner that similar internal marker activities ( gus ) were obtained in each experiment . the α - amylase activity of the total extract was then corrected with the final gus activities , and fig1 a shows the ratio of α - amylase activity to gus activity . if pat is coexpressed , tunicamycin leads to a reduction of α - amylase activities , as shown in fig1 . bip coexpression alone leads to slightly lower α - amylase activities compared to pat coexpression , but no further reduction of α - amylase activity was seen during tunicamycin treatment . coexpression of the antisense construct was indistinguishable from pat coexpression . fig1 b shows the percentage of α - amylase activity that remains after tunicamycin treatment and illustrates clearly that bip overexpression protects the cells from tunicamycin stress . er stress leads to a reduction of mrna levels corresponding to genes encoding secretory proteins fig1 shows that the transcript level of the vacuolar pr protein β - 1 , 3 - glucanase rapidly decreases during upr - induced bip transcription but begins to rise again when the bip mrna level has reached its maximum . during prolonged incubation times , transcript levels encoding secretory proteins recover to almost normal ( initial ) values again . identical results were obtained with other transcripts encoding the secretory proteins acidic chitinase and basic chitinase present in tobacco protoplasts , showing that the effect is not restricted to β - 1 , 3 - glucanase ( data not shown ). the data suggest that inhibition of secretory protein synthesis , observed during er stress ( fig1 ), occurs prior to translation . artificially increased bip levels alleviate er stress as measured by mrna levels corresponding to genes encoding secretory proteins fig1 a shows that in bip overexpressing tobacco protoplasts ( 89 ), no tunicamycin - mediated reduction of β - 1 , 3 - glucanase mrna levels is observed , consistent with the hypothesis that the effect is due to limiting amounts of bip . overexpression of a bip derivative lacking the er retention signal ( 801 ) only partially restores the β - 1 , 3 - glucanase mrna level under er stress conditions ( fig1 b ). this would be expected as the lack of a retention signal will result in a lower bip level in the er lumen . the result also suggest that it is the level of bip in the er lumen , and not the level of bip transcripts which is important in this respect as judged from our present results , two distinct mechanisms operate during a typical upr . one mechanism is the well established induction of expression of bip and other er chaperone genes during accumulation of unfolded proteins in the er ( shamu , 1997 ). a second mechanism ensures that secretory protein synthesis is held at a minimum at times when the amount of bip is limiting . this mechanism is post - transcriptional , and requires information to be present on the transcripts encoding secretory proteins . as soon as bip transcription is induced and sufficient bip is being synthesised to replenish the pool , the negative regulation is abolished and efficient secretory protein synthesis is permitted to take place once again . the proposed mechanism would limit er stress to a minimum . clearly , when the amount of bip is limiting , further protein synthesis on the rough er would cause additional er stress . this result could also explain the delay in pr gene induction until sufficient bip is available . plants of nicotiana tabacum cultivar petit havana ( maliga et al ., 1973 ) were axenically grown in ms medium ( murashige and skoog , 1962 ), 2 % sucrose in a temperature controlled room at 25 ° c . with a 16 h day / 8 h light regime and a light irradiance of 200 μe . m − 2 . s − 1 . arabidopsis thaliana nössen wt and saii plants ( shah et al ., 1997 ) were grown under the same conditions . plants were sprayed with 5 mm sa and 0 . 5 % tween 20 from all sides , ensuring contact on both sides of each leaf of the plant . typically , 10 ml of the sa solution was sprayed onto each plant . plants were then transferred from the 16 h day / 8 h night regime to constant light regime . protoplasts rnas were extracted as described by jones et al ., ( 1985 ). leaves were ground in frozen liquid nitrogen and transferred to ntes buffer ( 0 . 1 m nacl , 10 mm tris ph 7 . 5 , 1 mm edta , 1 % sds ). protoplasts samples were frozen in liquid nitrogen and thawed in ntes buffer . rna was extracted after adding an equal volume of phenol / chloroform . ethanol precipitation was carried out after incubation at − 20 ° c . for 16 hours . the pellet was resuspended and rna was selectively precipitated with licl ( 2m licl ) for 2 hours on ice . the pellet was washed with 70 % ethanol and resuspended in diethyl pyrocarbonate - treated water . gel blots of total rna denatured in formamide and formaldehyde were prepared . rna was blotted onto hybond - n membrane ( amersham corp ), as described by the manufacturer . a blp4 bip specific probe containing full length cdna , partial length bip2 were labelled using random prime dna synthesis using klenow fragment of dna polymerase i . hybridisation was performed as previously described ( denecke et al ., 1995 ). probes for tobacco bip ( denecke et al ., 1991 ), tobacco pr1a ( cornelissen et al ., 1986 ), arabidopsis bip and arabidopsis pr1a were prepared as described ( denecke et al ., 1995 ; vidal et al ., 1997 ). as a riboprobe , we used the 28s rna from asparagus , kindly provided by j . draper , university of wales , aberystwyth . fully expanded leaves were collected and quickly frozen in liquid nitrogen . frozen samples were then ground with a mortar and pestle . protein concentrations were determined using bio - rad protein assay reagent proteins in sds - polyacrylamide gels were transferred onto a nitrocellulose membrane and then blocked with pbs , 0 . 5 % tween 20 , and 5 % milk powder for 1 hr . the filter was then incubated in blocking buffer with primary antibody at a dilution of 1 / 5000 for anti - bip and anti - calreticulin antibodies . antibodies to barley α - amylase were used at a dilution of 1 / 10000 . after 1 hr , a 15 - min wash and three 5 min washes were done with 1 × pbs and 0 . 5 % tween 20 . the secondary antibody used was anti - rabbit antibody conjugated to horseradish peroxidase at a dilution of 1 / 5000 in 1 × pbs , 0 . 5 % tween 20 , and 5 % milk powder . the filter was incubated with the secondary antibody for 1 hr . washes were for 15 min , with 4 washes of 5 min with 1 × pbs and 0 . 5 % tween 20 followed by a final wash with 1 × pbs . detection of antigen - antibody complexes was performed with enhanced chemiluminescence ( ecl , amersham corp ), and the images were recorded on film . all dna manipulations were done according to established procedures . the escherichia coli mc1061 ampicillin - resistant strain ( casadaban and cohen , 1980 ) was used for the amplification of all plasmids . the plasmid pde203 containing the dual mannopine synthase ( mas ) promoter driving the chloramphenicol acetyltransferase ( cat ) gene and the β - glucuronidase ( gus ) gene is identical to pde222 ( denecke et al ., 1992 ), except for the presence of the cat coding region rather than the bar coding region . pde203 was digested with ncoi , filled in using the klenow fragment of dna polymerase i , and digested with hindiii . the α - amylase coding region was inserted as a blunt hindiii fragment , resulting in pnl200 ( fig7 ). the lumenal binding protein ( bip ) coding region of isoform blp4 ( denecke et al ., 1991 ) was amplified by polymerase chain reaction , creating an ncoi site overlapping with the translation initiation codon and a bamhi site just after the stop codon . this fragment was inserted between the cauliflower mosaic virus ( camv ) 35s promoter and the 3 ′ untranslated end of the nopaline synthase ( nos ) gene present on pde4 ( denecke et al ., 1990 ), resulting in pde800 . to obtain a bip antisense construct , pde800 was digested with ncoi and bamhi releasing the bip sequence , the vector was dephosphorylated using calf intestine alkaline phosphatase , and both vector and fragment were filled in . after gel purification , the two parts were ligated again . the plasmid containing the bip coding region in the antisense orientation was named pnl100 . chimeric genes containing the camv 35s promoter and the coding region of bip , in sense and antisense orientations , were ligated into the agrobacterium tumefaciens transformation vector pde 1001 ( denecke et al ., 1992 ). the pt plasmids were mobilised into the agrobacterium tumefaciens rifampicin - resistant strain c58 ( pgv2260 ) ( debleare et al ., 1985 ) using the kanamycin resistant e . coli helper strain hb101 ( prk2013 ). transformed plants were obtained by agrobacteria infection of leaf pieces with the respective strains . transformants were selected on murashige and skoog medium with 3 % sucrose containing 100 μg / ml kanamycin and 250 μg / ml cefotaxin . tobacco leaf protoplasts ( from transformed or untransformed plants ) were prepared , and electroporation experiments were performed as previously described ( denecke and vitale , 1995 ), with minor modifications to the electroporation conditions . the conditions used in these experiments were 910 μf and 130 v . these optimal conditions were established with the expression of the α - amylase gene in tobacco protoplasts . for each experiment 2 . 5 × 10 6 protoplasts were used with 20 to 40 μg of dna . after 24 or 48 hr , the protoplasts were analysed by enzymatic assay or by protein gel blotting . tunicamycin was used at a concentration of 20 μg / ml . harvesting of cells and culture medium was done as described previously ( denecke and vitale , 1995 ). α - amylase activity was measured with a kit ( megazyme , australia ). the reaction was performed in a microtiter plate at 45 ° c . with 30 μl of extract and 30 μl of substrate . the reaction was stopped by the addition of 150 μl of stop buffer . the absorbance was measured at a wavelength of 405 nm , with a microtiter plate reader against a blank containing stop buffer alone . each experiment was carried out twice with three replicates . gus activity in protoplasts was measured with a calorimetric assay . six mililiters of floated protoplasts were diluted in tex buffer ( b5 salts , 250 mg / l nh 4 no 3 , 750 mg / l cacl 2 , 500 mg / l mes , and 0 . 4 m sucrose , ph 5 . 7 ) and were spun down by the addition of 20 ml of 250 mm nacl . the pellet was resuspended in extraction buffer ( 50 mm phosphate buffer , ph 7 . 0 , 10 mm na 2 - edta , 0 . 1 % sodium lauryl sarcosine , 0 . 1 % triton x - 100 , and 10 mm β - mercaptoethanol ) and sonicated . the reaction was performed at 37 ° c . as follows . five hundred microliters of 2 × reaction buffer ( 50 mm phosphate buffer , ph 7 . 0 , 0 . 1 % triton x - 100 , 2 mm pnpg , and 10 mm β mercaptoethanol ) was added to 490 μl of dilution buffer ( 50 mm phosphate buffer ph 7 . 0 , 0 . 1 % triton x - 100 , 10 mm β - mercaptoethanol ) and 10 μl of supernatant . the reaction was stopped by the addition of 400 μl of 2 . 5 m 2 - amino - 2 - methyl propanediol . the absorbance was measured at 415 nm against a blank containing stop buffer that had been incubated at 37 ° c . for the duration of the reaction time . benhamou , n . ( 1996 ). elicitor - induced plant defence pathways . trends in plant science 1 , 233 - 240 boller , t . ( 1991 ). ethylene in pathogenesis and disease resistance . in the plant hormone ethylene ( ed . a . k . mattoo & amp ; j . c . suttle ), 293 - 314 . boca raton : crc press chen , z ., silva , h . and klessig , d . f . ( 1993 ). active oxygen species in the induction of plant systemic acquired resistance by salicylic acid . science 262 , 1883 - 1886 . chen , z . x ., malamy , j ., henning , j ., conrath , u ., sanchezcasa , p ., silva , h ., ricigliano , j . and klessig , d . f . ( 1995 ). induction modification and tranduction of the salicylic - acid signal in plant defence responses . proc . nat . ac . sci . u . s . a . 92 , 4134 - 4137 . cornelissen , b . j . c . ; hooft van huijsduijnen , r . a . m . ; van , loon , l . c . and bol , j . f . ( 1986 ). molecular characterization of messenger rnas for “ pathogenesis - related ” proteins 1a , 1b and 1c , induced by tmv infection of tobacco . embo j . 5 , 37 - 40 creelman , r . a ., tierney , m . l and mullet , j . e . ( 1992 ). jasmonic acid / methyl jasmonate accumulate in wound soybean hypocotyls and modulate wound gene expression . proc . natl . acad . sci . usa 89 , 4983 - 4941 debleare , r ., bytebier , b ., de greve , h ., debroeck , f ., schell , j ., van montagu , m ., and leemans , j . ( 1985 ). efficient octopine ti plasmid - derived vectors for agrobacterium - mediated gene transfer to plants . nucleic acids res . 13 , 4777 - 1788 . delaney , t ., uknes , s ., vernooij , b . friedrich , l ., weymann , k , negrotto , d ., gaffney , t ., gut - rella , m ., kessman , h ., ward , e and ryals , j . ( 1994 ). a central role of salicylic acid in plant disease resistance . sciencedd . 266 , 1247 - 1250 . denecke , j ., and vitale , a . ( 1995 ). the use of plant protoplasts to study protein synthesis , quality control , protein modification and transport through the plant endomembrane system . in methods in cell biology , vol . 50 , d . w . galbraith , h . j . bohnert , h ., and d . p . bourque , eds ( san diego , calif . : academic press ), pp . 335 - 348 . denecke , j ., botterman , j ., and debleare , r ( 1990 ). protein secretion in plant cells can occurs via a default pathway . plant cell 2 , 51 - 59 . denecke , j ., de rycke , r ., and botterman , j . ( 1992 ). plant and mammalian sorting signals for protein retention in the endoplasmic reticulum contain a conserved epitope . embo j . 11 , 2345 - 2355 . denecke , j ., goldman , m . h . s ., demolder , j ., seurinck , j ., and botterman , j . ( 1991 ). the tobacco luminal binding protein is encoded by a multigene family . plant cell 3 , 1025 - 1035 denecke , j ., carlsson , l . e ., vidal , s ., höglund , a - s , ek , b ., van zeijl , m . j ., sinjorgo , k . m . c . and palva , e . t . ( 1995 ). the tobacco homolog of mammalian calreticulin is present in protein complexes in vivo . the plant cell 7 , 391 - 406 . durner , j ., shah , j . and klessig , d . f . ( 1997 ). salicylic acid and disease resistance in plants . trends in plant science 2 , 226 - 273 . farmer , e . e ., johnson , r . r . and ryan , c . a . ( 1992 ). regulation of expression of proteinase inhibitor genes by methyl jasmonate and jasmonic acid . plant physiol 98 , 995 - 1002 gaffney , t ., friedrich , l ., vernooij , b ., negrotto , d ., nye , g ., uknes , s ., ward , e ., kessmann , h . and ryals , j . ( 1993 ). requirement of salicylic acid for the induction of systemic acquired resistance . science 261 , 754 - 756 . hyodo , h . ( 1991 ). stress / wound ethylene . in the plant hormone ethylene ( ed . a . k . mattoo & amp ; j . c . suttle ), 43 - 63 . boca raton : crc press jefferson , r . a ., kavanagh , t . a ., and michael , w . b . ( 1987 ). gus fusions : β - glucuronidase as a sensitive and versatile gene fusion marker in higher plants . embo j . 6 , 3901 - 3907 . jones , r . l . ( 1985 ). protein synthesis and secretion by the barley aleurone : a perspective . israel j bot 34 , 377 - 395 kozutsumi , y ., segal , m ., normington , k , gething , m .- j . and sambrook , j . ( 1988 ). the presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose - regulated proteins . nature 332 , 462 - 464 leon , j ., lawton , m . a . and raskin , i . ( 1995 ). hydrogen - peroxide stimulates salicylic - acid biosynthesis in tobacco . plant physiology 108 , 1673 - 1678 malamy , j . and klessig , d . f . ( 1992 ). salicylic acid and plant disease reisistance . plant j . 2 , 643 - 654 . maliga , p ., breznowitz , a ., and marton , l . ( 1973 ). streptomycin - resistant plants from callus culture of haploid tobacco . nature 244 , 29 - 30 . mauch , f ., mauch - mani , b . and boller , t . ( 1988 ). antifungal hydrolases in pea tissue . ii . inhibition of fungal growth by combinations of chitinase and β - 1 . 3 glucanase . plant physiol . 88 , 936 - 942 . murashige , t . and skoog , f . ( 1962 ). a revised medium for rapid growth and bioassays with tobacco tissue culture . physiol . plant . 15 , 473 - 479 . palva , t . k ., holmström , k .- o ., heino , p ., and palva , e . t . ( 1993 ). induction of plant defense response by exoenzymes of erwinia crotovora subsp . crotovora mol . plant - microbe interact . 6 , 190 - 196 palva , t . k ., hurtig , m ., saindrenan , p ., and palva , e . t . ( 1994 ). salicylic induced resistance to erwinia crotovora subsp . crotovora in tobacco . mol . plant - microbe interact . 7 , 356 - 363 pérombelon , m . c . m . and salmond , g . p . c . ( 1995 ) bacterial soft rots . in pathogenesis and host specifity in plant diseases ( ed . u s sing , r p singh and k kohmoto ), 1 , 1 - 20 . oxford : pergamon qin , x . f ., holuigue , l ., horvath , d . m . and chua , n . h . ( 1994 ). immediate - early transcription activation by salicylic - acid via the cauliflowre mosaic - virus as - 1 element . plant cell 6 , 863 - 874 . rogers , j . ( 1985 ). two barley α - amylase gene families are regulated differently in barley aleurone cells . j . biol . chem . 260 , 3731 - 3738 . ross , a . f . ( 1961 ). localized acquired resistance to plant virus infection in hypersensitive hosts . vir 14 : 329 - 339 sela - buurlage , m . b ., ponstein , a . s ., bres - vloemans , s . a ., melchers , l . s ., van den elzen , p . j . m . and cornelissen , b . j . c . ( 1993 ) only specific tobacco ( nicotania tabacum ) chitinases and beta - 1 , 3 - glucanases exhibit antifungal activity . plant phys 101 , 857 - 863 shah , j ., tsui , f . and klessig d . f . ( 1997 ). characterization of a alicylic acid - insensitive mutant ( sail ) of arabidopsis thaliana , identified in a selective screen utilizing the sa - inducible expression of the tms2 gene . mol . plant - microbe interact . 10 , 69 - 78 . shamu , c . ( 1997 ). splicing together the unfolded - protein response . current biology 7 , r67 - 70 . vidal , s ., de leon , i . p ., denecke j . and palva , e . t . ( 1997 ). salicylic acid and the plant pathogen erwinia carotovora induce defense genes via antagonistic pathways . plant journal 11 , 115 - 123 . vidal , s ., eriksson , a . r . b ., montesano , m ., denecke , j . and palva , e . t . ( 1998 ) cell wall - degrading enzymes from erwinia carotovora cooperate in the salicylic acid - independent induction of a plant defense response . mol plant - microbe interact 11 , 232 - 32 vidal , s ., norman , c . and palva , e . t . cross - talk between ethylene , jasmonic acid and salicylic acid - dependent signal pathways regulates defense gene expression triggered by the plant pathogen erwinia carotovora . in preparation vitale , a ., ceriotti , a . and denecke , j . ( 1993 ). the role of the endoplasmic reticulum in protein systhesis , modification and intracellular transport . j . exp . bot ., 44 , 1417 - 1444 . vogel , j . p , misra , l . m ., and rose , m . d . ( 1990 ). loss of bip / grp78 function blocks translocation of secretory proteins in yeast j . cell biol . 110 , 1885 - 1895 . walther - larsen , h ., brandt , j ., collinge , d . b . and thordal - christensen , h . ( 1993 ) a pathogen - induced gene of barley encodes hsp90 homologue showing striking similarity to vertebrate forms resident in the endoplasmic reticulum . plant mol biol 21 , 1097 - 11098 ward , e . r ., uknes , s . j ., williams , s . c ., dincher , s . s ., wiederhold , d . l ., alexander , d . c ., ahl - goy , p ., métraux , j .- p . and ryals . j . a . ( 1991 ). coordinate gene activity in response to agents that induce systemic acquired resistance . plant cell 3 , 1085 - 1094 .
| 2 |
the compounds of the formula ( i ) may be used as such or , where appropriate , as pharmacologically acceptable salts ( acid or base addition salts ) thereof . the pharmacologically acceptable addition salts mentioned above are meant to comprise the therapeutically active non - toxic acid and base addition salt forms that the compounds are able to form . compounds that have basic properties can be converted to their pharmaceutically acceptable acid addition salts by treating the base form with an appropriate acid . exemplary acids include inorganic acids , such as hydrogen chloride , hydrogen bromide , hydrogen iodide , sulfuric acid , phosphoric acid ; and organic acids such as formic acid , acetic acid , propanoic acid , hydroxyacetic acid , lactic acid , pyruvic acid , glycolic acid , maleic acid , malonic acid , oxalic acid , benzenesulfonic acid , toluenesulfonic acid , methanesulfonic acid , trifluoroacetic acid , fumaric acid , succinic acid , malic acid , tartaric acid , citric acid , salicylic acid , p - aminosalicylic acid , pamoic acid , benzoic acid , ascorbic acid and the like . exemplary base addition salt forms are the sodium , potassium , calcium salts , and salts with pharmaceutically acceptable amines such as , for example , ammonia , alkylamines , benzathine , and amino acids , such as , e . g . arginine and lysine . the term addition salt as used herein also comprises solvates which the compounds and salts thereof are able to form , such as , for example , hydrates , alcoholates and the like . for clinical use , the compounds of the invention are formulated into pharmaceutical formulations for oral , rectal , parenteral or other mode of administration . pharmaceutical formulations are usually prepared by mixing the active substance , or a pharmaceutically acceptable salt thereof , with conventional pharmaceutical excipients . examples of excipients are water , gelatin , gum arabicum , lactose , microcrystalline cellulose , starch , sodium starch glycolate , calcium hydrogen phosphate , magnesium stearate , talcum , colloidal silicon dioxide , and the like . such formulations may also contain other pharmacologically active agents , and conventional additives , such as stabilizers , wetting agents , emulsifiers , flavouring agents , buffers , and the like . the formulations can be further prepared by known methods such as granulation , compression , microencapsulation , spray coating , etc . the formulations may be prepared by conventional methods in the dosage form of tablets , capsules , granules , powders , syrups , suspensions , suppositories or injections . liquid formulations may be prepared by dissolving or suspending the active substance in water or other suitable vehicles . tablets and granules may be coated in a conventional manner . in a further aspect the invention relates to methods of making compounds of any of the formulae herein comprising reacting any one or more of the compounds of the formulae delineated herein , including any processes delineated herein . the compounds of the formula ( i ) above may be prepared by , or in analogy with , conventional methods . the processes described above may be carried out to give a compound of the invention in the form of a free base or as an acid addition salt . a pharmaceutically acceptable acid addition salt may be obtained by dissolving the free base in a suitable organic solvent and treating the solution with an acid , in accordance with conventional procedures for preparing acid addition salts from base compounds . examples of addition salt forming acids are mentioned above . the compounds of formula ( i ) may possess one or more chiral carbon atoms , and they may therefore be obtained in the form of optical isomers , e . g . as a pure enantiomer , or as a mixture of enantiomers ( racemate ) or as a mixture containing diastereomers . the separation of mixtures of optical isomers to obtain pure enantiomers is well known in the art and may , for example , be achieved by fractional crystallization of salts with optically active ( chiral ) acids or by chromatographic separation on chiral columns . the chemicals used in the synthetic routes delineated herein may include , for example , solvents , reagents , catalysts , and protecting group and deprotecting group reagents . the methods described above may also additionally include steps , either before or after the steps described specifically herein , to add or remove suitable protecting groups in order to ultimately allow synthesis of the compounds . in addition , various synthetic steps may be performed in an alternate sequence or order to give the desired compounds . synthetic chemistry transformations and protecting group methodologies ( protection and deprotection ) useful in synthesizing applicable compounds are known in the art and include , for example , those described in r . larock , comprehensive organic transformations , vch publishers ( 1989 ); t . w . greene and p . g . m . wuts , protective groups in organic synthesis , 3 rd ed ., john wiley and sons ( 1999 ); l . fieser and m . fieser , fieser and fieser &# 39 ; s reagents for organic synthesis , john wiley and sons ( 1994 ); and l . paquette , ed ., encyclopedia of reagents for organic synthesis , john wiley and sons ( 1995 ) and subsequent editions thereof . the necessary starting materials for preparing the compounds of formula ( i ) are either known or may be prepared in analogy with the preparation of known compounds . the dose level and frequency of dosage of the specific compound will vary depending on a variety of factors including the potency of the specific compound employed , the metabolic stability and length of action of that compound , the patient &# 39 ; s age , body weight , general health , sex , diet , mode and time of administration , rate of excretion , drug combination , the severity of the condition to be treated , and the patient undergoing therapy . the daily dosage may , for example , range from about 0 . 001 mg to about 100 mg per kilo of body weight , administered singly or multiply in doses , e . g . from about 0 . 01 mg to about 25 mg each . normally , such a dosage is given orally but parenteral administration may also be chosen . the invention will now be further illustrated by the following specific examples . these examples are not limitative of the remainder of the disclosure in any way whatsoever . without further elaboration , it is believed that one skilled in the art can , based on the description herein , utilize the present invention to its fullest extent . all publications cited herein are hereby incorporated by reference in their entirety . 1 h nuclear magnetic resonance ( nmr ) and 13 c nmr were recorded on a bruker pmr 500 spectrometer at 500 . 1 mhz and 125 . 1 mhz , respectively or on a jeol eclipse 270 spectrometer at 270 . 0 mhz and 67 . 5 mhz , respectively , or on a bruker advance dpx 400 spectrometer at 400 . 1 and 100 . 6 mhz , respectively . all spectra were recorded using residual solvent or tetramethylsilane ( tms ) as internal standard . all spectra were recorded using residual solvent or tetramethylsilane ( tms ) as internal standard . ir spectra were recorded on a perkin - elmer spectrum 1000 ft - ir spectrometer . electrospray mass spectrometry ( ms ) were obtained using an agilent msd mass spectrometer . accurate mass measurements were performed on a micromass lct dual probe . elemental analyses were performed on a vario el instrument or sent to mikro kemi in uppsala . analytical hplc were performed on agilent 1100 . preparative hplc was performed on a gilson system or on a waters / micromass platform zq system . preparative flash chromatography was performed on merck silica gel 60 ( 230 - 400 mesh ). the compounds were automatically named using acd6 . 0 . gc - ms analysis was performed on a hewlett packard 5890 gas chromatograph with a hp - 5ms 15 m * 0 . 25 mm * 0 . 25 μm column connected to a 5971 ms detector . electrospray mass spectrometry ( ms ) spectra were obtained on a perkin - elmer api 150ex mass spectrometer . accurate mass measurements were performed on a micromass lct dual probe . a solution of the amine , ( 3as *, 6r *, 7as *)- 1 - benzyl - 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - amine , comparative example 5 ( 18 . 3 mg ; 0 . 05 mmol ) in methylene chloride ( 2 . 0 ml ) was treated with an isocyanate or isothiocyanate ( 1 equiv . ; 0 . 05 mmol ) the mixture was shaken at room temperature for 18 h , then the solvent was removed by evaporation . a solution of the appropriate amine ( 1 mmol ) in dcm ( 5 . 0 ml ) was treated with para - nitrophenylchloroformate ( 1 mmol ). the resulting solution was then treated dropwise at room temperature with hunigs base ( 1 mmol ). the mixtures were stirred at room temperature for 5 h . an aliquot ( 0 . 25 ml ; 0 . 05 mmol ) of the crude pnp - carbamate from the reaction mixtures described above was then transferred to a solution of the amine , ( 3as *, 6r *, 7as *)- 1 - benzyl - 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - amine , comparative example 5 ( 18 mg ; 0 . 05 mmol ) in methylene chloride ( 3 . 0 ml ) and the resulting solution shaken at r . t . overnight . the solvent was removed by evaporation and the crude reaction mixtures purified by preparative hplc . a solution of the amine , ( 3as *, 6r *, 7as *)- 1 - methyl - 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - amine , comparative example 7 ( 7 . 3 mg ; 0 . 025 mmol ) in tetrahydrofuran ( 1 . 0 ml ) was treated with and isocyanate or isothiocyanate ( 1 equiv . ; 0 . 025 mmol ) the mixture was shaken at room temperature for 18 h , then the solvent was removed by evaporation . the amine , ( 3as *, 6r *, 7as *)- 1 - methyl - 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - amine , comparative example 7 ( 7 mg , 0 . 024 mmol ) and isocyanate ( 1 . 3 eq ) were dissolved in dry thf ( 1 . 5 ml ). reaction in r . t ., under n 2 and overnight . the solvent was evaporated under reduced pressure . purification was performed by preparative hplc . to the appropiate amine ( 0 . 06 mmol ) in etoh ( 0 . 5 ml ) and thf ( 0 . 5 ml ) was added an aldehyde ( 0 . 1 mmol ) and nabh 3 cn ( 1 mmol ). the mixture was stirred overnight and concentrated . 2 m naoh was added and the aqueous layer extracted with etoac . the products were purified by preparative hplc . dimethoxyphenyl acetonitrile ( 4 . 43 g , 2 . 5 mmol ) was dissolved in dmf ( 20 ml ). sodium hydride ( 4 g of a 60 % dispersion , 2 . 4 g , 100 mmol ) was added in portions and the mixture was stirred at room temperature for 10 minutes . bromochloroethane ( 2 . 1 ml , 3 . 62 g , 25 . 2 mmol ) was added , and the mixture stirred at room temperature overnight . the reaction was cautiously quenched by addition of a methanol / water mixture ( 1 : 1 , 300 ml ) and the reaction products were extracted into ethyl acetate ( 3 × 200 ml ). the combined extracts were washed with water ( 4 × 200 ml ), brine ( 1 × 200 ml ) and then dried ( na 2 so 4 ). the solvent was then removed under reduced pressure and the crude product chromatographed ( sio 2 , etoac / petroleum ether 1 : 3 as eluent ) to give the title compound as an off - white solid ( 2 . 4 g , 47 %). 1 h nmr ( 270 mhz , cdcl 3 ) δ 1 . 32 ( m , 2h ) 1 . 64 ( m , 2h ) 3 . 84 ( s , 3h ) 3 . 88 ( s 3h ) 6 . 79 ( d , j = 1 . 0 hz , 2h ) 6 . 84 ( s 1h ). ms ( esi +) for c 12 h 13 no 2 : m / z 204 . 1 ( m + 1 ). 1 -( 3 , 4 - dimethoxyphenyl ) cyclopropanecarbonitrile , comparative example 1 ( 2 . 0 g , 9 . 84 mmol ) was dissolved in thf ( 30 ml ). dibal - h ( 15 ml of a 1 . 0 m solution in toluene , 15 mmol ) was added and the mixture was stirred at room temperature for 3 hours . the reaction was cautiously quenched by addition of 2 m hcl and organic components were extracted into dichloromethane ( 3 × 125 ml ). the combined extracts were washed with water ( 2 × 100 ml ), brine ( 2 × 100 ml ) and then dried ( na 2 so 4 ), giving the title compound as an off - white sold ( 1 . 95 g , 98 %). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 1 . 38 ( m , 2h ) 1 . 53 ( m , 2h ) 3 . 87 ( s , 6h ) 6 . 81 ( s , 1h ) 6 . 84 ( d , j = 1 . 0 hz , 2h ) 9 . 23 ( s , 1h ). ms ( esi +) for c 12 h 14 o 3 : no ion detected . 1 -( 3 , 4 - dimethoxyphenyl ) cyclopropanecarbaldehyde , comparative example 2 ( 3 . 25 g , 16 . 0 mmol ) was dissolved in dichloromethane ( 35 ml ). benzylamine ( 1 . 77 ml , 1 . 74 g , 16 . 2 mmol ) was added , followed by sodium sulfate ( 15 g , 105 . 6 mmol ). the mixture was stirred at room temperature overnight before being filtered and evaporated to yield the crude imine as a clear oil . this material was then dissolved in dmf ( 15 ml ), and sodium iodide ( 246 mg , 1 . 64 mmol ) and trimethylsilyl chloride ( 202 μl , 172 mg , 1 . 58 mmol ) were added . the resulting mixture was heated to 70 ° c . for 3 hours and then partitioned between water ( 150 ml ) and ethyl acetate ( 200 ml ). the aqueous phase was extracted with a further portion of ethyl acetate ( 1 × 200 ml ) and the combined extracts were washed with brine ( 1 × 200 ml ) and dried ( na 2 so 4 ). the solvent was removed under reduced pressure , and the crude product dissolved in dichloromethane ( 30 ml ). to this was added hcl in ether ( 70 ml of a 1 . 0 m solution , 70 mmol ) and the crude hcl salt was evaporated to dryness . this material was then dissolved in acetonitrile ( 70 ml ), methyl vinyl ketone ( 1 . 42 ml , 1 . 19 g , 17 mmol ) was added and the mixture heated to reflux for 16 hours . on cooling the solvent was removed under reduced pressure and the resulting dark oil partitioned between 3m hcl solution ( 200 ml ) and ether ( 150 ml ). the aqueous fraction was washed with further ether ( 3 × 150 ml ), and then brought to basic ph using 3 m naoh solution . the organic components were then extracted into diethyl ether ( 3 × 150 ml ) and the combined extracts washed with brine ( 1 × 200 ml ) and dried ( na 2 so 4 ). on removal of the solvent under reduced pressure , the crude product was purified by chromatography ( sio 2 , ethyl acetate / petroleum ether 2 : 3 as eluent ) to give the title compound as a clear oil ( 3 . 10 g , 53 %). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm : 1 . 87 - 2 . 38 ( m , 6h ); ( 2 . 38 - 2 . 82 ( m , 3h ); 2 . 82 - 3 . 05 ( m , 1h ); 3 . 05 - 3 . 20 ( m , j = 12 . 6 hz , 1h ); 3 . 20 - 3 . 35 ( m , 1h ); 3 . 92 ( s , 6h ); 3 . 96 - 4 . 19 ( m , j = 12 . 6 hz , 1h ); 6 . 73 - 7 . 03 ( m , 3h ) 7 . 09 - 7 . 42 . 13 c nmr ( 68 mhz , cdcl 3 ) δ ppm : 34 . 80 , 36 . 21 , 38 . 61 , 40 . 63 , 47 . 18 , 51 . 67 , 53 . 38 , 57 . 38 , 60 . 32 , 68 . 15 , 109 . 90 , 110 . 95 , 117 . 76 , 126 . 89 , 128 . 15 , 128 . 76 , 138 . 79 , 140 . 32 , 147 . 47 , 148 . 98 , 211 . 36 . 1 -( 3 , 4 - dimethoxyphenyl ) cyclopropanecarbaldehyde , comparative example 2 ( 8 . 0 g , 38 . 8 mmol ) was dissolved in dichloroethane ( 100 ml ). sodium sulfate ( 25 g , 176 mmol ) was added and methylamine gas was bubbled through the solution for 10 minutes . the reaction vessel was then sealed and the mixture stirred at room temperature overnight before being filtered and evaporated to yield the crude imine as a yellow oil . this material was then dissolved in dmf ( 30 ml ), and sodium iodide ( 585 mg , 3 . 90 mmol ) and trimethylsilyl chloride ( 500 l , 426 mg , 3 . 92 mmol ) were added . the resulting mixture was heated to 90 ° c . for 3 hours and then partitioned between water ( 200 ml ) and ethyl acetate ( 200 ml ). the aqueous phase was extracted with a further ethyl acetate ( 2 × 100 ml ) and the combined extracts were dried ( na 2 so 4 ). the solvent was removed under reduced pressure , and the crude product dissolved in dichloromethane ( 100 ml ). to this was added hcl in ether ( 100 ml of a 1 . 0 m solution , 100 mmol ) and the crude hcl salt was evaporated to dryness . this material was then dissolved in acetonitrile ( 100 ml ), methyl vinyl ketone ( 3 . 5 ml , 2 . 95 g , 42 . 1 mmol ) was added and the mixture heated to reflux for 16 hours . on cooling the solvent was removed under reduced pressure and the resulting dark oil partitioned between 3m hcl solution ( 200 ml ) and ether ( 200 ml ). the aqueous fraction was washed with further ether ( 2 × 100 ml ), and then brought to basic ph using 3 m naoh solution . the organic components were then extracted into ethyl acetate ( 4 × 150 ml ) and the combined extracts washed with brine ( 1 × 200 ml ) and dried ( na 2 so 4 ). on removal of the solvent under reduced pressure , the crude product was purified by chromatography ( sio 2 , ethyl acetate as eluent ) to give the title compound as a yellow oil ( 4 . 5 g , 40 %). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm : 1 . 99 - 2 . 12 ( m , 2h ); 2 . 12 - 2 . 26 ( m , 3h ); 2 . 28 ( s , 3h ); 2 . 30 - 2 . 47 ( m , 2h ); 2 . 52 - 2 . 62 ( m , 2h ); 2 . 88 - 2 . 95 ( m , 1h ) 3 . 06 - 3 . 15 ( m , 1h ) 3 . 85 ( s , 3h ); 3 . 87 ( s , 3h ); 6 . 76 - 6 . 93 ( m , 3h ). 13 c nmr ( 68 mhz , cdcl 3 ) δ ppm : 35 . 20 , 36 . 16 , 38 . 76 , 40 . 01 , 40 . 48 , 47 . 42 , 54 . 78 , 55 . 82 , 55 . 92 , 70 . 31 , 109 . 84 , 110 . 87 , 117 . 83 , 140 . 12 , 147 . 39 , 148 . 90 , 211 . 40 . ms ( esi +) for c 17 h 23 no 3 m / z 290 . 2 ( m + h ) + . hrms ( ei ) calcd for c 17 h 23 no 3 : 289 . 1678 , found 289 . 1684 ( 3 as *, 7as *)- 1 - benzyl - 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 6h - indol - 6 - one ( comparative example 3 ) ( 750 mg , 2 . 05 mmol ) was dissolved in methanol ( 60 ml ). ammonium acetate ( 1 . 6 g , 20 . 8 mmol ) was added and the solution allowed to stir at room temperature for 2 hours before sodium cyanoborohydride ( 100 mg , 1 . 59 mmol ) was added . the mixture was stirred at room temperature for 16 hours , diluted with 3 m naoh solution ( 100 ml ) and extracted into dichloromethane ( 2 × 150 ml ). the combined extracts were dried ( na 2 so 4 ) and the solvent removed to give the crude mixture of amines ( 410 mg , 55 %). this crude material was used as a mixture without further purification , or the cis ( 6r *)- and trans - isomer ( 6s *) separated by flash chromatography using chloroform saturated with nh 3 ( g ). same procedure as for comparative example 5 and comparative example 6 starting from ( 3as *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 6h - indol - 6 - one ( comparative example 4 ). this crude material was used as a mixture without further purification , or the cis ( 6r *)- and trans - isomer ( 6s *,) separated by flash chromatography using chloroform saturated with nh 3 ( g ). into a solution of comparative example 3 ( 3 . 0 g , 8 . 2 mmol ) and ( boc ) 2 o ( 3 . 0 g , 13 . 7 mmol ) in i - proh ( 200 ml ) was suspended 10 % pd on charcoal ( 0 . 8 g ), and the resulting mixture was vigorously agitated under h 2 ( 1 . 4 atm ) during 4 h at rt . the catalyst was filtered off and the filtrate was shaken with ps - trisamine ( 3 . 0 g , 4 mmol / g ) at rt overnight . the resin was filtered off and the solvent evaporated , leaving the title compound ( 2 . 4 g , 80 %) as a thick oil , which was used in the next step without further purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 28 - 1 . 51 ( m , 9h ), 1 . 96 - 2 . 38 ( m , 6h ), 2 . 43 - 2 . 72 ( m , 1h ), 2 . 72 - 2 . 89 ( m , 1h ), 3 . 14 - 3 . 45 ( m , 1h ), 3 . 68 - 3 . 84 ( m , 6h ), 4 . 27 - 4 . 58 ( m , 1h ), 6 . 60 - 6 . 84 ( m , 3h ). 13 c nmr ( 270 mhz , cdcl 3 ): δ ppm 14 . 22 , 21 . 04 , 28 . 50 , 33 . 22 , 36 . 59 , 44 . 76 , 55 . 90 , 55 . 96 , 60 . 29 , 79 . 87 , 100 . 00 , 109 . 49 , 111 . 20 , 117 . 99 , 137 . 66 , 147 . 86 , 149 . 08 , 210 . 41 . the compounds were synthesised ( starting with 705 mg of the mixture of amines ) and purified in an analogous method to that described in example 14 and 15 to give : ms ( esi +) for c 26 h 35 n 3 o 2 s : m / z 454 . 0 ( m + 1 ) hrms ( ei ) calcd c 26 h 35 n 3 o 2 s : 453 . 2450 , found 453 . 2472 ms ( esi +) for c 26 h 35 n 3 o 2 s : m / z 454 . 0 ( m + 1 ) hrms ( ei ) calcd c 26 h 35 n 3 o 2 s : 453 . 2435 , found 453 . 2450 compounds were prepared and purified in an analougous method to that described in example 14 and 15 to give : ms ( esi +) for c 28 h 39 n 3 o 2 s : m / z 482 . 1 ( m + 1 ) hrms ( ei ) calcd c 28 h 39 n 3 o 2 s : 481 . 2763 , found 481 . 2765 ms ( esi +) for c 28 h 39 n 3 o 2 s : m / z 482 . 1 ( m + 1 ) hrms ( ei ) calcd c 28 h 39 n 3 o 2 s : 481 . 2763 , found 481 . 2742 the mixture of cis and trans amines from comparative example 5 and comparative example 6 ( 82 . 5 mg , 225 μmol ) was dissolved in dichloromethane ( 5 ml ). benzyl isothiocyanate ( 39 μl , 43 . 9 mg , 294 μmol ) was added and the mixture stirred at room temperature for 16 hours . the solvent was then removed , and the crude reaction mixture chromatographed ( sio 2 , petroleum ether / ethyl acetate 5 : 2 as eluent ) to give : ms ( esi +) for c 31 h 37 n 3 o 2 s : m / z 516 . 2 ( m + 1 ) hrms ( ei ) calcd c 31 h 37 n 3 o 2 s : 515 . 2606 , found 516 . 2602 ms ( esi +) for c 31 h 37 n 3 o 2 s : m / z 516 . 2 ( m + 1 ) hrms ( ei ) calcd c 31 h 37 n 3 o 2 s : 515 . 2606 , found 516 . 2623 the compound was synthesised and purified an analougous method to that described in example 14 and 15 to give : ms ( esi +) for c 26 h 35 n 3 o 3 : m / z 438 . 5 ( m + 1 ) hrms ( ei ) calcd c 26 h 35 n 3 o 3 : 437 . 2678 , found 437 . 2670 nh 4 oac ( 2 g ) was added to a solution of tert - butyl ( 3as *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 6 - oxooctahydro - 1h - indole - 1 - carboxylate ( comparative example 9 , 2 . 4 g , 6 . 4 mmol ) in meoh ( 50 ml ), and the solution was stirred at ambient temperature for 2 h before nabh 3 cn ( 400 mg ) was added and the mixture stirred overnight . the mixture was diluted with 3 m naoh ( 50 ml ) and extracted with dichloromethane . the crude mixture of amines was used without further purifications . benzyl thioisocyanate ( 1 . 5 eqv .) was added to a solution of the amine mixture from above ( 0 . 1 g , 0 . 26 mmol ) in chcl 3 ( 50 ml ) and the mixture was stirred at ambient temperature overnight . trisamine - ps ( 1 g ) was added and the mixture stirred for 4 h before filtration and separation of products by flash chromatography ( silica , chcl 3 / meoh / nh 3 ). first eluted . tert - butyl ( 3as *, 6r *, 7as *)- 6 -{[( benzylamino ) carbonothioyl ] amino }- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indole - 1 - carboxylate : 215 mg . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 13 - 1 . 53 ( m , 10h ), 1 . 65 - 1 . 99 ( m , 4h ), 1 . 99 - 2 . 23 ( m , 1h ), 2 . 92 - 3 . 31 ( m , 1h ), 3 . 31 - 3 . 66 ( m , 3h ), 3 . 77 - 3 . 94 ( m , 6h ), 3 . 96 - 4 . 15 ( m , 1h ), 4 . 74 - 5 . 01 ( m , 1h ), 5 . 79 - 5 . 96 ( m , 1h ), 6 . 74 - 6 . 91 ( m , 3h ), 7 . 18 - 7 . 34 ( m , 3h ), 7 . 34 - 7 . 44 ( m , 1h ), 7 . 44 - 7 . 70 ( m , 1h ). ( esi +) m / z 526 ( m + 1 ). hrms ( ei ) calc for c 32 h 36 f 3 n 3 o 3 s : 525 . 2661 ; found 525 . 2662 . to a solution of example 17 ( 600 mg , 1 . 14 mmol ) in dcm ( 20 ml ) was added trifluoroacetic acid ( 20 ml ) and the resulting solution was stirred at rt during 5 min . the volatiles were evaporated under reduced pressure and the residue was partitioned between etoac ( 5 ml ) and naoh ( aq ., 1m , 2 ml ). the water phase was extracted with etoac and the organic phases were washed with saturated aqueous nacl ( 2 ml ), dried ( mgso 4 ) and evaporated to give the title compound ( 0 . 44 g , 91 %) as a colorless oil . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 01 - 1 . 15 ( m , 1h ), 1 . 15 - 1 . 42 ( m , 1h ), 1 . 56 - 1 . 68 ( m , 1h ), 1 . 72 - 1 . 89 ( m , 2h ), 1 . 90 - 2 . 15 ( m , 4h ), 2 . 20 - 2 . 33 ( m , 1h ), 2 . 34 - 2 . 45 ( m , 1h ), 3 . 09 - 3 . 22 ( m , 1h ), 3 . 22 - 3 . 40 ( m , 1h ), 3 . 77 - 3 . 97 ( m , 6h ), 4 . 17 - 4 . 39 ( m , 1h ), 4 . 59 - 4 . 94 ( m , 2h ), 5 . 67 - 6 . 16 ( m , 1h ), 6 . 65 - 6 . 94 ( m , 3h ), 7 . 18 - 7 . 40 ( m , 5h ). ms ( esi +) m / z 426 ( m + 1 ). hrms ( ei ) calc for c 24 h 31 n 3 o 2 s : 425 . 2137 ; found 425 . 2157 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3 as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and quinoline - 3 - carbaldehyde ( 0 . 25 mmol ), gave the title compound after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 04 - 1 . 26 ( m , 1h ), 1 . 26 - 2 . 61 ( m , 8h ), 2 . 83 - 3 . 20 ( m , 3h ), 3 . 20 - 3 . 38 ( m , 1h ), 3 . 69 - 3 . 91 ( m , 6h ), 4 . 27 - 4 . 67 ( m , 3h ), 4 . 77 - 4 . 99 ( m , 2h ), 5 . 21 - 5 . 46 ( m , 1h ), 5 . 75 - 6 . 07 ( m , 1h ), 6 . 68 - 6 . 90 ( m , 3h ), 7 . 40 - 7 . 58 ( m , 2h ), 7 . 58 - 7 . 69 ( m , 1h ), 7 . 72 - 7 . 87 ( m , 1h ), 7 . 99 - 8 . 21 ( m , 3h ), 8 . 81 - 8 . 81 - 8 . 92 ( m , 1h ). ms ( esi +) m / z 567 ( m + 1 ). hrms ( ei ) calc for c 34 h 38 n 4 o 2 s : 566 . 2715 ; found 566 . 2695 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and 3 -( trifluoromethyl ) benzaldehyde ( 0 . 25 mmol ), gave the title compound after preparative hplc purification . 11h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 01 - 1 . 17 ( m , 1h ), 1 . 24 - 1 . 59 ( m , 3h ), 1 . 59 - 1 . 85 ( m , 3h ), 1 . 85 - 2 . 51 ( m , 4h ), 2 . 81 - 3 . 24 ( m , 3h ), 3 . 67 - 3 . 92 ( m , 6h ), 4 . 10 - 4 . 33 ( m , 1h ), 4 . 33 - 4 . 70 ( m , 3h ), 5 . 20 - 5 . 57 ( m , 1h ), 5 . 72 - 6 . 05 ( m , 2h ), 6 . 66 - 6 . 91 ( m , 3h ), 7 . 19 - 7 . 85 ( m , 7h ). ( esi +) m / z 584 ( m + 1 ). hrms ( ei ) calc for c 32 h 36 f 3 n 3 o 2 s : 583 . 2480 ; found 583 . 2487 following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3 as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and 4 -( trifluoromethoxy ) benzaldehyde ( 0 . 25 mmol ), gave the title compound after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 03 - 1 . 29 ( m , 1h ), 1 . 30 - 1 . 49 ( m , 1h ), 1 . 49 - 1 . 66 ( m , 2h ), 1 . 66 - 1 . 91 ( m , 3h ), 1 . 91 - 2 . 35 ( m , 3h ), 2 . 35 - 2 . 60 ( m , 1h ), 2 . 83 - 3 . 22 ( m ; 3h ), 3 . 72 - 3 . 97 ( m , 6h ), 4 . 09 - 4 . 34 ( m , 1h ), 4 . 34 - 4 . 76 ( m , 2h ), 5 . 75 - 6 . 02 ( m , 1h ), 6 . 73 - 6 . 95 ( m , 3h ), 7 . 05 - 7 . 19 ( m , 2h ), 7 . 20 - 7 . 34 ( m , 5h ), 7 . 34 - 7 . 49 ( m , 2h ). ms ( esi +) m / z 600 ( m + 1 ). hrms ( ei ) calc for c 32 h 36 f 3 n 3 o 3 s : 599 . 2429 ; found 599 . 2443 following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and 3 - phenylpropanal ( 0 . 25 mmol ), gave the title compound as a colorless after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 95 - 1 . 42 ( m , 3h ), 1 . 42 - 1 . 87 ( m , 6h ), 1 . 87 - 2 . 35 ( m , 5h ), 2 . 35 - 3 . 04 ( m , 4h ), 3 . 07 - 3 . 31 ( m , 1h ), 3 . 65 - 3 . 97 ( m , 6h ), 4 . 35 - 4 . 80 ( m , 2h ), 5 . 28 - 6 . 01 ( m , 1h ), 6 . 60 - 6 . 91 ( m , 3h ), 6 . 91 - 7 . 44 ( m , 10h ). ms ( esi +) m / z 544 ( m + 1 ). hrms ( ei ) calc for c 33 h 41 n 3 o 2 s : 543 . 2919 ; found 543 . 2902 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and pyridine - 3 - carbaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 01 - 1 . 40 ( m , 3h ), 1 . 43 - 1 . 60 ( m , 2h ), 1 . 67 - 1 . 78 ( m , 3h ), 1 . 91 - 2 . 04 ( m , 1h ), 2 . 04 - 2 . 26 ( m , 2h ), 2 . 37 - 2 . 50 ( m , 1h ), 2 . 83 - 2 . 99 ( m , 1h ), 2 . 99 - 3 . 14 ( m , 2h ), 3 . 62 - 3 . 69 ( m , 1h ), 3 . 76 - 3 . 87 ( m , 7h ), 4 . 12 - 4 . 27 ( m , 1h ), 4 . 36 - 4 . 62 ( m , 2h ), 5 . 77 - 5 . 97 ( m , 1h ), 6 . 71 - 6 . 71 - 6 . 84 ( m , 3h ), 6 . 96 - 7 . 00 ( m , 1h ), 7 . 38 - 7 . 42 ( m , 1h ), 7 . 71 - 7 . 85 ( m , 5h ), 8 . 40 - 8 . 45 ( m , 1h ), 8 . 47 - 8 . 53 ( m , 1h ). ms ( esi +) m / z 517 ( m + 1 ). hrms ( ei ) calc for c 30 h 36 n 4 o 2 s : 516 . 2559 ; found 516 . 2557 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and 4 - methoxybenzaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 01 - 1 . 15 ( m , 1h ), 1 . 26 - 1 . 43 ( m , 1h ), 1 . 43 - 1 . 63 ( m , 2h ), 1 . 63 - 1 . 85 ( m , 3h ), 1 . 85 - 2 . 16 ( m , 2h ), 2 . 16 - 2 . 43 ( m , 1h ), 2 . 84 - 3 . 20 ( m , 3h ), 3 . 66 - 3 . 77 ( m , 3h ), 3 . 77 - 3 . 92 ( m , 6h ), 3 . 95 - 4 . 18 ( m , 1h ), 4 . 37 - 4 . 73 ( m , 2h ), 5 . 28 - 5 . 62 ( m , 1h ), 5 . 62 - 5 . 99 ( m , 1h ), 6 . 62 - 6 . 62 - 6 . 95 ( m , 5h ), 7 . 03 - 7 . 44 ( m , 7h ). hrms ( ei ) calc for c 32 h 39 n 3 o 3 s : 545 . 2712 ; found 545 . 2712 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and ethyl glyoxalate ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 04 - 1 . 14 ( m , 3h ), 1 . 18 - 1 . 26 ( m , 11h ), 1 . 34 - 1 . 43 ( m , 11h ), 1 . 43 - 1 . 54 ( m , 2h ), 1 . 68 - 1 . 76 ( m , 1h ), 1 . 76 - 1 . 85 ( m , 2h ), 1 . 89 - 2 . 13 ( m , 3h ), 2 . 45 - 2 . 69 ( m , 1h ), 2 . 98 - 3 . 50 ( m , 4h ), 3 . 64 - 3 . 78 ( m , 1h ), 3 . 78 - 3 . 83 ( m , 6h ), 3 . 86 - 3 . 97 ( m , 1h ), 3 . 97 - 4 . 20 ( m , 1h ), 4 . 57 - 4 . 94 ( m , 2h ), 5 . 44 - 4 . 94 - 5 . 77 ( m , 1h ), 6 . 66 - 6 . 85 ( m , 3h ), 7 . 22 - 7 . 35 ( m , 5h ). ms ( esi +) m / z 512 ( m + 1 ). hrms ( ei ) calc for c 28 h 37 n 3 o 4 s : 511 . 2505 ; found 511 . 2518 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and 4 - nitrobenzaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 04 - 1 . 84 ( m , 9h ), 1 . 89 - 2 . 28 ( m , 3h ), 2 . 33 - 2 . 57 ( m , 1h ), 2 . 72 - 3 . 00 ( m , 1h ), 3 . 00 - 3 . 23 ( m , 2h ), 3 . 70 - 3 . 89 ( m , 6h ), 4 . 14 - 4 . 67 ( m , 4h ), 5 . 19 - 5 . 37 ( m , 1h ), 5 . 67 - 6 . 02 ( m , 1h ), 6 . 51 - 6 . 62 ( m , 1h ), 6 . 69 - 6 . 87 ( m , 3h ), 7 . 20 - 7 . 36 ( m , 3h ), 7 . 48 - 7 . 64 ( m , 2h ), 7 . 70 - 7 . 85 ( m , 1h ), 8 . 04 - 8 . 14 ( m , 3h ), 8 . 15 - 8 . 32 ( m , 1h ). ms ( esi +) m / z 544 ( m + 1 ). following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using n - benzyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - yl ] thiourea ( example 19 , 20 mg , 0 . 051 mmol ) and pentanal ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 70 - 0 . 91 ( m , 3h ), 0 . 91 - 1 . 85 ( m , 9h ), 1 . 85 - 2 . 09 ( m , 3h ), 2 . 09 - 2 . 30 ( m , 2h ), 2 . 59 - 2 . 78 ( m , 1h ), 2 . 78 - 2 . 94 ( m , 1h ), 3 . 04 - 3 . 24 ( m , 1h ), 3 . 70 - 3 . 88 ( m , 6h ), 4 . 48 - 4 . 81 ( m , 1h ), 5 . 64 - 5 . 88 ( m , 1h ), 6 . 64 - 6 . 87 ( m , 3h ), 7 . 20 - 7 . 35 ( m , 5h ). ms ( esi +) m / z 496 ( m + 1 ). hrms ( ei ) calc for c 29 h 41 n 3 o 2 s : 495 . 2919 ; found 495 . 2929 . to a solution of tert - butyl ( 3as *, 6s *, 7as *)- 6 -{[( benzylamino ) carbonothioyl ] amino }- 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indole - 1 - carboxylate ( example 18 , 10 mg ) in dcm ( 2 ml ) was added trifluoroacetic acid ( 2 ml ) and the resulting solution was stirred at rt during 5 min . the volatiles were evaporated under reduced pressure and the residue was partitioned between etoac ( 5 ml ) and naoh ( aq ., 1m , 2 ml ). the water phase was re - extracted with etoac and the organic phases were washed with saturated aqueous nacl ( 2 ml ), dried ( mgso 4 ) and evaporated to give the title compound as a colourless oil . 1 h nmr ( 500 mhz , cdcl 3 ): δ ppm 1 . 34 - 1 . 46 ( m , 1h ), 1 . 61 - 2 . 08 ( m , 9h ), 2 . 75 - 3 . 04 ( m , 2h ), 3 . 69 - 3 . 79 ( m , 1h ), 3 . 79 - 3 . 95 ( m , 6h ), 4 . 25 - 4 . 79 ( m , 3h ), 6 . 09 - 6 . 61 ( m , 1h ), 6 . 78 - 6 . 85 ( m , 3h ), 7 . 27 - 7 . 39 ( m , 4h ), 8 . 78 - 9 . 64 ( m , 1h ). ms ( esi +): m / z 426 ( m + 1 ). to a solution of mixture of amines , intermediate from example 17 and 18 ( 2 . 2 g , 5 . 84 mmol ) in dichloromethane ( 50 ml ) was added n - butyl thioisocyanate ( 1 . 02 g , 8 . 8 mmol ) and the mixture was stirred orvernight . ps - trisamine ( 2 g ) was added and mixture was filtered and purified by flash chromatography using 20 - 70 % etoac in hexanes . yield : 800 mg of cis - compound . the boc - protected compound from above was deproteced by stirring in dichloromethane ( 10 ml ) and trifluoroacetic acid ( 10 ml ) for 30 min . the mixture was concentrated and redissolved in chloroform . ps - trisamine was added and the mixture filtered . the crude material was used without further purifications . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using the deprotected amine from above ( 20 mg , 0 . 051 mmol ) and acetaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 86 - 0 . 98 ( m , 3h ), 1 . 25 - 0 . 98 1 . 40 ( m , 4h ), 1 . 40 - 1 . 57 ( m , 5h ), 1 . 67 - 1 . 95 ( m , 4h ), 2 . 08 - 2 . 35 ( m , 3h ), 2 . 35 - 2 . 49 ( m , 1h ), 2 . 61 - 2 . 78 ( m , 1h ), 3 . 34 - 3 . 50 ( m , 2h ), 3 . 63 - 3 . 78 ( m , 1h ), 3 . 80 - 3 . 92 ( m , 7h ), 4 . 05 - 4 . 16 ( m , 1h ), 4 . 41 - 4 . 60 ( m , 2h ), 6 . 93 - 7 . 04 ( m , 3h ). ms ( esi +) m / z 420 ( m + 1 ). hrms ( ei ) calc for c 23 h 37 n 3 o 2 s : 419 . 2606 ; found 419 . 2604 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and propanal ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 86 - 1 . 01 ( m , 3h ), 1 . 24 - 1 . 61 ( m , 5h ), 1 . 61 - 2 . 04 ( m , 4h ), 2 . 16 - 2 . 39 ( m , 2h ), 2 . 39 - 2 . 59 ( m , 1h ), 2 . 67 - 2 . 88 ( m , 1h ), 3 . 05 - 3 . 26 ( m , 3h ), 3 . 37 - 3 . 66 ( m , 2h ), 3 . 74 - 4 . 00 ( m , 7h ), 4 . 11 - 4 . 24 ( m , 1h ), 4 . 44 - 4 . 63 ( m , 2h ), 6 . 91 - 7 . 06 ( m , 3h ), 7 . 20 - 7 . 49 ( m , 5h ). ms ( esi +) m / z 434 ( m + 1 ). hrms ( ei ) calc for c 24 h 39 n 3 o 2 s : 433 . 2763 ; found 433 . 2775 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and isobutyraldehyde ( 0 . 25 mmol ), gave the title compound as a colorless after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 85 - 0 . 85 - 1 . 01 ( m , 3h ), 1 . 09 - 1 . 24 ( m , 5h ), 1 . 24 - 1 . 62 ( m , 6h ), 1 . 62 - 2 . 09 ( m , 4h ), 2 . 09 - 2 . 47 ( m , 5h ), 2 . 65 - 2 . 83 ( m , 1h ), 3 . 07 - 3 . 20 ( m , 1h ), 3 . 34 - 3 . 53 ( m , 3h ), 3 . 78 - 3 . 90 ( m , 6h ), 3 . 90 - 4 . 08 ( m , 1h ), 4 . 08 - 4 . 21 ( m , 1h ), 4 . 40 - 4 . 61 ( m , 2h ), 6 . 88 - 7 . 10 ( m , 3h ). ms ( esi +) m / z 448 ( m + 1 ). hrms ( ei ) calc for c 25 h 41 n 3 o 2 s : 447 . 2919 ; found 447 . 2808 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and pentanal ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 85 - 1 . 03 ( m , 6h ), 1 . 22 - 1 . 59 ( m , 10h ), 1 . 61 - 2 . 00 ( m , 7h ), 2 . 10 - 2 . 33 ( m , 2h ), 2 . 33 - 2 . 49 ( m , 1h ), 2 . 64 - 2 . 81 ( m , 1h ), 3 . 08 - 3 . 25 ( m , 1h ), 3 . 35 - 3 . 50 ( m , 2h ), 3 . 50 - 3 . 70 ( m , 1h ), 3 . 74 - 3 . 89 ( m , 7h ), 4 . 06 - 4 . 16 ( m , 1h ), 4 . 38 - 4 . 60 ( m , 1h ), 6 . 92 - 7 . 02 ( m , 3h ). ms ( esi +) m / z 462 ( m + 1 ). hrms ( ei ) calc for c 26 h 43 n 3 o 2 s : 461 . 3076 ; found 461 . 3059 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and phenylacetaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 84 - 1 . 00 ( m , 3h ), 1 . 26 - 1 . 58 ( m , 6h ), 1 . 61 - 1 . 82 ( m , 1h ), 1 . 82 - 2 . 03 ( m , 2h ), 2 . 15 - 2 . 37 ( m , 3h ), 2 . 38 - 2 . 54 ( m , 1h ), 2 . 68 - 2 . 87 ( m , 1h ), 3 . 39 - 3 . 65 ( m , 3h ), 3 . 73 - 4 . 00 ( m , 11h ), 4 . 13 - 4 . 22 ( m , 2h ), 4 . 46 - 4 . 61 ( m , 2h ), 6 . 92 - 7 . 04 ( m , 3h ), 7 . 21 - 7 . 48 ( m , 5h ). ms ( esi +) m / z 496 ( m + 1 ). hrms ( ei ) calc for c 29 h 41 n 3 o 2 s : 495 . 2919 ; found 495 . 2914 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and 2 - formyl - cyclopropanecarboxylic acid ethyl ester ( 0 . 25 mmol ), gave the title compound as a colorless oil in after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 82 - 0 . 98 ( m , 3h ), 1 . 05 - 1 . 42 ( m , 9h ), 1 . 42 - 1 . 60 ( m , 2h ), 1 . 66 - 2 . 02 ( m , 5h ), 2 . 12 - 2 . 36 ( m , 2h ), 2 . 36 - 2 . 51 ( m , 1h ), 2 . 59 - 2 . 80 ( m , 1h ), 3 . 14 - 3 . 27 ( m , 2h ), 3 . 47 - 3 . 74 ( m , 3h ), 3 . 74 - 4 . 02 ( m , 7h ), 4 . 05 - 4 . 23 ( m , 3h ), 4 . 36 - 4 . 57 ( m , 2h ), 6 . 89 - 7 . 05 ( m , 3h ). ms ( esi +) m / z 518 ( m + 1 ). hrms ( ei ) calc for c 28 h 43 n 3 o 4 s : 517 . 2974 ; found 517 . 2973 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and furan - 3 - carbaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 84 - 1 . 01 ( m , 3h ), 1 . 24 - 1 . 61 ( m , 5h ), 1 . 61 - 2 . 00 ( m , 4h ), 2 . 03 - 2 . 34 ( m , 3h ), 2 . 34 - 2 . 48 ( m , 1h ), 2 . 68 - 2 . 82 ( m , 1h ), 3 . 25 - 3 . 47 ( m , 1h ), 3 . 47 - 3 . 64 ( m , 2h ), 3 . 64 - 3 . 81 ( m , 2h ), 3 . 81 - 3 . 89 ( m , 6h ), 4 . 09 - 4 . 18 ( m , 1h ), 4 . 29 - 4 . 44 ( m , 1h ), 4 . 60 - 4 . 71 ( m , 1h ), 6 . 70 - 6 . 80 ( m , 1h ), 6 . 89 - 7 . 03 ( m , 3h ), 7 . 63 - 7 . 71 ( m , 11h ), 7 . 85 - 7 . 93 ( m , 11h ). ms ( esi +) m / z 472 ( m + 1 ). hrms ( ei ) calc for c 26 h 37 n 3 o 3 s : 471 . 2556 ; found 471 . 2569 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and 1 - methyl - 1h - pyrrole - 2 - carbaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ 0 . 86 - 0 . 97 ( m , 3h ), 1 . 25 - 1 . 42 ( m , 2h ), 1 . 42 - 1 . 57 ( m , 3h ), 1 . 70 - 1 . 98 ( m , 5h ), 2 . 14 - 2 . 32 ( m , 3h ), 2 . 32 - 2 . 56 ( m , 3h ), 2 . 67 - 2 . 82 ( m , 2h ), 3 . 27 - 3 . 47 ( m , 3h ), 3 . 58 - 3 . 73 ( m , 2h ), 3 . 79 - 3 . 89 ( m , 6h ), 4 . 15 - 4 . 22 ( m , 1h ), 4 . 43 - 4 . 54 ( m , 1h ), 6 . 11 - 6 . 16 ( m , 1h ), 6 . 46 - 6 . 51 ( m , 1h ), 6 . 84 - 6 . 89 ( m , 1h ), 6 . 94 - 7 . 01 ( m , 3h ), 7 . 31 - 7 . 31 - 7 . 42 ( m , 1h ). ms ( esi +) m / z 485 ( m + 1 ). hrms ( ei ) calc for c 27 h 40 n 4 o 2 s : 484 . 2872 ; found 484 . 2880 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and 5 - methyl - furan - 2 - carbaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 88 - 0 . 99 ( m , 3h ), 1 . 25 - 1 . 58 ( m , 5h ), 1 . 62 - 1 . 98 ( m , 3h ), 2 . 02 - 2 . 18 ( m , 1h ), 2 . 19 - 2 . 32 ( m , 1h ), 2 . 32 - 2 . 38 ( m , 3h ), 2 . 38 - 2 . 57 ( m , 2h ), 3 . 16 - 3 . 49 ( m , 2h ), 3 . 53 - 3 . 69 ( m , 2h ), 3 . 70 - 3 . 81 ( m , 1h ), 3 . 81 - 3 . 90 ( m , 6h ), 4 . 08 - 4 . 19 ( m , 1h ), 4 . 38 - 4 . 52 ( m , 1h ), 4 . 52 - 4 . 71 ( m , 3h ), 6 . 10 - 6 . 18 ( m , 1h ), 6 . 65 - 6 . 72 ( m , 1h ), 6 . 87 - 7 . 03 ( m , 3h ). ms ( esi +) m / z 486 ( m + 1 ). hrms ( ei ) calc for c 27 h 39 n 3 o 3 s : 485 . 2712 ; found 485 . 2721 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and thiophene - 3 - carbaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 87 - 1 . 01 ( m , 3h ), 1 . 20 - 1 . 62 ( m , 6h ), 1 . 62 - 2 . 03 ( m , 4h ), 2 . 03 - 2 . 31 ( m , 3h ), 2 . 31 - 2 . 48 ( m , 1h ), 2 . 59 - 2 . 77 ( m , 1h ), 3 . 51 - 3 . 76 ( m , 2h ), 3 . 79 - 3 . 90 ( m , 7h ), 4 . 09 - 4 . 23 ( m , 1h ), 4 . 39 - 4 . 59 ( m , 2h ), 4 . 73 - 4 . 83 ( m , 1h ), 6 . 87 - 7 . 04 ( m , 3h ), 7 . 34 - 7 . 45 ( m , 1h ), 7 . 56 - 7 . 67 ( m , 1h ), 7 . 78 - 7 . 89 ( m , 1h ). ms ( esi +) m / z 488 ( m + 1 ). hrms ( ei ) calc for c 26 h 37 n 3 o 2 s 2 : 487 . 2326 ; found 487 . 2327 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and 5 - methyl - 3h - imidazole - 4 - carbaldehyde ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 86 - 1 . 01 ( m , 3h ), 1 . 23 - 1 . 60 ( m , 6h ), 1 . 66 - 2 . 08 ( m , 3h ), 2 . 12 - 2 . 34 ( m , 2h ), 2 . 34 - 2 . 48 ( m , 1h ), 2 . 48 - 2 . 59 ( m , 4h ), 2 . 60 - 2 . 79 ( m , 1h ), 3 . 16 - 3 . 64 ( m , 3h ), 3 . 68 - 3 . 95 ( m , 8h ), 4 . 19 - 4 . 35 ( m , 1h ), 4 . 41 - 4 . 67 ( m , 2h ), 6 . 90 - 7 . 08 ( m , 3h ), 8 . 81 - 8 . 86 ( m , 1h ). ms ( esi +) m / z 486 ( m + 1 ). hrms ( ei ) calc for c 26 h 39 n 5 o 2 s : 485 . 2824 ; found 485 . 2839 . following the general procedure for reductive alkylation of the pyrrolidine moiety , scheme e , using deprotected amine , intermediate from example 40 ( 20 mg , 0 . 051 mmol ) and 3 - phenylpropanal ( 0 . 25 mmol ), gave the title compound as a colorless oil after preparative hplc purification . 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 86 - 1 . 00 ( m , 3h ), 1 . 24 - 1 . 59 ( m , 5h ), 1 . 62 - 1 . 97 ( m , 3h ), 2 . 10 - 2 . 33 ( m , 4h ), 2 . 33 - 2 . 48 ( m , 1h ), 2 . 61 - 2 . 84 ( m , 3h ), 3 . 12 - 3 . 47 ( m , 5h ), 3 . 53 - 3 . 73 ( m , 1h ), 3 . 73 - 3 . 90 ( m , 8h ), 4 . 04 - 4 . 16 ( m , 1h ), 4 . 41 - 4 . 59 ( m , 1h ), 6 . 91 - 7 . 02 ( m , 3h ), 7 . 16 - 7 . 37 ( m , 5h ). ms ( esi +) m / z 510 ( m + 1 ). hrms ( ei ) calc for c 30 h 43 n 3 o 2 s : 509 . 3076 ; found 509 . 3068 . n - benzyl - 1h - pyrazole - 1 - carboximidamide hydrochloride ( 50 mg , 0 . 21 mmol ), diispropylethylamine ( 0 . 03 ml , 0 . 21 mmol ) and ( 3as *, 6s *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyl - octahydro - 1h - indol - 6 - amine , ( comparative example 8 , 60 mg , 0 . 21 mmol ) were mixed in anhydrous dmf ( 1 ml ) and heated at 100 ° c . for 2 hrs . the crude mixture was purified by preparative hplc to give the title compound , 9 mg ( 8 %) n - butyl - 1h - pyrazole - 1 - carboximidamide hydrochloride ( 43 mg , 0 . 21 mmol ), diispropylethylamine ( 0 . 03 ml , 0 . 21 mmol ) and ( 3as *, 6s *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyl - octahydro - 1h - indol - 6 - amine ( comparative example 8 , 60 mg , 0 . 21 mmol ) were mixed in anhydrous dmf ( 1 ml ) and heated at 100 ° c . for 2 hrs . the crude mixture was purified by preparative hplc to give the title compound , 9 mg ( 9 %) hrms ( ei ) calc : 388 . 2838 found : 388 . 2849 . n - pentyl - 1h - pyrazole - 1 - carboximidamide hydrochloride ( 45 mg , 0 . 21 mmol ), diispropylethylamine ( 0 . 03 ml , 0 . 21 mmol ) and ( 3as *, 6s *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyl - octahydro - 1h - indol - 6 - amine ( comparative example 8 , 60 mg , 0 . 21 mmol ) were mixed in anhydrous dmf ( 1 ml ) and heated at 100 ° c . for 2 hrs . the crude mixture was purified by preparative hplc to give the title compound , 9 mg ( 8 %) hrms ( ei ) calc : 402 . 2995 found : 402 . 2991 n - butyl - 1h - pyrazole - 1 - carboximidamide hydrochloride ( 6 mg , 0 . 03 mmol ), diispropylethylamine ( 0 . 01 ml , 0 . 06 mmol ) and ( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 1h - indol - 6 - amine ( comparative example 7 , 10 mg , 0 . 03 mmol ) were mixed in anhydrous dmf ( 1 ml ) and heated at 100 ° c . for 2 hrs . the crude mixture was purified by preparative hplc to give the title compound , 1 mg ( 7 %) hrms ( ei ) calc : 388 . 2838 found : 388 . 2856 . mesembrine ( 250 mg , 870 μmol ) was dissolved in dcm ( 4 ml ). an aqueous solution of methylamine ( 12 ml of a 50 % solution ) was added , followed by sodium cyanoborohydride ( 250 mg , 3 . 98 mmol ). the mixture was stirred overnight at room temperature and the solvent removed under reduced pressure . the crude product was partitioned between naoh solution ( 25 ml , 3m ) and dcm ( 25 ml ). the aqueous portion was extracted with further dcm ( 2 × 20 ml ), the combined extracts dried ( na 2 so 4 ), and the solvent was removed under reduced pressure . the oily residue was dissolved in dcm ( 5 ml ), and treated with n - butylisothiocyanate ( 115 μl , 110 mg , 960 μmol ). after stirring at room temperature for 16 hours , the solvent was removed and the crude products purified by preparative hplc . ms ( esi +) for c 23 h 37 n 3 o 2 s : m / z 420 . 3 ( m + 1 ). hrms ( ei ) calcd c 23 h 37 n 3 o 2 s : 419 . 2606 , found 419 . 2605 n ′- butyl - n -[( 3as *, 6s *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 1h - indol - 6 - yl ]- n - methylthiourea ( 40 . 4 mg , 11 %): ms ( esi +) for c 23 h 37 n 3 o 2 s : m / z 420 . 3 ( m + 1 ). hrms ( ei ) calcd c 23 h 37 n 3 o 2 s : 419 . 2606 , found 419 . 2592 compounds were prepared and purified in an analogous method to example 70 and 71 . n ′- benzyl - n -[( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 1h - indol - 6 - yl ]- n - methylthiourea ( 56 . 3 mg , 14 %): ms ( esi +) for c 26 h 35 n 3 o 2 s : m / z 454 . 2 ( m + 1 ). hrms ( ei ) calcd c 26 h 35 n 3 o 2 s : 453 . 245 , found 454 . 2442 n ′- benzyl - n -[( 3as *, 6s *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 1h - indol - 6 - yl ]- n - methylthiourea ( 72 . 3 mg , 18 %): ms ( esi +) for c 26 h 35 n 3 o 2 s : m / z 454 . 2 ( m + 1 ). hrms ( ei ) calcd c 26 h 35 n 3 o 2 s : 453 . 245 , found 454 . 2444 . triethylamine ( 0 . 29 ml , 2 . 07 mmol ) was added to a solution of ( 3as *, 6s *, 7as *)- 1 - benzyl - 3a -( 3 , 4 - dimethoxyphenyl ) octahydro - 1h - indol - 6 - amine ( example 6 , 0 . 38 g , 1 . 04 mmol ) in dry ch 2 cl 2 ( 20 ml ). triphosgene ( 0 . 123 g , 0 . 415 mmol ), dissolved in dry ch 2 cl 2 ( 3 ml ), was added to the reaction mixture dropwise . the mixture was stirred at room temperature under n 2 atmosphere for about 30 minutes . during this time the colour changed from light yellow to darker yellow . volatiles were evaporated which gave the crude isocyanate as a yellow solid . ms ( esi +) m / z 393 ( m + h ) + . 1 - methyl - piperazine ( 0 . 164 ml , 1 . 48 mmol ) was added to the crude isocyanate ( 0 . 194 g , 0 . 494 mmol ) dissolved in dry ch 2 cl 2 ( 10 ml ), and the mixture was stirred under n 2 atmosphere for 3 hours . volatiles were evaporated and the crude product was purified by preparative hplc which gave 0 . 64 mg of the title compound as an off - white solid . ms ( esi +) m / z 493 ( m + h ) + . hrms ( ei ) calc for c 29 h 4 o 3 n 4 o 3 : 492 . 3100 found 492 . 3076 . triethylamine ( 62 μl , 0 . 448 mmol ) was added to a solution of ( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 1h - indol - 6 - amine ( comparative example 7 , 65 mg , 0 . 224 mmol ) dissolved in dry ch 2 cl 2 ( 3 ml ). triphosgene ( 26 . 6 mg , 0 . 0895 mmol ) was dissolved in dry ch 2 cl 2 ( 1 ml ) and added dropwise . the solution was stirred under n 2 in room temperature for 3 h . 1 - methyl - piperazine ( 25 μl , 0 . 224 mmol ) was added and the reaction mixture was stirred at room temperature overnight . volatiles was evaporated and the crude product was purified by preparative hplc which gave 93 mg ( 99 %) of the title compound . 1 h nmr ( 400 mhz , meoh - d4 ) δ ppm 1 . 18 ( s , 3h ), 1 . 21 ( s , 3h ), 1 . 67 - 1 . 75 ( m , 2h ), 2 . 11 ( br s , 2h ), 2 . 26 - 2 . 30 ( br s , 3h ), 2 . 77 - 3 . 35 ( m , 8h ), 3 . 69 ( s , 3h ), 3 . 73 ( s , 3h ), 3 . 78 ( br m , 2h ), 3 . 99 ( br m , 3h ), 6 . 86 ( m , 3h ). ms ( esi +) m / z 417 ( m + h ) + . hrms ( ei ) calc for c 23 h 36 n 4 o 3 : 416 . 2787 found 416 . 2791 . piperazine ( 9 . 5 mg , 0 . 1097 mmol ) was added to the crude solution of isocyanate ( 0 . 1097 mmol ) prepared in comparative example 77 . the mixture was stirred at room temperature under n 2 atmosphere overnight . volatiles were evaporated and the crude product was purified by preparative hplc which gave 5 . 8 mg ( 13 %) of example 76 . ms ( esi +) m / z 403 ( m + h ) + . hrms ( ei ) calc for c 22 h 34 n 4 o 3 : 402 . 2631 found 402 . 2630 . see also under comparative example 77 . triethylamine ( 305 μl , 2 . 19 mmol ) was added to a solution of ( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 1h - indol - 6 - amine ( comparative example 7 , 318 mg , 1 . 097 mmol ) dissolved in dry ch 2 cl 2 ( 5 ml ). triphosgene ( 130 mg , 0 . 44 mmol ) was dissolved in dry ch 2 cl 2 ( 1 ml ) and added dropwise . the solution was stirred under n 2 in room temperature for 3 h . ms ( esi +) m / z 393 ( m + h ) + . the crude isocyanate was partitioned into several reaction vials , to which the appropriate amine ( see below ) was added ). n -( 2 - aminoethyl ) piperazine ( 14 μl , 0 . 1097 mmol ) was added to the isocyanate ( 0 . 1097 mmol ) solution of comparative example 77 . the mixture was stirred at room temperature under n 2 atmosphere overnight . volatiles were evaporated and the crude product was purified by preparative hplc , which gave 39 mg ( 79 %) of the title compound . ms ( esi +) m / z 446 ( m + h ) + . hrms ( ei ) calc for c 24 h 39 n 5 o 3 : 445 . 3053 found 445 . 3058 . 1 -( 3 - aminopropyl )- 4 - methylpiperazine ( 17 mg , 0 . 1097 mmol ) was added to the isocyanate ( 0 . 1097 mmol ) solution of comparative example 77 . the mixture was stirred at room temperature under n 2 atmosphere overnight . volatiles were evaporated and the crude product was purified by preparative hplc , which gave 22 mg ( 42 %) of the title compound . ms ( esi +) m / z 474 ( m + h ) + . hrms ( ei ) calc for c 26 h 43 n 5 o 3 : 473 . 3366 found 473 . 3364 . 2 -( aminomethyl )- 5 - methylpyrazine ( 21 mg , 0 . 17 mmol ) was dissolved in 1 ml dry ch 2 cl 2 under n 2 . diisopropylamine ( 44 mg , 0 . 34 mmol was added followed by dropwise addition of triphosgene ( 24 mg , 0 . 08 mmol ) in 1 ml of dry ch 2 cl 2 . stirred at room temperature for 2 hrs , and then ( 3as *, 6r *, 7as *)- 3a -( 3 , 4 - dimethoxyphenyl )- 1 - methyloctahydro - 1h - indol - 6 - amine ( comparative example 7 , 50 mg , 0 . 17 mmol ) was added . stirred at room temperature overnight and then concentrated . purification using preparative hplc gave the product as light yellow oil ( 7 . 8 mg , 10 %). 1 hnmr ( 270 mhz , chloroform - d ) ppm 1 . 04 - 1 . 32 ( m , 5h ); 1 . 76 - 1 . 90 ( m , 3h ); 2 . 00 - 2 . 38 ( m , 5h ); 2 . 53 ( s , 3h ); 3 . 46 - 3 . 72 ( m , 1h ); 3 . 87 ( s , 6h ); 4 . 05 - 4 . 20 ( m , 1h ); 4 . 48 ( s , 2h ); 5 . 21 ( w , 1h ); 6 . 70 - 6 . 98 ( m , 2h ); 7 . 30 - 7 . 65 ( m , 1h ); 8 . 36 - 8 . 40 ( m , 2h ); 8 . 47 ( b , 1h ). ms ( esi + ) for c 24 h 33 n 5 o 3 m / z 440 ( m + h + ), hrms found : 439 , 2580 calculated : 439 , 2583 1 - amino - 4 - methylpiperazine ( 13 μl , 0 . 1097 mmol ) was added to the isocyanate ( 0 . 1097 mmol ) solution of comparative example 77 . the mixture was stirred at room temperature under n 2 atmosphere overnight . volatiles were evaporated and the crude product was purified by preparative hplc , which gave 33 mg ( 69 %) of the title compound . ms ( esi +) m / z 432 ( m + h ) + . hrms ( ei ) calc for c 23 h 37 n 5 o 3 : 431 . 2896 found 431 . 2875 . linh 2 ( 7 . 5 g , 328 mmol ) was suspended in dme ( 200 ml ) at ambient temperature and ( 3 , 4 - methylenedioxy ) phenylacetonitrile ( 20 g , 124 mmol ) in dme ( 50 ml ) was added portionwise over 15 min . the mixture was heated at 80 ° c . for 30 min , whereupon its color changed to green , before a solution of 1 - bromo - 2 - chloroethane ( 11 . 3 ml , 136 mmol ) in dme ( 50 ml ) was added over a period of 20 min . during the course of the addition , the green color of the mixture changed to light brown . the mixture was heated at 80 ° c . overnight , or until gc indicated & gt ; 95 % consumption of the starting material . the mixture was cooled on an ice / water bath , and water ( 200 ml ) and et 2 o ( 400 ml ) was then added to destroy the excess of strong base . the mixture was extracted with dcm ( 2 × 100 ml ), and the combined organic extracts were washed with h 2 o ( 100 ml ), dried ( mgso 4 ) and evaporated . the residue was purified by flash chromatography ( silica , 10 - 20 % etoac in n - heptane ) to yield 1 -( 3 , 4 - methylenedioxyphenyl ) cyclopropanecarbonitrile ( 19 . 0 g , 82 %) as a yellowish oil . 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 1 . 18 - 1 . 32 ( m , 2h ); 1 . 57 - 1 . 66 ( m , 2h ); 5 . 93 ( s , 2h ); 6 . 71 - 6 . 83 ( m , 3h ). 1 -( 3 , 4 - methylenedioxyphenyl ) cyclopropanecarbonitrile ( 19 . 0 g of crude material , 101 mmol ), was dissolved in dry toluene ( 800 ml ) and cooled on an ice / water bath . a solution of dibal ( 1m in toluene , 140 ml , 140 mmol ) was added dropwise via an addition funnel , over a period of 30 min . the resulting mixture was heated at 50 ° c . overnight . the reaction mixture was cooled to 0 ° c . and cautiously transferred , in small portions and with swirling , to a separatory funnel containing ice - cold aq . hcl ( 4m , 0 . 5 l ). the aqueous layer was extracted once with etoac ( 400 ml ) and the combined organic portions were washed with water ( 1 × 300 ml ) and brine ( 1 × 200 ml ), dried ( mgso 4 ) and concentrated to give the aldehyde ( 19 g ) as a yellowish oil , which was used in the subsequent step without further purification . 1 h nmr ( 270 mhz , cdcl 3 ) δ 1 . 32 - 1 . 37 ( m , 2h ); 1 . 49 - 1 . 55 ( m , 2h ); 5 . 95 ( s , 2h ); 6 . 69 - 6 . 83 ( m , 3h ); 9 . 18 ( s , 1h ). to a solution of the aldehyde ( 19 g of crude material , assumed to be 101 mmol ) in dry thf ( 800 ml ) was added benzylamine ( 11 . 9 g , 111 mmol ) and an excess of mgso 4 ( 50 g ) and the resulting mixture was stirred at rt during 24 h . the mixture was filtered and evaporated to give the imine ( 28 g ), which was used in the next step without further purification . 1 h nmr ( 270 mhz , cdcl 3 ) δ 1 . 12 - 1 . 17 ( m , 2h ); 1 . 30 - 1 . 36 ( m , 2h ); 4 . 56 ( s , 2h ); 5 . 93 ( s , 2h ); 6 . 69 - 6 . 89 ( m , 3h ); 7 . 14 - 7 . 40 ( m , 5h ); 7 . 70 ( s , 11h ). to a solution of imine ( 10 g of crude material , assumed to be 53 mmol ) and benzylamine hydrochloride ( 10 g , 68 mmol ) in mecn ( 400 ml ) was added na 2 so 4 ( 20 g ) and but - 3 - en - 2 - one ( 3 . 7 g , 53 mmol ). the mixture was heated at reflux for 5 h and then cooled to rt . the drying agent was filtered off and the filtrate was evaporated to dryness . the residue was partitioned between etoac ( 200 ml ) and saturated aqueous nahco 3 ( 100 ml ), and the aqueous layer was extracted with etoac ( 2 × 100 ml ). the combined organic portions were washed with brine ( 100 ml ), dried ( mgso 4 ) and concentrated to give ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydroindol - 6 - one as a colorless oil ( 29 %) after purification by column chromatography ( silica / hexanes : etoac 70 : 30 ). 1 h nmr ( 270 mhz , cdcl 3 ) δ 1 . 85 - 2 . 36 ( m , 6h ); 2 . 40 - 2 . 82 ( m , 3h ); 2 . 87 - 2 . 98 ( m , 1h ); 3 . 10 ( d , 11h , j = 12 . 1 hz ); 3 . 21 - 3 . 26 ( m , 11h ); 4 . 08 ( d , 11h , j = 12 . 1 hz ); 5 . 93 ( s , 2h ); 6 . 71 - 6 . 95 ( m , 3h ); 7 . 17 - 7 . 41 ( m , 5h ). 13 c nmr ( 67 . 9 mhz , cdcl 3 ) 34 . 86 , 36 . 08 , 38 . 45 , 40 . 36 , 47 . 24 , 51 . 46 , 57 . 30 , 68 . 24 , 100 . 88 , 106 . 73 , 107 . 86 , 118 . 48 , 126 . 75 , 128 . 02 , 128 . 57 , 138 . 78 , 141 . 52 , 145 . 63 , 147 . 86 , 210 . 96 . to a solution of ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydroindol - 6 - one ( 1 . 5 g , 4 . 30 mmol ) and ammonium formate ( 2 g , 38 mmol ) in meoh ( 100 ml ) was added nabh 3 cn ( 2 g , 32 mmol ) in portions during 5 min . the resulting mixture was stirred at rt for 4 h and then evaporated . the residue was partitioned between etoac ( 100 ml ) and saturated aqueous nahco 3 ( 50 ml ). the aqueous phase was extracted with etoac ( 2 × 50 ml ) and the combined organic fractions were washed with brine ( 50 ml ), dried ( mgso 4 ) and evaporated to give ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine as a colorless oil ( 1 . 3 g , 87 %), which was used in the next step without further purification . 1 h nmr indicated the formation of approximately a 1 : 1 mixture of diastereomers ( at c - 6 ). 1 h nmr ( 270 mhz , cdcl 3 ) δ 0 . 89 - 2 . 42 ( m , 11h ); 2 . 83 - 3 . 30 ( m , 3h ); 4 . 18 ( d , 0 . 5h , j = 13 . 7 hz ); 4 . 30 ( d , 0 . 5h , j = 13 . 0 hz ); 5 . 88 ( s , 2h ); 6 . 64 - 7 . 00 ( m , 3h ); 7 . 10 - 7 . 53 ( m , 5h ). the general procedure for urea / thiourea formation was used , starting from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine ( 0 . 1 g , 0 . 29 mmol ) and allyl isocyanate ( 34 mg , 0 . 4 mmol ), to give 102 mg ( 74 %) of the mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . first eluted : n - allyl - n ′-[( 3as *, 6r *, 7as *)- 3a -( 1 , 3 - benzodioxol - 5 - yl )- 1 - benzyloctahydro - 1h - indol - 6 - yl ] urea hydrochloride : 23 mg ( 17 %). 1 h nmr ( 500 mhz , cdcl 3 ): δ ppm 1 . 16 - 1 . 34 ( m , 1h ); 1 . 55 - 1 . 68 ( m , 1h ); 1 . 82 ( d , 1h , j = 14 . 1 hz ); 1 . 91 - 2 . 26 ( m , 4h ); 3 . 21 - 3 . 31 ( m , 1h ); 3 . 73 - 4 . 08 ( m , 4h ); 4 . 21 ( dd , 1h , j = 13 . 0 , 4 . 9 hz ); 4 . 45 - 4 . 54 ( m , 1h ); 4 . 56 ( d , 1h , j = 13 . 2 hz ); 5 . 11 ( d , 1h , j = 10 . 6 hz ); 5 . 21 ( dd , 1h , j = 16 . 7 , 4 . 8 hz ); 5 . 44 - 5 . 64 ( br s , 1h ); 5 . 82 - 5 . 95 ( m , 1h , j = 16 . 7 , 10 . 6 , 5 . 0 hz ); 5 . 97 ( s , 2h ); 6 . 59 ( d , 1h , j = 8 . 46 hz ); 6 . 65 ( s , 1h ); 6 . 78 ( d , 1h , j = 8 . 46 hz ); 6 . 68 - 7 . 05 ( br s , 1h ); 7 . 45 - 7 . 53 ( m , 3h ); 7 . 65 ( d , 2h , j = 7 . 06 hz ); 11 . 77 - 12 . 26 ( br s , 1h ). ms ( esi +): m / z 434 ( m + 1 ). hrms ( ei ) calc for c 26 h 31 n 3 o 3 : 433 . 2365 ; found 433 . 2553 . second eluted : n - allyl - n ′-[( 3as *, 6s *, 7as *)- 3a -( 1 , 3 - benzodioxol - 5 - yl )- 1 - benzyloctahydro - 1h - indol - 6 - yl ] urea hydrochloride : greyish gummy solid ; 49 mg ( 36 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 23 - 1 . 47 ( m , 2h ); 1 . 54 - 1 . 70 ( m , 1h ); 1 . 77 - 1 . 96 ( m , 2h ); 1 . 98 - 2 . 34 ( m , 2h ); 2 . 35 - 2 . 38 ( m , 1h ); 3 . 04 - 3 . 17 ( m , 1h ); 3 . 20 - 3 . 35 ( m , 2h ), 4 . 21 ( d , 1h , j = 13 . 0 hz ); 4 . 35 - 4 . 50 ( m , 1h ); 4 . 63 - 4 . 80 ( m , 1h ); 4 . 94 - 5 . 23 ( m , 2h ); 5 . 65 - 5 . 88 ( m , 1h ); 5 . 93 ( s , 2h ); 6 . 67 - 6 . 87 ( m , 3h ); 7 . 23 - 7 . 37 ( m , 5h ). ms ( esi +): m / z 434 ( m + 1 ). hrms ( ei ) calc for c 26 h 31 n 3 o 3 : 433 . 2365 ; found 433 . 2358 . the general procedure for urea / thiourea formation was used , starting from from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine , intermediate from example 86 and 87 ( 0 . 1 g , 0 . 29 mmol ) and ethyl isothiocyanate ( 36 mg , 0 . 4 mmol ), to give 111 mg ( 81 %) of the mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . n -[( 3as *, 6r *, 7as *)- 3a -( 1 , 3 - benzodioxol - 5 - yl )- 1 - benzyloctahydro - 1h - indol - 6 - yl ]- n ′- ethylthiourea hydrochloride ( slower elute ): greyish gummy solid ; 30 mg ( 20 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 0 . 81 - 0 . 96 ( m , 1h ); 1 . 03 ( t , 3h , j = 7 . 05 hz ); 1 . 10 - 1 . 52 ( m , 2h ); 1 . 55 - 1 . 75 ( m , 2h ); 1 . 75 - 2 . 10 ( m , 5h ); 2 . 18 ( d , 1h , j = 15 . 6 hz ); 2 . 56 - 2 . 71 ( m , 1h ); 2 . 87 - 3 . 54 ( m , 3h ); 4 . 03 - 4 . 50 ( m , 1h ); 5 . 12 - 5 . 26 ( br s , 1h ); 5 . 94 ( s , 2h ); 6 . 69 - 6 . 89 ( m , 3h ); 7 . 23 - 7 . 44 ( m , 5h ). ms ( esi +): m / z 438 ( m + 1 ). hrms ( ei ) calc for c 25 h 31 n 3 o 2 s : 437 . 2137 ; found 437 . 2151 . faster elute : n -[( 3as *, 6s *, 7as *)- 3a -( 1 , 3 - benzodioxol - 5 - yl )- 1 - benzyloctahydro - 1h - indol - 6 - yl ]- n ′- ethylthiourea hydrochloride : greyish gummy solid ; 58 mg ( 40 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ): δ ppm 1 . 03 - 1 . 16 ( m , 4h ); 1 . 16 - 1 . 32 ( m , 3h ); 1 . 36 - 1 . 52 ( m , 1h ); 1 . 60 - 1 . 93 ( m , 3h ); 1 . 94 - 2 . 06 ( m , 1h ); 2 . 10 - 2 . 48 ( m , 2h ); 2 . 95 - 3 . 13 ( m , 2h ); 3 . 16 - 3 . 38 ( m , 2h ); 4 . 15 - 4 . 28 ( m , 1h ); 5 . 27 - 5 . 51 ( br s , 1h ); 5 . 94 ( s , 2h ); 6 . 69 - 6 . 89 ( m , 3h ); 7 . 27 - 7 . 48 ( m , 5h ). ms ( esi +) m / z 438 ( m + 1 ). hrms ( ei ) calc for c 25 h 31 n 3 o 2 s : 437 . 2137 ; found 437 . 2124 . the general procedure for urea / thiourea formation was used , starting from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine , intermediate from example 86 and 87 ( 0 . 9 g , 2 . 57 mmol ) and benzyl isothiocyanate ( 500 mg , 3 . 3 mmol ), to give 960 mg ( 65 %) of the mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . n -[( 3as *, 6s *, 7as *)- 3a -( 1 , 3 - benzodioxol - 5 - yl )- 1 - benzyloctahydro - 1h - indol - 6 - yl ]- n ′- benzylthiourea hydrochloride ( faster eluting ): colorless gummy solid ; 500 mg ( 17 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 0 . 81 - 0 . 96 ( m , 1h ); 1 . 16 - 1 . 47 ( m , 2h ); 1 . 53 - 2 . 48 ( m , 10h ); 2 . 92 - 3 . 26 ( m , 2h ); 4 . 09 - 4 . 23 ( m , 2h ); 4 . 53 - 4 . 63 ( br s , 1h ); 5 . 94 ( s , 2h ); 6 . 71 - 6 . 90 ( m , 3h ); 7 . 15 - 7 . 42 ( m , 10h ). ms ( esi +) m / z 500 ( m + 1 ). hrms ( ei ) calc for c 30 h 33 n 3 o 2 s : 499 . 2293 ; found : 499 . 2277 the general procedure for urea / thiourea formation was used , starting from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine , intermediate from example 86 and 87 ( 0 . 1 g , 0 . 29 mmol ) and n - butyl isothiocyanate ( 46 mg , 0 . 4 mmol ), to give 95 mg ( 68 %) of the mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . the title compound ( slower elute ): greyish gummy solid ; 48 mg ( 33 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 0 . 86 ( t , 3h , j = 7 . 3 hz ); 1 . 06 - 2 . 06 ( m , 12h ); 2 . 18 ( d , 1h , j = 16 . 0 hz ); 2 . 55 - 2 . 70 ( m , 1h ); 2 . 85 - 3 . 33 ( m , 3h ); 3 . 45 ( d , 1h , j = 13 . 3 hz ); 4 . 04 - 4 . 14 ( m , 1h ); 4 . 58 - 4 . 75 ( br s , 1h ); 5 . 19 - 5 . 33 ( br s , 1h ); 5 . 93 ( s , 2h ); 6 . 70 - 6 . 87 ( m , 3h ); 7 . 23 - 7 . 45 ( m , 5h ) 8 . 43 - 8 . 59 ( br s , 1h ). ms ( esi +): m / z 466 ( m + 1 ). hrms ( ei ) calc for c 27 h 35 n 3 o 2 s : 465 . 2450 ; found 465 . 2435 . the general procedure for urea / thiourea formation was used , starting from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine , intermediate from example 86 and 87 ( 0 . 1 g , 0 . 29 mmol ) and t - butyl isothiocyanate ( 46 mg , 0 . 4 mmol ), to give 103 mg ( 74 %) of the mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . the title compound ( slower elute ): colorless gummy solid ; 19 mg ( 14 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 0 . 80 - 0 . 97 ( m , 1h ); 1 . 16 - 1 . 47 ( m , 11h ); 1 . 62 - 2 . 32 ( m , 7h ); 2 . 57 ( d , 11h , j = 14 . 0 hz ); 2 . 88 - 3 . 20 ( m , 2h ); 4 . 59 - 4 . 80 ( br s , 1h ); 5 . 29 ( d , 1h , j = 9 . 0 hz ); 5 . 78 - 5 . 90 ( br s , 1h ); 5 . 93 ( s , 2h ); 6 . 72 - 6 . 91 ( m , 3h ); 7 . 16 - 7 . 49 ( m , 5h ). ms ( esi +): m / z 466 ( m + 1 ). hrms ( ei ) calc for c 27 h 35 n 3 o 2 s : 465 . 2450 ; found 465 . 2448 . the general procedure for urea / thiourea formation was used , starting from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine , intermediate from example 86 and 87 ( 0 . 1 g , 0 . 29 mmol ) and t - butyl isothiocyanate ( 46 mg , 0 . 4 mmol ), to give 103 mg ( 74 %) of the mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . example 91 ( faster elute ): colorless gummy solid ; 48 mg ( 34 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 1 . 20 - 1 . 32 ( m , 1h ); 1 . 42 ( s , 9h ); 1 . 58 - 1 . 73 ( m , 1h ); 1 . 49 - 2 . 05 ( m , 6h ); 2 . 24 ( d , 1h , j = 16 . 5 hz ); 2 . 62 - 2 . 79 ( m , 1h ); 3 . 10 - 3 . 23 ( m , 2h ); 3 . 70 ( d , 1h , j = 13 . 8 hz ); 4 . 00 ( d , 11h , j = 13 . 8 hz ); 5 . 55 - 5 . 65 ( br s , 1h ); 5 . 93 ( s , 2h ); 6 . 68 - 6 . 80 ( m , 3h ); 7 . 25 - 7 . 40 ( m , 5h ); 7 . 94 - 8 . 11 ( br s , 1h ). ms ( esi +): m / z 466 ( m + 1 ). hrms ( ei ) calc for c 27 h 35 n 3 o 2 s : 465 . 2450 ; found 465 . 2450 . the general procedure for urea / thiourea formation was used , starting from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine , intermediate from example 86 and 87 ( 0 . 1 g , 0 . 29 mmol ) and n - butyl isothiocyanate ( 46 mg , 0 . 4 mmol ), to give 95 mg ( 68 %) of the mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . the title compound ( faster eluting ): colorless gummy solid ; 30 mg ( 21 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 0 . 82 - 0 . 96 ( m , 4h ); 1 . 14 - 2 . 52 ( m , 14h ); 2 . 96 - 3 . 36 ( m , 4h ); 4 . 20 - 4 . 31 ( m , 2h ); 5 . 32 - 5 . 61 ( br s , 1h ); 5 . 93 ( s , 2h ); 6 . 71 - 6 . 90 ( m , 3h ); 7 . 24 - 7 . 50 ( m , 5h ). ms ( esi +) m / z 466 ( m + 1 ). hrms ( ei ) calc for c 27 h 35 n 3 o 2 s : 465 . 2450 ; found 465 . 2451 . the general procedure for urea / thiourea was used , starting from ( 3as *, 7as *)- 3a - benzo [ 1 , 3 ] dioxol - 5 - yl - 1 - benzyl - octahydro - indol - 6 - ylamine , intermediate from example 86 and 87 ( 0 . 9 g , 2 . 57 mmol ) and benzyl isothiocyanate ( 500 mg , 3 . 3 mmol ), to give 960 mg ( 71 %) of a mixture of isomers . the isomers were separated by using column chromatography ( silica , chcl 3 / meoh / nh 3 ) and converted to the corresponding hydrochlorides via treatment of dcm solutions with hcl / et 2 o ( sat .) followed by evaporation . the title compound ( slower elute ): colorless gummy solid ; 350 mg ( 12 %). the relative configuration was determined by 1 h nmr spectroscopy ( noesy ). 1 h nmr ( 270 mhz , cdcl 3 ) δ ppm 0 . 79 - 0 . 93 ( m , 1h ); 1 . 14 - 2 . 60 ( m , 8h ); 3 . 00 - 3 . 15 ( m , 1h ); 3 . 38 ( 1h , d , j = 13 . 3 hz ); 3 . 95 - 4 . 78 ( m , 4h ); 4 . 64 - 4 . 75 ( br s , 1h ); 5 . 53 - 5 . 56 ( br s , 1h ); 5 . 94 ( s , 2h ); 6 . 68 - 6 . 86 ( m , 3h ); 7 . 16 - 7 . 41 ( m , 10h ). ms ( esi +) m / z 500 ( m + 1 ). hrms ( ei ) calc for c 30 h 33 n 3 o 2 s : 499 . 2293 ; found : 499 . 2283 the active ingredient 1 is mixed with ingredients 2 , 3 , 4 and 5 for about 10 minutes . the magnesium stearate is then added , and the resultant mixture is mixed for about 5 minutes and compressed into tablet form with or without film - coating . the ability of a compound of the invention to bind or act at the mch1r receptor can be determined using in vitro and in vivo assays known in the art . the biological activity of compounds prepared in the examples was tested using different tests . the compounds according to the invention were evaluated for their binding to the human mch1r receptor by the following method : compounds : mch peptide was purchased from phoenix pharmaceuticals . ( phe 13 , [ 125 i ] tyr 19 melanine - concentrating hormone ( human , mouse , rat ) ([ 125 i ]- mch ) was obtained from nen life science products . inc . boston , mass . wheat germ agglutinine spa beads ( rpnq 0001 ) were obtained from amersham - pharmacia biotech . all other reagents used are of highest purity from different resources available . protein kits , micro bca ™ protein assay reagent kit ( cat no . 23235 ) were purchased from piece , rockford , ill ., usa . plastic wares : cell culture flasks , dishes were from decton dickinson labware , n . j ., usa . scintillation plate , white clear bottom were from wallac , finland . cho - k1 cells expressing hmch1 receptor were purchased from euroscreen . cho - k1 hmchri ( euroscreen , brussels , belgium , # es - 370 - c ) were cultivated in nutrient mixture ham &# 39 ; s f - 12 with glutamax i ( gibco - brl # 31765 - 027 ) supplemented with 10 % heat - inactivated foetal calf serum ( fcs , gibco - brl # 10108 - 165 ) and 400 μg / ml geniticin ( gibco - brl # 1140 - 0359 ). the cells were sub - cultivated twice weekly with split ratio = 1 : 20 - 1 : 30 . for membrane preparation the cells were cultured in 500 mm 2 dishes and the cells were harvested when 90 % confluent . when the cells reached more than 90 % confluence , dishes ( 500 cm 2 ) were rinsed twice with 20 ml pbs ( ca 2 + and mg 2 + free ). buffer a , which contains tris . hcl ( 15 ), mgcl 2 . 6h 2 o ( 2 ), edta ( 0 . 3 ), egta ( 1 ) in mm with ph 7 . 5 , 25 ml was added and cells were suspended using a window scraper . the cells were collected in 50 ml falcon tube pre - cooled on ice and then centrifuged for 3 minutes at 1500 g at 4 ° c . the supernatant was discarded and the cells were suspended again with buffer a . the cells were homogenized using a polytron homogenizer at setting 4 for 4 times for 30 seconds with 1 minute pause between the cycles . the homogenized preparation was centrifuged at 40 , 000 g ( 18500 rpm with ss - 34 , no . 5 rotor in sorvall centrifuge , rc5c , dupont ) for 25 minutes at 4 ° c . the pellets were washed once with buffer a and centrifuged again under the same conditions . the pellets were suspended with buffer b , which contains tris . hcl ( 7 . 5 ), mgcl 2 . 6h 2 o ( 12 . 5 ), edta ( 0 . 3 ), egta ( 1 ), sucrose ( 25 ) in mm with ph 7 . 5 , and gently homogenized for several times with a glass homogenizer . the membrane preparation was aliquoted into eppendorf tubes , 1 ml / tube and frozen at − 70 ° c . the protein determination was done as described in the instruction provided with pierce protein assay kit ( peirce micro bca protein assay reagent kit , no 23235 , pierce , usa ). briefly , the piece working reagent components a , b and c were mixed in the ratio 25 : 24 : 1 . bsa ( no . 23209 , pierce , usa ) provided with the kits was used as standard , which the concentration in the curve is 1 , 2 , 4 , 6 , 8 , 12 , 16 and 24 μl / ml . the samples from membrane preparation were diluted for 50 , 100 , 200 , 400 times . the standards or the samples 150 μl and the working reagent 150 μl were mixed in each well in a costa 96 well microtiter plate and incubated at 37 ° c . for 2 hours . the plate was cooled down to room temperature and read at 595 nm with a microplate reader from molecular devices , usa . the wga beads were re - constructed with reaction buffer , which contains tris ( 50 ), mgcl 2 ( 5 ), edta ( 2 . 5 ) in mm with ph adjusted to 7 . 4 , to 40 mg / ml as a stock suspension . to link the membrane with the bead , the beads and the membrane will be pre - incubated with for 30 minutes at room temperature with gentle shaking . the suspension of the beads was centrifuged at 3400 rpm for 2 minutes using centrifuge . the supernatant was discarded and the beads were re - suspended with binding buffer , hepes ( 25 mm ), mgcl 2 ( 5 mm ), cacl 2 ( 1 mm ), bsa ( 0 . 5 %) with peptidase inhibitors ( 1 μg / ml ) leupeptin , aprotinin and pepstatin , ph 7 . 4 . since appropriated beads and membrane construction is needed for spa , the ratio of beads and membrane in link were tested and it will be indicated where the experiments are described . the radio labeled [ 125 i ]- mch was diluted with cold mch in ratio 1 : 3 . in kd determination , the concentrations of labeled peptide were 3 nm with 1 : 2 series dilution for 11 samples . the amount of the beads was 0 . 25 mg / well . the results were calculated using excel program and the curves were drawn using a program graphpad prism . for screening of the substances the amount of the beads used was 0 . 25 mg / well and the amount of the membrane protein was 4 μg / well 0 . 2 nm of labeled mch was used . the total volume was 200 μl , which contained 50 μl [ 125 i ]- mch , 100 μl substances and 50 μl beads . the plate was gently shaken for 30 minute and incubated overnight . the samples were counted using microbeta counter ( wallac trilux 1450 micro beta counter , wallac , finland ) for 2 minutes and the results were calculated by using the computer program activity base . the equilibrium time of the binding was investigated at room temperature , 30 and 37 ° c . the equilibrium time was about 30 minutes at 37 ° c . but the binding was lower compared with that at room temperature and 30 ° c . the equilibrium time was about 2 hours at 30 ° c . while it took about 4 hours to reach stable binding at room temperature . thus , room temperature was chosen since it is easy condition for experiments . the [ 125 i ]- mch binding to hmch r1 was further characterized by determination of kd values . the kd values are same , 0 . 19 nm , as reported by chambers j , ames r s , bergsma d , muir a , fitzgerald l r , hervieu g , dytko g m , foley j j , martin j , liu w s , park j , ellis c , ganguly s , konchar s , cluderay j , leslie r , wilson s , sarau h m . melanin - concentrating hormone is the cognate ligand for the orphan g - protein - coupled receptor slc - 1 . nature 1999 jul . 15 ; 400 ( 6741 ): 261 - 5 . in all displacement experiments , 0 . 2 nm [ 125 i ]- mch was used for total binding and 300 nm mch used as non - specific binding . the background is low and the signal is good . the z ′ factor was 0 . 83 which is considered very good for screening . kd values from present study were consistent with that from macdonald d , murgolo n , zhang r , durkin j p , yao x , strader c d , graziano m p . molecular characterization of the melanin - concentrating hormone / receptor complex : identification of critical residues involved in binding and activation . mol pharmacol 2000 july ; 58 ( 1 ): 217 - 25 but were slightly different from that 1 . 2 nm from hervieu g j , cluderay j e , harrison d , meakin j , maycox p , nasir s , leslie r a , the distribution of the mrna and protein products of the melanin - concentrating hormone ( mch ) receptor gene , slc - 1 , in the central nervous system of the rat . eur j neurosci 2000 april ; 12 ( 4 ): 1194 - 216 . the reason for this is unknown but might be caused by different clones of the cells . the calculation of the k i values for the inhibitors was performed by use of activity base . the k i value is calculated from ic 50 and the k m value is calculated using . the cheng prushoff equation ( with reversible inhibition that follows the michaelis - menten equation ): k i = ic 50 ( 1 +[ s ]/ k m ) [ cheng , y . c . ; prushoff , w . h . biochem . pharmacol . 1973 , 22 , 3099 - 3108 ]. the ic 50 is measured experimentally in an assay wherein the decrease of the turnover of cortisone to cortisol is dependent on the inhibition potential of each substance . the compounds of formula ( i ) exhibit the ic 50 values for the mch1r receptor in the range from 10 nm to 10 μm . illustrative of the invention , the following ki values have been determined in the assay ( see table 1 ):
| 2 |
first , briefly in overview , the present invention is directed to a novel proxy asset system operated by a system proprietor responsible for implementing and managing a group of proxy assets . the system proprietor is linked to various ancillary information sources and outlets , via communications links including dedicated server lines , the internet or similar . thus , the system is accessible to brokers or outside investors , in a limited and pre - defined way . the proxy asset system is implemented by a proxy asset data processor and a programmed controlled criterion for operation , with this criterion well understood by participants . the proxy asset data processor includes a proxy asset account manager and a proxy asset dividend generator . in addition , the proxy asset system preferably includes a trading , issuance and redemption system that receives and stores customer orders to buy and sell , including market orders , limit orders and possibly other varieties of order , and executes these orders by trading existing proxy asset shares or issuing or redeeming proxy asset shares in complete sets , here defined , as needed . the stored programming implements a cash account formula , that defines the balances in the cash accounts and a dividend payout formula for each proxy asset , to be discussed here below . the pooled resources for all cash accounts within the system are invested in some assets , such as money market instruments , by an investment manager , or separate firm external to the system , characterized herein as the bank . the bank reports to the system proprietor the value of the pooled resources , and the system proprietor tracks the separate cash accounts for the proxy assets , which are claims on the pooled funds in the bank . the underlying criteria for account processing are publically distributed to insure complete knowledge by participants . transfers are made among cash accounts within the proxy asset system . the illustrative examples here present a single proxy asset system , recognizing that there could be more than one such system , each operating at different institutions run by different system proprietors . turning to an exemplary proxy asset system implementing , at a minimum , two proxy assets for real estate in a given city for a given base year . these two proxy assets are referred to as an up proxy asset and a down proxy asset , one share of each forming what will be called a complete set ( see also below ). the first proxy asset , the up proxy asset , has a cash account balance per share that is adjusted by the system proprietor according to a cash account formula that specifies that it contains , at regular intervals ( e . g ., quarterly ), a balance proportional to the real estate price index for the given base year for that city , and investors (&# 34 ; shareholders &# 34 ;) in that proxy asset receive a regular dividend according to a dividend payout formula that specifies a dividend payout equal to a constant , predetermined , payout rate times the balance in the cash account corresponding to that share and subject to an upper limit . the second proxy asset , the down proxy asset has cash account balance per share that is set , according to its cash account formula , to equal the combined balances in the cash accounts for both up and down proxy asset per share minus the balance in the up proxy asset cash account per share . its dividend payout formula defines a dividend equal to the payout rate times the balance in that account , so long as that balance is positive , and not exceeding an upper bound . the system is defined so that all dividends payouts are always feasible : the sum of the dividend payout formulas for an up share and a down share is always less than the combined balances per share in the two accounts in the bank , by construction . accordingly , buying shares in the up proxy asset corresponds to investing in the illiquid real estate itself ; the proxy asset is , however , liquid . moreover , shares in the up proxy asset have the look and feel of an ordinary investment , since they confer on the investor a claim on the cash account which &# 34 ; backs &# 34 ; the proxy asset , thereby encouraging a receptive market psychology for these assets . investments in the down proxy asset are less clearly analogous to existing investments . one might call a share in one of them analogous to a portfolio consisting of a short position in real estate and also the margin account balance for that short position . by this interpretation , if the assets are created when the index is at 100 , we may say that the margin account has an initial margin of 200 %, rather than the 150 % required by the federal reserve regulations for conventional short positions , the higher initial margin allowing for a reasonably well - functioning hedging vehicle without margin calls . if the index drifts far from 100 , then the proxy asset system creates new up and down proxy assets with an index that is 100 in a newer base year , issuing both up and down proxy assets at 100 . investors may then redeem their original proxy assets and purchase those with the newer base year . since the down proxy asset does not involve margin calls at all and resembles an asset , it is better to regard it as a fundamentally new investment vehicle that makes it much easier for participants to hedge their risks . in accordance with pre - defined logic and controlling system instructions , the system proprietor has two primary functions . the first is to create the proxy assets and distribute shares in these assets , like the up - down proxy assets described in the example above , in a way that allows free commercial access and payment of a market price for the proxy assets , and to allow redemption of shares . the second aspect involves , as seen in the example above , the management of a cash account for each proxy asset that is linked to the cash accounts of other proxy assets in the system and so that the changes in the value of the underlying assets are translated into changes in cash account balances and ultimately into dividends for distribution to the owners of the proxy asset shares . a third function , a trading , issuance and redemption system , is optionally integrated as a feature of the system . as in the example above , each proxy asset within the proxy asset system has a prespecified cash account formula that defines how much is in its cash account per share at each point of time . those proxy assets whose cash account formulas sum identically to the combined cash values per share in the cash accounts corresponding to all the proxy assets in the set will be called a complete set of proxy assets . as long as all proxy assets are part of complete sets of proxy assets , then it is always possible for all proxy assets to be created such that the proxy asset data processor can always adhere to the cash account formulas defining the proxy assets &# 39 ; s balances without running out of cash . ( there may also be restrictions on the kinds of complete sets for which share redemptions or new share issues will be generated .) proxy assets will be issued and redeemed by the proxy asset data processor only in complete sets , so that the cash account balances defined by the cash account formula and the dividends can always be paid in accordance with the cash account formula . we can clarify what we have said above about issuance and redemption in mathematical terms . let us call v t the total value of all pooled cash accounts for a given base year in the bank at time t . call s , the number of shares of all proxy assets in the system . thus , the value per share , averaging over the entire system with that base year is v t / s t , though individual proxy assets within the system will have different values . the proxy asset data processor allows free issuance of new shares and redemption of existing shares at any time t at prices so as not to disturb v t / s t . thus , when a packet of new shares is issued at time t , if there are s t shares in the packet , the total value of the packet must be v t s / s t , so that after issuance there will be s t + s t shares and the total value after the issuance will be v t + v t s t / s t . it follows that the value per share after issuance will be ( v t + v t s t / s t )/( s t + s t ) which equals v t / s t , the same as it was before the issuance . note that in general the individual shares will nol be issued or redeemed at price v t / s t , nor will the underlying cash value accounts for each share contain that amount . the cash account formula for each proxy asset specifies how much its cash account contains per share , at regular intervals such as quarterly , in terms of some measure of value or income of underlying proxy assets , as well as in terms of v t / s t , and possibly other economic variables such as inflation or interest rates . a complete set is a set of n shares of proxy assets such that the sum of cash account formulas for the cash accounts per share equals nv t / s t . thus , so long as the shares comprise a complete set according to the formula definitions , they can be issued or redeemed together without affecting v t / s t . the dividend payout formula for each proxy asset specifies how much is paid out as a dividend per share each time period to owners of that proxy asset as a function of the balance in that proxy asset &# 39 ; s cash account per share , and possibly as a function of other data , such as interest rates and the rate of inflation , and possibly as a function of the balances in cash accounts that belong to the same complete set . the dividend payout formula must be specified so that dividend payments are always feasible given the balances in the cash accounts . there is an important reason for issuing and redeeming shares only in such a way that the value per share , averaging over the entire system , is unaffected . the reason is that the cash account balances of individuals will thus be protected from being influenced by the decisions of other investors to issue or redeem . the cash account for each proxy asset has several purposes . first , all proxy asset holders receive dividends equal to the amounts in their asset value account at the dividend definition date times a payout factor defined by the dividend payout formula , generally , the same payout factor applied to all proxy assets managed by a single proxy asset system . second , the account balance is used by the system to determine whether offers to buy or sell can be settled by issuance of new proxy assets or redemption of old proxy assets . third , the account balance is provided to customers as information relevant to their evaluation of the proxy assets ; the cash account balance may be referred to as the cash value of the investment , and thus lends substance to the otherwise amorphous securities . two illustrative techniques depict the issuance and redemption of proxy assets . the first technique involves issuing complete sets of proxy assets to brokers by conventional underwriting methods , just as new shares in corporations are issued today . brokers who buy the complete sets will then have the burden of selling off the elements of the complete sets to clients as best they can , leaving the problem of finding customers for the elements of the complete sets to the brokers . moreover , brokers can redeem the complete sets of proxy assets by purchasing on the market the complete sets , and submitting these back to the system proprietor . the second technique provides for an integrated trading , issuance , and redemption system implemented by the system proprietor , ( possibly with the participation of an existing electronic trading system ) that solves the problem of finding complete sets for the brokers , and also allows trading of existing shares . if the proxy asset shares are traded on the trading system described here , participants in the system , ( e . g ., brokers and possibly individuals ), can place orders to buy or sell proxy assets in the form of either a market order ( to buy or sell at any price ) or a limit order ( to buy at a price at or below a given price or to sell at a price at or above a given price ), and possibly other kinds of orders . the system will manage the buy or sell orders partly as do other existing trading systems today : in the case of limit orders , it will search for matches , sell limit orders that are at or below buy limit orders for single proxy assets , and clear them . it will also execute buy or sell orders in another way . whenever a set of unmatched buy orders can be found that constitutes a complete set of proxy assets , at combined prices equal to or above the combined values of the cash accounts of the proxy assets , then the orders will be executed by creating a new complete set of proxy assets and crediting the proceeds of the sale ( minus some commission ) into the cash accounts in amounts corresponding to the balances currently in the accounts . whenever a set of sell orders can be found that constitutes a complete set of proxy assets , at combined prices at or below the combined values of the cash accounts of the proxy assets , then the orders will be executed by redeeming a complete set of proxy assets , and transferring the balances ( minus some commission ) in the cash accounts in amounts corresponding to the balances currently in the accounts to the sellers . when such complete sets are discovered among buy or sell orders , it means that it is feasible to execute the order by issuance and / or redemption without having any effect on the system proprietors &# 39 ; ability to keep asset balances at their values specified by the cash account formula , and the execution will then be done automatically . the trading , issuance , and redemption system is preferably fully automated and electronic , though it is possible that elements of the system may need to be done manually , given possible regulatory or other issues . please see u . s . pat . no . 4 , 674 , 044 to kalmus , et al ., relating to automated trading techniques , the contents of which are incorporated by reference . it is possible in some implementations of the trading , issuance , and redemption system that the system proprietor is not the only exchange , or even the primary exchange , on which the existing proxy assets are traded . trades on the system may be limited to issuance and redemption , or limited to certain times , such as once a month . system constraints will reflect federal and state regulations , taxation issues , and issues raised by existing securities exchanges . a separate aspect involves the creation of proxy asset bundles , groupings of proxy assets that may be traded as a bundle even if the individual components do not trade individually . under this approach , the system implements the dismantling of the proxy asset bundles under select circumstances . the bundling and dismantling will be illustrated below . applying the above structure to a real estate example , two proxy assets are established for each city ( and associated base year ) to be managed by the system : one ( the up proxy asset for a long position in real estate in that city , and the other ( the down proxy asset ) for a short , or reciprocal position , in the city . we shall suppose that when the proxy assets for this base year were first issued in that base year , the home price index was scaled so that the index equaled 100 then , and the initial cash accounts for both the up proxy asset and the down proxy assets originally contained $ 100 . the cash account formula for the up proxy asset at quarterly intervals after that is just the price index : up cash account balance per share end of quarter = home price index . the cash account formula for the down proxy asset cash account balance per share , that determines its cash account balance at time t , is : down cash account balance per share end of quarter = 2 × total account balances per share - home price index . ( in terms of the mathematics shown above , the up proxy asset cash account balance at the end of quarter t equals the home price index at time t , i t , and the down proxy asset cash account balance equals 2v t / s t - i t .) transfers between the accounts are made each quarter to assure that at the end of each quarter these cash account formulas are satisfied . thus , if the index is 100 in the base year and is now 120 , ( reflecting an increase in real estate prices since the base year ) then the underlying account for each up security has $ 120 in it . the cash account balance for one share of the down security is just the combined investment value of the balances in a pair of up and down securities in that city minus the index . the combined investment value in the up and down cash accounts was $ 200 on the base date , when the index was 100 by definition , and today is the accumulated investment value ( in the money market fund where cash account balances are invested ) since the base date of $ 200 , after paying out dividends according to the dividend payout formula . thus , for example , if the combined value in the up and the down cash accounts per share is now $ 205 , then when the index is at 120 , the down account has $ 85 corresponding to each down security . to support issuance - redemption and trade execution , the proxy asset data processor searches over the buy and sell orders to find a complete set whose total prices exceed the total value of a set . since a complete set consists of one up proxy asset share and one down proxy asset share , then whenever an offer to buy an up proxy asset share at price p 1 and a down proxy asset share at price p 2 are found such that p 1 + p 2 ≧ 2v t / s t , then both orders are executed and from the proceeds of the combined sale the proxy asset data processor allocates an amount equal to the value corresponding to one share in the up cash account to that account , and an amount equal to the value corresponding to one share in the down cash account to that account . thus , after this issuance of new shares , each share has the same cash account balance as before , and there are now more shares outstanding . when offers to sell the shares are found at prices such that p t + p 2 ≦ 2v t / s t , then the shares are redeemed and the proceeds of the sale deducted from the cash accounts in proportion to the amounts already in these accounts . moreover , when an offer to buy one up proxy asset share at price p 1 and an offer to sell one up proxy asset share at price p 2 is found by the proxy asset data processor so that p 1 ≦ p 2 , then the order is executed without issuance or redemption , merely by selling an existing share . the same occurs for offers to buy and sell down proxy assets . in the above examples , we have neglected , for illustrative purposes only , the commission charged for the sales and also the profit accruing from these trades . the dividend payout formula for both up and down proxy assets in this example is given by : dividend per share = r ×( amount in own cash account per share ) if positive and if amount in own cash account is less than the combined value in the two accounts = r ×( combined amount in the two accounts ) if amount in own cash account is greater than the combined value where r is a payout rate defined by the proxy asset system rules ; it could be a fixed number such as 2 % per annum , corresponding to an estimate of the long - term real interest rate on money market accounts . ( it must of course be less than 100 % so that the dividend payout is always feasible , but presumably it will be much less .) the down proxy asset &# 39 ; s cash account could have a negative value in it , in which case no dividend will be paid to its shareholders . in this case , the up proxy asset &# 39 ; s cash account would have more than the total cash in the two accounts , in which case the dividend paid for the up proxy asset per share would just be the payout rate , r , times the total cash in the two accounts per share . the market price of the down proxy asset will still be positive , since there is always the possibility that the index will drop enough to bring its balance to a positive number again . note that the market price of the up proxy asset will tend to the index , so long as the index does not differ too far from 100 . in this case , investing in the up proxy asset will be a proxy for investing in the real estate itself . so long as the unobserved dividends ( in the form of housing services ) on the actual real estate are approximated by the dividend payout formula payout rate , then the owner of the proxy asset will be receiving the same dividends as would be received by investing in the real estate itself . so long as the proxy asset price stays close to the price index for the real estate , then investing in the proxy asset will also tend to produce essentially the same capital gains and losses as investing in real estate . however , investing in the proxy asset will not produce the identical capital gains and losses because the proxy asset market will be more liquid , allowing investors to take better opportunity of predictable movements in index values . the down proxy asset will be extremely useful to homeowners wishing to hedge the risks of their investment in their own home . as is well known , many recent declines in real estate markets have caused homeowners to lose the real equity in their homes . a single decision of a homeowner to put part of his or her investments in a down proxy asset for the city will then effectively hedge the homeowner indefinitely against such price risk . because the down proxy asset has such a simple form , and is easily understood , it is easy for people to do this . the system will provide continuous information about the balance in the cash account , and thus investors will have the satisfaction of knowing that their accounts are &# 34 ; backed &# 34 ; by some real assets . they will also know that if certain predefined circumstances pertain ( such as termination of the system ), they will automatically receive the balance in their cash account , further strengthening their impression that their investment has substantive value , even though such circumstances are so defined as to be unlikely for the foreseeable future . bundling is applied to our up - down proxy assets to facilitate the marketing of the assets . for example it is possible that in each city there is a demand for the down asset for that city , corresponding to the natural hedging demand for people of that city , but little or no demand for the individual up assets of individual cities , as investors all want to be diversified . the system creates and market down assets for each of the cities , but the corresponding up proxy assets for each city is bundled for distribution as a single global up proxy asset which is a portfolio of the up proxy assets for all cities . these up assets could then later be taken apart , under defined circumstances . the initial down proxy assets could also be for individual zip codes or even census tracts , thereby facilitating very accurate hedging for individual homeowners , and the up proxy assets marketed could be only highly aggregated as of the corresponding individual up proxy assets . a second form of proxy asset , continuing the real estate example , is labeled here swap proxy assets . investors wishing to swap out of the risk in their own city can buy an asset that is short their own city and long some other city . with such assets , they cannot adjust their overall real estate exposure ( as they could with up - down proxy assets ) but they can diversify their real estate exposure across cities ( horizontal hedging ). adjusting the exposure to their own city can be a useful portfolio management device , since many investors are not overinvested in real estate per se but are overexposed to real estate in one region . with between - city - swap proxy assets , this kind of hedging of one &# 39 ; s risk and diversification into other cities can have the appearance of buying ordinary shares in other cities . buying the proxy asset is like buying a share in the other city and selling exposure in a first city . if we begin the system for n cities , then there are n2 - n ordered pairs of cities , and there will be one swap proxy asset for each such pair . for the ijth pair , then the cash account formula for the cash account for one share of swap proxy asset ij is : cash account balance per share for swap proxy asset ij = average cash account value per share + 2 *( index i - index j ) and we will have for the jith pair a swap proxy asset whose cash account formula is : cash account balance per share for swap proxy asset ij = average cash account value per share + 2 *( index j - index i ) note that the average cash account value per share is the total balance in all cash accounts in the system per share , denoted v t / s t above . in this example the swap proxy assets are more levered than in the previous up - down example , in that the indices are multiplied by two . ( another multiplier , other than two , could of course be used , to create a different amount of leverage ; the number given is just for illustration .) the prices of the swap proxy assets will not have the simple interpretation of the price of the up proxy asset of the previous example , but the assets will have the offsetting advantage that they offer effective means of diversifying risk . one way of defining the complete sets for the purpose of issuance and redemption is that all pairs of investments , one share in ij and one in ji , are complete sets . in this case , we can use the same dividend rule as was defined in the previous example , the example of up - down proxy assets . there are other possible ways to define complete sets . a complete set could consist of a share in ij a share jk and a share in ki proxy assets . these sets are circles of assets . if we defined such alternative complete sets , then we may wish to alter the dividend payout formula so that , in the case where some balances are negative , so that some swap proxy assets are paying no dividend , the dividends on the remaining swap proxy assets still sum to the payout rate times the combined balances . fig1 shows an illustration of the kinds of closed paths ( complete sets ) that the swap system processor identifies among the orders to buy and sell shares . the first set , set a , is just a san francisco - denver swap proxy asset paired with a denver - san francisco swap proxy asset . the second set , set b , is a complicated closed path involving three cities and three swap proxy assets . the proxy asset data processor applies these more complicated definitions of complete sets and searches the data to find opportunities to issue , redeem , and allow trade of proxy assets , a process much more complicated than was the case with the up - down proxy assets . for example , setting the average cash account balance in the system ( v t / s t ) at $ 105 . 50 dollars per share , suppose that three book windows on the trading display screen are as shown : ______________________________________bid quantity offer quantity______________________________________boston / chicago base 1998010111015 100 11015 5011014 50 11016 5011013 50 11018 1001999 / 03 / 02 10 : 53chicago / seattle base 19980101 8593 50 8594 501999 / 03 / 02 10 : 53seattle / boston base 1998010112042 50 12043 50 12045 50 12046 1001999 / 03 / 02 10 : 53______________________________________ the proxy asset system and processor would discover that a bid for 50 boston - chicago shares at $ 110 . 15 matches with the offer to sell 50 boston - chicago shares , and so this trade would automatically be executed , and the match shown on the hypothetical window above would not persist for more than an instant . to execute these orders , there is no need for issuance or redemption . the computer will also discover that there is a bid for boston - chicago for another 50 shares at $ 110 . 15 , a bid for 50 chicago - seattle shares at $ 85 . 93 , and a bid for 50 seattle - boston shares for $ 120 . 42 , and that the sum of these prices is $ 316 . 50 , or three times the average cash account value per share ( 3 v t / s t ), and so it automatically fills these orders by issuing the new proxy assets , and allocating the proceeds from the sale into the respective cash accounts in proportion to amounts already there . once again , these orders would not persist on the book window for more than an instant . note that in interfacing with an electronic trading system , such as the globex or other system , there would ideally be some minor modifications in the electronic trading system . for an obvious example , traders would probably appreciate the ability to maintain more than one book window on the screen at a time , because of the interaction of orders within complete sets . for another example , traders who have asked the trading system to alert them when the price has hit a specific level may also want to be alerted in case any combination of orders for other proxy assets within the same compete set would suggest an opportunity to obtain the specified price by issuance or redemption at the specified price . it would be natural for our system to do this alerting , since such an operation would combine naturally with the enterprise of searching for complete sets among the orders . these swap proxy assets will work very well for those investors who already hold both real estate and other investments , but whose real estate investment is largely accounted for by their own homes , which are too concentrated in each city . for example , a person who owns a $ 400 , 000 home in los angeles and is worried about possible poor performance of real estate in los angeles relative to new york can invest $ 100 , 000 in proxy asset shares like those described just above that is short los angeles and long new york , and thereby create a situation in which he or she is effectively invested in the los angeles market only in the amount of $ 200 , 000 , and is effectively invested in the new york market in the amount of $ 200 , 000 , thereby diversifying risks equally between the two cities . the person could also invest $ 40 , 000 in each of four swaps , a new - york - los angeles swap proxy asset , a miami - los angeles swap proxy asset , and a chicago - los - angeles swap proxy asset , a denver - los angeles swap proxy asset , thereby diversifying from an exclusive los angeles real estate position to a real estate position that is equally diversified across five cities . the swap proxy assets are optionally bundled together and sold only as a group ( called here a proxy asset bundle ). for example , if there is a lot of demand among residents of each city to swap their city real estate index for an average of all other cities , thereby effecting a diversified investment , then the only assets that need be marketed are the bundles of swaps that respond positively to a single city . under certain conditions , these proxy asset bundles will provide the underlying swaps to the public which then may be disassembled later if demand appears for the individual components of the bundles . if there is a lot of demand among investors to invest in how well each city &# 39 ; s real estate index will perform relative to all of the others combined , the relevant assets are the proxy asset bundles of swap proxy assets of each city versus all of the others . in this case , complete sets with only two elements would not exist ; complete sets would require representation of all cities . such structures permit investors to go long the chosen city while requiring no one to hedge any city . such a structure could be of value if the demand for hedging is minimal . a third form of proxy asset is labeled here as multi - asset pools . this arrangement has no down securities , only up securities , the up securities for a given illiquid asset functioning also as down securities for the others together . here , n proxy assets , each , corresponding to an index i at , a = 1 , . . . , n , at time t , swaps the one index against the remaining n - 1 indices . a complete set is one of each of the n proxy assets . the cash account function that defines the balance per share after transfer in cash account a at time t may be given by : ## equ1 ## for example , if n = 2 , then the assets are analogous to swaps between pairs of assets , as with the swap proxy assets described above . for another example , if n = 5 , there could be five proxy assets , one for the real estate of each of the five largest cities of the country . note that this formula satisfies the adding - up constraint ; the total value of all accounts after transfers still equals the total amount in all accounts before transfer . another cash account formula that would define the balance in the cash account a at time t with a nonlinear formula : ## equ2 ## where the weights w a , a = 1 , . . . , n correspond to the relative amounts outstanding of the various assets . ( for example , cities with more people in them would get more weight .) a complete set is again one of each of the n proxy assets . with such a formula , the individual proxy asset cash accounts would never hit zero . note that this formula also satisfies the adding - up constraint ; the total value of all cash accounts after transfers still equals the total amount in all cash accounts before transfer . the amounts in the various accounts would always correspond to the values in the various illiquid assets . thus , there will be less of a need to issue securities with a new base year as time goes on . this multi - asset pooling proxy asset security will tend to be less volatile than the one defined by the linear formula . with the foregoing description in mind , attention is now directed to fig2 providing a schematic block diagram of the proxy asset account manager in the up - down proxy asset version . in this exemplary arrangement , two proxy assets are created , and the two constitute a complete set . in particular , the system proprietor issues shares of up proxy asset ( a ) ( block 10 ), following orders placed in the system on behalf of investors by conventional brokerage arrangements ( block 40 ). similarly , the system proprietor also issues , at block 20 , the down proxy assets ( b ), also following orders placed in the system by brokers on behalf of investors . importantly , the shares must be issued only in complete sets , which in this example means that the number of a proxy assets issued must equal the number of b proxy assets issued . receipts from the sale of both the up and the down securities are pooled by the system proprietor in the bank and then the individual cash accounts credited with shares of this pool , block 30 , in proportions to the amounts per share already in these accounts . as provided above , it can be recognized that no actual underlying illiquid asset has been identified or purchased by the system proprietor , and accordingly , no meaningful transaction expenses have been incurred . the system operates to provide a proxy to real estate . the up proxy assets are marketed with a set of defining parameters including a link to an established index , and the cash account , acct a tied to these account balance would grow in proportion with the index . in a reciprocal manner , the down proxy asset &# 39 ; s cash account balance would drop in value in proportion to an increase in the real estate index value . this is practically implemented by having actual capital taken from acct b and deposited in acct a in correspondence with the changing index value , as shown at 70 . acct a would grow and acct b would shrink by a like amount . as the underlying index is capable of both growth and retraction , fig2 depicts capital flows in both directions . in accordance with stored program logic , the system receives input on adjusted account balances and determines a dividend payment , w corresponding to this new balance . an inverted relation is found between the index and the dividend stream of acct b , linked to the down securities . as real estate markets appreciate , funds in acct b are transferred out , leaving less capital for dividend generation w &# 39 ;, and thus a reduced dividend for the holders of the down proxy assets b . these proxy assets , however , should remain in demand at some price , because of the cash account value and because of their usefulness as a hedging vehicle against a drop in real estate values . implementation of the foregoing features is best accomplished via digital computer utilizing a uniquely defined controlling logic , wherein the computer system includes an integrated network between and among the various participants in the proxy asset security . this is depicted generally in fig3 wherein a block diagram highlights the components of a computer system useful for implementing these assets . the computer system is of conventional design , having a central processor ( cpu ) block 100 linked to a main database , db ( i ), block 110 . the main database includes archival data on the various securities , and allows proper manipulation of the underlying parameters in accordance with system logic . the database structure is outlined in detail in the database structure section below . the logic controlling system operation is stored in discrete memory block 120 . one aspect of the foregoing system involves the input of price or income indices in the underlying illiquid asset markets , recording price movements and / or income changes necessary to implement changes in proxy asset accounts . accordingly , the system includes commlink , block 140 , to a network for proper controlled communication to various institutions and investors involved in the proxy asset . these participants have separate workstations , 150 located at remote locations , but in communication with the system . it is expected that the bank and the price and income index provider ( s ) as well as the brokers handling trades with individuals , and possibly also individuals themselves , will each communicate with the system proprietor . the actual hardware configuration used is not particularly critical , as long as the processing power is adequate in terms of memory , accounts , periods of updating indexed values , the number of proxy assets and their respective cash account formulas and dividend payout formulas , and order execution , redemption and issuance . a network of pcs with a windows nt operating system is expected to give acceptable performance . oracle based database engines allow substantial account coverage and expansion . the controlling logic will invariably use a language and compiler to match that on the cpu 100 . these selections will be set according to per se well known conventions in the software community . an alternative configuration would involve , instead of the 150 workstation linked by windows nt , an internet web site that allows trade directly over the internet . use of the system could still be restricted to brokers , if that is the objective , by suitable password procedures . table 1 below shows an exemplary arrangement of the database for the proxy asset data processor . this table shows the records and fields that will be necessary for proper management under this embodiment . table 1______________________________________database structure______________________________________format : recordsfieldsshareholder information : customer or client i . d . number : name or firm : address : proxy asset or bundle id numbers *: current numbers of shares or bundles owned in each *: transaction id numbers *: transaction information : transaction id number : proxy asset or bundle id number : buyer id number : seller id number : exchange , issuance or redemption : date and time : number of shares or bundles : price per share or bundle : complete set id number : buy and sell orders : order number : customer id number : buy order or sell order : proxy asset id number or bundle id number : if market order : numbers of shares or bundlesif limit order : price and numbers of shares or bundlesif stop order : price and numbers of shares or bundlesorder date and time *: order expiration date and time : e . g . fill order until 1 : 00 pm 1 / 5 / 98pooled cash account information : total investable assets held for cash accounts ( in bank ) ( v . sub . t ): total number of shares outstanding in entire system ( s . sub . t ): average cash account balance per share in system ( v . sub . t / s . sub . t ): complete sets : set number : proxy asset or bundle id numbers in set *: index information : index id number : update frequency : e . g . quarterlydate of last update : market description : e . g . single family homes in metro los angelesprice or income index : e . g . pricedate *: e . g . first quarter 1980index level *: e . g . 100 . 00cash account formula : cash account formula id number : proxy asset type : swap , up or down , etc . : cash account formula : e . g ., a ) for up cash account = index ( index id number ) b ) for down cash account = 2 × v . sub . t / s . sub . t - index ( index idnumber ) c ) for swap cash account = v . sub . t / s . sub . t + 2 × ( a index - bindex )( index id numbers ) dividend payout formula : dividend payout formula id number : proxy asset type : swap , up or down , etc . : dividend payout dates *: dividend payout formula : e . g ., dividend paid per share = 0 . 02 × ( cash account balance ) proxy asset balance change information : proxy asset cash balance change formula id : proxy asset id number : index id number *: cash account formula id number : cash balance change frequency : e . g . quarterlynext cash balance change date : historical cash balance changes : historical cash balance change id numberhistorical cash balance change date *: historical cash balance before change amount *: historical cash balance change amount *: historical cash balance after change amount *: proxy asset definition : proxy asset id number : proxy asset type : swap , up or down : initial cash per share : e . g . $ 100 . 00base date : e . g . january 10 , 1998current number of shares outstanding : e . g . 500 , 000current cash account balance per share : e . g . $ 100dividend frequency : next dividend due : e . g . january 10 , 1998cash account formula id number : dividend payout formula id number : next cash balance change due : e . g . january 10 , 1998cash account number : next interest deposit due : issuance id *: redemption id *: proxy asset bundle definition : proxy asset bundle id : proxy asset id numbers *: number of shares of each proxy asset in bundle *: issuance history : proxy asset or bundle id number : complete set id number : issuance id number : issuance date : number of shares : issuance amount per share : redemption history : proxy asset or bundle id number : complete set id number : redemption id number : redemption date : number of shares : redemption amount per share : ______________________________________ * may be a multiple field there are three primary functions of the logic command instructions . the first is to allow controlled creation of proxy assets , by defining new proxy assets from scratch , by bundling existing proxy assets together , by debundling existing proxy asset bundles , or by doing combinations of the above . the second is to transfer balances among cash accounts so that the cash account formula is satisfied by the balances . the third is to define and allocate dividends on the proxy assets . in each case , the critical controlling data must be stored in the properly configured database . the first of these three functions is important , as success in risk management requires identifying the appropriate risk categories , categories that may be changing all the time . for example , investor demand for proxy assets in real estate may suddenly shift to a small configuration of neighborhoods that might be represented by a combination of zip - code or census - tract real estate price indices . we want to have a system in which the creation of new proxy assets such as these can be done as automatically as possible , by a trained representative of the system proprietor operating the proxy asset data processor , or even , possibly , by broker clients themselves . if the cost of creating new proxy assets is made very low , then we might expect to see many more such proxy assets created . the first function is accomplished in accordance with the logic flow chart depicted in fig4 . logic conceptually begins at start block 200 and continues to block 210 wherein the proxy asset under consideration ast ( i ) is entered by the system user . by ast ( i ) we mean , for the real estate example , a definition of the geographical area , identification of real estate price index , base year , cash account formula , and dividend payout formula . since users will find it difficult to specify these , the system may provide tools , such as maps showing locations of zip codes or census tracts , and some summary statistics about the price indices for each of these . the system first tests whether the entered proxy asset definition ast ( i ) is new and cannot be approximated by existing proxy assets , by an identical proxy asset already defined , by proxy assets with a slightly different base year , by new bundles of existing proxy assets , by components of existing proxy asset bundles , or by combinations thereof . in an initial run , test 220 , the system searches over the existing proxy assets , the possibilities for new proxy asset bundles from existing proxy assets , components of existing proxy asset bundles , and displays the characteristics of the proxy assets that may be thus generated , including information about the cash account balance that would be implied for the proxy asset under consideration . possibly , some combination or division of proxy assets with a slightly different base year may be close enough to the proposed proxy asset . if the user signals that the entered proxy asset is not sufficiently new , if one of the possibilities put forward by the data processor is satisfactory , logic branches to block 230 and the existing records are pulled from the database for the already extant proxy asset or proxy asset bundles , with logic shifted to a separate subroutine . a positive response to test 220 branches logic to block 250 wherein the parameters of the new proxy asset are entered into the system , and the parameters of the remaining elements of the complete set specified . in the case of simple up - down proxy assets , as illustrated in the figure , the complete set can be automatically defined by the system , providing a definition of the proxy asset pair ( ast -- par ( i )), both elements of which must now be created . at this point , it must be decided whether the new proxy asset pair should be defined in terms of a single index or whether the pair should be defined as a proxy asset bundle in terms of a cluster of component indices . if the former , the system branches to block 290 . if the latter , the system branches to block 270 , where the bundle is defined , possibly by entering new indices into the system , and updating the database , block 280 . at test 310 , the system queries about a default cycle for the asset adjustment period . a negative response to this allows custom entry of a controlling cycle , cyc ( i ) setting the time interval between adjustments for the accounts and dividends for the up - down proxy assets . the more common response to test 310 defaults the controlling interval to a system stored value , blocks 320 - 330 . this completes the first portion of the processing with logic shifted to the next sequence , block 350 . creation of the underlying cash accounts and associated computer files and displays forming the foundation for the up - down proxy asset pair is accomplished by the logic control commands shown in fig5 . beginning at start block 1400 , logic first enables the entry of the pending proxy asset pair , ast -- par ( i ) block 1410 . the system checks whether this is a new proxy asset pair at test 1420 . if new , logic continues to block 1440 , wherein the cash account balance per share ast -- bal ( i ) is entered for both elements of the pair . these balances provide the financial backbone of the proxy assets . implementation is made at blocks 1450 - 1460 setting up the two corresponding accounts accta ( i ) and acctb ( i ): operation allows the entry of custom account parameters (&# 34 ; yes &# 34 ; to test 1470 -- and entry at block 1490 ) or entry of pre - selected default values , block 1480 . as previously described , the system includes a communication link between various participants and governing institutions . a book window is created , block 1500 , for traders on the trading system , indicating , initially , the defined cash account balances per share for both proxy assets in the pair , even though no shares yet exist . orders may now be placed by customers , and these will appear on the book window . to create the first proxy asset share , since no shares yet exist , the trading system must first identify a complete set within the orders whose value equals ( or exceeds ) the combined cash account balances per share . thereafter , the system can fill orders both by exchanging existing shares and by finding complete sets among orders . when a complete set is first created , the bank or similar repository of capital in account form , must be notified with wire transfer of funds and automatic structuring of accounts particularized in advance , in response to the order . during routine operation of the proxy asset system , the system proprietor will be directly responsible for rebalancing the accounts ( maintained by the bank in pooled form only ) within complete sets with the changing indices governing the accounts . returning to fig5 after the database is updated with the current ( and new ) ast ( i ) information , logic queries on the next ast value ( i + 1 ) at test 1530 ; if another batch is ready , logic continues to the beginning and the process is repeated for the next in series . day to day operation of the system requires analysis of a variety of time - varying inputs and selective calculation of a number of distinct variables to allow operation of the proxy asset . in fig6 several of these operations and routine procedures are depicted as examples of system processing , recognizing that many other variables are tracked in like fashion . beginning with block 1600 , logic in fig6 first pulls the current date , date ( j ), and enters this into the process , block 1610 . the current proxy asset pair file is recalled , block 1620 read , which includes the current asset balances updated for interest earned by the bank . the periodic date is compared to the present date to determine if the current date is an event date for adjusting the proxy asset accounts . a positive response to test 1630 reflects the match of dates and need to update the accounts ; accordingly logic continues to block 1640 and the system recalls the current index value for the tracked asset , idx ( i , j ). in this context , the counter variable j tracks the cycle -- and thus absolute and relative time periods . continuing with fig6 the system applies the cash account formula to the down proxy asset , block 1650 , making the balance per share equal the combined balances per share in the two accounts before the transfer minus the index , and applies the cash account formula to the up proxy asset , block 1660 , making the balance per share just equal to the index . note that the combined balances of the two accounts is unchanged by this transfer , so the transfer is always feasible , even though the down proxy asset cash account balance may be negative . then the foregoing calculations are applied to calculate the appropriate dividend level per share for each proxy asset pair , using the dividend payout formula . in block 1670 , the system queries whether the balance in the down proxy asset is negative . if no , the system proceeds to blocks 1680 and 1690 , where each account is given a dividend at the rate dr ( i ). if yes , then the system branches to block 1700 , where the up proxy asset is defined a dividend equal to dr ( i ) times the combined values in the two accounts , and block 1710 , where the down proxy asset is given a dividend of 0 . these values are then stored in the main database , db ( x ) at block 1720 , and the entire process repeated for the next proxy asset under management by incrementing index variable i , block 1730 . as previously described , the system includes a communications link between various participants and governing institutions . this includes a bank or similar repository of capital in account form , with wire transfer of funds and automatic structuring of accounts particularized in advance , and individual brokers or even individual investors who might place orders directly with the system . during routine operation of the proxy management system , the bank will be directly responsible for investing the pooled balances of the cash accounts , while the proxy asset system will be responsible for maintaining the cash accounts for the individual proxy assets , thereby in effect dividing up the balance in the bank among proxy asset shareholders . execution of orders , by issuance and redemption or matching and clearing of buy and sell orders , for the proxy assets is accomplished by the logic and control commands detailed in fig7 and 8 . fig7 shows the proxy asset order processor . beginning at start block 400 in fig7 the order entry subroutine is detailed . orders are received at block 410 from investors or brokers via workstations 150 ( fig3 ) or internet link . orders may consist of market orders ( to buy or sell a specific number of a specific proxy asset at any price ) or limit orders ( to buy a specific number of proxy assets at or below a certain price , or to sell a specific number of proxy assets at or above a certain price , bids and offers , hits and takes ), or possibly other kinds of orders . these buy and sell orders are stored , at block 420 , in a pending order list for each proxy asset in what is essentially equivalent to a book window in the trading system . they may be arranged , in effect , in the book window with the highest bid at the top of one column , and the highest offer at the top of another column , with prices in descending value below these . with reference to fig8 the proxy asset trading , issuance and redemption system begins at block 500 . in a subroutine beginning at block 510 , the pending order lists corresponding to each proxy asset are individually accessed and searched . at block 520 , if a buy order for a proxy asset is matched with an identical sell order for that proxy asset , those shares are traded at block 530 without the issuance or redemption of any additional shares , those orders removed from the pending order list and processing returns to block 520 to search for additional matching orders . when no additional matches are present in the pending order list for the current proxy asset , the no path from block 520 is followed and processing loops , asset in the system . when all matching orders in the system have been processed , logic extends to block 550 , whereupon the buy orders for all proxy assets in the system are together searched for a complete set or closed path . as discussed in example i , a complete set is just an up - down pair . in example ii above , closed paths may consist of reciprocal swap proxy assets ( e . g ., ij and ji ) or a more complicated set , such as an ij swap , a jk swap , and a ki swap ( or any other path beginning and ending on the same asset ). the combination of the proxy assets in the path have a total value as discussed in example ii . the sum of the buy orders in the path must equal or exceed this value . if so , test block 560 branches to a processing routine , beginning at block 570 , for issuing new shares of these proxy assets , updating the cash accounts of the respective proxy assets in the proportion to amounts already there , then deletes these buy orders from the pending order list , before returning to loop 550 to search for additional closed paths . alternately , if the sum of the buy orders in the identified path do not meet the total value of the path , the path identified in block 550 is rejected at test 560 and different path combinations are searched . when no additional complete sets ( closed paths ) are located in subroutine 550 , processing continues to a subroutine beginning at block 600 , searching for closed paths of sell orders in the pending order lists of all proxy assets in the system . the sum of the sell orders is compared to the total value of the proxy assets in the identified path at block 610 . if greater , the orders are executed beginning with block 620 by redeeming existing shares of these proxy assets , updating the cash accounts to reflect the redeemed proxy assets and deleting the sell orders from the pending order list . processing then continues to exhaust all possible closed paths . when all closed paths are identified , the subroutine ends at block 630 , or alternately , the abilities of one skilled in the art of programming may allow the system proprietor to implement the subroutines instead beginning at blocks 510 , 550 and 600 as separate , and / or concurrent subroutines . the execution of the buy and sell orders may also be connected to procedures whereby trade is suspended in unusual market situations , akin to the circuit breakers of organized exchanges . the execution of the buy and sell orders may be limited to certain classes of customers , such as registered broker dealers . the execution of the buy and sell orders may also be connected to a market surveillance system , like those at existing exchanges , to check for attempts at market manipulation or other illegal trading practices . fig9 is a relational block diagram depicting the proxy asset bundle manager . in this diagram , four proxy assets , proxy assets a , b , c , and d are shown for illustration . in this example , only proxy asset d is sold directly to the public . proxy assets a , b , and c are bundled together as shown , and the bundle is sold to the public . since the cash accounts for proxy assets a , b , and c are already in place , and their cash account formulas and dividend payout formulas already defined , people will have some idea of the effects of taking this proxy asset bundle apart at a later date . knowing that the proxy asset bundle is decomposable later may facilitate its marketing to the public today . table 2 below shows an outline of the functions of the proxy asset data processor . the table gives an outline of the basic steps that this data processor must handle , on a continuing or daily basis , and the steps that are undertaken only on a less frequent basis . table 2______________________________________functions of proxy asset data processor______________________________________1 . functions ordered by system proprietoradd index data ( run manually ) load new index into index record databasefill in other fields of index recordupdate interest payment ( run daily ) for each proxy asset : is interest deposit due today ? if yes : adjust current cash balance with interest paymentfill in next interest deposit duepay dividends ( run daily ) for each proxy asset : interest deposit run for today ? if yes : dividend payment due today ? if yes : use dividend payout formula to calculate dividendpay dividend , adjust current cash account balancefill in next dividend payment dueupdate indices ( run daily ) for each indexdate for an index update ? if yes : receive index update into index recordupdate cash account balances using cash account formulas ( run daily ) index , interest and dividend update performed already for today ? if yesfor each proxy asset : look up cash balance change formula and necessary indicescalculate cash account balances changeis transfer between accounts due today ? if yes : make transfers among cash accounts according tocash account formuladefine new swap proxy asset ( run manually ) select the two indices to be used , rescale to 100 on base dateselect formula typefill in base date and initial cash per sharefill in cash account formulafill in dividend payout formulamake list of all complete setsdefine new up / down proxy asset pair ( run manually ) select the index to be used , rescale to 100 on base dateselect formula typefor both up and down proxy asset : fill in base date and initial cash per share ( same for both ) fill in cash account formulafill in dividend payout formulamake list of all complete sets2 . functions ordered by brokersprocess buy or sell orders ( run when an order comes in )( if for a bundle , treat each proxy asset in bundle as shown below ) receive transaction request and enter into databasedisplay order on screen with other unfilled ordersdisplay historical values of indicesdisplay cash account balancessearch for combinations of non - expired buy and sell orders of sameproxy asset identify matches in limit orders and numbers of sharesif found , execute orders through exchange of existing sharesif none found , combine order with other orders of same type ( e . g . buys forsame proxy asset ) if a bid for proxy assetsearch for complete set among bidsif total bid prices in set ≧ total cash account balancesthen : issue new shares create transaction records create complete set record fill in issuance records create investor records fill in historical cash balance changes record update number of shares and current cash balance in proxy asset recordif an offer to sell a proxy assetsearch for complete sets among offersif total offer prices in set ≦ total cash account balancesthen : redeem existing sharescreate transaction recordscreate complete set recordfill in redemption recordsupdate investor recordsfill historical cash balance changes recordupdate number of shares and current cash balance in proxy asset recordprovide information for electronic trading systemorder processing and confirmationprovide information for book window for trading screenprovide responses to requests for alerts - e . g ., alert traderswhen a specified price level has been reached either bya trade in subject proxy asset or by trades in otherproxy assets within the same complete set3 . functions ordered by investors ( informational web site ): view indicesview outstanding limit orders ( book window ) view composition of bundlesview proxy assetbase dateindices usedcash account balance per sharestarting cash account balance per sharecash account balance change historydividend payment historycash account formuladividend payout formula______________________________________ although the invention has been described in detail for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention . indeed , some variations may need to be made to satisfy requirements of regulators , tax authorities , existing exchanges , brokers and underwriters , requirements that may vary through time and across countries .
| 6 |
a description will be given below of embodiments in accordance with the present invention with reference to the accompanying drawings . fig1 , 2 and 3 show one example of a welding method in accordance with the present invention , and show a case of applying a friction stir welding method to a lap joint . fig1 shows a material 1 and a material 2 corresponding to a weld material . a cavity portion 3 and a cavity portion 4 respectively having semicircular cross sectional shapes are formed in the material 1 and the material 2 . a cavity portion having a circular cross sectional shape is formed at a time of lapping the material 1 and the material 2 , thereby forming an embedded member 5 having an approximately equal cross sectional shape to the cavity portion . the material 1 and the material 2 corresponding to two weld materials having the cavity portions of the semicircular cross sectional shape are lapped via the embedded member 5 . both of the material 1 and the material 2 are made of an aluminum alloy . an applied material is essentially constituted by a material which can be friction stir welded . for example , metals such as a magnesium alloy , a copper alloy , a steel material and the like correspond thereto . both of thicknesses of the material 1 and the material 2 are 10 mm . a thickness of the applied material is determined on the basis of an applied material , a friction stir welding apparatus and a capacity of a rotating tool , however , in the case of the aluminum alloy , it is possible to apply to the thickness between about 0 . 5 mm and 100 mm . fig2 is a conceptual view of a state in which the material 1 , the material 2 and the embedded member 5 are set in such a manner as to be welded . the cavity portion 3 and the cavity portion 4 are lapped in such a manner that end portions thereof are aligned , and a cavity portion having a circular cross sectional shape is provided . the embedded member 5 is set to the cavity portion 7 . the cross sectional shape of the embedded member 5 is approximately equal to that of the cavity portion 7 . a radius of the cavity portion 7 formed by the cavity portion 3 and the cavity portion 4 having the semicircular cross sectional shape is about one half of the thickness of the material 1 . in other words , in order to form the weld portion having an excellent fatigue property , it is necessary to set a member having a larger radius of curvature than the unwelded portion formed near the weld portion . accordingly , the radius of the cavity portion 7 is larger than a gap of the lap surface formed by the material 1 and the material 2 , and is limited to one half of the thickness of the material 1 . the embedded member 5 is made of a steel material , and is harder than the material 1 and the material 2 . in order to form the weld portion which is excellent in the fatigue property , the cross sectional shape of the cavity portion 7 and the embedded member 5 is not limited to the circular shape , but may be changed as far as a cross sectional shape has a large radius of curvature . for example , an oval shape or the like corresponds thereto . further , fig2 shows a positional relation among the rotating tool 6 , a weld line and a weld surface . the rotating tool 6 is inserted from a direction which is in parallel to the weld surface 8 and is perpendicular to the weld surface 9 . an end surface 11 close to the embedded member 5 in a probe 10 existing in an end portion of the rotating tool 6 is inserted in such a manner as to be approximately in contact with the embedded member 5 , and a distance between the end surface 11 and the embedded member 5 at a time of inserting the rotating tool 6 is set to about 0 . 5 mm . fig3 shows a conceptual view of a state in which the rotating tool 6 is inserted to the weld surface 8 and the weld surface 9 , and the material 1 and the material 2 are welded along the weld line 12 . the rotating tool 6 is rotated in a clockwise direction as seen from the above of the rotating tool 6 . the weld makes progress toward a far side from a near side of the material . as shown in fig3 , a stir zone 13 stirred by the rotating tool 6 is formed in the weld portion in such a manner as to be in contact with the embedded member 5 . in accordance with the structure mentioned above , the unwelded portion is not formed between the stir zone 13 and the embedded member 5 . fig4 shows a cross section to which the friction stir welding is applied by forming only the cavity portion without using the embedded member 5 . a positional relation between a material 14 and a material 15 is shown by a dotted line 16 . a cavity portion obtained by lapping the semicircular cross sectional shape is provided on a surface in which the material 14 and the material 15 are brought into contact with each other . a shape of the cavity portion before the friction stir welding is applied thereto has a circular cross sectional shape as described by a dotted line 17 . a shape of the rotating tool 18 is structured such that a diameter of a shoulder portion is 10 mm , a diameter of a probe 20 is 4 mm , and a length of the probe 20 is 10 mm . a description will be given of a positional relation between the rotating tool 18 and the cavity portion 17 by using fig4 . when the rotating tool 18 is inserted to the material 14 and the material 15 , a distance between an end surface 21 of the probe 20 close to the cavity portion and the cavity portion 17 is 0 . 2 mm . a rotating speed of the rotating tool 18 is set to 1000 rotation / min , and a welding speed is set to 100 mm / min . as is understood from fig4 , a shape of the cavity portion 17 after the friction stir welding is applied thereto is largely deformed , and loses the circular shape . this is because about some hundreds kg to about one ton load is applied to the weld portion by inserting and traveling the rotating tool 18 at a time of the friction stir welding , whereby the material exposed to the load of the material 14 and the material 15 flows into the cavity portion in case that a backing metal supporting the load does not exist . as mentioned above , the shape of the cavity portion provided for improving the fatigue property of the weld portion collapses . in other words , since the surface having the large radius of curvature does not exist near the weld portion , and the unwelded portion is formed in the weld surface 23 , the stress concentration to the weld portion becomes higher and the fatigue property is deteriorated , in the case that the stress is applied in the perpendicular direction to the weld surface 23 . on the contrary , fig5 shows a cross section photograph in the case that the friction stir welding is applied by using the embedded member . the positional relation between the rotating tool 18 and an embedded member 24 after the end of the welding is shown in fig5 . a welding condition is approximately equal to that shown in fig4 . there can be observed that the unwelded defect does not appear between the rotating tool 18 and the embedded member 24 , and a complete weld is achieved . even in the case that the stress is applied to the weld portion , the unwelded portion is not formed , and the surface to which the stress is applied exhibits the large curvature , so that it is possible to avoid the stress concentration . as mentioned above , it is possible to improve the fatigue property of the weld portion by setting the embedded member in the cavity portion having the circular cross section so as to weld . fig6 shows a conceptual view of a case that the welding method is applied to the weld structure . the weld structure is constituted by a pressure container , and is structured such that a material 25 corresponding to a container and a material 26 corresponding to a lid are lapped over such that end portions are aligned with each other . a circular cavity portion 28 is provided in a surface 27 in which the material 25 and the material 26 are in contact with each other . a member 29 having an approximately equal cross sectional shape is embedded in the cavity portion 28 . the material 25 and the material 26 are welded in accordance with a friction stir welding method by using a rotating tool 30 . a positional relation between the rotating tool 30 and the weld surface and a positional relation between the rotating tool 30 and the embedded member 29 is the same as those of fig1 , 2 and 3 . the unwelded portion is not formed between a stir zone 31 formed thereby and the embedded member 29 even by applying the friction stir welding , and a surface having a large curvature is obtained . a space 32 is formed in an inner side thereof by welding the material 25 and the material 26 . in the case that a repeated stress is applied to a direction perpendicular to the surface 27 by the space 32 , the unwelded portion is not formed , so that it is possible to form a weld portion which is excellent in a fatigue strength . the weld mentioned above can be applied to a weld structure to which the repeated stress is applied , for example , a cooling apparatus having a water channel , a pressure container or the like . fig7 , 8 and 9 show a welding method in accordance with the other embodiment of the present invention . the present embodiment corresponds to a case that the present invention is applied to a lap joint , however , shapes of a material 33 and a material 34 are different from the material 1 and the material 2 of the embodiment 1 . fig7 shows a positional relation among the material 33 and the material 34 , a cavity portion 38 having a semicircular cross sectional shape and a cavity portion 39 having a semicircular cross sectional shape , and an embedded member 40 having a circular cross sectional shape . the cavity portion 38 and the cavity portion 39 are provided on a surface in which the material 33 and the material 34 are brought into contact with each other , that is , a butt weld surface 35 and a butt weld surface 36 . both of the material 33 and the material 34 are made of an aluminum alloy . the embedded member 40 is made of a harder material than the material 33 and the material 34 , and is made of a steel material . thicknesses of the material 33 and the material 34 are the same as those shown in the embodiment 1 . fig8 is a conceptual view showing a state in which the material 33 , the material 34 , the cavity portion 38 , the cavity portion 39 and the embedded member 40 are set in such a manner as to be welded . fig8 shows a positional relation among the butt weld surface 35 , the butt weld surface 36 and a rotating tool 37 . the rotating tool 37 is inserted from a direction perpendicular to the butt weld surface 35 and the butt weld surface 36 . a cavity portion 41 having a circular cross sectional shape is provided by lapping the cavity portion 38 and the cavity portion 39 in such a manner that end portions thereof are aligned with each other . the embedded member 40 is set to the cavity portion 41 . a cross sectional shape of the embedded member 40 is approximately equal to the cavity portion 41 . a radius of the cavity portion 41 formed by the cavity portion 38 having the semicircular cross sectional shape and the cavity portion 39 having the semicircular cross sectional shape is approximately one half of a thickness of the material 33 , and is set to the same as described in the embodiment 1 . a positional relation between an end surface 43 of the embedded member 40 side in the probe 42 at a time of inserting the rotating tool 37 and the embedded member 40 is the same as described in the embodiment 1 . fig9 shows a conceptual view of a state in which the material 33 and the material 34 are welded by inserting the rotating tool 37 to the butt weld surface 35 and the butt weld surface 36 from a direction of the material 33 while keeping the positional relation between the end surface 43 and the embedded member 40 . the rotating tool 37 is rotated in a clockwise direction as seen from the above of the rotating tool 37 . a frictional stir welding makes progress toward a far side from a near side of the drawing . as shown in fig9 , a stir zone 44 stirred by the rotating tool 37 is formed in the weld portion in such a manner as to be in contact with the embedded member 40 , and an unwelded portion is not formed between the stir zone and the embedded member 40 . as a result , it is possible to improve a fatigue characteristic of the weld portion . fig1 , 11 and 12 show the other embodiment in accordance with the present invention . the embodiment corresponds to a case that the frictional stir welding is applied to a butt joint . fig1 shows a positional relation among a material 45 and a material 46 , a cavity portion 47 having a semicircular cross sectional shape and a cavity portion 48 having a semicircular cross sectional shape , and an embedded member 49 having a circular cross sectional shape . the cavity portion 47 and the cavity portion 48 are provided on a surface in which the material 45 and the material 46 are brought into contact with each other . both of the material 45 and the material 46 are made of an aluminum alloy . an applied material is the same as described in the embodiment 1 . thicknesses of the material 45 and the material 46 are both set to 10 mm . fig1 is a conceptual view showing a state in which the material 45 , the material 46 , the cavity portion 47 , the cavity portion 48 and the embedded member 49 are set in such a manner as to be welded . a cavity portion 50 having a circular cross sectional shape is provided by lapping the cavity portion 47 and the cavity portion 48 in such a manner that end portions thereof are aligned with each other . a cross sectional shape of the embedded member 49 is approximately equal to the cavity portion 50 . a radius of the cavity portion 50 formed by the cavity portion 47 and the cavity portion 48 is approximately one half of a thickness of the material 45 and the material 46 . fig1 shows a positional relation between a rotating tool 51 and a weld line . the rotating tool 51 is inserted from a direction perpendicular to a butt weld line 53 . a lower end surface 55 in a probe 54 existing in an end portion of the rotating tool 51 is inserted to a position which is approximately in contact with the embedded member 49 , and a distance between the end surface 55 and the embedded member 49 at a time of inserting the rotating tool 51 is set to about 0 . 1 mm . fig1 shows a conceptual view of a state in which the material 45 and the material 46 are welded by inserting the rotating tool 51 along the weld line 53 . the rotating tool 51 is rotated in a clockwise direction as seen from the above of the rotating tool 51 . a welding makes progress toward a far side from a near side of the drawing . as shown in fig1 , a stir zone 56 stirred by the rotating tool 51 is formed in the weld portion in such a manner as to be in contact with the embedded member 49 . in accordance with the structure mentioned above , an unwelded portion is not formed between the stir zone 56 and the embedded member 49 . a load from about some hundreds of kg to about one ton is applied to the weld portion by inserting and traveling the rotating tool 51 at a time of the friction stir welding , however , since the embedded member 49 supporting the load is provided , the curvature is not changed , and the unwelded portion is not formed , so that it is possible to support the load . in the case that a repeated stress is applied in a perpendicular direction to the weld surface , the unwelded portion is not formed . accordingly , it is possible to form the weld portion which is excellent in a fatigue strength . in accordance with these embodiments , since the unwelded portion is not formed near the cavity portion , the notch effect is reduced , and it is possible to form the weld member which is excellent in the fatigue property . the present invention relates to the friction stir welding method of welding in a state in which the cavity portion is provided in the weld surface , and the embedded member is formed in the cavity portion , in the case of applying the friction stir welding . it should be further understood by those skilled in the art that although the foregoing description has been made on embodiments of the invention , the invention is not limited thereto and various changes and modifications may be made without departing from the spirit of the invention and the scope of the appended claims .
| 1 |
the following definitions are used , unless otherwise described : halo is fluoro , chloro , bromo , or iodo . alkyl , alkoxy , alkenyl , alkynyl , etc . denote both straight and branched groups ; but reference to an individual group such as “ propyl ” embraces only the straight chain variant , a branched chain isomer such as “ isopropyl ” being specifically referred to . bicyclic aryl denotes an ortho - fused bicyclic carbocyclic substituent having about nine to ten ring atoms in which at least one ring is aromatic . monocyclic heteroaryl encompasses a substituent attached via a ring carbon of a monocyclic aromatic ring containing five or six ring atoms consisting of carbon and one to four heteroatoms each selected from the group consisting of non - peroxide oxygen , sulfur , and n ( x ) wherein x is absent or is h , o , ( c 1 – c 4 ) alkyl , phenyl or benzyl . bicyclic heteroaryl encompasses a substituent of an ortho - fused bicyclic heterocycle of about eight to ten ring atoms derived therefrom , particularly a benzyl - derivative or one derived by fusing a propylene , trimethylene , or tetramethylene divalent substituent thereto . bicyclic alkyl encompasses a substituent of an ortho - fused bicyclic alkyl of about eight to ten ring atoms containing five or six ring atoms consisting of carbon and one to four ring atoms consisting of heteroatoms selected from the group consisting of non - peroxide oxygen , sulfur , and n ( x ) wherein x is absent or is h , o , ( c 1 – c 4 ) alkyl , phenyl or benzyl . it will be appreciated by those skilled in the art that compounds of the invention having a chiral center may exist in and be isolated in optically active and racemic forms . some compounds may exhibit polymorphism . it is to be understood that the present invention encompasses any racemic , optically - active , polymorphic , or stereoisomeric form , or mixtures thereof , of a compound of the invention , which possess the useful properties described herein , it being well known in the art how to prepare optically active forms ( for example , by resolution of the racemic form by recrystallization techniques , by synthesis from optically - active starting materials , by chiral synthesis , or by chromatographic separation using a chiral stationary phase ) and how to determine mmp inhibition activity using the standard tests described hereinbelow , or using other similar tests which are well known in the art . as used herein , “ ovulation ” is the release of an ovum from the ovarian follicle . stedman &# 39 ; s medical dictionary , 25th ed ., illustrated , williams & amp ; wilkins , baltimore , 1990 , p . 1116 . as used herein , “ ovum ” is the female sex ( reproductive ) cell . when fertilized by a spermatozoon , an ovum is capable of developing into a new individual of the same species . stedman &# 39 ; s medical dictionary , 25th ed ., illustrated , williams & amp ; wilkins , baltimore , 1990 , p . 1116 . as used herein , “ fertilization ” is the process beginning with penetration of the secondary oocyte by the spermatozoon and completed by infusion of the male and female pronuclei . stedman &# 39 ; s medical dictionary , 25th ed ., illustrated , williams & amp ; wilkins , baltimore , 1990 , p . 573 . as used herein , a “ uterus ” is the womb , metra , or the hollow muscular organ in which the impregnated ovum is developed into the child . stedman &# 39 ; s medical dictionary , 25th ed ., illustrated , williams & amp ; wilkins , baltimore , 1990 , pp . 1677 – 1678 . specific and preferred values listed below for substituents ( i . e ., groups ) and ranges are for illustration only ; they do not exclude other defined values or other values within defined ranges for the substituents specifically , ( c 1 – c 6 ) alkyl can be methyl , ethyl , propyl , isopropyl , butyl , iso - butyl , sec - butyl , pentyl , 3 - pentyl , or hexyl ; ( c 1 – c 6 ) alkoxy can be methoxy , ethoxy , propoxy , isopropoxy , butoxy , iso - butoxy , sec - butoxy , pentoxy , 3 - pentoxy , or hexyloxy ; ( c 2 – c 6 ) alkenyl can be vinyl , allyl , 1 - propenyl , 2 - propenyl , 1 - butenyl , 2 - butenyl , 3 - butenyl , 1 - pentenyl , 2 - pentenyl , 3 - pentenyl , 4 - pentenyl , 1 - hexenyl , 2 - hexenyl , 3 - hexenyl , 4 - hexenyl , or 5 - hexenyl ; ( c 2 – c 6 ) alkynyl can be ethynyl , 1 - propynyl , 2 - propynyl , 1 - butynyl , 2 - butynyl , 3 - butynyl , 1 - pentynyl , 2 - pentynyl , 3 - pentynyl , 4 - pentynyl , 1 - hexynyl , 2 - hexynyl , 3 - hexynyl , 4 - hexynyl , or 5 - hexynyl ; ( c 1 – c 6 ) alkanoyl can be acetyl , propanoyl or butanoyl ; ( c 2 – c 6 ) alkanoyloxy can be acetoxy , propanoyloxy , butanoyloxy , isobutanoyloxy , pentanoyloxy , or hexanoyloxy ; ( c 3 – c 8 ) cycloalkyl can be cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , or cyclooctyl ; aryl can be phenyl , indenyl , 5 , 6 , 7 , 8 - tetrahydronaphthyl , or naphthyl and heteroaryl can be furyl , imidazolyl , tetrazolyl , pyridyl , ( or its n - oxide ), thienyl , pyrimidinyl ( or its n - oxide ), indolyl , or quinolyl ( or its n - oxide ); bicyclic aryl can be indenyl or naphthyl ; monocyclic heteroaryl can be furyl , imidazolyl , triazolyl , triazinyl , oxazoyl , isoxazoyl , thiazolyl , isothiazoyl , pyrazolyl , pyrrolyl , pyrazinyl , tetrazolyl , pyridyl ( or its n - oxide ), thienyl , or pyrimidinyl ( or its n - oxide ), bicyclic heteroaryl can be quinolyl ( or its n - oxide ); and bicyclic alkyl can be decahydroquinoline or decahydronaphthalene ( cis and trans ). as used herein , an “ amino acid ” is a natural amino acid residue ( e . g . ala , arg , asn , asp , cys , glu , gln , gly , his , hyl , hyp , ile , leu , lys , met , phe , pro , ser , thr , trp , tyr , and val ) in d or l form , as well as unnatural amino acid ( e . g . phosphoserine ; phosphothreonine ; phosphotyrosine ; hydroxyproline ; gamma - carboxyglutamate ; hippuric acid ; octahydroindole - 2 - carboxylic acid ; statine ; 1 , 2 , 3 , 4 ,- tetrahydroisoquinoline - 3 - carboxylic acid ; penicillamine ; ornithine ; citruline ; a - methyl - alanine ; para - benzoylphenylalanine ; phenylglycine ; propargylglycine ; sarcosine ; and tert - butylglycine ) residue having one or more open valences . the term also comprises natural and unnatural amino acids bearing amino protecting groups ( e . g . acetyl , acyl , trifluoroacetyl , or benzyloxycarbonyl ), as well as natural and unnatural amino acids protected at carboxy with protecting groups ( e . g . as a ( c 1 – c 6 ) alkyl , phenyl or benzyl ester or amide ). other suitable amino and carboxy protecting groups are known to those skilled in the art ( see for example , t . w . greene , protecting groups in organic synthesis ; wiley : new york , 1981 ; d . voet , biochemistry , wiley : new york , 1990 ; l . stryer , biochemistry , ( 3rd ed . ), w . h . freeman and co . : new york , 1975 ; j . march , advanced organic chemistry , reactions , mechanisms and structure , ( 2nd ed . ), mcgraw hill : new york , 1977 ; f . carey and r . sundberg , advanced organic chemistry , part b : reactions and synthesis , ( 2nd ed . ), plenum : new york , 1977 ; and references cited therein ). according to the invention , the amino or carboxy protecting group can also comprise a radionuclide ( e . g ., fluorine - 18 , iodine - 123 , or iodine - 124 ). as used herein , an “ electrophile ” refers to a chemical species , ion , or a portion of a compound which , in the course of a chemical reaction , will acquire electrons , or share electrons , to form other molecules or ions . electrophiles are ordinarily thought of as cationic species ( positively charged ). mcgraw - hill concise encyclopedia of science & amp ; technology , mcgraw - hill , p . 715 , 4 th edition , new york , n . y . ( 1998 ). as used herein , a “ nucleophile ” refers to a chemical species , ion , or a portion of a compound which , in the course of a chemical reaction , will lose electrons , or share electrons , to form other molecules or ions . nucleophiles are ordinarily thought of as anionic species ( negatively charged ). typical nucleoplic species include , e . g ., hydroxyl ( oh ), halo ( f , cl , br , or i ), cyano ( cn ), alkoxy ( ch 3 ch 2 o ), carboxyl ( coo ), and thio ( s ). mcgraw - hill concise encyclopedia of science & amp ; technology , mcgraw - hill , p . 715 , 4 th edition , new york , n . y . ( 1998 ). as used herein , a “ peptide ” is a sequence of 2 to 25 amino acids ( e . g . as defined hereinabove ) or peptidic residues having one or more open valences . the sequence may be linear or cyclic . for example , a cyclic peptide can be prepared or may result from the formation of disulfide bridges between two cysteine residues in a sequence . a peptide can be linked through the carboxy terminus , the amino terminus , or through any other convenient point of attachment , such as , for example , through the sulfur of a cysteine . peptide derivatives can be prepared as disclosed in u . s . pat . nos . 4 , 612 , 302 ; 4 , 853 , 371 ; and 4 , 684 , 620 . peptide sequences specifically recited herein are written with the amino terminus on the left and the carboxy terminus on the right . as used herein , a “ hydrophobic group ” or “ hydrophobic moiety ” refers to a group that is relatively non - polar and will have a relatively minimal affinity for water . the nature of the hydrophobic group ( i . e ., a — x — m ) is not important , provided the hydrophobic group fits into the pocket and has a favorable interaction ( e . g ., binding ) with the enzyme . the hydrophobic group , while being relatively hydrophobic , can include one or more heteroatoms ( e . g ., s , o , or n ) that can have an electrostatic charge or can include one or more groups ( e . g ., esters or amides ) that can have an electrostatic charge , provided the hydrophobic group fits into the pocket and has a favorable interaction with the enzyme . any suitable hydrophobic group can be employed as a — x — m , provided the hydrophobic group fits into the pocket and has a favorable interaction ( e . g ., binding ) with the enzyme . for example , the hydrophobic group can include a straight - chained or branched hydrocarbon chain ( e . g ., alkyl , alkenyl , or alkynyl ), an aryl group ( e . g ., monocyclic or bicylic ), a heteroaryl group ( e . g ., monocyclic or bicylic ), a cycloalkyl group , an amino acid , a peptide , or a combination thereof . in one embodiment , a — x — m can be a saturated or partially unsaturated hydrocarbon chain comprising one or more carbon atoms and optionally comprising one or more oxy (— o —), thio (— s —), sulfinyl (— so —), sulfonyl ( s ( o ) 2 —), or nr f in the chain , wherein each r f is independently hydrogen or ( c 1 – c 6 ) alkyl . the saturated or partially unsaturated hydrocarbon chain can optionally be substituted with one or more oxo (═ o ), hydroxy , cyano , halo , nitro , trifluoromethyl , trifluoromethoxy , ( c 1 – c 6 ) alkyl , ( c 1 – c 6 ) alkoxy , ( c 1 – c 6 ) alkoxy ( c 1 – c 6 ) alkyl , ( c 3 – c 6 ) alkyl , c 3 – c 8 ) cycloalkyl , aryl , heteroaryl , ( c 3 – c 8 ) cycloalkyl ( c 1 – c 6 ) alkyl , ( aryl )( c 1 – c 8 ) alkyl , ( heteroaryl )( c 1 – c 6 ) alkyl , ( c 3 – c 8 ) cycloalkyl oxy , ( aryl ) oxy , ( heteroaryl ) oxy , ( c 3 – c 8 ) cycloalkyl , ( aryl ) oxy ( aryl ), ( heteroaryl ) oxy ( heteroaryl ), ( c 3 – c 8 ) cycloalkyl oxy ( c 1 – c 6 ) alkyl , ( aryl ) oxy ( c 1 – c 6 ) alkyl , or ( heteroaryl ) oxy ( c 1 – c 6 ) alkyl . in addition , any aryl , ( c 3 – c 8 ) cycloalkyl , or heteroaryl can optionally be substituted with one or more oxo (═ o ), hydroxy , cyano , halo , nitro , trifluoromethyl , trifluoromethoxy , ( c 1 – c 6 ) alkyl , ( c 1 – c 6 ) alkoxy , ( c 1 – c 6 ) alkoxy ( c 1 – c 6 ) alkyl , ( c 3 – c 8 ) cycloalkyl , aryl , heteroaryl , ( c 3 – c 8 ) cycloalkyl ( c 1 – c 6 ) alkyl , ( aryl )( c 1 – c 8 ) alkyl , ( heteroaryl )( c 1 – c 6 ) alkyl , ( c 3 – c 8 ) cycloalkyl oxy , ( aryl ) oxy , ( heteroaryl ) oxy , ( c 3 – c 8 ) cycloalkyl , ( aryl ) oxy ( aryl ), ( heteroaryl ) oxy ( heteroaryl ), ( c 3 – c 8 ) cycloalkyl oxy ( c 1 – c 6 ) alkyl , ( aryl ) oxy ( c 1 – c 6 ) alkyl , or ( heteroaryl ) oxy ( c 1 – c 6 ) alkyl . when a — x — m is a “ partially unsaturated ” group , such group may comprise one or more ( e . g . 1 or 2 ) carbon - carbon double or triple bonds . for example , when a — x — m is a partially unsaturated ( c 1 – c 6 ) alkyl , it can be vinyl , allyl , 1 - propenyl , 2 - propenyl , 1 - butenyl , 2 - butenyl , 3 - butenyl , 1 , 3 - butadienyl , 1 - pentenyl , 2 - pentenyl , 3 - pentenyl , 4 - pentenyl , 1 - hexenyl , 2 - hexenyl , 3 - hexenyl , 4 - hexenyl , 2 , 4 - hexadienyl , 5 - hexenyl , ethynyl , 1 - propynyl , 2 - propynyl , 1 - butynyl , 2 - butynyl , 3 - butynyl , 1 - pentynyl , 2 - pentynyl , 3 - pentynyl , 4 - pentynyl , 5 - hexene - 1 - ynyl , 2 - hexynyl , 3 - hexynyl , 3 - hexen - 5 - ynyl , 4 - hexynyl , or 5 - hexynyl . a specific value for a — x — m is a and m are each independently phenyl or monocyclic heteroaryl , wherein any phenyl or heteroaryl is optionally substituted with one or more ( e . g ., 1 , 2 , 3 , or 4 ) hydroxy , ( c 1 – 6 ) alkyl , ( c 1 – c 6 ) alkanoyl , ( c 1 – c 6 ) alkanoyloxy , ( c 1 – c 6 ) alkoxy , cyano , nitro , halo , trifluoromethyl , trifluoromethoxy , sr , nrr , or coor ; and x is o , s , so , so 2 , c (═ o ) nr , c (═ o ) o , nrc (═ o ), oc (═ o ), nr , a direct bond , or ( c 1 – c 6 ) alkyl optionally substituted with one or more hydroxy , ( c 1 – c 6 ) alkoxy , cyano , nitro , halo , sr , nrr , or coor . another specific value for a — x — m is bicyclic aryl ( e . g ., naphthyl ), bicyclic heteroaryl , or bicyclic alkyl ; wherein any aryl , heteroaryl or alkyl is optionally substituted with one or more ( e . g ., 1 , 2 , 3 , or 4 ) hydroxy , ( c 1 – c 6 ) alkyl , ( c 1 – c 6 ) alkanoyl , ( c 1 – c 6 ) alkanoyloxy , ( c 1 – c 6 ) alkoxy , cyano , nitro , halo , trifluoromethyl , trifluoromethoxy , sr , nrr , or coor ; wherein each r is independently h , ( c 1 – c 6 ) alkyl , phenyl , benzyl , or phenethyl . a specific value for a is phenyl or monocyclic heteroaryl . another specific value for a is phenyl . a specific value for m is phenyl or monocyclic heteroaryl . another specific value for m is phenyl . a specific value for x is o , s , so , so 2 , c (═ o ) nr , c (═ o ) o , nrc (═ o ), oc (═ o ), nr , a direct bond , or ( c 1 – c 6 ) alkyl . another specific value for x is o . x ′ is o , ( c 1 – c 6 ) alkyl ( e . g ., ch 2 ), or a direct bond ; y ′ is n or ( c 1 – c 6 ) alkyl ( e . g ., ch 2 ); and z ′ is halo , ( c 1 – c 6 ) alkoxy ( e . g ., och 3 ), or hydroxy . z ′ is halo , ( c 1 – c 6 ) alkoxy ( e . g ., och 3 ), or hydroxy . z ′ is halo , ( c 1 – c 6 ) alkoxy ( e . g ., och 3 ), or hydroxy . r ′ is o , ( c 1 – c 6 ) alkyl ( e . g ., ch 2 ), or s ; and a specific value for e is ( c 1 – c 6 ) alkyl . another specific value for e is methyl . a specific value for ( c 1 – c 6 ) alkyl is methyl . a specific compound of the present invention is a compound of formula ( i ) wherein a is phenyl , m is phenyl , x is o , d is so 2 , e is methyl , j is s , g is hydrogen , t is hydrogen , and q is hydrogen . fig2 illustrates a synthesis for compounds 1 - 4 . 4 - phenoxythiophenol 10 was prepared from the commercially available 4 - phenoxyphenol 7 via the 3 step procedure illustrated by newman and karnes . newman m . s . ; karnes h . a . j . org . chem ., 1996 , 31 , 3980 – 3984 . subsequent alkylation of 10 with allyl bromide , 4 - bromo - 1 - butene and 5 - bromo - 1 - pentene respectively , led to the sulfanyl compounds 11 – 13 in good yield . although the epoxidation of 12 and 13 with mcpba was relatively quick , taking only 2 – 3 days , the formation of 11 took 7 days and required a large excess of mcpba . finally , the conversion of the epoxides 4 – 6 to their corresponding thiirane derivatives 1 – 3 , was accomplished via the treatment of each epoxide with ammoniumthiocyanate in thf / water . although the thiiranes 2 and 3 were isolated in high yield , 93 % and 85 % respectively , thiirane 1 could only be recovered in a very poor ( i . e ., 14 %) yield . processes for preparing compounds of formula ( i ) or for preparing intermediates useful for preparing compounds of formula ( i ) are provided as further embodiments of the invention . intermediates useful for preparing compounds of formula ( i ) are also provided as further embodiments of the invention . a compound of formula ( i ) wherein j is s can be prepared by treating a corresponding compound of formula ( i ) wherein j is o with a suitable sulfonating reagent . see , e . g ., march , advanced organic chemistry reactions , mechanisms and structure , 2 nd ed ., 1977 and carey & amp ; sundberg , advanced organic chemistry , part b : reactions , 2 nd ed ., 1983 . a compound of formula ( i ) wherein j is o can be prepared by epoxidizing a corresponding compound of formula ( i ) wherein the ring that includes j is an alkene . see , e . g ., march , advanced organic chemistry , reactions , mechanisms and structure , 2 nd ed ., 1977 and carey & amp ; sundberg , advanced organic chemistry , part b : reactions , 2 nd ed ., 1983 . a compound of formula ( i ) wherein d is so 2 and j is o can be prepared by oxidizing a corresponding compound of formula ( i ) wherein d is s . see , e . g ., march , advanced organic chemistry , reactions , mechanisms and structure , 2 nd ed ., 1977 and carey & amp ; sundberg , advanced organic chemistry , part b : reactions , 2 nd ed ., 1983 . a specific group of the compounds of the present invention , that can be activated by zinc for nucleophilic substitution and that can form a covalent bond with a nucleophile of the matrix metalloproteinase , includes a thiirane ring . another specific group of the compounds of the present invention , that can be activated by zinc for nucleophilic substitution and that can form a covalent bond with a nucleophile of the matrix metalloproteinase , includes an oxirane ring . in addition , a specific nucleophile of the matrix metalloproteinase which can form a covalent bond with the group of the compounds of the present invention ( e . g ., thiirane or oxirane ) is located at the amino acid residue corresponding to residue 404 of the matrix metalloproteinase , wherein the numbering is based on the active site general base for gelatinase a , which is observed in other mmps . more specifically , the nucleophile is a carboxy ( i . e ., coo − ) oxygen atom located at amino acid residue corresponding to residue 404 of the matrix metalloproteinase , wherein the numbering is based on the active site general base for gelatinase a , which is observed in other mmps . see , fig1 . the matrix metalloproteinase can be a human matrix metalloproteinase . in addition , the matrix metalloproteinase can be a gelatinase , collagenase , stromelysin , membrane - type mmp , or matrilysin . specifically , the gelatinase can be mmp - 2 or mmp - 9 . according to the method of the invention , the matrix metalloproteinase can be contacted with the compound , e . g ., a compound of formula ( i ), in vitro . alternatively , the matrix metalloproteinase can be contacted with the compound , e . g ., a compound of formula ( i ), in vivo . without being bound by any particular theory , coordination of a thiirane in a compound of formula ( i ) with the enzyme active - site zinc ion is believed to activate the thiirane for modification by a nucleophile of the enzyme . see , fig1 . a computational model based on three - dimensional homology modeling for this enzyme with compound 1 indicates that the biphenyl group would fit in the active site analogously to the same group in certain known reversible inhibitors of mmp - 2 and mmp - 9 , as analyzed by x - ray structure determination . freskos , j . n . ; mischke b . v . ; decrescenzo , g . a . ; heintz , r . ; getman , d . p . ; howard , s . c . ; kishore , n . n . ; mcdonald , j . j . ; munie , g . e . ; rangwala , s . ; swearingen , c . a . ; voliva , c . ; welsch , d . j . bioorg . & amp ; med . chem . letters , 1999 , 9 , 943 – 948 . tamura , y . ; watanabe , f . ; nakatani , t . ; yasui , k . ; fuji , m . ; komurasaki , t . ; tsuzuki , h . ; maekawa , r . ; yoshioka , t . ; kawada , k . ; sugita , k . ; ohtani , m . j . med . chem . 1998 , 41 , 640 – 649 . as such , the biphenyl ether moiety in compounds 1 – 4 is believed to fit in the p1 ′ subsite of gelatinases , which is a deep hydrophobic pocket . ( a ) morgunova , e . ; tuuttila , a . ; bergmann , u . ; isupov , m . ; lindqvist , y . ; schneider , g . ; tryggvason , k . science 1999 , 284 , 1667 – 1670 . ( b ) massova , i . ; fridman , r . ; mobashery , s . j . mol . mod . 1997 , 3 , 17 – 34 ; olson , m . w . ; bernardo , m . m . ; pietila , m . ; gervasi , d . c . ; toth , m . ; kotra , l . p . ; massova , i . ; mobashery , s . ; fridman , r . j . biol . chem ., 2000 , 275 , 2661 – 2668 . this binding mode brings the sulfur of the thiirane in i into the coordination sphere of the zinc ion . see , fig1 . the models also indicated that the thiirane moiety in compounds 2 and 3 , with longer carbon backbones , would not be able to coordinate with the zinc ion as well as compound 1 , but would fit in an extended configuration in the active site . it is believed that the high specificity of certain compounds of the invention for a targeted enzyme arises predominantly from three factors . ( i ) the compounds satisfy the binding specificity requirements at the active site . in this respect these compounds are not any different from conventional reversible or affinity inhibitors . ( ii ) furthermore , the structural features of the inhibition should allow it to undergo chemical activation by the zinc atom of the enzyme to generate an electrophilic species within the active site . ( iii ) finally , there should be a nucleophilic amino - acid residue in the active site , in the proper orientation , to react with the electrophilic species ( e . g ., thiirane ring ), resulting in irreversible enzyme inactivation . by selecting a hydrophobic group ( e . g ., a — x — m ) located a specific distance from a group ( e . g ., d ) that can bind ( e . g ., hydrogen bond ) with one or more sites in the enzyme ( e . g ., amino acid residue 191 and / or amino acid residue 192 , in gelatinase a ), which is in turn located a specific distance from a thiirane ring that can coordinate with the enzyme active - site zinc atom , one can prepare selective mechanism - based inhibitors for a given mmp . see , fig1 . accordingly , preferred mmp inhibitors have a hydrophobic aryl moiety ( e . g ., a — x — m ) that can fit in the deep hydrophobic pocket ( i . e ., p 1 ′ subsite ) of an mmp . in addition , preferred mechanism - based mmp inhibitors also have a thiirane ring that can coordinate with the enzyme active - site zinc ion , and be modified by a nucleophile ( e . g ., carboxylate group of amino acid residue 404 of mmp - 2 ) in the enzyme active site . see , fig1 . the preferred mmp inhibitors can optionally include a second group ( e . g ., d ) that can coordinate with one or more sites in the enzyme . specifically , the second group can optionally hydrogen bond to the one or two proton donors ( e . g ., amino acid residue corresponding to residue 191 and / or amino acid residue corresponding to residue 192 of mmp - 2 ) in the enzyme active site . see , fig1 . the present invention provides a method for identifying a mechanistic based mmp inhibitor . the method includes providing a compound wherein ( 1 ) a hydrophobic moiety of the compound fits into a hydrophobic pocket of the mmp ; ( 2 ) the compound has one or two groups that can hydrogen bond with one or two hydrogen donors of the mmp , wherein the hydrogen donors of the mmp are located at amino acid residue corresponding to residue 191 and amino acid residue corresponding to residue 192 of mmp - 2 ; ( 3 ) the compound has an electrophilic group that can covalently bond with a nucleophile of the mmp , wherein the nucleophile of the mmp is located at amino acid residue corresponding to residue 404 of mmp - 2 ; and / or ( 4 ) the compound includes a group that can coordinate with the zinc ion of the mmp . preferred mmp inhibitors have a thiirane or oxirane such that the sulfur or oxygen atom of the thiirane or oxirane is located about 3 angstroms to about 4 angstroms from the zinc ion . the suitable mmp inhibitors can also include a thiirane or oxirane ring located about 3 angstroms to about 5 angstroms from the active site nucleophile . see , fig1 and 3 . radiolabeled compounds of formula ( i ) are also useful as imaging agents for imaging cells comprising mmp &# 39 ; s . accordingly , the invention also provides compounds of formula ( i ) that include one or more detectable radionuclides ( e . g ., one or more metallic radionuclide and / or one or more non - metallic radionuclides ). for example , a detectable radionuclide can be incorporated into a compound by replacing an atom of the compound of formula ( i ) with a radionuclide ( e . g ., non - metallic radionuclide ). alternatively , a radiolabeled compound of the invention can be prepared by linking a compound of formula ( i ) to a chelating group that includes a detectable radionuclide ( e . g ., metallic radionuclide ). such compounds can be useful to image tissues with mmp activity or tumors , in vivo or in vitro . as used herein , a “ chelating group ” is a group that can include a detectable radionuclide ( e . g ., a metallic radioisotope ). any suitable chelating group can be employed . suitable chelating groups are disclosed , e . g ., in poster sessions , proceedings of the 46th annual meeting , j . nuc . med ., p . 316 , no . 1386 ; scientific papers , proceedings of the 46th annual meeting , j . nuc . med ., p . 123 , no . 499 ; scientific papers , proceedings of the 46th annual meeting , j . nuc . med ., p . 102 , no . 413 ; scientific papers , proceedings of the 46th annual meeting , j . nuc . med ., p . 102 , no . 414 ; scientific papers , proceedings of the 46th annual meeting , j . nuc . med ., p . 103 , no . 415 ; poster sessions , proceedings of the 46th annual meeting , j . nuc . med ., p . 318 , no . 1396 ; poster sessions , proceedings of the 46th annual meeting , j . nuc . med ., p . 319 , no . 1398 ; m . moi et al ., j . amer . chem ., soc ., 49 , 2639 ( 1989 ); s . v . deshpande et al ., j . nucl . med ., 31 , 473 ( 1990 ); g . kuser et al ., bioconj . chem ., 1 , 345 ( 1990 ); c . j . broan et al ., j . c . s . chem . comm ., 23 , 1739 ( 1990 ); c . j . anderson et al ., j . nucl . med . 36 , 850 ( 1995 ); u . s . pat . nos . 5 , 739 , 313 ; and u . s . pat . no . 6 , 004 , 533 . specifically , the chelating group can be . as used herein , a “ detectable radionuclide ” is any suitable radionuclide ( i . e ., radioisotope ) useful in a diagnostic procedure in vivo or in vitro . suitable detectable radionuclides include metallic radionuclides ( i . e ., metallic radioisotopes ) and non - metallic radionuclides ( i . e ., non - metallic radioisotopes ). suitable metallic radionuclides ( i . e ., metallic radioisotopes or metallic paramagnetic ions ) include antimony - 124 , antimony - 125 , arsenic - 74 , barium - 103 , barium - 140 , beryllium - 7 , bismuth - 206 , bismuth - 207 , cadmium - 109 , cadmium - 115m , calcium - 45 , cerium - 139 , cerium - 141 , cerium - 144 , cesium - 137 , chromium - 51 , cobalt - 55 , cobalt - 56 , cobalt - 57 , cobalt - 58 , cobalt - 60 , cobalt - 64 , copper - 67 , erbium - 169 , europium - 152 , gallium - 64 , gallium - 68 , gadolinium - 153 , gadolinium - 157 gold - 195 , gold - 199 , hafnium - 175 , hafnium - 175 - 181 , holmium - 166 , indium - 110 , indium - 111 , iridium - 192 , iron - 55 , iron - 59 , krypton - 85 , lead - 210 , manganese - 54 , mercury - 197 , mercury - 203 , molybdenum - 99 , neodymium - 147 , neptunium - 237 , nickel - 63 , niobium - 95 , osmium - 185 + 191 , palladium - 103 , platinum - 195m , praseodymium - 143 , promethium - 147 , protactinium - 233 , radium - 226 , rhenium - 186 , rhenium - 188 , rubidium - 86 , ruthenium - 103 , ruthenium - 106 , scandium - 44 , scandium - 46 , selenium - 75 , silver - 110m , silver - 111 , sodium - 22 , strontium - 85 , strontium - 89 , strontium - 90 , sulfur - 35 , tantalum - 182 , technetium - 99m , tellurium - 125 , tellurium - 132 , thallium - 204 , thorium - 228 , thorium - 232 , thallium - 170 , tin - 113 , tin - 114 , tin - 117m , titanium - 44 , tungsten - 185 , vanadium - 48 , vanadium - 49 , ytterbium - 169 , yttrium - 86 , yttrium - 88 , yttrium - 90 , yttrium - 91 , zinc - 65 , and zirconium - 95 . specifically , the chelating group can include more than one metallic radioisotope . more specifically , the detectable chelating group can include 2 to about 10 , 2 to about 8 , 2 to about 6 , or 2 to about 4 metallic radioisotopes . specifically , the non - metallic radionuclide can be a non - metallic paramagnetic atom ( e . g ., fluorine - 19 ); or a non - metallic positron emitting radionuclide ( e . g ., carbon - 11 , fluorine - 18 , iodine - 123 , or bromine - 76 ). specifically , the compounds of the present invention can include more than one non - metallic radioisotope . more specifically , the compounds of the present invention can include 2 to about 10 , 2 to about 8 , 2 to about 6 , or 2 to about 4 non - metallic radioisotopes . a compound of formula ( i ), or a pharmaceutically acceptable salt thereof , can be administered to a mammal ( e . g ., human ) in conjunction with a chemotherapeutic agent , or a pharmaceutically acceptable salt thereof . accordingly , a compounds of formula ( i ) can be administered in conjunction with a chemotherapeutic agent to treat a tumor or cancer . as used herein , a “ chemotherapeutic agent ” is a compound that has biological activity against one or more forms of cancer and can be administered to a patient with a compound of formula ( i ) without losing its anticancer activity . suitable chemotherapeutic agents include , e . g ., antineoplasts . representative antineoplasts include , e . g ., adjuncts , androgen inhibitors , antibiotic derivatives , antiestrogens , antimetabolites , cytotoxic agents , hormones , immunomodulators , nitrogen mustard derivatives and steroids . physicians &# 39 ; desk reference , 50th edition , 1996 . representative adjuncts include , e . g ., levamisole , gallium nitrate , granisetron , sargramostim strontium - 89 chloride , filgrastim , pilocarpine , dexrazoxane , and ondansetron . physicians &# 39 ; desk reference , 50th edition , 1996 . representative androgen inhibitors include , e . g ., flutamide and leuprolide acetate . physicians &# 39 ; desk reference , 50th edition , 1996 . representative antibiotic derivatives include , e . g ., doxorubicin , bleomycin sulfate , daunorubicin , dactinomycin , and idarubicin . representative antiestrogens include , e . g ., tamoxifen citrate and analogs thereof . physicians &# 39 ; desk reference , 50th edition , 1996 . additional antiestrogens include nonsteroidal antiestrogens such as toremifene , droloxifene and roloxifene . magarian et al ., current medicinal chemistry , 1994 , vol . 1 , no . 1 . representative antimetabolites include , e . g ., fluorouracil , fludarabine phosphate , floxuridine , interferon alfa - 2b recombinant , methotrexate sodium , plicamycin , mercaptopurine , and thioguanine . physicians &# 39 ; desk reference , 50th edition , 1996 . representative cytotoxic agents include , e . g ., doxorubicin , carmustine [ bcnu ], lomustine [ ccnu ], cytarabine usp , cyclophosphamide , estramucine phosphate sodium , altretamine , hydroxyurea , ifosfamide , procarbazine , mitomycin , busulfan , cyclophosphamide , mitoxantrone , carboplati , cisplati , cisplatin , interferon alfa - 2a recombinant , paclitaxel , teniposide , and streptozoci . physicians &# 39 ; desk reference , 50th edition , 1996 . representative hormones include , e . g ., medroxyprogesterone acetate , estradiol , megestrol acetate , octreotide acetate , diethylstilbestrol diphosphate , testolactone , and goserelin acetate . physicians &# 39 ; desk reference , 50th edition , 1996 . representative immunodilators include , e . g ., aldesleukin . physicians &# 39 ; desk reference , 50th edition , 1996 . representative nitrogen mustard derivatives include , e . g ., melphalan , chlorambucil , mechlorethamine , and thiotepa . physicians &# 39 ; desk reference , 50th edition , 1996 . representative steroids include , e . g ., betamethasone sodium phosphate and betamethasone acetate . physicians &# 39 ; desk reference , 50th edition , 1996 . additional suitable chemotherapeutic agents include , e . g ., alkylating agents , antimitotic agents , plant alkaloids , biologicals , topoisomerase i inhibitors , topoisomerase ii inhibitors , synthetics , antiangiogenic drugs , and antibodies . see , e . g ., anticancer agents by mechanism , http :// www . dtp . nci . nih . gov / docs / cancer / searches / standard_mechanism_list . html , apr . 12 , 1999 ; approved anti - cancer agents , http :// www . ctep . info . nih . gov / handbook / handbooktext / fda_agen . htm , pages 1 – 7 , jun . 18 , 1999 ; mcmp 611 chemotherapeutic drugs to know , http // www . vet . purdue . edu / depts / bms / courses / mcmp611 / chrx / drg2no61 . html , jun . 24 , 1999 ; chemotherapy , http :// www . vetmed . lsu . edu / oncology / chemotherapy . htm , apr . 12 , 1999 ; and angiogenesis inhibitors in clinical trials , http :// www . cancertrials . nci . nih . gov / news / angio / table . html , pages 1 – 5 , apr . 19 , 2000 . representative alkylating agents include , e . g ., asaley , azq , bcnu , busulfan , bisulphan , carboxyphthalatoplatinum , cbdca , ccnu , chip , chlorambucil , chlorozotocin , cis - platinum , clomesone , cyanomorpholinodoxorubicin , cyclodisone , cyclophosphamide , dianhydrogalactitol , fluorodopan , hepsulfam , hycanthone , iphosphamide , melphalan , methyl ccnu , mitomycin c , mitozolamide , nitrogen mustard , pcnu , piperazine , piperazinedione , pipobroman , porfiromycin , spirohydantoin mustard , streptozotocin , teroxirone , tetraplatin , thiotepa , triethylenemelamine , uracil nitrogen mustard , and yoshi - 864 . anticancer agents by mechanism , http :// dtp . nci . nih . gov / docs / cancer / searches / standard_mechanism_list . html , apr . 12 , 1999 . representative antimitotic agents include , e . g ., allocolchicine , halichondrin b , colchicine , colchicine derivatives , dolastatin 10 , maytansine , rhizoxin , paclitaxel derivatives , paclitaxel , thiocolchicine , trityl cysteine , vinblastine sulfate , and vincristine sulfate . anticancer agents by mechanism , http :// dtp . nci . nih . gov / docs / cancer / searches / standard_mechanism_list . html , apr . 12 , 1999 . representative plant alkaloids include , e . g ., actinomycin d , bleomycin , l - asparaginase , idarubicin , vinblastine sulfate , vincristine sulfate , mitramycin , mitomycin , daunorubicin , vp - 16 - 213 , vm - 26 , navelbine and taxotere . approved anti - cancer agents , http :// ctep . info . nih . gov / handbook / handbooktext / fda_agent . htm , jun . 18 , 1999 . representative biologicals include , e . g ., alpha interferon , bcg , g - csf , gm - csf , and interleukin - 2 . approved anti - cancer agents , http :// ctep . info . nih . gov / handbook / handbooktext / fda_agent . htm , jun . 18 , 1999 . representative antiangiogenic drugs include e . g ., marimastat , ag3340 , col - 3 , neovastat , bms - 275291 , tnp - 470 , thalidomide , squalamine , combretastatin a - 4 prodrug , endostatin , su5416 , su6668 , interferon - alpha , anti - vegf antibody , emd121974 , cai , interleukin - 12 , and im862 . angiogenesis inhibitors in clinical trials , http :// www . cancertrials . nci . nih . gov / news / angio / table . html , pages 1 – 5 , apr . 19 , 2000 . representative topoisomerase i inhibitors include , e . g ., camptothecin , camptothecin derivatives , and morpholinodoxorubicin . anticancer agents by mechanism , http :// dtp . nci . nih . gov / docs / cancer / searches / standard_mechanism_list . html , apr . 12 , 1999 . additional biologicals include drugs designed to inhibit tumor vascularization , which is also known as tumor angiogenesis . these drugs can be potent antiangiogenic agents . additional biologicals include humanized antibodies to growth factors , for example , to her2 , signaling molecules and adhesion receptors . additional biologicals also include treatment with recombinant viruses and other means of gene therapy delivery , including for example , dna , oligonucleotides , rybozymes , and liposomes . representative topoisomerase ii inhibitors include , e . g ., mitoxantron , amonafide , m - amsa , anthrapyrazole derivatives , pyrazoloacridine , bisantrene hcl , daunorubicin , deoxydoxorubicin , menogaril , n , n - dibenzyl daunomycin , oxanthrazole , rubidazone , vm - 26 and vp - 16 . anticancer agents by mechanism , http :// dtp . nci . nih . gov / docs / cancer / searches / standard_mechanism_list . html , apr . 12 , 1999 . representative synthetics include , e . g ., hydroxyurea , procarbazine , o , p ′- ddd , dacarbazine , ccnu , bcnu , cis - diamminedichloroplatimun , mitoxantrone , cbdca , levamisole , hexamethylmelamine , all - trans retinoic acid , gliadel and porfimer sodium . approved anti - cancer agents , http :// ctep . info . nih . gov / handbook / handbooktext / fda_agen . htm , jun . 18 , 1999 . in cases where compounds are sufficiently basic or acidic to form stable nontoxic acid or base salts , administration of the compounds as salts may be appropriate . examples of pharmaceutically acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion , for example , tosylate , methanesulfonate , acetate , citrate , malonate , tartarate , succinate , benzoate , ascorbate , a - ketoglutarate , and a - glycerophosphate . suitable inorganic salts may also be formed , including hydrochloride , sulfate , nitrate , bicarbonate , and carbonate salts . pharmaceutically acceptable salts may be obtained using standard procedures well known in the art , for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion . alkali metal ( e . g ., sodium , potassium or lithium ) or alkaline earth metal ( e . g ., calcium ) salts of carboxylic acids can also be made . the compounds of formula ( i ) can be formulated as pharmaceutical compositions and administered to a mammalian host , such as a human patient in a variety of forms adapted to the chosen route of administration , i . e ., orally or parenterally , by intravenous , intramuscular , topical or subcutaneous routes . thus , the present compounds may be systemically administered , e . g ., orally , in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier . they may be enclosed in hard or soft shell gelatin capsules , may be compressed into tablets , or may be incorporated directly with the food of the patient &# 39 ; s diet . for oral therapeutic administration , the active compound may be combined with one or more excipients and used in the form of ingestible tablets , buccal tablets , troches , capsules , elixirs , suspensions , syrups , wafers , and the like . such compositions and preparations should contain at least 0 . 1 % of active compound . the percentage of the compositions and preparations may , of course , be varied and may conveniently be between about 2 to about 60 % of the weight of a given unit dosage form . the amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained . the tablets , troches , pills , capsules , and the like may also contain the following : binders such as gum tragacanth , acacia , corn starch or gelatin ; excipients such as dicalcium phosphate ; a disintegrating agent such as corn starch , potato starch , alginic acid and the like ; a lubricant such as magnesium stearate ; and a sweetening agent such as sucrose , fructose , lactose or aspartame or a flavoring agent such as peppermint , oil of wintergreen , or cherry flavoring may be added . when the unit dosage form is a capsule , it may contain , in addition to materials of the above type , a liquid carrier , such as a vegetable oil or a polyethylene glycol . various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form . for instance , tablets , pills , or capsules may be coated with gelatin , wax , shellac or sugar and the like . a syrup or elixir may contain the active compound , sucrose or fructose as a sweetening agent , methyl and propylparabens as preservatives , a dye and flavoring such as cherry or orange flavor . of course , any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non - toxic in the amounts employed . in addition , the active compound may be incorporated into sustained - release preparations and devices . the active compound may also be administered intravenously or intraperitoneally by infusion or injection . solutions of the active compound or its salts can be prepared in water , optionally mixed with a nontoxic surfactant . dispersions can also be prepared in glycerol , liquid polyethylene glycols , triacetin , and mixtures thereof and in oils . under ordinary conditions of storage and use , these preparations contain a preservative to prevent the growth of microorganisms . the pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions , optionally encapsulated in liposomes . in all cases , the ultimate dosage form should be sterile , fluid and stable under the conditions of manufacture and storage . the liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising , for example , water , ethanol , a polyol ( e . g ., glycerol , propylene glycol , liquid polyethylene glycols , and the like ), vegetable oils , nontoxic glyceryl esters , and suitable mixtures thereof . the proper fluidity can be maintained , for example , by the formation of liposomes , by the maintenance of the required particle size in the case of dispersions or by the use of surfactants . the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents , for example , parabens , chlorobutanol , phenol , sorbic acid , thimerosal , and the like . in many cases , it will be preferable to include isotonic agents , for example , sugars , buffers or sodium chloride . prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption , for example , aluminum monostearate and gelatin . sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above , as required , followed by filter sterilization . in the case of sterile powders for the preparation of sterile injectable solutions , the preferred methods of preparation are vacuum drying and the freeze drying techniques , which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile - filtered solutions . for topical administration , the present compounds may be applied in pure form , i . e ., when they are liquids . however , it will generally be desirable to administer them to the skin as compositions or formulations , in combination with a dermatologically acceptable carrier , which may be a solid or a liquid . useful solid carriers include finely divided solids such as talc , clay , microcrystalline cellulose , silica , alumina and the like . useful liquid carriers include water , alcohols or glycols or water - alcohol / glycol blends , in which the present compounds can be dissolved or dispersed at effective levels , optionally with the aid of non - toxic surfactants . adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use . the resultant liquid compositions can be applied from absorbent pads , used to impregnate bandages and other dressings , or sprayed onto the affected area using pump - type or aerosol sprayers . thickeners such as synthetic polymers , fatty acids , fatty acid salts and esters , fatty alcohols , modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes , gels , ointments , soaps , and the like , for application directly to the skin of the user . examples of useful dermatological compositions which can be used to deliver the compounds of formula i to the skin are known to the art ; for example , see jacquet et al . ( u . s . pat . no . 4 , 608 , 392 ), geria ( u . s . pat . no . 4 , 992 , 478 ), smith et al . ( u . s . pat . no . 4 , 559 , 157 ) and wortzman ( u . s . pat . no . 4 , 820 , 508 ). useful dosages of the compounds of formula i can be determined by comparing their in vitro activity , and in vivo activity in animal models . methods for the extrapolation of effective dosages in mice , and other animals , to humans are known to the art ; for example , see u . s . pat . no . 4 , 938 , 949 . generally , the concentration of the compound ( s ) of formula i in a liquid composition , such as a lotion , will be from about 0 . 1 – 25 wt -%, preferably from about 0 . 5 – 10 wt -%. the concentration in a semi - solid or solid composition such as a gel or a powder will be about 0 . 1 – 5 wt -%, preferably about 0 . 5 – 2 . 5 wt -%. the amount of the compound , or an active salt or derivative thereof , required for use in treatment will vary not only with the particular salt selected but also with the route of administration , the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician . in general , however , a suitable dose will be in the range of from about 0 . 5 to about 100 mg / kg , e . g ., from about 10 to about 75 mg / kg of body weight per day , such as 3 to about 50 mg per kilogram body weight of the recipient per day , preferably in the range of 6 to 90 mg / kg / day , most preferably in the range of 15 to 60 mg / kg / day . the compound is conveniently administered in unit dosage form ; for example , containing 5 to 1000 mg , conveniently 10 to 750 mg , most conveniently , 50 to 500 mg of active ingredient per unit dosage form . ideally , the active ingredient should be administered to achieve peak plasma concentrations of the active compound of from about 0 . 5 to about 75 μm , preferably , about 1 to 50 μm , most preferably , about 2 to about 30 μm . this may be achieved , for example , by the intravenous injection of a 0 . 05 to 5 % solution of the active ingredient , optionally in saline , or orally administered as a bolus containing about 1 – 100 mg of the active ingredient . desirable blood levels may be maintained by continuous infusion to provide about 0 . 01 – 5 . 0 mg / kg / hr or by intermittent infusions containing about 0 . 4 – 15 mg / kg of the active ingredient ( s ). the desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals , for example , as two , three , four or more sub - doses per day . the sub - dose itself may be further divided , e . g ., into a number of discrete loosely spaced administrations ; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye . the ability of a compound of the invention to act as an mmp inhibitor may be determined using pharmacological models which are well known to the art , or using the methods described hereinbelow . the enzymatic activity of mmp - 2 , mmp - 9 , and mmp - 7 was monitored with the fluorescence quenched substrate mocacplgla 2 pr ( dnp )- ar - nh 2 . fluorescence was measured with a photon technology international ( pti ) spectrofluorometer interfaced to a pentium computer , equipped with the ratiomaster ™ and felix ™ hardware and software , respectively . the cuvette compartment was thermostated at 25 . 0 ° c . substrate hydrolysis was monitored at emission and excitation wavelengths of 328 and 393 nm and excitation and emission band passes of 1 and 3 nm , respectively . fluorescence measurements were taken every 4 s . less than 10 % hydrolysis of the fluorogenic substrate was monitored , as described by knight . knight , c . g . methods enzymol . 1995 , 248 , 18 – 34 . stromelysin i enzymatic activity was monitored using the synthetic fluorogenic substrate mocacrpkpve - nva - wrk ( dnp )- nh 2 ( peptides international , louisville , ky .) at excitation and emission wavelengths of 325 and 393 nm and excitation and emission band passes of 1 and 3 nm , respectively . human pro - mmp - 2 , pro - mmp - 9 , timp - 1 and timp - 2 were expressed in hela s3 cells infected with the appropriate recombinant vaccinia viruses and were purified to homogeneity , as previously described . fridman , r . ; fuerst , t . r . ; bird , r . e . ; hoyhtya , m . ; oelkuct , m . ; kraus , s . ; komarek , d . ; liotta , l . a . ; berman , m . l . ; stetler - stevenson , w . g . j . biol . chem . 1992 , 267 , 15398 – 15405 . fridman , r . ; birs , r . e . ; hoyhtya , m . ; oelkuct , m . ; komarek , d . ; liang , c . m . ; berman , m . l . ; liotta , l . a . ; stetler - stevenson , w . g . ; fuerst , t . r . biochem . j . 1993 , 289 , 411 – 416 . pro - mmp - 2 , pro - mmp - 9 , timp - 1 and timp - 2 concentrations were determined using the extinction coefficients of 122 , 800 , 114 , 360 , 26 , 500 and 39 , 600 m − 1 cm − 1 , respectively . to obtain active mmp - 2 , pro - mmp - 2 ( 7 . 3 μm ) was incubated at 37 ° c . for 1 h with 1 mm p - aminophenylmercuric acetate ( apma ) ( dissolved in 200 mm tris ) in buffer c . the enzyme solution was dialyzed against buffer d at 4 ° c . to remove apma . active mmp - 9 was obtained by incubating pro - mmp - 9 ( 1 μm ) with heat - activated recombinant human stromelysin 1 ( 68 nm ) ( mmp - 3 , generously provided by dr . paul cannon , center for bone and joint research , palo alto , calif .) at 37 ° c ., for 2 . 5 h in buffer c . the resulting solution was subjected to gelatin - agarose chromatography to remove stromelysin 1 . mmp - 9 was eluted with buffer d containing 10 % dmso and dialyzed against the same buffer without dmso to remove the organic solvent . pro - mmp - 2 and pro - mmp - 9 activation reactions were monitored using the fluorescence quenched substrate mocacplgla 2 pr ( dnp )- ar - nh 2 ( peptides international , louisville , ky . ), as will be described below . the mmp - 2 and mmp - 9 concentrations were determined by titration with timp - 1 . progress curves were obtained by adding enzyme ( 0 . 5 – 2 nm ) to a mixture of fluorogenic substrate ( 5 – 7 μm ) and varying concentrations of inhibitor in buffer r containing 5 – 15 % dmso ( final volume 2 ml ), in acrylic cuvettes with stirring and monitoring the increase in fluorescence with time for 15 – 30 minutes . the progress curves were nonlinear least squares fitted to equation 1 ( muller - steffner , h . m ., malver , o ., hosie , l ., oppenheimer , n . j ., and schuber , f . j . biol . chem . 1992 , 267 , 9606 – 9611 . ): f = ν s t + i ( ν 0 − ν s )( 1 − exp (− kt ))/ k + f 0 ( 1 ) where ν 0 represents the initial rate , ν s , the steady state rate , k , the apparent first order rate constant characterizing the formation of the steady - state enzyme - inhibitor complex and f 0 , the initial fluorescence , using the program scientist ( micromath scientific software , salt lake city , utah ). the obtained k values , ν 0 and ν s were further analyzed according to equations 2 and 3 for a one - step association mechanism ( ν 0 − ν s )/ ν s =[ i ]/( k i ( 1 +[ s ]/ k m )) ( 3 ) intercept and slope values , obtained by linear regression of the k versus inhibitor concentration plot ( equation 2 ), yielded the association and dissociation rate constants k on and k off , respectively , and the inhibition constant k i ( k off / k on ). alternatively , k i was determined from the slope of the ( ν 0 − ν s )/ ν s νs [ i ] plot according to equation 3 . the dissociation rate constants were determined independently from the enzyme activity recovered after dilution of a pre - formed enzyme - inhibitor complex . to this end , typically 200 nm of enzyme was incubated with 1 μm of inhibitor for a sufficient time to reach equilibrium (& gt ; 45 min ) at 25 . 0 ° c . the complex was diluted into 2 ml of buffer r containing fluorogenic substrate ( 5 – 7 μm final concentration ) to a final enzyme concentration of 1 nm . recovery of enzyme activity was monitored for ˜ 30 min . the fluorescence versus time trace was fitted , using the program scientist , to equation 4 f = ν s t +( ν 0 − ν s )( 1 − exp (− k off ))/ k off + f 0 ( 4 ) where ν o represents the initial rate ( very small ), ν s , the rate observed when the e . i complex is completely dissociated and k off , the first order rate constant when the e . i dissociation . analysis for linear competitive inhibition was performed in the following manner . initial rates were obtained by adding enzyme ( 0 . 5 – 2 nm ) to a mixture of fluorogenic substrate ( 5 – 7 μm ) and varying concentrations of inhibitor in buffer r , containing 5 – 15 % dmso ( final volume 1 ml ) in semi - micro quartz cuvettes , and monitoring the increase in fluorescence with time for 5 – 10 minutes . the fluorescence versus time traces were fitted by linear regression analysis using felix ™. the initial rates were fitted to equation 5 ( segel , i . h . in : enzyme kinetics , wiley inc ., new york , 1975 , pp . 104 . ): v / v max = s /( k m ( 1 + i / k i )+ s ) ( 5 ) where v and v max represent the initial and maximal velocities , s and i , the substrate and inhibitor concentrations , respectively , k m the michaelis - menten constant for the substrate - enzyme reaction and k i the inhibition constant , using the program scientist . inhibitors 1 – 4 all bind with the active site of the mmps that were used in the study , with k i values of micromolar , or less , however , the behavior of inhibitor 1 was very different . inhibitor 1 showed a dual behavior . it served as a mechanism - based inhibitor with a partition ratio of 79 ± 10 ( i . e . k cat / k inact ) for mmp - 2 and 416 ± 63 for mmp - 9 . furthermore , it also behaved as a slow - binding inhibitor , for which the rate constants for the on - set of inhibition ( k on ) and recovery of activity from inhibition ( k off ) were evaluated ( table 1 ). it would appear that coordination of the thiirane with the zinc ion ( as seen in energy - minimized computational models ; fig1 ) would set in motion a conformational change , which is presumed from the slow - binding kinetic behavior . the kinetic data fit the model for slow - binding inhibition . morrison , j . f . adv . enzymol . 1988 , 61 , 201 – 301 . covalent modification of the enzymes results from this conformational change . inhibitor 1 was incubated with mmp - 2 to the point that less than 5 % activity remained . this inhibitor - enzyme complex was dialyzed over three days , which resulted in recovery of approximately 50 % of the activity . this observation is consistent with modification of the active site glu - 404 ( according to the numbering for human mmp - 2 ), via the formation of an ester bond , which is a relatively labile covalent linkage . the time - dependent loss of activity is not merely due to the slow - binding behavior . for instance , for a k off of 2 × 10 − 3 s − 1 ( the values are not very different from one another in table 1 ) the half time for recovery of activity ( t 1 / 2 ) is calculated at just under 6 min . the fact that 50 % of activity still did not recover after dialysis over three days strongly argues for the covalency of enzyme modification . selectivity in inhibition of gelatinases by inhibitor 1 was observed . its k i values are 13 . 9 ± 4 nm and 600 ± 200 nm for mmp - 2 and mmp - 9 , respectively . the corresponding k i values are elevated to the micromolar range for the other mmps , even for the case of mmp - 3 , which does show the slow - binding , mechanism - based inhibition profile . in addition , the values for k on are 611 - and 78 - fold larger for mmp - 2 and mmp - 9 , respectively , than that for mmp - 3 . whereas the k off values are more similar to one another , the value for mmp - 2 is the smallest , so the reversal of inhibition of this enzyme takes place more slowly . collectively , these kinetic parameters demonstrate that inhibitor 1 can be a potent and selective inhibitor for mmp - 2 , mmp - 9 , and especially mmp - 2 . it has been previously shown that two molecules of either timp - 1 or timp - 2 ( endogenous cellular protein inhibitors of mmps ) bind to activated mmp - 2 and mmp - 9 . olson , m . w . ; gervasi , d . c . ; mobashery , s . ; fridman , r . j . biol . chem . 1997 , 272 , 29975 . one binding event is high affinity and would appear physiologically relevant , whereas the second binding event takes place with relatively lower affinity ( micromolar ). olson , m . w . ; gervasi , d . c . ; mobashery , s . ; fridman , r . j . biol . chem . 1997 , 272 , 29975 . inhibition of mmp - 2 and mmp - 9 by timps also follows slow - binding kinetics . the kinetic parameters for these interactions at the high affinity site are listed in table 1 . the kinetic parameters for the slow - binding component of inhibition of mmp - 2 and mmp - 9 by inhibitor 1 ( k on and k off ) approach closely the same parameters for those of the protein inhibitors . olson , m . w . ; gervasi , d . c . ; mobashery , s . ; fridman , r . j . biol . chem . 1997 , 272 , 29975 – 29983 . oxiranes 4 – 6 inhibit mmps in a competitive manner with higher k i values . there was no evidence of slow - binding behavior or time - dependence of loss of activity with this inhibitor with any of the mmps . small - molecule inhibitor 1 follows both slow - binding and mechanism - based inhibition in its kinetic profile . this compound appears to behave very similarly to the endogenous cellular protein inhibitors for mmps ( timps ) in the slow - binding component of inhibition . furthermore , the inhibitor also exhibits a covalent mechanism - based behavior in inhibition of these enzymes . the high discrimination in targeting that inhibitor 1 displays ( both in affinities and the modes of inhibition ) among the other structurally similar mmps is noteworthy and could serve as a paradigm in the design of inhibitors for other closely related enzymes in the future . 1 h and 13 c nmr spectra were recorded on either a varian gemini - 300 , a varian mercury - 400 or a varian unity - 500 spectrometer . chemical shifts are reported in ppm from tetramethylsilane on the d scale . infrared spectra were recorded on a nicolet 680 dsp spectrophotometer . mass spectra were recorded on a kratos ms 80rft spectrometer . melting points were taken on an electrothermal melting point apparatus and are uncorrected . thin - layer chromatography was performed with whatman reagents 0 . 25 mm silica gel 60 - f plates . all other reagents were purchased from either aldrich chemical company or across organics . the following buffers were used in experiments with enzymes : buffer c ( 50 mm hepes at ph 7 . 5 , 150 mm nacl , 5 mm cacl 2 , 0 . 02 % brij - 35 ); buffer r ( 50 mm hepes at ph 7 . 5 , 150 mm nacl , 5 mm cacl 2 , 0 . 01 % brij - 35 , and 1 % v / v me 2 so ) and buffer d ( 50 mm tris at ph 7 . 5 , 150 mm nacl , 5 mm cacl 2 , and 0 . 02 % brij - 35 ). ( 4 - phenoxyphenylsulfonyl ) methyloxirane ( 4 ). to compound 11 ( 598 mg , 2 . 5 mmol ) in dichloromethane ( 10 ml ), mcpba ( 2 . 84 g , 10 mmol , aldrich 57 – 86 %), was slowly added . the mixture was stirred at room temperature for 3 days , after which time a second portion of mcpba ( 2 . 84 g , 10 mmol ) was added . the mixture was then stirred for another 4 days , after which time the mixture was poured into ethyl acetate ( 200 ml ), and washed with aqueous sodium thiosulfate ( 3 × 50 ml , 10 % w / v ), aqueous sodium bicarbonate ( 3 × 50 ml , 5 % w / v ), and brine ( 50 ml ). the organic phase was dried over magnesium sulfate and was concentrated to provide a yellow oil . the crude material was purified by column chromatography ( silica , 4 : 1 hexanes : ethyl acetate ) to give compound 4 as a pale yellow semi - solid ( 501 mg , 70 %). 1 h nmr ( 500 mhz , cdcl 3 ) d 7 . 90 – 7 . 86 ( m , 2 h ), 7 . 46 – 7 . 40 ( m , 2 h ), 7 . 26 – 7 . 22 ( m , 1 h ), 7 . 10 – 6 . 96 ( m , 4 h ), 3 . 34 – 3 . 24 ( m , 2 h ), 2 . 84 – 2 . 8 ( m , 1 h ), 2 . 49 – 2 . 46 ( m , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) d 163 . 15 , 154 . 95 , 130 . 76 , 130 . 51 , 125 . 52 , 120 . 77 , 117 . 83 , 59 . 89 , 46 . 13 ; ir ( film ) 3054 ( w ), 2919 ( w ), 1576 ( s ), 1492 ( s ), 1320 ( s ), 1245 ( s ), 1148 ( s ) cm − 1 ; m / z ( ei ) 290 ( m + , 100 %), 233 ( 70 ) ( 50 ), 185 ( 40 ); hrms ( ei ) calcd . for c 15 h 14 o 4 s 290 . 0613 , found 290 . 0611 . ( a .) o - 4 - phenoxyphenyl - n , n - dimethylthiocarbamate ( 8 ). to a solution of 4 - phenoxyphenol ( 7 , 8 . 46 g , 45 mmol ) in dmf ( 40 ml ) at 10 cc , sodium hydride ( 1 . 83 g , 45 mmol , 60 % dispersion in mineral oil ) was added in small portions . after the evolution of hydrogen ceased , n , n - dimethylthiocarbamoyl chloride ( 6 . 16 g , 50 mmol ) was added in one portion . the reaction mixture was then stirred at 70 cc for 2 hours . the mixture was cooled to room temperature , poured into water ( 100 ml ) and extracted with chloroform ( 3 × 50 ml ). the combined organic extracts were washed with aqueous potassium hydroxide ( 50 ml , 5 % w / v ), and brine ( 10 × 50 ml ). the organic extract was dried over magnesium sulfate and concentrated to obtain a yellow oil . the crude material was purified by column chromatography ( silica , 5 : 1 hexanes : ethyl acetate ) to give compound 8 as a white solid ( 11 . 16 g , 90 %). m . p . 50 – 51 cc ; 1 h nmr ( 300 mhz , cdcl 3 ) d 7 . 38 – 7 . 31 ( m , 2 h ), 7 . 14 – 7 . 08 ( m , 1 h ), 7 . 06 – 7 . 00 ( m , 6 h ), 3 . 46 ( s , 3 h ), 3 . 34 ( s , 3 h ); 13 c nmr ( 75 mhz , cdcl 3 ) d 188 . 17 , 157 . 26 , 155 . 16 , 149 . 62 , 130 . 05 , 124 . 11 , 123 . 71 , 119 . 31 , 43 . 57 , 38 . 96 ; ir ( kbr ) 3040 ( m ), 2938 ( s ), 1587 ( s ), 1487 ( s ), 1394 ( s ), 1287 ( s ), 1190 ( s ) cm − 1 ; m / z ( ei ) 273 ( m + , 15 %), 186 ( 100 ); hrms ( ei ) calcd . for c 15 h 15 no 2 s 273 . 0823 , found 273 . 0824 . ( b .) s - 4 - phenoxyphenyl - n , n - dimethylthiocarbamate ( 9 ). compound 8 ( 3 . 99 g , 15 mmol ) was heated under argon at 260 cc for 3 . 5 hours . the resulting dark brown oil was purified by column chromatography using a gradient eluent system ( silica , 19 : 1 then 9 : 1 then 3 : 1 hexanes : ethyl acetate ) to obtain compound 9 as a pale yellow solid ( 2 . 55 g , 64 %). m . p . 97 – 99 cc ; 1 h nmr ( 400 mhz , cdcl 3 ) d 7 . 45 – 7 . 40 ( m , 2 h ), 7 . 40 – 7 . 30 ( m , 2 h ), 7 . 15 – 7 . 10 ( m , 1 h ), 7 . 05 ( d , j = 8 . 8 hz , 2 h ) 6 . 98 ( d , j = 8 . 8 hz , 2 h ) 3 . 08 ( bs , 3 h ), 3 . 02 ( bs , 3 h ); 13 c nmr ( 100 mhz , cdcl 3 ) d 167 . 48 , 158 . 87 , 156 . 53 , 137 . 66 , 130 . 09 , 124 . 14 , 122 . 39 , 119 . 87 , 118 . 94 , 37 . 14 ; ir ( kbr ) 3037 ( w ), 2925 ( w ), 1652 ( s ), 1581 ( s ) 1486 ( s ), 1239 ( s ) cm − 1 ; m / z ( ei ) 273 ( m + , 25 %), 257 ( 5 ), 200 ( 5 ); hrms ( ei ) calcd . for c 15 h 15 no 2 s 273 . 0823 , found 273 . 0822 . ( c .) 4 - phenoxythiophenol ( 10 ). a mixture of compound 9 ( 2 . 55 g , 9 mmol ) in methanol ( 20 ml ), and aqueous naoh ( 10 ml , 10 % w / v ), were refluxed for 4 hours . the solution was cooled to room temperature and was acidified to ph 1 with aqueous hcl ( 1m ). water ( 100 ml ) was added and the mixture was extracted with chloroform ( 3 × 50 ml ). the combined organic extracts were washed with brine ( 50 ml ), dried over magnesium sulfate and concentrated to obtain a yellow oil . the crude product was purified by column chromatography ( silica , 5 : 1 hexanes : ethyl acetate ) to give compound 10 as a pale yellow oil ( 1 . 80 g , & gt ; 99 %). 1 h nmr ( 300 mhz , cdcl 3 ) d 7 . 36 – 7 . 31 ( m , 2 h ), 7 . 30 – 7 . 25 ( m , 2 h ), 7 . 13 – 7 . 09 ( m , 1 h ), 7 . 04 – 6 . 88 ( m , 4 h ), 3 . 43 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) d 157 . 30 , 156 . 15 , 132 . 14 , 130 . 00 , 124 . 04 , 123 . 95 , 119 . 88 , 119 . 04 ; ir ( film ) 3038 ( w ), 1583 ( s ), 1484 ( s ), 1236 ( s ), 1166 ( s ) cm − 1 ; m / z ( ei ) 202 ( m + , 100 %; hrms ( ei ) calcd . for c 12 h 10 os 202 . 0452 , found 202 . 0454 . ( d .) 3 -( 4 - phenoxyphenylsulfanyl )- 1 - propene ( 11 ). to a mixture of compound 10 ( 516 mg , 2 . 7 mmol ) and potassium carbonate ( 534 mg , 3 . 9 mmol ) in dmf ( 5 ml ), allyl bromide ( 253 μl , 2 . 9 mmol ) was added in one portion . the mixture was stirred at room temperature overnight . the crude reaction mixture was poured into ether ( 200 ml ), washed with saturated aqueous potassium carbonate ( 25 ml ), and brine ( 6 × 50 ml ). the organic layer was dried over magnesium sulfate and concentrated in vacuo to give a yellow oil . the crude material was purified by column chromatography ( silica , 98 : 2 hexanes : ethyl acetate ) to obtain the title compound as a pale yellow oil ( 598 mg , 93 %). 1 h nmr ( 300 mhz , cdcl 3 ) d 7 . 38 – 7 . 32 ( m , 4 h ), 7 . 15 – 7 . 10 ( m , 1 h ), 7 . 04 – 7 . 00 ( m , 2 h ), 6 . 97 – 6 . 92 ( m , 2 h ), 5 . 92 – 5 . 82 ( m , 1 h ), 5 . 10 – 5 . 04 ( m , 2 h ), 3 . 50 ( d , j = 7 . 2 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) d 157 . 14 , 156 . 73 , 134 . 01 , 133 . 22 , 130 . 05 , 129 . 50 , 123 . 75 , 119 . 40 , 119 . 25 , 117 . 81 , 38 . 84 ; ir ( film ) 3078 ( w ), 3039 ( w ), 1582 ( s ), 1484 ( s ), 1240 ( s ), 1165 ( s ) cm − 1 ; m / z ( ei ) 242 ( m + , 100 %), 201 ([ m - allyl ] + , 100 ); hrms ( ei ) calcd . for c 15 h 14 os 242 . 0765 , found 242 . 0764 . 2 -( 4 - phenoxyphenylsulfonyl ) ethyloxirane ( 5 ). the title compound was prepared in the same manner as described for 4 , with the exception that compound 12 was used in place of compound 11 , and the reaction time was 2 days . the title compound was obtained as a white solid ( 78 %). m . p . 75 – 77 cc ; 1 h nmr ( 500 mhz , cdcl 3 ) d 7 . 84 – 7 . 80 ( m , 2 h ), 7 . 44 – 7 . 38 ( m , 2 h ), 7 . 24 – 7 . 20 ( m , 1 h ), 7 . 09 – 7 . 04 ( m , 4 h ), 3 . 25 – 3 . 15 ( m , 2 h ), 3 . 02 – 2 . 97 ( m , 1 h ), 2 . 76 ( t , j = 4 . 3 hz , 1 h ), 2 . 49 ( dd , j = 3 . 0 and 5 . 0 hz , 1 h ), 2 . 19 – 2 . 10 ( m , 1 h ), 1 . 86 ( m , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) d 162 . 93 , 155 . 02 , 130 . 58 , 130 . 81 , 125 . 47 , 120 . 69 , 117 . 91 , 53 . 15 , 50 . 32 , 47 . 29 , 26 . 23 ; ir ( kbr disc ) 3040 ( s ), 1580 ( s ), 1490 ( s ), 1320 ( s ), 1248 ( s ), 1148 cm − 1 ; m / z ( ei ) 304 ( m + , 80 %), 233 ( 50 ), 217 ( 100 ); hrms ( ei ) calcd . for c 16 h 16 o 4 s 304 . 0769 , found 304 . 0768 . ( a .) 4 -( 4 - phenoxyphenylsulfanyl )- 1 - butene ( 12 ). the title compound was prepared in the same manner as described for 11 , with the exception that 4 - bromo - 1 - butene was used in place of allyl bromide . compound 12 was obtained as a colorless oil ( 88 %). 1 h nmr ( 400 mhz , cdcl 3 ) d 7 . 37 – 7 . 32 ( m , 4 h ), 7 . 14 – 7 . 10 ( m , 1 h ), 7 . 04 – 7 . 00 ( m , 2 h ), 6 . 96 – 6 . 88 ( m , 2 h ), 5 . 90 – 5 . 80 ( m , 1 h ), 5 . 12 – 5 . 02 ( m , 2 h ), 2 . 98 ( m , 2 h ), 2 . 41 – 2 . 34 ( m , 2 h ); 13 c nmr ( 100 mhz , cdcl 3 ) d 157 . 18 , 156 . 50 , 136 . 65 , 132 . 57 , 130 . 05 , 123 . 72 , 119 . 55 , 119 . 21 , 116 . 47 , 34 . 65 , 33 . 71 ; ir ( film ) 3076 ( w ), 2923 ( w ), 1583 ( s ), 1485 ( s ), 1239 ( s ) cm − 1 ; m / z ( ei ) 256 ( m + , 100 %), 215 ([ m - allyl ] + , 90 ), 202 ( 15 ); hrms ( ei ) calcd . for c 16 h 16 os 256 . 0922 , found 256 . 0922 . 3 -( 4 - phenoxyphenylsulfonyl ) propyloxirane ( 6 ). the title compound was prepared in the same manner as described for 4 , with the exception that compound 13 was used in place of compound 11 , and that the reaction time was 3 days . the title compound was obtained as a white solid ( 94 %). 1 h nmr ( 500 mhz , cdcl 3 ) d 7 . 86 – 7 . 80 ( m , 2 h ), 7 . 44 – 7 . 39 ( m , 2 h ), 7 . 25 – 7 . 22 ( m , 1 h ), 7 . 10 – 7 . 04 ( m , 4 h ), 3 . 21 – 3 . 08 ( m , 2 h ), 2 . 90 – 2 . 86 ( m , 1 h ), 2 . 74 ( t , j = 4 . 5 hz , 1 h ), 2 . 45 ( dd , j = 2 . 5 and 4 . 5 hz 1 h ), 1 . 92 ( quin , j = 7 . 0 hz , 2 h ), 1 . 85 – 1 . 78 ( m , 1 h ), ( m , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) d 162 . 84 , 155 . 08 , 130 . 58 , 130 . 48 , 125 . 43 , 120 . 70 , 117 . 88 , 56 . 28 , 51 . 64 , 46 . 86 , 31 . 17 , 20 . 12 ; ir ( kbr disc ) 3063 ( w ), 2923 ( w ), 1582 ( s ), 1488 ( s ), 1294 ( s ), 1246 ( s ), 1142 ( s ) cm − 1 ; m / z ( ei ) 318 ( m + , 40 %), 290 ( 20 ), 217 ( 100 %); hrms ( ei ) calcd . for c 17 h 18 o 4 s 318 . 0926 , found 318 . 0924 . ( a .) 5 -( 4 - phenoxyphenylsulfanyl )- 1 - pentene ( 13 ). the title compound was prepared in the same manner as described for 11 , with the exception that 5 - bromo - 1 - pentene was used in place of allyl bromide . the title compound was obtained as a colorless oil ( 65 %). 1 h nmr ( 500 mhz , cdcl 3 ) d 7 . 37 – 7 . 34 ( m , 4 h ), 7 . 13 – 7 . 09 ( m , 1 h ), 7 . 03 – 7 . 00 ( m , 2 h ), 6 . 96 – 93 ( m , 2 h ), 5 . 83 – 5 . 74 ( m , 1 h ), 5 . 06 – 4 . 98 ( m , 2 h ), 2 . 88 ( t , j = 7 . 0 hz , 2 h ), 2 . 22 – 2 . 16 ( m , 2 h ), 1 . 73 ( q , j = 7 . 0 hz , 2 h ); 13 c nmr ( 125 mhz , cdcl 3 ) d 157 . 23 , 156 . 36 , 137 . 84 , 132 . 30 , 130 . 41 , 130 . 03 , 123 . 67 , 119 . 55 , 119 . 16 , 115 . 62 , 34 . 61 , 32 . 86 , 28 . 61 ; ir ( film ) 3075 ( w ), 2929 ( m ), 1583 ( s ), 1484 ( s ), 1236 ( s ) cm − 1 ; m / z ( ei ) 270 ( m + , 100 %), 215 ( 70 ), 202 ( 60 ); hrms ( ei ) calcd . for c 17 h 18 os 270 . 1078 , found 270 . 1076 . ( 4 - phenoxyphenylsulfonyl ) methylthiirane ( 1 ). to a solution of compound 4 ( 710 mg , 2 . 5 mmol ) in thf ( 5 ml ), a solution of ammonium thiocyanate ( 559 mg , 7 . 4 mmol ) in water ( 3 ml ) was added . the reaction was stirred at room temperature for 16 hours , after which time it was poured into ethyl acetate ( 100 ml ), and then washed with water ( 25 ml ), followed by brine ( 25 ml ). the organic phase was dried over magnesium sulfate and was concentrated to give a white oil . the crude material was purified by column chromatography ( silica , 8 : 1 hexanes : ethyl acetate ) to obtain compound i as a white solid ( 102 mg , 14 %). m . p . 99 – 101 ° c . ; 1 h nmr ( 500 mhz , cdcl 3 ) d 7 . 89 – 7 . 84 ( m , 2 h ), 7 . 46 – 7 . 40 ( m , 2 h ), 7 . 26 – 7 . 22 ( m , 1 h ), 7 . 11 – 6 . 96 ( m , 4 h ), 3 . 52 ( dd , j = 5 . 5 and 14 . 5 hz , 1 h ), 3 . 17 ( dd , j = 7 . 5 and 14 . 5 hz , 1 h ), 3 . 09 – 3 . 03 ( m , 1 h ), 2 . 53 ( dd , j = 2 . 0 and 6 . 0 hz , 1 h ) 2 . 16 ( dd , j = 2 . 0 and 5 . 0 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) d 163 . 20 , 155 . 02 , 132 . 13 , 130 . 95 , 130 . 52 , 125 . 52 , 120 . 69 , 117 . 97 , 62 . 90 , 26 . 31 , 24 . 47 ; ir ( kbr disc ) 3030 ( w ), 1583 ( s ), 1486 ( s ), 1317 ( s ), 1246 ( s ), 1141 ( s ) cm − 1 ; m / z ( ei ) 306 ( m + , 2 %), 242 ([ m − so 2 ] + , 35 ); hrms ( ei ) calcd . for c 15 h 14 o 3 s 2 306 . 0384 , found 306 . 0382 . 2 -( 4 - phenoxyphenylsulfonyl ) ethylthiirane ( 2 ). the title compound was prepared in the same manner as described for 1 , with the exception that compound 5 was used in place of compound 4 . the crude material was purified by column chromatography ( silica , 2 : 1 hexanes : ethyl acetate ) to give the title compound as a white solid ( 93 %). m . p . 99 – 101 ° c . ; 1 h nmr ( 500 mhz , cdcl 3 ) d 7 . 83 ( d , j = 8 . 0 hz , 2 h ), 7 . 42 ( t , j = 8 . 0 hz , 2 h ), 7 . 26 – 7 . 22 ( m , 1 h ), 7 . 10 – 7 . 06 ( m , 4 h ), 3 . 30 – 3 – 20 ( m , 2 h ), 2 . 98 – 2 . 92 ( m , 1 h ), 2 . 52 ( dd , j = 1 and 6 hz , 1 h ), 2 . 48 – 2 . 39 ( m , 1 h ), 2 . 18 ( dd , j = 1 and 5 hz , 1 h ), 1 . 78 – 1 . 69 ( m , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) d 162 . 94 , 155 . 03 , 132 . 50 , 130 . 55 , 130 . 51 , 125 . 48 , 120 . 71 , 117 . 92 , 55 . 97 , 33 . 62 , 29 . 82 , 26 . 05 ; ir ( kbr disc ) 3040 ( w ), 1583 ( s ), 1487 ( s ), 1256 ( s ), 1142 ( s ) cm − 1 ; m / z ( ei ) 320 ( m + , 50 %), 288 ( 20 ), 234 ( 40 ), 217 ( 60 ), 170 ( 100 ); hrms ( ei ) calcd . for c 16 h 16 o 3 s 2 320 . 0541 , found 320 . 0540 . 3 -( 4 - phenoxyphenylsulfonyl ) propylthiirane ( 3 ). the title compound was prepared in the same manner as described for 1 , with the exception that compound 6 was used in place of compound 4 . the crude material was purified by column chromatography ( silica , 2 : 1 hexanes : ethyl acetate ) to give the title compound as a white solid ( 85 %). m . p . 75 – 76 cc ; 1 h nmr ( 500 mhz , cdcl 3 ) d 7 . 85 – 7 . 82 ( m , 2 h ), 7 . 44 – 7 . 40 ( m , 2 h ), 7 . 26 – 7 . 22 ( m , 1 h ), 7 . 10 – 7 . 06 ( m , 4 h ), 3 . 20 – 3 . 09 ( m , 2 h ), 2 . 84 – 2 . 79 ( m , 1 h ), 2 . 50 ( dd , j = 1 and 6 hz , 1 h ), 2 . 14 ( dd , j = 1 and 5 . 5 hz , 1 h ), 2 . 12 – 2 . 06 ( m , 1 h ), 1 . 97 ( quin , j = 8 hz , 2 h ), 1 . 45 – 1 . 38 ( m , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) d 162 . 85 , 155 . 08 , 132 . 55 , 130 . 60 , 130 . 49 , 125 . 43 , 120 . 69 , 117 . 91 , 56 . 09 , 35 . 13 , 34 . 86 , 25 . 72 , 22 . 92 ; ir ( kbr disc ) 3000 ( w ), 1583 ( s ), 1480 ( s ), 1254 ( s ), 1143 ( s ) cm − 1 ; m / z ( ei ) 334 ( m + , 30 %), 301 ( 10 ), 234 ( 100 ), 217 ( 70 ), 170 ( 70 ); hrms ( ei ) calcd . for c 17 h 18 o 3 s 2 334 . 0697 , found 334 . 06 . all publications , patents , and patent documents are incorporated by reference herein , as though individually incorporated by reference . the invention has been described with reference to various specific and preferred embodiments and techniques . however , it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention . in addition , some references were obtained on the world wide web ( www ). these references are also incorporated by reference herein , as though individually incorporated by reference .
| 2 |
the present invention is directed to apparatus for synchronizing brake light activation of following vehicles using a rear - facing directional transmitter that is powered upon vehicle brake light activation . a following vehicle would pick up a signal from the transmitter , immediately re - transmitting it to the next following vehicle , simultaneously initiating brake light operation of that vehicle , and so on , thereby eliminating the one - second reaction delay of each successively following driver . the transmitter - receiver range is preferably limited such as to 100 to 120 feet for eliminating interference from other vehicles . while pulsed infra red ( ir ) radiation , described below , is preferred as the presently most practical and lowest cost directional tansmitter - receiver implementation , the present invention is not necessarily limited to any particular range of radiation frequency . ir leds pulsed at a standard rate provide good range and freedom from interference from other vehicles . the radiation is invisible , and penetrates fog and rain better than normal brake lights . an ir detector on the following vehicle simultaneously activates ir leds on that vehicle and its brake lights . this means that all these vehicle brake lights would turn on at the same time or synchronize with the brake lights of the first vehicle . the result is that all the vehicles behind the first vehicle would brake only about one second later , the cumulative delays that normally cause many of the worst rear - end collisions being eliminated . drivers of vehicles not equipped with the invention would benefit by seeing brake lights a number of seconds earlier , depending on the number of equipped vehicles ahead . rather than pulse the ir leds continuously while the brake lights are on , the pulsed ir leds are preferably driven for one second , when the brake lights first come on , or when an ir signal from a leading vehicle is detected . this feature allows automatic turn - on of the brake lights of the following vehicle while limiting the possibility of reception by vehicles in other lanes , when many vehicles are so equipped . the ir leds typically have a narrow output angle of about 50 degrees , and typical ir detector diodes have an even narrower pickup angle . however , it is preferred that the detector diodes as well as the leds be shrouded for further decreasing the possibility of interference pickup from adjacent lanes . the detector and associated receiver electronics can be mounted inside the passenger compartment near the center mirror , detecting through the windshield for long - term clarity , cleanliness , and reliability . the output from the detector triggers a two second timer to turn on the brake lights until the driver reacts to press the brake pedal . if the driver chooses not to brake , then only a short flash will be seen . in that case , a next - following driver is not likely to react with braking , although a heightened state of alertness is likely to result . with reference to fig1 - 5 of the drawings , exemplary apparatus 10 of the present invention is installed on a vehicle 20 , the vehicle having a brake pedal 22 or equivalent operatively connected to a brake actuator 24 for applying vehicle brakes 26 , a brake light switch 28 activating a brake light 30 in a conventional manner upon and during application of the brakes . a rear - facing infrared ( ir ) transmitter 40 is connected to the brake lights , being activated in response to operation of the brake light switch 28 , for producing rearwardly directed radiation from the vehicle 20 when its brakes are applied . an ir receiver 60 is oriented for detecting like radiation from another vehicle that the vehicle 20 is following , the receiver 60 also being connected to the brake light switch of the vehicle 20 for activating the brake light 30 independently of operation of the brake actuator 24 . fig2 shows three of the vehicles , designated 20 a , 20 b , and 20 c , in a line , each of the vehicles 20 being equipped with counterparts of the apparatus 10 . the vehicles 20 a and 20 c are typical passenger automobiles , and vehicle 20 b is a van truck . the passenger vehicles 20 a and 20 c preferably have the ir receivers mounted behind the windshield , together with the rear - view mirror ( that of vehicle 20 c only being shown ), whereas the truck 20 b ( being taller ) has the receiver 60 mounted near the bottom of the windshield . the automobiles 20 a and 20 c preferably have the ir transmitters 40 mounted high , such as adjacent an upper stop light assembly , if present , whereas the truck 20 b has the ir transmitter 40 mounted relatively lower such as together with the stop light 30 as shown in fig2 , a high mounting being typically much higher than the height of automobiles . with particular reference to fig3 , the transmitter 40 includes a first power regulator 42 for powering a series - parallel ir led emitter array 44 , the regulator having a storage capacitor 46 . a second power regulator 48 feeds a pulse generator 50 that is enabled by a burst timer 51 for driving a solid - state switch 52 , periodically grounding the ir array at high repetition rate and low duty - cycle during an interval of approximately one second . preferably the emitter array 44 is provided with a shroud 54 for avoiding transmission of radiation to adjacent lanes . the shroud 64 is configured for reducing the radiation angle of the array ( or of the leds individually ) to approximately five degrees . suitable devices for the switch 52 include power mosfets having low rdson , one such commercially available device being irlz44n for switching up to 31 amps from 5 volt logic . a preferred pulse repetition rate is 1000 times per second , with a 10 , 20 , or 30 microsecond pulse width ( corresponding to a duty cycle of one , two , or three percent ), which allows a much higher pulse power output than is practical on a continuous basis . the longer pulse widths provide greater range and power , the modulation at the same time allowing the signal to be selectively detected , using a filter having a corresponding pass frequency ( 1 khz in this case ), thereby eliminating unwanted interference . this frequency ( 1 khz in this example ) would be the standard pulse repetition frequency , allowing every vehicle to be responsive to the braking transmissions of every other vehicle that is equipped with the present invention . this frequency also permits the receiver to achieve substantially instant brake light activation . the first and second power regulators 42 and 48 are preferably powered from the brake light switch 28 for wiring simplicity , the first regulator 42 being current - limited such as to approximately 3 a for limiting inrush current to the storage capacitor 46 , which is preferably of large value such as 10 , 000 μf , for high - current pulse drive of the emitter array 44 as described above . once the capacitor is charged , the average current drawn at 12v is far less than the peak current powering the leds for only 10 microseconds . the first power regulator preferably is set for approximately 10v , with current limiting to approximately 3 a . the second regulator 48 can be a conventional voltage regulator , preferably set for 5v , a convenient operating voltage for the pulse generator 50 which can be a suitable 74 - series integrated circuit , the regulator 48 having a relatively lower current rating such as 100 ma . initial charging of the storage capacitor 46 , with current limiting in the first power regulator 42 as described above , does result in a slight delay in achieving full power output of the ir leds 44 ; however , this delay is relatively negligible , on the order of 5 ms . the burst timer 51 is configured for disabling the pulse generator 50 after a suitable period such as one second , for decreasing the possibility of spurious reception by other vehicles equipped with the present invention that are in adjacent lanes . the burst timer 51 can be implemented conveniently in a known manner based on capacitive discharge or using a pulse counter . fig4 shows an exemplary configuration of the receiver 60 , including an ir sensor 61 and an associated preamplifier 62 and pulse amplifier 64 . more particularly , and as shown in fig5 , the ir sensor itself is preferably a pin ir photodiode having a peak response at 890 nm . the preamplifier 62 includes an integrated operational amplifier 621 which is powered from a conventional 5 - v regulator ( not shown ), and having a feedback inductor 623 , the amplifier being configured for removing 60 hz pickup from streetlights , etc . it was discovered that the feedback inductor 623 materially improves rejection of ambient light interference . preferably the ir sensor 61 is provided with a shroud 63 for excluding reception of radiation from adjacent lanes . the shroud 63 is configured for reducing the reception angle of the sensor to approximately five degrees . the received signal from the sensor 61 and preamplifier 62 , having a duration of approximately 10 μs as generated in the above - described exemplary configuration of the ir transmitter 40 , is capacitively coupled to a counterpart of the operational amplifier , designated 641 , of the pulse amplifier 64 as further shown in fig5 . a suitable integrated circuit for both operational amplifiers 621 and 641 is available as device mcp 6022 from a variety of sources . a suitable device for use as the ir sensor 61 is similarly available as pin photodiode el - pd333 - 2c / ho1 . 2 . the pulse amplifier 64 drives a ( 1 khz ) bandpass filter 66 , preferably an active high - q filter for discriminating against spurious radiation . the filter 66 thus “ tunes ” the receiver to signals having a pulse repetition rate of 1 khz , thereby further eliminating interference . the resulting 1 khz sine wave is fed through a rectifying diode detector 67 and compared with a reference voltage in a comparator 68 for producing a logic signal which feeds a timer 70 for activating a lamp driver 72 , the output of which is connected to the brake light 30 . the timer 70 has an active duration of approximately two seconds ; consequently , the brake light is activated for that interval only , unless the interval is extended by operation of the vehicle brakes 26 . the apparatus 10 as described above has been tested , the results confirming an active range of approximately 75 feet . however , improved discrimination at the 1 khz signal frequency was found to be desirable . with further reference to fig6 , a preferred alternative configuration of the receiver , designated 60 ′, provides increased range and immunity from spurious signals . the receiver 60 ′ includes counterparts of the sensor 61 , preamplifier 62 , and of the pulse amplifier , designated 64 ′ ( having increased high - frequency gain ). the pulses , which are 10 μs in duration in the exemplary configuration of the ir transmitter 40 when a valid signal is being received , are directly fed to an inverted counterpart of the comparator , designated 68 ′, for passing pulses that exceed a predetermined amplitude greater than a noise amplitude . the comparator 68 ′ is connected to a schmitt trigger 69 , which triggers a counterpart of the timer , designated 70 ′ for producing corresponding pulses of uniform width being half the period of the pulse repetition rate of the ir transmitter 40 , that is 500 μs in the preferred exemplary configuration described above . thus , when radiation from the ir transmitter 40 of a leading vehicle is received , the output of the timer 71 is a 5v p - p square wave , at 1 khz in this example . the output of the timer 70 ′ is fed through an adjustable attenuator 74 to a counterpart of the ( high - q ) bandpass filter , designated 66 ′, producing an approximate sine wave output of robust amplitude only when fed at nearly exactly 1 khz . this output of the filter 66 ′ is passed through a counterpart of the diode detector 67 to a counterpart of the schmitt trigger , designated 69 ′, which activates a counterpart of the timer 70 that feeds a counterpart of the lamp driver 72 for activating the brake light 30 as described above . the apparatus 10 including the ir receiver 60 ′ as described above has also been tested , the results confirming an extended active range of approximately 100 feet , and with improved discrimination and noise immunity . with further reference to fig7 and 8 , another alternative configuration of the ir receiver , designated 60 ″, is responsive to vehicle speed for disabling operation below a predetermined speed such as 10 mph . the receiver 60 ″ includes counterparts of the ir sensor 61 , preamplifier 62 , pulse amplifier 64 ′, comparator 68 ′, schmitt trigger 69 , and the timer 70 ′. the receiver 60 ″ also includes counterparts of the adjustable attenuator 74 , band - pass filter 66 ′, diode detector 67 , schmitt trigger 69 ′, timer 70 , and the lamp driver 72 as described above for the receiver 60 ′. the timer 70 is enabled by a speed controller 78 that receives a vehicle speed signal from the vehicle 20 . under modern practice ( since 1985 ) typical vehicles no longer use traditional ( bowden ) speedometer cables , the speed timer being configured for receiving speedometer pulses having a 10 mph pulse rate of between 10 and 150 per second . thus the receiver 60 ″ is operative for activating the brake light 30 for 2 seconds in response to validly received ir signals unless the vehicle is traveling at or under approximately 10 mph . with further reference to fig9 and 10 , an alternative configuration of the apparatus , designated 10 ′ has a microprocessor implementation , which is consistent with recent developments in vehicle technology . the vehicle 20 , as is currently typical , includes one or more microprocessors ( not shown ) that communicate with vehicle components on a common signal bus 32 ( such as a canbus that is typically used in current vehicle manufacture ), a counterpart of the brake light switch , designated 28 ′, being activated by a brake light microprocessor 34 in response to signals on the signal bus 32 . the apparatus 10 ′ includes counterparts of the ir transmitter , designated 40 ′, and the ir receiver , designated 60 ′″, each being interfaced with the signal bus as described herein . the ir transmitter 40 ′ includes a transmit microprocessor 56 that is interfaced with the signal bus 52 , being programmed for driving the solid state switch 52 directly or , if necessary through a suitable buffer ( not shown ). the microprocessor 56 monitors the signal bus 32 for activation signals addressed to the brake light microprocessor , programmed activation of the solid state switch 52 being a series of pulses ( 10 μs in duration with a repetition rate of 1 khz and terminating after one second as described above in connection with the pulse generator 50 , or other suitable combination ), the pulses preferably terminating after one or two seconds as described above in connection with the burst timer 51 . a counterpart of the first power regulator , designated 42 ′, can be powered directly from a suitable switched battery bus , typically 12v , there being no particular advantage in powering from the vehicle brake light switch in this signal bus implementation of the apparatus 10 ′. also , since the regulator 42 ′ commences charging the bypass capacitor 46 as soon as the battery bus is switched on , there is no associated delay in activation of the emitter array 44 from the time the solid state switch 52 is first activated by the transmit microprocessor 56 . optionally , transmitter 40 ′ includes an auxiliary counterpart of the brake light switch , designated 28 ″, for driving an auxiliary counterpart of the brake light , designated 30 ′. the auxiliary brake light 30 ′ can be mounted together with the emitter array 44 . as described below , the auxiliary brake light 30 ′ can be operated in unison with the vehicle brake light 30 as described above or , for example , only when the emitter array is activated , the vehicle brake light 30 being conventionally activated only in response to application of the brakes 26 . alternatively , the auxiliary brake light 30 ′ can be activated both during brake application and activation of the emitter array , the vehicle brake light activation also being restricted to brake application . in another alternative , further described below , the transmit microprocessor 56 can be programmed for addressing the brake light microprocessor 34 and activating the vehicle brake light 30 during activation of the emitter array 44 , the brake light 30 also being conventionally activated during brake application . in this alternative the auxiliary brake light 30 ′ and associated auxiliary brake light switch 28 ″ can be omitted . the ir receiver 60 ′″ includes counterparts of the ir sensor 61 , the preamplifier 62 , the pulse amplifier 64 ′, the comparator 68 ′, the schmitt trigger 69 , and the timer 70 ′, the timer 70 ′ feeding a receive microprocessor 80 that is interfaced with the signal bus 32 . the microprocessor 80 is programmed for determining a validly received ir signal based on the pulse rate output of the schmitt trigger 69 , and addressing signals to the brake light microprocessor 34 for activating the brake light 30 , the signals continuing for a limited duration such as two seconds as described above . fig1 shows a brake light control process 100 for operating the vehicle brake lights when an ir signal of proper frequency is picked up by the receiver 60 ′″. in the process 100 , a brake output register b is initialized to zero ( turning brake lights off , unless vehicle brakes are on ). optionally , for implementations activating the auxiliary brake light 30 ′, a check loop is entered ( and reentered if the brake lights are already on ). next , a counter c is set to zero and then incremented by ir pulses during an interval of t milliseconds ( 100 , for example ). the resulting count is compared against low ( l ) and high ( h ) limits ( 95 and 105 , for example ) for validity . if valid , the register b is set for activating the brake lights and the process pauses for s milliseconds ( 2000 , for example ), after which control is returned to the beginning , resetting register b to zero to turn off the brake lights ( unless the brakes are applied ). the process 100 can be implemented in a microchip processor using a basic compiler such as picbasic pro , available from micro engineering labs , inc ., of colorado springs , colo . using the preferred ir pulse repetition rate of 1 khz with the count interval t being 100 ms , exemplary values for l and h , respectively , can be 96 and 94 ( 95 & lt ;= c & lt ;= 105 ), corresponding to a received pulse repetition rate range of 950 to 1050 hz . in this example , the receive microprocessor 80 takes 100 ms to identify the received ir pulse frequency ( thus giving a 100 ms reaction delay to each vehicle ), whereas the bandpass filter 66 ′ requires less than 10 ms . assuming the sample interval remains unchanged ( 1 ms ), there is a trade - off between speed and accuracy . for example , using a count duration of 10 ms , one count corresponds to 10 %, that is from 900 to 1100 hz . it will be understood that other count intervals between 10 ms and 100 ms can provide corresponding trade - offs between speed and accuracy . in practice , however , much higher count rates are possible using current technology , and ir pulse rates higher than 1 khz are contemplated within the scope of the present invention . as described above , the transmit microprocessor 56 is operative for activating the emitter array 44 in response to brake light activation signals on the signal bus , regardless of their origination from the receive microprocessor 80 or the vehicle braking system . alternatively , the receive microprocessor 80 can be implemented for addressing the transmit microprocessor exclusively , at least in configurations wherein the vehicle brake light is to be operated only in response to vehicle braking . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . for example , the enlargement structure 15 can be separately formed and bonded to the base portion 14 . also , a relay can be substituted for the solid state switch 52 , although a delay on the order of 10 ms would be introduced . therefore , the spirit and scope of the appended claims should not necessarily be limited to the description of the preferred versions contained herein .
| 1 |
referring first to fig1 an apparatus for removing electrostatic charges from paper according to the present invention comprises an enclosure 10 having a door 12 . in the presently preferred embodiment , enclosure 10 is roughly cubical with an edge length of about 36 inches . enclosure size and configuration can be changed as desired according to how large a stack is to be treated , as long as components inside of enclosure 10 to be described below are sufficiently removed from one another to prevent high voltage arcing effects . the door 12 has a handle 14 and hinges 16 and 18 . enclosure 10 may also be provided with a lid 20 for permitting access to the interior of enclosure 10 through its top . a separate enclosure 22 contains the means for applying a high voltage gradient to a stack of paper placed within enclosure 10 . it will be obvious to one skilled in the art that any suitable commercially available high voltage power supply with or without incorporated switches and meters will suffice for this application . in the presently preferred embodiment , the enclosure 22 contains a high voltage supply 24 having an off / on switch 26 , indicator light 28 , and power fuse 30 . high voltage supply 24 also incorporates a voltage adjustment dial 32 , voltmeter polarity switch 35 , and an overload fuse 36 . the system output polarity is not affected by the switch on the front panel , although the polarity may be changed internally by connector reversal . a volt meter 38 and a milliammeter 40 are also incorporated into high voltage supply 24 . the high voltage supply used in the presently preferred embodiment has an operating range of 0 - 60 kv . above 60 kv the corona discharge is very difficult to contain , or control . also contained in enclosure 22 is high voltage supply timer control 42 which controls line power ( 115 vac ) to high voltage supply 24 . timer control 42 has a center dial 43 having an inner part 44 and outer part 46 . depression of center part 44 activates power supply 24 for an interval of time preselected by means of outer part 46 . in the presently preferred embodiment , timer control 42 is a sixteen minute maximum range timer settable in one - half minute intervals . an indicator lamp 47 indicates operation of timer control 42 . turning now to fig2 the interior elements of enclosure 10 can now be seen . specifically , it can be seen that the walls of enclosure 10 are of two layers , an exterior layer 48 and an interior layer 50 . exterior layer 48 is made of insulating material . the preferred embodiment uses one - half inch plywood . interior layer 50 is made of a conducting material such as sheet aluminum . one skilled in the art will readily appreciate that the entire enclosure may be fabricated from aluminum or other conductive metal , although this would be more costly than the choice of materials in the presently preferred embodiment . also in fig2 one can see lid 20 drawn in phantom in a partially opened position . lid 20 has attached to it hooks 52 , which hook into eyelets 54 disposed in the interior of enclosure 10 . also inside enclosure 10 is treatment platform 56 . in the presently preferred embodiment , treatment platform 56 is an electrically conductive plate measuring about 18 × 18 × 1 / 8 inches . this plate may be of any desirable size as long as its edges are sufficiently distant from the interior of enclosure 10 . also , the edges of treatment platform 56 must be rounded to reduce high voltage arcing effects . treatment platform 56 is supported by four insulating posts 58 . the insulating posts 58 in the presently preferred embodiment are comprised of ceramic and are about 71 / 2 inches high . their height is selected to prevent arcing between treatment platform 56 and the floor or enclosure 10 . enclosure 10 also contains door actuated roller mechanism 60 . door actuator roller mechanism 60 is comprised of a pivot 62 , on which turns arms 64 and 66 and shorting arm 68 . arm 64 is provided with roller 70 which frictionally engages door 12 . arm 66 is attached to spring 72 which is also connected to the interior of enclosure 10 . spring 72 tends to pull the end of arm 66 remote from pivot 62 towards the interior of enclosure 10 . shorting arm 68 bears a high voltage cable 69 . arms 64 and 66 and shorting arm 68 are rigidly interconnected so that shorting arm 68 does not contact treatment platform 56 when door 12 is closed , but places cable 69 in contact with platform 56 when door 12 is open . cable 69 is electrically connected to resistor 74 , which is disposed in the interior of enclosure 10 on insulating posts 76 . the other end of resistor 74 is connected to ground . platform 56 is connected to the high voltage supply through coaxial cable 78 . the sheathing of coaxial cable 78 is connected at one end to the interior 50 of enclosure 10 and at the other end to ground . the center conductor of coaxial cable 78 is guided to treatment platform 56 through pipe 80 . pipe 80 is comprised of electrically insulative material . pipe 80 is secured to treatment platform 56 by an encircling outer circumference of the female pipe connector 82 . cable 78 is secured to the exterior of enclosure 10 by bracket 84 by wing nut means 92 electrically connected to an internal shield by a through bolt 93 . a center conductor of coaxial cable 78 plugs into the inner circumference of copper pipe 82 . as seen in fig3 edges 87 and 89 of treatment platform 56 are provided with polyethylene sleeves 86 to prevent the effects of corona discharge . in the preferred embodiment , sleeves 86 are slit polyethylene tubing secured to edges 87 and 89 with a silicon - based adhesive . also visible in fig3 are microswitches 88 and 90 which are open when door 12 is open and closed when door 12 is closed . electrically , these microswitches are interposed between timer control 42 and high voltage supply 24 . also visible in fig3 are magnetic door latches 92 . the electrical connection between various components is most readily perceived in fig4 . a line voltage source 94 is connected to timer control 42 through on / off switch 26 , to indicator lamp 28 , and fuse 30 . timer control 42 is connected to the adjustable high voltage supply 24 through microswitches 90 and 88 . high voltage supply 24 is connected to treatment platform 56 through fuse 36 , milliammeter 40 , and coaxial cable 78 . polarity and magnitude control 25 , controlled by voltage adjustment dial 32 , and polarity switch 35 in fig1 is connected to high voltage supply 24 . high voltage meter 38 is connected in parallel with treatment plate 56 . when switch 80 , corresponding to shorting arm 68 , is closed , treatment plate 56 is also connected to ground through resistor 74 . interior surfaces 50 of enclosure 10 are connected to ground and serve as both opposing electrodes and shield for platform 56 . in use , an apparatus for removing electrostatic charges from paper arranged in stacks according to the present invention operates as follows . door 12 is opened and the stack of papers is placed within enclosure 10 atop platform 56 , care being taken not to allow too much overlap of the plate 56 with the edges of the sheets [ the overlap cannot be great enough to permit breakdown of the dielectric -- paper -- and arcing to the inside of the enclosure ]. while door 12 is open , shorting arm 68 contacts it , thus draining off any charge which may reside on the plate due to previous charging operations . also , microswitches 88 and 90 are open thus disabling high voltage supply 24 and protecting the user from the hazard of electric shock . once the stack of papers has been properly positioned atop plate 56 , door 12 is closed . door 12 is retained in the closed position by magnetic latches 92 . closing door 12 closes microswitches 88 and 90 . then inner part 44 of center dial 43 of high voltage supply timer control 42 is depressed , thus activating high voltage supply 24 for a period of time preselected by use of outer part 46 . this time period depends on stack height and type of paper . to discharge the charges on an eight inch stack of computer form paper , for example , the stack is subjected to 55 kilovolts for four minutes . if a smaller stack is used , less time is required . after the preselected amount of time , high voltage timer control 42 deactivates high voltage supply 24 . the stack of paper is then removed , having been rendered more susceptible to manipulation in subsequent handling operations . although only one embodiment of the invention has been described in detail above , those skilled in the art will readily appreciate that many modifications are possible without departing from the novelty teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention as defined by the following claims .
| 7 |
fig1 is a perspective exploded view of a first embodiment of the present invention . it shows a pressure bulkhead 1 having a longitudinal axis 17 . in this embodiment the bulkhead 1 has a circular or oval shape and comprises a frame 2 and a bulkhead main portion 3 . the bulkhead main portion 3 consists of a reticular component 5 , which is formed by a braided cloth 11 with a peripheral rim 12 . on the left side of the frame 2 there is an inside of a not shown interior of an aircraft , indicated by the reference sign a . reference sign b indicates an outside , e . g . the rear of the tail of the aircraft not shown . the frame 2 supports the bulkhead main portion 3 which is fixed to the frame 2 as shown in fig2 and in an enlarged sectional view in fig3 . fig2 ( above ) illustrates a plan view of the assembled bulkhead 1 from the inside a and from the outside b ( below ). as can be seen from fig2 , the cloth 11 is attached to the frame 2 from the outside b as illustrated in fig3 . fig3 is an enlarged schematic sectional view of an exemplary attachment of the bulkhead according to the first embodiment of fig1 to a fuselage 10 of the aircraft . in this example the frame 2 has a rectangle or cross - section or may have another cross - section and may be a hollow profile made of aluminium , such as aluminium 7150 . the cloth 11 is attached to the frame 2 on its surface facing to the outside b and on the outer peripheral surface facing to the fuselage 10 . the frame 2 is fixed to the fuselage 10 by first fixing elements 15 , e . g . rivets . for example , these rivets 15 may fix the attached cloth 11 as well . further and / or other methods for fixing the cloth 11 may be used , e . g . a suitable adhesive or the same . as can be seen from fig3 , the pressure bulkhead 1 is a flat element under unloaded condition . this is a significant advantage because the areas next to the bulkhead 1 are easy to access and to maintain . the cloth 11 may be made of braided ligament elements 6 as can be seen from fig4 in an enlarged view . the ligaments 6 are woven in a specific manner so that an airtight structure is achieved . thus , the cloth 11 will bear only tensional stresses under loaded condition , for example when the inside a ( see fig3 ) is under cabin pressure . in case of positive or negative pressure gradients , only tensional stresses will occur in the cloth 11 . furthermore , fig4 shows an opening 14 with so called polar weaves 13 in the cloth 11 . this type of opening may be used for airtight passage of e . g . conduits if necessary . the best position of such an arrangement can be found by finite elements analysis of the bulkhead . fig5 illustrates a standard cloth 11 with a circular shape . in an alternative embodiment the cloth 11 may comprise more than one layer of braided ligaments 6 . these layers may be standard fabrics stacked in a quasi orthotropic sequence . due to the airtight structure no resins or the like are necessary . therefore , the number of parts and time of manufacturing are significantly reduced . the cloth 11 may be made of aromatic polyamide fibres also known as aramide fibres . this material provides an excellent flame resistance and is a non toxic material . it has a functionality to ensure air tightness even if penetrated by a small particle ( e . g . shot bullet ). the examples shown in fig1 to 5 are of a diameter of approximately 4 m . fig6 is a perspective exploded view of a second embodiment of the present invention . it illustrates a pressure bulkhead 1 ′ having a longitudinal axis 17 . in this example , the bulkhead 1 has a circular or oval shape and comprises a frame 2 and a bulkhead main portion 3 . the bulkhead main portion 3 consists of two reticular components 5 ′ and 5 ″, which are formed by ligament elements 6 ′, 6 ″ in the shape of belts . on the left side of the frame 2 there is the inside , indicated by the reference sign a of a not shown interior of an aircraft . reference sign b indicates the outside , e . g . the rear part of the tail of the aircraft not shown . the frame 2 supports the bulkhead main portion 3 which is fixed to the frame 2 as shown in fig9 similar as shown in fig3 . the ligaments 6 ′ of the reticular component 5 ′ are arranged in a manner so that they extend radially in at least one first layer and one second layer , respectively and form at least two retaining layers for a sealing element 4 arranged between said retaining layers . the ligaments 6 ′ of the first retaining layer on the outside b are connected with inner ends 7 to a circular central belt 8 as can be seen from the right view of fig7 . the outer ends of the ligaments 6 ′ are connected to a peripheral belt 9 . these connections may be formed by sewing or the same . as shown in fig8 , the ligaments 6 ″ of the second retaining layer on the inside a may be smaller than the ligaments 6 ′ of the first layer due to the possible load they have to bear . these ligaments 6 ″ are connected together in a central region and are connected with their outer ends to the peripheral belt 9 as well as the sealing element 4 . according to this embodiment the sealing element 4 is made of a thermoplastic membrane which is flat under unloaded condition and retained by the ligaments 6 ′, 6 ″ of the retaining layers in case of loaded condition . the ligaments 6 ′, 6 ″ are loaded only by tensional stresses in both cases , positive and negative pressure gradients . the peripheral belt 9 and the ligaments 6 ′, 6 ″ and the sealing element 4 connected thereto is fixed to the fuselage 10 via the frame 2 for example as shown in fig9 . as can be seen from fig9 , the sealing element 4 and the ligaments 6 ′, 6 ″ are fixed to the frame 2 by second fixing element 16 , e . g . rivets . further and / or other fixing methods may be used . in the second embodiment of the present invention 250 ligaments 6 ′ and 4 ligaments 6 ″ are used for example . they form a flat bulkhead . regarding the sizing of the shown examples it has to be noted as follows : the dimension of each part has been obtained for a circular fuselage having a diameter of about 4 m . an analytical model of the ligaments 6 , 6 ′, 6 ″ based on the catenary &# 39 ; s equation has been used to evaluate the stability of the bulkhead . the load case taken into account is the maximum positive pressure gradient at ultimate level ( 2 δp = 1 . 234 bar ) that results the most critical one . all the results obtained , in terms of stress and strain , are compatible with the mechanical properties of the materials selected , while the resulting high frequencies of the first two modes of the frame ensure its stability at ultimate level . the results of this test show a maximum displacement of the bulkhead main portion 3 of the first embodiment of about 196 mm and of the second embodiment of about 453 mm . the present invention eliminates the disadvantages of the state of art mentioned above as follows . the pressure bulkhead 1 , 1 ′ is a flat element and has a less area with respect to a bulkhead with a single or double curvature . the pressure bulkhead 1 , 1 ′ has a reduced thickness and does not need any stiffeners . it cannot buckle because it is a membrane that exhibits only tensional stresses . for these reasons the weight is reduced and the manufacturing problems are reduced . furthermore , the pressure bulkhead 1 , 1 ′ does not need expensive curing cycles , so the manufacturing time is reduced . less material is needed with respect to the state of the art . the advantages are reduced thickness , no stiffeners , cost reduction and reduction of manufacturing time . it will be apparent that modifications can be made to the embodiments described above . for example , the cloth 11 may be soaked with an appropriate material to achieve a specific high level of air tightness . the pressure bulkhead 1 , 1 ′ may have an other shape than circular or oval shape . the ligaments 6 , 6 ′, 6 ″ may be made of materials with same or better characteristics than the mentioned ones .
| 1 |
in the lamp according to the invention , the synthetic resin member connects in radial directions , i . e . directions transverse to the axis of the lamp vessel , the end portion of the lamp vessel to the lamp cap . as a result , there is a comparatively large surface of application for the synthetic resin member to both the lamp vessel and the lamp cap . moreover , size differences in these components are more readily neutralized and the lamp cap can be more readily positioned correctly coaxially to the lamp vessel . the lamp vessel , the synthetic resin member and the lamp cap are then arranged substantially coaxially . the torsional strength of the connection between the lamp vessel and the lamp cap is materially improved as compared to the known lamp , due to the fact that the end portion of the lamp vessel is non - circular in cross - sections transverse to the axis of the lamp vessel . for example , the end portion may be oval or may have one or more depressions , for example transversal or axial grooves , in which the synthetic resin member adheres and which are filled with the synthetic resin . the end portion can have a projection which extends transversely to the axis of the lamp vessel and projects into the synthetic resin member . such a projection neutralizes shearing forces in the interface between the lamp cap and the synthetic resin member . the uniformity of the forces in this interface is larger when several , for example two or more , of such projections are distributed along the circumference of the end portion . such projections are readily obtained during the operation in which the end portion of the lamp vessel is shaped . this operation is a normal step in the manufacture of conventional lamps whose lamp vessel is fixed in the lamp cap by means of cement . the projections have a particular advantage , which will be stated hereinafter . the adhesion of the synthetic resin member to the material of the lamp cap , generally metal , for example copper alloys , such as copper - nickel , brass or tombak , stainless steel , aluminum , new silver or nickel - plated metals , is generally stronger than to glass of the lamp vessel . nevertheless , the inner surface of the lamp cap where it is in contact with the synthetic resin can be profiled to enlarge the application of the synthetic resin thereto . a good possibility is to use for this purpose an inwardly depressed metal lamp cap . the depression ( s ) is ( are ) then at least tangentially enclosed in the synthetic resin . in a particular embodiment of the lamp according to the invention , a current supply conductor to the light source is clamped between the synthetic resin and the sheath of the lamp cap . in lamp caps having a metal sheath , it has surprisingly been found that a good electrical contact between this sheath and this conductor is obtained . in fact it has been found that it is possible in this manner , for example with swan - s lamp caps , i . e . swan lamp caps having only one contact at the base portion and one contact at the sheath , and with edison lamp caps to connect the contact at the sheath of the lamp cap to a current supply conductor without using a soldering or welding operation . this means a very considerable simplification and acceleration of the manufacturing process , the more so as a current conductor emerging from the lamp over the edge of its cap can be situated at any point along the circumference of this edge . this is in contrast with a current conductor that can emerge from the base portion of the lamp cap only at one given area . therefore , before this current conductor can be fixed , it has first to be ascertained where this conductor is situated . another important advantage is that the relevant current supply conductor is now allowed to be so short that it does not emerge from the lamp cap . a loose wire outside the lamp cap , which may be touched in conventional lamps while it is alive , is not possible in this embodiment in which the current supply conductor remains inside the lamp cap . this embodiment renders welding or soldering of contacts entirely superfluous in lamps having two lamp caps each having a sheath contact , such as in a lamp having festoon caps . very satisfactory results are attained with at least substantially aromatic polyethersulphones , marketed under the tradename victrex by ici and having the structure of a repeating unit shown in fig6 of the drawings . the polyethersulphones may have a filling of mineral powders , such as sio 2 , caco 3 , mgo , zno , baso 4 , al 2 o 3 , but alternatively of fibres , such as glass fibres . the lamp according to the invention may be one of several kinds , for example an incandescent lamp , in which the light source is a filament . the filament may be surrounded by an inner bulb which is arranged in the lamp vessel . the lamp may alternatively be a discharge lamp , for example a low - pressure discharge lamp , such as a low - pressure mercury discharge lamp . the light source is in this case an ionizable mercury - containing gas with electrodes that may be arranged in the lamp vessel . inside the lamp vessel , the gas filling may be present in an inner bulb , such as in a low - pressure sodium discharge lamp . the lamp may alternatively be a high - pressure discharge lamp , such as a high - pressure sodium discharge lamp , which emits at least substantially white light . the light source is in this case a sodium - containing ionizable gas in a crystalline inner bulb provided with electrodes . the lamp according to the invention can be very readily manufactured . it has proved to be favorable to arrange a preformed ring of the polyethersulphone around the hot end portion of the lamp vessel . it is favourable to carry out this step while this end portion is still hot , for example has a temperature of 400 °- 450 ° c . due to the operation in which this portion is shaped . in an embodiment of the method , the ring is brought to an elevated temperature , for example 150 °- 200 ° c . the ring adheres , when it is provided , to the hot surface of the end portion . if desired , the ring around the end portion may then be shaped by means of a jig . the jig may have an elevated temperature , for example of 150 °- 200 ° c . subsequently , the lamp cap is provided . the lamp cap is heated for this purpose at a temperature of about 400 °- 450 ° c . the temperatures are not critical . at temperatures at the level of 400 ° c ., the synthetic resin material rapidly softens and adheres . at temperatures at the level of 200 ° c ., the ring retains its shape and does not adhere to objects with which it is in contact . on adhesion to objects at a temperature of about 400 ° c ., a connection is obtained which becomes stronger upon cooling . when a current supply conductor is bent around the ring provided on the end portion , an electrical connection is obtained with the lamp cap during the step of providing the lamp cap if this lamp cap has a metal sheath . these steps of connecting the cap and making an electrical contact require only a few , for example 3 to 4 seconds , while , when using a conventional cement , times of up to 25 seconds are required for curing the cement only . as a result , in conventional lamps , the step of mounting the lamp cap is one of the slowest assembling steps , so a material improvement is achieved by use of the invention . the ring of synthetic resin has in a favorable embodiment a conical shape , for example with an apic angle of 2 × 5 °. this shape facilitates the step of providing the ring around the end portion of the lamp vessel . in many cases , the lamp vessel is moreover conical at the free end of its end portion , because glass mouldings cannot be made with sharp shapes . one or more projections at the end portion of the lamp vessel are particularly favorable means for enlarging the grip of the synthetic resin on the lamp vessel . the ring of synthetic resin can then have at its inner surface one or more grooves , which are caused to engage these projections . a ring having a smaller wall thickness can be used while maintaining its enlarged grip if this ring has at its wide end one or more recesses with which the ring laterally engages a projection . these embodiments make it possible to provide the ring around the end portion in a simple manner , by slipping the ring onto the end portion while requiring only a small quantity of synthetic resin . similar recesses at the narrow end of the ring or grooves in the outer surface of the ring may be present to receive inward depressions in the lamp cap . eu ps 186 , 827 a2 discloses a lamp of pressed glass whose lamp cap is connected via a skirt of synthetic resin to the bottom of the lamp vessel . the sleeve then replaces a metal collar and a glass body through which in conventional lamps of pressed glass the bottom of the lamp vessel is connected to the lamp cap . the skirt of synthetic resin has a wide collar portion with longitudinal slots and internal nose - shaped projections , which under elastic deformation of the collar portion are caused to engage cavities in the bottom of the lamp vessel . as a result , a mechanical coupling is obtained between the lamp vessel and the skirt . at its outer surface the skirt has parts of screw - thread onto which the edison lamp cap is screwed , while it further has in its outer surface recesses in which the lamp cap is depressed in order to lock the screw connection between the skirt and the lamp cap against displacement . the skirt is consequently secured mechanically both to the lamp vessel and to the lamp cap . the skirt is more than a means for coupling the lamp vessel to the lamp cap . it is an insulator body between the lamp vessel and the lamp cap and a body which causes the length of the lamp to be considerably greater than in the case of a direct connection of the lamp cap to the lamp vessel . the synthetic resins that can be used for the sleeve include polyethersulphones . an embodiment of the lamp and the method according to the invention will be described more fully with reference to the drawing . as shown in fig3 this lamp has a translucent glass lamp vessel 1 having an axis 2 and an end portion 3 . a filament 4 serving as the light source is arranged in the lamp vessel 1 . in the lamp cap 5 , which has a sheath portion 6 and base portion 7 , the end portion 3 of the lamp vessel 1 is fixed by means of a thermoplastic synthetic resin member 8 so that the synthetic resin member adheres both to the lamp vessel and to the lamp cap . the lamp cap 5 has an electrical contact at the sheath 6 to which a current supply conductor 11 to the light source 4 is connected . a base contact 9 at the base portion 7 is connected to a second current supply conductor 12 to the light source 4 . as the thermoplastic synthetic resin use is made of polyethersulfone containing 30 % by weight of glass fibre . the synthetic resin member 8 bonds the end portion 3 of the lamp vessel 1 in directions transverse to the axis 2 of the lamp vessel 1 to this lamp vessel . the synthetic resin member 8 and the lamp cap 5 consequently surround the end portion 3 and the synthetic resin member 8 , respectively , substantially coaxially . the end portion 3 has non - circular cross - sections transverse to the axis 2 of the lamp vessel 1 in which the end portion 3 is in contact with the synthetic resin . in the embodiments shown in fig1 this non - circularity is due to a projection 10 which extends transversely to the axis 2 and projects into the synthetic resin member 8 ( fig5 ). although this is not visible in fig1 the end portion 3 has diametrically opposite to the projection 10 a second similar projection ( 14 in fig3 ). the projections 10 , 14 are distributed regularly along the circumference of end portion 3 . the current supply conductor 11 is in electrical contact with the lamp cap 5 on the inner side of this lamp cap due to the fact that this conductor 11 is clamped between the synthetic resin member 8 and the sheath portion 6 of the lamp cap 5 . the synthetic resin member 8 employed in the lamp of fig1 is a conical ring , the wide end of which is provided with two diametrically opposed recesses of which only one , 13 , is shown in fig2 a cross - sectional view of said ring . the synthetic resin employed in the member 8 is a polyethersulfone , the structural formula of a unit of which is shown in fig6 . steps in a method of mounting the lamp cap according to the invention will now be described with reference to fig1 fig2 and fig3 . in fig3 the lamp vessel 1 is shown rotated through 180 ° with respect to fig1 and is held in position by a holder 20 . the end portion 3 has a temperature of 400 ° to 450 ° c . due to a shaping and cleaning process , at the end of which process the lamp vessel 1 was sealed in a vacuum - tight manner by closing the exhaust tube 15 . a thermoplastic synthetic resin ring 8 heated at about 150 °- 200 ° c . is situated in a holder 21 accommodating heating elements 22 . the holders 20 , 21 are moved towards each other and the ring 8 is pressed on the end portion 3 , the ring melting at its inner surface and adhering to the end portion 3 . the recesses 13 in the ring 8 then engage the projections 10 , 14 . the ring consequently has a profile cooperating with the non - circular cross - sections of the end portion 3 . similar recesses may be present at the narrow end of the ring 8 in order to cooperate with depressions that may be present in the lamp cap 5 . a shaper 23 in fig4 which internally is oversized with respect to the interior of the lamp cap 5 , is moved to the holder 20 to shape the external surface of the thermoplastic synthetic resin ring 8 . after the current supply conductor 11 has been shortened and bent and the current supply conductor 12 has been aligned substantially coaxially , a holder 24 ( fig5 ) with a lamp cap 5 shown diagrammatically , which is heated by means of , for example , a flame to a temperature of about 400 ° to 450 ° c ., is pressed on the ring 8 , this ring melting at its outer surface and adhering to the sheath portion 6 ( shown in fig1 ) of the lamp cap 5 . after the holder 24 is removed , the connection of the base contact 9 ( shown in fig1 ) with the current supply conductor 12 can be made and the lamp may be cooled by means of an air jet . alternatively , the current supply conductor 11 may be shortened before the ring 8 is mounted in the step shown in fig3 .
| 7 |
the device of the present invention is generally adapted for use in an apparatus for measuring the concentration of analytes , such as alcohol , cholesterol , proteins , ketones , enzymes , phenylalanine , and glucose , in biological fluids such as blood , urine , and saliva . for brevity , we describe the details for using the device in connection with self - monitoring of blood glucose ; however , a person of ordinary skill in the art of medical diagnostics would be able to readily adapt the technology for measuring other analytes in other biological fluids . self - monitoring of blood glucose is generally done with meters that operate on one of two principles . the first is the photometric type , which is based on reagent strips that include a composition that changes color after blood is applied . the color change is a measure of the glucose concentration . the second type of blood glucose monitor is electrochemical and operates on the understanding that blood applied to an electrochemical cell can cause an electrical signal -- voltage , current , or charge , depending on the type of meter -- that can be related to the blood glucose concentration . the present invention permits convenient , remote dosing for both photometric and electrochemical systems . for brevity , the description below focuses on a photometric system . similar devices can be used with an electrochemical system . with either type of system , the present device permits the meter to monitor the complete course of the reaction , from the time the sample is applied until a glucose determination is made . the ability to measure the test start time makes it easier to determine the glucose concentration accurately . there are some advantages to using a photometric rather than an electrochemical system to make a glucose determination . one advantage of a photometric system is that measurements can be made at more than one wavelength of light , and corrections can be made for variations in blood hematocrit . the disposable disclosed here provides these advantages of the photometric system , while also permitting minimal meter contamination . the disposables used in photometric measurement systems are generally made in the form of a thin rectangular strip . the shape derives from the original so - called &# 34 ; dip and read &# 34 ; test strip configuration . one end serves as a handle , while the chemical reaction with the fluid sample is carried out at the other end . these rectangular disposables form the male portion of the interface with the meter . that is , the strip is retained by features on the meter that enclose the disposable . this method of retention invites contamination of the meter with the fluid sample . in order to avoid the problems of contamination the present disposable takes the form of a hollow frustum , which provides the female portion of the interface with the meter . that is , the disposable encloses a portion of the meter and serves as a cover to prevent contamination of the meter by the fluid sample . fig1 depicts in partial cutaway an embodiment of this invention in which the disposable 10 is a hollow frustum of a cone . membrane 12 is attached to the smaller end 14 . optional lip 16 provides a surface to which membrane 12 is attached with adhesive 18 . optional indentations 20 are spaced around the circumference of the cone to provide a retention mechanism , in conjunction with a groove on a meter . fig2 is a cross section of the disposable of fig1 taken along the line 2 -- 2 . as shown in fig2 the membrane is attached to the outside of the disposable . alternatively , as shown in fig1 , the membrane may be attached to the inside of the disposable . fig3 is an exploded perspective view of a photometric meter and a disposable device of the type shown in fig1 . meter 30 has an elongated configuration with a distal section 32 that is a substantially cylindrically symmetrical frustum , along whose perimeter is optionally a groove 34 . note that the disposable nests on the distal section of the meter in such a way that there is an accurately defined gap g between the distal end 36 of meter 30 and the bottom surface of membrane 12 . the accurate positioning contributes to measurement precision and reliability . in the cutout can be seen a light source 38 and detector 40 , which provide for illuminating a disposable and for detecting light reflected from the disposable , respectively . as discussed below , measuring light reflected from the disposable yields the glucose concentration in the sample applied to the membrane . although only one source and detector are shown in fig3 multiple sources , optionally having different output spectra , and / or multiple detectors may be used . fig4 is a perspective view of the way in which a device and meter of fig3 can be used to obtain a sample s from a stuck finger tip . it is quite easy for the user to bring the disposable into contact with the finger , which is a big advantage for users that have impaired vision . fig5 is a cross section of part of distal section 32 of meter 30 and disposable 10 , which illustrates the way indentations 20 and groove 34 positively locate meter 30 within disposable 10 , leaving gap g . note that gap g ensures that blood that penetrates through the membrane does not contaminate the meter . the gap dimension , while not critical , is preferably at least about 1 / 2 mm . an advantage of the device of the invention , when used with a meter of the type shown in fig3 is that the devices can be in a stack , nested conveniently in a container 42 , as shown in fig6 . a device can then be secured simply by inserting the distal section 32 of meter 30 into container 42 and engaging groove 34 and indentations 20 . after a test has been completed , a used disposable can be ejected into waste container w , as shown in fig7 provided there is an optional push - button ejection mechanism . push - button ejection mechanisms of the type that are widely known and used are suitable for this invention ( see e . g . ; u . s . pat . no . 3 , 991 , 617 ). one such mechanism is depicted in fig8 and 9 , which show a push - button mechanism mounted in a meter of the type shown in fig3 . the elements of the mechanism include shaft 44 , which joins ejector 46 and push button 48 . push button 48 works through shaft 44 to cause ejector 46 to disengage disposable 10 from the distal section 32 of meter 30 . spring 50 works to return the ejector 46 and push button 48 to their retracted position . push - button ejection , by permitting the disposable to be removed without direct contact , helps to avoid contamination . disposables to be used with push - button ejection mechanisms of the type shown in fig8 and 9 preferably have a flange 19 . fig1 depicts an embodiment of a meter of this invention , which includes a display 50 for depicting the analyte concentration measured by the meter . the display can be a light - emitting diode ( led ) display , a liquid crystal display ( lcd ), or similar display well known in the art . although the above description and figures contemplate a disposable having a circular cross section and meter having a distal section having a mating cross section , that geometry is not essential and , in fact , may not even be preferred . a primary consideration in selecting the geometry in a photometric system is the optical design . generally , reflectometry dictates at least a minimum angular separation ( typically 45 °) between a detector and specularly reflected light . this , in turn requires at least a minimum vertex angle of the conical disposable . however , it is an advantage to a user to be able to view his / her finger for dosing , and a large vertex angle interferes with that view . thus , a disposable having a rectangular cross section may be preferred , such as the hollow frustum of a rectangular pyramid 110 shown in fig1 . in that case , the angular separation between detector and specular - reflected light determines only the minimum feasible value of l , the longitudinal dimension of the larger open end . but the disposable could be smaller and provide less interference with a user &# 39 ; s view of his / her finger . furthermore , rectangular membranes can be fabricated from ribbons or sheets at less expense and with less waste of material . nevertheless , a circular cross section is advantageous when an array of several sources and / or detectors is used in the optical system . since contamination is possible if excess sample were to drop from the disposable , it is desirable to accommodate large samples , without dripping . various designs can serve to retain excess sample . one is shown in fig1 , 13 , and 14 . fig1 depicts the disposable of fig1 with indentations 124 on the small - end surface of the disposable . as shown in fig1 and 14 , the indentations allow capillary flow to fill the resulting gap between the membrane and the top inside surface of the device . an alternative way of forming such gaps is to adhere the membrane to the disposable with thick adhesive , leaving gaps to accommodate the excess sample . another way to absorb excess sample is to attach an absorbent pad 126 over the front surface of the membrane , as shown in fig1 . fig1 is an exploded perspective view of a meter and a disposable of the type shown in fig1 . the distal section 132 of meter 130 has an optional groove 134 , which is similar to groove 34 , for retaining the disposable . elongated neck 130 facilitates pickup of disposables from the elongated containers 42 shown in fig6 . display 150 depicts the measured analyte concentration . fig1 depicts an alternative embodiment of a meter adapted for use with the disposable of fig1 . fig1 depicts the distal portion of yet another embodiment of a disposable 210 and meter 230 . distal section 232 mates with disposable 210 . note that slots 234 are an alternative to groove 34 ( or 134 ) for capturing indentations , such as 220 , on the disposable . in the method of this invention , a blood sample is picked up on the outward - facing surface of the membrane . glucose in the sample interacts with a reagent in the membrane to cause a color change , which changes the reflectance of the inward - facing membrane surface . the light source in the meter illuminates the inward - facing membrane surface and measures the intensity of light reflected from that surface . using the appropriate computation , the change in reflectance yields the glucose concentration in the sample . a variety of combinations of membrane and reagent compositions are known for photometric determinations of blood glucose concentration . a preferred membrane / reagent composition is a polyamide matrix incorporating an oxidase enzyme , a peroxidase , and a dye or dye couple . the oxidase enzyme is preferably glucose oxidase . the peroxidase is preferably horseradish peroxidase . a preferred dye couple is 3 - methyl - 2 benzothiazolinone hydrazone hydrochloride plus 3 , 3 - dimethylaminobenzoic acid . details of that membrane / reagent combination and variations on it appear in u . s . pat . no . 5 , 304 , 468 , issued apr . 19 , 1994 , to phillips et al ., incorporated herein by reference . another preferred membrane / reagent composition is an anisotropic polysulfone membrane ( available from memtec america corp ., timonium , md .) incorporating glucose oxidase , horseradish peroxidase , and the dye couple 3 - methyl - 2 - benzothiazolinone hydrazone ! n - sulfonyl benzenesulfonate monosodium combined with 8 - anilino - 1 - naphthalene sulfonic acid ammonium . details of that membrane / reagent combination and variations on it appear in u . s . patent application ser . no . 08 / 302 , 575 , filed sep . 8 , 1994 , incorporated herein by reference . it will be understood by those skilled in the art that the foregoing descriptions of embodiments of this invention are illustrative of practicing the present invention but are in no way limiting . variations of the detail presented herein may be made without departing from the scope and spirit of the present invention .
| 8 |
in the preferred embodiment of the splash apron according to fig1 and 2 , the splash apron 1 is formed of straight , substantially vertical elongated , fibrous flaps or strips 2 , 3 , which are attached side - by - side in a row to a suitable supporting member 4 . the supporting member can further be attached by conventional methods behind the tire 5 , seen from the driving direction , to the frame structure or equivalent of a vehicle , which is not illustrated in the drawing . the fibrous flaps 33 of the splash apron are alternately long and short , respectively . the difference in length in comparison with the total length of the splash apron is not great , preferably about 5 - 15 %, which depends on the material to be used . advantageously the flaps 2 , 3 are manufactured of a flexible and facile , water - repellent artificial fiber material , which should be particularly resistant to corrosion . when a vehicle provided with the aforementioned splash aprons moves forwardly , the air flow separates the shorter and lighter flaps 3 from the longer and heavier flaps 2 , as is seen in fig3 . thus there are formed vertical air gaps in the splash apron . in the previous embodiment , the fibrous flaps can also be suitably divided into alternating groups of short and long flaps that is every other one of the flaps is short . the air gaps in the splash apron of the invention can also be created as shown in fig7 so that at the lower end of every second flap or group of flaps 10 there is attached a suitable leaden weight or equivalent 12 , in which case the lighter flaps 11 move more easily in accordance to the air flow . in the embodiment of fig1 - 3 the fibrous flaps of the splash apron fall directly downwardly from the supporting member . they can also be arranged to fall downwardly in a fan - shaped fashion , in which case the air gaps are arranged without any further measures between the flaps 2 , 3 of equal length . in fig4 is presented another splash apron according to the invention , which splash apron consists of adjacent ribbon - like or lamellated flaps 7 , 8 . every second flap 7 becomes wider in the downward direction from the supporting member 4 or its immediate neighbourhood , and respectively the remaining flaps 8 become narrower . owing to the effect of a driving draft , the flaps 7 which are wide at the bottom are bent backwardly and thus separated -- due to greater air resistance -- from the flaps 8 which are narrow at the bottom . thus the desired vertical or roughly vertical air gaps are formed in the splash apron . this is also due to the narrower web of the flaps 7 which connect the top of each flap to a common cross part as shown in fig4 . the splash apron of fig4 can also be realized so that the ribbon - like or lamellated flaps are partly arranged in overlapping or roughly adjacent fashion . in that case the first alternating flaps 8 , located partly at the front , could be of equal width , whereas the second alternating flaps 7 , located partly at the back , could still become wider towards the bottom . the splash apron is attached in a conventional fashion to a suitable supporting member , and by means of the member further behind the tire or directly to the body of the vehicle . in fig5 and 6 are illustrated details of a splash apron of the invention , where a certain type of supporting member is utilized . the fibrous , ribbon - like or lamellated flaps of the splash apron can be pressed in between the supporting pieces 41 , 42 by means of bolted joints 9 or similar joints . in the supporting pieces there are respectively arranged grooves 10 and brackets 11 to match those alternating flaps or groups of flaps , which are directed slightly backwardly from the plane of the splash apron ( fig6 ) in order to create or reinforce the air gaps . fig5 represents a side - elevation view of a similar point as described above , and fig6 represents a respective view for example at the next flap of the splash apron where the grooves and brackets do not exist and where the flap of the flash apron falls directly downwardly when in the resting position . the splash apron of the invention can be manufactured of any flexible and durable material , such as rubber or a suitable type of plastic . the whole of the splash apron can be made of one piece of material by suitably cutting the fibrous , ribbon - like or lamellated flaps therefrom and by leaving the upper part unbroken as is seen in fig4 . on the other hand , the flaps can also be manufactured separately , and what is more , of different materials . they can be arranged for instance so that every second flap is made of a more flexible material than the rest . in the above the present invention has been described with reference to a few preferred embodiments only . it is , however , by no means intended to limit the scope of the invention to include only these embodiments , but several modifications thereto are possible within the invention specified in the following patent claims .
| 1 |
the present invention provides a system which eliminates the need to isolate the gas purifier in the event of equipment malfunction or otherwise a false alarm . with reference to fig2 , a gas purifier 200 , which may be utilized in system 100 is provided . purifier 200 can be configured as a column , having a chemical adsorbent bed therein . a conventional purity gas stream such as nitrogen enters purifier 200 and is exposed to chemical adsorbent bed 210 , which removes contaminants such as hydrogen , carbon monoxide and oxygen . the chemical adsorbent can be made from nickel , palladium or any other material that is sensitive or selective to the impurities removed and retains same . the chemical adsorbent bed is designed to include at least one dual temperature sensor 204 , 205 , 206 that is located in close proximity to the adsorbent bed , but at various locations therein . the temperature sensors may be resistance - based devices , such as resistance temperature detectors ( rtds ) or thermocouples . these devices are inserted into the chemical adsorbent bed 210 through thermal wells , which are permanent tubular devices that project into the bed , and minimize the interference with the gas flow . the temperature sensors may also be located on the wall of the purifier bed . typically , more than one temperature sensor is utilized so that excessive temperature is quickly detected at the various locations within the bed . high chemical adsorbent temperatures are indicative of the bed being exposed to excessive contaminant levels . the temperature measured by sensors 204 , 205 , 206 is transformed into an electrical signal which is sent to a receiving computer card . in the event the computer registers a temperature in excess of the predetermined value , typically between 120 ° f . and 400 ° f ., adsorbent bed 210 is isolated by closing valves 220 , 230 , 240 , and the bed is vented to atmosphere or an abatement system ( not shown ) by opening valve 250 . the failure of temperature sensing equipment , such as thermocouples and thermocouple computer boards , generate an electrical signal that is similar in magnitude to that generated by a high temperature reading . therefore , the computer interprets failed temperature sensing equipment in the same manner as a high temperature reading , causing the purifier to shutdown as described above . such a shutdown is unnecessary , because the chemical adsorbent temperature is not excessive . the present invention addresses the need to distinguish between temperature sensing equipment failure and excessive chemical adsorbent temperature . in an exemplary embodiment , dual temperature sensor sets 204 a and 204 b ; 205 a and 205 b ; 206 a and 206 b ; can be utilized to detect the temperature at various locations in the bed . for example , one set of temperature sensors can be disposed in close proximity to the top of the purifier bed , while the others may be place near the center of the purifier , and in close proximity to the bottom of the purifier , respectively . utilizing dual temperature sensors in the manner explained below provides a means to distinguish a failure of the equipment ( i . e ., temperature sensor , computer card , etc .) from a real event such as temperature rise in the chemical adsorbent bed above a predetermined level . the latter would lead to the destruction of the chemical adsorbent , which could cause corrosive substances such as hydrochloric or sulfuric acid to be released from the purifier . without this distinction , gas purifier 200 would need to be shut down ( i . e ., taken off - line ) regardless of whether or not a real event were occurring . with continued reference to fig2 , conventional purity nitrogen is provided from an air separation unit 140 , or a backup source 160 to gas purifier 200 at near ambient temperature and a pressure ranging from about 10 psia to 200 psia , preferably 50 psia to 180 psia and most preferably 100 psia to 170 psia . the flow rate of the incoming stream ranges from ranging from 1 , 000 cfh - ntp to 1 , 000 , 000 cfh - ntp , preferably between 5 , 000 cfh - ntp and 750 , 000 cfh - ntp and most preferably between 10 , 000 cfh - ntp and 500 , 000 cfh - ntp , and contains between 0 . 1 and 10 part per million each of hydrogen , carbon monoxide and oxygen . the conventional purity nitrogen gas stream enters gas purifier 200 , and is passed through and exposed to the chemical adsorbent bed 210 . the adsorbent bed typically contains a nickel based chemical adsorbent . examples of other chemical adsorbents that can be employed include but not limited to palladium , zirconium , platinum , rhodium , ruthenium , and titanium - based or other materials that are selective toward particular contaminants . the metal based chemical adsorbent reacts with and / or adsorbs residual oxygen , hydrogen and carbon monoxide , thereby removing them from the conventional purity nitrogen gas stream and producing an ultra - high purity nitrogen gas stream . this ultra - high purity nitrogen gas stream exits the chemical adsorbent bed typically containing between 0 and 20 parts per billion each of hydrogen , carbon monoxide and oxygen , preferably containing between 0 and 10 parts per billion each of hydrogen , carbon monoxide and oxygen and most preferably containing between 0 and 1 part per billion each of hydrogen , carbon monoxide and oxygen . the gas purifier is designed to include at least one dual temperature sensor set 204 a and 204 b ; 205 a and 205 b ; 206 a and 206 b that is located in proximity to the chemical adsorbent 210 , as discussed above . these temperature sensors are relatively fragile and could break as the chemical adsorbent shifts during the transition from purification to regeneration and back . moreover , the temperature sensors need to be removed and replaced whenever they fail . as a result , the temperature sensors / detectors are inserted into the chemical adsorbent bed 210 through thermal wells , which project into the bed . the dual temperature sensors can be placed in one or several thermowells . the dual temperature sensors are used as part of a set so that temperature sensor failure can be detected while eliminating a false or misleading indication of a high chemical adsorbent temperature . the distinction between a temperature sensor failure and a high chemical adsorbent temperature is made by determining the temperature difference between the two temperature sensors in a given dual temperature sensor set . if both temperature sensors are functioning properly , this temperature difference should be small , since the temperature sensors in a given set ( for example , 204 a and 204 b ) are located in close proximity to one other . typically , the distance between the temperature sensors is between 0 and 6 inches , preferably between 0 and 3 inches and most preferably between 0 and 1 inch . however , if the difference in measured temperature between two temperature sensors in a given set ( for example , 204 a and 204 b ) exceeds a first predetermined value , typically between 5 ° f . and 100 ° f ., preferably between 10 ° f . and 40 ° f . and most preferably between 10 ° f . and 25 ° f ., one of the temperature sensors is determined to have failed and an alarm is initiated . a high chemical adsorbent temperature is not found to have occurred unless both temperature sensors in a given dual thermocouple set indicate a temperature that exceeds a second predetermined value . specifically , each temperature sensor in the dual temperature sensor set 204 a and 204 b ; 205 a and 205 b ; 206 a and 206 b generates an electric signal that is sent to a temperature sensor signal receiving computer card 207 a and 207 b . the temperature sensors associated with each dual temperature sensor set are wired to separate temperature sensor signal receiving computer cards . in this embodiment , temperature sensors 204 a , 205 a and 206 a are wired to temperature sensor signal receiving computer card 207 a and temperature sensors 204 b , 205 b and 206 b are wired to temperature sensor signal receiving computer card 207 b . in order to initiate a gas purifier shutdown , at least one temperature sensor must indicate a temperature that exceeds the second predetermined value on each temperature sensor signal receiving computer card . the second predetermined value is typically between 120 ° f . and 400 ° f ., preferably between 150 ° f . and 350 ° f . and most preferably between 150 ° f . and 300 ° f . the temperature sensor and temperature sensor signal receiving computer card logic is illustrated in fig3 . referring to this figure , the temperature difference between temperature sensors 204 a and 204 b is determined . if this difference exceeds the first predetermined value , one of the temperature sensors or the temperature sensor signal receiving computer card has failed and an alarm is sounded . in this situation the operator , would access the gas purifier and change out the malfunctioning equipment without having to take the purifier off - line . on the other hand , if the temperature difference does not exceed the first predetermined value , the temperature difference between sensors 205 a and 205 b is determined . if this difference exceeds the first predetermined value , one of the temperature sensors or the temperature sensor signal receiving computer card has failed and an alarm is sounded , and the procedure outlined above can be carried out . if this difference does not exceed the first predetermined value , the temperature difference between sensors 206 a and 206 b is determined . if the temperature difference exceeds the first predetermined value , one of the temperature sensors or the temperature sensor signal receiving computer card has failed and an alarm is sounded . if this difference does not exceed the first predetermined value , the actual value of the temperature readings is examined . if the temperature measured by at least one of the dual thermocouple in the dual set exceeds the second predetermined value , the chemical adsorbent temperature is too high and the gas purifier is isolated . the chemical adsorbent bed 210 is isolated by closing valves 220 , 230 and 240 . the chemical adsorbent bed may also be vented by opening valve 250 . if the temperature readings do not exceed the second predetermined value , the gas purifier is operating normally and no action is taken . the logic illustrated in fig3 is programmed into a computing device that contains the temperature sensor signal receiving computer cards . this device is typically a computer or programmable logic controller ( plc ). because at least one temperature sensor must indicate an excessive temperature on each temperature sensor signal receiving computer card to initiate a gas purifier shutdown , a single temperature sensor or temperature sensor signal receiving computer card failure will not cause the gas purifier to isolate . typically , the system is designed such that a single temperature sensor or temperature sensor signal receiving computer card failure will initiate an alarm to notify the operator that the failure has occurred . the chemical adsorbent requires periodic regeneration . referring again to fig2 , the regeneration nitrogen is heated in a heat exchanger 260 , typically to a temperature between 400 ° f . and 800 ° f ., preferably to a temperature between 400 ° f . and 700 ° f . and most preferably to a temperature between 400 ° f . and 600 ° f . the hot regeneration nitrogen stream is routed to the purifier 200 where it drives contaminants off of the chemical adsorbent 210 . generally , the contaminant - containing regeneration nitrogen is circulated counter to the direction in which the production gas is purified , and exits purifier 200 as waste . the temperature of the regeneration stream generally exceeds the temperature that initiates a chemical adsorbent bed shutdown . therefore , the chemical adsorbent bed high temperature shutdown is disregarded during regeneration . however , a single temperature sensor or temperature sensor signal receiving computer card failure can still be detected because these are identified based on temperature difference , not absolute temperature . while the invention has been described in detail with reference to specific embodiments thereof , it will become apparent to one skilled in the art that various changes and modifications can be make , and equivalents employed .
| 1 |
referring to the drawings in detail wherein like numerals designate like parts , a rectangular steel casing or shell 10 , which may be thermally insulated , is filled with fresh water or another thermal transfer liquid , such as glycol , to the approximate level 11 , fig2 . preferably , the shell 10 has attached skids 12 to protect the bottom wall of the unit from deck water on a ship , and to facilitate handling by a forklift truck . fixed within the shell 10 midway between its two side walls 13 is a rectangular firebox 14 which shares the bottom wall 15 of the shell 10 . as best shown in fig3 a vertical water - tight bulkhead 16 extends between the shell side walls 13 and defines the front of the fresh water chamber of the unit . the bulkhead 16 is spaced slightly forwardly of the front wall of the firebox 14 to form an intervening liquid - filled space . the rear wall 17 of the firebox is spaced forwardly of the rear parallel wall 18 of shell 10 . the top wall 19 of the firebox is at a level well above the bottom wall 15 . the firebox 14 is thus surrounded by liquid on all sides and at its top . only its bottom wall is a dry wall . there is no necessity for any refractory lining of the firebox due to its immersion in liquid , which prevents warping of its walls . the dry bottom wall 15 of the firebox promotes rapid ignition and more complete burning of oil or other fuel in the firebox . in this connection , the device may utilize liquid , gaseous or solid fuels , depending upon availability , convenience and the particular application of the heating unit . a relatively shallow adapter sleeve 20 rises from the top of the firebox 14 and is in open communication with its combustion chamber . on top of this adapter sleeve is fixedly mounted a primary heat exchanger assembly 21 consisting of a unitized group of open - ended vertical axis fire tubes 22 , preferably arranged in three spaced parallel transverse rows of six fire tubes each and six spaced front - to - back parallel rows of three tubes each , fig3 . different numbers of fire tubes in a different configuration and size may be employed in some cases . the open top and bottom ends of the fire tubes are united with horizontal flange plates 23 and 24 , as shown . the lower flange plate 24 is fixed to the adapter sleeve 20 , and the top flange plate 23 is similarly fixed to the bottom of a heat exchanger cap or hood 25 which leads upwardly to and communicates directly with an exhaust stack 26 for gaseous combustion products rising from the fire tubes 22 . the primary heat exchanger 21 including all of the fire tubes 22 and the cap 25 are submerged in the water or other liquid contained in the shell 10 and therefore are in direct heat transfer relationship with such liquid . the top wall of the shell 10 is preferably in the form of a detachable and removable plate 27 held in place by fastening means 28 , thereby allowing ready access at required times to the interior of the heating unit . a short sleeve extension 29 rises above the removable top wall 27 and is united therewith in spaced surrounding relationship to the exhaust stack 26 . the interior of the shell 10 is vented to atmosphere by a series of spaced splash plates 30 fixedly held within the sleeve 29 . in this connection , the liquid heating unit is completely unpressurized device , distinguishing it from a classic boiler which is a pressurized device . the splash plates 30 prevent the liquid contained in the shell 10 from splashing out of the top of the unit when a ship carrying it is in rough water , as with diver utilization of the invention . preferably , a rain cover 30 &# 39 ; is provided above the exhaust stack 26 , and a heat baffle , not shown , may be placed in the area between the stack 26 and forward fuel tanks . in connection with diver utilization , preferably a pair of secondary heat exchangers 31 in the form of finned copper tubing coils are supported in a submerged state in the liquid chambers at the opposite sides of firebox 14 and between the firebox and shell side walls . the secondary heat exchanger coils , as best shown in fig2 may extend vertically for the major portion of the height of the shell 10 . in the front - to - back direction , fig3 the secondary heat exchanger coils extend at least along the two opposite side walls of the firebox 14 and may extend rearwardly of the firebox , if desired . the secondary heat exchangers could , in some cases , be located at other locations within the shell 10 instead of the two side positions illustrated . in still other cases , only a single secondary heat exchanger may be utilized , or more than two secondary heat exchangers could be used , if desirable . in diver utilization of the invention , sea water is pumped through the secondary heat exchanger coils 31 and such water or other liquid is heated in direct proportion to the temperature maintained in the liquid filling the shell 10 by operation of the primary heat exchanger 21 . the thus heated liquid in the secondary heat exchanger coils 31 is then circulated through the suit of a diver or divers and then is discharged from the suit or suits back into the sea . any suitable pumping arrangement , not shown , such as a submersible pump or an on - board pump , may be used to maintain circulation of the sea water through the coils 31 in the described manner . when the unit is employed for non - diver applications , the secondary heat exchangers 31 can be shut off or omitted entirely . water or other suitable liquid in the shell 10 can be maintained at a proper level therein by conventional pumping means , not shown , and this liquid will be heated by the primary heat exchanger 21 and can be delivered in a closed loop system or systems to remote heat exchangers , such as radiators for heating a building or for other like purposes . thus , the invention is versatile in its use capabilities as well as being simplified , substantially self - contained and efficient and economical in operation . at the front of the rectangular unit , forwardly of the bulkhead 16 , upper and lower dry service compartments 32 and 33 , fig1 are provided . within the upper compartment 16 is an electrical control panel 34 for instrumentation including aquastat temperature controls and temperature gages , not shown . also , in the compartment 16 , are sea water strainers 35 through which incoming sea water must pass before being delivered to the secondary heat exchanger coils 31 as shown schematically in fig4 . the sea water heated within the coils 31 is delivered to a manifold 36 in the compartment 16 having several different delivery lines 37 through which warm water can be delivered to one or more divers through hoses of sufficient lengths . as previously , stated , the water after passing through the diver &# 39 ; s suit is expelled back into the sea . in the lower front compartment 33 , twin oil or gas burner gun units 38 are fixed to mounting flanges 39 on the forward ends of short gun spacer pipes 39 &# 39 ; which are attached to the forward vertical wall of the firebox 14 , fig3 . the use of the spacer pipes 39 &# 39 ; for mounting the fuel guns 38 prevents overheating of the fuel guns , as might occur if they were in direct thermal contact with the firebox . the narrow water space at the front of the firebox adjacent to the bulkhead 16 also keeps the temperature of the guns 38 within a safe range . the guns 38 , which are conventional , deliver oil or other fuel directly into the combustion chamber defined by the firebox 14 where the fuel is ignited and burned . on opposite sides of the two front compartments 32 and 33 , built - in vertically elongated fuel storage tanks 40 extend from the top to the bottom of the shell 10 . a connecting upper horizontal tank 40 &# 39 ; extends between and communicates with the two vertical tanks 40 for added fuel storage capacity . double folding doors 41 are provided to cover the compartments 32 and 33 , and when opened these doors can fold flat against the fronts of tanks 40 . a single rear dry service compartment 42 having hinged doors 43 is recessed into the rear of the shell 10 and thus projects into the rear water chamber of the shell behind the firebox 14 . within opposite sides of the service compartment 42 can be installed forwardly projecting dual back - up electrical heating elements 44 for the diver application of the invention . these back - up heating elements assure sufficient heating of the fresh water or other liquid in the shell 10 for life support even in the event of complete failure of the primary heat exchanger 21 due to combustion failure in the firebox 14 . in lieu of the electrical back - up elements 44 , steam heated dual back - up elements , not shown , can be employed in some cases . it is also possible to provide a back - up emergency heating element , either steam or electric , across the rear liquid chamber of the shell 10 beneath the compartment 42 or at other locations in the shell . an electrical control panel 45 for electric heat sensors , not shown , aquastat temperature gages , etc . are provided in the rear service compartment 42 . inasmuch as warmth is vital to the survival of divers , it may be seen that in addition to providing one or more back - up heating means within the shell 10 the invention throughout provides dual or redundant prime operating components including the dual burner guns 38 , dual secondary heat exchangers 31 , and dual back - up heating elements 44 . the maximum safety of the diver relying on the heating system is thus assured . when using solid fuel , the fuel gun mounting flanges 39 can be easily adapted to a solid fuel auger for automated feed , or replaced with a door arrangement to provide solid fuel and combustion air access to the firebox 14 . it is to be understood that the form of the invention herewith shown and described is to be taken as a preferred example of the same , and that various changes in the shape , size and arrangement of parts may be resorted to , without departing from the spirit of the invention or scope of the subjoined claims .
| 1 |
now , embodiments of the present invention will be described in detail with reference to the accompanying drawings . configurations of the present invention for performing encoding and decoding using panning ( hereinafter “ balance adjustment ”) will be explained using the following configuration . that is to say , using part of the configuration of an encoder ( that is , the configuration removing the part for generating side signals from the left half configuration shown in fig . b . 13 ) used widely as an aac ( advanced audio codec ), which is a standard mpeg - 2 and mpeg - 4 system in iso / iec given in “ iso / iec 14496 - 3 : 1999 ( e ) “ mpeg - 2 ”, p . 232 , fig . b . 13 ″ ( hereinafter “ non - patent literature 3 ), by adding intensity stereo components disclosed in patent literature 1 to the right half of this configuration and adding encoders to the respective output destinations of individual signals , an overall configuration for encoding and transmitting all information is given . furthermore , a stereo signal is designed so that , by receiving different audio signals in the left ear and the right ear , a listener can enjoy audio with realistic sensation . consequently , with audio sigils to provide content , the simplest stereo signal is a two - channel signal comprised of an l signal and an r signal , and a case where an input signal is a two - channel signal will be described with the present embodiment . first , the configuration of an encoding apparatus according to am embodiment of the present invention will be described . fig1 is a block diagram showing a configuration of encoding apparatus 100 according to the present embodiment . fig1 shows a configuration to perform scalable ( multilayer - structure ) coding of stereo signals , that is , to encode an m signal in a core encoder and then encode a stereo signal in the frequency domain using a decoded signal generated by decoding in a core decoder . encoding apparatus 100 is formed primarily with down mixing section 101 , core encoder 102 , core decoder 103 , modified discrete cosine transform ( hereinafter referred to as “ mdct ( modified discrete cosine transform )”) section 104 , mdct section 105 , mdct section 106 , down mixing section 107 , adding section 108 , quantizing apparatus 109 , multiplying section 110 , multiplying section 111 , adding section 112 , adding section 113 , encoder 114 , encoder 115 and encoder 116 . down mixing section 101 receives as input an l signal ( first signal ) and an r signal ( second signal ), which are vectors of a predetermined length , and provides an m signal ( third signal ) by down - mixing the l signal and r signal received as input . down mixing section 101 also outputs the m signal found , to core encoder 102 . equation 1 is an example of a down mixing calculation method in down mixing section 101 . the present embodiment uses a most simple down mixing method of adding an l signal and an r signal and multiplying the result by 0 . 5 . core encoder 102 finds a code by encoding the m signal received as input from down mixing section 101 , and outputs the found code to core decoder 103 and multiplexing section 117 . core decoder 103 generates a decoded signal by decoding the code received as input from core encoder 102 , and outputs the generated decoded signal to mdct section 105 . mdct section 104 receives as input the l signal , performs a discrete cosine transform of the l signal received as input , and transforms the time domain signal to a frequency domain signal ( frequency spectrum ). mdct section 104 outputs the transformed signal to down mixing section 107 , adding section 112 and quantizing apparatus 109 . mdct section 105 performs a discrete cosine transform of the decoded signal received as input from core decoder 103 , and transforms the time domain signal into a frequency domain signal ( frequency spectrum ). mdct section 105 outputs the transformed signal to adding section 108 . mdct section 106 receives as input an r signal , performs a discrete cosine transform of the r signal received as input , and transforms the time domain signal into a frequency domain signal ( frequency spectrum ). mdct section 106 outputs the transformed signal to down mixing section 107 , adding section 113 and quantizing apparatus 109 . down mixing section 107 finds an m signal by down mixing the l signal received as input from mdct section 104 and the r signal received as input from mdct section 106 . down mixing section 107 outputs the found m signal to adding section 108 . down mixing section 107 is different from down mixing section 101 in down mixing a frequency domain signal , not a time domain signal . the down mixing calculation method is the same as equation 1 and will not be described here . adding section 108 subtracts the signal received as input from mdct section 105 , from the m signal received as input from down mixing section 107 , and calculates an m signal of the target ( hereinafter referred to as “ target m signal ”). then , adding section 108 outputs the calculated target m signal to multiplying section 110 , multiplying section 111 , encoder 115 and quantizing apparatus 109 . quantizing apparatus 109 encodes a balancing weight coefficient to use for balance adjustment and finds a weight coefficient code , using the l signal received as input from mdct section 104 , the target m signal received as input from adding section 108 , and the r signal received as input from mdct section 106 . then , quantizing apparatus 109 outputs the found code to multiplexing section 117 . quantizing apparatus 109 acquires balancing weight coefficient w l , ( hereinafter referred to as “ l signal balancing weight coefficient w l ”) to adjust the amplitude balance of the target m signal with respect to the l signal by decoding found code , and sets acquired l signal balancing weight coefficient w l in multiplying section 110 . quantizing apparatus 109 acquires balancing weight coefficient w r ( hereinafter referred to as “ r signal balancing weight coefficient w r ”) to adjust the amplitude balance of the target m signal with respect to the r signal , using acquired l signal balancing weight coefficient w l , and sets acquired r signal balancing weight coefficient w r in multiplying section 111 . the configuration of quantizing apparatus 109 will be described in detail later . multiplying section 110 multiples the target m signal received as input from adding section 108 , by l signal balancing weight coefficient w l received as input from quantizing apparatus 109 , and outputs the result to adding section 112 . multiplying section 111 multiplies the target m signal received as input from adding section 108 , by r signal balancing weight coefficient w r received as input from quantizing apparatus 109 , and outputs the result to adding section 113 . adding section 112 subtracts the target m signal multiplied by l signal balancing weight coefficient w l , received as input from multiplying section 110 , from the l signal received as input from mdct section 104 , and finds an l signal of the target ( hereinafter “ target l signal ”). adding section 112 outputs the found target l signal to encoder 114 . adding section 113 subtracts the target m signal multiplied by r signal balancing weight coefficient w r , received as input from multiplying section 111 , from the r signal received as input from mdct section 106 , and finds an r signal of the target ( hereinafter “ target r signal ”). adding section 113 outputs the found target r signal to encoder 116 . the calculations in adding section 112 and adding section 113 can be represented by equations 2 . { circumflex over ( r )} f = r f − w r ·{ circumflex over ( m )} f ( equations 2 ) the above algorithms are equivalent to transformation of an l signal and an r signal using balance adjustment . the balancing weight coefficients show the similarity between the target m signal and the l and r signals . consequently , a target l signal and a target r signal , given by subtracting the target m signal multiplied by balancing weight coefficients from an l signal and an r signal , become signals in which redundant parts are removed by the target m signal and in which signal power is reduced , so that the target l signal and target r signal both can be encoded efficiently . encoder 114 outputs a code found by encoding the target l signal received as input from adding section 112 , to multiplexing section 117 . encoder 115 outputs a code found by encoding the target m signal received as input from adding section 108 , to multiplexing section 117 . encoder 116 outputs a code found by encoding the target r signal received as input from adding section 113 , to multiplexing section 117 . multiplexing section 117 multiplexes the codes received as input from core encoder 102 , quantizing apparatus 109 , encoder 114 , encoder 115 and encoder 116 , and outputs a multiplexed bit stream . next , the configuration of quantizing apparatus 109 will be described using fig2 . fig2 is a block diagram showing a configuration of quantizing apparatus 109 . quantizing apparatus 109 is formed primarily with power / correlation calculating section 201 , intermediate value calculating section 202 , codebook 203 , search section 204 and decoding section 205 . power / correlation calculating section 201 performs power calculation and correlation value calculation using the l signal received as input from mdct section 104 , the target m signal received as input from adding section 108 , and the r signal received as input from mdct section 106 . then , power / correlation calculating section 201 outputs the calculated power and correlation value , to intermediate value calculating section 202 . the power and correlation value can be found by equations 3 . c { circumflex over ( m )}{ circumflex over ( m )} : power of target m signal c { circumflex over ( m )} l : correlation value between target m signal and l signal c { circumflex over ( m )} r : correlation value between target m signal and r signal intermediate value calculating section 202 finds two intermediate values using the power and correlation value received as input from power / correlation calculating section 201 . then , intermediate value calculating section 202 outputs the found intermediate values to search section 204 . for example , intermediate value can be determined using equations 4 . a 2 =− 2 . 0 · c { circumflex over ( m )} l − 4 . 0 · c { circumflex over ( m )} m + 2 . 0 . · c { circumflex over ( m )} r ( equations 4 ) codebook 203 is information that is stored in a memory means such as a rom ( read only memory ), and is formed with a plurality of scalar values to be selected as an l signal weight coefficient . fig3 shows , by way of example , scalar values numbered and stored in codebook 203 of the present embodiment . the scalar values stored in codebook 203 are only the l values of balancing weight coefficients . search section 204 searches for an optimal one of a plurality of scalar values stored in codebook 203 , and encodes a balancing weight coefficient by selecting a number corresponding to the optimal scalar value found . to be more specific , for example , search section 204 searches for number n to minimize the cost function shown in equation 5 . search section 204 outputs selected number n to multiplexing section 117 as a code . search section 204 outputs the code having been outputted to multiplexing section 117 , to decoding section 205 . a 1 ·( w l n ) 2 + a 2 · w l n ( equation 5 ) w l n : scalar value of number n stored in codebook 203 referring to equation 5 , although scalar values stored in codebook 203 are squared , in this case , search is made possible by even a smaller amount of calculation by storing square values in codebook 203 in advance . decoding section 205 finds an l signal balancing weight coefficient by decoding a code ( number n ) received as input from search section 204 ( w l = w l n ). that is to say , decoding section 205 picks up a scalar value corresponding to the code ( number n ) received as input from search section 204 , out of a plurality of scalar values stored in codebook 203 , as an l signal balancing weight coefficient . decoding section 205 uses the result of subtracting the acquired l signal balancing weight coefficient from a predetermined constant , as an r signal balancing weight coefficient . for example , decoding section 205 finds an r signal balancing weight coefficient ( w r = 2 . 0 − w l n ) by subtracting the l signal balancing weight coefficient from the constant 2 . 0 . here n is an l signal balancing weight coefficient code , and w l and w r are decoded balancing weight coefficients . the constant 2 . 0 is a value set according to the quantitative relationships between signals upon down mixing in down mixing section 101 . the reason to find an r signal balancing weight coefficient by subtracting an l signal balancing weight coefficient from the constant 2 . 0 , will be described later . decoding section 205 sets the l signal balancing weight coefficient in multiplying section 110 and sets the r signal balancing weight coefficient in multiplying section 111 . next , a detailed explanation will be given about the theoretical background of balance adjustment by means of quantized and decoded balancing weight coefficients according to the present invention . first , efficient coding of an l signal and r signal using balance adjustment is made possible by minimizing the power of the transformed values in equations 6 . the m signal in this case is an average value of an l signal and an r signal . where l ′ f and r ′ f in equation 6 are the same as shown in equation 7 next , calculating a balancing weight coefficient to minimize the l signal power in equations 6 gives equation 8 . similarly , in equations 6 , the balancing weight coefficient to minimize the power in the equation for the r signal is shown as equation 9 . that is to say , l signal power and r signal power can be minimized by selecting the balancing weight coefficients of equations 8 and 9 above . furthermore , given that the m signal holds the relationship of equation 1 , the addition result of an l signal balancing weight coefficient and an r signal balancing weight coefficient can be represented by equation 10 , from equation 1 and equations 3 . although with the present embodiment a target m signal is quantized in a scalable fashion as shown in fig1 , not based on the simple relationship of equation 1 , but , presuming that the relationship of equation 1 is predominant , balancing weight coefficients are quantized based on the relationship of equation 10 . based on this presumption , it is possible to quantize ( encode ) only one parameter , allowing low bit rate coding . furthermore , it is also possible to quantize l signal balancing weight coefficient w l alone using codebook 203 , and find r signal balancing weight coefficient w r from the relationship of equation 10 . cost function f of search in this case can be represented by equation 11 . in above equation 11 , the third term is not related to l signal balancing weight coefficient w l and therefore omitted , and only the sum of the first term and the second term is used as a cost function . the values multiplied upon the balancing weight coefficients are the two intermediate values shown in equations 4 . furthermore , when this cost function is smaller , the total sum of a target l signal and a target r signal can be made smaller , and searching for such l signal balancing weight coefficient w l is equivalent to quantizing ( encoding ) an optimal balancing weight coefficient . by using balancing weight coefficients found by means of the above coding , it is possible to reduce target l signal power and target r signal power and consequently transmit sound / speech of good quality at low bit rates . a verification test of the present embodiment has been conducted and its result will be explained next . the encoder that was used was a codec simulator to perform the same scalable spectrum quantization of stereo signals ( 16 khz sampling ) as in non - patent literature 3 . the evaluation data was data ( 24 seconds ) appending six sounds / voices given from varying source positions . the number of balancing weight coefficient quantization bits was four . the result of performing a verification test based on the above conditions was that , by replacing a conventional encoding apparatus with the encoding apparatus of the present embodiment , the amount of calculation when finding balancing weight coefficients according to the present embodiment and performing quantization was 3 / 5 compared to heretofore . consequently , with the present embodiment , the amount of calculation was saved significantly compared to heretofore . reasons this significant effect could be achieved may include that a calculation to involve a complex arithmetic operation and increase the amount of calculation , such as division , is not performed , and that the number of pairs of numbers and scalar values stored in codebook 203 is comparatively small , that is , sixteen variations , so that these can be specified by only dour bits . thus , with the present invention , balancing weight coefficients themselves are not calculated , so that the amount of calculation is reduced and more efficient quantization is made possible . a feature of the present embodiment lies in performing different calculations from embodiment 1 in a quantizing apparatus upon performing coding and decoding using balance adjustment . with the present embodiment , the encoding apparatus configuration is the same as in fig1 and explanations will be omitted . also , with the present embodiment , the quantizing apparatus configuration is the same as in fig2 . in the following description , codes in fig1 and fig2 will be used . power / correlation calculating section 201 performs power calculation and correlation value calculation using the l signal received as input from mdct section 104 , the target m signal received as input from adding section 108 , and the r signal received as input from mdct section 106 . power / correlation calculating section 201 outputs the calculated power and correlation value to intermediate value calculating section 202 . power / correlation calculating section 201 finds power and correlation value by equations 12 . c1 { circumflex over ( m )}{ circumflex over ( m )} : adjusted power of target m signal c1 { circumflex over ( m )} l : adjusted correlation value of target m signal and l signal c1 { circumflex over ( m )} r : adjusted correlation value of target m signal and r signal in equations 12 , γ , η , and ζ , representing the proportions of power components to be added , may be variables or constants , or may be all different values . for example , experiment has shown that , when making γ , η , and ζ constants , good performance can be achieved by setting these three γ , η , and ζ to 0 . 25 . the adjusted power of a target m signal , the adjusted correlation value of a target m signal and an l signal , and the adjusted correlation value of a target m signal and an r signal , are provided by adjusting the power of a target m signal , the correlation value of a target m signal and an l signal , and the correlation value of a target m signal and an r signal using the power of an l signal , the power of an r signal , the sum of l signal power and r signal power , and the proportions of power components to be added ( three coefficients ). in the following description , the adjusted power of a target m signal will be redefined as the power of a target m signal , the adjusted correlation value of a target m signal and an l signal will be redefined as the correlation value between a target m signal and an l signal , and the adjusted correlation value of a target m signal and an r signal will be redefined as the correlation value of a target m signal and an r signal . when γ , η and ζ are made variables , power / correlation calculating section 201 performs equalization in order to reduce the variations of the variables over time . power / correlation calculating section 201 performs equalization by performing the calculation of equations 13 , applying the result to equations 14 , and updating each state . c 2 { circumflex over ( m )} r = α · c { circumflex over ( m )} r +( 1 − α )· s { circumflex over ( m )} r ( equations 13 ) c2 { circumflex over ( m )}{ circumflex over ( m )} : equalized power of target m signal c2 { circumflex over ( m )} l : equalized correlation value between target m signal and l signal c2 { circumflex over ( m )} r : equalized correlation value between target m signal and r signal s { circumflex over ( m )}{ circumflex over ( m )} : power state of target m signal s { circumflex over ( m )} l : correlation value state between target m signal and l signal s { circumflex over ( m )} r : correlation value state between target m signal and r signal c2 { circumflex over ( m )}{ circumflex over ( m )} : equalized power of target m signal c2 { circumflex over ( m )} l : equalized correlation value between target m signal and l signal c2 { circumflex over ( m )} r : equalized correlation value between target m signal and r signal s { circumflex over ( m )}{ circumflex over ( m )} : power state of target m signal s { circumflex over ( m )} l : correlation value state between target m signal and l signal s { circumflex over ( m )} r : correlation value between target m signal and r signal the three states in equations 13 and equations 14 , namely the power state of a target m signal , the correlation state of a target m signal and an l signal , and the correlation state of a target m signal and an r signal , are all variables to be stored in a static memory area during coding processing . consequently , upon starting coding processing , the three states need to be initialized to 0 . furthermore , α , which represents the proportion in equalization , may be either a variable or a constant . for example , experiment has shown that good performance can be achieved when α is set between 0 . 5 and 0 . 7 . when α is 1 . 0 , power / correlation calculating section 201 performs equalization . the equalized power of a target m signal , the equalized correlation value of a target m signal and an l signal , and the equalized correlation value of a target m signal and an r signal , are provided by equalizing the power of a target m signal , the correlation value of a target m signal and an l signal , and the correlation value of a target m signal and an r signal , using the power state of a target m signal , the correlation value state of a target m signal and an l signal , the correlation value state of a target m signal and an r signal and the proportions of equalization . in the following descriptions , the equalized power of a target m signal will be redefined as the power of a target m signal , the equalized correlation value of a target m signal and an l signal will be redefined as a correlation value of a target m signal and an l signal , and the equalized correlation value of a target signal and an r signal will be redefined as the correlation value of a target m signal and an r signal . with the present embodiment , the processings in intermediate value calculating section 202 , codebook 203 , search section 204 and decoding section 205 are the same as in embodiment 1 , and so their explanations will be omitted . the present embodiment is different from embodiment 1 in adding l signal power or r signal power in equations 12 . an effect of adding l signal power or r signal power will be explained below . first , the cost function is as shown in equation 11 . ω l to minimize this cost function is as shown in equation 15 , given that the result of partial differentiation is 0 . in equation 15 , when cross term c lr shows stable positive correlation ( that is , has a positive value ), ω l is a stable weight and gives little perceptual awkwardness . on the other hand , when cross term c lr shows negative correlation or moves wildly between positive and negative over time , although cost function f is made smaller , decoded sound / speech obtained in a decoder using that weight is perceptually awkward sound / speech in which sound pressure moves to the left and the right wildly . this is a specific phenomenon seen when there is significant coding distortion . then , in quantization of weight , if the cost function is modified in a direction to be less influenced by the value of cross term c lr , it is possible to achieve good sound / speech quality even when there is significant coding distortion . if each term in equations 4 is developed top be in proximity with a signal given by down mixing a target m signal , the result can be represented by equations 16 . a 1 = 2 . 0 · c { circumflex over ( m )}{ circumflex over ( m )} ≅ 0 . 5 ·( c llrr + 2 . 0 · c lr ) a 2 =− 2 . 0 · c { circumflex over ( m )} l − 4 . 0 · c { circumflex over ( m )} m + 2 . 0 · c { circumflex over ( m )} ≅( c ll + c lr )−( c llrr + 2 . 0 · c lr )+( c rr + c lr ) ( equations 16 ) to reduce the influence of cross term c lr included in each term of equations 16 , the values of the terms of power besides cross term c lr may be added and increased . this is a significant element of the present embodiment . consequently , in the end , equations 12 can be derived . experiment has verified that good sound / speech quality can be achieved when the transmission rate is low ( that is , when there is significant coding distortion ). in equations 12 , addition of the values of the terms of power besides cross term c lr is addition of known signal power , so that the amount of calculation required for weight quantization does not increase significantly . consequently , a significant effect can be achieved at a small increase in the amount of calculation . according to the present embodiment , in addition to the advantages of above embodiment 1 , by reducing the influence of cross term between a plurality of signals , it is possible to achieve good sound / speech quality by preventing awkward sound / speech quality in which , for example , sound pressure varies significantly , prevent the amount of calculation from increasing , and achieve good sound / speech quality . a feature of the present embodiment lies in performing different calculations from those of embodiment 1 and embodiment 2 , in a quantizing apparatus , upon performing coding and decoding using balance adjustment . the encoding apparatus configuration of the present embodiment is the same as in fig1 , and its explanations will be omitted . with the present embodiment , the quantizing apparatus configuration is the same as in fig2 . in the following description of a quantizing apparatus , codes in fig1 and fig2 will be used . power / correlation calculating section 201 performs power calculation and correlation value calculation using the l signal received as input from mdct section 104 , the target m signal received as input from adding section 108 , and the r signal received as input from mdct section 106 . power / correlation calculating section 201 outputs the calculated power and correlation value , to intermediate value calculating section 202 . power / correlation calculating section 201 finds the power and correlation value using equations 12 and equations 17 . equations 17 provides an algorithm to support embodiment 1 and equations 12 provides an algorithm to support embodiment 2 . c { circumflex over ( m )}{ circumflex over ( m )} : power of target m signal c { circumflex over ( m )} l : correlation value between target m signal and l signal c { circumflex over ( m )} r : correlation value between target m signal and r signal when power and correlation value are found using equations 12 , power / correlation calculating section 201 performs equalization as represented by equations 13 and equations 14 in order to reduce the variations of variables in equations 12 over time . when power and correlation value are found using equations 17 , power / correlation calculating section 201 performs equalization by performing the calculation of equations 18 , applying the result of equations 18 to equations 19 and updating each state . c3 { circumflex over ( m )}{ circumflex over ( m )} : equalized power of target m signal c3 { circumflex over ( m )} l : equalized correlation value between target m sign al and l signal c3 { circumflex over ( m )} r : equalized correlation value between target m sign al and r signal s { circumflex over ( m )}{ circumflex over ( m )} : equalized power of target m signal s { circumflex over ( m )} l : correlation value state between target m signal an d l signal s { circumflex over ( m )} r : correlation value state between target m signal an d r signal c3 { circumflex over ( m )}{ circumflex over ( m )} : equalized power of target m signal c3 { circumflex over ( m )} l : equalized correlation value of target m signal and l signal c3 { circumflex over ( m )} r : equalized correlation value of target m signal and r signal s { circumflex over ( m )}{ circumflex over ( m )} : power state of target m signal s { circumflex over ( m )} l : correlate values state between target m signal an d l signal s { circumflex over ( m )} r : correlation value state between target m signal an d r signal the equalized power of a target m signal , the equalized correlation value of a target m signal and an l signal , and the equalized correlation value of a target m signal and an r signal , are provided by equalizing the power of a target m signal , the correlation value of a target m signal and an l signal , and the correlation value of a target m signal and an r signal , using the power state of a target m signal , the correlation value state of a target m signal and an l signal , the correlation value state of a target m signal and an r signal and the proportions of equalization . in the following descriptions , the equalized power of a target m signal will be redefined as the power of a target m signal , the equalized correlation value of a target m signal and an l signal will be redefined as a correlation value of a target m signal and an l signal , the equalized correlation value of a target signal and an r signal will be redefined as the correlation value of a target m signal and an r signal , the equalized power of an l signal will be redefined as the power of an l signal , and the equalized power of an r signal will be redefined as the power of an r signal . intermediate value calculating section 202 finds five intermediate values using the power and correlation value received as input from power / correlation calculating section 201 . intermediate value calculating section 202 outputs the found intermediate values to search section 204 . for example , intermediate values can be found using equations 20 . α 2 =− 4 . 0 · c { circumflex over ( m )}{ circumflex over ( m )} + 2 . 0 · c { circumflex over ( m )} r α 4 = 4 . 0 · c { circumflex over ( m )}{ circumflex over ( m )} − 4 . 0 · c { circumflex over ( m )} r + c rr ( equations 20 ) where α 0 , α 1 , α 2 , α 3 , α 4 : intermediate values codebook 203 is information that is stored in a memory means such as a rom and is formed with a plurality of scalar values to be selected as an l signal balancing weight coefficient , weight coefficients , and calculated value found from weigh coefficients . the content of information to be stored in codebook 203 will be described later . search section 204 searches for an optimal one of a plurality of scalar values stored in codebook 203 , and encodes a balancing weight coefficient by selecting a number corresponding to the optimal scalar value found . to be more specific , for example , search section 204 searches for number n to minimize the cost function shown in equation 21 . search section 204 outputs selected number n to multiplexing section 117 as a code . search section 204 outputs the code having been outputted to multiplexing section 117 , to decoding section 205 . the processing in decoding section 205 according to the present embodiment is the same as in above embodiment 1 and so will not be described . α 0 · w 0 n + α 1 · w 1 n α 2 · w 2 n + α 3 · ω l n + α4 · ω r n ( equation 21 ) where ω l n , ω r n : scalar values of number n stored in codebook 203 ( weight coefficients for l signal and r signal ) w 0 n , w 1 n , w 2 n : values determined using scalar value of nu mber n stored in codebook 203 ( balancing weight coefficient f or l signal ) and weight coefficients for l signal and r signal n : number ( number n to minimize cost function beco mes code ) this concludes the explanation of the configuration of quantizing apparatus 109 . the idea of the present embodiment and the method of designing codebook 203 of the present embodiment will be explained next . although the theoretical background of balance adjustment is the same as described with embodiment 1 , the cost function of the present embodiment is different from those of embodiment 1 and embodiment 2 . although embodiment 1 and embodiment 2 use the cost function of equation 11 , when the cost function of equation 11 is used , good sound / speech quality can be achieved when there is not much difference between the power of signal l f and the power of signal r f , but , when there is a significant difference between the power of signal l f and the power of signal r f ( that is , when balancing weight coefficient w n l is extremely small or when balancing weight coefficient w n l is extremely large ), the one of the l signal side and the r signal side having the greater power becomes predominant , and the one of the smaller power becomes not worth evaluating . in that case , a phenomenon occurs where the signal of the one of the smaller power becomes even smaller . in embodiment 1 and embodiment 2 , the distortion of the signal of the smaller power becomes smaller , so that the sound / speech quality of the predominant signal improves and good sound / speech quality can be achieved . there is also a method to keep the power of a signal of a small sound that is heard with a big sound from falling , and , in that case , ingenuity would be required . so , the present embodiment uses the cost function of equation 22 below . where ω l , ω r : weight coefficients for l signal and r signal that is to say , the difference between l signal power and r signal power can be learned from the scale of the reconstructed l signal balancing weight coefficient , so that the above technical problems can be solved by performing weighting of the corresponding cost function . the present embodiment uses the weight coefficients shown in fig4 . fig4 shows part of information stored in codebook 203 of the present embodiment . in fig4 , the size of codebook 203 is 16 ( four bits ). as obvious from fig4 , when the value of l signal weight coefficient ω l is small , the value of r signal weight coefficient ω r is set large , and , when the value of r signal weight coefficient ω r is small , the value of l signal weight coefficient ω l is set large . by this means , the weight of the cost function of equation 22 can be adjusted . now , the intermediate values are found by developing the cost function of equation 22 . the developed equations are shown as equation 23 . in equation 21 , calculated values w n 0 , w n 1 , and w n 2 , necessary for the calculation of equation 21 , are found in advance by equations 24 below , and stored in codebook 203 . thus , according to the present embodiment , it is possible to find intermediate values by equation 20 , find scalar values efficiently following the above steps using codebook 203 and equation 21 , and quantize balancing weight coefficients . as a result of this , even when there is a significant difference between the values of the two terms of the l signal side and the r signal side constituting the cost function , the deterioration of the signal of the smaller value , caused by the fact that the term of the greater value becomes predominant , can be prevented , and , consequently , synthesized speech of good overall sound / speech quality can be acquired . although with the present embodiment the size of the codebook is sixteen variations ( four bits ), the present invention is by no means limited to this , and other sizes can obviously be used as well , because the present invention does not rely upon the size of the codebook . although examples have been given with above embodiments 1 through embodiment 3 where coding is performed in a scalable configuration in which an m signal is encoded in core encoder 102 before a stereo signal is quantized , the present invention is by no means limited to this and is equally applicable to stereo signal coding without a core encoder . this is because the present invention is designed to encode a balancing weight coefficient efficiently taking advantage of the fact that an m signal is produced by down mixing , and because the present invention therefore does not rely upon the presence or absence of a core encoder . regarding the m signal to be processed in quantizing apparatus 109 , although the difference between an m signal acquired by down mixing and a decoded signal obtained by core decoder 103 is used as a target m signal , the present invention is not limited to this , and it is equally possible to process a decoded signal or an m signal subjected to down mixing , in quantizing apparatus 109 . this is because the present invention is designed to encode a balancing weight coefficient efficiently taking advantage of the fact that an m signal is produced by down mixing , and because the present invention therefore does not rely upon the quality of an m signal . although embodiment 1 to embodiment 3 above disclose cases where the sum of the balancing weight coefficients of an l signal and an r signal is 2 . 0 , the present invention is by no means limited to this , and the sum of the balancing weight coefficients of an l signal and an r signal may be values other than 2 . 0 , such as 1 . 9 , 1 . 85 , etc ., given that the optimal value might vary depending on the nature of an m signal . a possible interpretation of the present embodiment is that some of the characteristics of an m signal are lost , due to down minimizing , from a target m signal obtained in core encoder 102 , so that there is a possibility to achieve good coding performance by setting values slightly lower than 2 . 0 . to be more specific , a possible method is to , for example , evaluate coding performance by changing this sum value little by little and using this sum value as the value of the sum of the balancing weight coefficients of an l signal and an r signal for encoding , on a fixed basis . although with embodiment 1 to embodiment 3 above down mixing is performed after transformation into the frequency domain , the present invention is by no means limited to this , and the present invention obviously maintains valid even if a signal having been down mixed in the time domain is transformed into the frequency domain , because the present invention does not rely upon in which domain down mixing is performed . although in embodiment 1 through embodiment 3 above the mdct is used as the method of transformation into the frequency domain , the present invention is by no means limited to this , and it is equally possible to use any digital transformation method resembling the mdct such as the dct and fft , because the present invention does not rely upon the method of frequency domain transformation . although the three signals in embodiments 1 to embodiment 3 above were time domain signals , it is equally possible to use frequency domain signals or segments of these signals , because the present invention does not rely upon the nature of vectors . codes acquired in embodiment 1 to embodiment 3 above may be transmitted when used for communication or may be stored in a recoding medium ( such as a memory , disc or print code ) when used for storage , because the present invention does not rely upon the usage of codes . although cases with two channels have been described above with embodiments 1 to embodiment 3 , the present invention is by no means limited to this and is equally applicable to cases of multiple channels ( e . g . 5 . 1 ch ). although with embodiment 1 to embodiment 3 above an l signal , r signal and m signal are subject to coding , the present invention is by no means limited to this , and it is equally possible to encode frequency spectrums of an l signal , r signal , and m signal , or segments of these , as a first signal , second signal and third signal . although with embodiment 1 to embodiment 3 above balance adjustment for a target m signal is performed prior to encoding , the present invention is by no means limited to this , and it is equally possible to perform encoding prior to balance adjustment . that is to say , encoder 115 may be placed in a location closer to input than adding section 108 , because the present invention does not rely upon whether balance adjustment is performed before or after encoding . although the above descriptions have shown preferred embodiments of the present invention by way of example , this by no means limits the scope of the present invention . the present invention is applicable to any system featuring a coding apparatus . the quantizing apparatus and encoding apparatus according to the present invention can be provided in a communication terminal apparatus and base station apparatus in a mobile communication system , so that it is possible to provide a communication terminal apparatus , base station apparatus and a mobile communication system having the same operations and effects . also , although cases have been described with the above embodiment as examples where the present invention is configured by hardware , the present invention can also be realized by software . for example , it is possible to write the algorithms of the present invention in a programming language , store this program in a memory , and , by running this program using an information processing means , implement the same functions as those of the coding apparatus of the present invention . each function block employed in the description of each of the aforementioned embodiments may typically be implemented as an lsi constituted by an integrated circuit . these may be individual chips or partially or totally contained on a single chip . “ lsi ” is adopted here but this may also be referred to as “ ic ,” “ system lsi ,” “ super lsi ,” or “ ultra lsi ,” depending on differing extents of integration . further , the method of circuit integration is not limited to lsi &# 39 ; s , and implementation using dedicated circuitry or general purpose processors is also possible . after lsi manufacture , utilization of a programmable fpga ( field programmable gate array ) or a reconfigurable processor where connections and settings of circuit cells within an lsi can be reconfigured is also possible . further , if integrated circuit technology comes out to replace lsi &# 39 ; s as a result of the advancement of semiconductor technology or a derivative other technology , it is naturally also possible to carry out function block integration using this technology . application of biotechnology is also possible . the disclosure of japanese patent application no . 2008 - 205643 , filed aug . 8 , 2008 , japanese patent application no . 2009 - 59502 , filed mar . 12 , 2009 , and japanese patent application no . 2009 - 95260 , filed apr . 9 , 2009 , including the specifications , drawings and abstracts , are incorporated herein by reference in their entirety . the quantizing apparatus , encoding apparatus , quantizing method and encoding method of the present invention are suitable for use to , for example , encode a stereo audio signal at a low bit rate .
| 6 |
with reference now to fig1 . compost is formed by grinding organic waste comprising bagged cuttings , clippings and unsalable produce to a reduced size , preferably of a size that will pass through a screen having a hole size of 6 inches square ( 6 &# 34 ;× 6 &# 34 ;) or more . any plastic containers ( bags ) for the green waste is ground with the green waste and remains with it until separated in accordance with the invention . the green waste is stored in wind - rows 10 containing plastic fragments 12 spaced to a wetting truck 14 as well as a wind - row former / processor . the fragments of plastic bags are normally in segments to about 12 - 20 inches long . the compost is kept wet by a spray of water 18 on the pile from truck 14 and allowed to stand until sufficiently digested or mature for separation according to size . when mature or stabilized , the compost is transferred to a collection truck ( not shown ), which transports the compost to a vibrating screen separator 20 for segregation according to size . separator 20 consists of a non - blinding vibrating screen and associated means to deliver the compost to the screens and process it into &# 34 ; accept &# 34 ; and &# 34 ; reject &# 34 ;. it is preferred to employ a screen with a screen bed 22 containing flexible screen mats which are dynamically tensioned and slackened by a screen box driver unit ( s ) ( not shown ). the screen box is accelerated by 3 . 5 g , the bulk receives up to 50 g . this materially aids in preventing blinding or pegs . oscillation of the screen frame , which is similar to a ladder in construction , is caused by connection to rubber blocks at the screen deck 22 level , which in turn are activated by the vibration of the screen box ( not shown ). the rubber blocks act as spring elements for the oscillation system . operation is quite quiet with minimum vibration transmitted to the support structure . the screen mats are typically - full width formed of polyurethane and flexible oscillation systems , which operate at different amplitudes , but at the same frequency to generate the non - blinding action . the non - blinding vibrating screen system is described , for instance , in u . s . pat . nos . 4 , 169 , 788 to 5 , 062 , 949 incorporated herein by reference , and manufactured by aggregates equipment , inc . of leola , pa . the screen is inclined at an angle of about 20 ° and is divided into multiple , preferably three , zones . the first zone or zones separate out small sized particles and typically has a hole size of about 1 / 4 inch square ( 1 / 4 &# 34 ;× 1 / 4 &# 34 ;). smaller or larger holes can be employed . an intermediate zone contains holes of a larger size , typically 3 / 8 &# 34 ;× 3 / 8 &# 34 ; to 5 / 8 &# 34 ;× 5 / 8 &# 34 ; and more typically about 1 / 2 &# 34 ;× 1 / 2 &# 34 ;. the coarser zone typically contains screens of holes 3 / 4 &# 34 ;× 3 / 4 &# 34 ; to 1 &# 34 ;× 1 &# 34 ;. committed , particulate compost enters screen deck 22 from hopper 24 and passes through a zone a of finest screen size . from there , it passes through zone b of a larger screen size , and then to a larger screen size in zone c for final recovery of largest compost particles . maximum screen size may be anywhere from 1 / 2 &# 34 ;× 1 / 2 &# 34 ; to 1 &# 34 ;× 1 &# 34 ;, depending on the market . it is to be understood that more or less screen sections may be employed , but to no great advantage . after final separation , the oversized particles are passed to the discharge conduit 26 and deposited onto conveyer 28 for recycling to freshly made green waste to help initiate and promote the digestion of the green waste . the recycled compost is substantially free of plastic due to removal in an exhaust system and prevented thereby from concentrating in the green waste and , ultimately , the compost . one or more , preferably two ( 2 ) plenum chambers 30 and 32 are coupled to frame 34 positioned above the screen deck 22 and act in cooperation with a wheel blower system 36 and 38 to draw air through the bed of compost counter - current to the passage of compost through the screen . the air lifts the waste plastic fragments from the bed . the fragments are drawn by suction into the plenum chambers . the plenum chambers have converging walls which cause velocity to increase as the exhaust of the plenum chamber is approached . the plenum chambers typically have a length coextensive with a width of the screen deck and sealed to screen bed 22 with flexible rubber seals 40 and 42 . plenum chamber 30 has a width in machine direction of about three feet ( 3 &# 39 ;) and draws air through the bed of compost at a rate of about 5 to about 10 feet per second . plenum chamber 32 , by contrast , is smaller , having a width of about 2 feet ( 2 &# 39 ;) and draws air at higher velocity , of about 10 to about 15 feet per second . as depicted , the plenum chambers are positioned over the mid - section ( zone b ) of the bed so as not to draw in the finer sized compost from zone a . purification is typically completed by the time the compost reaches zone c . the plenum chambers could , however , extend into zone a and / or zone c . the waste plastic which is recovered is recycled or disposed of in a landfill . compost which passes through the screens is separately recovered or combined in conveyor 40 . the compost which passes through the screen is , as indicated , conveyed away from the screen deck , packaged and sold to the agricultural and horticultural markets . as indicated above , oversized particles goes back to the compost and mixed with the green waste to continue the digestion action to break down both the green waste and the oversize . in process , the screen size in zone a is sufficiently small to prevent plastic from entering the product . in zone b , the size of the compost is large enough not to enter the plenum chamber with the plastic while the suction and screen size inhibit plastic from passing through the screen . in the final zone , plastic may pass through the screen and contaminate the compost , but is removed ahead of that zone .
| 2 |
an embodiment of the present invention will be described hereinbelow with reference to the drawings . fig3 and 4 are block diagrams showing constructions of an embodiment of the invention . fig3 shows a coding circuit and fig4 shows a decoding circuit . in fig3 reference numeral 60 denotes a memory to store data , as a table , corresponding to check bits of cyclic codes for input data i 0 , i 1 , . . . , i k - 1 , and i k . when the data i 0 , i 1 , . . . , i k - 1 , and i k are input to addresses a 0 , a 1 , . . . , a k - 1 in the memory 60 , corresponding check bits r 0 , r 1 , . . . , r m - 1 are output from data outputs d 0 , d 1 , . . . , and d m - 1 . reference numeral 62 indicates a latch circuit for latching the input data i 0 , i 1 , . . . , i k - 1 , and i k and outputs of the memory 60 corresponding to them , that is , the check bits r 0 , r 1 , . . . , and r m - 1 and outputting as a code word . in fig4 reference numeral 64 indicates a memory of the same content as that of the memory 60 . when information bits of the code word including the error pattern which was received are input to the memory 64 , corresponding check bits are output therefrom . reference numeral 66 denotes a comparator of a bit unit for comparing the check bits of the code word including the error pattern which was received and the check bits from the memory 64 on a bit unit basis and outputting an error detection signal indicative of the presence or absence of error and the error position . as the result of the bit comparison by the comparator 66 , if all of the check bits coincide , respectively , it is decided that no error exists . fig5 is a block diagram showing a schematic construction of the main section of a processing circuit as the second embodiment of the invention in the case where the number of information bits constructing one code word and the number of check bits corresponding to the information bits are large . that is , fig5 shows modification examples of the portions of the memories 60 and 64 in the coding circuit of fig3 and the decoding circuit of fig4 . reference numerals 70 , 71 , 72 , and 73 denote memories for outputting the data regarding check bits , which will be explained hereinlater , for the address inputs . reference numerals 76 , 77 , 78 , and 79 indicate operating circuits for getting the exclusive or . in the example shown in the diagram , the check bits r 0 , r 1 , . . . , and r 7 of eight bits are generated for the inputs i 0 , i 1 , . . . , and i 19 of 20 bits . the arithmetic operations are based on the galois field and its theoretical background will now be described hereinbelow . there is the relation of the following equation between the input data i and the check bits r . ## equ1 ## the equation ( 9 ) is separated into four parts . ## equ2 ## since coefficients { g i , j } of the equation ( 10 ) are previously known , the relation of ( r 0 &# 39 ;, r 1 &# 39 ;, r 2 &# 39 ;, r 3 &# 39 ;) for ( i 0 , i 1 , . . . , i 9 ) is previously obtained . a data table such that when ( i 0 , i 1 , . . . , i 9 ) are input to the addresses , the output data of ( r 0 &# 39 ;, r 1 &# 39 ;, r 2 &# 39 ;, r 3 &# 39 ;) in the equation ( 10 ) can be obtained is stored into the memory 70 . similarly , data tables such as to provide the relations of the equations ( 11 ), ( 12 ), and ( 13 ) are respectively stored into the memories 71 , 72 , and 73 . the operations of the equation ( 14 ) are executed by the operating circuits 76 , 77 , 78 , and 79 , thereby obtaining the check bits ( r 0 , r 1 , . . . , r 7 ) as final objective values . fig6 is a block diagram showing a schematic construction of the main section in the embodiment in the cases where the number of information bits and the number of check bits are further increased than those in the case of fig5 and where the number of information bits is set to a × n and the number of check bits is set to b × m . in a manner similar to fig5 fig6 shows modification examples of the portions of the memories 60 and 64 in fig3 and 4 . as shown in the diagram , in the construction of fig6 ( a × b ) memories 80 to 88 similar to the memories 70 to 73 in fig5 are arranged like a matrix , the input information bits i 0 , . . . , and i an - 1 are divided into groups and the information bits of each group are input to address inputs of the memory of the same row . similar to fig5 the memories 80 to 88 output the data regarding the corresponding check bits . if outputs from the memories of the same column are calculated by exclusive or circuits 90 to 95 , the objective check bits r 0 , . . . , r bm - 1 can be obtained . in a manner similar to the case of fig4 according to the decoding circuit using the circuits shown in fig5 and 6 , in the constructions shown in fig5 and 6 , the check bits for the information bits in the reception code word are obtained and compared with the check bits in the reception code word by a bit comparator on a bit unit basis . with the above construction , since the data is processed in parallel , objective outputs can be obtained at a very high speed . on the other hand , since the apparatus does not depend on the bit rate , even a signal of a high bit rate can be also similarly processed at a high speed . as will be easily understood from the above description , according to the invention , the check bits for the information bits can be obtained at a high speed irrespective of the bit rate . thus , the data transmission of a high bit rate can be easily realized .
| 7 |
referring to fig3 there is shown a schematic block diagram of a single channel rotary transformer circuit for a vcr in accordance with the present invention . as shown in this drawing , the single channel rotary transformer circuit comprises a microcomputer 1 for generating a head switching signal and recording / playback flags to control recording / playback operations , a control signal oscillator 2 for generating a control oscillating signal in response to the head switching signal from the microcomputer 1 , an erase signal oscillator 3 for generating an erase oscillating signal in response to the recording / playback flags from the microcomputer 1 , and a first rotary transformer 4 for transferring a signal into which the control oscillating signal from the control signal oscillator 2 and the erase oscillating signal from the erase signal oscillator 3 are combined , to first and second band pass filters 9 and 6 and a power supply circuit 5 . the power supply circuit 5 is adapted to supply power to a drum rotating circuit ( not shown ) in response to an output signal from the first rotary transformer 4 . to this end , the power supply circuit 5 includes a diode 51 for rectifying the output signal from the first rotary transformer 4 , and a condenser 52 for smoothing the rectified signal from the diode 51 . the second band pass filter 6 is adapted to filter the output signal from the first rotary transformer 4 at an erase signal frequency band . the first band pass filter 9 is adapted to filter the output signal from the first rotary transformer 4 at a control signal frequency band . the single channel rotary transformer circuit further comprises an erase switch 7 being switched in response to an output signal from the second band pass filter 6 , an erase magnetic head 8 for erasing signals recorded on a magnetic tape in response to an output signal from the erase switch 7 , a frequency / voltage converter 10 for converting an output signal from the first band pass filter 9 into a voltage signal , a buffer 11 for buffering an output signal from the frequency / voltage converter 10 , a 2 - divider 12 for dividing a period of an output signal from the buffer 11 by 2 , and a head section 16 for recording signals on the magnetic tape and reading the signals recorded on the magnetic tape . an output signal from the 2 - divider 12 is applied as a switching control signal to first and second select switches 151 and 153 in a switching section 15 , and the output signal from the frequency / voltage converter 10 is applied as a switching control signal to a third select switch 152 in the switching section 15 . the head section 16 includes a plurality of magnetic heads a - d for recording the signals on the magnetic tape and reading the signals recorded on the magnetic tape . the switching section 15 is switched in response to the output signal from the buffer 11 and the output signal from the 2 - divider 12 to transfer an output signal from the head section 16 to a second rotary transformer 14 . also , the switching section 15 is switched in response to the output signal from the buffer 11 and the output signal from the 2 - divider 12 to transfer an output signal from the second rotary transformer 14 to the head section 16 . to this end , the switching section 15 includes the first to third select switches 151 , 153 and 152 . the first select switch 151 is switched in response to the output signal from the 2 - divider 12 to select one of output signals from the magnetic heads a and b in the head section 16 . the second select switch 153 is switched in response to the output signal from the 2 - divider 12 to select one of output signals from the magnetic heads c and d in the head section 16 . the third select switch 152 is switched in response to the output signal from the buffer 11 to select one of output signals from the first and second select switches 151 and 153 . the second rotary transformer 14 is adapted to transfer an output signal from the switching section 15 to a recording / playback amplifier circuit 13 having an amplifier . also , the second rotary transformer 14 transfers an output signal from the recording / playback amplifier 13 to the switching section 15 . the recording / playback amplifier circuit 13 is adapted to amplify an output signal from the second rotary transformer 14 by a predetermined level and output the amplified signal to an input / output terminal . also , the recording / playback amplifier circuit 13 amplifies an output signal from the input / output terminal by the predetermined level and outputs the amplified signal to the second rotary transformer 14 . the operation of the single channel rotary transformer circuit for the vcr with the above - mentioned construction in accordance with the present invention will hereinafter be described in detail with reference to fig4 a to 4i which are waveform diagrams of the output signals from the components in fig3 . first , in a playback mode , the magnetic heads a - d in the head section 16 travel on tracks of the magnetic tape to read sequentially the signals recorded on the magnetic tape . at this time , the microcomputer 1 , which controls the rotation of a head drum ( not shown ), outputs the head switching signal as shown in fig4 a to the control signal oscillator 2 . the microcomputer 1 also outputs the playback flag &# 34 ; 0 &# 34 ; to the erase signal oscillator 3 . when the head switching signal from the microcomputer 1 is high in logic , the control signal oscillator 2 outputs the control oscillating signal as shown in fig4 b . the erase signal oscillator 3 outputs a playback oscillating frequency signal fp in response to the playback flag &# 34 ; 0 &# 34 ; from the microcomputer 1 , the playback oscillating frequency signal fp having a frequency lower than that of a recording oscillating frequency signal fn . the control oscillating signal from the control signal oscillator 2 and the playback oscillating frequency signal fp from the erase signal oscillator 3 are combined as shown in fig4 c and then transferred through the first rotary transformer 4 to the first and second band pass filters 9 and 6 and the power supply circuit 5 . in the power supply circuit 5 , the combined signal is rectified by the diode 51 and smoothed by the condenser 52 . the resultant direct current ( referred to hereinafter as dc ) voltage signal is supplied to the drum rotating circuit . also , the combined signal is not filtered at a recording oscillating frequency band by the second band pass filter 6 . also , the combined signal is filtered at the control signal frequency band by the first band pass filter 9 and the resultant signal as shown in fig4 b is applied to the frequency / voltage converter 10 . the frequency / voltage converter 10 converts the output frequency signal from the first band pass filter 9 into the voltage signal as shown in fig4 d and outputs the converted voltage signal to the buffer 11 . the buffer 11 buffers the output signal from the frequency / voltage converter 10 and outputs the resultant signal as shown in fig4 e to the 2 - divider 12 and the third select switch 152 in the switching section 15 . the 2 - divider 12 divides the period of the output signal from the buffer 11 by 2 and outputs the resultant signal as shown in fig4 f to the first and second select switches 151 and 153 in the switching section 15 . when the output signal from the 2 - divider 12 as shown in fig4 f is high in logic , the first and second select switches 151 and 153 select the output signal from the magnetic head a and the output signal from the magnetic head c , respectively . on the contrary , when the output signal from the 2 - divider 12 as shown in fig4 f is low in logic , the first and second select switches 151 and 153 select the output signal from the magnetic head b and the output signal from the magnetic head d , respectively . as a result , the first and second select switches 151 and 153 output the resultant signals as shown in fig4 g and 4h to the third select switch 152 , respectively . also , when the output signal from the buffer 11 as shown in fig4 e is high in logic , the third select switch 152 selects the output signals from the magnetic heads a and b transferred through the first select switch 151 . on the contrary , when the output signal from the buffer 11 as shown in fig4 e is low in logic , the third select switch 152 selects the output signals from the magnetic heads c and d transferred through the second select switch 153 . as a result , the third select switch 152 outputs the resultant signal as shown in fig4 i to the second rotary transformer 14 . in result , the output signals from the magnetic heads a - d in the head section 16 are sequentially applied to the second rotary transformer 14 through the switching section 15 . then , the output signal from the switching section 15 as shown in fig4 i is transferred to the recording / playback amplifier circuit 13 through the second rotary transformer 14 . the recording / playback amplifier circuit 13 amplifies the output signal from the second rotary transformer 14 by the predetermined level and outputs the amplified signal to a video / audio processing circuit ( not shown ) through the input / output terminal . on the other hand , in a recording mode , the microcomputer 1 , which controls the rotation of the head drum ( not shown ), outputs the head switching signal as shown in fig4 a to the control signal oscillator 2 . the microcomputer 1 also outputs the recording flag &# 34 ; 1 &# 34 ; to the erase signal oscillator 3 . when the head switching signal from the microcomputer 1 is high in logic , the control signal oscillator 2 outputs the control oscillating signal as shown in fig4 b . the erase signal oscillator 3 outputs the recording oscillating frequency signal fn in response to the recording flag &# 34 ; 1 &# 34 ; from the microcomputer 1 . the control oscillating signal from the control signal oscillator 2 and the recording oscillating frequency signal fn from the erase signal oscillator 3 are combined as shown in fig4 c and then transferred through the first rotary transformer 4 to the first and second band pass filters 9 and 6 and the power supply circuit 5 . in the power supply circuit 5 , the combined signal is rectified by the diode 51 and smoothed by the condenser 52 . the resultant dc voltage signal is supplied to the drum rotating circuit . also , the combined signal is filtered at the recording oscillating frequency band by the second band pass filter 6 , thereby causing the erase switch 7 to be turned on . as the erase switch 7 is turned on , the erase magnetic head 8 erases the signals recorded on the magnetic tape . also , the combined signal is filtered at the control signal frequency band by the first band pass filter 9 and then applied as the switching control signals to the first to third select switches 151 , 153 and 152 in the switching section 15 in the same manner as that in the playback mode . on the other hand , an output signal from the video / audio processing circuit ( not shown ) is applied to the recording / playback amplifier circuit 13 through the input / output terminal . the output signal from the video / audio processing circuit is amplified by the predetermined level by the recording / playback amplifier circuit 13 and then applied to the switching section 15 through the second rotary transformer 14 . in the switching section 15 , the first to third select switches 151 , 153 and 152 are switched in response to the output signal from the 2 - divider 12 and the output signal from the buffer 11 to drive the corresponding magnetic hems . as a result , the output signal from the video / audio processing circuit is recorded on the magnetic tape . as apparent from the above description , according to the present invention , the single channel rotary transformer circuit is capable of switching the plurality of magnetic heads to transmit the recording / playback signals to / from the magnetic heads through the single channel . therefore , an rf circuit can be simplified in construction as compared with the conventional multi - channel rotary transformer circuit . also , there is no necessity for designing a short ring to shield an inter - channel signal interference . further , the reduced number of recording / playback amplifiers has the effect of reducing the manufacturing cost . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .
| 6 |
we turn now to the circuitry and operation of a preferred embodiment of the invention , after first briefly describing the drawings . fig1 is a block diagram of the circuitry embodying this invention . fig2 is a circuit diagram of a single stage of a low pass filter . fig3 is a circuit diagram of a single stage of a high pass filter . fig4 is a timing diagram of the input and output of a modulator . referring to fig1 the muscle fatigue monitor circuit is shown generally at 10 . a myoelectric signal is detected by differential surface electrodes 12 and transmitted to preamplifier 14 . preamplifier 14 first filters the myoelectric signal to remove noise and low frequency artifacts caused by body movements and then amplifies the signal . the output from preamplifier 14 is simultaneously fed to modulated low pass and high pass filters 16 , 18 . each filter has a series of five identical stages . the first stage 20 for the low pass filter is shown in fig2 . the signal passes through a pair of switches 24 , 25 ( when closed ) and a pair of identical resistors 27 , 28 to an input of operational amplifier 30 . identical capacitors 32 , 33 form a double - pole rc filter with resistors 27 , 28 , which determines the cutoff frequency fc of the filter stage according to the following equation : as the rc value is constant , the cutoff frequency is actually a function of n , the duty cycle , which is directly proportional to the length of time switches 24 , 25 remain closed during a cycle . trim resistors 35 , 36 control the spectral characteristics of stage 20 . first stage 40 for high pass filter 18 is shown in fig3 . the signal from preamplifier 14 passes through a pair of identical , series - connected capacitors 44 , 45 to an input of operational amplifier 47 . switches 49 , 50 connect a pair of resistors 52 , 53 to corresponding capacitors 44 , 45 , and the cutoff frequency of stage 40 is governed by the same equation as with low pass filter stage 20 . trim resistors 55 , 56 control the spectral characteristics of stage 40 . low pass filter 16 has the same cutoff frequency as high pass filter 18 for all values of the duty cycle . both filters 16 , 18 have very sharp roll - offs of about 60 db per octave , and their resistor and capacitor values are correspondingly equal so that filter characteristics are independent of any change in cutoff frequency . filters 16 , 18 introduce a gain of about ten . the output signal of high pass filter 18 is fed to fixed low pass filter 60 , which removes the high frequency artifacts created by the filter &# 39 ; s switches . as fixed low pass filter 60 introduces its own gain of about ten , an attenuator 61 is used as a pre - stage to reduce the incoming signal by the same factor . the gain of filter 60 therefore restores its output signal to a level equal to the output signal of low pass filter 16 . the signals from filters 16 , 60 are fed into identical rms circuits 70 , 71 , which calculate true rms voltage . rms circuits 70 , 71 have unity gain amplifiers 72 , 73 as first stages , which provide the input signals for rms modules 75 , 76 . amplifiers 72 , 73 remove any d . c . offsets introduced by the amplifiers of filters 16 , 18 , and 60 . such offsets would otherwise be erroneously added to the rms circuits &# 39 ; output , as each rms module 75 , 76 continuously sends out an rms voltage corresponding to the magnitude of the filtered input signal it receives . a four position switch 77 having multiple poles is connected to rms modules 75 , 76 of the rms circuits 70 , 71 . two poles connect a different capacitance 81 - 84 to rms modules 75 , 76 and thereby enables time constant of 0 . 1 , 0 . 5 , 2 . 83 or 10 . 0 seconds to be selected for a given test . six other poles are used to maintain the gains and offsets of the circuits . the outputs of rms circuits 70 , 71 are fed through switches 78 , 79 ( when closed ) to difference amplifier 80 , the output of which is proportional to the difference between its two rms voltage inputs . the gain of amplifier 80 is externally adjustable through two poles of switch 77 . the gain is adjusted by the poles to keep dynamic performance constant relative to the selected time constant . the output from amplifier 80 is sent to differentiator 85 and one input of summing amplifier 86 . differentiator 85 produces an initially large , transient voltage for an abrupt change in input voltage . the differentiator &# 39 ; s output is fed to the other input of summing amplifier 86 . the addition of the differentiated voltage into this circuitry which controls the response of the monitor ( as hereinafter explained ) improves the dynamic responses of the monitor by a factor of about four . summing amplifier 86 combines the differentiator &# 39 ; s and the difference amplifier &# 39 ; s outputs . the sum of these voltages is then fed to integrator 87 which produces a slowly varying d . c . voltage corresponding to the integral of the difference between the high - filtered and low - filtered rms voltages and the differentiated value of said difference . the integrated output is fed through sample and hold circuit 88 ( to be discussed later ) to comparator 92 of the modulator 90 . the other input for comparator 92 is from triangle wave generator 94 which operates at about 20 khz . the integrator signal of fig4 is greatly time - compressed as it has a much lower frequency content than that of the triangle wave . therefore , changes in pulse width and duty cycle would occur more gradually than represented . as shown in the timing diagram of fig4 the output of comparator 92 is a pulse width modulated ( pwm ) signal or pulse train , the pulse width ( and hence the duty cycle ) of which increases or decreases with a corresponding change in the level of the integrator output . the pwm signal is fed to low and high pass filters 16 , 18 . the output from sample and hold circuit 88 is also fed to band pass filter 98 which eliminates the d . c . level and sends an amplified a . c . output to zero detector 100 . placement of band pass filter 98 after sample and hold circuit 88 insures stable operation when monitor is used in the hold mode ( as hereinafter explained ). zero detector 100 feeds an input signal from band pass filter 98 into a pair of matched comparators 101 , 102 and sends out the resulting signal to clock 104 . as long as no voltage is received from zero detector 100 , clock 104 provides high frequency clocking pulses for sample and hold circuit 88 . the clocking pulses repeatedly enable the sample and hold circuit 88 , thus passing a staircased version of the output of integrator 87 to modulator 90 . the output of zero detector 100 is also fed to switches 78 , 79 , alternate light circuit 108 , and event marker driver circuit 114 . when the integrator output continues to have significant a . c . variation , no zero is detected . red light 109 of light circuit 108 is lit , and switches 78 , 79 remain closed . if there is no a . c . variation from integrator 87 , zero detector 100 produces an output voltage . green light 110 turns on , and switches 78 , 79 are open . driver circuit 114 enables the event marker of a gulton rustrack # 500 strip chart recorder 112 . recorder 112 also has scale select switch 116 , which controls the recorder chart scale , and a chart drive switch 118 , which selectively enables the chart movement of recorder 112 . the rms circuits 70 , 71 also need their respective outputs to meter switch 120 and meter 122 . meter switch 120 is a two - pole , three - position switch which selectively forwards either high or low filtered rms voltage or their difference to meter circuit 122 . meter circuit 122 amplifies the signal from meter switch 120 and sends it to meter 124 for visual display . the same rms outputs are also fed to mode switch 126 , which when closed , feeds the rms voltage to divider circuit 128 . divider circuit 128 produces an output signal which represents the ratio of the two rms voltages . this ratio output is amplified and sent to analog switch 130 . analog switch 130 sets its ratio output to 1 until an initial signal is received . the ratio output of analog switch 130 is sent to recorder &# 39 ; s parameter switch 132 . parameter switch 132 also receives the output from sample and hold circuit 88 , and either signal can be selected for print out on the recorder 112 . referring to fig1 surface electrodes 12 are connected to a patient &# 39 ; s muscle . a cutoff frequency is selected for filters 16 , 18 . this selected frequency is usually about 90 hz , which is in the mid - range of possible median myoelectric frequencies . when the monitor is activated , the actual myoelectric signal is sensed by electrodes 12 and sent through preamplifier 14 to low and high pass filters 16 , 18 . if the actual median frequency of the myoelectric signal is above or below the selected cutoff frequency , the low and high filters &# 39 ; rms voltages from rms circuits 70 , 71 will not be the same . when the rms difference is zero the cutoff frequency of the filters approximately equals the true median frequency . switches 78 , 79 are initially closed , and the different rms voltages are fed into amplifier 80 . the amplifier output represents the difference between the rms voltages . if the low pass filter &# 39 ; s output is greater than the high pass filter &# 39 ; s output , the output of difference amplifier 80 has a negative value . if the opposite were the case , the amplifier output would be positive . this signal passes through differentiator 85 and summing amplifier 86 . integrator 87 then produces the slowly varying d . c . signal which is fed to modulator 90 , because sample and hold circuit 88 is initially continuously enabled . the modulator combines the integrator output with the triangle wave to produce a 20 khz pulse train which is fed to the switches of filters 16 , 18 . the filter switches close when they receive a pulse and open for a period of zero voltage . as previously explained , the duty cycle and hence the filters &# 39 ; cutoff frequency directly depend on the length of &# 34 ; on &# 34 ; time for the switches , and as shown in fig4 the level of the integrator output determines this pulse width or &# 34 ; on &# 34 ; time . based on the pulse width of the modulator output signal , the filters &# 39 ; cutoff frequency increases or decreases toward the actual median frequency . the rms voltages are compared again and the difference is less . integrator 87 integrates the new difference to the old , and the cutoff frequency is increased or decreased again towards the real median . this is a continuous process which forces the cutoff frequency of the filters toward close approximation of the true median frequency . in the event the modulator output raises or lowers the filters &# 39 ; cutoff frequency past the actual median , the output of difference amplifier 80 will change sign . the new output will reduce the integrator output thereby correcting the overshoot . the monitor can operate in a track mode in which the sample and hold circuit 88 is continually enabled , and switches 78 , 79 remained closed throughout the test . the track plot records the cutoff frequency of filters 16 , 18 . the filters &# 39 ; cutoff frequency is continually displayed as it decreases as the median frequency decreases . the decrease in frequency can be real - time recorded in this manner and directly observed as it occurs . the resulting track mode plot can be directly read for median frequency at any given point . the track plot is also not susceptable to amplitude changes which invariably occur due to a number of factors including patient movement . finally , track plots for successive tests can be easily compared . there is a fall off at the beginning of each muscle contraction . this is clearly shown by the track plots even if the readouts for different tests were not started at the same time . the monitor can also function in a hold mode . there , zero detector 100 disables clock 104 when it senses the absence of substantial a . c . variation from the integrator 87 . sample and hold circuit 88 then blocks any signal from integrator 87 and holds the last previous value . at the same time , zero detector 100 switches 78 , 79 cutting off any further rms voltages from rms circuits 70 , 71 . the cutoff frequency of the filters of the now - balanced monitor is fixed at the initial median frequency . the median frequency of the myoelectric signal decreases as the muscle is fatigued , however , and low pass filter therefore passes increasingly more of the entire signal . as the test progresses , the high filtered voltage decreases with respect to the low filtered voltage . the difference can be seen visually at meter 124 or on the chart of recorder 112 . in one embodiment the two voltages are respectively plotted along x and y axes of a graph , with the resulting polar vector representing the magnitude of the overall myoelectric signal . alternatively , the ratio of the voltages can be plotted as a function of time .
| 0 |
some examples of the present invention will be described below in the specification with reference to illustrative drawings . it should be noted that each reference numerals in the drawings are to be meant to indicate the same element when the numeral is the same although present in different drawings . also , in explaining the examples of the present invention in the specification , detailed description on the well - known constructing element or functions related to the invention will be omitted when the specific explanation can obscure the features of the present invention . also , if a component is referred to be “ linked ”, “ coupled ” or “ connected ” to another component in describing construction component of the present invention , the component may be directly linked or connected to the other component , or a third component may intervene to “ link ”, “ couple ” or “ connect ” the two components . fig1 is a block diagram illustrating a 3d image processing unit . referring to fig1 , the 3d image processing unit comprises an input unit 100 , an inverse - multiplexing unit 110 , a video decoding unit 120 , a 3d image synchronizing unit 130 , a 3d image compositing unit 140 , a video output unit 150 , an audio decoding unit 160 and an audio output unit 170 . the input unit 100 receives input of 3d images from outside . more specifically , the input unit 100 receives input of transmission stream including 3d image data , and transmits the input to an inverse - multiplexing unit . the inverse - multiplexing unit 110 separates audio and video . more specifically , the inverse - multiplexing unit 110 can separate basic stream ( s ) on audio and basic stream ( s ) on video from the transmission stream and , in the case of 3d image broadcasting , can separate basic stream on multiple constituent videos ( images ). the video decoding unit 120 decodes the basic stream ( s ) on video . the video decoding unit 120 can include a first video decoding unit 121 and a second video decoding unit 122 . the first video decoding unit 121 can decode the basic stream on the first image constituting the 3d image to generate a first image ( data ), and the second video decoding unit 122 can decode the basic stream on the second image , which constitutes the 3d image and related to the first image , to generate a second image ( data ). for example , when the 3d image is consist of a dual stream with one basic stream on the reference image and the other basic stream on the additional image , the first video decoding unit 121 can decode the basic stream on the reference image to generate a reference image , and the second video decoding unit 122 can decode the basic stream on the additional image to generate on additional image . the audio decoding unit 160 decodes the basic stream ( s ) on audio and generates audio ( data ), and the audio output unit 170 outputs the audio data generated . the 3d image synchronizing unit 130 synchronizes the decoded first image and the second image at the video decoding unit 120 . the 3d image compositing unit 140 generates 3d image ( data ) on the basis of the synchronized first and second images , and outputs the images on a display means through the video output unit 150 . the 3d image compositing unit 140 generates the 3d image data in the format of side - by - side or frame packing depending on the format supported by the video output unit 150 , and outputs the images on a displaying means through the video output unit 150 . for example , the first image can be a reference image and the second image an additional image . when the first video decoding unit 121 decodes the basic stream on the reference image to generate a reference image and the second video decoding unit 122 decodes the basic stream on the additional image to generate an additional image , mpeg - 2 video encoding method can be used at the first video decoding unit 121 and encoding methods producing high quality video such as h . 264 or hevc ( high efficiency video coding ) can be used at the second video decoding unit 122 . the h . 264 video encoding method generally shows two times higher compression efficiency compared to mpeg - 2 video encoding method , and the hevc video method shows four times higher compression efficiency compared to mpeg - 2 video method . therefore , when a broadcasting station ( server ) transmits dual stream - based 3d image broadcasting , h . 264 encoded stream can have 12 mbps of data rates if mpeg - 2 encoded stream has 6 mbps of data rates . in other words , under the same channel noise environment , the chances of error when transmitting mpeg - 2 encoded data is about two times higher compared to the chances of error when transmitting h . 264 encoded data . the present invention , considering the features that occurrence of errors in multiple images constituting a 3d image is not homogeneous among images , proposes a method of enhancing the quality of 3d images by correcting ( or compensating ) the error of one image by using the other image in which error has not occurred from multiple images constituting a 3d image . fig2 is a block diagram illustrating a 3d image processing unit according to one example of the present invention . referring to fig2 , the 3d image processing unit according to the present invention comprises an input unit 200 , an inverse - multiplexing unit 210 , a video decoding unit 220 , a 3d image synchronizing unit 230 , a 3d image correcting unit 235 , a 3d image compositing unit 240 , a video output unit 250 , an audio decoding unit 260 and an audio output unit 270 . the video decoding unit 220 includes a first video decoding unit 221 and a second video decoding unit 222 . the operations of the input unit 200 , the inverse - multiplexing unit 210 , the video decoding unit 220 , the 3d image synchronizing unit 230 , the audio decoding unit 260 and the audio output unit 270 are the same as the operations of the devices described with reference to fig2 and detailed explanation is omitted . the 3d image processing unit according to the present invention further includes a 3d image correcting unit 235 . the 3d image correcting unit 235 performs the step of error correction on the basis of the first and second images synchronized at the 3d image synchronizing unit 230 . the step of error correction includes checking the error and , when error is detected , correcting the error of the data of the image which contains the error on the basis of other image in which error is not detected . when error is detected in the first image ( or one block of the first image ), for example , the error in the first image ( or one block of the first image ) can be corrected on the basis of the second image ( or corresponding block of the second image ). when error is detected in the second image ( or one block of the second image ), as another example , the error in the second image ( or one block of the second image ) can be corrected on the basis of the first image ( or corresponding block of the first image ). the 3d image compositing unit 240 generates a 3d image on the basis of the reference image and additional image for which error correction has been performed , and outputs the 3d image on a display means through the video output unit 150 . the process of correcting errors performed at the 3d image correcting unit 235 can be performed as follows . fig3 is a flow diagram illustrating the process of error correction by the 3d image correcting unit according to one example of the present invention . in the description below , the case where error is detected in the first image among multiple images constituting the 3d image will be described as an example . it is obvious that the first image can be one arbitrary image of multiple images 3d image . for example , the first image can be a reference image constituting the stereoscopic image or the first image can be an additional . also , when three or more images constitute the 3d image , for example , the first image can be one of the three or more images . referring to fig3 , the 3d image correcting unit detects ( or checks ) errors on the first image constituting a 3d image in block unit ( or pixel unit ) of the image ( s 300 ). the error detection can be performed by using the characteristics of the basic stream of corresponding image itself or can be performed by comparing the pixel values of corresponding image decoded or by comparing the values of pixel blocks . as one example , if the first image is a reference image encoded by mpeg - 2 , the 3d image correcting unit can detect errors by comparing the level ( value ) in macro block unit of n × n pixels ( for example 8 × 8 pixels ) on the image decoded by mpeg - 2 . explaining more specifically , dc ( direct current ) coefficient included in dct ( discrete cosine transform ) coefficient as respective macro block unit of decoded image data is compared with dc coefficients of adjacent blocks to check whether the coefficient is within a certain range of values , and if the coefficient is not within the certain range of values , the macro block can be determined to contain errors . in other words , after extracting dc of each macro block unit , dc level of one block is compared to those of adjacent blocks and if the dc level is not within a certain range , the block can be detected ( or determined ) as an error block in which an error is occurred . in this case , the 3d image correcting unit can detect error blocks in the way shown in table 1 . referring to table 1 , x represents a certain block and neighbor ( x ) adjacent blocks around x ( for example 8 blocks surrounding the block x ). in the table , y represents the block among the adjacent blocks represented by neighbor ( x ), which is most similar to the block x in dc level . also , dis ( x , y ) represents the distance of similarity between the dc level of block x and the dc level of block y , and t represents the value of certain limit . in other words , the block x can be determined as an error block if the distance of similarity between the dc level of block y , which is the adjacent block with the closest dc level to the block x , and the dc level of block x is larger than the limit value of t . when the 3d image correcting unit detects error in macro block unit , detection of error can be easily performed with shorter time for correction . when the 3d image correcting unit detects an error block ( or pixel ) containing an error in the first image , the unit searches a corresponding block ( or pixel ) which corresponds to the error block in the second image related to the first image ( s 310 ). when the first image is a reference image decoded by mpeg - 2 and the second image is an additional image decoded by h . 264 ( or hevc ), for example , and if an error block is detected in the macro block unit of n × n pixels ( for example , 8 × 8 pixels ) on the reference image , comparison can be made on the macro block unit of n × n pixels ( for example , 8 × 8 pixels ) on the additional image . first , the 3d image correcting unit calculates correlation between the macro blocks on the first image and the macro blocks on the second image related to the first image to calculate disparity at the block unit . the calculation of correlation between the macro blocks on the first image and the macro blocks on the second image can be performed by using general 3 dimensional stereo matching method . as one example , dc level ( value ) of each block can be used as the value of each block of the macro blocks of the first image and the macro blocks of the second image . for example , considering each block as one pixel , disparity between two blocks can be represented as mathematical formula 1 , and the value of disparity can be calculated by using the value with the minimum cost among adjacent pixels . e ( x , y , d )=| i 1 ( x + d , y )− i 2 ( x , y )| [ mathematical formula 1 ] referring to mathematical formula 1 , i 1 is the value of the block ( or pixel ) of the first image , i 2 the block ( or pixel ) of the second image , ( x , y ) a variable representing the spatial coordinate of blocks ( or pixels ), d the disparity representing spatial distance between two corresponding blocks ( or pixels ) and e the cost . the 3d image correcting unit can calculate the value of disparity by using the value with minimum cost on the basis of the mathematical formula 1 . then , the 3d image correcting unit can search corresponding block in the second image , in which error has not been occurred , by using disparities of blocks excluding error block of the first image ( for example , reference image ), in which the error has occurred , and the blocks of the second image ( for example , additional image ) related to the first image . fig4 illustrates the process of searching the block corresponding to an error block according to one example of the present invention . in the figure , it is assumed that ( a ) represents the macro blocks on the first image and ( b ) represents the macro blocks on the second image . in fig4 , assuming that the area with oblique lines in ( a ), which is the blocks on the first image , is an error block 400 , corresponding block 410 can be searched in ( b ), which is the blocks on the second image , through the disparities of adjacent blocks ( 401 , 402 , 403 , 404 , 405 , 406 , 407 , 408 ). referring to fig3 again , the 3d image correcting unit corrects the error block ( or pixel ) of the first image , in which an error has occurred , on the basis of the block ( or pixel ) information of the corresponding block ( or pixel ) related to the first image ( s 320 ). here , correction of the block in which an error has occurred includes correcting the error pixel in the block in which the error has occurred . the 3d image correcting unit can correct the error block on the basis of the block information of the corresponding block when the amount of disparity change of the error block and the amount of disparity change of the corresponding block is not similar . in other words , the 3d image correcting unit can correct the error block on the basis of the block information of the corresponding block when the difference between the amount of disparity change , which is measured between the adjacent blocks of said error block and said error block , and the amount of disparity change , which is measured between the adjacent blocks of said corresponding block and said corresponding block , is greater than a certain value . here , the amount of disparity change can mean the amount of disparity change between the corresponding block and adjacent blocks . in the above one example , when the value of disparity at the same block of previous frame exists in the step of searching the corresponding block , the value can be used for reference . for example , when the value of a block except the error block is similar to the value of previous frame , the value of disparity calculated in previous frame can be used as the value of disparity of current block . also , the 3d image correcting unit can correct the error block on the basis of the color of the corresponding block or the difference in colors with adjacent blocks of the corresponding block when the difference in colors of the error block and adjacent blocks of the error block is not similar to the difference in colors of the corresponding block and adjacent blocks of the corresponding block . the 3d image correcting unit can correct the error block by simply copying the color of the corresponding block to the error block , or can correct the error block on the basis of the difference in colors between the corresponding block and adjacent blocks of the corresponding block . fig5 is a block diagram illustrating a 3d image processing unit according to one example of the present invention . referring to fig5 , the 3d image correcting unit 50 , which performs error correction on the first and second images constituting the 3d image , includes an error block detector 500 , a corresponding block searcher 510 and a corrector 520 . the error block detector 500 determines errors of the first image in block unit and detects an error block . the error block detector 500 can detect an error block by extracting dc level from the macro block unit of n × n pixels of the first image and comparing dc level of a certain block to dc level of adjacent blocks . for example , the macro block unit of n × n pixels of the first image includes the case of the macro block unit of 8 × 8 pixels of the first image . also , the error block detector 500 can detect a certain block as the error block when the difference of the dc level of the certain block and the dc level of the block having the dc level which is closest to the dc level of the certain block among the adjacent blocks of the certain block is greater than predetermined limit , as described in table 1 . the corresponding block searcher 510 searches the corresponding block which corresponds to the error block detected in the second image . the corresponding block searcher 510 can calculate the disparity at the macro block unit of n × n pixels of the first image and the macro block unit of n × n pixels of the second image , and search the corresponding block in the second image on the basis of the disparity at the block unit . in this case , the corresponding block searcher 510 can calculate the disparity by using the mathematical formula 1 . the corrector 520 corrects the error of the error block on the basis of the block information of the corresponding block . the corrector 520 can correct the error block by copying the colors of the corresponding block to the error block . also , the corrector 520 can correct the error block on the basis of the difference in colors between the corresponding block and adjacent blocks of the corresponding block . fig6 illustrates the process of processing a 3d image according to one example of the present invention . the 3d image processing unit synchronizes the first and second images constituting the 3d image ( s 600 ). the 3d image processing unit detects an error block in the first image ( s 610 ). the 3d image processing unit extracts dc level from macro block unit ( for example , macro block unit of 8 × 8 pixels ) of n × n pixels of the first image , and can detect the error block by comparing dc level of a certain block to dc level of adjacent blocks . for example , as described with respect to table 1 , the 3d image processing unit can detect a certain block as the error block when the difference of the dc level of the certain block and the dc level of the block having the dc level which is closest to the dc level of the certain block among the adjacent blocks of the certain block is greater than predetermined amount . the 3d image processing unit searches the corresponding block which corresponds to the error block in the second image ( s 620 ). the 3d image processing unit , in searching the corresponding block , can calculate the disparity at the macro block unit of n × n pixels of the first image and the macro block unit of n × n pixels of the second image , and can search the corresponding block in the second image on the basis of the disparity at the block unit . in this case , the 3d image processing unit can calculate the disparity by using the mathematical formula 1 described above . the 3d image processing unit corrects the error block on the basis of the block information of the corresponding block ( s 630 ). the 3d image processing unit can correct the error block by copying the colors of the corresponding block to the error block . also , the 3d image processing unit can correct the error block on the basis of the difference in colors between the corresponding block and adjacent blocks of the corresponding block . also , the 3d image correcting device can correct the error block on the basis of the block information of the corresponding block only when the difference between the amount of disparity change , which is measured between the adjacent blocks of the error block and the error block , and the amount of disparity change , which is measured between the adjacent blocks of the corresponding block and the corresponding block , is greater than predetermined value . also , the 3d image processing unit can correct the error block on the basis of the color of the corresponding block or the difference in colors with adjacent blocks of the corresponding block when the difference in colors of the error block and adjacent blocks of the error block is not similar to the difference in colors between the corresponding block and adjacent blocks of the corresponding block . the 3d image processing unit generates the 3d image by compositing the first image the error block corrected and the second image ( s 640 ). the 3d image processing unit can generate a 3d image with error corrected . the devices and the system including thereof can be implemented by hardware , software and the combination thereof . in the case of hardware implementation , the module used for recording broadcast program can be implemented by one or more application specific ic ( asic ), digital signal processor ( dsp ), digital signal processing unit ( dspd ), programmable logic device ( pld ), field programmable gate array ( fpga ), processor , controller , micro - controller , microprocessor , or other electronic unit designed to perform the functions described in the specification , or by combination thereof . software can be used to implement the module performing the functions described in the specification . software codes can be stored in a memory unit and executed by a processor . the memory unit can be implemented inside or outside the processor , and when implemented outside the processor , the memory can be connected to the processor through well - known connecting means . meanwhile , the method of the present invention described above can be implemented by a computer program . and the code or code segment constituting the program can be easily inferred by computer programmers in the field . also , the produced computer program can be stored in recording media ( information storing media ) that can be read by a computer , and executed by the computer , thereby implementing the method of the present invention . and , the recording media include all forms of recording media that can be read by a computer ( including intangible media such as carrier wave as well as tangible media such as cd and dvd ). it should be appreciated that the above description has been made to illustrate the technical idea of the present invention , and can be corrected and modified within the scope of the essential features of the present invention by those skilled in the art to which the present invention pertains to . therefore , the examples in the specification of the present invention should be considered not to limit the technical idea of the present invention but illustrate the present invention . in sum , and the present invention shall not be limited by the examples but shall be interpreted by the claims attached in terms of the scope of the invention , and any technical ideas equivalent to that of the present invention shall be considered to be within the scope of the present invention .
| 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.