text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
[ 0020 ] fig1 is a side view of a bicycle that incorporates a particular embodiment of a braking apparatus according to the present invention . in this embodiment , the bicycle is a touring bicycle comprising a frame 1 with a double - loop frame body 2 and a front fork 3 , a handle assembly 4 for steering , a drive unit 5 for transmitting the rotation of pedals 5 a to a rear wheel 7 , a front wheel 6 , and a brake system 8 for braking the front and rear wheels 6 and 7 . the handle assembly 4 comprises a handle stem 10 fixedly mounted in the upper portion of the front fork 3 and a handlebar 11 fixedly mounted on the handle stem 10 . the handle assembly 4 , drive unit 5 , front wheel 6 , rear wheel 7 , and brake system 8 are mounted together with a saddle 9 and other components on the frame 1 . as shown in fig2 the brake system 8 comprises front and rear brake levers 12 f and 12 r , braking devices 13 f and 13 r actuated by the front and rear brake levers 12 f and 12 r , front and rear brake cables 14 f and 14 r connected between the front and rear brake levers 12 f and 12 r and the front and rear braking devices 13 f and 13 r , and a cable connector 15 for connecting the front and rear brake cables 14 f and 14 r in a manner described below . the brake cables 14 f and 14 r comprise inner cables 16 f and 16 r connected at both ends to the brake levers 12 f and 12 r and to the braking devices 13 f and 13 r , and outer casings 17 f and 17 r for covering the inner cables 16 f and 16 r . the outer casings 17 f and 17 r are divided by the cable connector 15 into the outer casings 17 fa and 17 ra extending from cable connector 15 toward the brake levers 12 f and 12 r , and the outer casings 17 fb and 17 rb extending from cable connector 15 toward the braking devices 13 f and 13 r . the front brake lever 12 f is mounted inwardly from a grip 18 a attached to the left end of the handlebar 11 , and the rear brake lever 12 r is mounted inwardly from a grip 18 b attached to the right end of the handlebar 11 . the brake levers 12 f and 12 r are mirror images of each other . the brake levers 12 f and 12 r each comprise a lever bracket 20 mounted on the handlebar 11 , a lever member 21 pivotably supported by the lever bracket 20 , and an outer retainer 22 fixedly screwed into the lever bracket 20 . each lever bracket 20 comprises a rocking shaft 20 a for pivotably supporting the lever member 21 , a mounting component 20 b detachably mountable on the handlebar 11 , and an internally threaded component 20 c capable of threadably accepting the outer retainer 22 and receiving the inner cables 16 f and 16 r therethrough . each lever member 21 is biased by a biasing member ( not shown ) in the direction of brake release , and each lever member 21 has an inner retainer 21 a for securing the inner cables 16 f and 16 r of the brake cables 14 f and 14 r . as shown in fig4 , each outer retainer 22 comprises a cable sleeve 23 , a guide 24 , a coil spring 25 , and a cable cover 26 . the guide 24 is a cylindrical member whose tip is provided with an externally threaded portion 24 a for detachable threaded engagement with the internally threaded component 20 c of a conventional lever bracket 20 . such a structure makes it easy to remove and / or repair outer retainer 22 . the cable sleeve 23 is a perforated cup - shaped member capable of securing the tips of the outer casings 17 fa or 17 ra , and it has on the external periphery thereof a spring sleeve 23 a that is folded near the opening . guide 24 is designed to support the cable sleeve 23 on the internal peripheral surface thereof while allowing cable sleeve 23 to move a predetermined distance along the axis of the brake cables 14 f and 14 r . the coil spring 25 , disposed in compressed form between the tip of guide 24 and the spring sleeve 23 a of cable sleeve 23 , biases the cable sleeve 23 toward the base end ( cable insertion side ) of guide 24 . the base end of guide 24 opens to allow the passage of the cable sleeve 23 , and an annular lid member 27 made of metal and capable of accommodating the outer casings 17 fa and 17 ra therein is fixedly mounted in the opening by press fitting . the cable sleeve 23 is thus retained inside guide 24 against the biasing force of the coil spring 25 . cable sleeve 23 is moved toward the tip of guide 24 ( toward the brake lever ) against the biasing force of the coil spring 25 when the inner cables 16 f and 16 r of the brake cables 14 f and 14 r are pulled , and the cable sleeve 23 is moved toward the base end of guide 24 ( toward the lid member 27 ) by the coil spring 25 when the inner cables 16 f and 16 r are released from tension , as shown by the chain line in fig4 . the cable cover 26 , which is a contractible bellows member made of an elastic material , sealingly covers the external peripheral surfaces of the guide 24 and the outer casings 17 fa and 17 ra to prevent the entry of water or other contaminants to prevent freezing or corrosion of the components . as shown in fig2 , 3 ( a ) and 3 ( b ), the front and rear braking devices 13 f and 13 r are roller - type internal expanding brakes . the braking devices 13 f and 13 r comprise fixed brackets 30 f and 30 r fixedly mounted to the back portions of the bicycle front fork 3 and frame body 2 , play adjusting components 31 f and 31 r for securing the outer casings 17 fb and 17 rb and adjusting the play of the braking devices 13 f and 13 r , brake bodies 32 f and 32 r , and brake operating arms 33 f and 33 r that can pivot relative to the brake bodies 32 f and 32 r . the play adjusting components 31 f and 31 r are provided with outer retainers screwed into the fixed brackets 30 f and 30 r , thus allowing the play of the braking devices 13 f and 13 r to be adjusted by moving the end positions of the outer casings 17 fb and 17 rb back and forth in the axial direction . the brake bodies 32 f and 32 r have substantially the same structure , so the rear brake body 32 r alone will be described herein . as shown in fig3 ( a ) and 3 ( b ), the rear brake body 32 r comprises a rotary component 40 that rotates integrally with the hub shell of the rear wheel 7 , a brake drum ( braked member ) 41 fixedly mounted on the internal peripheral surface of the rotary component 40 , and brake shoes ( braking members ) 42 capable of coming into contact with and disengaging from the brake drum 41 . the brake shoes 42 are brought into contact with the brake drum 41 for applying a braking force to the rear wheel 7 when a plurality of rollers 44 supported by a roller case 43 are moved radially outward by the rotation of a rotary cam 45 . the rotary cam 45 rotates in conjunction with the brake operating arm 33 r , wherein the inner cable 16 r is secured to the brake operating arm 33 r . thus , pulling the inner cable 16 r by gripping the brake lever 12 r will cause the brake operating arm 33 r to rotate clockwise from the brake release position shown in fig3 ( a ) to the braking position shown in fig3 ( b ). this , in turn , causes the brake shoes 42 to come into contact with the brake drum 41 and apply a braking force to the rear wheel 7 . the gap formed between the brake shoes 42 and the brake drum 41 during brake release constitutes the play of the braking device 13 r . the cable connector 15 is a device for connecting the front and rear brake cables 14 f and 14 r together so that both the front and rear braking devices 13 f and 13 r may be actuated by operating either one of the front and rear brake levers 12 f and 12 r . as shown in fig4 - 6 , the cable connector 15 comprises a connection member 45 for connecting the inner cables 16 f and 16 r of the front and rear brake cables 14 f and 14 r together , a bracket 46 for housing the connection member 45 , a play confirmation component 47 that allows the play of the front and rear braking devices 13 f and 13 r to be confirmed visually , and a casing 48 for covering the bracket 46 . the connection member 45 is movably mounted inside the bracket 46 and comprises a first connector 45 a connected by screws 45 c to a second connector 45 b . the front and rear inner cables 16 f and 16 r are connected together by the insertion of the two cables 16 f and 16 r between the two connectors 45 a and 45 b . the connection member 45 is biased by two coil springs 49 in the direction of the braking devices 13 f and 13 r . such biasing aids the initial setting of connection member 45 . the bracket 46 comprises a bracket body 46 a formed of metal and press - molded into a substantial u shape , and a bottom plate component 46 b mounted over the open portion of the bracket body 46 a . the central portion of the bracket body 46 a is provided with outer retainers 46 c for securing the outer casings 17 fa and 17 ra on the side of the brake levers 12 f and 12 r . the bottom plate component 46 b , which is disposed opposite the central portion , is provided with outer retainers 46 d designed to secure the outer casings 17 fb and 17 rb on the side of the braking devices 13 f and 13 r . a guide 50 is disposed in contact with the lower surface of the bottom plate component 46 b . guide 50 allows confirmation knobs 51 f and 51 r to be supported while allowing movement of confirmation knobs 51 f and 51 r in the axial direction . a casing 48 is mounted to cover the bracket 46 and the guide 50 , and a transparent indicator window 52 with the graduation marks 52 f and 52 r is provided to the casing 48 . the upper end of the casing 48 is closed while the lower end is blocked by the guide 50 . the upper end of the casing 48 is provided with through holes 48 f and 48 r for accommodating the outer casings 17 fa and 17 ra . the outer casings 17 fa and 17 ra are sealed with an o - ring 55 ( fig6 ) around the through holes 48 f and 48 r to prevent liquids from penetrating inside . the confirmation knobs 51 f and 51 r comprise cup - shaped indicators 53 f and 53 r and knob components 54 f and 54 r . the inner cables 16 f and 16 r are sealed with a seal ring 56 mounted inside the indicators 53 f and 53 r . indicators 53 f and 53 r are made readily visible by being colored , for example , red or yellow , and they are fixed by crimping to the tips of the outer casings 17 fb and 17 rb . guide 50 movably guides the indicators 53 f and 53 r . thus , the play of the braking devices 13 f and 13 r can be visually confirmed by determining the position occupied by the end portions 57 f and 57 r of the indicators 53 f and 53 r in relation to the graduation marks 52 f and 52 r when the outer casings 17 fb and 17 rb are pulled toward the braking devices 13 f and 13 r . when the brake cables 14 f and 14 r are set , the inner cables 16 f and 16 r are in a retracted state , so the cable sleeves 23 are moved by the outer casings 17 fa and 17 ra toward the brake lever against the biasing force of the corresponding coil springs 25 . when one of the front and rear brake levers 12 f and 12 r ( for example , the rear brake lever 12 r ) is operated , the inner cable 16 r is pulled , and the rear braking device 13 r experiences a braking force . the inner cable 16 f , which is connected to the inner cable 16 r by connection member 45 , also is pulled , thus causing the braking device 13 f to experience a braking force as well . however , at this time no tension is applied to the portion of inner cable 16 f between the connection member 45 and the brake lever 12 f , thus causing slack in the inner wire 16 f . when this happens , the cable sleeve 23 is biased and moved by the coil spring 25 toward the base end ( cable insertion side ) of outer retainer 22 as shown by the chain line in fig . 4 . consequently , the lever member 21 remains taut . to adjust the play of braking devices 13 f and 13 r during manufacture or during routine brake adjustment , the knob components 54 f and 54 r of the confirmation knobs 51 f and 51 r are grasped , and the outer casings 17 fb and 17 rb are pulled toward the braking devices 13 f and 13 r . at that time , the play of the braking devices 13 f and 13 r can be visually confirmed by determining the position occupied by the bottom portions 57 f and 57 r of the indicators 53 f and 53 r on the graduation marks 52 f and 52 r . the play of the rear braking device 13 r should be slightly reduced if the goal is to provide the front braking device 13 f with a slower response than the one possessed by the rear braking device 13 r . in this case , the play should be adjusted using play adjusting components 31 f and 31 r so that the bottom portion 57 f of the indicator 53 f for the front braking device 13 f is aligned with the graduation mark 52 fb shown by the broken line in fig7 and so that the bottom portion 57 r of the indicator for the rear braking device 13 r is aligned with the graduation mark 52 ra shown by the solid line in fig7 . while the above is a description of various embodiments of the present invention , further modifications may be employed without departing from the spirit and scope of the present invention . for example , the size , shape , location or orientation of the various components may be changed as desired . components that are shown directly connected or contacting each other may have intermediate structures disposed between them . the functions of one element may be performed by two , and vice versa . it is not necessary for all advantages to be present in a particular embodiment at the same time . although the original embodiment was described with reference to a case in which roller - type internal expanding brakes for exerting a braking force on wheel hubs were used as the braking devices , such brakes may include band or disk brakes for exerting a braking force on hubs , or caliper or cantilever brakes for exerting a braking force on rims . although the original embodiment was described with reference to a case in which coil springs 49 and 25 were mounted on the cable connector 15 and outer retainer 22 , respectively , it is also possible to adopt an arrangement in which a coil spring is provided to either of the components , and the inner cable or the outer casing is biased in the direction in which the inner cable is exposed . fig8 is a partial cross sectional view of another embodiment of a cable connector according to the present invention . the cable connector 65 shown in fig8 is devoid of a coil spring for biasing a connection member 75 . the rest of the structure is the same as in the above embodiment . in this structure , the gap between the brake cables 14 f and 14 r can be reduced in proportion to the absence of springs . a more compact cable connector 65 can therefore be designed . although the original embodiment was described with reference to a case in which separate brackets and casings were used , it is also possible to integrate the casings and brackets together . fig9 is a partial cross sectional view of such an embodiment . in the cable connector 80 shown in fig9 the cylindrical bracket 84 doubles as a casing , and the connection member 85 is mounted while allowed to move in the axial direction . in this case , the entire connection member 85 is biased by a single coil spring 86 . in this embodiment , the outer casings 17 fb and 17 rb are provided with annular markings 87 . play should be adjusted such that the markings 87 reach a position beyond the bottom portion 84 a of the bracket 84 when the outer casings 17 fb and 17 rb are pulled toward the braking device during play adjustment . it is also possible to mount a modulator ( brake force adjusting mechanism ) capable of varying the braking force of one of the two front and rear braking devices 13 f and 13 r during braking . in fig1 , a modulator 95 is mounted inside a hub 94 connected to a front braking device 93 f . the modulator 95 comprises washers 96 with retaining holes nonrotatably secured in the hub 94 , and lugged washers 97 disposed between the washers 96 with retaining holes . the lugged washers 97 are secured in an annular cup 99 that rotates in conjunction with the rotary component 98 of the braking device 93 f , and are caused to rotate in conjunction with the rotary component 98 . the modulator 95 allows the rate at which the braking force increases with the operating force during braking to be reduced in accordance with the contact pressure of the two types of washers 96 and 97 . although the original embodiment was described with reference to an arrangement in which the casing 48 was not fixedly mounted on the frame 1 , it is also possible immovably mount the casing on the frame 1 . furthermore , although the above embodiment was described with reference to an arrangement in which the play confirmation mechanism was provided to the cable connector 15 , it is also possible to provide the gauge to the front and rear braking devices 13 f and 13 r . every feature which is unique from the prior art , alone or in combination with other features , also should be considered a separate description of further inventions by the applicant , including the structural and / or functional concepts embodied by such feature ( s ). thus , the scope of the invention should not be limited by the specific structures disclosed or the apparent initial focus on a particular structure or feature .
| 5 |
one advantage shown by the present invention is to increase the number of commands that may simultaneously transit on an interchip link bus , particularly pervasive commands . it is a further advantageous that the invention permit a programmed reversal of command priority , such that a functional command may be sent over the interchip link bus , while a pervasive command is held waiting . fig2 is a representative microprocessor or chip that may perform the functions of receiving and dispatching timing signals and occasionally recovering when soft errors occur . chip 200 may have a first core processor 201 a and a second core processor 201 b . each core processor may be simply referred to as a core . a core processor may have multithreading capability , error detection and recovery functions , numerous general purpose registers ( gpr ) and special purpose registers ( spr ). connectivity of first core 201 a and second core 201 b may be with the level 2 cache 203 or l2 , and the non - cacheable unit 205 or ncu . ncu 205 may handle commands to store data received from a core onto a fabric bus 210 for storage to main memory . such stores may be memory - mapped i / o . access to memory that may be susceptible to frequent accesses later may be stored to the l 2 203 in order to reduce latency of operations performed by a core . l 2 203 may similarly provide access to its contents via the fabric bus 210 which may interconnect to other chips on the same board , and also beyond the board upon which the chip 200 is placed . a nearby , but off - chip level 3 cache or l3 may be provided . controls governing access between the cores and the l3 are in l3 cache control 213 . similarly , a memory controller 215 , and an i / o interface 217 may be provided on - chip to facilitate long - latency access to general ram and to various peripheral devices , respectively . symmetric multi - processor ( smp ) fabric controls 219 , is a special purpose device that mediates the contention for the fabric bus by the various attached devices , and provides for smp topology configuration via expansion ports a , b , x , y and z . five expansion ports are shown in the embodiment , however , it is understood that to achieve varying levels of complex multichip topologies , fewer or more expansion ports may be used . it is anticipated that five ports may provide 64 chips with rapid instruction , data and timing signals between and among them . pervasive controls 221 are circuits that exist both outside and mingled within the various processing blocks found on chip . among the functions of pervasive controls is the providing of back - ups to the processor state on each core by providing redundant copies of various gprs and sprs of each core at convenient instruction boundaries of the each core processor . in addition pervasive controls may assist in the detection of errors and communication of such errors to an outside service processor for further action by , e . g . firmware . pervasive controls 221 are a gating point for redundant oscillators and other circuits which provide or receive derivative timing signals . it is appreciated that a fault , or other condition may remove one or more redundant oscillators from the configuration , and it is an object of the pervasive control to select the better timing signal ( or at least one that is within tolerances ) from among the redundant oscillators , and step - encoded signals that may arrive via the expansion ports . in addition , pervasive controls may form and issue commands through the interchip link bus or fabric bus , such as fabric maintenance operations , io hotplug , and error indications , so called pervasive commands . the pervasive controls , however , share authority over the interchip link bus with other functional units of the chip , which may issue , from time to time functional commands , which may include memory reads , memory writes , cache - inhibited reads and cache - inhibited writes , among others . fig3 shows a first embodiment configuration of a symmetric multiprocessor using the chip of fig2 in the form of a processor node 300 . processor node 300 may contain memory banks 301 a , 301 b , i / o hubs 303 , service processors 305 a , 305 b , ports or connectors 307 a and 307 b handling the a and b ports from each of the multichip modules ( mcm ) 321 a , 321 b , 321 c , and 321 d . each multichip module may be identical in its hardware configuration , but configured by software to have varying topologies and functions as , e . g . between master and slave functions . within a mcm may be found the chip 322 of fig2 , as well as level 3 cache memory 323 a and 323 b . the processor node 300 may have a primary oscillator 331 and a secondary oscillator 333 that are each routed to each chip found on the processor node . connections between the oscillators and functional units extend throughout the board and chips , but are not shown in fig3 in order to limit clutter . similarly , it is understood that many convoluted interconnects exist between the ports and i / o hubs , among other components — though such interconnects are not shown here . the chips within a node are connected by a synchronous coherency fabric . the separate nodes are connected by an asynchronous coherency fabric , i . e . each node may have its own logic oscillator pair sourced on the node . the master - slave relationship among the nodes is established by service firmware at initial program load , which among other things , sets up various configuration registers in each processor chip . the configuration registers may exist as two different sets , indicating two alternate topologies for the smp wherein a primary control register set organizes the nodes by one topology ( e . g . using a first node as a ‘ master ’) and another topology ( secondary control register set ) may use a second node as a ‘ master ’. a set of pervasive commands may permit the pervasive control of fig2 to accomplish its varied functions . table 1 depicts some of the commands and further shows whether various attributes may be applicable to the pervasive command . some commands are broadcast , i . e . all chips that snoop on the interchip link bus receive the commands . otherwise a command may be point - to - point , i . e . directed to a particular chip or core processor . regardless of whether a command is a pervasive command or a functional command , existing as a single command or multiplexed together with others , all commands that exist on the interchip link bus are said to transit the interchip link bus . an omnibus command may be a pervasive command that is transmitted on an interchip link bus , or it may be several pervasive commands that are transmitted in a collective set of bit fields that are transmitted via the interchip link bus in consecutive bus beats . an omnibus command may include a time - of - day ( tod ) pervasive command . an omnibus command may include a miscellaneous command , wherein one or more pervasive commands are present , but none are a tod pervasive command . a miscellaneous command can include any number of broadcast commands that can be fit into the data space of a single omnibus command , but can only include one point - to - point command . conversely , a point - to - point command can be combined with any number of broadcast commands , but may not be combined with another point - to - point command . since a tod command from a pervasive control may be 64 bits wide , there may not be enough bits available in an address request to support transmittal in a single command . therefore a tod command , e . g . “ send tod value ”, may be split into two sub - commands , each sending 32 bits of tod data at a time during an address bus beat of the fabric bus . even though a tod command is a broadcast command , in this embodiment it may not be combined with other commands since it requires the transmittal of a large amount of data and no other commands will fit into the same omnibus command . table 1 depicts each pervasive command and its attributes as a ) broadcast among the chips ; b ) point - to - point to a single chip ; c ) able to combine with other broadcast commands ; d ) the number of fabric bus commands that may be required to transport the command . each fabric bus command is 2 beats . fig4 shows a pervasive command interface or pervasive control to the interchip link , which may be a interchip link bus of the symmetric multiprocessor system . such a pervasive control may , for example transmit a tod register value by using the tod command structure , as organized in tables 2 and 3 . a macro or send block 441 may be active in transmitting a tod command , which may include a tod register value . the macro may also be known as tp_fbc_snd_pmac . the send block 441 may have tod queue 443 , which may be two deep , for accepting commands for later dispatch along the interchip link bus 449 . additional pervasive functions may have respective queues 443 b , 443 c , 443 d , 443 e and 443 f , for staging commands concerning in - memory trace ( htm ) global triggering , trace array global triggering , and io hotplug pervasive commands , among others . a macro or receive block 442 also known as , tp_fbc_rcv_pmc , may exist on the chip to receive such pervasive commands as well . associated with tod queue 443 may be a valid bit 444 to indicate to a command arbiter 445 that a command is available and stored as contents to the queue . when a valid command is in the command queue a request may be sent to the icl 449 that a command is waiting to be sent . the icl 449 will respond with a request sent signal or grant and the command is placed into the interchip link . when command arbiter 445 delivers a valid command to pending fabric register 446 , a valid bit may be set 446 b . each chip has a tp_fbc_rcv_pmc macro or receive block 442 that snoops the fabric line for pervasive commands that are broadcast or point - to - point addressed to the chip . each pervasive command has a unique command type , or ttype , that indicates to the snooping logic that it is a pervasive command . in this embodiment that ttype is 0x3c . referring to fig4 and fig5 , fig5 shows flow diagram of steps that may occur when a tod command or other pervasive command arrives at the send block 441 . each queue may receive pervasive commands from various specialty macros of the pervasive control block of fig2 . each queue may be a two position queue , and may initially be empty or without valid data . thus each command may arrive and depart at a queue in typical first in first out fashion . the first step , once a queue obtains a command , is the embodiment examines ( step 501 ) the command that is a time - of - day ( tod ) command on tod queue 443 , and examines a next - lower - priority pervasive command ( step 503 ) from a queue among queues 451 a , 451 b , 451 c , 451 d and 451 e , if a tod command is not available . in many cases , a timeout ( step 505 ) will not be applicable , since we may want pervasive commands to have high priority access to the interchip link bus . if such is the case , execution continues to determine ( step 507 ) if a tod command is among the one or more pervasive commands obtained . if the yes branch is taken , then the tod command may be marked valid , so that it may be immediately susceptible to placing on the interchip communications link ( step 511 ). if the no branch is taken , then the first examined pervasive command marked as valid is placed in the pending command register 446 for the next frame of the interchip communications link ( icl ) ( step 513 ). the data stored in the pending command register 446 is known as the pending command . next it is decided if the secondary command ( from step 503 ) is compatible with the command already queued for the icl frame ( step 515 ). if so , the command is placed ( step 520 ) in the pending command register with the command already queued for the next icl frame occurrence , and its queue entry is marked invalid . if not , the command is left in its command queue ( step 519 ), wherein the queue may be any of the queues 443 b , 443 c , 443 d , 443 e , and 443 f , and left marked valid so that it will be available to be added to the next command to be placed on the icl . note that the effort of marking valid , or marking invalid , may simply involve setting or resetting a latch associated with the data to be considered either valid or invalid . a determination is made to see if another pervasive command has arrived at the head of a queue before a icl frame has occurred ( step 521 ). if so , and the new command is compatible with the commands already present in the pending icl command , the additional command is added to the icl command in queue ( step 515 ). each queue head is examined iteratively , until the last one is reached , and all compatible commands are either added to the pending icl command or left valid for the next available command . when the icl frame arrives , the pending command is loaded into the icl and the fabric gives a “ request sent ” signal ( step 531 ). the interchip link bus transmits an initial set of data in bus beat 0 ( step 535 ), and then a second set of date in bus beat 1 ( step 537 ). collectively , during the bus beats , the interchip link bus may transmit several pervasive commands at once . once the bus beat 1 transmittal ( step 537 ) is complete , the embodiment may advance ( step 539 ) each queue that had its head vacated when the command formerly contained therein had been placed on the pending command register 446 of the icl . at the decision point to determine if a command is compatible with existing commands , table 1 , shows the rules used . moreover , if two commands of the same type arrive , the first of the two commands is not compatible with the second of the two commands , since the two commands are assigned the same bit fields for data transport . in addition , two commands that are point - to - point may not be compatible , for example , not all pervasive commands are compatible with a xscom status reporting . a fabric and io hotplug command is not compatible with an xscom status reporting . in addition to a tod command , the present invention may transmit a miscellaneous command . like the tod command , the miscellaneous command may transport several pervasive commands among the bit fields of the miscellaneous command , provided that no two commands that are point - to - point are multiplexed together into the same omnibus command . the field structure of a pair of bus beats is shown is table 4 and table 5 which represent the condition of bits in a miscellaneous type of omnibus command . the purpose of the timeout loop ( step 506 ), for those cases where a timeout may be set to operate , is to provide a time during which the lower priority functional commands may also access the interchip link bus , without being pre - empted by pervasive commands . a determiniation that pervasive commands are lower priority , as compared to functional commands , causes the yes branch of the timeout applicable ( step 505 ) to be taken . during the times that that the flow of fig5 experiences a timeout loop , another routine may seize the interchip link bus and dispatch functional commands . giving priority to the dispatch of functional commands over pervasive commands is called applying a timeout . it is important to note that while the present invention has been described in the context of a fully functioning data processing system , those of ordinary skill in the art will appreciate that the processes of the present invention are capable of being distributed in the form of a computer readable medium of instructions and a variety of forms and that the present invention applies equally regardless of the particular type of signal bearing media actually used to carry out the distribution . examples of computer readable media include recordable - type media , such as a floppy disk , a hard disk drive , a ram , cd - roms , dvd - roms , and transmission - type media , such as digital and analog communications links , wired or wireless communications links using transmission forms , such as , for example , radio frequency and light wave transmissions . the computer readable media may take the form of coded formats that are decoded for actual use in a particular data processing system . the description of the present invention has been presented for purposes of illustration and description , and is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art . the embodiment was chosen and described in order to best explain the principles of the invention , the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated .
| 8 |
the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any aspect described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other aspects . in this description , the term “ application ” may also include files having executable content , such as : object code , scripts , byte code , markup language files , and patches . in addition , an “ application ” referred to herein , may also include files that are not executable in nature , such as documents that may need to be opened or other data files that need to be accessed . further , an “ application ” may be a complete program , a module , a routine , a library function , a driver , etc . the term “ content ” may also include files having executable content , such as : object code , scripts , byte code , markup language files , and patches . in addition , “ content ” referred to herein , may also include files that are not executable in nature , such as documents that may need to be opened or other data files that need to be accessed , transmitted or rendered . for example , in this description , reference to “ returned goods content ” may include any , or all of , but not limited to , a picture of a returned good , a proof of purchase ( e . g ., scan of a barcode , scan of a qr code , an optical character recognition file of a receipt , etc . ), customer contact information , returned goods authorization number , etc . in this description , the term “ qr code ” is used generally to refer to any type of matrix barcode ( or multi - dimensional bar code ) or identifier associated with a returned goods transaction and is not meant to limit the scope of any embodiment to the use of the specific type of barcode understood in the art to be a quick response code . that is , it is envisioned that any given embodiment of the systems and methods within the scope of this disclosure may use data identifiable in the form of barcodes , plain text user entries , nfc transmissions , wifi transmissions , short wave radio transmissions ( e . g ., bluetooth ), light modulations , sound modulations . etc . moreover , as one of ordinary skill in the art understands , a matrix barcode is an optical machine - readable label that may be associated with data such as data representative of a returned good or a damaged good in inventory . an exemplary matrix barcode may include black modules ( square dots ) arranged in a square grid on a white background . the information encoded by the barcode may be comprised of four standardized types of data ( numeric , alphanumeric , byte / binary , kanji ) or , through supported extensions , virtually any type of data . as one of ordinary skill in the art further understands , a matrix barcode may be read by an imaging device , such as a camera , and formatted algorithmically by underlying software using error correction algorithms until the image can be appropriately interpreted . data represented by the barcode may then be extracted from patterns present in both horizontal and vertical components of the image . in this description , the terms “ item ,” “ good ” and “ merchandise ” are used interchangeably . also in this description , the terms “ customer ,” “ consumer ” and “ end user ” are used interchangeably to refer to a person or entity other than a retailer who has purchased a good . similarly , the terms “ merchant ” and “ retailer ” are used interchangeably to refer to an entity that markets and sells goods to an end user . and , the terms “ supplier ” and “ manufacturer ” are used interchangeably to refer to an entity that provides goods to a retailer for sale to end users . in this description , the term “ returned good ” will be understood to capture both goods ( e . g ., damaged goods ) that have been returned to a retailer by a consumer and goods that have been received by a retailer from a supplier . moreover , the terms “ goods ,” “ items ,” “ products ,” “ merchandise ” and the like are used interchangeably . as used in this description , the terms “ component ,” “ database ,” “ module ,” “ system ,” and the like are intended to refer to a computer - related entity , either hardware , firmware , a combination of hardware and software , software , or software in execution . for example , a component may be , but is not limited to being , a process running on a processor , a processor , an object , an executable , a thread of execution , a program , and / or a computer . by way of illustration , both an application running on a computing device and the computing device may be a component . one or more components may reside within a process and / or thread of execution , and a component may be localized on one computer and / or distributed between two or more computers . in addition , these components may execute from various computer readable media having various data structures stored thereon . the components may communicate by way of local and / or remote processes such as in accordance with a signal having one or more data packets ( e . g ., data from one component interacting with another component in a local system , distributed system , and / or across a network such as the internet with other systems by way of the signal ). in this description , the terms “ communication device ,” “ wireless device ,” “ wireless telephone ,” “ wireless communication device ,” “ wireless handset ” and portable computing device (“ pcd ”) are used interchangeably . with the advent of third generation (“ 3g ”) and fourth generation (“ 4g ”) wireless technology , greater bandwidth availability has enabled more portable computing devices with a greater variety of wireless capabilities . therefore , a portable computing device (“ pcd ”) may include a cellular telephone , a pager , a pda , a smartphone , a navigation device , a tablet personal computer (“ pc ”), or a hand - held computer with a wireless connection or link . embodiments of the systems and methods provide for efficient management of a returned goods process . a “ bizzap ” server in communication with both a retailer inventory management and accounting system and a manufacturer inventory management and accounting system , and optionally a consumer pcd , centrally documents and reconciles returned goods transactions . by doing so , embodiments of the solution work to minimize unnecessary scrapping of damaged goods otherwise eligible for cost effective repair . moreover , embodiments of the solution enable accurate accounting of returned goods chargebacks from a retailer to a supplier . further , embodiments of the solution provide a manufacturer with a channel for direct interaction with a consumer that may enable the manufacturer to repair damaged goodwill resulting from a less than satisfying product experience . an exemplary embodiment of the solution leverages a tablet - based application configured to communicate with back end hardware / software to manage captured return goods content . advantageously , embodiments automate the return or repair process of an item from the consumer to the retailer to the manufacturer , keeping all interested parties “ in the loop .” in some embodiments , however , it is provided for a consumer to process returns and requests for damaged parts directly with the manufacturer . by capturing returned goods content in the manner envisioned , embodiments of the solution enable a retailer and a manufacturer to immediately access and share common data associated with a particular good purchased and returned by a particular consumer . embodiments of the solution provide for , among other functionality : a ) automating the selection of the appropriate item to be returned or repaired / replaced via barcode or qr code scanning , point and touch image selection , and / or product search features ; b ) generation of an associated return authorization number from the manufacturer ; c ) automating appropriate dispensation instructions from the manufacturer to the retailer or end consumer for a returned good ( i . e ., a defective product ); d ) documentation via actual photo of returned good ; e ) generation of shipping label and tracking information viewable to all parties for either replacement parts to the consumer directly or retailer for repairs , or to track the defective product to the manufacturer ; f ) reporting to the retailer and manufacturer to provide analytics and business intelligence data for the manufacturer and retailer including , but not limited to , common returns and repair histories to facilitate engineering or product changes ; data to more accurately calculate end of year chargebacks for returns ; returns by product , manufacturer , geographic area , cost and final dispensation ; actual cost of returns per vendor and / or per product to produce a true running total of rgd ( returned goods ); customer information for customers who experienced defective items for promos to rejuvenate the manufacturer brand reputation ; manufacturing defect information including photos of defective product to assist in reengineering of product , etc . fig1 a is a functional block diagram illustrating exemplary components of a system 100 a for managing returned goods 102 from a merchant retail location 135 . embodiments of a system 100 for managing returned goods from a merchant retail location and / or a customer location ( fig1 b ) has many potential advantages . to provide the basis for an exemplary , non - limiting application scenario in which aspects of some embodiments of the disclosed systems and methods may be suitably described , consider a supplier of bicycles to a retailer . any one or more of the bicycles manufactured by the supplier and shipped to the retailer may be damaged and unsuitable for resale to a customer of the retailer . for example , a given bicycle may have a bent handlebar . in the event that the bent handlebar is discovered by the retailer before the bike is sold to a customer , the retailer may either repair / replace the handlebar or scrap the entire bicycle . similarly , in the event that the bent handlebar is discovered by a customer who bought the given bicycle from the retailer , the customer may either return the bicycle to the retailer for repair / replacement or work directly with the manufacturer of the bicycle to repair or replace in kind returning to the fig1 a illustration , a returned good 102 ( such as the exemplary bicycle with a damaged handlebar ) and an associated proof of purchase 103 or other information uniquely associated with the returned good 102 ( e . g ., a serial number , an invoice or po number , etc .) may be presented to the retailer at the retailer location 135 . notably , in the fig1 a illustration , it will be understood that the returned good 102 may be merchandise that was bought by an end user and is being returned to the retailer or may be damaged merchandise that has been received by the retailer from the supplier but not yet sold to a customer . regardless , returned good 102 represents potentially repairable product that , if scrapped , would unnecessarily contribute to a future chargeback transaction between the retailer and supplier . the merchant portable computing device 110 a ( more detail in fig2 illustration and related description regarding pcd 110 ) may form part of a merchant point of sale (“ pos ”) system 125 and be equipped with , among other components and functionality , a returned goods management (“ rgdm ”) module 212 a , a display 232 a , a communications module 216 a and a processor 224 a . using the rgdm module 212 a , the merchant pcd 110 a may capture a digital picture of the returned good 102 that documents the type of returned good 102 and the nature of damage to the returned good 102 . the rgdm module 212 a may also be configured to receive proof of purchase data 103 ( such as may be represented by a qr code ) for uniquely identifying the customer and / or the good itself . using the proof of purchase data 103 and / or the digital picture of the returned good 102 , embodiments of the solution may provide for a user of the merchant pcd 110 a to interface with a merchant inventory management and accounting ( im & amp ; a ) system 106 to verify an identification of the returned good 102 . for example , the merchant pcd 110 a may render pictures of products and models sold by the retailer so that the user of the pcd 110 a may match the returned good 102 thereto . depending on embodiment , the user of the merchant pcd 110 a may make a judgment call as to whether the returned good 102 should be scrapped or repaired . in other embodiments , the system 100 a may be preconfigured to dictate to the user of merchant pcd 110 a whether the returned good 102 should be designated for scrap of repair . in some embodiments , the supplier may review the returned goods content and return instructions to the retailer regarding scrapping or repairing the returned good . regardless , in the event that the returned good 102 is designated for repair , the user of the merchant pcd 110 a may query merchant im & amp ; a system 106 for a necessary part , or engage the supplier to provide the necessary part , and subsequently coordinate the repair of the returned good . working through the bizzap server 105 , the user of the merchant pcd 110 a may trigger provision of a returned goods authorization (“ rga ”) from the supplier im & amp ; a system 107 for return of the damaged good to the supplier . a replacement good ( not depicted in fig1 ) may be pulled from the retailer inventory and provided to a customer in exchange for a returned good 102 . alternatively , a returned good 102 may be repaired and placed in inventory or given back to a customer , depending on the scenario . regardless , all returned good content is managed through and documented by the bizzap server 105 , thereby aggregating an accurate and multi - party accessible accounting in database 120 of returned goods over a period of time . advantageously , the data captured by the merchant pcd 110 a in association with the returned good may be transmitted to the bizzap server 105 via communications network 130 . in turn , the bizzap server 105 may leverage rgdm module 212 b to interface with the rgdm module 212 a to store the returned good transaction data in the rgd and customer relationship database 120 . as such , an accurate accounting of the returned goods over a period of time may be accessed by , and provided to , both of the retailer and supplier . in this way , inventory data represented in both merchant im & amp ; a system 106 and supplier im & amp ; a system 107 may be reconciled against data captured by and stored by bizzap server 105 . also , returned goods designated for scrap by the retailer may be disputed by the supplier based on digital pictures and other return good transaction data managed by the bizzap server 105 . or , in some embodiments , returned goods previously designated for scrap by the supplier based on digital pictures and other return good transaction data managed by the bizzap server 105 may be indisputable . resulting from the returned goods reconciliation aspect , embodiments of the system and method may be able to provide both the supplier and the retailer with an accurate and fair accounting of chargebacks . the fig1 b is a functional block diagram illustrating exemplary components of a system 100 b for managing returned goods 102 from a customer location 145 , as opposed to the retail location 135 of fig1 a . the system 100 b is similar to the system 100 a , with the exception that the returned good transaction may be handled via a customer pcd 110 b in communication directly with the supplier via the bizzap server 105 . the returned good 102 , such as a bicycle with a bent handlebar , may be captured in a digital picture documenting the damage using the customer pcd 110 b and rgdm module 212 b . the customer pcd 110 b may transmit the digital picture and proof of purchase 103 data via network 130 to bizzap server 105 . the rgdm module 212 b may work with the rgdm module 212 c to document the returned good transaction in the database 120 . the supplier may then work through the bizzap server 105 to coordinate a repair or replacement of the damaged item . turning to the fig1 illustrations , exemplary embodiments of a pcd 110 envision remote communication , real - time software updates , extended data storage , etc . and may be leveraged in various configurations by users of system 100 . advantageously , embodiments of pcds 110 configured for communication via a computer system such as the exemplary system 100 depicted in the fig1 illustrations may leverage communications networks 130 including , but not limited to cellular networks , pstns , cable networks and the internet for , among other things , software upgrades , content updates , database queries , data transmission , etc . other data that may be used in connection with a pcd 110 , and accessible via the internet or other networked system , will occur to one of ordinary skill in the art . the illustrated computer system 100 may comprise a bizzap server 105 , supplier and merchant backend server systems ( such as may comprise im & amp ; a systems 106 , 107 ) that may be coupled to a network 130 comprising any or all of a wide area network (“ wan ”), a local area network (“ lan ”), the internet , or a combination of other types of networks . it should be understood that the term server may refer to a single server system or multiple systems or multiple servers . one of ordinary skill in the art will appreciate that various server arrangements may be selected depending upon computer architecture design constraints and without departing from the scope of the invention . the bizzap server 105 , in particular , may be coupled to a rgd and customer relationship database 120 . the database 120 may store various records related to , but not limited to , pcd user - specific contact or account information , historical content , purchase transaction data , return good transaction data including digital pictures and / or videos of returned goods , supplier specific information , retailer specific information , inventory levels , accounts receivable data , repair work in progress , filters / rules algorithms for designating a scrap or repair status , survey content , previously recorded feedback , etc . when a server in system 100 , such as but not limited to a bizzap server 105 , is coupled to the network 130 , the server may communicate through the network 130 with various different pcds 110 associated with customers and / or retailers . each pcd 110 may run or execute web browsing software or functionality to access the server and its various applications including rgdm module 212 b . any device that may access the network 130 either directly or via a tether to a complimentary device , may be a pcd 110 according to the computer system 100 . the pcds 110 , as well as other components within system 100 such as , but not limited to , a wireless router ( not shown ), may be coupled to the network 130 by various types of communication links 145 . these communication links 145 may comprise wired as well as wireless links which may be either uni - directional or bi - directional communication channels , as would be understood by one of ordinary skill in the art of networking . a pcd 110 may include a display 232 , a processor 224 and a communications module 216 that may include one or more of a wired and / or wireless communication hardware and a radio transceiver 217 . it is envisioned that the display 232 may comprise any type of display device such as a liquid crystal display (“ lcd ”), a plasma display , an organic light - emitting diode (“ oled ”) display , a touch activated display , a cathode ray tube (“ crt ”) display , a brail display , an led bank , and a segmented display . a pcd 110 may execute , run or interface to a multimedia platform that may be part of a plug - in for an internet web browser . the communications module 216 may comprise wireless communication hardware such as , but not limited to , a wifi card or nfc card for interfacing with a digital rendering of returned good transaction data . further , the communications module 216 may include a cellular radio transceiver to transmit returned good content as well as other information to exemplary bizzap server 105 , as depicted in the system 100 embodiment . one of ordinary skill in the art will recognize that a communications module 216 may include application program interfaces to processor 224 . it is envisioned that a pcd 110 may be configured to leverage the cellular radio transceiver of the communications module 216 to transmit data , such as a returned good content by way of a secure channel using a wireless link 145 to the bizzzap server 105 . it is also envisioned that a pcd 110 a in some exemplary embodiments of system 100 may established a communication between the pos 125 and pcd 110 a to transmit data to and from bizzap server 105 . communication links 145 , in general , may comprise any combination of wireless and wired links including , but not limited to , any combination of radio - frequency (“ rf ”) links , infrared links , acoustic links , other wireless mediums , wide area networks (“ wan ”), local area networks (“ lan ”), the internet , a public switched telephony network (“ pstn ”), and a paging network . an exemplary pcd 110 may also comprise a computer readable storage / memory component 219 ( shown in fig2 ) for storing , whether temporarily or permanently , various data including , but not limited to , returned goods content . the memory 219 may include instructions for executing one or more of the method steps described herein . further , the processor 224 and the memory 219 may serve as a means for executing one or more of the method steps described herein . data added to , extracted or derived from the returned goods content may comprise a consumer id , a transaction id , a digital picture or video content , a qr code , a directory number (“ dn ”) or calling line id (“ clid ”) associated with pcd 110 , a retailer id , a hash value , a codec key , encryption or decryption data , account numbers and other account related data , etc . fig2 is a diagram of an exemplary , non - limiting aspect of a portable computing device (“ pcd ”) comprising a wireless tablet or telephone that corresponds with fig1 . as shown , the pcd 110 includes an on - chip system 222 that includes a digital signal processor 224 and an analog signal processor 226 that are coupled together . as illustrated in fig2 , a display controller 228 and a touchscreen controller 230 are coupled to the digital signal processor 224 . a touchscreen display 232 external to the on - chip system 222 is coupled to the display controller 228 and the touchscreen controller 230 . fig2 further indicates that a video encoder 234 , e . g ., a phase - alternating line (“ pal ”) encoder , a sequential couleur avec memoire (“ secam ”) encoder , a national television system ( s ) committee (“ ntsc ”) encoder or any other video encoder , is coupled to the digital signal processor 224 . further , a video amplifier 236 is coupled to the video encoder 234 and the touchscreen display 232 . a video port 238 is coupled to the video amplifier 236 . a universal serial bus (“ usb ”) controller 240 is coupled to the digital signal processor 224 . also , a usb port 242 is coupled to the usb controller 240 . a memory 219 and a subscriber identity module (“ sim ”) card 246 may also be coupled to the digital signal processor 224 . further , a digital camera 248 may be coupled to the digital signal processor 224 and the rgdm module 212 . in an exemplary aspect , the digital camera 248 is a charge - coupled device (“ ccd ”) camera or a complementary metal - oxide semiconductor (“ cmos ”) camera . as further illustrated in fig2 , a stereo audio codec 250 may be coupled to the analog signal processor 226 . moreover , an audio amplifier 252 may be coupled to the stereo audio codec 250 . in an exemplary aspect , a first stereo speaker 254 and a second stereo speaker 256 are coupled to the audio amplifier 252 . fig2 shows that a microphone amplifier 258 may be also coupled to the stereo audio codec 250 . additionally , a microphone 260 may be coupled to the microphone amplifier 258 . in a particular aspect , a frequency modulation (“ fm ”) radio tuner 262 may be coupled to the stereo audio codec 250 . also , an fm antenna 264 is coupled to the fm radio tuner 262 . further , stereo headphones 268 may be coupled to the stereo audio codec 250 . fig2 further indicates that a radio frequency (“ rf ”) transceiver 217 may be coupled to the analog signal processor 226 . an rf switch 270 may be coupled to the rf transceiver 217 and an rf antenna 272 . as shown in fig2 , a keypad 274 may be coupled to the analog signal processor 226 . also , a mono headset with a microphone 276 may be coupled to the analog signal processor 226 . further , a vibrator device 278 may be coupled to the analog signal processor 226 . also shown is that a power supply 280 may be coupled to the on - chip system 222 . in a particular aspect , the power supply 280 is a direct current (“ dc ”) power supply that provides power to the various components of the pcd 110 that require power . further , in a particular aspect , the power supply is a rechargeable dc battery or a dc power supply that is derived from an alternating current (“ ac ”) to dc transformer that is connected to an ac power source . fig2 also shows that the pcd 110 may include rgdm module 212 and a communications module 216 . as described above , the rgdm module 212 may be operable work with the rf antenna 272 and transceiver 217 to establish communication with another pcd 110 or server or backend system ( such as one or more of im & amp ; a system 106 , pos 125 , etc .) and send a returned good content via a bizzap server 105 . as depicted in fig2 , the touchscreen display 232 , the video port 238 , the usb port 242 , the camera 248 , the first stereo speaker 254 , the second stereo speaker 256 , the microphone 260 , the fm antenna 264 , the stereo headphones 268 , the rf switch 270 , the rf antenna 272 , the keypad 274 , the mono headset 276 , the vibrator 278 , and the power supply 280 are external to the on - chip system 222 . in a particular aspect , one or more of the method steps described herein may be stored in the memory 219 as computer program instructions . these instructions may be executed by the digital signal processor 224 , the analog signal processor 226 or another processor , to perform the methods described herein . further , the processors , 224 , 226 , the memory 219 , the instructions stored therein , or a combination thereof may serve as a means for performing one or more of the method steps described herein . fig3 is a functional block diagram of a general purpose computer 310 that may form at least one of the merchant inventory management and accounting system 106 , supplier inventory management and accounting system 107 , and bizzap server 105 illustrated in fig1 . generally , a computer 310 includes a central processing unit 321 , a system memory 322 , and a system bus 323 that couples various system components including the system memory 322 to the processing unit 321 . the system bus 323 may be any of several types of bus structures including a memory bus or memory controller , a peripheral bus , and a local bus using any of a variety of bus architectures . the system memory includes a read - only memory ( rom ) 324 and a random access memory ( ram ) 325 . a basic input / output system ( bios ) 326 , containing the basic routines that help to transfer information between elements within computer 310 such as during start - up , is stored in rom 324 . the computer 310 may include a hard disk drive 327 a for reading from and writing to a hard disk , not shown , a memory card drive 328 for reading from or writing to a removable memory card 329 , and / or an optional optical disk drive 330 for reading from or writing to a removable optical disk 331 such as a cd - rom or other optical media . hard disk drive 327 a and the memory card drive 328 are connected to system bus 323 by a hard disk drive interface 332 and a memory card drive interface 333 , respectively . although the exemplary environment described herein employs hard disk 327 a and the removable memory card 329 , it should be appreciated by one of ordinary skill in the art that other types of computer readable media which may store data that is accessible by a computer , such as magnetic cassettes , flash memory cards , digital video disks , bernoulli cartridges , rams , roms , and the like , may also be used in the exemplary operating environment without departing from the scope of the invention . such uses of other forms of computer readable media besides the hardware illustrated may be used in internet connected devices such as in portable computing devices (“ pcds ”) 110 that may include personal digital assistants (“ pdas ”), mobile phones , tablet portable computing devices , and the like . the drives and their associated computer readable media illustrated in fig3 provide nonvolatile storage of computer - executable instructions , data structures , program modules , and other data for computer 310 . a number of program modules may be stored on hard disk 327 , memory card 329 , optical disk 331 , rom 324 , or ram 325 , including , but not limited to , an operating system 335 and rgdm modules 212 b . consistent with that which is defined above , program modules include routines , sub - routines , programs , objects , components , data structures , etc ., which perform particular tasks or implement particular abstract data types . a user may enter commands and information into computer 310 through input devices , such as a keyboard 340 and a pointing device 342 . pointing devices 342 may include a mouse , a trackball , and an electronic pen that may be used in conjunction with a tablet portable computing device . other input devices ( not shown ) may include a microphone , joystick , game pad , satellite dish , scanner , or the like . these and other input devices are often connected to processing unit 321 through a serial port interface 346 that is coupled to the system bus 323 , but may be connected by other interfaces , such as a parallel port , game port , a universal serial bus ( usb ), or the like . the display 347 may also be connected to system bus 323 via an interface , such as a video adapter 348 . the display 347 may comprise any type of display devices such as a liquid crystal display ( lcd ), a plasma display , an organic light - emitting diode ( oled ) display , and a cathode ray tube ( crt ) display . a camera 375 may also be connected to system bus 323 via an interface , such as an adapter 370 . the camera 375 may comprise a video camera such as a webcam . the camera 375 may be a ccd ( charge - coupled device ) camera or a cmos ( complementary metal - oxide - semiconductor ) camera . in addition to the monitor 347 and camera 375 , the computer 310 may include other peripheral output devices ( not shown ), such as speakers and printers . the computer 310 may operate in a networked environment using logical connections to one or more remote computers such as the portable computing device ( s ) 110 illustrated in fig1 . the logical connections depicted in the fig3 include a local area network ( lan ) 342 a and a wide area network ( wan ) 342 b , as illustrated more broadly in fig1 as communications network 130 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets , and the internet . when used in a lan networking environment , the computer 310 is often connected to the local area network 342 a through a network interface or adapter 353 . the network interface adapter 353 may comprise a wireless communications and therefore , it may employ an antenna ( not illustrated ). when used in a wan networking environment , the computer 310 typically includes a modem 354 or other means for establishing communications over wan 342 b , such as the internet . modem 354 , which may be internal or external , is connected to system bus 323 via serial port interface 346 . in a networked environment , program modules depicted relative to the remote portable computing device ( s ) 110 , or portions thereof , may be stored in the remote memory storage device 327 e ( such as rgdm module 212 b ). a portable computing device 110 may execute a remote access program module for accessing data and exchanging data with rgdm modules 212 b running on the computer 310 . those skilled in the art may appreciate that the present solution for returned goods management may be implemented in other computer system configurations , including hand - held devices , multiprocessor systems , microprocessor based or programmable consumer electronics , network personal computers , minicomputers , mainframe computers , and the like . embodiments of the solution may also be practiced in distributed computing environments , where tasks are performed by remote processing devices that are linked through a communications network , such as network 130 . in a distributed computing environment , program modules may be located in both local and remote memory storage devices , as would be understood by one of ordinary skill in the art . in one or more exemplary aspects , the functions described may be implemented in hardware , software , firmware , or any combination thereof . if implemented in software , the functions may be stored on or transmitted as one or more instructions or code on a computer - readable media . computer - readable media include both computer storage media and communication media including any device that facilitates transfer of a computer program from one place to another . a storage media may be any available media that may be accessed by a computer . by way of example , and not limitation , such computer - readable non - transitory media may comprise ram , rom , eeprom , cd - rom or other optical disk storage , magnetic disk storage or other magnetic storage devices , or any other medium that may be used to carry or store desired program code in the form of instructions or data structures and that may be accessed by a computer . also , any connection is properly termed a computer - readable medium . for example , if the software is transmitted from a website , server , or other remote source using a coaxial cable , fiber optic cable , twisted pair , digital subscriber line (“ dsl ”), or wireless technologies such as infrared , radio , and microwave , then the coaxial cable , fiber optic cable , twisted pair , dsl , or wireless technologies such as infrared , radio , and microwave are included in the definition of medium . disk and disc , as used herein , includes compact disc (“ cd ”), laser disc , optical disc , digital versatile disc (“ dvd ”), floppy disk and blu - ray disc where disks usually reproduce data magnetically , while discs reproduce data optically with lasers . combinations of the above should also be included within the scope of non - transitory computer - readable media . fig4 is a product and communications flow diagram associated with a prior art system and method for management of returned goods . as described above , employees and retailers using prior art systems for returned goods management , such as that illustrated in fig4 , often find it more efficient to simply discard or scrap defective product than to coordinate for returning the product back to the manufacturer , especially in light of the ability to negotiate the discarded product in a chargeback at the end of a sales process . moreover , retailers often have to cannibalize other products at the store to repair returned goods for customers , thereby rendering the cannibalized product unavailable to sell . the result of these shortcomings in the prior art is that manufacturers are charged back for products that could have been easily fixed with a replacement part sent to the store or customer . there is also no “ true ” data trail in the prior art systems and methods documenting what happened to a returned product , and so end of year chargebacks are often contentious negations between a manufacturer and retailer . consider the fig4 product and communications flow diagram 400 , for example , where the solid arrows indicate movement of a product and the dashed arrows indicate communication of data . beginning at step 401 , the supplier ships a product to a merchant , such as a bicycle . the product is received by the merchant and placed into inventory . as would be understood by one of ordinary skill in the art , the merchant may have paid the supplier for the product with the intention of placing the product on sale to the consuming public . if the product is discovered to be damaged , such as the bicycle with a bent handlebar , the merchant documents the product as a damaged good ( i . e ., a returned good ) at step 403 . notably , the merchant may simply discard the bicycle or allow it to “ find its way home ” with an employee . at any rate , whether the damaged good is returned to the supplier or earmarked for repair is at the discretion of the merchant and / or an employee of the merchant . the supplier , of course , may be charged back for the entire value of the product because the product was not sold to a consumer . moving to step 405 , a damaged good may be sold to a customer of the merchant . at step 407 , the customer may return the damaged good to the merchant as he has no other remedy . the merchant , in an effort to provide quality customer service , may give the customer a replacement product at step 409 and discard the damaged product . the damaged product , which may have been easily fixed if the supplier were in the loop , or may have at least presented to the supplier a problem to avoid with future product , may be discarded by the merchant and documented at step 411 as a returned good . at the end of the sales cycle , the merchant may provide at step 413 a total chargeback amount to the supplier for the discarded goods . the supplier , absent any opportunity throughout the sales cycle to verify the nature of the damaged goods and remedy the damaged goods , is unable to mitigate its chargeback obligations to the merchant . fig5 a - 5c is a product and communications flow diagram illustrating various aspects of a system and method for management of returned goods according to an exemplary embodiment of the solution . in the fig5 product and communications flow diagram 500 , the solid arrows indicate movement of a product and the dashed arrows indicate communication of data . beginning at step 501 , the supplier may ship a damaged product to a merchant . using a pcd 110 that may be a part of the merchant pos 125 , the merchant may communicate with a bizzap server at step 503 to document the damaged goods . as explained above , any amount of returned goods content may form the documentation including a digital picture of the damaged goods , the model and type of goods , shipping information , purchase order information , serial numbers , etc . at step 505 , the bizzap server 105 may communicate with the supplier , such as via the supplier im & amp ; a system 107 , to make the buyer aware of the damaged good . in the event that the damaged good is deemed repairable , at step 507 the supplier may provide the merchant with a repair part . notably , the bizzap server 105 and , by extension the rgd and customer relationship database 120 , may be updated to reflect that the replacement parts have been shipped from the supplier , the nature of the parts , associated repair instructions , etc . it will be understood that every step explicitly and inherently described herein may be documented by the bizzap server 105 even if such is not depicted in the figures or mentioned in this description . returning to the fig5 illustration , at step 509 the merchant may repair the goods and place them into inventory , thereby avoiding a scrap event or chargeback for the full value of the product . at step 511 , the merchant may update the bizzap server 105 to reflect that the damaged good has been repaired . beginning at step 513 , a good may be purchased from the merchant by a customer . the customer may later discover that the good is damaged and elect to return the damaged good to the merchant at step 515 . similar to that which has been described above , the merchant may leverage the pcd 110 a to document the nature of the returned good and the returned good transaction and update the bizzap server 105 at step 517 . the bizzap server 105 then notifies the supplier at step 519 . the supplier may subsequently determine that the returned good is repairable and should not be scrapped . at step 523 the supplier may provide the merchant with repair parts to repair the returned good . at step 525 , the merchant may repair the returned good and place it back in inventory or return it to the customer . at step 527 , the merchant may update the bizzap server 105 . turning now to steps 529 through 539 of fig5 b , dispensation instructions provided through a bizzap based solution may require scrapping of a damaged or returned good not economically repairable . beginning at step 529 , a merchant may ship a damaged product to a merchant . recognizing that the product is damaged , the merchant may leverage the pcd 110 a to interface with the bizzap server 105 and provide documentation of the damaged product at step 531 . at step 533 the supplier is notified and , at step 535 , elects to scrap the damaged product . at step 537 the bizzap server 105 updates the database 120 to reflect that the product was damaged beyond repair and should be charged back to the supplier at the end of the sales cycle . at step 539 , the merchant receives instructions to scrap the item . turning now to steps 541 through 555 , dispensation instructions provided through a bizzap based solution may require repair of a damaged item that proves irreparable . beginning at step 541 , a merchant may ship a damaged product to a merchant . recognizing that the product is damaged , the merchant may leverage the pcd 110 a to interface with the bizzap server 105 and provide documentation of the damaged product at step 543 . at step 545 the supplier is notified and , at step 547 , ships repair parts to repair the damaged product . at step 549 , the merchant may determine that the product cannot be repaired and updates the bizzap server 105 accordingly . the supplier is notified at step 551 and , at step 553 , elects to scrap the damaged product . at step 555 the bizzap server 105 updates the database 120 to reflect that the product was damaged beyond repair and should be charged back to the supplier at the end of the sales cycle . turning now to steps 557 through 571 of fig5 c , a supplier may leverage a bizzap based solution to directly interface with a customer for repair of a damaged product . beginning at step 557 , the customer may purchase a good that it later determines is damaged . using a pcd 110 b configured with a rgdm module , the customer may document to the bizzap sever 105 the damaged good along with any required returned good content at step 559 . the supplier may be notified of the damaged good and return request at step 561 . subsequently , at step 563 the supplier may provide the customer with repair parts . at step 565 , the customer may repair the product , thereby avoiding the need to return the entire good to the supplier . at step 567 , the bizzap server 105 may be updated that the previously damaged product is repaired to the satisfaction of the customer . at step 569 , the supplier may be updated as to the status of the product . at step 571 , using the returned good content collected by the bizzap server 105 and stored in the database 120 , the supplier may reach out to the customer in an effort to repair and damaged goodwill . for example , the supplier may provide the customer with a discount on a future purchase . at step 573 , the total chargeback for a sales cycle , whether such chargeback is attributable to scrapped items , merchant labor associating with repairing damaged items , etc ., may be calculated by the bizzap server 105 and provided to the supplier and merchant at step 575 . notably , it should be understood that any data collected over the sales cycle and aggregated by the bizzap server 105 may be provided to the supplier and / or merchant . such data may include , but is not limited to including , customer information , product return rates , repair lead times , etc . certain steps in the processes or process flows described in this specification naturally precede others for the invention to function as described . however , the invention is not limited to the order of the steps described if such order or sequence does not alter the functionality of the invention . that is , it is recognized that some steps may performed before , after , or parallel ( substantially simultaneously with ) other steps without departing from the scope and spirit of the invention . in some instances , certain steps may be omitted or not performed without departing from the invention . also , in some instances , multiple actions depicted and described as unique steps in the present disclosure may be comprised within a single step . further , words such as “ thereafter ”, “ then ”, “ next ”, “ subsequently ”, etc . are not intended to limit the order of the steps . these words are simply used to guide the reader through the description of the exemplary method . additionally , one of ordinary skill in programming is able to write computer code or identify appropriate hardware and / or circuits to implement the disclosed invention without difficulty based on the flow charts and associated description in this specification , for example . therefore , disclosure of a particular set of program code instructions or detailed hardware devices is not considered necessary for an adequate understanding of how to make and use the invention . the functionality of the claimed computer implemented processes is explained in more detail in the above description and in conjunction with the figures which may illustrate various process flows . therefore , although selected aspects have been illustrated and described in detail , it will be understood that various substitutions and alterations may be made therein without departing from the spirit and scope of the present invention , as defined by the following claims .
| 6 |
an embodiment of the present invention is described below with reference to drawings . a net - shaped protective material of the embodiment shown in fig1 is a sheet . the sheet 1 is net - shaped by fusing sectionally elliptic vertical strands 2 and horizontal strands 3 to each other at intersection points 4 thereof to form rhombic vacancies 5 surrounded with the vertical strands 2 and the horizontal strands 3 . because the vacancies 5 are rhombic , the vertical strands 2 are not parallel with a longitudinal direction ( axis direction ) l of the sheet 1 , and the horizontal strands 3 are not orthogonal to the axial direction l , but both the vertical strands 2 and the horizontal strands 3 are in a tilt direction to the axial direction l . strands are distinguishably named the vertical strand 2 and the horizontal strand 3 . both the vertical strands 2 and the horizontal strands 3 consist of identical flame - retardant resin fibers 10 and are elliptic in section , as described above . in detail , the flame - retardant resin fiber 10 is composed of not less than one kind of a halogen - free resin component selected from among mixtures each consisting of not less than two kinds of polypropylene , polyester , polyethylene terephthalate , polyamide , polyphenylene ether , polybutylene terephthalate , and polyphenylene sulfide and a flame retardant , added to the halogen - free resin component , which is selected from among a bromine - based flame retardant , phosphates , metal hydroxides , and melamine . 0 . 5 to 100 parts by mass of the flame retardant is added to 100 parts by mass of the resin component . if necessary 0 to 50 parts by mass of a filler consisting of magnesium oxide or / and calcium carbonate is added to 100 parts by mass of the resin component . in this embodiment , the polypropylene ( pp ) is used as the resin component , and the bromine - based flame retardant consisting of tetrabromobisphenol is used as the flame retardant . the vertical strands 2 and the horizontal strands 3 are not braided , but fused to each other at intersection points 4 by layering the vertical strands 2 on the horizontal strands 3 with the vertical strands 2 being disposed at an upper side and the horizontal strands 3 being disposed at an upper side . as shown in fig2 ( c ) , the sectionally elliptic vertical strands 2 disposed at the upper side and the sectionally elliptic horizontal strands 3 disposed at the lower side make surface contact at the intersection points 4 and are fused to each other with a portion 3 m , of the lower - side horizontal strand 3 , which occupies 40 to 50 % of the sectional area thereof being penetrated into the upper - side vertical strands 2 . the major axis of each of the vertical strand 2 and the horizontal strand 3 is set to 0 . 35 mm to 0 . 5 mm . the thickness of the net - shaped sheet 1 composed of the vertical strands 2 and the horizontal strands 3 is set to 0 . 4 mm to 0 . 8 mm . in the net - shaped sheet 1 , the length of the vertical strand 2 and that of the horizontal strand 3 surrounding the rhombic vacancy 5 are set to 1 . 4 mm × 1 . 4 mm in this embodiment . the tensile strength , tear strength , and tensile elongation of the sheet 1 in the vertical direction ( axial direction ) and in the horizontal direction are set to not less than 15 . 7n , not less than 15 . 7n , and 180 to 230 % respectively . as shown in fig3 , by using a method described later , the net - shaped sheet 1 is so bent in advance that the net - shaped sheet 1 has an undeformable cylindrical configuration to overlap both ends thereof in the width direction thereof orthogonal to the longitudinal direction thereof , namely , the axial direction l thereof on each other . at the process of mounting the sheet 1 on a wire harness 20 , the sheet 1 is disposed along the longitudinal direction of a group w of electric wires of the wire harness 20 . in this state , the bent sheet 1 having the undeformable cylindrical configuration is wound around the peripheral surface of the group w of the electric wires . in this state , both ends of the net - shaped sheet 1 in the width direction thereof are overlapped each other . thus the net - shaped sheet 1 is capable of completely covering the entire peripheral surface of the group w of the electric wires . thereafter an adhesive tape t is wound around both ends of the sheet 1 in its longitudinal direction and the group w of the electric wires drawn out of the sheet 1 to fix the adhesive tape t and the sheet 1 as well as the electric wires to each other . the method for producing the net - shaped sheet 1 is described below . the sheet 1 is formed by using a sizing machine shown in fig4 ( a ) and 4 ( b ) . in detail , after the resin component , the flame retardant , a stabilizer , and the like are supplied to a hopper 25 , they are stirred to mix them with one another . a mixture obtained by stirring and mixing the components is transported to a die set 27 with the mixture being kneaded by a screw conveyor 26 . the die set 27 molds the kneaded material into the net - shaped sheet consisting of the flame - retardant resin fiber 10 . the die set 27 is constructed of an outer die 27 a and an inner die 27 b . the outer die 27 a and the inner die 27 b are rotated in opposite directions by a motor 29 . an intersection portion ( intersection point ) where the vertical strand 2 and the horizontal strand 3 overlap on each other is formed at a portion 27 c where a hole of the outer die 27 a and a hole of the inner die 27 b overlap on each other . when the hole of the outer die 27 a and that of the inner die 27 b move apart , a grating shape ( rhombic shape in this embodiment ) is formed . when the net - shaped sheet is extruded from the die set 27 , the vertical strand 2 and the horizontal strand 3 are heated and pressurized to fuse them to each other . because the vertical strand 2 and the horizontal strand 3 are heated and pressurized , both are thermally fused to each other with the vertical strand 2 and the horizontal strand 3 being penetrated into each other at the intersection point 4 of the vertical strand 2 and the horizontal strand 3 , as shown in fig2 ( c ). thereafter a net - shaped sheet 40 is transported to a cooling bath 31 and thermally stretched by a draw roll 32 . thereafter the net - shaped sheet 40 is transported to a stretching bath 33 and wound in a coil 41 . the net - shaped sheet 40 is so bent that the net - shaped sheet 40 has an undeformable cylindrical configuration to overlap both ends thereof in the width direction thereof . fig5 ( a ) shows a method of producing a sheet 1 - a having a predetermined length from the net - shaped sheet 40 . fig5 ( b ) shows a method of producing a continuous sheet 1 - b from the net - shaped sheet 40 . in the method shown in fig5 ( a ) , the uncoiled sheet 40 is cut to a predetermined length by a sheet - cutting machine ( not shown ) to obtain a cut sheet 42 . thereafter the cut sheet 42 is passed through a heated roll 43 to obtain a cut sheet 42 c so bent that an obtained cut sheet 40 has an undeformable circular arc configuration . in the method shown in fig5 ( b ) , a conic cylindrical molding machine 45 is used , and pull rolls 46 a and 46 b are disposed upstream and downstream from the molding machine 45 respectively . the sheet 40 is passed through the molding machine 45 from the roll 46 a to shape the sheet 40 into an undeformable circular arc configuration inside the molding machine 45 so that both ends of sheet 40 in its width direction overlap on each other at a small - diameter portion of the molding machine 45 disposed at the rear portion thereof . the sheet 40 is drawn out by a roll 46 b in this state . in this manner , the continuous sheet 1 - b is produced . the sheet 1 - b is cut to a required length by a cutting machine 47 in dependence on a use condition . as shown in fig2 ( c ) , in the net - shaped sheet 1 having the above - described construction , at the intersection point 4 of the vertical strand 2 and the horizontal strand 3 , the vertical strand 2 and the horizontal strand 3 are deformed sectionally elliptically and thermally fused to each other with the vertical strand 2 and the horizontal strand 3 being penetrated into each other . therefore unlike a case in which the peripheral surface of the vertical strand and that of the horizontal strand are welded to each other , the vertical strand 2 and the horizontal strand 3 are unlikely to peel from each other . therefore the net - shaped sheet 1 has the above - described degree of tensile strength and tear strength and the shape and size of meshes of the net are prevented from being changed and is thus reliable . because the vertical strand 2 and the horizontal strand 3 are formed from the flame - retardant resin fiber 10 , the net - shaped sheet 1 has flame retardance and thus can be used as a sheathing material for the wire harness to be wired inside the engine room . further because the vertical strand 2 and the horizontal strand 3 are firmly fixed to each other , each of the vertical strand 2 and the horizontal strand 3 do not generate fray at a cut end thereof . furthermore because the sheet 1 is net - shaped , the weight thereof can be reduced to half the weight of a round tube . particularly by using the sheet 1 as a sheathing material for a large number of wire harnesses to be wired on a car , the sheet 1 is capable of contributing to a decrease of the weight of the car and thus decreasing fuel consumption . in the net - shaped sheet 1 having the above - described construction , by adjusting the position of the intersection point 4 of the vertical strand 2 and the horizontal strand 3 , it is possible to arbitrarily alter the size of the vacancy 5 and the configuration thereof . fig6 shows a coarse net n - 1 having large vacancies 5 and a fine net n - 2 having small vacancies 5 . regarding the relationship between the size of the vacancy 5 and the stretchability , wear resistance , and strength of the net - shaped sheet 1 , as shown in fig6 , the coarse net n - 1 has a high stretchability , but has a low wear resistance and strength . the fine net n - 2 has a low stretchability , but has a high wear resistance and strength . as apparent from the foregoing description , in dependence on a use condition of the wire harness , the net tube 1 is allowed to have a demanded degree of elongation and strength by adjusting the size of the vacancy 5 . the vacancy 5 can be shaped as shown in fig7 ( a ) through 7 ( h ) . the net tube 1 shown in fig7 ( a ) has rectangular meshes so that the net tube 1 is unlikely to stretch . the net tube 1 shown in fig7 ( b ) has rhombic meshes so that the net tube 1 is stretchy . the net tube 1 shown in fig7 ( c ) has hexagonal meshes so that the net tube 1 has a strength higher than that of the net tube 1 of ( b ) and has a stretchability a little lower than that of the net tube 1 of ( b ). the net tube 1 shown in fig7 ( d ) has circular meshes so that the net tube 1 has a strength higher than that of the net tube 1 of ( c ) and does not have stretchability . the net tube 1 shown in fig7 ( e ) has narrow rhombic meshes obtained by stretching the vertical strands 2 and the horizontal strands 3 . although the net tube 1 has a low strength , it has an excellent stretchability . in the net tube 1 shown in fig7 ( f ), as the vertical strands and the horizontal strands , large - diameter strands 2 a and 3 a and small - diameter strands 2 b and 3 b are formed respectively . the large - diameter strands 2 a and 3 a and the small - diameter strands 2 b and 3 b are arranged by sandwiching a plurality of the small - diameter strands 2 b and 3 b between the large - diameter strands 2 a and 3 a . net - shaped portions formed with the small - diameter strands 2 b and 3 b are disposed in vacancies surrounded with the large - diameter strands 2 a and 3 a . the net tube 1 has a strength higher than that of the net tube 1 of ( d ) and stretchability to some extent . the net tube 1 shown in fig7 ( g ) has rectangular meshes . the net tube 1 has a selvage , having a solid portion ns , which is formed at both ends of the net tube 1 in its longitudinal direction to allow an adhesive tape to be easily wound around a group of electric wires and the front end of the net tube 1 . the solid portion is formed by heating resin fibers to melt them and immersing them in a cooling bath to solidify them . the net tube 1 shown in fig7 ( h ) has rhombic meshes , and the net tube 1 has a selvage . as apparent from the above description , the configuration of the vacancy 5 can be easily adjusted according to a demand for a stretchy net tube or a net tube unlikely to stretch . comparison between physical properties of the net - shaped sheets of the examples and those of net - shaped sheets of the comparison examples is described below . in examples 1 , 2 , and 3 , four parts by mass of a bromine - based flame retardant was added to 100 parts by mass of polypropylene to form vertical strands and horizontal strands . at the intersection point of the vertical strand and the horizontal strand , as described in the embodiment , the vertical strand and the horizontal strand were thermally fused to each other with 40 to 50 % of the sectional area of the horizontal strand being penetrated into the vertical strand to obtain a net - shaped sheet having rhombic meshes . the lengths of sides of vacancies of the examples 1 , 2 , and 3 were different from each other , as shown in table 1 . in the net tube of the comparison example 1 , the sectionally circular vertical strand and horizontal strand were made of the polypropylene , and the surface of the vertical strand and that of the horizontal strand at an intersection point thereof were fused to each other in line contact . the net - shaped sheet had rhombic meshes similarly to the net - shaped sheets of the examples . in a tube of the comparison example 2 , the vertical strand and the horizontal strand were made of polyester and woven densely . a tape of the comparison example 3 was a vinyl chloride tape generally used to be wound around a wire harness . in the test apparatus , an auxiliary weight 31 was mounted on a supporting bar 30 , and a bracket 32 is disposed below the auxiliary weight 31 . the bracket 32 was coupled to the front end of a cantilevered shaft arm 33 . a test tape 40 was fixed to a horizontal supporting bar 34 . in this state , a wear tape 36 consisting of 150 a sand paper was moved in a direction shown with arrows with the wear tape 36 being held by a supporting pin 35 and sliding the test tape 40 . the wear volume of the test tape 40 was measured at a portion thereof where the wear tape 36 slid . the tear strength shown in table 1 was measured as follows : as shown in fig8 ( b ) , a slit 41 a having a length of 25 mm was formed from the center of one side of a test tape 41 having vertical and horizontal lengths of 50 mm . the test tape 41 was pulled in left - ward and right - ward directions by setting the slit 41 a as the boundary . as shown in table 1 , the test net - shaped sheets of the examples 1 , 2 , and 3 were excellent in the flame retardance ( oi value ) thereof . the oi values of the test net - shaped sheets of the examples 2 and 3 were more than the target value of 23 . 5 . the test net - shaped sheets of the examples 1 , 2 , and 3 had a tensile strength 3 to 10 times higher than the test net tube of the comparison example 1 in which intersection points of the vertical strands and the horizontal strands were fused to each other in line contact and tear strengths higher than the test net tube of the comparison example 1 . in the wear test , the test net - shaped sheets of the examples 1 , 2 , and 3 had wear volumes not less than the target value of 1000 , which proved that they were excellent in the wear resistance thereof . in the above - described embodiment , the net - shaped sheet 1 is shaped into a circular arc configuration such that both ends in its width direction overlap each other . besides , as shown in fig9 ( a ) , overlapped both ends of the net - shaped sheet 1 may be thermally fused to each other to form a tube 50 . as shown in fig9 ( b ) , after a wire harness 20 is inserted through the contracted net - shaped tube 50 , the net - shaped tube 50 is stretched as shown in fig9 ( c ) to fix a group of electric wires to an adhesive tape t .
| 8 |
in fig1 the belt press has been designated generally by the numeral 10 and shown to include substantially identical upper and lower sections 12 and 14 , respectively , that are aligned one above the other . each section includes a pair of belt rolls 11 , 13 on the upper and 15 , 17 on the lower . the rolls are rotatably mounted to frame ( not shown ). traveling around rolls 11 , 13 is a metal alloy belt 18 and around rolls 15 and 17 an identical belt 20 . both belts coact to form a constant height nip section within the frame hereafter referred to as the heating and cooling zone 22 . each belt is supported on its back side in the zone 22 by a stationary antifriction bearing 24 sandwiched between the stationary zone and the moving belts . belt tension rolls 28 , 30 are mounted for rotatable and vertical movement as indicated by the direction arrows . the belts are driven in the direction of the arrows by conventional drive means ( not shown ). each zone 22 is composed of heating sections 32 , 34 , and cooling sections 36 separated by thermal barriers 38 . the zones are attached to the frame with mechanical shims 26 , 26 a in a fashion to allow vertical positioning for maintaining a constant spacing between the belts . there are numerous heating and cooling concepts practiced by commercial belt press suppliers . heating systems use an electrical heat source to generate heat and then carry the heat to the belt via pneumatic , hydraulic and regular conduction techniques . the source of cooling is usually a water supply with the heat being carried from the belt by pneumatic , hydraulic and conductive sytems . in order to provide capability for the belt press to operate at temperatures above 540 ° f . the static anti friction bearings 24 of woven screen must be permanently impregnated with either a dried graphite paste , a dried molylube n ( molybdenum ) paste or a graphite sheeting , which are all high temperature and low volatility substrates which fill the voids in the screen . the bearing surface must then be coated periodically with a high temperature and low volatility lubricant such as c5a ( fel pro , inc ., skokie , ill . ), a copper based lubricant , molylube - 16 ( bel - ray co ., inc ., farmingdale , n . j . ), a molybdenum based lubricant , or krytox ™ paste ( du pont ), a fluorinated lubricant . in a batch mode of operation shown in fig1 a , a layup consisting of a core member 50 and facings 50a comprised either of preimpregnated fiber reinforced sheets or sheets of thermoplastic resin and fabrics of high performance fibers ( glass , aramids or carbon ) 50 is introduced from platform 49 into the nip between the belts 18 and 20 . if necessary , a release film 52 is unrolled from the supply roll 51 to cover belts 18 and 20 . the facings are bonded to the core as the layup passes through zone 22 of fig1 under a positive pressure created by the difference in the opening between the belts and the thickness of the core and its facings . usually the bonding pressure is limited by the compressive strength of the core at the processing temperature . a stationary platen press of the type known to one skilled in the art could also be used to heat and bond the facing 50a to the core 50 . while fig1 a shows a system set up for a batch mode of operation , it is to be understood that a ( single step ) continuous mode of operation could be obtained as disclosed in fig2 wherein a continuous core 50 &# 39 ; is fed to the nip of the belt press 10 from platform 49 . upper and lower facings 60 , 62 , respectively , are formed from a reinforcing fabric 64 , sandwiched between thermoplastic resin sheets 66 , 68 ( in the case of upper facing 60 ) and 64a sandwiched between thermoplastic resin sheets 65 , 67 ( in the case of lower facing 62 ) a release film 70 such as kapton ™ is fed between the upper and lower facings and the belts of the belt press 10 . kapton ™, aluminum or teflon ™ coated glass fabric are needed for a release agent with certain thermoplastic sheets but may not be required by others . the panels are formed in the belt press in substantially the same manner as described above except the operation is continuous . panels made according to the above procedure are then tested for damage tolerance via the climbing drum peel test ( astm d781 - 76 ; reapproved 1986 ). panels exhibiting at least 10 pounds of peel per 3 &# 34 ; sample have sufficient damage tolerance for use in aircraft interiors . if higher peel strengths are desired with honeycomb of nomex ™, crushed - core panels can be made . with the above technology , peel strengths can be enhanced by as much as 3 - 4 times versus noncrushed core panels . this is because the bonding surface area has been increased . more particularly , as shown in fig3 a honeycomb core member 50 &# 34 ; is introduced into the nip between belts 18 , 20 along with a fiber reinforced resin facing 51 &# 39 ;. as they pass through the nip under positive pressure , the cell walls of the honeycomb structure are folded into hooklike configurations pointed generally in a direction opposite to the direction of movement of the core , thus increasing the surface area of the honeycomb structure contacting the facings 52 &# 39 ;. with the new thermoplastic facing technology , the core is heated above its softening point such that the cells are crushed much more uniformly than with conventional thermoset crushed - core panels which have considerable cell damage after panel fabrication leading to a decrease in certain physical properties such as bending stiffness . an alternate embodiment using a foam core is shown in fig5 wherein a foam core member 50 &# 34 ;&# 39 ; is introduced into the nip between belts 18 and 20 along with a fiber reinforced resin facing 52 &# 34 ;. if the foam is thermoplastic in nature , as shown in fig6 a strong bond 54 is formed between the foam and the facing resin as defined by peel strength exceeding 30 lbs ./ 3 &# 34 ; width . this strong bond results from fusion bonding ( i . e . melting together of the facing resin and the melted foam surface ) between the resin and the foam at the interface . the heat from the belt press melts the surface of the foam as seen by thickening of the foam cell walls near the interface . the heat is not applied long enough to penetrate through the thickness of the foam , therefore , the foam interior remains intact . examples of foams which will bond to thermoplastic pekk resin in this manner are polymethacrylimide foams ( rohacell ™) and polyetherimide foams ( airex ™). if the foam is not thermoplastic in nature , as shown in fig7 a strong bond 54 &# 39 ; is formed between the foam and facing resin which results from flow of the pekk polymer into the cells at the interface , resulting in a bond of increased surface area at the interface . the resin flows into and around the surface cell walls of the foam core . the strong bond is characterized by peel strength of greater than 25 lbs ./ 3 &# 34 ; width . examples of foams which will bond to pekk resin in this manner are polyurethanes and polyisocyanurates ( last - a - foam ™). in addition to being used as core materials , these foam materials have been demonstrated for use as an edge trim to honeycomb - cored sandwich panels as shown in fig8 and 9 . the foam edge trim member acts as a barrier to moisture for the honeycomb , as a location for fastener attachment , and also as a smooth edge finish for an aircraft part . the foam edge 50 &# 34 ;&# 39 ; is held in place around the honeycomb core member 50 &# 34 ; for processing by a variety of methods . in the preferred method a screw 56 is used to mechanically fasten the foam strips together at each splice point . other types of fasteners at the splice point which have been demonstrated include kapton ™ tape or fast drying adhesives . ultrasonic bonding of the face sheets to the core or a wooden frame around the edges of the panel have been demonstrated as techniques to hold the foam in place without fasteners . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . three pieces of amorphous ( 60 / 40 t / i ) pekk film ( 1 . 5 mils thick , 150 melt index as measured by astm 1238 - 79 procedures ) were placed on the core bonding side of kevlar ™ 49 aramid fiber ( by du pont ) style 285 fabric ( 5 . 1 oz ./ sq . yd ., 9 mils thick ) and one piece on the belt contact side to form the top facing . the bottom facing consisted of a balanced 2 pieces of film on each side of the kevlar ™. the resin percentage by weight of the facings was 54 %. the facings were placed on each side of a piece of honeycomb of nomex ™ aramid paper ( by du pont ) ( 3 lbs ./ cu . ft ., 1 / 8 &# 34 ; cell , 1 / 2 &# 34 ; thick ). the warp direction of the fabric was aligned with the ribbon direction of the core . the warp face of the fabric was placed against the core . the facing layers were anchored to the core material with two 1 &# 34 ; wide kapton ™ tape strips along the leading edge of the sample . the belt press ( substantially as shown in fig2 ) was set to a constant temperature of 650 ° f . and a belt speed of 15 &# 34 ; per min . ( approximately 32 sec . residence time in the heat zone ). the gap between the upper and lower belts was fixed to give a panel thickness of 0 . 518 &# 34 ;. a kapton ™ polyimide release sheet ( by du pont ) was placed over both sides of the entire laminate . the front edge of the sample , perpendicular to the warp direction of the facing fabric and containing the kapton ™ tape anchors , was inserted into the belt press . once consolidated , the kapton ™ release film and tape anchors were removed from the sample . the panel was cut into three 3 &# 34 ;× 12 &# 34 ; samples ( length perpendicular to the warp direction ). peeling the 3 ply pekk / kevlar ™/ 1 ply pekk facing from the core gave an average peel strength of 28 . 4 lbs ./ 3 &# 34 ; sample . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . two pieces of amorphous ( 60 / 40 t / i ) pekk film ( 1 . 5 mils thick , 150 melt index as measured by astm 1238 - 79 procedures ) were placed on each side of style 7781 glass ( 9 mils thick ). the facesheet was consolidated at belt press conditions of 650 ° f . and 15 &# 34 ;/ min . belt speed ( about 32 sec . in the heating zone ). the gap between upper and lower belts was adjusted to give a sample thickness of 0 . 012 &# 34 ;. a second facesheet was consolidated in an identical fashion . the resin percentage by weight of the facings was 39 %. the described facings were then placed on each side of a piece of honeycomb of nomex ™ ( 3 lbs ./ cu . ft ., 1 / 8 &# 34 ; cell , 1 / 2 &# 34 ; thick ). the facings were anchored to the core material with two 1 &# 34 ; wide kapton ™ tape strips along the leading edge of the sample . the belt press was set to a constant temperature of 625 ° f . and a belt speed of 15 &# 34 ; per min . ( residence time approximately 32 sec . in the heat zone ). the gap between the upper and lower belts was fixed to give a sample thickness of 0 . 516 &# 34 ;. a kapton ™ release sheet was placed over both sides of the entire laminate . the front edge of the sample , perpendicular to the warp direction of the facing fabric and containing the kapton ™ tape anchors , was inserted into the belt press . the belt press conditions were then adjusted to a constant 500 ° f . and 3 . 5 &# 34 ;/ min . ( residence time about 2 . 3 min . in the heat zone ) belt speed and the panel was inserted as before . once consolidated , the kapton ™ release film and tape anchors were removed from the sample . the panel was cut into three 3 &# 34 ; by 8 &# 34 ; samples ( length parallel to the core ribbon direction ). the specimens gave an average short beam shear value of 100 psi . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . two pieces of amorphous ( 60 / 40 t / i ) pekk film ( 1 . 5 mils thick , 180 melt index ) were placed on each side of a kevlar ™ style 281 fabric , 5 . 1 oz ./ sq . yd ., 10 mils thick , to form the facing . to achieve a sample size of 14 &# 34 ;× 17 &# 34 ;, 6 . 5 &# 34 ; strips of the above mentioned amorphous pekk film were concurrently placed over a 14 &# 34 ;× 17 &# 34 ; piece of core material being careful not to overlap film edges . identical facings were placed on each side of a piece of honeycomb of nomex ™ ( 3 lbs ./ cu . ft ., 1 / 8 &# 34 ; cell , 1 / 2 &# 34 ; thick ). the warp direction of the fabric was aligned with the ribbon direction of the core . the facing layers were anchored to the core material with two 2 &# 34 ; wide kapton ™ tape strips along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . and a belt speed of 12 &# 34 ; per min . ( residence time approximately 48 sec . in the heat zone ). the gap between the upper and lower belts was set to achieve a total sample thickness of 0 . 36 &# 34 ; ( 70 % of the theoretical thickness ). a kapton ™ release sheet was placed over both sides of the entire laminate according to the above described procedure . the front edge of the sample , perpendicular to the warp direction of the facing fabric and containing the kapton ™ tape anchors , was inserted into the belt press . the kapton ™ release film and the tape anchors were removed from the sample . the average sample thickness , as measured by a micrometer , was found to be 0 . 387 &# 34 ;. three 3 &# 34 ;× 12 &# 34 ; samples ( long direction perpendicular to the warp direction ) were cut from the sample . the average peel strength was determined to be 56 lbs ./ 3 &# 34 ; sample . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . two pieces of polyethermide ultem ™ film were placed on each side of a kevlar ™ style 281 fabric , 5 . 1 oz ./ sq . yd ., 10 mils thick , to form the facing . identical facings were placed on each side of a piece of honeycomb of nomex ™ ( 3 lbs ./ cu . ft ., 1 / 8 &# 34 ; cell , 1 / 2 &# 34 ; thick ). the warp direction of the facing fabric was aligned with the ribbon direction of the core . the facing layers were anchored to the core material with two 1 &# 34 ; wide kapton ™ tape strips along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . and a belt speed of 15 &# 34 ;/ min . ( residence time about 32 sec . in the heat zone ). the gap between the upper and lower belts was set to achieve a total sample thickness of 0 . 44 &# 34 ; ( 85 % theoretical gap ). a kapton ™ release sheet was placed over both sides of the entire laminate according to the above described procedure . the front edge of the sample , perpendicular to the warp direction of the facing fabric and containing the kapton ™ tape anchors , was inserted to the belt press . the kapton ™ release film and the tape anchors were removed from the sample . a climbing drum peel test was performed on three samples and had an average result of 11 . 0 lbs ./ 3 &# 34 ; sample . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . two pieces of 70 / 30 t / i , pekk film were placed on the top side of a kevlar ™ 49 style 281 fabric ( 5 . 1 oz ./ sq . yd ., 10 mils thick ) and two pieces of 60 / 40 t / i pekk film ( 180 melt index as measured by astm 1238 - 79 ) on the bottom to form the facing . the percentage of resin by weight was about 49 . identical facings were placed on each side of a piece of honeycomb of nomex ™ ( 3 lbs ./ cu . ft ., 1 / 8 &# 34 ; cell , 1 / 2 &# 34 ; thick ). the 60 / 40 t / i film was placed next to the honeycomb core on both sides . to achieve a sample size of 13 &# 34 ;× 17 &# 34 ;, 6 . 5 &# 34 ; strips of the above mentioned amorphous pekk films were concurrently placed over a 14 &# 34 ;× 17 &# 34 ; piece of the core material being careful not to overlap film edges . the warp direction of the fabric was aligned with the ribbon direction of the core . the facing layers were anchored to the core material with two 1 &# 34 ; wide kapton ™ tape strips along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . and a belt speed of 15 &# 34 ;/ min . ( residence time approximately 32 sec . in the heat zone ). the gap between the upper and lower belts was fixed to 0 . 360 &# 34 ; ( 70 % theoretical thickness ). a kapton ™ release sheet was placed over both sides of the entire laminate . the front edge of the sample , perpendicular to the warp direction of the facing fabric and containing the kapton ™ tape anchors , was inserted into the belt press . once consolidated the kapton ™ release film and tape anchors were removed from the sample . the average sample thickness , as measured by a micrometer , was found to be 0 . 365 &# 34 ;. three 3 &# 34 ;× 12 &# 34 ; samples ( length perpendicular to the warp direction ) were cut from the sample . the peel strength was determined to be 27 lbs ./ 3 &# 34 ; sample . the components of the panel were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . three pieces of amorphous polyetheretherketone ( peek ) film ( stabar k200 - 782 ), 1 . 06 oz ./ sq . yd ., melt index 19 @ 360 ° c ., as measured by astm 1238 - 79 procedures , were laid over a piece of 1 / 2 &# 34 ; thick nomex ™ honeycomb core . then a piece of 7781 glass fabric was placed atop the film layers with the warp direction of the fabric parallel to the core ribbon direction and the warp face towards the core . three more layers of film were then placed on the fabric . this layup was intended to produce a resin content on the face sheets of approximately 41 %. the film and fabric stacked layup was duplicated on the reverse side of the core . the layers of film and fabric were anchored to the core by ultrasonic welder along the leading edge of the panel . the belt press was set to a constant temperature of 680 ° f . and a belt speed of 15 &# 34 ; per min . ( about 32 sec . residence time in the heat zone ). the gap between the belts was adjusted to give a product thickness of 0 . 44 &# 34 ;, or 85 % of the theoretical thickness expected . a kapton ™ release sheet was placed over both sides of the entire laminate . the laminate was placed into the belt press such that the ribbon direction of the core was parallel to the machine direction , with the edge that had been ultrasonic spot welded entering the belt press first . after consolidation , the release sheets were removed from the surfaces of the laminate . three 3 &# 34 ;× 12 &# 34 ; samples were cut from the panel , length perpendicular to the core ribbon direction . the average peel strength of the three samples was found to be 15 lbs ./ 3 &# 34 ; sample . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . two pieces of amorphous ( 60 / 40 t / i ) pekk film ( 130 melt index as measured by astm 1238 - 79 procedures ) were placed on each side of a kevlar ™ 49 style 281 fabric , 5 . 1 oz ./ sq . yd ., 10 mils thick , to form the facing . the percentage of resin by weight was calculated to be 51 %. identical facings were placed on each side of a piece of honeycomb of aluminum ( 3 lbs ./ cu . ft ., 1 / 8 &# 34 ; cell , 1 / 2 &# 34 ; thick ). to achieve a sample size of 13 &# 34 ;× 17 &# 34 ;, 6 . 5 &# 34 ; strips of the above mentioned amorphous pekk film were concurrently placed over a 14 &# 34 ;× 17 &# 34 ; piece of the core material being careful not to overlap film edges . the warp direction of the fabric was aligned with the ribbon direction of the core . the facing layers were anchored to the core material with two 1 &# 34 ; wide kapton ™ tape strips along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . and a belt speed of 15 &# 34 ;/ min . ( residence time approximately 32 sec . in the heat zone ). the gap between the upper and lower belts was fixed to give a sample thickness of 0 . 516 &# 34 ;. a kapton ™ release sheet was placed over both sides of the entire laminate . the front edge of the sample , perpendicular to the warp direction of the facing fabric and containing the kapton ™ tape anchors , was inserted into the belt press . once consolidated the kapton ™ release film and tape anchors were removed from the sample . the average sample thickness , as measured by a micrometer , was found to be 0 . 523 &# 34 ;. three 3 &# 34 ;× 12 &# 34 ; samples ( length perpendicular to the warp direction ) were cut from the sample . the peel strength was determined to be 11 . 9 lbs ./ 3 &# 34 ; sample . the components of the laminate were drid for at least 2 hours at 120 ° c . and then laid up in the following manner . two pieces of amorphous ( 60 / 40 t / i ) pekk film ( 150 melt index ) were placed on either side of a kevlar ™ style 281 fabric , 5 . 1 oz ./ sq . yd ., 10 mils thick , to form the panel facings . one inch wide strips of 1 / 2 &# 34 ; thick foam ( last - a - foam ™ fr - 10118 polyisocyanurate by general plastics mfg . co ., tacoma , wash .) were cut from a sheet of foam and assembled into a frame with outer dimensions measuring 12 &# 34 ;× 16 &# 34 ;. the strips of foam were held together using a rigid wooden frame with inner dimensions of 12 &# 34 ;× 16 &# 34 ;. a piece of nomex ™ honeycomb core cut exactly to 10 &# 34 ;× 14 &# 34 ; was fitted into the center of the frame . the identical facings described above were then placed on each side of the foam - framed nomex ™ honeycomb such that the warp direction of the fabric ran in the ribbon direction of the honeycomb core . one inch wide strips of kapton ™ tape were used to anchor the facings to the frame along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . with a belt speed of 15 &# 34 ;/ min . ( residence time approximately 32 secs . in the heat zone ). the gap between the upper and lower belts was set to produce a finished sample thickness of 0 . 516 &# 34 ; or 100 % of the theoretical thickness . the front edge of the sample with the kapton ™ tape anchors ) was inserted into the belt press . this sample was covered with kapton ™ film as a release agent to prevent the sample from sticking to the belts . once consolidated the kapton ™ release film and tape anchors were removed from the sample . the finished panel edges were trimmed , leaving 1 / 2 &# 34 ; width of foam around the panel . the average thickness of the foam trimmed portion of the panel , as measured by a micrometer , was 0 . 507 &# 34 ; and the average thickness of the honeycomb cored portion of the sample was measured to be 0 . 494 &# 34 ;. the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . identical panel facings as described in example 8 were laid up . 1 . 5 &# 34 ; strips of 1 / 2 &# 34 ; thick foam ( rohacell ™ 200 wf polymethacrylimide by rohm tech , inc ., malden , mass .) were cut from a foam sheet and assembled into a frame with outer dimensions measuring 12 &# 34 ;× 12 &# 34 ;. the strips of foam were anchored together using kapton ™ tape . a piece of nomex ™ honeycomb core cut exactly to 9 &# 34 ;× 9 &# 34 ; dimensions was fitted into the center of the frame . the identical facings were placed on either side of the foam - framed nomex ™ honeycomb with the warp direction of the fabric parallel to the ribbon direction of the honeycomb core . the kapton ™ tape was used to anchor the facings in place along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . with a belt speed of 15 &# 34 ;/ min . ( residence time about 32 sec . in the heat zone ). the gap between the upper and lower belts was set to produce a finished sample thickness of 0 . 516 &# 34 ;. the panel was then consolidated in the belt press using kapton ™ release film . after processing , the kapton ™ film and tape were removed . this sample was then reprocessed to apply a decorative laminate to one side of the panel . the belt press was set to a constant temperature of 250 ° f . and 6 &# 34 ;/ min . ( residence time about 80 sec . in the heat zone ). the panel was consolidated using kapton ™ release film which was removed after processing . the finished average thickness of the foam was measured to be 0 . 521 &# 34 ; and the honeycomb core thickness was 0 . 516 &# 34 ;. the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . two pieces of amorphous ( 60 / 40 t / i ) pekk film ( 150 melt index ) were placed on either side of a kevlar ™ style 281 fabric , 5 . 1 oz ./ sq . yd ., 10 mils thick , to form the panel facings . dimensions of the fabric and film measured 16 &# 34 ;× 25 &# 34 ;. a piece of foam core ( rohacell ™ 200 wf polymethacrylimide ) was cut to these same dimensions . the facings were placed on either side of the foam and anchored in place using two 1 &# 34 ; wide kapton ™ tape anchors along the leading edge of the sample . the warp direction of the fabric was aligned along the length ( 25 &# 34 ;) direction of the panel . the belt press was set to a constant temperature of 650 ° f . with a belt speed of 15 &# 34 ;/ min . ( residence time about 32 sec . in the heat zone ). the gap between the upper and lower belts was set to produce a finished sample thickness of 0 . 516 &# 34 ; or 100 % of the theoretical thickness . the leading edge of the sample was inserted into the belt press . a kapton ™ release film was used when processing the sample . after consolidation the release film and tape anchors were removed . the average sample thickness , as measured by the micrometer , was 0 . 540 &# 34 ;. this panel was cut into five 3 &# 34 ;× 24 &# 34 ; strips for long beam flex evaluation as described in test boeing mil . spec . 256 , page 29 . the average flex strength was determined to be 14 . 7 ksi at maximum machine deflection . an identical sample was manufactured but with the warp direction of the fabric perpendicular to the length of the foam cored panel . this sample was cut into 3 &# 34 ;× 12 &# 34 ; samples for climbing drum peel evaluation . the average peel strength was determined to be 33 lbs . per 3 &# 34 ; sample . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . identical facings as described in example 9 were placed on each side of a piece of foam ( last - a - foam ™ fr 3718 polyurethane ) measuring 16 &# 34 ;× 25 &# 34 ; with the warp direction of the fabric parallel to the length of the panel . two kapton ™ tape strips were used to anchor the facings to the core along the leading edge of the panel . the panel was consolidated using a constant belt press temperature of 600 ° f . and a constant belt speed of 12 &# 34 ;/ min . ( residence time about 48 sec . in the heat zone ). kapton ™ release film was used during consolidation . after consolidation the release film and tape anchors were removed . the average panel thickness was measured to be 0 . 541 &# 34 ;. this panel was cut into samples for long beam flex evaluation . the average flex strength was determined to be 13 ksi at maximum machine deflection . an identical sample was manufactured with the warp direction perpendicular to the length of the panel for climbing drum peel evaluation . manufacturing conditions for this sample were 650 ° f . belt temperature and 15 &# 34 ;/ min . belt speed ( residence time about 32 sec . in the heat zone ). the average peel strength was determined to be 27 lbs ./ 3 &# 34 ; sample . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . identical facings of amorphous ( 60 / 40 ) pekk film and kevlar ™ fabric style 281 were placed on either side of a foam ( last - a - foam ™ fr 10118 polyisocyanurate ) core . two 1 &# 34 ; wide strips of kapton ™ were used to anchor the facings in place along the leading edge of the sample . all parts of the lay - up were cut to dimensions of 12 &# 34 ;× 16 &# 34 ;. the warp direction of the fabric was laid parallel to the length of the panel . the panel was consolidated using a constant belt press temperature of 650 ° f . and a constant belt speed of 12 &# 34 ;/ min . ( residence time about 48 sec , in the heat zone ). the gap between the upper and lower belts was set to achieve a finished panel thickness of 0 . 516 &# 34 ;. the kapton ™ release film was used during panel processing . after consolidation the kapton ™ film and tape were removed . the panel was cut into four 3 &# 34 ;× 12 &# 34 ; samples with the warp direction of the fabric parallel to the 3 &# 34 ; dimension . the average peel strength of this panel by the climbing drum peel strength test method was determined to be 27 lbs ./ 3 &# 34 ; sample . the components of the laminate were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . one piece of amorphous nylon film ( 0 . 008 &# 34 ; thick ) was placed on each side of a flat woven 5 × 5 harness satin fabric ( 15 oz ./ sq . yd . code , t5674 - 34 ) made from e - glass / amorphous nylon impregnated tow ( binnersley and krueger u . s . pat . no . 4 , 640 , 861 ) to form the facing . identical facings were placed on each side of a piece of honeycomb of nomex ™ ( 3 lbs ./ sq . ft ., 1 / 8 &# 34 ; cell , 1 / 2 &# 34 ; thick ). the warp direction of the facing fabric was aligned with the ribbon direction of the core and the predominently warp faced side of the fabric placed closest to the core . the facing layers were anchored to the core with ( 3 ) 1 &# 34 ; wide kapton ™ tape strips along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . and a belt speed of 15 &# 34 ;/ min . ( residence time about 32 sec . in the heat zone ). the gap between the upper and lower belts was set to achieve a total sample thickness of 0 . 504 &# 34 ;. a kapton ™ release sheet was placed over both sides of the entire laminate according to the above described procedure . the front edge of the sample , perpendicular to the warp direction of the facing fabric and containing the kapton ™ tape anchors , was inserted into the belt press . the kapton ™ release sheet and the tape anchors were removed from the sample . the average sample thickness , as measured by micrometer , was found to be 0 . 507 &# 34 ;. a climbing drum peel test was performed on three samples ( in the fabric warp direction ) and had an average result of 19 . 1 lbs ./ 3 &# 34 ; sample . the components of this panel were dried for at least 2 hours at 120 ° c . and then laid up in the following manner . a piece of amorphous pekk ( 60 / 40 ) film ( melt index 150 ) was laid over a piece of 1 / 2 &# 34 ; nomex ™ honeycomb core . a piece of peek / as4 uni tape ( ici fiberire apc - 2 / as - 4 12 &# 34 ; uni tape , batch no . n89 - 0038 , roll no . 11 ) was then placed upon the core with the fibers in the tape running perpendicular to the ribbon direction of the core . another piece of the same tape was then placed on the stack , but with the as - 4 fibers running parallel to the ribbon direction of the core . the tape layup was repeated in the same fashion for the opposite side of the core , including the layer of pekk film . the facing layers were fastened to the core material with kapton ™ tape along the leading edge of the sample for insertion into the belt press ( an edge perpendicular to the ribbon direction of the core ). the belt press was set up for a constant temperature of 680 ° f . and a belt speed of 15 &# 34 ;/ min . ( residence time about 32 secs . in the heat zone ). the gap between the upper and lower belts was fixed to a final sample thickness of 0 . 516 &# 34 ;. a kapton ™ release sheet was placed over both sides of the entire laminate . the leading edge of the layup was inserted into the belt press . once consolidated , the kapton ™ release film and the kapton ™ tape were removed from the sample . the average sample thickness as measured by micrometer was found to be 0 . 512 &# 34 ;. the completed panel was then cut into three 3 &# 34 ;× 24 &# 34 ; specimens ( length parallel to the ribbon direction of the core ) and tested for flexural strength and modulus according to method bms - 256 . another sample was fabricated in the above manner except that the facing ply orientation of the uni graphite tape was reversed to give maximum peel srength . therefore , the 0 ° axis of the fibers was placed parallel to the ribbon direction of the honeycomb core and the outer ply was placed perpendicular to the core ribbon direction . peel strength samples were then cut in a perpendicular orientation to the core ribbon direction . the measured peel value was determined to be 13 . 6 lbs ./ 3 &# 34 ; sample . the components of the laminate were laid up in the following manner . two strips of foam measuring 17 . 5 &# 34 ;× 2 &# 34 ; and two strips measuring 8 &# 34 ;× 2 &# 34 ; were cut from a sheet of rohacell ™ 200wf foam . these foam strips were assembled into a frame 17 . 5 &# 34 ; long and 12 &# 34 ; wide held together with 2 . 5 &# 34 ; regular screws inserted into the side approximately 1 / 2 &# 34 ; from the panel edge . a piece of honeycomb was cut to fit tightly into the center of the frame . identical panel facings composed of two pieces of amorphous ( 60 / 40 t / i ) pekk film ( 150 melt index ) on either side of a kevlar ™ style 285 fabric were assembled and placed on either side of the honeycomb core / foam frame assembly . one inch wide strips of kapton ™ tape were used to anchor the panel facings in place along the leading edge of the sample . the belt press was set to a constant temperature of 650 ° f . with a belt speed of 15 &# 34 ;/ min . sample residence time in the heat zone was approximately 32 secs . the gap between the upper and lower belts was set to produce a finished sample thickness of 0 . 516 &# 34 ; or 100 % of the theoretical thickness . the sample was inserted into the belt process with kapton ™ film as the release agent . after consolidation , the relese film and tape anchors were removed . visual inspection of the panel suface indicates that minimal space exists at the foam / honeycomb interface . the finished average thickness of the foam trimmed portion of the panel , as measured by a micrometer , was 0 . 539 &# 34 ;, and the average thickness of the honeycomb - cored portion of the sample was measured as 0 . 536 &# 34 ;.
| 1 |
referring to fig1 and 2 , a horizontal balance control system of motor vehicle in accordance with a first configuration of the invention is shown . the system comprises a pneumatic conveyor ( or electromagnetic device ) 10 which is operable to actuate hydraulic devices , links , and other mechanical elements for enabling wheels in the same line or wheels not in the same line to rotate toward the same direction and thus , overcoming irregularity of road surface . as a result , forces adapted to various road conditions can be generated , the restraint of wheels can be appropriately controlled , and balance of the car can be obtained . in the invention , the pneumatic conveyor ( or electromagnetic device ) 10 is mounted in a suitable position of a car . at least one first valve 11 and a second valve 21 are provided at one end of the pneumatic conveyor ( or electromagnetic device ) 10 . a first line 111 is interconnected the first valve 11 and a first lower pneumatic cylinder 12 . one end of the first lower pneumatic cylinder 12 is coupled to a front right wheel suspension device ( see fig2 ). the first lower pneumatic cylinder 12 comprises an extended first piston 121 coupled to a first upper hydraulic cylinder 13 . hydraulic fluid is stored in the first upper hydraulic cylinder 13 . the other end of the first upper hydraulic cylinder 13 is coupled to a front right portion of car body ( not shown ). also , a second line 112 is interconnected one end of the first upper hydraulic cylinder 13 and one end of a second upper hydraulic cylinder 14 . one end of the second upper hydraulic cylinder 14 is coupled to a front left portion of the car body ( not shown ). hydraulic fluid is stored in the second upper hydraulic cylinder 14 . a third line 113 is interconnected the other end of the second upper hydraulic cylinder 14 and the other end of the first upper hydraulic cylinder 13 . the second upper hydraulic cylinder 14 comprises an extended second piston 141 coupled to one end of a second lower pneumatic cylinder 15 . the other end of the second lower pneumatic cylinder 15 is coupled to a front left wheel suspension device ( see fig2 ). a fourth line 114 is interconnected the other end of the second lower pneumatic cylinder 15 and the first valve 11 . in the invention , a fifth line 115 is interconnected the second valve 21 and a third lower pneumatic cylinder 16 . one end of the third lower pneumatic cylinder 16 is coupled to a rear right wheel suspension device ( see fig2 ). the third lower pneumatic cylinder 16 comprises an extended third piston 161 coupled to a third upper hydraulic cylinder 17 . hydraulic fluid is stored in the third upper hydraulic cylinder 17 . the other end of the third lower pneumatic cylinder 16 is coupled to a rear right portion of car body ( not shown ). also , a sixth line 116 is interconnected one end of the third upper hydraulic cylinder 17 and one end of a fourth upper hydraulic cylinder 18 . one end of the fourth upper hydraulic cylinder 18 is coupled to a rear left portion of the car body ( not shown ). hydraulic fluid is stored in the fourth upper hydraulic cylinder 18 . a seventh line 117 is interconnected the other end of the fourth upper hydraulic cylinder 18 and the other end of the third upper hydraulic cylinder 17 . the fourth upper hydraulic cylinder 18 comprises an extended fourth piston 181 coupled to one end of a fourth lower pneumatic cylinder 19 . the other end of the fourth lower pneumatic cylinder 19 is coupled to a rear left wheel suspension device ( see fig2 ). an eighth line 118 is interconnected the other end of the fourth lower pneumatic cylinder 19 and the second valve 21 . configured as above , one ends of the first , the second , the third , and the fourth lower pneumatic cylinders 12 , 15 , 16 , and 19 and all wheels are disposed in normal positions when a car is running on a straight road . in case that a car is making a turn a control device ( not shown ) is activated to cause the pneumatic conveyor ( or electromagnetic device ) 10 to activate . next , output compressed gas ( in the case of pneumatic conveyor ) flows from the first and the second valves 11 and 21 to the first and the second lower pneumatic cylinders 12 and 15 and the third and the fourth lower pneumatic cylinders 16 and 19 via the first and the fourth lines 111 and 114 and the fifth and eighth lines 115 and 118 respectively . as such , pressure is built up in each of the first , the second , the third , and the fourth lower pneumatic cylinders 12 , 15 , 16 , and 19 . hence , pressure of hydraulic fluid in each of the first , the second , the third , and the fourth upper hydraulic cylinders 13 , 14 , 17 , and 18 is increased by compressed gas in each of the first , the second , the third , and the fourth lower pneumatic cylinders 12 , 15 , 16 , and 19 respectively . the pressurized hydraulic fluid in each of the first , the second , the third , and the fourth upper hydraulic cylinders 13 , 14 , 17 , and 18 flows to the first , the second , the third , and the fourth pistons 121 , 141 , 161 , and 181 via the second , the third , the sixth , and the seventh lines 112 , 113 , 116 , and 117 respectively . as a result , a restraint force among the first , the second , the third , and the fourth pistons 121 , 141 , 161 , and 181 is generated . as an end , poor maneuverability of an inclined car due to centrifugal force when making a turn is greatly improved . referring to fig3 , there is shown a horizontal balance control system of motor vehicle in accordance with a second configuration of the invention . in the system , one end of a fifth hydraulic cylinder 51 is coupled to the second line 112 . an eighth line 118 is interconnected the other end of the fifth hydraulic cylinder 51 and one end of the second upper hydraulic cylinder 14 . the third line 113 is interconnected the other end of the second upper hydraulic cylinder 14 and one end of a sixth hydraulic cylinder 52 . a ninth line 119 is interconnected the other end of the sixth hydraulic cylinder 52 and one end of the first upper hydraulic cylinder 13 . the fifth and the sixth hydraulic cylinders 51 and 52 are arranged side by side . hydraulic fluid is stored in each of the fifth and the sixth hydraulic cylinders 51 and 52 . the fifth hydraulic cylinder 51 comprises an extended fifth piston 511 coupled to a seventh pneumatic cylinder 53 and the sixth hydraulic cylinder 52 comprises an extended sixth piston 521 coupled to the seventh pneumatic cylinder 53 respectively . a tenth line 311 is interconnected the seventh pneumatic cylinder 53 and a third valve 31 . the third valve 31 is in turn coupled to one end of the pneumatic conveyor ( or electromagnetic device ) 10 . also , the seventh pneumatic cylinder 53 comprises an extended seventh piston 531 coupled to an eighth hydraulic cylinder 54 . hydraulic fluid is stored in the eighth hydraulic cylinder 54 . an eleventh line 541 is extended from one end of the eighth hydraulic cylinder 54 . a twelfth line 542 is extended from the other end of the eighth hydraulic cylinder 54 . in the invention , the sixth line 116 is coupled to one end of a ninth hydraulic cylinder 55 . a thirteen line 551 is interconnected the other end of the ninth hydraulic cylinder 55 and one end of the fourth upper hydraulic cylinder 18 . the seventh line 117 is interconnected the other end of the fourth upper hydraulic cylinder 18 and one end of of a tenth hydraulic cylinder 56 . a fourteenth line 561 is interconnected the other end of the tenth hydraulic cylinder 56 and one end of the third upper hydraulic cylinder 17 . the ninth and the tenth hydraulic cylinders 55 and 56 are arranged side by side . hydraulic fluid is stored in each of the ninth and the tenth hydraulic cylinders 55 and 56 . the ninth hydraulic cylinder 55 comprises an extended eighth piston 552 coupled to an eleventh pneumatic cylinder 57 and the tenth hydraulic cylinder 56 comprises an extended ninth piston 562 coupled to the eleventh pneumatic cylinder 57 respectively . a fifteenth line 571 is interconnected the eleventh pneumatic cylinder 57 and the other end of the third valve 31 . the eleventh pneumatic cylinder 57 comprises an extended tenth piston 572 coupled to a twelfth hydraulic cylinder 58 . hydraulic fluid is stored in the twelfth hydraulic cylinder 58 . two ends of the twelfth hydraulic cylinder 58 are coupled to the eleventh line 541 and the twelfth line 542 respectively . configured as above , in a case that a car is braking or accelerating the control device is activated to cause the pneumatic conveyor ( or electromagnetic device ) 10 to activate . next , output compressed gas ( in the case of pneumatic conveyor ) flows from the first and the second valves 11 and 21 to the first and the second lower pneumatic cylinders 12 and 15 and the third and the fourth lower pneumatic cylinders 16 and 19 via the first and the fourth lines 111 and 114 and the fifth and eighth lines 115 and 118 respectively . as such , pressure is built up in each of the first , the second , the third , and the fourth lower pneumatic cylinders 12 , 15 , 16 , and 19 . hence , pressure of hydraulic fluid in each of the first , the second , the third , and the fourth upper hydraulic cylinders 13 , 14 , 17 , and 18 is increased by compressed gas in each of the first , the second , the third , and the fourth lower pneumatic cylinders 12 , 15 , 16 , and 19 respectively . the pressurized hydraulic fluid in each of the first , the second , the third , and the fourth upper hydraulic cylinders 13 , 14 , 17 , and 18 flows to the first , the second , the third , and the fourth pistons 121 , 141 , 161 , and 181 via the second , the third , the sixth , and the seventh lines 112 , 113 , 116 , and 117 respectively . as a result , a restraint force among the first , the second , the third , and the fourth pistons 121 , 141 , 161 , and 181 is generated . at the same time , the activated pneumatic conveyor ( or electromagnetic device ) 10 causes output compressed gas ( in the case of pneumatic conveyor ) to flow from the third valve 31 to the seventh and the eleventh pneumatic cylinders 53 and 57 via the tenth and the fifteenth lines 311 and 571 respectively . as such , pressure is built up in each of the seventh and the eleventh pneumatic cylinders 53 and 57 . hence , pressure of hydraulic fluid in each of the eighth and twelfth hydraulic cylinders 54 and 58 is increased by compressed gas in each of the seventh and the eleventh pneumatic cylinders 53 and 57 respectively . the pressurized hydraulic fluid in each of the eighth and twelfth hydraulic cylinders 54 and 58 flows to the seventh and the tenth pistons 531 and 572 via the eleventh and twelfth lines 541 and 542 respectively . as a result , a restraint force between the seventh and the tenth pistons 531 and 572 is generated . as an end , discomfort of driver and passenger ( s ) due to moving forward or backward while a car is braking or accelerating can be greatly improved . referring to fig4 , there is shown a first preferred embodiment according to the invention . a gearbox 61 is interconnected two links 60 . each link 60 is further coupled to either the first or the second piston 121 or 141 . as such , the first and the second upper hydraulic cylinders 13 and 14 can be replaced by the above configuration . similarly , a restraint force between the first and the second pistons 121 and 141 is generated . likewise , in another configuration the gearbox 61 is interconnected both links 60 . each link 60 is further coupled to either the third or the fourth piston 161 or 181 ( not shown ). as such , the third and the fourth upper hydraulic cylinders 17 and 18 can be replaced by the above configuration . similarly , a restraint force between the third and the fourth pistons 161 and 181 is generated . referring to fig5 , there is shown a second preferred embodiment according to the invention . two ends of one u - shaped link 70 are coupled to the first and the second pistons 121 and 141 respectively . two ends of another u - shaped link 70 are coupled to the third and the fourth pistons 161 and 181 respectively . a bar 71 is perpendicularly coupled to each of the u - shaped links 70 . another bar 72 is interconnected the other end of the bar 71 and a pair of aligned pneumatic cylinders 73 and 74 . the third valve 31 is interconnected the pneumatic cylinders 73 and 74 . as such , pressure is built up in each of the pneumatic cylinders 73 and 74 . compressed gas in each of the pneumatic cylinders 73 and 74 will activate another bar 72 . hence , a restraint force between the bars 71 is generated . as an end , discomfort of driver and passenger ( s ) due to moving forward or backward while a car is braking or accelerating can be greatly improved . while the invention has been described by means of specific embodiments , numerous modifications and variations could be made thereto by those skilled in the art without departing from the scope and spirit of the invention set forth in the claims .
| 1 |
referring to fig1 a domino circuit 40 includes a p - channel transistor 42 having its source coupled to an external power supply potential . the drain of the transistor 42 is coupled to the output node 44 . a set of three n - channel input transistors 46 , 48 and 50 form a logic structure 51 . the devices 46 , 48 and 50 are illustrated as being coupled to the drain of the p - channel device 42 . in one embodiment of the present invention , the logic structure 51 is a nand gate formed of n - channel transistors . an additional n - channel transistor 52 has its source coupled to external ground and its gate connected to a clock signal that also drives the gate of the p - channel transistor 42 . the drain of the transistor 52 is coupled to the logic structure 51 , and in the illustrated embodiment , the source of the input transistor 50 . while a logic structure 51 that is a nand gate having three input transistors is illustrated , a variety of other logic structures may be implemented using the principles set forth in the present invention . another logic structure normally implemented with domino circuits is nor gate as an example . when the clock signal ( clock ) is active or low , the output node 44 is charged up and is prevented from being discharged because the transistor 52 is not conducting . this condition generally corresponds to the precharge state of the domino circuit 40 . each input transistor 46 , 48 and 50 has its gate coupled to receive an input signal indicated as i 1 , i 2 or i 3 . each input signal is also coupled to a p - channel transistor 54 , 56 or 58 , each arranged to act as a keeper device . each p - channel transistor 54 , 56 and 58 has its drain coupled to the output node 44 and its source coupled to the external supply voltage . in one embodiment of the present invention , the drains of adjacent pairs of p - channel transistors , such as the transistors 54 and 56 , may share drain diffusions as indicated in dashed ovals in fig1 . also coupled to the output node 44 is an inverter 60 and a p - channel transistor 62 that form a keeper circuit . like the transistors 54 , 56 and 58 , the transistor 62 is also coupled between the external supply voltage and the output node 44 . as an example , where the input transistors 46 , 48 and 50 are eight microns in width , and the transistor 52 is also eight microns in width , the effective width of the combined transistors is two microns . in this case , the transistors 54 to 62 may be relatively smaller devices , each have a width of about one micron for example . however , as can been seen in fig2 due to the use of a plurality of transistors 54 , 56 , 58 and 62 , the node 44 charge sustaining ability may be increased . when all of the input signals i 1 , i 2 and i 3 are high , the transistors 54 , 56 , and 58 are all shut off and thus the transistors 54 , 56 and 58 do not deteriorate the delay . however , when one or more of the input signals i 1 , i 2 or i 3 is inactive or low , the domino circuit 40 does not evaluate and one or more of the p - channel transistors 54 , 56 and 58 is enabled or active . thus , the transistor 54 , 56 or 58 coupled to an inactive input signal tends to sustain the potential on the output node 44 . for example , if i 2 is inactive or low , p - channel transistor 56 may be active . by sustaining the potential on the output node 44 , the soft error rate may be improved . in some embodiments of the present invention , the effective keeper strength ( which is a result of the transistors 54 , 56 , 58 and 62 ) may be increased two to four times compared to the design shown in fig2 . this domino technology may be used effectively in address decoders and particularly in situations where domino circuits are driven directly from latches . thus , in the circuit 10 , the transistors 54 , 56 and 58 act as data driven keepers . that is , they selectively sustain the potential on the node 44 depending on the state of the input signals i 1 , i 2 and i 3 . where the input signal to a given transistor in the logic structure 51 is low , a keeper transistor 54 , 56 or 58 coupled to that transistor &# 39 ; s gate may actively supply charge to the node 44 . while the present invention is illustrated as using n - channel transistors in the logic structure , n - channel transistors may be used in place of p - channel transistors and vice versa . the principles described in connection with a nand gate domino circuit can also be applied to an exclusive or ( xor ) domino circuit as shown in fig2 . in this case , a p - channel transistor 66 is coupled to an output node 74 . a transistor 68 is also coupled to the output node 74 and has the signal b coupled to its gate . anther transistor 70 has an input signal a coupled to its gate . a clock signal is coupled to the gate of the p - channel transistor 66 and an n - channel transistor 72 which is also coupled to ground . a second pair of transistors 88 and 90 have the input signals b and a coupled to their gates . each of the transistors 68 , 70 , 80 and 90 also have their gates coupled to a p - channel transistor 76 , 78 , 80 or 82 as illustrated . the drains of the transistors may share diffusions as indicated in dashed lines . a keeper transistor 84 has its gate coupled to an inverter 86 as described previously . in this case , the transistors 76 , 78 , 80 and 82 act as data driven keepers . that is , they selectively sustain a potential on the node 74 depending on the state of the input signals a , b , { overscore ( b )} and { overscore ( a )}. where the input signal to a given transistor in the logic structure is low , a keeper transistor 76 , 78 , 80 or 82 coupled to that transistors gate may actively supply charge to the node 74 . referring next to fig3 an embodiment of the present invention in connection with a nor domino gate receives the input signals i 1 , i 2 and i 3 on the gates of transistors 96 , 112 and 114 . these gates are also coupled to keeper p - channel transistors 102 , 104 and 106 . in this case , the p - channel transistors 102 , 104 and 106 are connected in series between a supply voltage and an output node 100 . also coupled to an output node 100 , is an inverter 110 and a keeper p - channel transistor 108 . a clock input signal in connected to the gate of a p - channel transistor 94 and an n - channel transistor 98 . again , the p - channel keeper transistors 102 , 104 and 106 maintain the potential on the output node 100 when an input signal to a given transistor 96 , 112 or 114 is low by actively supplying charge to the node 100 . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention .
| 7 |
in the most recent past , the development of c - arm x - ray systems has advanced so far that not only is a three - dimensional reconstruction of high - contrast subjects ( such as , for example , bones of vessels filled with contrast agent ) possible , but also three - dimensional representations of low - contrast subjects ( such as , for example , organs ) can be determined from the projection exposures . this is substantially due to improvements in planar image detectors and the evaluation methods used . c - arm x - ray systems thus can provide structure information of organs . in order to obtain an image dataset for a three - dimensional representation of a measurement subject , a series of projection images of the measurement subject must be acquired from different spatial directions . the acquisition time is short , with typical times of 15 to 20 seconds . this is primarily because the technique of obtaining individual slices obtained with linearly arranged detectors is no longer used , but instead a planar image detector with which a complete projection image can be acquired in one pass of the radiation source and detector is used . the image quality is , in fact , clearly less than that which is achievable with a computer tomography system , but it is more than sufficient in order to provide structural information about organs for which anatomical functional measurements are to be effected . in an apparatus to acquire radiographic projection images , a planar image detector 2 is disposed opposite the emission opening of an x - ray source 3 , such that the x - rays are incident on the x - ray - sensitive surface of the detector 2 . in the exposures , the patient or the examination subject is located between the x - ray source 3 and the planar image detector 2 . the subject is irradiated , and x - ray absorption distributions are acquired as projection images . in order to acquire sufficient data for a three - dimensional reconstruction of the examination subject , the arrangement composed of the planar image detector 2 and the x - ray source 3 rotates around the examination subject . up to 200 projection exposures are acquired in equal or variable angle increments . using a projection matrix describing the image geometry , an image dataset with a three - dimensional representation of the irradiated subject is generated from these projection exposures in a known manner . the apparatus to acquire radiographic projection images therefore is suited to acquire information about the anatomical structures of a patient in the shortest time . there is no need to undertake a corresponding measurement simultaneously with the measurement of functional anatomic processes . typically , corresponding measurements with a spect , pet or mr system take some minutes . in contrast to this , the radiographic exposure to determine the anatomical structures lasts approximately one minute , and thus represents ( when effected separately ) no significant extension of the total measurement time . a reliable measurement of the anatomical structures therefore can be acquired with a radiographic examination just before or after the corresponding functional examination . the figure shows an inventive combination apparatus 1 . it is composed of a pet system 4 having a gantry tunnel 5 , in front of which is mounted a unit composed of a planar image detector 2 and an x - ray source 3 opposite thereto . the unit composed of the planar image detector 2 and the x - ray source 3 rotates around a common rotation axis that substantially coincides with the axis of symmetry of the gantry tunnel 5 . instead of being mounted at the entrance of the gantry tunnel 5 of a pet system 4 , the unit composed of the planar image detector 2 and the x - ray source 3 can be mounted at the entrance of the gantry tunnel of a spect or mr system . for the examination , a patient is positioned on the patient bed 6 . this bed 6 can be moved , monitored with regard to position , parallel to the tunnel axis of the gantry tunnel 5 . the examination region of the patient is brought into the beam path of the radiographic apparatus composed of the planar image detector 2 and the x - ray source 3 either before or after the functional tomography . for the measurement , the radiographic apparatus is rotated around its rotation axis through a defined angle range , during which radiographic projection exposures are acquired at defined angle increments . the measurement volume from which the data are acquired is a cube approximately 30 cm long on each side , so that in practice the entire examination region is acquired with a single radiographic exposure series . a spatial association of both image datasets is achieved by knowledge ( by monitoring ) of the shift path of the patient bed between the radiographic exposure and the functional exposure . this is sufficient since the patient does not have to be transferred and the shifting time is short enough in relation to the total measurement time so as to exclude patient movements . as an alternative to the arrangement shown in the figure , a c - arm x - ray apparatus can be fixedly mounted in front of the gantry of a functional tomography apparatus , meaning a pet , spect or mr system . a fixed spatial relation between the radiographic and the functional measurement region is given by the fixed mounting . the equipment of the functional tomography apparatus with its own mechanism for isocentric rotation of the unit composed of the planar image detector 2 and the x - ray source 3 can be advantageously foregone with this solution , so a significant cost savings can be achieved , particularly given low production numbers . if the connection between the c - arm x - ray apparatus and the functional tomograph is detachable , both apparatuses can be used independently of one another as needed . a number of diagnostic methods thus can be implemented with flexible apparatus use . it is also possible , however , to integrate the radiographic apparatus into a common housing with the functional tomographic apparatus . this solution is particularly preferable for particle emission - tomographic systems and when the combination apparatus is predominantly used to examine organ functions with simultaneous acquisition of the anatomical structures . the integration enables both detector systems , meaning the detector system for the acquisition of the decay products and the planar image detector , to be arranged adjacent to one another . the patient no longer has to be moved a short distance between the two measurements . furthermore , it is also possible to tilt the radiographic apparatus with regard to its rotation axis , such that the connection line between the planar image detector 2 and the x - ray source 3 permeates the measurement region of the emission - tomographic detector . a shifting of the patient between the two measurements thus is unnecessary , and both measurements can possibly ensue within the same time span . the above - described combination , in one apparatus , of an apparatus to acquire tomographic image datasets and an apparatus to acquire radiographic projection images allows multi - modal imaging to associate functional anatomical information with structural anatomical information for diagnosis , therapy planning and therapy support . due to the substantially short measurement times ( with regard to ct combination apparatuses ), the radiation exposure as well as the emotional stress on the patient is substantially reduced . in addition , the above - described system can be substantially more cost - effectively produced than a comparable ct combination apparatus . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art .
| 6 |
fig1 a - b and 2a - b illustrate article 10 , an example of the present invention . in this example article 10 is a two - piece ( bikini ) bathing suit and includes top 14 and bottom 18 . top 14 thus comprises cups 22 and straps 26 for attachment about the neck and torso of a female wearer . straps 26 may be made of pvc or any other material capable of being connected permanently to cups 22 . each of cups 22a and 22b includes two plies of material 30a and 30b formed to be impervious to air ( or other appropriate inflation fluid ). although in presently - preferred embodiments of article 10 plies 30a and 30b are made of pvc , those skilled in the art will recognize that compositions other than pvc may be useable consistent with the present invention . those so skilled will also recognize that in some cases two separate plies may not be necessary ( as , for example , with materials whose internal structures permit entrapment of air ). nonetheless , for article 10 , plies 30a and 30b are shaped substantially identically and their respective edges 34a and 34b are sealed ( by heating , ultrasonic welding , or any other suitable technique ). sealing edges 34a and 34b effectively forms a pocket into which air may be introduced . fig2 a details valves 38a and 38b , one for each of cup 22a and 22b , through which air may be inserted into the cups 22 . because valves 38a and 38b are in the illustrated embodiments designed to be placed in plies 30b closest to the skin of the wearer , they may be covered by displaceable flaps 42 of suitable material . greater stability in structure or shape of top 14 may sometimes be obtained by connecting ( by , for example , spot welding or otherwise ) portions of plies 30a and 30b in the area of the pocket . doing so results in a lattice of connected and unconnected portions of plies 30a and 30b , with any injected air filling the space between the unconnected portions of the plies 30 . bottom 18 is conceptually similar to top 14 . intended to cover the pubic region of a female wearer , bottom 18 shown in fig1 b and 2b includes plies 46a and 46b whose respective edges 50a and 50b are sealed together . bottom 18 additionally may incorporate thong 54 and hook and loop fasteners 58 to facilitate attachment to the wearer . valve 62 may be used to inflate the pocket formed by plies 50a and 50b and may be covered ( when desired ) by flap 66 . like plies 30a and 30b of top 14 , plies 50a and 50b may be connected in some areas of the pocket they form . for stability in use , bottom 18 additionally may include a waistband 70 whose plies inflate as ( horizontally - oriented ) rectangles 74 . those skilled in the art will , however , recognize that other stabilizing methods may be employed consistent with the present invention . thus , although the foregoing is provided for purposes of illustrating , explaining , and describing embodiments of the present invention , further modifications and adaptation to these embodiments will be apparent to those skilled in the art and may be made without departing from the scope of spirit of the invention .
| 0 |
referring now particularly to fig1 of the drawings , the present invention will be seen to relate to a self propelled hay roll transporter truck 10 providing for the pickup of large , generally cylindrical hay rolls in the field , transporting the hay rolls to another location either by public roads or off road , and depositing the hay rolls at the destination , without requiring any other vehicles , equipment , or labor other than the single operator of the transporter 10 . while the present disclosure refers to the transporter 10 being used for the pickup and carriage of hay rolls , it will be understood that it may also be used for the pickup , transport , and delivery of other large , heavy objects , such as hay bales and the like , if desired . the transporter 10 generally comprises a relatively large and flat bed 12 , defined by a plurality of longitudinal members 14 extending from the front end 16 to the rear end 18 of the bed 12 . the longitudinal members 14 may be relatively wide and shallow inverted u - shaped steel channels , or other suitable material as desired . preferably , four such members 14 are spaced apart to form a left side pair and a right side pair , and are supported by a plurality of lateral crossmembers 20 extending from the left side 22 to the right side 24 of the bed , which crossmembers 20 may also be formed of steel channel components , or other materials as desired . the bed 12 of the prototype transporter 10 is on the order of thirty five feet in length by nine feet in width ; however , other dimensions may be used as desired . it may be desirable to restrict the maximum width so as not to exceed the nine foot width of the prototype to a great extent , however , in order to allow for travel on public roads without special permit . each of the longitudinal members 14 has a section removed along the majority of its length , with the removed sections of each member 14 comprising a pair , facing one another so that the members 14 of each pair are in mirror image . another channel component is inserted in the cutaway section of each channel 14 , and placed on its side to form two mutually facing channels or tracks 26 in each pair of longitudinal members 14 . these bed tracks 26 are on the order of twenty seven feet on the prototype , and thus extend substantially the length of the bed 12 ; their lengths may be modified as desired . the two pairs of bed tracks 26 provide for the retention of the wheels of a left and a right bed rack 28 , which bed racks 28 move longitudinally along the bed 12 . fig5 and 6 provide detailed views of one of the bed racks 28 . a base 30 is provided , with wheels 32 disposed along the sides or edges thereof and engaging the facing channel members comprising each pair of tracks 26 for each bed rack 28 . each bed rack 28 is propelled along its respective pair of facing track channels 26 by a pair of cables , roller chains , or other suitable elements 34 , each pair of which is preferably actuated by a conventional hydraulic motor 36 ( shown schematically in fig9 in order to provide clarity in the other drawing figures ). each bed rack 28 also includes a pair of forks 38 , which are pivoted about a lateral axis 40 by a hydraulic cylinder 42 which drives an adjustable linkage 44 . ( the hydraulic system which actuates the cylinders 42 , as well as the bed rack motors 36 ; is shown schematically in fig9 and is discussed further below .) these bed racks 28 are thus able to pick up an object by means of the pivoting forks 38 and hold the object therein , and transfer the object essentially from one end of the bed 12 to the other , as required . the present invention preferably includes two such bed racks 28 , disposed side by side in parallel pairs of bed rack tracks 26 in the transporter bed 12 . such provision of two bed racks capable of working parallel to one another , allows two rows of material ( hay rolls , etc . . .) to be placed side by side on the transporter bed 12 , thus essentially doubling the load which the present transporter 10 may carry . however , smaller ( particularly narrower ) versions of the present transporter 10 may include only a single bed rack thereon , if desired , although such would limit the capacity of such a vehicle . hay rolls or the like are lifted onto the bed racks 28 by means of a single front ramp 46 and front ramp rack 48 , shown in fig1 through 3 . the ramp 46 comprises two mutually facing channel sections 50 , which serve as tracks for the front rack 48 . the front rack 48 is substantially similar to the bed rack ( s ) 28 discussed above , and includes a base 52 which travels longitudinally between the two tracks 50 on wheels 54 contained within the two channels comprising the tracks 50 . a pair of cables or chains 56 drive the front rack base 52 along the tracks or channels 50 , and are in turn powered by a front rack or ramp lift movement hydraulic motor 58 ( shown schematically in fig9 ). a pair of front ramp forks 60 are pivotally actuated about a lateral axis 62 , by one or more front ramp fork lift pivot hydraulic cylinders 64 , which are connected to a linkage similar to the linkage 44 of the bed racks 28 discussed above . the two front ramp track channels 50 include cross bracing 66 therebetween ( shown in fig2 and 3 , but deleted from the other figures for clarity ) for rigidity , as they are not rigidly affixed to the truck bed members 14 , as are the bed tracks 26 for the bed racks 28 . in addition to the pivoting and traveling actuation of the front forks provided respectively by the hydraulic cylinder 64 and front ramp rack movement motor 58 ( similar to the actions provided by the bed rack fork pivot cylinders 42 and travel motor 36 discussed above ), the he front ramp assembly 46 may also be arcuately lifted about its bed attachment end 68 at the front end 16 of the transporter , and may also be laterally translated across the front end 16 of the transporter , from the left side 22 to the right side 24 of the bed 12 . the arcuate lifting action is provided by a pair of front ramp lifting cylinders 70 , which serve to arcuately lift and lower the distal forward end of the front ramp 46 as desired . the lateral movement of the forward ramp 46 across the front end 16 of the truck 10 , serves to align the forward ramp 46 and the front rack 48 thereon with one of the two bed racks 28 , as desired . a transverse front rack pivot bar 72 extends from the left side 22 to the right side 24 of the transporter 10 , immediately in front of the forward edge 16 of the bed 12 , with a lower lateral track 74 serving to secure the bottom edge of a front ramp plate 76 to which the front ramp assembly 46 is secured . a set of wheels 78 disposed in both horizontal and vertical planes , is provided along the lower back portion of the from ramp plate 76 and between the plate 76 and the fixed front end of the truck 10 , to accommodate vertical and rearward compressive loads as the ramp 46 is lifted . further accommodation of loads is provided by a supplemental upper transverse bar 80 and a collar 82 which slides along the two bars 72 and 80 and serves to transfer loads from the primary bar 72 to the secondary bar 80 . the lateral translation of the front ramp 46 is provided by a hydraulic motor 84 ( fig9 ) and chain assembly , similar to that described above for the bed racks 28 . obviously , any objects to be loaded from the front ramp 46 to the truck bed 12 will be blocked by the cab 86 , if the front ramp 46 is positioned directly in front of the cab 86 . if the cab 86 were fixed in position , then only one side of the bed 12 would be usable , or a much more complex arrangement would have to be provided to transfer hay rolls or the like - laterally from one side of the bed 12 to the other , around such a fixed cab . the present invention overcomes this problem by providing for the lateral translation of the entire cab 86 and controls located therein , across the front end of the bed 12 , as shown in fig1 , and 4 . the cab 86 is laterally translated across the front of the truck 10 by means of a conventional hydraulic motor 88 ( shown schematically in fig9 ) and chain 90 ( or cable or the like ), similar to the other motors 36 , 58 , and 84 discussed further above for translational movement of the bed racks 28 , front rack 48 , and front ramp assembly 46 . the cab 86 is supported by a pair of lateral i section members 92 , which in turn have their bottom flanges captured within a pair of upwardly facing cab guide channels 94 , serving to secure the cab 86 against fore or aft movement relative to the bed 12 . the channels 94 are supported by a pair of cab support crossmembers 96 . ( guide wheels or bearings , not shown , may be provided between the cab support i section members 92 , the guide channels 94 , and the cab support crossmembers 96 to reduce frictional forces during lateral translation of the cab 86 .) the two innermost longitudinal bed members 14 have lateral slots 98 thereacross , providing for passage of the i section cab supports 86 therethrough when the cab 86 is laterally translated from one side of the bed 12 to the other . the various transporter controls within the cab 86 may be connected to their respective systems by various flexible means , such as those disclosed in fig8 . clutch operation ( assuming the present transporter is equipped with a manual , rather than an automatic , transmission ) may be provided by a clutch pedal 100 and clutch master cylinder 102 actuating a hydraulic clutch cylinder 104 . the brake pedal 106 may conventionally actuate a brake master cylinder 108 for the hydraulic brakes 110 in a like manner , via flexible hydraulic lines 112 . the throttle or gas pedal 114 may actuate the carburetor ( or fuel injection system ) 116 , and the shift lever 118 may control the transmission 120 , by means of flexible cables 122 . while other control means are possible ( e . g ., electronic , etc ), the above hydraulic and mechanical cable systems are well proven in other applications and are relatively economical , durable , and easy to maintain . in a like manner , the various hydraulic controls 124 discussed above for operation and movement of the bed racks 28 , front ramp assembly and rack 46 and 48 , and cab 86 may be connected by means of flexible hydraulic lines 126 , shown schematically in fig9 . thus , movement of the cab 86 may be easily accomplished without disruption of any control functions . electrical wiring for lighting , etc . may also be flexibly connected to switches in the cab 86 , as desired . the steering system for the laterally translatable cab 86 is shown in fig2 with the steering box 128 being connected to the steering column 130 by plural u - joints 132 and conventional splined couplings or the like , to allow for the angular and length deflection of the steering column 130 as the cab 86 moves from one side to the other of the transporter 10 . other means ( hydraulic , etc .) may be used , as desired . the present transporter 10 is powered by a conventional internal combustion vehicle engine 134 ( gasoline or diesel ), as shown in the side elevation view of fig7 . the engine 134 provides power to drive the transporter 10 by means of the transmission 120 , and further provides power for all of the hydraulically powered devices described above by means of a hydraulic pump 136 ( also shown schematically in fig9 ). various other conventional hydraulic accessories ( reservoir , accumulator , pressure relief valves , etc .) may also be included in the above system as required for operation . preferably , the present transporter 10 is equipped for operation on public roads , and includes such equipment as an audible warning or signalling device ( horn ) 138 , lights 140 , windshield and other glass 142 for the cab 86 enclosure and door ( s ) 144 , and windshield wiper ( s ) 146 . other equipment and instruments ( not shown ) may be provided as needed . the present transporter 10 as described above , will be seen to provide for the picking up and loading of large hay rolls r in the field , the transport of such hay rolls r either off road or on public roads as required to a destination , and further for the off loading and stacking of such hay rolls r or the like onto another vehicle or for storage at the destination , all by a single operator . the operator of the transporter 10 need only drive the transporter 10 through the hay field and align one side of the truck 10 with the hay roll ( s ) r to be picked up . the front ramp 46 is positioned to the appropriate side of the transporter to align it with the hay roll r as needed , and the cab 86 is positioned to the side opposite the front ramp 46 . ( it may assist the operator in alignment , to have the cab 86 to the same side as the front ramp 46 , until the ramp 46 is aligned ) before moving the cab 86 .) when the front ramp 46 properly aligned , it is lowered and the front forks 60 pivoted or tilted forwardly , with the front tines parallel to the surface , and the front rack 48 moved forward to the distal end of the ramp . the truck 10 is then driven slowly forward to push the front fork tines under the hay roll r until the roll r is completely on the front forks 60 ; this is shown at the right end of the side elevation view of fig7 . the appropriate bed rack 28 is then positioned at its forwardmost limit of travel , adjacent the front end 16 of the truck bed 12 , with the forks 38 pivoted forward so the forwardmost forks are substantially parallel to the longitudinal bed members 14 . ( it will be noticed that the forks are displaced from their lateral pivot axis 40 , to position the tines below the upper surface of the bed members 14 , in order to fit beneath a hay roll r or the like loaded onto the bed 12 .) at this point , the operator pivots or tilts the front forks 60 rearwardly , as in the configuration shown for the forks 38 shown in broken lines of the bed rack 28 of fig6 . in such a position , the hay roll r is securely retained within the right angle defined by the forks 60 , add cannot shift as it is placed upon the truck 10 . the operator then uses the appropriate controls to move the front rack 48 upwardly and rearwardly along the front ramps or tracks 50 , to its rearmost travel position adjacent the front end 16 of the truck bed 12 . the front ramp assembly 46 is then raised upwardly , to tilt the assembly 46 back toward the truck bed 12 . the front forks 60 are then pivoted to their most rearward position , whereupon the narrower spacing of the rearmost tines ( those which were upwardly disposed when the roll r was first picked up ) allows them to fit between the forwardly disposed tines of the bed rack 28 . at this point , the forks 38 of the appropriate bed rack 28 are pivoted or tilted rearwardly , to lift and transfer the hay roll r from the front forks 60 of the front rack 48 and to cradle the hay roll r therein . the bed rack 28 is then moved rearwardly by means of the appropriate hydraulic controls , with an intermediate position showing a hay roll r being cradled within the bed rack 28 being shown in fig7 . the bed rack 28 is moved to the most rearward position available ( depending upon the number of hay rolls r previously loaded , as indicated on the rear portion of the truck 10 shown in fig7 ), and the forks 38 are tilted rearwardly to nest between the longitudinal bed members 14 . the hay roll r will then be supported by the bed members 14 to each side of the bed rack 28 , for transport . essentially , the above process is repeated until the transporter 10 is fully loaded , or until no further hay rolls r remain for pickup . in order to keep the load balanced laterally , the front ramp 46 may be shifted laterally across the front of the truck 10 after one or two hay rolls r are loaded , with the cab 86 being shifted to the opposite side . ( e . g ., the front ramp 46 may be shifted from the right side 24 to the left side 22 , with the cab 86 being shifted from the left side 22 to the right side 24 . the left side bed rack 28 is then used to move and position the hay roll r on the truck bed 12 .) once the truck 10 is fully loaded , the hay rolls r thereon cannot roll forward due to the location of the cab 86 to the front of the bed on one side , and due to the opposite side bed rack 28 being positioned to hold the last loaded hay roll r thereon . the hay rolls r cannot fall from the rear end 18 of the transporter 10 , due to a rear retaining bar 148 provided thereon . once the truck or transporter 10 is loaded as desired , it may be driven to the appropriate off loading location or destination by the same single operator who loaded the transporter 10 , either off road or on public roads , as appropriate . off loading of the transporter 10 is just as easily accomplished as the loading operation described above , by essentially reversing the operation . however , it will be noted that the capability of elevating the front ramp 46 for ground clearance while en route , and for assisting in loading operations , provides an additional benefit : two vertical rows of hay rolls r may be stacked , by positioning a first row on the surface and then raising the forward or distal end of the front ramp 46 to off load further hay rolls r on top of the first row on the surface . thus , the present transporter 10 not only provides for the pickup , transport , and off loading of such hay rolls r , but also for their compact storage by means of the ability to stack the rolls r one row atop another . although the present disclosure is directed to the handling of relatively large hay rolls r , that the present transporter 10 may be used for the pickup , carriage , and delivery of a multitude of other agricultural and non - agricultural articles . conventional hay bales , large , heavy , and / or bulky machinery or equipment , etc . . . may also be carried using the present transporter 10 , particularly for relatively short distances off road on farm property or the like . the present transporter 10 will be seen to be a highly versatile and labor saving device , which further reduces or eliminates the need for several other pieces of equipment to accomplish the task . it is to be understood that the present invention is not limited to the sole embodiment described above , but encompasses any and all embodiments within the scope of the following claims .
| 0 |
detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely illustrative of the invention that may be embodied in various forms . in addition , each of the examples given in connection with the various embodiments of the invention are intended to be illustrative , and not restrictive . further , the figures are not necessarily to scale , some features may be exaggerated to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . referring now to fig1 ( as well as fig2 a and 2b , showing exploded perspective views of the bone plate apparatus of fig1 ), one embodiment of a bone plate apparatus according to the present invention is shown . as seen in these figs ., bone plate 101 may be attached to bone using bone screws 103 a , 103 b and 103 c . in one example ( which example is intended to be illustrative and not restrictive ), bone plate 101 may have a length between 20 mm and 30 mm ( e . g ., bone plate 101 may be provided in a number of distinct lengths ). in another example ( which example is intended to be illustrative and not restrictive ), each of bone screws 103 a , 103 b and 103 c may be a self - tapping bone screw . in another example ( which example is intended to be illustrative and not restrictive ), each of bone screws 103 a , 103 b and 103 c may have a diameter selected from the group including ( but not limited to ) 1 . 5 mm , 2 . 0 mm and 2 . 7 mm . in another example ( which example is intended to be illustrative and not restrictive ), each of bone screws 103 a , 103 b and 103 c may have a length from 4 mm to 8 mm , in 0 . 1 mm increments . further , locking plate 105 ( which may itself be held in place by fastener 107 ( e . g ., a machine screw )) may be used to help prevent screw back - out ( fig2 a and 2b show use of locking plate 105 and fastener 107 most clearly ). further still , slot 109 ( which may have distinct holding positions or detents ( as shown in these figs . ), and / or which may not have such detents in order to allow essentially free positioning anywhere within the slot ) may be provided to aid in adjustment to an individual patient &# 39 ; s anatomy . further still , one or more protrusions ( or “ teeth ”) may be provided to aid in maintaining position during and / or after implantation ( a number of such teeth are shown but not separately numbered in these figs .). further still , the bottom profile may be streamlined as shown in these figs . ( e . g ., in order to reduce the penetration inside the spine ). referring now to fig3 a , 3b and 3 c , a plan view , a side elevational view and a front view of the bone plate apparatus of fig1 are shown . of note , the dimensions identified in these figs . are , of course , illustrative and not restrictive . referring now to fig4 a , 4b and 4 c , a plan view , a side elevational view and a front view of a bone plate apparatus according to an embodiment of the present invention are shown . of note , these figs . depict the bone plate apparatus without showing the bone screws . of further note , the dimensions identified in these figs . are , of course , illustrative and not restrictive . referring now to fig5 a , 5b and 5 c , a plan view , a side elevational view and a front view of a bone plate apparatus according to an embodiment of the present invention are shown . of note , these figs . depict the bone plate apparatus without showing the bone screws . of further note , the dimensions identified in these figs . are , of course , illustrative and not restrictive . referring now to one example use of a bone plate apparatus according to the present invention ( which example is intended to be illustrative and not restrictive ), it is noted that under this example an “ open door laminoplasty ” ( wherein the vertebrae are made to swing open like a door ) may be simplified and / or stability may be maintained ( such simplification / stability may be obtained by replacing and / or supplementing certain steps and / or components of a conventional laminoplasty with steps and / or components of the present invention ( e . g ., with an embodiment of the bone plate apparatus described herein ). such an open door laminoplasty is typically performed on a restricted spinal canal in the neck ( e . g ., a painfully restricted spinal canal ), wherein the laminoplasty relieves pressure ( e . g ., immediately ) by creating additional space for the spinal cord and roots . the surgeon makes an incision on the back of the patient &# 39 ; s neck . the surgeon creates a “ hinge ” by cutting a groove down one side of the cervical vertebrae . the surgeon cuts all the way through the other side of the vertebrae . in order to create room for the bones to open like a door , the surgeon removes the tips of the spinal process . in order to take pressure off the spinal cord and roots , the surgeon bends open the back of each vertebrae ( like a door on its hinge ). the surgeon places , in the opened space of the door , appropriately sized wedges made of bone . the surgeon allows the door to swing shut . since the wedges stop the door from closing all of the way , the spinal cord and roots receive additional space . referring now to fig6 , it is seen that insertion tool 601 may be used to aid insertion into a patient ( e . g ., to make placement quick and easy ), and that insertion tool 601 may include handle 603 , shaft 605 and mounting mechanism 607 ( which may be used to hold a bone plate and / or to aid in turning the various screws associated with the bone plate ). referring now to fig7 , a cut - away view of a bone plate apparatus according to an embodiment of the present invention is shown . of note , this fig . clearly shows detents 703 a , 703 b and 703 as well as machine screw retaining thread 705 . referring now to fig8 , another perspective view of two bone plate apparatus according to embodiments of the present invention are shown . in another embodiment , some or all of the components may include or be made essentially entirely from a commercially pure material ( e . g ., titanium and / or alloy titanium ). in another embodiment , indications relating to use of the present invention may include ( but not be limited to ): for use as laminoplasty plate for cervical spine ( from c2 - c7 ) for use as orthognathic plate for fixation ( e . g ., permanent fixation ) of bone segment ( s ) after a sagittal split osteotomy . while a number of embodiments of the present invention have been described , it is understood that these embodiments are illustrative only , and not restrictive , and that many modifications may become apparent to those of ordinary skill in the art . for example , while the present invention has been described principally with respect to three bone screws , any desired number may , of course , be utilized . further , the teeth , grooves and / or ridges may be placed at any desired position ( s ) on the bone plate apparatus . further still , one or more slots may be utilized for one or more bone screws . further still , any desired number of detents may be utilized . further still , the angle between the portion of the bone plate shown principally with one bone screw and the portion of the bone plate shown principally with two bone screws may be any desired angle . further still , any desired mechanism ( s ) for locking one or more bone screws relative to the bone plate may be utilized ( instead of or in addition to the locking plate described above ). further still , the bone plate apparatus may , of course , have any desired dimensions ( e . g ., for any desired patient — man , woman or child ). further still , the bone plate apparatus of the present invention may be provided in a “ line ” or “ family ” of devices ( e . g ., small , medium and large ; adult , child ; male , female ). further still , the bone plate apparatus of the present invention may be provided in standard sizes . further still , one or more components may be constructed of ti , cobalt chromium , surgical steel and / or any combination thereof . further still , a “ hole ” may be of any desired shape ( e . g ., circular , square , oval , rectangular , etc .). further still , any steps relating to manufacture and / or use may be performed in any desired order .
| 0 |
reference is made to fig1 , illustrating an example of an optical system 100 configured according to the invention for a semiconductor laser based light source . system 100 includes a cooling chamber 110 containing a light source 150 formed by at least one semiconductor laser , generally at ls i , three lasers ls 1 , ls 2 , and ls 3 being seen in the figure ; an optical window 170 , and an optical unit 130 . the cooling chamber can be configured as a vacuum or low - pressure chamber . light source 150 is associated with a cooler assembly 105 operable to maintain a desired temperature of the lasers . cooler assembly 105 is , for example , configured as a mechanical system that approximates the ideal gas cycle and is fed by electricity . preferably , the use of a cryogenic cooler assembly is considered . preferably , this cooler is capable of providing to the light source a cooling capacity of a hundred of milliwatts to several watts or higher . also , preferably , this cooling capacity can be provided at a temperature as low as 240k , more preferably at a temperature as low as 170k , and even more preferably at a temperature as low as 140k or lower . the temperature of 170k defines the limit of cryogenic temperatures for the purposes of this patent application . preferably , the cooler assembly is of a one of three types : stirling , joule thompson , or pulse tube . for example , the cooler may be one of ricor &# 39 ; s cryogenic coolers ( www . ricor . com ). other general types of cryogenic coolers suitable for use with the present invention include active transport , reverse brayton , active refrigerator , vuilleumier , and those capable of providing an appropriate cooling capacity at cryogenic temperatures needed for operation of semiconductor lasers . optical unit 130 is located inside chamber 110 so as to be in the optical path of light beams b 1 , b 2 and b 3 emitted by lasers ls 1 , ls 2 and ls 3 , respectively . optical unit 130 is configured as collimating optics to collimate these beams and direct them out of the cooling chamber through appropriately provided optical window 170 . resulting output beams , b ′ 1 , b ′ 2 , and b ′ 3 , emerging from the cooling chamber 110 , are substantially parallel to each other . optical system 100 is thus configured and operable operation with cooled multiple semiconductor lasers and for affecting the propagation of multiple laser beams inside the cooling chamber , so as to provide a desired laser beams propagation scheme when emerging from the cooling chamber . it should be noted , although not specifically shown , that system 100 may include an optical fiber unit optically coupled to the light output of cooling chamber 110 . such a fiber unit may include one or more multimode fibers for collecting two or more of the laser beams . with reference to fig2 , there is shown a more specific example of optical system 100 configured according to the invention for a semiconductor laser based light source . to facilitate understanding , the same reference numbers are used for the same features in different examples of the invention . chamber 110 includes a thereto insulated housing ( e . g . dewar ) 120 formed with an optical window 170 . such a window may be constituted by an aperture made in the respective facet of the housing , or a region of the facet optically transparent with respect to the operative wavelength range of the lasers , or an optical element mounted in an opening made on the facet of the housing . window 170 is also configured to provide a sealing required for the proper dewar performance . mounted inside housing 120 is a cold - finger 60 connected to a cryogenic cooler ( not shown ), and a support assembly ( mount ) 140 configured according to the invention to be attachable to the cold - finger . the support assembly is configured for carrying lasers ls 1 , ls 2 , ls 3 of the laser based light source , and in the present example , is also configured for carrying optical elements ( lenses ) l i of the optical unit — three such elements l 1 , l 2 , l 3 being shown in the figure . in system 100 , heat generated by the light source is withdrawn first to support assembly 140 , then to cold - finger 60 , and finally to the cryogenic cooler . preferably , the invention is used with , semiconductor lasers emitting radiation in mid or far infrared wavelength range , but generally any other operative wavelength range can be used . preferably , these semiconductor lasers are quantum cascade lasers , inp based with alinas / gainas active layers . lasers radiation spectra may overlap . a number of these emitters may be monolithically integrated in a laser bar . cooling chamber 110 preferably also contains a cold shield assembly 180 configured for absorbing thermal radiation emitted by the light source and the support assembly . cold shield assembly 180 is thermally coupled to cold finger 60 whereto heat generated by the dissipating thermal radiation is transferred . as shown in the figure , cold shield assembly 180 is configured to define a window permitting the passage of the laser beams therethrough , and to surround support assembly 140 . further provided in system 100 is a filter assembly 165 accommodated inside cooling chamber 110 so as to be in the optical path of laser beams b i emerging from lenses l i . filter assembly 165 is configured as a wavelength - selective filter for rejecting external infrared radiation which dissipates into heat in the internal parts of the cooling chamber . such a filter may be configured as a stack of dielectric materials with different thicknesses and / or indices of refraction . as light passes through this stack , wavelengths , that are to be rejected , experience subtractive interference . this arrangement functions as a narrow band pass filter which transmits only a narrow band of wavelengths at and around the wavelength of the laser itself , while reflecting all other wavelengths . laser beams b i , emitted by the lasers ls i of the light source , propagate through lenses l i associated with the lasers . lenses l i , constituting optical elements of the optical unit , are aligned with the lasers and in the present example are mounted on support assembly 140 . generally , optical elements may deflect , collimate , or focus the light beams , or increase or decrease the beams divergence . it should be noted that by an effect of beams collimation , either an effect of deflection of beams to make them parallel or an effect of increasing of the beams divergence is considered . considering laser radiation of mid or far infrared wavelength range ( e . g . 3 to 5 microns ), lenses l i , which are to be transparent to this radiation , may be made for example from germanium , znse , zns , cleartran ® ( water clear zinc sulfide ), caf 2 , baf 2 , silicon , sapphire , fused silica or quartz . the lenses may be realized using refractive , reflective or diffractive optics , or a combination of them . laser beams b ′ i ( collimated beams ) emerge from housing 120 through window 170 . generally , the window may be configured as a wavelength selective filter thus eliminating a need for filter 165 , but preferably and especially considering the filter implemented as a stack of dielectric materials , such a filter structure is a separate element 165 while window 170 provides the filtered beams &# 39 ; passage therethrough and serves for a low quality sealing of the cooling chamber . the fixation of optical unit 130 on the same support assembly 140 with laser light source 150 allows for providing an adequate alignment between the so optical elements of the optical unit and the emitting lasers of the laser light source . as a result , beams b ′ i emerging from the chamber are parallel and collimated . despite that lenses l i are placed inside the chamber , the resulting cooling system efficiency is high , because the cooling system requires less space . indeed , the divergence of laser light propagating from the laser source to window 170 is reduced . hence , the size of the window may be decreased . it is important to prevent the filter and the window of the cooling chamber from reflecting laser light back to the laser , because such back - reflections may negatively affect the laser operation . undesired reflections may be prevented by covering the filter and / or the window with an antireflective coating , usually able to increase the light propagation throughput beyond 99 %, or may be prevented by orienting the filter and / or the window in non - right angles to the laser light . also , covering the lenses and other transmitting optical elements with antireflective coating will allow to avoid heating their surfaces and to maximize the light throughput . the energy required for cooling the chamber increases with the size of the cooled devices inside the chamber , owing to the effect of the blackbody radiation . in the described configuration , the lenses may be small ( of the order of 1 - 10 mm ), either because a narrow waist is acceptable , or because a beam expander is placed out of the chamber . the total diameter of the chamber may be of the order of 1 - 2 cm ( i . e . small ). with reference to fig3 , there is shown a front view of cooling chamber 110 . support assembly 140 is configured to define an array of compartments three such compartments 145 a , 145 b , 145 c in the present example , and lenses l i are mounted at the output facets of these compartments to be in the optical path of light beams emitted by the lasers ( which are not shown here ). lenses l i are located in a common plane ( the lasers behind the lenses are also located in their associated common plane ) and are arranged in a two dimensional array — three lenses in each of three rows in the present example . a part of window 170 , allowing output light passage and possibly providing a sealing to the chamber , is also shown here . other embodiments may utilize lenses ( as well as lasers ) configured in a one - dimensional array or another two - dimensional array ( e . g ., circular array ), or in a three - dimensional array when the support assembly allows for a non - planar configuration . the lasers may be arranged as bars of monolithic emitters . it should be noted that the lasers , support assembly and optics may be configured to direct different laser beams along parallel or non - parallel axes . the lenses may focus laser beams in one or two dimensions , i . e . in a point or in a line . any focal point may be common for two or more laser beams . reference is made to fig4 a and 4b , exemplifying the configuration of a laser module 200 of the present invention mountable inside a cooling chamber which has an optical window for allowing passage of electromagnetic radiation of a predetermined wavelength range . fig4 a and 4b show the side and front views , respectively of laser module 200 . laser module 200 includes a support assembly 140 having three spaced - apart compartments 145 a - 145 c , each containing three semiconductor lasers and three lenses . fig4 b shows all nine lasers ls 1 - ls 9 contained in the compartments and their associated lenses l 1 - l 9 mounted at the output facets of the compartments . lenses l 1 - l 9 collimate , focus or diverge laser beams , thus providing for a desired light propagation scheme . such laser modules are useful for the design and integration of optical systems requiring cooling of the light source . they may be installed in different cooling chambers . a laser module approach is more flexible from the design and testability point of view than a conventional technique incorporating the lasers in a cooling chamber in the first step and coupling it to an external dedicated optics in the second step . a cooling system integrated using the conventional technique needs to be redesigned for any change of the system definition and can be tested only at the last stage of integration . reference is made to fig5 a exemplifying a cooling system 300 of the present invention utilizing a beam expander unit 230 accommodated outside the cooling chamber and operating for expanding the cross - sectional dimension ( diameter ) of an output laser beam beyond the dimension of a cooling chamber . in this example , beam expander unit 230 is a single magnification unit for all the laser beams emerging from the cooling chamber . magnification unit 230 includes two lenses 220 a and 220 b , and a magnification unit support assembly 210 holding the lenses aligned with each other . the magnification unit is aligned with the light source located inside the cooling chamber ; the magnification unit is held in a correct position and orientation in respect to the cooling chamber by the same magnification unit support assembly 210 or by another support assembly as the case may be . lenses 220 a and 220 b are cofocused and positive . lens 220 a is smaller and has a smaller focus than lens 220 b . thus , the widths of beams b ′ i , emerging from the cooling chamber , are increased when they pass through magnification unit 230 , resulting in wider output beams b ″ i . the design of magnification unit 230 is very simple . however , magnification unit 230 does not utilize the area of lenses 220 a and 220 b in the best manner , because it images benches 195 a and 195 b associated with the compartments of assembly 140 . fig5 b shows another example of a cooling system 400 utilizing a beam expander unit 430 . in this embodiment , the beam expander includes lenses and reflectors . beam expander 430 is configured to deflect each of beam b ′ 1 and b ′ 2 away from each other to produce output parallel beams b ″ 1 and b ″ 2 . this is implemented by sequentially reflecting beam b ′ 1 by a pair of parallel reflectors ( mirrors ) 420 a and 420 b . similarly , beam b ′ 3 is sequentially reflected by another two mirrors . beam expander 430 defines two magnification units 430 a and 430 b each including two lenses similar to those in the above - described example of fig5 a . the widths of beams b ′ 1 and b ′ 2 are magnified when they pass through these magnification units 430 a and 430 b as shown in the figure in a self - explanatory manner . the mirrors and / or lenses of the beam expander may be allowed to move , hence a compensation for various alignment and mounting inaccuracies may be provided . other beam expander modifications may be used as well , for example a one utilizing three reflectors with their planes being oriented at 90 degrees with respect to each other . this beam expander modification is useful in case when ( yet narrow ) beams exit the chamber perpendicularly to each other ( depending on the support assembly configuration , beams can exit the chamber at different angles of propagation ). three reflectors ( e . g . mirrors and / or prisms ) of such a beam expander located outside the chamber may be oriented to change the beams &# 39 ; directions to produce output ( possibly wide ) beams propagating in the same direction . also , in this modification an original direction of a laser beam ( the direction of propagation of a laser beam emerging from the cooler chamber ) may be maintained with higher mechanical tolerances to possible misalignments between the cooling chamber and the beam expander unit . to this end , placing the reflectors on a two - rotating axis can be utilized , and misalignments between the laser and the lens within the chamber can be corrected using a close loop correction mechanism tapping the laser light into a collimator . more generally , flexibility of the beam expander designs provides an option to manage the laser beam directions with which they exit the entire system ; various configurations of the output beams propagation schemes while exiting the chamber can be dealt with and various inaccuracies in these directions can be compensated for . reference is made to fig6 a and 6b , showing an example of a beam expander 500 which is generally similar to that shown in fig5 a , namely formed by two lenses 520 a and 520 b , but distinguishing therefrom in that beam expander 500 has movable parts . in this embodiment , the beams &# 39 ; divergence at the output of beam expander 500 may be dynamically adjusted by a moving lens 520 e . as shown in fig6 a , when focal points 530 a and 530 b of lenses 520 a and , 520 b coincide , passage of a collimated beam b ′ i ( as emerging from the cooler chamber ) through the beam expander results in the remained collimation of an output beam b ″ 1 . as shown in fig6 b , when lens 520 b and accordingly its focus 530 e is shifted towards lens 520 a , beam b ″ i is diverged . fig7 a - 7c show the top , side , and front views of a support assembly 740 suitable to be used in the invention ( not to scale ). support assembly 740 carries a laser ls i ( formed by active layers 750 a and 750 b ) and a lens l i ( shown in fig7 a and 7b ). the support assembly contains a cylindrical portion 740 a , a wide elongated lens - holding portion 740 b , and a laser - holding portion 740 c . laser ls i is connected to thin film electrodes 790 a and 790 b , lying on electrode carriers 795 a and 795 b used to isolate the electrodes from the support assembly , by six electrical connections , generally at 785 . in a cooling system , the support assembly is configured to carry out several functions . in particular , it serves as a mechanical support for lenses and lasers , provides the lasers with an electrical feed and serves them as a heat sink . it is also desirable that the support assembly has a small effective thermal expansion coefficient , minimizing a misalignment entailed by heating . the following are some not limiting examples for the materials from which the support assembly may be made : ceramic materials based on beo , ain , alsic , bn , sic , sin , silicon oxide . thus , the present invention provides a cooling system for use with a semiconductor laser based light source to improve the performance of the light source . in the cooling system of the present invention , a cooling chamber contains a cooler assembly , multiple semiconductor lasers , and an optical unit . as a result , the system provides for cooling the multiple semiconductor lasers and for affecting the propagation of the multiple laser beams while inside the cooling chamber . the optics inside the cooling chamber or together with optics located outside the chamber provide a desired propagation scheme of the output light . those skilled in the art will readily appreciate that various modifications and changes can be applied to the embodiments of the invention as herein described without departing from its scope defined in and by the appended claims .
| 7 |
at the outset , it should be appreciated that like drawing numbers on different drawing views identify identical , or functionally similar , structural elements of the invention . while the present invention is described with respect to what is presently considered to be the preferred embodiments , it is to be understood that the invention as claimed is not limited to the disclosed embodiments . furthermore , it is understood that this invention is not limited to the particular methodology , materials and modifications described and as such may , of course , vary . it is also understood that the terminology used herein is for the purpose of describing particular embodiments only , and is not intended to limit the scope of the present invention , which is limited only by the appended claims . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs . although any methods , devices or materials similar or equivalent to those described herein can be used in the practice or testing of the invention , the preferred methods , devices , and materials are now described . fig1 a is a perspective view of cylindrical coordinate system 80 demonstrating spatial terminology used in the present application . the present invention is at least partially described within the context of a cylindrical coordinate system . system 80 has a longitudinal axis 81 , used as the reference for the directional and spatial terms that follow . the adjectives “ axial ,” “ radial ,” and “ circumferential ” are with respect to an orientation parallel to axis 81 , radius 82 ( which is orthogonal to axis 81 ), and circumference 83 , respectively . the adjectives “ axial ,” “ radial ” and “ circumferential ” also are regarding orientation parallel to respective planes . to clarify the disposition of the various planes , objects 84 , 85 , and 86 are used . surface 87 of object 84 forms an axial plane . that is , axis 81 forms a line along the surface . surface 88 of object 85 forms a radial plane . that is , radius 82 forms a line along the surface . surface 89 of object 86 forms a circumferential plane . that is , circumference 83 forms a line along the surface . as a further example , axial movement or disposition is parallel to axis 81 , radial movement or disposition is parallel to radius 82 , and circumferential movement or disposition is parallel to circumference 83 . rotation is with respect to axis 81 . the adverbs “ axially ,” “ radially ,” and “ circumferentially ” are with respect to an orientation parallel to axis 81 , radius 82 , or circumference 83 , respectively . the adverbs “ axially ,” “ radially ,” and “ circumferentially ” also are regarding orientation parallel to respective planes . fig1 b is a perspective view of object 90 in cylindrical coordinate system 80 of fig1 a demonstrating spatial terminology used in the present application . cylindrical object 90 is representative of a cylindrical object in a cylindrical coordinate system and is not intended to limit the present invention in any manner . object 90 includes axial surface 91 , radial surface 92 , and circumferential surface 93 . surface 91 is part of an axial plane , surface 92 is part of a radial plane , and surface 93 is part of a circumferential plane . fig2 is a profile of present invention stepped stator blades 100 demonstrating fluid flow through a stator ( not shown ) of a torque converter ( not shown ) at a low speed ratio . stator blade 100 has face , or surface , 102 and face , or surface , 112 , with the faces located substantially circumferentially opposite each other . face 102 includes surface segments 106 and 108 , and step , or step surface , 104 . in a preferred embodiment , step 104 is located on face 102 , as shown . surface segments 106 and 108 are disjointed and are connected by step 104 . by disjointed we mean that segments 106 and 108 do not form a surface with a smooth curvature , because of the presence of step 104 . that is , face 102 does not have a smooth curvature , particularly at step 104 . alternately stated , segments 106 and 108 are misaligned . blade 100 includes body portion 122 and body portion 124 connected by step body portion 120 . portions 122 and 124 are misaligned , or disjoint , with respect to each other . arrow 110 represents the direction of the flow of fluid through the stator at low speed ratios of the torque converter , when blades 100 are installed in the stator . two blades are shown in fig2 ; however , it should be understood that a stator using blades 100 is not limited to a particular number of blades 100 . the direction of the fluid changes as the fluid passes through the stator , specifically , between blades 100 . the turning of the fluid occurs because the fluid contacts segment 106 , the blade reacts to the force from the fluid , and the blade redirects the fluid down the stator blade towards segment 108 . the fluid pressure at step 104 is substantially lower than fluid pressure at least one of segments 106 and 108 . the step provides redirection for the fluid as the fluid travels to segment 108 . the curvature of segment 108 continues directing the flow of fluid until the fluid exits out of the stator . the redirection of the fluid by step 104 enables the fluid to smoothly transition from segment 106 to segment 108 , and therefore provide better turning of the fluid . for example , the angle at which the fluid turns in response to contacting segment 106 is advantageously reduced . as a result , the fluid slows down less as the fluid transitions from segment 106 to segment 108 . the maintained speed of the fluid and the reduced turning angle of the fluid noted supra increase fluid flow rate past blades 100 , increase the mass flow rate past blades 100 , and increase the capacity of the torque converter . fig3 is a profile of stepped stator blades 100 shown in fig2 demonstrating fluid flow through the stator at a high speed ratio . the following should be viewed in light of fig2 and 3 . face 112 includes surface segments 116 and 118 , and step 114 . the discussion of fig2 regarding face 102 , segments 106 and 108 and step 104 is applicable to face 112 , segments 116 and 118 , and step 114 . arrow 111 represents the general direction of the flow of fluid through the stator at high speed ratios of the torque converter , when blades 100 are installed in the stator . at high speed ratios the capacity of the torque converter is proportional to the mass flow of fluid through the stator . the mass flow is limited by a minimum flow area . the minimum flow area is represented in one dimension by distance 126 which is shown perpendicularly between the end of segment 108 on blade 100 a and step 114 on blade 100 b . blades 100 a and 100 b are the same as blades 100 , but are given identifying letters to differentiate them from each other in this particular figure . the second dimension which defines the minimum flow area is the width of the stator blade ( not shown ). the width of the stator blades is not germane to the invention , and any width known in the art for stator blades may work . however , the width is assumed to be consistent from blade to blade for comparison of the performances of differently profiled blades . thus , due to the stepped configuration of blades 100 , distance 126 and the minimum flow area , and consequently , the mass flow between blades 100 a and 100 b is increased . for example , the stepped configuration results in surface 108 of blade 100 a being axially and circumferentially further from blade 100 b and also results in step 114 of blade 100 b being axially and circumferentially further from blade 100 a . fig4 is a profile of present invention stator blades 150 having face , or surface , 152 and face , or surface , 162 demonstrating fluid flow through the stator at a low speed ratio . in this embodiment , face 152 is substantially similar to face 102 on stator blade 100 . face 152 includes segment 156 and segment 158 connected by step 154 . face 162 does not contain a step and is an example of a constant surface , airfoil shape , typical for conventional stator blades . arrow 160 represents the direction of fluid through the stator at low speed ratios of the torque converter , when blades 150 are installed in the stator . the discussion in the description of fig2 regarding flow 110 is applicable to flow 160 in fig4 . that is , flows 110 and 160 behave in substantially the same way . fluid contacts segment 156 , the blade reacts to the force from the fluid , and the blade redirects the fluid down the blade towards segment 158 . the fluid pressure at step 154 is substantially lower than the fluid pressure at least one of segments 156 and 158 . the step provides redirection for the fluid as the fluid travels to segment 158 . the redirection of the fluid by step 154 enables the fluid to smoothly transition from segment 156 to segment 158 , and therefore provide better turning of the fluid . despite the constant surface of second face 162 , the flow of fluid remains substantially similar to the flow of fluid in the first embodiment , as illustrated in fig2 . therefore , the absence of a second step on blade 150 does not significantly affect the turning properties of the fluid at high speed ratios . fig5 is a diagram comparing the performances of present invention stepped stator blades and prior art constant surface blades in a stator ( not shown ) in a torque converter ( not shown ). it should be understood that the torque converter referenced in fig5 can be any applicable torque converter known in the art . the following should be viewed in light of fig2 - 5 . in fig5 , the present invention blades are blades 100 , although it should be understood that in general , a present invention blade provides the benefits , with respect to a prior art blade , shown in fig5 and described infra . conventional , constant surface blades do not contain steps , for example , step 104 in fig2 . that is , a conventional blade has a profile that closely resembles the shape of an airfoil . as discussed supra , present invention stepped blades , for example , blade 100 in fig2 and 3 , provide improved fluid turning for low speed ratios and increased minimum fluid flow area for high speed ratios . some beneficial results of the fluid turning and increased mass flow are shown in fig5 . curves 208 and 210 illustrate the relationship between the speed ratio and the k - factor , or torque capacity , for a torque converter using the stepped stator blade and the torque 10 converter using a prior art constant surface stator blade , respectively . as is known in the art , lowering the k - factor results in an increase in torque capacity . at a zero speed ratio , curve 210 is lower than curve 208 . as the speed ratio increases to 0 . 8 , the difference between the respective curves ( k - factors ) increases . the lower k - factor for curve 208 indicates a substantial improvement in torque capacity for a torque converter using a present invention blade . curve 200 represents the relationship between the speed ratio and mass flow for the torque converter using the present invention stepped blade noted supra . curve 202 represents the speed ratio and mass flow for the torque converter using the constant surface blade noted supra . the mass flow is advantageously higher for the stepped blade . as previously described , the stepped blade results in the increased mass flow by providing improved fluid turning at low speed ratios and a larger minimum flow area at higher speed ratios . increasing the mass flow results in an improvement in k - factor and therefore torque capacity , as shown in curves 208 and 210 . the relationship between the speed ratio and torque ratio for the torque converter using the stepped blades and the constant surface blades are illustrated as curves 204 and 206 , respectively . curves 212 and 214 represent the relationship between the speed ratio and efficiency for the torque converter using the stepped stator blades and constant stator blades , respectively . as noted supra , using prior art blades , an increase in one of the k - factor , torque ratio , or efficiency , is only possible by decreasing one or both of the remaining parameters . however , the torque ratio and the efficiency associated with blades 100 and the prior art blades are nearly identical . therefore , the stepped stator blade advantageously enables a significant improvement in k - factor , which represents a significant and desirable gain in torque capacity , while maintaining virtually the same efficiency and torque ratio . it should be appreciated that the present invention stepped stator blade can be manufactured by casting , stamping , or any other blade manufacturing process known in the art . thus , it is seen that the objects of the present invention are efficiently obtained , although modifications and changes to the invention should be readily apparent to those having ordinary skill in the art , which modifications are intended to be within the spirit and scope of the invention as claimed . it also is understood that the foregoing description is illustrative of the present invention and should not be considered as limiting . therefore , other embodiments of the present invention are possible without departing from the spirit and scope of the present invention .
| 5 |
references to “ one embodiment ” or “ an embodiment ” do not necessarily refer to the same embodiment , although they may . unless the context clearly requires otherwise , throughout the description and the claims , the words “ comprise ,” “ comprising ,” and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense ; that is to say , in the sense of “ including , but not limited to .” words using the singular or plural number also include the plural or singular number respectively . additionally , the words “ herein ,” “ above ,” “ below ” and words of similar import , when used in this application , refer to this application as a whole and not to any particular portions of this application . when the claims use the word “ or ” in reference to a list of two or more items , that word covers all of the following interpretations of the word : any of the items in the list , all of the items in the list and any combination of the items in the list . “ logic ” refers to signals and / or information that may be applied to influence the operation of a device . software , hardware , and firmware are examples of logic . hardware logic may be embodied in circuits . in general , logic may comprise combinations of software , hardware , and / or firmware . those skilled in the art will appreciate that logic to carry out particular techniques described herein may be dispersed throughout one or more devices , and thus may not lend itself to discrete illustration in the drawings , but may nonetheless be considered as elements of the one or more devices . for example , a mobile phone may comprise logic to carry out acts described herein , as may a pin server and devices ( such as computers ) controlled by financial institutions . fig1 illustrates an embodiment of a mobile phone 200 . information is presented on the screen 201 and through the speaker ( s ) 203 . a data bus 206 communicatively couples various elements within the phone . the mobile phone embodiment 200 also comprises processor 207 and random access memory 208 and persistent memory 209 ( which could be re - writeable flash memory ). the phone 200 comprises a radio 210 to communicate via a medium range ( up to many kilometers ) microwave link 225 with cellular wireless voice and data network base stations 214 through their associated mobile phone carrier 215 and onward , either though a phone network 217 or through a gateway 216 to a public or private data network 218 such as the internet . the radio 210 can send and receive both short message service ( sms ) messages 228 through the phone network ( s ) 215 217 to other phones identified by their phone numbers and send and receive a variety of data 229 protocols ( udp , tcp , smtp , http , etc ) through the data network 218 . in data communication with the data network 218 is a server complex 231 that enables a download of executable code and data files to the phone 200 . in data communication with the server complex 231 is a financial institution 232 , communicating either directly or via the network 218 . fig2 illustrates an embodiment of an initiation process between a user device and a financial institution . a user device downloads an application from a server at block 301 . the server may be , for example , a pin server that provides one or more pin numbers to the device . at a block 303 , the downloaded application initiates an authentication process with the server and the financial institution . this authentication process serves to authenticate ( e . g . verify the identity of ) the device and / or the user of the device with the server and the financial institution . the financial institution may access an account corresponding to the device - supplied information . at a block 304 , the server matches user device information ( such as the device &# 39 ; s phone number , unique hardware code , or unique user code such as may be obtained from a subscriber identity module ) against data supplied by the financial institution . at a block 305 , the server matches user entered information against data supplied by the financial institution , e . g . a password corresponding to the user &# 39 ; s account . for example , in addition to verifying the user &# 39 ; s phone number , device id , or sim id , the server may also perform a challenge / response authentication process with the device , such as requiring a password . at a block 305 , the server supplies list of personal identification numbers ( pins ) to the user device ( block 306 ) and to the financial institution . the list may comprise a single pin or multiple pins . the pins may be generated dynamically by the server , or they may be obtained from a pin “ pool ”. the pins may be limited in use to a single transaction , a number of transactions , or may be limited to use for an interval of time . fig3 illustrates an embodiment of a point of purchase transaction performed after the authentication performed in fig2 . at a block 501 , the user initiates a purchase of a product at a retailer device . at a block 502 , the retailer device requests that the provider of a bank card provide a pin . at a block 503 , the user activates an application on the user &# 39 ; s mobile device that displays a pin to use for this transaction . the pin could be generated dynamically by the pin server and provided to the device , or it may be one or one or more pins previously generated by the pin server and stored by the device . for example , the pin could be one of the list of pins that were supplied at block 305 of fig2 ( see block 504 ). the user provides the displayed pin at the retailer device . at a block 505 , the retailer device transmits the entered pin to the financial institution at a block 505 . the financial institution determines if the correct pin has been entered at a block 506 . if the financial institution determines that the correct pin has not been entered , the transaction is denied ( block 507 ) and the denial is reported to the retailer . if the financial institution determines that the correct pin has been entered , the transaction is approved ( block 507 ) and the approval is reported to the retailer for completion of the transaction . the transaction need not even involve a bank card , in some instances . rather , a pin supplied to the mobile device , along with identification of the corresponding bank account , may provide sufficient authentication for purposes of the transaction , without requiring the user to supply a bank card . in other instances , the mobile device may communicate account information of the user to the point of sale equipment ( e . g . via short - range wireless technology such as bluetooth ). while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention may be delimited by reference to the claims that follow .
| 6 |
an embodiment of the invention will be described in detail with reference to the accompanying drawings . fig1 illustrates the whole system according to an embodiment of the invention . as shown , the system comprises an ic card terminal and contact - type ic card 20 . it is a matter of course that the ic card terminal 10 may be connected via a network to , for example , a server that centrally manages a large number of ic card terminals 10 . the contact - type ic card 20 comprises a plastic card member 25 of a rated size and an ic module 24 . the ic module 24 includes an ic chip 22 sealed with a sealing member 23 and configured to perform a predetermined logical operation , and an ic card interface 21 exposed to the outside and connected to the ic chip 22 . when the ic cared 20 is inserted in the ic card terminal 10 , it receives power from the terminal , and the ic chip 22 performs the predetermined logical operation . on the other hand , when the ic cared 20 is not inserted in the ic card terminal 10 , the ic chip 22 does not perform the logical operation . the ic card terminal 10 comprises an insertion unit 11 for inserting therein the ic card 20 , and an ic card interface 13 to be electrically connected to the ic card 20 when the ic card 20 is inserted in the insertion unit 11 . when the ic card 20 is inserted , the ic card interface 13 opposes the ic card interface 21 of the ic card 20 . the ic card terminal 10 further comprises an input unit 12 for permitting a user to input a pin ( personal id number ) after the ic card 20 is inserted , and a controller 14 for controlling the whole ic card terminal 10 . the input unit 12 , controller 14 and power supply v for supplying power to the ic card 20 are connected to the ic card interface 13 . in the system constructed as above , to use the ic card 20 , firstly , the ic card 20 is inserted into the ic card terminal 10 , then a user pin is input through the input unit 12 and supplied to the ic chip 22 of the ic card 20 via the ic card interfaces 13 and 21 . the ic chip 22 , in turn , compares the supplied pin with the legitimate pin stored therein . if it is determined that these pins are identical to each other , a command is supplied from the ic card terminal 10 to the ic card 20 via the ic card interfaces 13 and 21 . the ic card 20 , for example , interprets the command , operates in accordance with the command , and responds to the ic card terminal 10 . fig2 is a block diagram illustrating the internal configuration of the ic chip 22 incorporated in the ic card 20 . as seen from fig2 , an input / output unit 31 is connected to the ic card interface 21 and internal bus 39 . when the ic card 20 is inserted in the ic card terminal 10 , the input / output unit 31 supplies a power supply unit 38 with the power acquired from the terminal 10 via the ic card interface 21 , transmits , to the internal bus 39 , the command or data received from the ic card interface 21 , and transmits , to the ic card interface 21 , the command or data received from the internal bus 39 . a cpu 32 controls the whole ic chip 22 , and operates in accordance with the program stored in a rom 33 . the rom 33 stores , as well as the program , the pin assigned to the ic card 20 . the pin stored in the rom 23 will hereinafter be referred to as a “ legitimate pin ”, and any other pin will be referred to as an “ illegitimate pin ”. in the case of an ic card 20 that permits the pin to be changed , the pin may be stored in an eeprom 35 described later . the rom 33 also stores a threshold value for limiting the number of occasions an illegitimate pin is input during a predetermined period of time . a ram 34 is a work memory used by the cpu 32 . the eeprom 35 is a nonvolatile semiconductor memory that can be rewritten by the cpu 32 , and has a count value storing area for storing the number of occasions an illegitimate pin is input during a predetermined period of time . the power supply unit 38 is connected to the input / output unit 31 so that it receives the power supplied from the ic card terminal 10 and supplies it to each element of the ic chip 22 . a timer 36 for locking and timer 37 for counting have the same structure , and are disposed to change in state with lapse of time without external power , thereby measuring whether or not a predetermined time period has elapsed . each state of the timer 36 and timer 37 changes from an initial state to a final state via an intermediate state . the timers 36 and 37 measure different predetermined time periods . the timer 36 can measure a longer time period than the timer 37 . the lock timer 36 sets a locking period in which the ic card 20 cannot perform any process other than the time measurement . on the other hand , the count timer 37 sets a period in which the number of occasions an illegitimate pin is input is counted . the timers 36 and 37 ( hereinafter generically referred to as a “ timer 36 / 37 ”) will be described in more detail . fig3 is a block diagram illustrating the basic concept of the timer 36 / 37 . the timer 36 / 37 comprises : a change unit 41 , the state of which changes with lapse of time without a power supply , such as battery ; an input unit 42 for inputting an input signal to the change unit 41 ; and an output unit 43 for outputting an output signal changed relative to the input signal based on the state of the change unit 41 . the change in the state of the change unit 41 is utilized to measure time . the input unit 42 and output unit 43 are used to confirm the state of the change unit 41 . fig4 illustrates a first example that realizes the basic concept of the timer 36 / 37 of fig3 . the first example of the timer 36 / 37 comprises : a first layer having a source region 51 , drain region 52 and channel region 53 therebetween ; a second layer provided on the first layer and formed of a tunnel insulation film 54 ; a third layer provided on the second layer and formed of a floating gate 55 ; a fourth layer provided on the third layer and formed of an insulation film 56 ; and a fifth layer provided on the fourth layer and formed of a control gate 57 . a source electrode 58 and drain electrode 59 are provided on the source and drain regions 51 and 52 , respectively . fig5 illustrates changes with lapse of time in the state of the timer 36 / 37 of fig4 . in the figure , hatched circles indicate electrons , and white circles indicate positive holes . in fig5 , state 1 is the initial state . in the timer 36 / 37 that assumes the state 1 , a pre - process is performed , in which the control gate 57 applies a high electric field between the substrate boundary of the channel region 53 and the floating gate 55 , thereby injecting electrons from the channel into the floating gate 55 utilizing fn tunneling . at this time , positive holes gather at the substrate boundary of the channel region 53 , whereby a channel is formed on the substrate boundary between the source and drain regions 51 and 52 . in the state 1 , the electrons in the floating gate 55 gradually shift , by direct tunneling , to the substrate boundary , thereby reducing the level of the electric field at the substrate boundary in the channel region 53 . state 2 of fig5 is assumed at a time point t 1 a certain time period after the state 1 . state 3 of fig5 is assumed at a time point t 2 a certain time period after the state 2 . similarly , state 4 is the state assumed at a time point t 3 a certain time period after the state 3 . the circles indicated by the broken lines represent the shift of electrons made due to direct tunneling by the respective time points . in the state 4 ( i . e . a final state ) at the time point t 3 , most electrons escape from the floating gate 55 , therefore the channel at the substrate boundary of the channel region 53 disappears . as a result , no signals are output . fig6 is a graph illustrating the relationship between the time and the output signal of the timer 36 / 37 . direct tunneling occurs between time points t a (= 0 ) and t b ( i . e . between the states an initial state and an intermediate state ), and lastly , the channel disappears , whereby the level of the output signal is reduced to the noise level . since the timer 36 / 37 supplies an output signal corresponding to a change in level between t a (= 0 ) and t b (= e . g . the time when the output signal level reaches the noise level ), the side for receiving the output signal can determine whether or not a predetermined time period has elapsed , or can determine a specific time point ( e . g . t 1 , t 2 or t 3 shown in fig6 ) a predetermined time period after the initial state if the relationship between the state of the timer 36 / 37 and the level of the output signal is always clear . the time points t 1 , t 2 and t 3 correspond to the states 2 , 3 and 4 in fig5 . fig7 is a second example that realizes the basic concept of the timer 36 / 37 of fig3 . the second example of the timer 36 / 37 comprises : a first layer having a source region 61 , drain region 62 and channel region 63 therebetween ; a second layer provided on the first layer and formed of a tunnel insulation film 64 ; a third layer provided on the second layer and formed of a gate 65 ; and a pn junction 66 provided on the third layer for controlling a leak current . a source electrode 68 and drain electrode 69 are provided on the source and drain regions 61 and 62 , respectively . the change in the state of the second example of the timer 36 / 37 with lapse of time is similar to that of the first example of the timer 36 / 37 , although in the former , current leakage occurs in a pn junction , and in the latter , direct tunneling occurs . therefore , no description is given of the change in the state of the second example of the timer 36 / 37 with lapse of time . fig8 is a third example that realizes the basic concept of the timer 36 / 37 of fig3 . the third example of the timer 36 / 37 comprises : a first layer having a source region 71 , drain region 72 and channel region 73 therebetween ; a second layer provided on the first layer and formed of a tunnel insulation film 74 ; a third layer provided on the second layer and formed of a gate 75 ; and a schottky junction 76 provided on the third layer for controlling a leak current . a source electrode 78 and drain electrode 79 are provided on the source and drain regions 71 and 72 , respectively . the change in the state of the third example of the timer 36 / 37 with lapse of time is similar to that of the first example of the timer 36 / 37 , although in the former , current leakage occurs in a schottky junction , and in the latter , direct tunneling occurs . therefore , no description is given of the change in the state of the third example of the timer 36 / 37 with lapse of time . when the above - described timer 36 / 37 is used , it is constructed as shown in the examples of connection of fig9 a and 9b . in the example of fig9 a , a voltage can be applied between the opposite ends of the timer 36 / 37 . a power supply terminal 81 is connected to the source electrode 58 , 68 , 78 of the timer 36 / 37 via a switch element 83 , while a gnd terminal 82 is connected to the drain electrode 59 , 69 , 79 via an ampere meter 84 . the switch element 83 is connected to an on / off ( enable ) signal line , and is turned on when an on signal is supplied thereto from the on / off signal line . the ampere meter 84 is connected to output a current value to the cpu 32 . to detect the state of the timer 36 / 37 during the operation of the ic chip 22 , the cpu 32 turns on the switch element 83 , thereby applying a predetermined voltage between the power supply terminal 81 and gnd terminal 82 . as a result , a current flows through the timer 36 / 37 , which is measured by the ampere meter 84 . the measured current value is output to the cpu 32 . thus , the cpu 32 detects the state of the timer 36 / 37 . as described above referring to fig5 , a pre - process must be performed in the timer 36 / 37 before time measurement . therefore , the timer 36 / 37 is equipped with a means for performing the pre - process ( not shown ). upon receiving an instruction to start time measurement from the outside , the timer 36 / 37 performs the pre - process and then starts time measurement . in the example of connection shown in fig9 a , a single timer 36 / 37 is employed . however , a plurality of timers 36 / 37 may be employed . the states of the change units 41 of the timers 36 / 37 may change at the same rate or different rates , according to purpose . fig9 b illustrates timers 36 / 37 in which the states of the change units 41 change at different rates . as shown in fig9 b , the timers 36 / 37 identical to that shown in fig9 a are arrange in parallel , and the current values output therefrom are input to an averaging circuit 85 . the average current value from the averaging circuit 85 is output to the cpu 32 . the on / off ( enable ) signal line led from the cpu 32 is connected to the switch elements 83 so that the cpu 32 can commonly control the switch elements 83 . in this example , even if the change units 41 exhibit some different changes in state with lapse of time , the average current value output from the averaging circuit 85 enables a stable timer to be realized . further , if change units 41 that exhibit different changes in state with lapse of time are intentionally employed ( this example is not shown ), various types of time information can be acquired . referring to fig1 a and 10b , the operation of the cpu 32 of the chip 22 will be schematically described . after the ic card 20 is inserted into the ic card terminal 10 and before it is ejected therefrom , pin identification is always performed , and a subsequent process can be performed if the pin identification result indicates that the input pin is legitimate . if the pin identification result indicates that the input pin is illegitimate , the card 20 is ejected ( fig1 a ), or pin identification is performed again instead of ejecting the card 20 ( fig1 b ). referring to the flowchart of fig1 , the pin identification process will be described in detail . firstly , a user inserts the ic card 20 into the ic card terminal 10 , then inputs a pin . the input pin is supplied to the input / output unit 31 of the ic card 20 via the ic card interfaces 13 and 21 . the pin is then supplied therefrom to the cpu 32 ( s 101 ). upon receiving the pin , the cpu 32 firstly determines whether or not the lock timer 36 is now measuring time ( s 102 ). specifically , as described referring to fig9 a and 9b , the cpu 32 reads a current value from the lock timer 36 and determines whether or not the current value reaches a noise level . if it is determined that the timer 36 is now measuring time , pin identification is determined to have failed since the ic card 20 is locked , which is reported to the terminal 10 ( s 103 ). on the other hand , if it is determined that the timer 36 is not measuring time , it is then determined whether or not the count timer 37 is now measuring time ( s 104 ). this determination is performed in the same manner as at the step s 102 . unless the count timer 37 is measuring time , an illegitimate data counter stored in an illegitimate data count value storing area in the eeprom 35 is reset ( s 105 ), thereby causing the count timer 37 to start time measurement ( s 106 ). if , for example , the count timer 37 is the above - described first example , a high voltage is instantly applied to the timer upon reception of the instruction to start measurement , whereby electrons are accumulated in the floating gate . after that , time measurement is started automatically . subsequently , the cpu 32 compares the pin received at the step s 101 , with the legitimate pin stored in the rom 33 ( s 107 ). if the received pin is determined to be a legitimate one as a result of the comparison , the measurement by the count timer 37 is stopped ( s 108 ), thereby determining that the pin identification process has succeeded , and informing the terminal 10 of this ( s 109 ). more specifically , at the step s 108 , the change in the state of the count timer 37 with lapse of time may be stopped . alternatively , the timer 37 may be managed using a valid / invalid flag that is stored in , for example , the eeprom 35 and indicates the validity / invalidity of the time measurement by the count timer 37 . if , on the other hand , the received pin is determined to be illegitimate as a result of the pin comparison , the value of the illegitimate data counter stored in the illegitimate data counter storing area of the eeprom 35 is incremented ( s 110 ). after that , it is determined whether or not the incremented counter value reaches a threshold value stored in the rom 33 ( s 111 ). if the value of the illegitimate data counter reaches the threshold value , it is determined to be very possible that an illegitimate user is trying to illegally use the ic card 20 , thereby causing the lock timer 36 to start measurement of time ( s 112 ). as a result , the ic card 20 is locked . the start of the time measurement may be performed in the same manner as that employed at the step s 106 . when the lock timer 36 starts time measurement , it is determined that pin identification has failed , which is reported to the terminal 10 ( s 113 ). fig1 a and 12b are time charts according to the flowchart of fig1 that illustrates the operation of the first example related to pin identification . in the figures , it is assumed that the threshold value for input of an illegitimate pin is 3 , and the time periods of the time measurement by the count timer 37 and lock timer 36 are t 1 and t 2 ( t 1 & lt ; t 2 ), respectively . further , “ illegitimate pin ” indicates that an illegitimate pin has been input through the input unit 12 , and “ legitimate pin ” indicates that a legitimate pin has been input through the input unit 12 . in fig1 a , the initial value of the illegitimate data counter is indefinite ( any value is ok ), and the timers 36 and 37 do not yet start time measurement . in this state , if the first illegitimate pin is input , the illegitimate data counter is reset to 0 at the step s 105 , whereby the count timer 37 starts time measurement , and the illegitimate data counter is incremented and set to “ 1 ” at the step s 110 . in this state , since the illegitimate data counter value is lower than the threshold value , the step s 112 is not yet started . assume that before the time period t 1 elapses from the input of the initial illegitimate pin , the second illegitimate pin is input . at this time , since the count timer 37 is measuring time , the steps s 105 and s 106 are not executed , and the illegitimate data counter is incremented to 2 at the step s 110 . even in this state , the value of the illegitimate data counter is lower than the threshold value , therefore the step s 112 is not yet started . after that , assume that before the period t 1 elapses from the input of the initial illegitimate pin , the third illegitimate pin is input . at this time , since the count timer 37 is measuring time , the steps s 105 and s 106 are not executed , and the illegitimate data counter is incremented to 3 at the step s 110 . at this time , the value of the illegitimate data counter reaches the threshold value , therefore the step s 112 is executed . specifically , the lock timer 36 starts time measurement , thereby locking the ic card 20 until the period t 2 elapses . within the period t 2 , even if a legitimate pin is input , the locked state is maintained , and the identification process is finished at the step s 103 . after the period t 2 elapses , the lock timer 36 stops its time measurement . at this time , the count timer 37 has already finished its time measurement ( since t 1 & lt ; t 2 ). thus , the timers 36 and 37 assume states similar to the initial states . also at this time , the illegitimate data counter may have any value as in the initial state , since it is always reset at the step s 105 when the next pin is input . fig1 b illustrates the case where a legitimate pin is input when the count timer 37 is measuring time . in fig1 b , the initial state , initial illegitimate pin and second illegitimate pin are assumed to be identical to those of fig1 a . if the third pin is a legitimate one , the steps s 101 , s 102 , s 104 and s 107 are executed in this order , and it is determined at the step s 107 that the third pin is a legitimate one , followed by the step s 108 where the count timer 37 finishes time measurement and the pin identification process is returned to the initial stage . as described above , the ic card of the embodiment incorporates a lock timer that operates for a predetermined time period without external power , therefore can assume a pin receivable state again a predetermined period after it is locked . further , since a timer that operates for a predetermined time period without external power is used as a timer for counting , if the card 20 is not locked within a predetermined period after the initial illegitimate pin is input , the illegitimate data counter can be reset . by virtue of this structure , even if a legitimate user has unintentionally input an illegitimate pin a number of times higher than the threshold value , they can reuse the ic card after a predetermined period , without , for example , accessing the system managing side . furthermore , since a pin cannot be input for a predetermined period of time , a lot of time is required until an illegitimate user reaches the legitimate pin by guessing and inputting a pin a large number of times . it is also advantageous that ic cards according to the invention enable their users to utilize conventional ic card terminals without modifying them . referring to the flowchart of fig1 , another modification of the above - described pin identification process will be described in detail . this modification differs from the flowchart of fig1 only in that in the latter , the count timer starts time measurement at the step s 106 , while in the former , the count timer does it after the step s 107 . in the modification , when an illegitimate pin is detected by pin identification , the count timer 37 restarts time measurement . fig1 a and 14b are time charts according to the last - mentioned modification . the conditions employed in these time charts are the same as those in fig1 a and 12b . as is understood from fig1 a and 14b , when the lock timer 36 does not perform time measurement ( when the value of the illegitimate data counter does not exceed the threshold value ), the count timer 37 restarts time measurement each time an illegitimate pin is input during time measurement , resulting in an extension of time measurement . further , as shown in the left portion of fig1 b , if an illegitimate pin is input , when the lock timer 36 does not perform time measurement ( when the value of the illegitimate data counter does not exceed the threshold value ), and when the count timer 37 is measuring time , the time measurement of the timer 37 is stopped . on the other hand , as shown in the right portion of fig1 b , when the lock timer 36 is measuring time ( when the value of the illegitimate data counter exceeds the threshold value ), the operation of the count timer 37 does not change ( the period of the time measurement of the timer 37 is not extended ), even if either a legitimate pin or an illegitimate pin is input . the above - described modification provides a further advantage ( compared to the flowchart of fig1 ) of being assured that if the ic card is not locked , pin input can be resumed a predetermined period after the last pin input , unless no further pin is input during the predetermined period . as described above , the ic card according to the modification of the embodiment uses , for locking , a timer operable without external power , therefore can receive a further pin a predetermined period after the ic card is locked . furthermore , the ic card according to the modification uses , for counting , a timer operable without external power , therefore can reset the illegitimate data counter if a predetermined period elapses from the last pin input . by virtue of the above structure , even if a legitimate user has unintentionally input an illegitimate pin a number of times that is larger than the threshold value , they can reuse the ic card after a predetermined period , without , for example , accessing the management side . moreover , even if a third party attempts to crack the card by repeatedly guessing the legitimate pin of the card , this attempt may well be thwarted , since pin input is prevented until a predetermined period elapses and therefore an enormous amount of time is required to detect the legitimate pin . it is also advantageous that ic cards according to the embodiment enable their users to utilize conventional ic card terminals without modifying them . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .
| 6 |
next , a specific embodiment of an electric motor stator according to the present invention will be described below with reference to the drawings . fig1 is a simplified view of essential parts of a motor in which the stator is used . the motor is constituted mainly of the stator 1 and a rotor 2 which is rotatably fitted in the stator 1 . the stator 1 has a stator core 3 and windings 4 wound on the stator core 3 . the stator core 3 has a core main body 6 formed by stacking a large number of annular - shaped thin plates made of electromagnetic steel and insulators ( insulating members ) 5 , 5 provided on axial end surfaces of the core main body 6 ( see fig1 to 3 ). the stator core 3 is provided with a plurality of teeth t ( six in this case ) at a predetermined pitch along a circumferential direction thereof . the windings 4 are wound on the respective teeth t . at this time , slots 15 are formed between adjacent teeth t along the circumferential direction . there are six slots 15 in this case , i . e ., from a first slot 15 a to a sixth slot 15 f . the rotor 2 has a rotor core 7 and a plurality of magnets ( not shown ) embedded in the rotor core 7 . a shaft ( not shown ) is inserted through and fixed by an axial hole of the rotor core 7 . in this case , the rotor core 7 is formed by stacking a large number of annular - shaped thin plates made of electromagnetic steel . as shown in fig2 , each of the insulators 5 includes a peripheral wall 8 , a plurality of radially internally protruding portions 9 protruding from the peripheral wall 8 , and raised portions 10 provided at an end edge of the radially internally protruding portions 9 to face the peripheral wall 8 . the radially internally protruding portions 9 are arranged circumferentially at a predetermined pitch ( at a pitch of 60 °). one insulator 5 ( 5 a ) is fitted on one axial end surface of the core body 6 , while the other insulator 5 ( 5 b ) is fitted on the other end surface of the core body 6 . the windings 4 consist of a u - phase winding 4 a , a v - phase winding 4 b and a w - phase winding 4 c as shown in fig4 . the u - phase winding 4 a has a first magnetic pole portion u 1 and a second magnetic pole portion u 2 ; the v - phase winding 4 b has a first magnetic pole portion v 1 and a second magnetic pole portion v 2 ; and the w - phase winding 4 c has a first magnetic pole portion w 1 and a second magnetic pole portion w 2 . the u - phase winding 4 a , the v - phase winding 4 b and the w - phase winding 4 c are connected to one another via a neutral point n . at this time , as shown in fig1 , the first magnetic pole portion u 1 and the second magnetic pole portion u 2 of the u - phase winding 4 a are placed in such a manner as to be symmetrical with each other with respect to a central axis of the stator core 3 so that they are opposite to each other ; the first magnetic pole portion v 1 and the second magnetic pole portion v 2 of the v - phase winding 4 b are placed in such a manner as to be symmetrical with each other with respect to the central axis of the stator core 3 so that they are opposite to each other ; and the first magnetic pole portion w 1 and the second magnetic pole portion w 2 of the w - phase winding 4 c are placed in such a manner as to be symmetrical with each other with respect to the central axis of the stator core 3 so that they are opposite to each other . the winding method will be described in detail regarding the u - phase winding 4 a . as shown in fig5 , a part following a neutral wire 30 of the winding is wound around one of the opposed teeth t until after a tooth winding portion 11 a serving as the second magnetic pole portion u 2 is provided . a crossover wire 31 to the other tooth t is extended to serve as a power wire 29 . then , a part following the power wire 29 of the winding is wound around the other tooth t until after a tooth winding portion 11 b serving as the first magnetic pole portion u 1 is provided . a winding end at the other tooth t is drawn out toward the neutral wire 30 so as to be connected to the neutral wire . that is , the neutral wire 30 a on the winding start side of the tooth winding portion 11 a serving as the second magnetic pole portion u 2 is connected to a neutral wire 30 b on the winding end side of the tooth winding portion 11 b serving as the first magnetic pole portion u 1 via the neutral point n . the same winding method as that of the u - phase winding 4 a is applied to the other v - phase winding 4 b and w - phase winding 4 c . therefore , the second magnetic pole portion u 2 , v 2 , w 2 of each winding 4 a , 4 b , 4 c has a lead - out portion 32 drawn out to the first magnetic pole portion u 1 , v 1 , w 1 , and the first magnetic pole portion u 1 , v 1 , w 1 has a lead - out portion 33 drawn out to the neutral wire 30 ( 30 b ). the power wire 29 is fixed in such a manner that it is held between the tooth winding portion 11 and a slot bottom 21 ( which is an inner circumferential surface defining the slot 15 ). that is , as shown in fig5 , the power wire 29 is held between the tooth winding portion 11 b that constructs the second magnetic pole portion u 2 , and the slot bottom 21 corresponding to the tooth winding portion 11 b . next , as shown in fig3 , the peripheral wall 8 has a plurality of sub - walls 16 corresponding to the respective slots 15 . of the slots , a first slot 15 a corresponds to a first sub - wall 16 a , a second slot 15 b corresponds to a second sub - wall 16 b , a third slot 15 c corresponds to a third sub - wall 16 c , a fourth slot 15 d corresponds to a fourth sub - wall 16 d , a fifth slot 15 e corresponds to a fifth sub - wall 16 e , and a sixth slot 16 f corresponds to a sixth sub - wall 16 f . the sub - walls 16 are each provided with a slit 24 , and the power wires 29 are received in the respective slits 24 . specifically , the slit 24 is provided in the first sub - wall 16 a , whereby the first sub - wall 16 a is divided into a first wall portion 22 and a second wall portion 23 . and , the power wire 29 drawn out and running along an inner surface of the sixth sub - wall 16 f is then placed on an inner surface side of the first wall portion 22 of the first sub - wall 16 a and then on an outer surface side of the second wall portion 23 of the first sub - wall 16 a . the sub - walls 16 each constitute a support portion , which will be described later . in this case , a wiring separator 25 ( 25 a ) that supports the power wire 29 is provided between the sixth sub - wall 16 f and the first sub - wall 16 a ; a wiring separator 25 ( 25 b ) that also supports the power wire 29 is provided between the first sub - wall 16 a and the second sub - wall 16 b ; and a wiring separator 25 ( 25 c ) that also supports the power wire 29 is provided between the second sub - wall 16 b and the third sub - wall 16 c . more specifically , a protrusion provided in a gap 26 between the sixth sub - wall 16 f and the first sub - wall 16 a forms the wiring separator 25 a ; a protrusion provided in a gap 27 between the first sub - wall 16 a and the second sub - wall 16 b forms the wiring separator 25 b ; and a protrusion provided in a gap 28 between the second sub - wall 16 b and the third sub - wall 16 c forms the wiring separator 25 c . thus , the power wires 29 pass the wiring separators 25 a , 25 b , and 25 c , so that movement of the power wires toward the neutral wires 30 is restricted by these wiring separators 25 a , 25 b , and 25 c . therefore , a lead wire 20 ( formed by bundling the power wires 29 of the u -, v -, and w - phases ) can be drawn out in a state in which contact of the power wires 29 with the neutral wires 30 provided on the outer surface side of the peripheral wall 8 of the insulator 5 is prevented . the other insulator 5 b on the counter - lead wire side is also provided with sub - walls 17 , but no wiring separators 25 ( 25 a , 25 b , 25 c ) are provided . this is because the power wires 29 are not drawn out to this insulator 5 b . each sub - wall 16 of the insulator 5 forms a support portion for supporting a protruding portion 35 of the tooth wiring portion 11 ( see fig1 ) from its radially outer side , the protruding portion 35 being a portion that protrudes from an end surface of the stator core 3 . more specifically , the sub - walls ( support portion ) 16 have a height ( i . e ., an axial length ) ( h ) ( see fig3 ) set to be approximately equal to or slightly larger than the dimension of the protruding portion 35 of the tooth winding portion 11 . furthermore , the sub - walls ( support portion ) 16 have a circumferential length ( s ) ( see fig3 ) to accommodate the confronting circumferential edge portions of the circumferentially adjacent tooth winding portions 11 , 11 . this motor ( which is of permanent magnet type ) is used as , for example , a motor for a compressor of an air conditioner . the compressor includes a casing , which is a sealed container , a compressor elements part housed in the lower side of the sealed container , and a motor elements part housed in the upper side of the sealed container . the permanent magnet type motor is used for the motor elements part . therefore , a shaft that is inserted through and fixed by the axial hole of the rotor 2 is a crankshaft for the compressor elements part , and the crankshaft is supported by a supporting member within the sealed container . in the electric motor stator , since the power wire 29 drawn out from the tooth winding portion 11 of the winding 4 is fixed by being held between the tooth winding portion 11 and the slot bottom 21 , winding can be performed without wobbling of the power wire 29 . therefore , it is possible to prevent the power wire 29 from being brought into contact with tooth winding portions 11 of other phases , so that the electric motor can exhibit a stable function as the motor for a long time . further , the protective tube , which has conventionally been used , can be dispensed with , which makes it possible to provide an improvement in assembling performance and a reduction in costs . further , since no complicated structure or arrangement for fixing the power wire 29 is required , a further cost reduction through simplification of the structure of the stator is possible . since the insulator 5 is provided with the winding separators 25 that keep the power wires 29 spaced from the neutral wires 30 by a predetermined distance , it is possible to prevent the power wires 29 from being brought into contact with the neutral wires 30 . thereby , a motor with high quality can be provided . moreover , wiring can securely be performed such that the power wires 29 are not brought into contact with the neutral wires 30 in the wiring operation , thus making it possible to contrive simplification of the wiring operation of the windings 4 . that is , the provision of the winding separators 25 in the insulator 5 makes it possible to achieve stable wiring workability and improve the non - contact reliability between the power wire 29 and the neutral wire 30 . furthermore , since the insulator 5 has , on its radially outer side , the support portions formed of the sub - walls 16 of the peripheral wall 8 , the tooth winding portions 11 are thereby prevented from falling outward , so that the tooth winding portions 11 can maintain their stable winding state . consequently , simplification of the winding operation can be achieved and a stator with high quality can be provided . further , since the insulator 5 has , on its radially inner side , the raised portions 10 , it is also possible to prevent the protruding portions 35 of the tooth winding portions 11 from falling inward . embodiments of the invention being thus described , it will be obvious that the preset invention is not limited to those embodiments , but that same may be varied in many ways within the scope of the following claims . for example , it is possible to change the number of phases and the number of poles in the motor . the distance between the power wire 29 and the neutral wire 30 can be changed by changing the height of each protrusion forming the winding separator 25 a , 25 b , 25 c . furthermore , the winding separators 25 a , 25 b , 25 c may have the same or different heights .
| 7 |
the best mode for carrying out the present invention will be described below in connection with practical embodiments . table 1 , given below , shows chemical compositions (% by weight ) of specimens corresponding to in706 and examples of ni — fe based super alloy of the present invention . among the specimens shown in table 1 , an alloy 1 corresponds to in706 , and an alloy 2 corresponds to an improved version of in718 . each of alloys 2 - 5 corresponds to the ni — fe based super alloy of the present invention . the alloys 1 - 4 present the cases in which n is not added and the n content is negligible because of incapability of analysis . any of the alloys was produced through the steps of melting and forging raw materials by rf vacuum fusion , and then successively performing , on the forging material , hot plastic working at 800 - 1100 ° c ., solution treatment at 1000 ° c . for 2 hours , and two - stage aging treatment that comprises heat treatment at 720 ° c . for 2 hours and subsequent heat treatment at 620 ° c . for 8 hours . fig1 is a graph showing the relationship between 0 . 2 % yield point and temperature in the specimens , i . e ., the results of tensile tests made on the specimens . as will be seen from fig1 , the alloys 3 and 4 of the present invention have the 0 . 2 % yield points slightly inferior to that of the alloy 1 in a relatively low - temperature range of not higher than 350 ° c ., but their 0 . 2 % yield points are superior to the alloy 1 in a relatively high - temperature range near 700 ° c . therefore , the alloys of the present invention are more suitable for use at high temperatures than the alloy 1 of the known material . fig2 illustrates metal structures of the ni — fe based super alloy according to the present invention , which were observed by an electron microscope before and after aging treatment at 700 ° c . before the aging treatment , the γ ″ phase and the γ ′ phase were both precipitated in the alloy 2 , and those phases similarly appeared in the structure of the alloy 1 . on the other hand , in the alloys 3 and 4 , only the spherical γ ′ phase was precipitated , while the γ ″ phase was not observed . since the γ ′ phase has a specific property of increasing the strength at high temperatures , superiority of the alloys of the present invention in yield point at high temperatures is attributable to the fact that the alloys of the present invention are strengthened by only the γ ′ phase . after the aging treatment of the specimen at 700 ° c ., in the alloy 2 as the improved version of the known material , the γ ″ phase was reduced , while the η and δ phases , each known as a detrimental phase in the super alloy , were precipitated to some extent , although the amounts of the η and δ phases were smaller than those precipitated in the alloy 1 . on the other hand , in the alloys 3 and 4 of the present invention , it was observed even after the aging treatment at 700 ° c . that only the γ ′ phase was observed in size slightly increased with growth and the detrimental phases were hardly precipitated . fig3 is a graph showing the relationship between aging treatment time and 0 . 2 % yield point when the specimens were subjected to the aging treatment at 700 ° c . with the aging treatment at 700 ° c ., the 0 . 2 % yield point was reduced in the alloy 1 of the known material . on the other hand , in the alloys 3 and 4 of the present invention , the 0 . 2 % yield point at the room temperature was hardly reduced even with the aging treatment at 700 ° c . in the alloy 2 as the improved version of the known material , the 0 . 2 % yield point was reduced with the aging treatment at 700 ° c ., but it showed a value comparable to those of the alloys 3 and 4 . fig4 is a graph showing the relationship between charpy absorbed energy and aging treatment time when the aging treatment was performed at 700 ° c . a drop of the charpy absorbed energy , i . e ., embrittlement , was abruptly caused in the alloy 1 of the known material , whereas no embrittlement was caused in the alloys 3 and 4 of the present invention . such results are attributable to the fact that , with the aging treatment at 700 ° c ., the precipitated strengthening phase was reduced and the detrimental phases were precipitated in the alloy 1 of the known material , whereas the γ ′ phase serving as the precipitated strengthening phase was not reduced and the detrimental phases were not precipitated in the alloys 3 and 4 . it is apparent from those results that the alloys of the present invention are more suitable for use at high temperatures than the known alloy . fig5 is a graph showing the relationship between the fe and nb contents in the alloys of the present invention . in the alloys of the present invention , preferably , as described above , it is preferable that no detrimental phases be precipitated at high temperatures . also , if the nb content exceeds 3 % by weight , productivity in making a large - sized ingot would deteriorate as compared with the known alloy . therefore , the nb content is preferably not more than 3 % by weight . however , if nb is added in too small amount , the yield point could not be obtained at a level required as a strength characteristic in the gas turbine rotor material . for that reason , the contents of fe and nb ( fe %, nb %) are preferably within a region defined , as shown in fig5 , by successively connecting a point a ( 15 %, 3 . 0 %), a point b ( 30 %, 3 . 0 %), a point c ( 45 %, 2 . 25 %), a point d ( 45 %, 1 . 25 %), a point e ( 15 %, 2 . 75 %), and the point a . fig6 is a graph showing the relationship between 0 . 2 % yield point and temperature in the specimens , i . e ., the results of tensile tests made on the specimens . as will be seen from fig6 , the yield point of the alloy 5 of the present invention , which was obtained by adding a proper amount of n to the alloy 3 , was increased from that of the alloy 3 , and it was also superior to that of the alloy 1 of the known material in a temperature range of from the room temperature to high temperature . fig7 is a graph showing the relationship between charpy absorbed energy and aging treatment time when the aging treatment was performed at 700 ° c . the charpy absorbed energy of the alloy 5 of the present invention was higher than that of the alloy 1 of the known material even before the heat treatment , and no embrittlement was caused in the alloy 5 even with the aging treatment unlike the alloy 1 . the structure of the alloy 5 observed by an electron microscope was the same as these of the alloys 3 and 4 in both states before and after the aging treatment . fig8 illustrates metal structures of the ni — fe based super alloy according to the present invention , which were observed by an optical microscope before and after oxidation treatment . in the alloy 5 of the present invention , the c content was smaller than in the alloy 1 , but the amount of precipitated carbides was comparable because of addition of n . accordingly , the crystal grain size was also comparable . also , nbc was observed in large amount in the alloy 1 of the known material , whereas tic was observed in large amount in the alloy 5 . as a result of performing the oxidation treatment on those alloys at 600 ° c ., in the alloy 1 containing a large amount of nbc , nbc in an outer surface of the alloy and surroundings thereof were noticeably oxidized and the carbides were dropped with the oxidation . those portions causing dropping of the carbides may possibly become crack start points . on the other hand , tic contained in the alloy 5 in large amount was oxidized on the side near the outer surface , but noticeable oxidation appeared in the surroundings of tic and defects possibly becoming the crack start points were not caused . this is the reason why the charpy absorbed energy remain high as mentioned above . from those results , it is understood that finer crystal grains can be formed and the yield point can be increased with addition of n without increasing the number of crack start points . thus , according to this embodiment , it is apparent to be able to obtain a ni — fe based super alloy capable of suppressing a reduction in both yield point and toughness at high temperatures even when exposed to the high temperatures . also , the ni — fe based super alloy has productivity in making a large - sized ingot comparable or superior to in718 and in706 . further , the super alloy can be used at temperatures higher than in718 and in706 . by using the ni — fe based super alloy of the present invention , a gas turbine operating with high efficiency can be provided . additionally , since it is possible to increase the combustion temperature and the compression ratio and to reduce the amount of cooling air required , a gas turbine operating at even higher thermal can be provided . fig9 is a partial sectional view showing a rotating section and thereabout of a gas turbine according to one embodiment of the present invention . as shown in fig9 , the gas turbine comprises a turbine stub shaft 1 , three stages of turbine blades 2 , turbine stacking bolts 3 , two annular turbine spacers 4 , distant pieces 5 , three stages of turbine nozzles 6 , a turbine compartment 7 , a combustor 8 , two stages of annular shrouds 9 , three stages of turbine disks 10 , and through holes 11 . though not shown , the gas turbine of this embodiment further comprises a distant piece coupled to the turbine disk 10 , a plurality of compressor disks coupled to the distance piece , compressor blades mounted to the compressor disks and compressing air , and a compressor stub shaft integrally coupled to a first stage of total 17 stages of the compressor disks . in another case , the turbine blades 2 many be provided in four stages . in any case , the turbine blade disposed on the side of an inlet for combustion gases constitutes a first stage . then , second and third stages ( and , if present , a fourth stage ) follow successively downstream . arrows indicated by dotted lines represent paths of high - temperature cooling air compressed by a compressor and flowing into the gas turbine . the turbine disks 10 and the turbine spacers 4 in this embodiment were each produced through the steps of melting , by rf vacuum fusion , an alloy having substantially the same composition as the alloy 3 shown in table 1 , then melting it again by electroslag fusion , and successively performing forging , solution treatment and two - stage aging treatment in a similar manner to that in the first embodiment . after the heat treatment for aging , the resulting material was likewise subjected to the tensile test and the v - notch charpy impact test . as a result , it was confirmed that each specimen had similar characteristics and electron microscopic structure as those of the alloy 3 in the first embodiment . in this embodiment , the three stages of turbine disks 10 and the two turbine spacers 4 were all made of materials having the same composition . any of those parts was machined into a final shape after the heat treatment . each of the turbine disks 10 has an outer diameter of 1000 mm and a thickness of 200 mm with through holes 11 formed therein . numeral 12 denotes a portion where a hole for insertion of the stacking bolt 3 is formed , and 13 denotes a portion where the turbine blade 2 is mounted . the mount portion is provided by forming an axial recess in the shape of an inverted christmas tree along all over an outer peripheral portion of the turbine disk 10 . a dovetail of the turbine blade 2 is implanted into the mount portion . additionally , the thickness of the turbine blade 2 in the portion where the hole for insertion of the turbine stacking bolt 3 is formed is slightly larger than that in the portion of the through hole 11 , and the turbine blade 2 has the largest thickness in a central portion where the through hole 11 is formed . each of the turbine spacers 4 is an annular member and has an insertion hole in a portion where the turbine stacking bolt 3 is to be inserted . also , the turbine spacer 4 has projections and recesses in the form of comb teeth in engagement with the shroud 9 disposed on the side of the turbine nozzle 6 . further , the turbine spacer 4 has annular bosses supported by the turbine disk 10 when the gas turbine is rotated at high speed . with the construction described above , the gas turbine is capable of operating at a compression ratio of 14 . 7 , temperature of not lower than 450 ° c ., and the gas temperature of not lower than 1300 ° at an inlet of the first - stage turbine nozzle , and thermal efficiency ( lhv ) of not less than 35 % can be obtained . thus , by producing the turbine disks 10 and the turbine spacers 4 using the ni — fe based super alloy of the present invention , which has a high yield point at high temperatures and shows less embrittlement under heating as described above , it is possible to provide a gas turbine having higher reliability from the total point of view .
| 5 |
what is needed is a method to allow a memory controller to be able to view a processor bus queue , to begin processing of a memory fetch that may be issued , prior to its issuance on the processor bus . an embodiment of the present invention may provide a method for a processor to communicate information about a next memory fetch it may issue as part of a currently issued memory fetch ( i . e ., bus request ). this may allow a memory controller to begin the next memory fetch while the next memory fetch may still be in the processor bus queue , and prior to its issuance on the processor bus . when the next memory fetch is then issued , a memory access ( e . g ., dram access ) has already commenced , and the data may be returned with reduced latency . the information about the next memory fetch may be referred to as a next fetch hint . fig1 is a block diagram of a bus - based system 100 in accordance with an embodiment of the present invention . the bus - based system 100 may include a processor 102 connected to a memory controller 104 via a processor bus 106 . the processor 102 may include a processor bus queue 108 . fig2 is a schematic representation of a bus request 200 in accordance with an embodiment of the present invention . in a standard bus - based signaling protocol , a bus request 200 may consist of a request phase 202 , during which an address 204 , request type 206 , and other attributes 208 may be driven by an agent ( e . g ., the processor 102 ) on the bus ( e . g ., the processor bus 106 ). all other slave agents on the bus may perform a snoop of their caches / directories , and report snoop results . the snoop results may be gathered by a central agent ( e . g ., the memory controller 104 ) and the results may be signaled during a response phase ( not shown ). in an embodiment , the processor bus 106 may be a quad pumped data bus . in a quad pumped data bus , bus requests 200 may be issued once every other cycle , and may queue up inside the processor bus queue 108 , waiting for their time slice on the processor bus 106 . the presence of other requesters on the processor bus 106 may cause further queuing within the processor bus queue 108 . in an embodiment , the processor 102 may examine a next queued request ( e . g ., a next memory fetch ) in the processor bus queue 108 , and provide a next fetch hint 210 as part of a currently issued memory fetch ( i . e ., bus request 200 ). the next fetch hint 210 may indicate the address of the next memory fetch . the operation of the bus - based system 100 is now described with reference to fig1 and 2 , and with reference to fig3 which illustrates a method 300 for reducing memory fetch latency using a next fetch hint in accordance with an embodiment of the present invention . with reference to fig3 , in operation 302 , the method may begin . in operation 304 , a next memory fetch queued in the processor bus queue 108 may be examined in generating the next fetch hint 210 . in operation 306 , the currently issued memory fetch ( i . e ., bus request 200 ) may be issued from the processor 102 to the memory controller 104 over the processor bus 106 . the currently issued memory fetch may include the next fetch hint 210 . the next fetch hint 210 may include information about a next memory fetch . in operation 308 , the currently issued memory fetch may be processed by the memory controller 104 . the processing of the currently issued memory fetch may include beginning a memory access corresponding to the next memory fetch before the next memory fetch is received by the memory controller . the beginning of the memory access corresponding to the next memory fetch may be in response to the next fetch hint 210 . in operation 310 , a response may be issued from the memory controller 104 to the processor 102 . in an embodiment , to take advantage of streaming applications , or “ adjacent sector ” prefetch behavior of the processor 102 , the next fetch hint may be a limited subset of next possible fetches . for example , if two bits of the request phase 202 were used as the next fetch hint 210 , the possible combinations could be ( assuming a 64 kb cacheline ): 00 — no next fetch hint ; 01 — the next bus request may be to the following 64 b cacheline ; 10 — the next bus request may be to the following 128 b cacheline ; and 11 — the next bus request may be to the previous 64 b cacheline . fig4 a is a schematic representation of commands 400 within the processor bus queue 108 showing application of such a next fetch hint convention . fig4 b is a schematic representation of a request stream 402 of the processor 102 . in fig4 a , each of the commands 400 is represented with a position , the command itself , and an address . for example , at position 0 , there may be a read command to read from address 0x100 . at position 1 , there may be a read command to read from address 0x140 . in fig4 b , each request may include a position , a command , an address , and a next fetch hint . for example , for the command at position 0 , the command may be to read from address 0x100 and the next fetch hint may be 01 ( i . e ., to the following cacheline ). for the command at position 1 , the command may be to read from address 0x140 and the next fetch hint may be 01 ( i . e ., to the following cacheline ). the memory controller 104 may use the next fetch hint 214 to manipulate the address of the current bus request 200 , and issue a subsequent request of the new address to memory prior to the processor 102 actually issuing its request ( e . g ., next memory fetch ). then , when the processor 102 does issue its request , the request may be matched with the already in - flight memory ( e . g ., dram ) access , resulting in a lower latency for the second request . the foregoing description discloses only exemplary embodiments of the invention . modifications of the above - disclosed embodiments of the present invention of which fall within the scope of the invention will be readily apparent to those of ordinary skill in the art . for instance , although embodiments are described with reference to environments including a processor bus , in alternative embodiments , environments may include a process bus interface and / or network protocol . further , although the next fetch hint 210 is described as two - bits of the request phase 202 , a larger or smaller number of bits could be used . similarly , a larger or smaller number of possible next fetch hints could be possible . accordingly , while the present invention has been disclosed in connection with exemplary embodiments thereof , it should be understood that other embodiments may fall within the spirit and scope of the invention as defined by the following claims .
| 6 |
as can be seen firstly from fig1 and 2 , a system side of a self - locking belt retractor is shown comprising a belt shaft 10 with a shaft extension 11 projecting therefrom along a shaft axis defined by the belt shaft 10 , wherein the belt shaft 10 serves as mounting means and as drive means for the system parts connected to the belt shaft 10 . a blocking catch 12 is mounted on the belt shaft 10 and is able to be swung out radially for engagement into a toothed blocking ( not illustrated ) fixed to the housing , wherein the blocking catch 12 has a guide pin 12 a projecting in the shaft axis . the guide pin 12 a engages into a link formed on a control disc 13 , such that the control disc 13 rotates respectively together with the belt shaft 10 . in the case of a response by a vehicle - sensitive and / or belt - webbing - sensitive control system which is to be described below , the control disc 13 is blocked from further rotary movement , so that relative rotation is produced between the stationary control disc 13 and the rotating belt shaft 10 , wherein this relative rotation is converted by the guide pin 12 a , which is guided in the control disc 13 , into the radial deflection of the blocking catch 12 . this radial blocking principle is known to those of ordinary skill in the art and will therefore not be described in greater detail . an essential functional component of the belt retractor is the control disc , designated by 13 , which consists of a platform 14 and a ring 16 externally surrounding the platform 14 . on the platform 14 of the control disc 13 , an inertial mass 15 is swivellably mounted swivellably thereon , which forms the belt - webbing - sensitive control system described below . a wobble plate 17 arranged adjacent to the control disc 13 and cooperating functionally therewith , has cams 18 on its underside facing the control disc 13 . the wobble plate 17 includes a recess having an inner toothing 23 for slidably engaging an externally toothed extension 22 of the platform 14 , so that when the control disc 13 is rotating with the belt shaft 10 , the control disc 13 drives the wobble plate 17 and entrains it in a rotating manner . the system side of the belt retractor is surrounded and covered by a housing cap 19 having an internal toothing 20 fixed to the cap 19 on its inner side . the functional parts of the system side of the belt retractor described above are held together by an adapter piece 21 which carries the platform 14 of the control disc 13 by a projecting flange 35 . at its end facing the housing cap 19 , the adapter piece 21 has a detent groove 36 which can be inserted into a corresponding detent configuration on the inner side of the housing cap 19 so that the adapter piece 21 is able to be engaged thereon . as the control disc 13 and the wobble plate 17 are arranged on the adapter piece 21 , a pre - mounted assembly is produced by way of the control disc 13 and the wobble plate 17 being able to be secured with the associated functional parts ( discussed below ) on the housing cap 19 via the adapter piece 21 . the shaft extension 11 of the belt shaft 10 engages into the adapter piece 21 with a form - fitting connection , wherein the adapter piece 21 is able to be engaged with the shaft extension 11 of the belt shaft 10 via a detent window 37 during the final mounting of the belt retractor . as can be further seen from fig2 , the ring 16 has both an outer toothing 25 and an inner toothing 26 . outside the control disc 13 , a vehicle sensor 24 is secured on the inner side of the housing cap 19 , wherein a sensor lever of the vehicle sensor 24 comes into engagement with the outer toothing 25 of the ring 16 of the control disc 13 based on corresponding vehicle accelerations or vehicle decelerations as understood to those of ordinary of skill in the art , and thereby blocks the ring 16 from further rotary movement . on the platform 14 of the control disc 13 , a locking lever 27 is swivellably mounted between an activation position and a cutoff or disabling position . in the activation position , the locking lever 27 is in engagement with the inner toothing 26 of the ring 16 . as such , the externally toothed ring 16 is therefore connected to the platform 14 via the locking lever 27 , so that in light of conventional control discs , a control disc 13 is formed which is capable of functioning . when the sensor lever of the vehicle sensor 24 engages into the outer toothing 25 of the control disc 13 during this activation position , the control disc 13 is stopped from further rotary movement and the blocking movement of the blocking catch 12 is brought about . on the other hand , when the locking lever 27 is controlled such that it is not in engagement with the inner toothing 26 of the ring 16 , and is in fact in engagement with the sensor lever of the vehicle sensor 24 via the outer toothing 25 of the ring 16 , the ring 16 remains at a standstill , but the platform 14 , which is connected to the belt shaft 10 , continues to rotate , so that the necessary relative rotation is not brought about ; thus , the vehicle - sensitive control system is cut off . as can be further seen from fig4 , the belt - webbing - sensitive control system is realized through the arrangement of the inertial mass 15 mounted movably on the platform 14 . during normal rotations of the shaft 10 , the inertial mass 15 lies within the contour of the platform 14 , so that the platform 14 or the control disc 13 rotates together with the belt shaft 10 . if a rapid belt withdrawal movement occurs , then the inertial mass 15 remains behind the rotating platform 14 and is thereby deflected . with this deflection , a blocking tooth 40 formed on the inertial mass 15 engages into the toothing 20 of the housing cap 19 , so that further rotary movement of the control disc 13 is stopped and the relative rotation between the control disc 13 and belt shaft 10 occurs , thereby bringing about the blocking of the belt retractor . it can be seen from fig5 that the locking lever 27 is arranged on the platform 14 such that in its inwardly swiveled position , wherein the locking lever 27 is not in engagement with the inner toothing 26 , it abuts against the inertial mass 15 which is mounted so as to be swivellably movable , and thereby secures the latter against swivelling movement . as the inertial mass 15 is therefore secured by the locking lever 27 , the function of the inertial mass 15 described above can no longer occur in the case of rapid belt webbing withdrawal . in this respect , it can be seen that through the single switching movement of the locking lever 27 , both the vehicle - sensitive control system and the belt - webbing - sensitive control system is cut off or functionally disabled . it can also be seen from fig5 that as an additional security measure for the disabling of the control systems , a locking tooth 33 projecting in the direction of the shaft extension 11 of the belt shaft 10 is formed on the lever 27 . in the cutoff position of the locking lever 27 ( fig5 ), the locking tooth 33 comes into engagement with a peripheral recess 34 provided on the periphery of the shaft extension 11 , so that in this engagement position the belt shaft 10 and the control disc 13 are non - rotatably locked with each other . therefore , relative rotation between the control disc 13 and the belt shaft 10 , which is necessary for the blocking of the belt retractor , is prevented . the belt retractor may also have an alr / elr switchover function . for this function , a separate switching lever 28 is mounted on the platform 14 . in the alr switching position , in which the control disc 13 is secured against further rotation , the switching lever is to be swiveled outwards to engage with the toothing 20 of the housing cap 19 . in order to carry out the corresponding swivelling and switching movements of the locking lever 27 and switching lever 28 , the two levers have a guide pin , 27 a and 28 a , respectively , wherein these guide pins 27 a , 28 a are guided in the cams 18 of the wobble plate 17 , so that controlling the movements of the locking lever 27 and switching lever 28 takes place via the rotation of the wobble plate 17 . fig6 - 8 illustrate an alternative embodiment of the control disc 13 with the functional parts arranged thereon . insofar as the control disc 13 illustrated in fig6 in its functional position during activation of both the vehicle - sensitive and the belt - webbing - sensitive control system , i . e . in the elr switching state , corresponds to the embodiment illustrated in fig4 and already described , those features are denoted by identical reference characters and will not be described in detail below . the embodiment illustrated in fig6 shows the locking lever 27 in the deflected position and in engagement with the inner toothing 26 of the ring 16 . the switching lever 28 is situated in its swiveled - in position , wherein the switching lever 28 engages with an inner spring arm 50 into a recess 51 formed on the extension 22 of the platform 14 of the control disc 13 . in the illustrated embodiment , the locking lever 27 and switching lever 28 are arranged in different planes staggered in an axial direction of the control disc 13 . the locking lever 27 has an attachment 52 extending into the plane of movement of the switching lever 28 and carrying the guide pin 27 a . as will be described in greater detail below , the attachment 52 cooperates with the switching lever 28 in a switching position of the locking lever 27 . at the same time , the inertial mass 15 axially extends along its height over both movement planes of the locking lever 27 and switching lever 28 . in addition , the inertial mass 15 has a cutout 53 , arranged in the movement plane of the switching lever 28 , to receive the switching lever 28 so that the switching lever 28 respectively follows the control movements of the inertial mass 15 . with this step , a space - saving construction of the control disc 13 is achieved with the functional parts formed thereon . the arrangement of the attachment 52 lying in the movement plane of the switching lever 28 on the locking lever 27 helps bring about the disabling of the belt - webbing - sensitive control system . in particular , for the case where a cutoff of the guide pin 28 a situated on the switching lever 28 were to occur due to a very rapid belt webbing withdrawal reaching the elr / alr switchover point , the foregoing arrangement brings the switching lever 28 and hence the belt - webbing - sensitive control system in its cutoff position via the cutoff movement of the locking lever 27 by means of the associated cam , and at the same time , via the abutment of the attachment 52 on the switching lever 28 , in which case a blocking of the belt shaft is no longer possible . in fig7 , the control disc 13 of fig6 is illustrated in the alr switching state . as can be seen , the switching lever 28 is swiveled radially outwards , wherein its spring arm 50 has emerged out of the recess 51 and lies with a corresponding pre - stressed tension on the extension 22 of the platform 14 . if a controlling back of the switching lever 28 occurs on the switchover from the alr switching state into the elr switching state , the spring arm 50 engages again into the recess 51 , so that the elr switching state is defined . in fig8 , the cutoff of both the vehicle - sensitive and the belt - webbing - sensitive control system is illustrated , in which the locking lever 27 is guided inwards out of engagement with the inner toothing 26 of the ring 16 . in so doing , the locking lever 27 at the same time secures the inertial mass 15 , so that the belt - webbing - sensitive control system cannot respond . at the same time , the switching lever 28 is in a swiveled - in position , so that no blocking of the belt shaft can be brought about . as can be seen from fig9 , an eccentric bearing 29 for the wobble plate 17 is formed on the inner side of the housing cap 19 , so that the rotary drive of the wobble plate 17 , brought about via the engagement of the inner toothing 23 of the wobble plate 17 with the externally toothed extension 22 of the control disc 13 or the platform 14 , is able to be converted at the same time into an eccentric - radial displacement of the wobble plate 17 . in fig1 and 11 , the construction of the wobble plate 17 is shown , wherein the wobble plate 17 is arranged to control the switching movements of the locking lever 27 and switching lever 28 . as can be seen firstly from fig1 , the wobble plate 17 has a strip 54 extending over its periphery and projecting axially into the plane of the guide pins 27 a , 28 a of the locking lever 27 and switching lever 28 , respectively . the wobble plate 17 also has a bearing ring 55 , projecting parallel to the strip 54 , for the bearing of the wobble plate 17 . the strip 54 is arranged with a radial distance to both the bearing ring 55 and the outer periphery of the wobble plate 17 . moreover , an inner cam 30 and an outer cam 31 respectively formed on the inner and outer side of the strip 54 is provided for the guide pin 27 a of the locking lever 27 , and at least one opening 32 is provided as a radial transition section for the passage of the guide pin 27 a between the inner cam 30 and the outer cam 31 . on their running paths for the guide pins 27 a , 28 a of the locking lever 27 and switching lever 28 , the cams 30 , 31 have an undulating contour for equalizing the movements of the wobble plate with respect to the guide pins 27 a , 28 a of the locking lever 27 and switching lever 28 , revolving with the control disc 13 . owing to the strip 54 , extending over the entire periphery , with cams 30 , 31 , the guide pin 27 a of the locking lever 27 is guided during the entire rolling and unrolling movement of the belt shaft 10 on the cams 30 , 31 . the wobble plate 17 is designed so that a full revolution of the wobble plate 17 corresponds to the revolutions of the belt shaft 10 carried out during the unwinding or winding of the belt webbing between the complete winding state and the complete unwinding state . depending on the length of the belt webbing wound on the belt shaft 10 of the belt retractor , the belt shaft 10 can carry out 14 to 16 revolutions , for example , with a complete revolution of the wobble plate 17 . to control the switching lever 28 , the wobble plate 17 additionally has a third cam 56 , which is formed by the outer periphery of the bearing ring 55 of the wobble plate 17 . in addition , at the switchover point from the elr to the alr switching state of the belt retractor with almost complete belt webbing withdrawal , a radial cross - piece 57 is arranged between the bearing ring 55 and the strip 54 for the radial guidance of the guide pin 28 a of the switching lever 28 out of its cam 56 for the elr switching state and up to abutment against the inner cam 30 of the strip 54 during the alr state , wherein with the unrolling movement of the belt webbing from the belt shaft , the guide pin 28 a reaches the cross - piece 57 at the end of the belt webbing withdrawal and is re - routed by the cross - piece 57 into its swiveled - out position . in addition , the strip 54 has a section 58 in the region of its inner cam 30 , wherein the section 58 is directed radially inwards to the bearing ring 55 . in this manner , after a rolling movement of the belt webbing , ( i . e ., corresponding to the path of the guide pin 28 a of the switching lever 28 from the cross - piece 57 along the inner cam 30 ), onto the belt shaft of the guide pin 28 a , a re - routing takes place from the inner cam 30 to the cam 56 on the bearing ring 55 , whereby the elr switching state is reproduced . in fig1 , the path of the guide pin 27 a for controlling the locking lever 27 , and the path of the guide pin 28 a for controlling the switching lever 28 , is shown for the control contour illustrated in fig1 . here , the guide pin 27 a is illustrated in the position with a fully wound belt webbing ; the illustration in dashed lines makes it clear that in particular embodiments a greater amount of belt webbing can be wound on the belt shaft 10 . as can be seen from the illustration of the path line 59 for the movement of the guide pin 27 a , at the start of the unwinding of the belt webbing , the guide pin 27 a firstly follows the inner cam 30 up to the opening 32 , by which the guide pin 27 a is deflected radially outwards . then , on further unwinding of the belt webbing , the guide pin 27 a follows the outer cam 31 , in which the locking lever 27 is guided in engagement with the toothing 26 of the ring 16 , and hence produces the function of the control disc 13 . accordingly , on winding of the belt webbing , the control pin 27 follows the path line 59 up to its initial position . correspondingly , for the movement of the guide pin 28 a of the switching lever 28 , the path line 60 is similarly illustrated in fig1 , and it can be seen here that the guide pin 28 a , firstly up to reaching the switchover point defined by the cross - piece 57 , is guided on the cam 56 of the bearing ring 55 , whereby the swiveled - in position of the switching lever 28 is defined . when the belt webbing is ( almost ) completely unwound from the belt shaft and therefore the alr switching state is to be brought about , the guide pin 28 a is deflected radially outwards via the cross - piece 57 . if after a certain extent of winding of the belt webbing onto the belt shaft 10 , a switching over is to take place again from the alr switching state to the elr switching state , then firstly the guide pin 28 a follows the inner cam 30 , during the return rotation of the belt shaft 10 , until the guide pin 28 a reaches the section 58 arranged in the region of the opening 32 , via which the guide pin 28 a is guided back in abutment against the bearing ring 55 , and hence into the path of the cam 56 , in which the switching lever 28 is not engaged with the toothing 20 of the housing cap 19 . in fig1 , another embodiment of the wobble plate 17 is illustrated . here , the strip 54 with the cams 30 , 31 formed thereon extends only over a partial region of the periphery of the wobble plate 17 , wherein the partial region is traveled through by the guide pin 27 a of the locking lever 27 after initial belt webbing withdrawal , wherein the guide pin 27 a is in a position such that it is guided outwards to engage with the inner toothing 26 of the ring 16 . in the other , remaining peripheral region , radially outwardly directed cross - pieces 60 are arranged on the wobble plate 17 such that with corresponding control movements , the guide pin 27 a of the locking lever 27 can enter between the cross - pieces 61 . insofar as the control pin 27 a , with initial belt webbing withdrawal , travels in the peripheral direction through a curved line , the cross - pieces 61 are arranged with an adapted position , aligned obliquely to the peripheral direction , and have at their inner end a flattened introduction surface 62 for the guiding of the guide pin 27 a into the spaces respectively existing between the cross - pieces 61 . as such , in the case of high initial accelerations of a belt webbing withdrawal , the guide pin 27 a does not strike against the cam 30 formed in this region ( i . e ., according to the embodiment described with respect to fig1 and 11 ), and does not break off under these circumstances . rather , the guide pin 27 a can enter radially outwards into the spaces existing between the cross - pieces 61 and in so doing , the guide pin 27 a is not subject to any stress . since in such a case of a high acceleration of belt webbing withdrawal , the belt - webbing - sensitive control system would at the same time respond with a blocking of the belt shaft 10 , further rotation of the belt shaft 10 would be prevented , so that the guide pin 27 a no longer carries out a movement in the peripheral direction of the wobble plate 17 . if the belt webbing is slackened to release this blocking state , the guiding pin 27 a slips out of the region of the cross - pieces 61 again , and can then take its path up to the opening 32 with a correspondingly slower withdrawal movement . in fig1 and 15 , respectively , the control disc 13 is again illustrated with the levers 27 , 28 arranged thereon and in cooperation with the cams 30 , 31 , 56 of the wobble plate 17 . here , fig1 in turn shows the alr switching state , in which the switching lever 28 is in its guided - out position in engagement with the toothing 20 of the housing cap 19 , in which the guide pin 28 a lies against the inner cam 30 of the strip 54 . in this position , the locking lever 27 is guided into the outer toothing 26 of the ring 16 , and in this respect , the guide pin 27 a lies against the outer cam 31 . in this respect , therefore , an immediate readiness for blocking exists in the case of a belt webbing withdrawal , as is provided for the alr operation . fig1 once again shows the state in which both the vehicle - sensitive and the belt - webbing - sensitive control system is cut off . in this respect , the guide pin 27 a of the locking lever 27 is guided on the inner cam 30 , so that the locking lever 27 is not in engagement with the outer toothing 27 of the ring 16 , and so that the ring 16 rotates on access of the vehicle sensor and no blocking is initiated . at the same time , the locking lever 27 lies against the inertial mass 15 and therefore blocks the response of the belt - webbing - sensitive control system . the switching lever 28 lies in its inner position with abutment of the guide pin 28 a against the control cam 56 , which , however , is without functional significance for the cutoff of the belt - webbing - sensitive and vehicle - sensitive control system . the features of the subject matter of the present invention , as disclosed in the above description , the claims , the abstract , and the drawings , can be essential individually and also in any desired combinations with each other for the realization of the invention in its various embodiments . as a person skilled in the art will readily appreciate , the above description is meant as an illustration of the principles of this invention . this description is not intended to limit the scope or application of this invention in that the invention is susceptible to modification , variation and change , without departing from spirit of this invention , as defined in the following claims .
| 1 |
the synthesis of the preferred type of anion desired for use in the present invention begins with the double hydroboration of an alkyl - substituted acetylene reagent of the formula rch . tbd . ch , where r is branched lower alkyl , such as t - butyl . this is accomplished by using a boron dihalide hydroboration agent , such as hbcl 2 . this can be generated in - situ using the corresponding bx 2 derivative and a silane ( e . g ., me 3 sih ) to yield the desired hydroboration product which is of the formula where x is halo , such as chloro and r is branched lower alkyl , such as t - butyl . the hydroboration product from the previously described step is then preferably reacted with lithium pentafluorophenyl which had been generated by the lithiation of bromopentafluorobenzene , under cooling conditions , to afford a reaction mixture which comprises a predominate amount of the following compound the next step in the process is the delivery of a hydride moiety to the previously described compound by the reaction of such compound with , preferably , potassium triethyl borohydride in tetrahydrofuron ( thf ), to yield a product of the following formula : ## str4 ## where r is as defined above . the foregoing anion can be readily converted to its ammonium salt , as depicted in example 4 hereinbelow , by reaction with a trialkylammonium halide ammoniating reagent , such as tributylammonium chloride , in an appropriate solvent , such as a hydrocarbon solvent , to yield the ammonium salt depicted in example 4 hereinafter . once the ammonium salt , previously described , has been formed , it can be reacted with a cyclopentadienyl - substituted metallocene , such as dicyclopentadienyl zirconium dimethyl or analogous compounds where the zirconium atom has been substituted with another group ivb metal , such as titanium or hafnium or an actinide metal , such as thorium , to yield the desired cationic species . the present invention will be further understood by reference to the examples which follow . in this example , as well as all those which follow , all procedures were performed under air - free and moisture - free conditions . any solvents that were employed were distilled from sodium / potassium amalgam . the compound cl 2 bch ( ch 2 tbu ) bcl 2 , &# 34 ; tbu &# 34 ; meaning t - butyl , was synthesized by first dissolving t - butylacetylene ( 4 . 10 g , 0 . 050 mol ) and trimethyl silane ( 3 . 75 g , 0 . 051 mol ) in pentane ( 100 ml ). the solution was cooled to - 78 ° c . and was then cannulated into a boron trichloride solution ( 52 ml , 1 . 0 m in hexanes ) in a - 78 ° c . cold bath . the solution was stirred for two hours at - 78 ° c . and warmed up to room temperature . after the solvent was pumped away , the colorless liquid product was vacuum transferred at 80 ° c . and collected ( yield 95 %). h 1 nmr ( c 6 d 6 )= δ 0 . 63 ( 9h ), 1 . 83 ( d , 2h ) 2 . 55 ( b , 1h ). this example illustrates the synthesis of a compound of the formula ( c 6 f 5 ) 2 bch ( ch 2 tbu ) b ( c 6 f 5 ) 2 using the compound synthesized in example 1 . c 6 f 5 br ( 12 . 6 g , 0 . 051 mol ) was dissolved in 500 ml of pentane , and the solution was cooled to - 78 ° c . a solution of n - butyl lithium ( 32 ml , 1 . 6 m in hexanes ) was then injected . after the mixture was stirred at - 78 ° c . for one hour , the compound from example 1 ( 2 . 77 g , 0 . 011 mol ) was added dropwise , and the mixture was then allowed to warm to room temperature over a period of twelve hours . the solution was filtered , and the solvent was removed under vacuum . the desired crude product ( 5 . 2 g ) was obtained as a sticky yellowish oil ( yield = 60 %). 1 h nmr ( c 6 d 6 ): δ 0 . 76 ( s , 9h ), 2 . 21 ( d , 2h ), 3 . 53 ( b , 1h ). this example illustrates preparation of the anion ## str5 ## from the compound synthesized in example 2 . the crude compound from example 2 ( 3 . 87 g , 0 . 005 mol ) was dissolved in 100 ml of toluene . a solution of ket 3 bh ( 5 ml , 1 . 0 m solution in tetrahydrofuran , thf ) was added dropwise to the solution at room temperature while the solution was stirred . after two hours , the solvent was removed , and the resulting yellow oil was washed twice with 50 ml of pentane . the solid was then dissolved in 20 ml of toluene and was then precipitated out with 100 ml of pentane . a solid white product ( 2 . 5 g ) was obtained ( yield = 60 %). 1 h nmr ( c 6 d 6 ): δ 1 . 32 ( s , 9h ), 1 . 39 ( t , 4h ), 1 . 42 ( d , 2h ), 2 . 19 ( b , 1h ), 2 . 37 ( b , 1h ), 3 . 48 ( t , 4h ); 19 f nmr ( c 6 d 6 ): δ - 130 . 8 ( b ), - 133 . 7 ( b ), - 157 . 5 ( t ), - 158 . 0 ( t ), - 163 . 4 ( b ), - 163 . 8 ( b ). the anion synthesized in example 3 was converted to the ammonium salt of the formula ## str6 ## in this example . equivalent quantities of the anion from example 3 and bu 3 nhcl were dissolved in toluene and were stirred for four hours . the solution was filtered , and pentane was added to precipitate a white product . the yield was almost quantitative . 1 h nmr ( c 6 d 6 ): δ 0 . 69 ( m , 9h ), 0 . 88 ( m , 12h ), 1 . 30 ( s , 9h ), 1 . 67 ( d , 2h ), 2 . 18 ( m , 6h ), 3 . 05 ( b , 1h ); 19 f nmr ( c 6 d 6 ): δ - 128 . 9 ( b ), - 131 . 3 ( b ), - 159 . 3 ( t ), - 159 . 8 ( t ), - 165 . 0 ( t ), - 165 . 4 ( b ). anal . calcd : c , 52 . 46 ; h , 4 . 30 ; n , 1 . 45 . found : c , 51 . 67 ; h , 4 . 14 ; n , 1 . 20 . the desired cationic complex useful in olefin polymerization was synthesized in this example . the compound synthesized in example 4 ( 0 . 1922 g , 0 . 0002 mol ) and bis ( pentamethylcyclopentadienyl ) thorium dimethyl ( 0 . 1064 g , 0 . 00021 mol ) were loaded into a flask and then 20 ml of benzene was condensed into the flask under vacuum at - 78 ° c . while it was stirred , the mixture was allowed to warm up to room temperature . a white slurry was obtained . after filtration and solvent evaporation , 0 . 12 g of white solid was collected ( yield = 40 %). 1 h nmr ( c 6 d 6 - thfd 8 ): δ 0 . 17 ( s , 3h ), 1 . 30 ( s , 9h ), 1 . 62 ( s , 30h ), 1 . 73 ( d , 2h ), 2 . 27 ( b , 1h ), 3 . 24 ( b , 1h ); 19 f nmr : δ - 129 . 2 ( b ), - 131 . 4 ( b ), - 159 . 0 ( t ), - 159 . 5 ( t ), - 164 . 2 ( b ), - 164 . 8 ( b ). anal . calcd : c , 47 . 39 ; h , 3 . 59 ; n , 0 . 00 ; found : c , 47 . 08 ; h , 3 . 35 ; n , 0 . 00 . in this example the same procedure as employed in example 5 was used except that toluene was used as the solvent . the product was yellow . the yield was 50 %. 1 h nmr ( c 6 d 6 - thfd 8 ): δ 0 . 00 ( s , 3h ), 1 . 28 ( s , 9h ), 1 . 43 ( s , 30h ), 1 . 71 ( d , 2h ), 2 . 24 ( b , 1h ), 3 . 23 ( b , 1h ); 19 f nmr : δ - 128 . 4 ( b ), - 131 . 4 ( d , b ), - 160 . 6 ( t ), - 161 . 0 ( t ), - 165 . 8 ( t , b ), - 166 . 1 ( b ). the polymerization of ethylene is shown in this example using the catalyst synthesized in example 5 . the catalyst from example 5 ( 9 mg ) was loaded in a flask in which 30 ml of benzene was condensed . ethylene ( 1 atm ) was charged into the flask at room temperature with vigorous stirring of the solution . the catalytic reaction was quenched by methanol after three minutes . after removing the solvent under high vacuum overnight , polyethylene ( 0 . 98 g ) was obtained . the activity of the catalyst was calculated to be 2 . 80 × 10 6 gpe / mol atm h . in this example , polyethylene was synthesized using a catalyst generated in situ using the compound from example 4 as one component thereof . catalyst was generated in situ by loading dicyclopentadienyl zirconium dimethyl ( 7 mg ) and the compound of example 4 ( 18 mg ) into a flask and stirring the mixture in 30 ml of toluene for ten minutes at room temperature . ethylene was then charged into the flask . it became impossible to stir in forty seconds due to the production of a large amount of polyethylene . the reaction was stopped by opening it to air . after removing the solvent under high vacuum overnight , polyethylene ( 0 . 82 g ) was obtained . the activity was 4 . 04 × 10 6 g pe / mol atm h . the foregoing examples , which are presented herein for illustrative purposes only , should not be construed in a limiting sense for that reason . the scope of protection sought is set forth in the claims which follow .
| 2 |
in the present embodiment , distributed systems management software monitors a collection of networked devices via snmp over a network . the networked devices run software agents , which handle the snmp communication with the distributed systems management software and monitor the performance of the networked devices . one feature of the agents examines the networked devices for configuration data , such as network addresses , physical components , resource allocations , and so forth . a subset of the configuration data may describe network resources consumed and provided by each network device , such as network addresses for the resource , access codes , preferred file directories ( if the resource is a file server ), and so forth . a dependency relationship exists between a first networked resource and a second networked resource if a problem in the first resource could cause a problem in the second . this is called the “ propagation ” of a problem from the second resource to the first . the second resource is said to depend on or “ consume ” the first . thus , the relationship from the second resource to the first is a “ consumer ” dependency relationship , while the relationship from the first to the second is a “ provider ” dependency relationship . the property describing whether a dependency relationship is consumer or provider with regard to its resources is its “ direction ”. a dependency relationship exists even if the second resource has a failover response , i . e . is configured to handle the first resource &# 39 ; s problem gracefully so that no problem actually occurs for the second resource . the number of resources involved in a given dependency relationship is called the “ degree ” of the dependency relationship . a relationship that involves just two resources is called “ binary ”. more complicated dependency relationships might not be binary but may involve three or more resources . such relationships can usually be expressed by a set of binary dependency relationships . a “ networked resource ” is an entity monitored by distributed systems management software ( hereafter “ systems management software ”). since there are many things that systems management software monitors , “ networked resource ” has a range of meanings . for example , a networked resource can be a software program . thus , an application or service hosted on a physical device , for instance encoded in a computer memory and executed by a processor , is a networked resource . a networked resource can be largely physical , as with an ethernet repeater whose function is primarily electrical and involves little information processing of the ethernet traffic it handles . a networked resource can also include both logical ( such as software ) and physical components of a networked device , as with a file server whose important functions include both filing system software and physical storage . another type of networked resource is a collection of resources , where the collection may be a logical construct , such as a level - three network route . collections such as groups of resources , for instance the group of servers at a physical location , or the group of workstations for a department , are also networked resources . the agents have plug - in architectures . each agent includes a dependency plug - in containing features specialized to manage dependency relationships between the networked resources . the dependency plug - in includes a dependency filter to extract dependency data from general configuration data ( as well as performance data and traffic analysis , as will be explained ). the dependency plug - in stores dependency data in a dependency repository . the dependency plug - in also enables a mib interface through which the systems management software can manage the agent , including periodically collecting management data that the agent has gathered , and configuring dependency data on the agent . the dependency mib interface exposes the table structures of the dependency repository . the agent can also raise snmp traps to the systems management software , with the traps being based on dependency data . using the dependency plug - in , the systems management software can automatically configure and activate agents specified by dynamic discovery of dependency data . the dependency plug - in also enables the systems management software to display dependency data to web browser via bfs and dfs indented reports . referring now to fig1 a , managed device 21 includes agent 30 . managed device 21 typically has some role on network 23 that makes it of interest to users of manager 22 . for instance , managed device 21 can be a user workstation or server . managed device 21 can also be a networked device that has a role in the operation of network 23 , such as a bridge , modem , switch , router , firewall , and the like . additionally , managed device 21 can be a device shared by users of network 23 , such as a printer or network storage . referring now to fig1 b , agent 30 contains computer instructions and runs on operating system 210 . for simplicity , fig1 b shows agent 30 interacting with one operating system 210 and related hardware , when in fact component processes of agent 30 may be distributed over multiple computing platforms 63 interconnected by network interfaces 214 . operating system 210 is a software process , or set of computer instructions , resident in either main memory 212 or non - volatile storage device 216 or both . processor 211 can access main memory 212 and non - volatile storage device 216 to execute the computer instructions that comprise operating system 210 and agent 30 . access is provided by bus 213 . for the purposes of this description , operating system 210 is understood to include networking services , regardless of whether the networking software is a core part of operating system 210 or is a third - party product . non - volatile storage device 216 can be writable storage , such as a disk drive , or read - only storage such as rom ( read - only memory ). bus 213 interconnects processor 211 , storage device 216 , main memory 212 , and network interface 214 . network interface 214 includes a device and software driver to provide network functionality , such as an ethernet card configured to run tcp / ip , for example . managed device 21 can have multiple network interfaces 214 , for example as required by bridges and the like . optionally , managed device 21 includes installed software package 217 . installed software package 217 typically has files in non - volatile storage device 216 related to installation or configuration of the package . agent 30 is written primarily in the programming language c . the c code of agent 30 is compiled into lower - level code , such as machine code , for execution on managed device 21 . some components of agent 30 can be written in other languages such as c ++ and java and incorporated into the main body of software code via component interoperability standards . referring now to fig1 a , agent 30 assists manager 60 in managing managed device 21 over network 23 . agent 30 is a software process running on managed device 21 , in part because common security measures can preclude remote processes from discovering certain privileged information , such as configuration parameters for networking functions . agent 30 includes configuration data discoverer 31 , which “ instruments ” ( i . e ., takes samples of , or measures ) configuration parameters 215 and other properties of managed device 21 . configuration data discoverer 31 can also analyze network traffic on network interface 214 to discover relationships such as network addresses and protocols in current use by managed device 21 . for example , ip network traffic involving well - known port 80 , which is reserved for the http protocol , allows configuration data discoverer 31 to infer that a web server is in use . in general , configuration data discoverer 31 is a general - purpose process for gathering any data that agent 30 requires about managed device 21 . an example of commercially available agent is systemedge , a product of concord communication , inc ., of marlboro , mass ., usa . configuration data discoverer 31 represents managed device 21 properties as configuration data objects 311 . example properties represented by configuration data objects 311 include configuration parameters 215 for a variety of services , including : network services , such as default routers and routing paths ; parameters for naming services such as dns and wins ; parameters for directory services such as active directory , file systems and file sharing ( nfs , smb ); and network protocols such as ip , http , and email . in general , configuration data discoverer 31 populates configuration data objects 311 with configuration information from installed software packages 217 and from services of operating system 210 . configuration data discoverer 31 also queries performance monitoring facilities of operating system 210 . performance monitoring facilities sometimes include configuration data in response to queries about performance . for instance , a query about problematic tcp connections may identify devices that managed device 21 is communicating with . agent 30 also includes plug - in architecture 32 , which allows plug - ins to extend the functionality of agent 30 without requiring the software code of the agent 30 to be re - compiled . in microsoft windows , for instance , a plug - in is encoded in a dynamic link library ( dll ). in another example , in unix , a plug - in is encoded in a shared library . plug - in architecture 32 also allows the functionality provided by a plug - in to be upgraded or removed with minimal effects to the operation of the rest of agent 30 . agent 30 further includes snmp interface 33 whereby applications conforming to snmp 24 can interact with agent 30 over network 23 . for instance , manager 60 includes snmp interface 61 , which initiates snmp exchanges to snmp interface 33 on agent 30 . typically , manager 60 initiates exchanges with agent 30 that recur at regular intervals , to keep manager 60 &# 39 ; s state information current regarding managed device 21 . this is known as “ polling ”. agent 30 formulates a response and replies to manager 60 via snmp messages as required by the snmp protocol . snmp interface 33 also allows agent 30 to initiate snmp exchanges with manager 60 via snmp interface 61 , for instance to inform manager 60 of important changes in the status of managed device 21 . an snmp exchange initiated by agent 30 is known as a “ trap ”. traps are a form of asynchronous communication . they are asynchronous relative to the polling schedule of manager 60 . also , as required by snmp standards , agent 30 includes a supported mib list 331 . a mib ( management information base ) module defines structured types of information . agent 30 encodes the types as data structures in an interface that can be accessed via snmp . each mib supported by agent 30 through its snmp interface 33 is included in supported mib list 331 . agent 30 can support a mib directly or via a plug - in installed in plug - in architecture 32 . plug - in architecture 32 supports dependency plug - in 35 , shown in fig1 a . dependency plug - in 35 extends the functionality of agent 30 to discover , analyze , report on , and monitor dependency - related information , among other features . agent 30 includes dependency plug - in 35 via plug - in architecture 32 . referring now to fig2 b , dependency plug - in 35 includes dependency filter 36 , dependency interface support 37 , and dependency trap module 38 . dependency filter 36 distinguishes dependency data 361 from non - dependency data among the configuration data objects 311 gathered by configuration data discoverer 31 . when dependency filter 36 determines that configuration data object 311 is relevant to some dependency relationship , configuration data object 311 is added to repository 45 , which stores dependency data 361 . dependency interface support 37 extends the function of snmp interface 33 so that dependency plug - in 35 can support dependency mib module 40 , which agent 30 would not support otherwise . thus , dependency interface support 37 allows dependency plug - in 35 to add dependency mib module 40 to supported mib list 331 . dependency mib module 40 defines a software interface under snmp 24 . the interface presents a view of dependency data 361 in repository 45 . thus , dependency mib module 40 allows snmp - compatible applications to collect dependency data 361 from agent 30 . referring now to fig3 a , dependency mib module 40 includes several scopes of mib objects . snmp standards define a universal scheme for mib objects . dependency mib module 40 includes vendor scope 401 , which includes applications scope 402 . applications scope 402 includes plug - in scope 403 . plug - in scope 403 includes version 406 , mode 407 , and dependency scope 404 , which is the scope in which objects unique to dependency plug - in 35 begin to be defined . version 406 indicated the modification version of dependency plug - in 35 . mode 407 supports licensing considerations . mode 407 has values for full mode , which enables all features of dependency plug - in 35 , and restricted mode , which disables some features of dependency plug - in 35 . dependency scope 404 includes dependency mib table 405 . referring now to fig3 b , there is a correspondence between dependency mib table 405 and dependency table 459 . in brief , dependency mib table 405 is an snmp - compatible interface to dependency table 459 . dependency table 459 is a table that contains entries for dependency data 361 . in other words , dependency mib table 405 is a table data structure that exposes dependency data 361 . dependency mib table 405 includes a sequence of dependency entries 41 . dependency entries 41 correspond to rows in dependency table 459 storing dependency data 361 . dependency entry 41 includes a sequence of objects corresponding to fields in dependency data 361 . this dependency entry 41 sequence includes index 411 , type 412 , source 413 , server 414 , arguments 415 , timestamp 416 , description 417 , and status 418 . these objects correspond to fields for index 451 , type 452 , source 453 , server 454 , arguments 455 , timestamp 456 , description 457 , and status 458 , respectively , in dependency data 361 . for simplicity of explanation , fields in dependency data 361 will be explained in terms of the interface exposed in dependency entry 41 . that is , they will not be redundantly explained in terms of dependency data 361 ). index 411 is a unique number identifying dependency entry 41 within dependency mib table 405 . type 412 indicates the dependency type . type 412 includes options for : unknown ; other ; user defined type ; file system ; dns ; nis ; email ; wins ; router ; printer ; world wide web ; database ; active directory ; dhcp ; and http . source 413 indicates how the dependency information was discovered . possible values include static , dynamic , configuration , and unknown . static means that the dependency was hard - coded in a dependency configuration file . ( such a file can be stored on storage device 637 , shown in fig1 b , and consulted by configuration data discoverer 31 . for instance , a dependency configuration file allows administrators to distribute fixed dependency settings , including user - defined dependency types .) dynamic means that the dependency was discovered through traffic analysis , while configuration means the dependency was discovered via configuration data 215 . server 414 indicates the ip address or hostname of an entity providing the resource to managed device 21 . arguments 415 contains as its value a comma - separated list of keywords paired to values , indicating dependency parameters , arguments to methods , and so forth . an example list occurs in table 1 under the entry “ dependencyargs ”. the list of keywords paired to values can support arbitrary keywords , allowing great flexibility in information that can be stored about dependency relationships . for instance , parameters necessary to describe a dependency relationship for a file server may include username , password , and default directory in a list like “ username = toph , password = tgr , default = c :\”. in contrast , parameters necessary to describe a route through an ip network might include a series of hop addresses such as “ hop1 = a . b . c . d , hop2 = w . x . y . z ” and so forth , where a . b . c . d and w . x . y . z denote ip addresses . one feature of arguments 415 is to distinguish dependencies that themselves depend on a user profile , such as under the security scheme for operating system 631 of managed device 21 ( shown in fig1 b ) when managed device 21 is a workstation . thus , for instance , dependency data 361 can be stored distinctly for each user of managed device 21 with a keyword pair of “ user = jason ” or “ user = rhea ”. another feature of arguments 415 is that they can distinguish consumer relationships from provider relationships , for example with a keyword pair of “ direction = consumer ” or “ direction = provider ”. arguments 415 also support user - defined dependency types , in part by providing a flexible storage format for user - defined dependency parameters . in general , it is up to the snmp reader using dependency mib module 40 to parse and interpret information stored in arguments 415 . timestamp 416 and status 418 support “ bookkeeping ” features , so to speak , on dependency entry 41 . timestamp 416 indicates the date and time at which this dependency entry 41 was discovered or last updated . status 418 supports the semantics of the snmp v2 smi rowstatus textual - convention given in rfc 1443 . in general , status 418 describes administrative states of dependency entry 41 related to creation , deletion , and row - locking of dependency entries 41 . status 418 can be set to instruct dependency plug - in 35 to take actions including adding and removing rows from dependency table 459 . thus , since status 418 is accessible via dependency mib module 40 , status 418 assists in remote configuration of dependency information via snmp 24 , including the addition and deletion of predefined dependency types as well as user - defined types . description 417 provides an optional human - readable description for dependency entry 41 . description 417 is used primarily for dependency entries 41 created remotely by manager 60 via snmp operations or via configuration file directive . dependency scope 404 also includes unused index 408 , match description 409 , and match index 410 . unused index 40 allows snmp clients to get a value suitable for use as index 411 in a new dependency entry 41 , i . e ., an unused value . match description 409 and match index 410 allow snmp clients to submit a value for description 417 as a query to get a value for index 411 for matching dependency entries 41 . when match description 409 is set by an snmp client , dependency plug - in 35 responds by populating match index 410 with the index 411 value of the last dependency entry 41 whose description 409 matches the submitted query . referring now to fig6 a , manager 60 interacts with agent 30 via commands ( including snmp set commands ) request / response communications from manager 60 to agent 30 and via traps 50 from agent 30 to manager 60 . interactions involve snmp interface 61 on manager 60 and snmp interface 33 on agent 30 . manager 60 initiates a request , which snmp interface 61 transmits to snmp interface 33 via network 23 . snmp interface 33 notifies dependency interface support 37 of the request . dependency interface support 37 formulates a response and passes it to snmp interface 33 , which transmits the response back to snmp interface 61 . snmp interface 61 notifies manager 60 of the response . dependency trap module 38 tests dependencies stored in dependency data 361 , raising traps 50 when dependencies are unverifiable or trap criteria 382 ( shown in fig2 b ) indicate conditions for the raise . dependency trap module 38 passes trap 50 to snmp interface 33 , which transmits trap 50 to snmp interface 61 via network 23 . snmp interface 61 notifies manager 60 of trap 50 . referring now to fig6 b , dependency trap module 38 repeatedly iterates over dependency data 361 and related trap criteria 382 ( shown in fig2 b ) to raise traps 50 . dependency trap module 38 iterates to a next dependency data 361 ( procedure 381 ). dependency trap module 38 tests source field 453 to determine whether dependency data 361 was discovered dynamically ( procedure 382 ). if so , dependency trap module 38 uses configuration data discoverer 31 ( shown in fig1 a ) to verify that the source of information for dependency data 361 is still available or has been verified recently ( procedure 383 ). if the source is not available or its performance is unacceptable ( for instance , if the latency period of the source &# 39 ; s replies is too large ), dependency trap module 38 raises a trap 50 ( procedure 388 ). if the source is still available , or if the source is not discovered dynamically , dependency trap module 38 tests the device specified by server 454 ( procedure 384 ). dependency trap module 38 can use additional parameters , such as those contained in arguments field 455 . for instance , arguments 455 can specify a port to use with an ip address specified by server 454 . dependency trap module 38 can also apply trap criteria 382 to determine whether the dependency is acceptable . if the dependency is not acceptable ( procedure 386 ), dependency trap module 38 raises a trap 50 ( procedure 388 ). otherwise , dependency trap module 38 returns to iterate to a next dependency data 361 ( procedure 381 ). dependency trap module 38 returns to iterate to a next dependency data 361 ( procedure 381 ) after raising any trap 50 ( procedure 388 ). manager 60 is a systems management software application compatible with snmp 24 . manager 60 includes an snmp interface 61 with which manager 60 initiates snmp exchanges with agents 30 . snmp interface 61 also receives traps from agents 30 that the manager 60 can react to , for instance by logging the trap event and , if the trap describes a problem with a managed device 21 , by informing a user of manager 60 of the problem . referring now to fig4 b , manager 60 maintains a central management information repository 65 of information collected from agents 30 , as well as an active agent list 66 of agents 30 currently available for communication with manager 60 . central management information repository 65 includes a central dependency table 659 , which stores data collected from multiple dependency tables 459 on agents 30 in a “ central ” location , i . e ., one that is an authoritative collection point for systems management environment 20 . manager 60 collects dependency data 361 from multiple agents 30 , centralizing the entries of their dependency data 361 on manager 60 as central dependency entries 68 in central dependency table 659 . central dependency entry 68 includes fields for index 651 , type 652 , source 653 , server 654 , arguments 655 , timestamp 656 , description 657 , status 658 , agent index 650 , which correspond in datatype and function to the following fields , respectively , of dependency table 459 : index 411 , type 412 , source 413 , server 414 , arguments 415 , timestamp 416 , description 417 , and status 418 , as explained above . central dependency entry 68 also includes agent index 650 , which adopts values corresponding to the agent 30 from which dependency data 361 was collected . in other words , agent index 650 differentiates central dependency entries 68 according to their affiliations with agents 30 ( and therefore according to their affiliations with managed devices 21 as well ). manager 60 includes a dependency web interface 62 for reporting systems management information involving dependencies . dependency web interface 62 provides report presentations to a user via a web browser . reports include both the logic necessary to gather the information being reported , as well as one or more presentation specifications for how to format the output . reports include indented bfs report 63 and indented dfs report 64 . “ bfs ” stands for breadth - first search . “ dfs ” stands for depth - first search . indented bfs report 63 and indented dfs report 64 display dependency information by organizing a collection of data around a specific managed device 21 and visually laying out a representation of the consumer dependency relationships for that device 21 . specifically , reports 63 and 64 internally represent dependency information as a graph , with managed devices 21 as nodes and dependency relationships as edges connecting nodes . indented bfs report 63 and indented dfs report 64 use bfs and dfs traversals , respectively , of the graph to sequence the dependency information with respect to a root device . indented bfs report 63 and indented dfs report 64 also use indentation away from a margin to indicate path length in the graph away from the root device : the shortest indentation indicates path length one ( 1 ), the next - shortest indicates path length two ( 2 ), and so forth . path length in the graph corresponds to dependency length . dependency relationships between two networked resources can be either immediate or indirect . a dependency relationship is immediate between two networked resources if it describes a dependency of one upon the other . an indirect dependency relationship is between two networked resources a and b such that no immediate dependency relationship exists between a and b but there exists a sequence of networked resources a , c1 , c2 , c3 , etc ., ending in b , such that immediate dependency relationships exist between all adjacent pairs in the sequence , the directions of the relationships on all such pairsagree , and a given problem state at one end of the relationship can lead to a problem state at the opposite end . put another way , indirect dependency relationships are transitive and describe paths that problems follow . if a is in an immediate dependency relationship with c and c is in an immediate dependency relationship with b , and the direction from a to c is the same direction from c to b , then a is in an indirect dependency relationship with b if a problem in b can propagate to a . not all transitive chains of immediate dependency relationships lead to indirect dependency relationships . an indirect dependency relationship extends only as far as its initial causative problem can propagate . if x is a consumer of y and y is a consumer of z , but no problem of z can propagate through y to x , then x does not have an indirect dependency relationship with z via y . the “ length ” of a dependency relationship is defined to be the minimum number of immediate dependency relationships needed to construct a sequence that qualifies the dependency relationship as an indirect dependency relationship , as described above . the length of an immediate dependency relationship is therefore one . the length of an indirect dependency relationship is at least two . as an example , suppose a workstation computer has an immediate consumer relationship with an email server , and the email server has an immediate consumer relationship with a security server . further suppose the workstation computer has no immediate consumer relationship with the security server . then the workstation computer still has an indirect consumer relationship of length two with the security server , by virtue of the email server . now suppose that a laptop computer also has an immediate consumer relationship with the email server . the laptop does not have a dependency relationship with the workstation computer ( even though there is a dependency between workstation and email server , and another dependency between email and laptop ), because the direction of the former dependency is “ consumer ” while the direction of the latter is “ provider ”. referring now to fig5 a , indented bfs report 63 takes a specific managed device 21 as an input parameter and labels it the root device 631 . indented bfs report 63 also takes a search depth 632 as an input parameter . search depth 632 is an integer greater than zero that provides an upper bound on the path lengths displayed in the indented bfs report 63 . additionally , indented bfs report 63 takes a search direction 634 as an input parameter . search direction 634 specifies whether indented bfs report 63 is restricted to consumer or provider dependency relationships with regard to root device 631 . indented bfs report 63 includes bfs presentation 635 , which is a formatted presentation of data put out by indented bfs report 63 . bfs presentation 635 has a tabular layout , with rows corresponding to dependencies . bfs presentation 635 has a linear border from which the rows are offset ( i . e ., indented ). in the example of fig5 a , the linear border is the left edge . the first dependency row in bfs presentation 635 includes root device display 636 , which represents root device 631 . root device display 636 is offset from the linear border by root distance 633 . root distance 633 can be zero , i . e ., root device display 636 can abut the linear border . immediate dependencies 638 represent binary dependencies for which one of the network resources is root device 631 . because of the bfs approach , all dependencies of length one precede all dependencies of higher length in bfs presentation 635 . thus , immediate dependencies 638 are arranged following root device display 636 . bfs presentation 635 indents immediate dependencies 638 by a first distance , proportionate indentation 637 a in the example of fig5 a . this first distance is visibly greater than root distance 633 . proportionate indentation 637 is constant among representation of dependencies of same length to graphically indicate the length of the dependency relationship relative to root device 631 . a first set of extended dependencies 639 a - 639 b is represented if search depth 632 is greater than one and if bfs presentation 635 finds dependencies of length two , relative to root device 631 . fig5 a illustrates the offset distance for this set with proportionate indentation 637 b , chosen to be visibly greater than indentation 637 a . subsequent set of extended dependencies 639 are represented if search depth 632 allows and if bfs presentation 635 finds dependencies of sufficient length , relative to root device 631 . note that it follows from the definition of length that if a dependency of length n exists , then a dependency of length n − 1 exists ( for n greater than 1 ). therefore bfs presentation 635 never need “ skip ” a set of extended dependencies 639 en route to a next such set . fig5 a illustrates the offset distance for a second set of extended dependencies 639 c - 639 d with proportionate indentation 637 c , chosen to be visibly greater than indentation 637 b . in general , proportionate indentation 637 for dependencies of length n are visibly greater than proportionate indentation 637 for dependencies of length n − 1 . rows for root device display 636 , immediate dependencies 638 , and extended dependencies 639 can contain data from any fields in repository 45 . the dotted vertical lines in fig5 a are for illustrative purposes , showing the left - alignment distances of the rows in bfs presentation 635 as a reference for proportionate indentations 637 . the dotted vertical lines are optional in the actual display of bfs presentation 635 . referring now to fig5 b , indented dfs report 64 takes a specific managed device 21 as an input parameter ; this device 21 is labeled the root device 641 . indented bfs report 64 also takes a search depth 642 as an input parameter . search depth 642 is an integer greater than zero that provides an upper bound on the path lengths displayed in the indented dfs report 64 . additionally , indented dfs report 64 takes a search direction 644 as an input parameter . search direction 644 specifies whether indented dfs report 64 is restricted to consumer or provider dependency relationships with regard to root device 641 . indented dfs report 64 includes dfs presentation 645 , which is a formatted presentation of data put out by indented dfs report 64 . dfs presentation 645 has a tabular layout , with rows corresponding to dependencies . dfs presentation 645 has a linear border from which the rows are offset ( i . e ., indented ). in the example of fig5 b , the linear border is the left edge . the first dependency row in dfs presentation 645 includes root device display 646 , which represents root device 641 . root device display 646 is offset from the linear border by root distance 643 . root distance 643 can be zero , i . e ., root device display 646 can abut the linear border . immediate dependencies 648 represent dependencies of length one with regard to root device 641 . because of the dfs approach , a first dependency of length one follows root device display 646 . in the example of fig5 b , this is immediate dependency 648 a . it is followed by extended dependency 649 a ( the first dependency of length two ) and extended dependency 649 c ( the first dependency of length three ). immediate dependency 648 b is the second dependency of length one . according to the dfs approach , all descendants of immediate dependency 648 a are displayed before immediate dependency 648 b . all descendents of this second dependency of length one are displayed before the third dependency of length one is displayed , and so forth . this arrangement holds recursively for dependencies of higher length , as well . dfs presentation 645 uses the same indentation scheme to assign indentations 647 as bfs presentation 635 uses to assign indentations 637 . similarly , rows for root device display 646 , immediate dependencies 648 , and extended dependencies 649 can contain data from any fields in repository 45 . as with fig5 a , the dotted vertical lines in fig5 b are for illustrative purposes , showing the left - alignment distances of the rows in dfs presentation 645 as a reference for proportionate indentations 647 . the dotted vertical lines are optional in the actual display of dfs presentation 645 . referring now to fig7 a , manager 60 is not initially managing discovered device 26 . manager 60 can automatically activate or configure an agent 30 on discovered device 26 to bring discovered device 26 under management by manager 60 , if dependency data 361 indicates that a managed device 21 is in a dependency relationship with discovered device 26 . in other words , manager 60 can automatically process information to reclassify a discovered device 26 as a managed device 21 . this extends the management capabilities of manager 60 to the discovered device 26 , when manager 60 was not previously managing the discovered device 26 . the processing of information is as follows . configuration data discoverer 31 discovers configuration data 311 ( shown in fig1 a ) and passes it to dependency filter 36 ( procedure 261 ). dependency filter 36 verifies that configuration data 311 includes dependency data 361 ( procedure 262 ), specifying a consumer relationship with discovered device 26 ( procedure 263 ). dependency filter 36 notifies manager 60 of dependency data 361 ( procedure 264 ). manager 60 uses information in dependency data 361 specifying discovered device 26 and contacts remote start facility 218 on agent 30 on discovered device 26 ( procedure 266 ). upon successful remote start , agent 30 on discovered device 26 contacts manager 60 to be included in active agent list 66 ( procedure 267 ). referring now to fig7 b , a process for distributed dependency management propagation 67 proceeds as follows . configuration data discoverer 31 discovers configuration data 311 ( procedure 671 ). dependency filter 36 tests configuration data 311 for qualifications as dependency data 361 ( procedure 672 ). if the test fails , distributed dependency management propagation 67 concludes ( procedure 679 ). if the test succeeds , dependency filter 36 notifies manager 60 and specifies dependency data 361 ( procedure 673 ). manager 60 consults active agent list 66 to determine whether the device specified by dependency data 361 already has an active agent 30 under control of manager 60 ( procedure 674 ). if an active agent 30 exists , distributed dependency management propagation 67 concludes ( procedure 679 ). otherwise , manager 60 attempts a remote start of agent 30 on discovered device 26 using remote start facility 218 ( procedure 676 ). if the remote start fails , distributed dependency management propagation 67 concludes ( procedure 679 ). otherwise , agent 30 on discovered device 26 contacts manager 60 to be included in active agent list 66 , and manager 60 begins managing agent 30 ( procedure 678 ). discovered device 26 thus becomes a managed device 21 , and distributed dependency management propagation 67 concludes ( procedure 679 ). at times , for instance due to security or administration policies on discovered device 26 , manager 60 cannot activate an agent 30 on discovered device 26 . in this case , manager 60 configures agent 30 for activation at a later time . there is still a benefit to configuration without activation , at least in that manager 60 has automatically reclassified discovered device 26 to be a managed device 21 at some future point . thus , manager 60 still extends the number of devices 21 under management . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . for example , the functions of the dependency plugin 35 need not be added to agent 30 via the plugin architecture 32 : such functions could be incorporated into the software code of agent 30 directly . also , although the present embodiment uses snmp and mib &# 39 ; s , any open systems management protocol , or general purpose protocol such as xml adapted to systems management , together with interfaces supporting the security , get , and set features of mib &# 39 ; s , could be substituted in place of snmp and mib &# 39 ; s . central dependency table 659 and dependency table 459 have each been described as a table . however , central dependency table 659 and dependency table 459 could each ( or both ) be implemented as a collection of tables or a relational database view based on one or more tables . fig1 b shows a managed device 21 with a processor 211 . managed device 21 could have multiple processors 211 .
| 7 |
fig1 is a sectional view of an entire structure of a recording apparatus according to the present invention . referring to fig1 a sheet feeding section , a transfer section , a recording head section , and a sheet discharge section will be described . in the sheet feeding section , a pressure plate 21 for stacking recording sheets p and a feeding roller 22 for feeding the recording sheets p are rotatable about a rotational shaft connected to a base 20 and the pressure plate 21 is urged to the feeding roller 22 by a pressure plate spring 24 . the pressure plate 21 is provided with a separating pad ( not shown ) made from a material with a high coefficient of friction for preventing piled - up feeding of the recording sheets p and a separating claw ( not shown ) for separating the recording sheets p one by one . there is provided a release cam ( not shown ) for releasing the abutment between the pressure plate 21 and the feeding roller 22 . in the structure mentioned above , the release cam pushes down the pressure plate 21 in a standby mode . the abutment between the pressure plate 21 and the feeding roller 22 is thereby released . when a driving force of a sheet - feeding motor 25 is transmitted to the feeding roller 22 and the release cam via gears , etc ., the release cam is separated from the pressure plate 21 . thereby , the pressure plate 21 moves upwardly and the feeding roller 22 abuts the recording sheet p so as to pick up the recording sheet p along with the rotation of the feeding roller 22 and to start the sheet feeding . the feeding roller 22 rotates until the recording sheets p are fed to the transfer section . the transfer section comprises a transfer belt 31 for holding and transferring the recording sheets p and a pe sensor ( not shown ). the transfer belt 31 is driven by a driving roller 34 and looped over a transfer roller 32 and a tightening roller 35 , which are follower rollers . a belt motor 50 drives the driving roller 34 . the transfer belt 31 is made from a synthetic resin such as polyethylene and is endless belt - shaped . power dispatching means f applies a voltage of from 0 . 5 kv to 10 kv across the recording sheet p so as attract the sheet to the transfer belt ( description of the power dispatching means , high - voltage generating means , and high - voltage controlling means is omitted ). the transfer belt 32 moves at a speed of 170 mm / sec in a recording mode . at a position opposing the transfer roller 32 , a pinch roller 33 is abutted , which follows the transfer belt 32 . recording heads h 1 , h 2 , h 3 , h 4 , and h 5 are sequentially arranged in the transfer direction downstream of the transfer roller 32 . along the transfer direction , the recording head h 1 is placed at the most upstream position while the recording head h 5 is placed at the most downstream position . the distance between these recording heads is 10 cm . each recording head has a resolution of 600 dpi and employs a line - type ink - jet method having 7200 recording elements arranged in a direction perpendicular to the transfer direction . each recording element comprises a nozzle and a driving unit for applying heat to ink with a heater . the ink is film - boiled due to the heat and the ink pressure is changed by growth or contraction of bubbles due to the film boiling , so that the ink is ejected from the nozzle so as to form images on the recording sheet p . there are two classes of the electrical power consumption of each recording head , as follows . a yellow recording head yh has a power consumption of 50 wh ; a magenta recording head mh has a power consumption of 60 wh ; a cyan recording head ch has a power consumption of 60 wh ; a light cyan recording head lch has a power consumption of 50 wh ; and a black recording head kh has a power consumption of 60 wh . the value for each of the recording heads is the standard electrical power consumption when the entire 7200 nozzles eject ink in an environment with a room temperature of approximately from 10 ° c . to 30 ° c . the difference in the electrical power consumptions is due to the difference in volumes of one drop of ejected ink . the electrical power consumption is assumed to be steady with little dependence on the room temperature . the sheet discharge section comprises a discharge roller 41 and a spur 42 , and the recording sheet p having images formed thereon is conveyed by the nip between the discharge roller 41 and the spur 42 pinched therebetween so as to be discharged into a discharge tray 43 . the linear speed of the discharge roller 41 is substantially the same as that of the transfer belt , and the discharge roller 41 moves at a speed of 170 mm / sec in a recording mode . a sheet discharge sensor 40 checks for the existence of the recording sheet p in the sheet discharge section . a separation sensor 49 is disposed in the discharge side of the belt 31 for checking for the existence of the transferred sheet . a cleaning roller 38 is used for cleaning the belt 31 . numeral 39 denotes an electrostatic eliminating roller . fig9 is a schematic representation of a state that two recording sheets p 1 and p 2 are transferred when the recording heads are spaced at equal intervals . the distance between adjacent recording heads is 10 cm . the recording sheet p 1 is located under the recording heads h 3 , h 4 , and h 5 , from which ink is ejected . the recording sheet p 2 is located more upstream and not yet under the recording head h 1 , and recording is not yet performed . the distance between the recording sheets p 1 and p 2 is 20 cm . immediately under the recording heads h 1 and h 2 , the recording sheet does not exist , so that those recording heads are not driven . in addition , the sheet feeding section feeds a recording sheet about every 1 . 18 sec so that the distance between the recording sheets p 1 and p 2 is to be 20 cm . the recording sheets p 1 and p 2 are of a 4 size , and the distance between leading and trailing edges is 210 mm . the recording region initiates at 5 mm inside the leading edge and ends at 5 mm back from the trailing edge of the recording sheet . in this case , for one page of the recording sheet , recording is simultaneously performed with a maximum of three recording heads . the start - timing reference of ejection by each recording head is starting of the feeding roller 22 . in accordance with the distance from the feeding roller 22 , the start timing of ejection is set . ejecting duration t is obtained by “ the distance of the recording region in the transfer direction ÷ the speed of the transfer belt ”. fig1 a - 11d show calculated results of the total amount of the electrical power consumption for every arrangement of the recording heads in the recording apparatus formed of five recording heads arranged at equal intervals as shown in fig9 . a first head is h 1 ; a second head is h 2 ; a third head is h 3 ; a fourth head is h 4 ; and a fifth head is h 5 . numerals at the top of the tables indicate electrical power consumptions of each head . the total amount of the electrical power consumptions is obtained for four different arrangements of the recording heads as shown in fig1 a - 11d . for example , in the arrangement of fig1 a , the amount of the electrical power consumption of the first head is 50 wh ; that of each of the second through fourth heads is 60 wh ; and that of the fifth head , which is the most downstream , is 50 wh . from t 1 to t 5 , the symbol x denotes a non - driven state . when there is no recording sheet immediately under a recording head , that recording head is in a non - driven state . lapses of time indicated by t 1 → t 2 → t 3 → t 4 → t 5 show the progress of the recording medium moving from upstream to downstream . the t 1 indicates a state that the recording heads h 3 , h 4 , and h 5 are ejecting while the recording heads h 1 and h 2 are not driven . similarly , t 2 indicates a state that the recording heads h 1 , h 4 , and h 5 are ejecting while the recording heads h 2 and h 3 are not driven ; t 3 indicates a state that the recording heads h 1 , h 2 , and h 5 are ejecting while the recording heads h 3 and h 4 are not driven ; t 4 indicates a state that the recording heads h 1 , h 2 , and h 3 are ejecting while the recording heads h 4 and h 5 are not driven ; and t 5 indicates a state that the recording heads h 2 , h 3 , and h 4 are ejecting while the recording heads h 1 and h 5 are not driven . from the comparison of the amounts of the electrical power consumptions , it is understood that the maximum electrical power consumption values are lowest in the arrangements of fig1 b and 11c . in the arrangements of fig1 b and 11c , specifically in fig1 b , the black recording head kh is located at the position h 1 ; the light cyan recording head lch at the position h 2 ; the cyan recording head ch at the position h 3 ; the magenta recording head mh at the position h 4 ; and the yellow recording head yh at the position h 5 . also , in fig1 c , the black recording head kh is located at the position h 1 ; the cyan recording head ch at the position h 2 ; the light cyan recording head lch at the position h 3 ; the magenta recording head mh at the position h 4 ; and the yellow recording head yh at the position h 5 . as described above , the peak value of the electrical power consumptions can be kept low by combining the recording heads which are simultaneously driven so as to be a combination of the recording heads with different electrical power consumptions . furthermore , according to the embodiment , the combination of the recording heads is to be the combination between the recording head with the maximum electrical power consumption and the recording head with the minimum electrical power consumption , so that the electrical power consumption can be efficiently reduced . fig6 shows control blocks of the apparatus according to the present invention . a control section 80 comprises a cpu 80 a which operates according to a control program , a rom 80 b for storing the program , and a ram 80 c which is a work memory . a gate array is an lsi for controlling the driving signal of the recording head , the holding means , the sheet feeding section , and the transfer section together with the cpu . the control section 80 is connected to the belt motor 50 for driving the transfer belt , the sheet - feeding motor 25 which is a driving source of the feeding roller 22 , the black recording head kh , the cyan recording head ch , the magenta recording head mh , the yellow recording head yh , and the light cyan recording head lch . according to a second embodiment , the recording heads have an arrangement shown in fig9 . as the description of fig9 is similar to that of the first embodiment , it is omitted . the electrical power consumptions of the recording heads have three classes as follows . a yellow recording head yh has a power consumption of 40 wh ; a magenta recording head mh has a power consumption of 60 wh ; a cyan recording head ch has a power consumption of 60 wh ; a light cyan recording head lch has a power consumption of 50 wh ; and a black recording head kh has a power consumption of 60 wh . fig1 a - 10d show calculated results of the total amount of the electrical power consumptions for every arrangement of the recording heads in the recording apparatus formed of five recording heads arranged at equal intervals . a first head is h 1 ; a second head is h 2 ; a third head is h 3 ; a fourth head is h 4 ; and a fifth head is h 5 . numerals at the top of the tables indicate electrical power consumptions of each head . the units of the numerals are wh . the total amount of the electrical power consumptions is obtained for four different arrangements of the recording heads as shown in fig1 a - 10d . for example , in the arrangement of fig1 a , the amount of the electrical power consumption of the first head is 50 wh ; that of each of the second through fourth heads is 60 wh ; and that of the fifth head , which is the most downstream , is 40 wh . from t 1 to t 5 , the symbol x denotes a non - driven state . when there is no recording medium immediately under a recording head , that recording head is in a non - driven state . lapses of time indicated by t 1 → t 2 → t 3 → t 4 → t 5 show the progress of the recording medium moving from upstream to downstream . the t 1 indicates a state that the recording heads h 3 , h 4 , and h 5 are ejecting while the recording heads h 1 and h 2 are not driven . similarly , t 2 indicates a state that the recording heads h 1 , h 4 , and h 5 are ejecting while the recording heads h 2 and h 3 are not driven ; t 3 indicates a state that the recording heads h 1 , h 2 , and h 5 are ejecting while the recording heads h 3 and h 4 are not driven ; t 4 indicates a state that the recording heads h 1 , h 2 , and h 3 are ejecting while the recording heads h 4 and h 5 are not driven ; and t 5 indicates a state that the recording heads h 2 , h 3 , and h 4 are ejecting while the recording heads h 1 and h 5 are not driven . from the comparison of the amounts of the electrical power consumptions , it is understood that the electrical power consumption maximum values of the arrangements of fig1 b and 10c are the lowest . in the arrangements of fig1 b and 10c , specifically in fig1 b , the black recording head kh is located at the position h 1 ; the light cyan recording head lch at the position h 2 ; the cyan recording head ch at the position h 3 ; the magenta recording head mh at the position h 4 ; and the yellow recording head yh at the position h 5 . also , in fig1 c , the black recording head kh is located at the position h 1 ; the cyan recording head ch at the position h 2 ; the light cyan recording head lch at the position h 3 ; the magenta recording head mh at the position h 4 ; and the yellow recording head yh at the position h 5 . by the arrangements of fig1 a and 10c , the combination of the recording heads which are simultaneously driven is of recording heads with different electrical power consumptions , so that the peak value of the electrical power consumptions can be efficiently reduced . furthermore , by combining the recording heads so that at least one of the recording heads is stopped driving , the peak value of the electrical power consumptions can be efficiently reduced . according to a third embodiment , the recording heads have an arrangement shown in fig4 . the electrical power consumptions of the recording heads have two classes as follows . a yellow recording head yh has a power consumption of 40 wh ; a magenta recording head mh has a power consumption of 60 wh ; a cyan recording head ch has a power consumption of 60 wh ; and a black recording head kh has a power consumption of 50 wh . the drawing is a schematic representation of a state that two recording sheets p 1 and p 2 are transferred when the four recording heads h 1 , h 2 , h 3 , and h 4 are arranged at equal intervals . the distance between adjacent recording heads is 8 cm . the recording sheet p 1 is located under the recording heads h 3 and h 4 , from which ink is ejected . the recording sheet p 2 is located under the recording head h 1 from which ink is ejected . the distance between the recording sheets p 1 and p 2 is 10 cm . immediately under the recording head h 2 , a recording sheet does not exist , so that recording head is not driven . the sheet feeding section feeds a recording sheet about every 0 . 58 sec so that the distance between the recording sheets p 1 and p 2 is to be 10 cm . the recording sheets p 1 and p 2 are of a 5 size , and the distance between leading and trailing edges is 148 mm . the recording region initiates at 5 mm inside the leading edge and ends at 5 mm back from the trailing edge of the recording sheet . in this case , for one page of the recording sheet , recording is simultaneously performed with a maximum number of two recording heads . fig5 shows calculated results of the total amount of the electrical power consumptions for every arrangement of the recording heads . a first head is h 1 ; a second head is h 2 ; a third head is h 3 ; and a fourth head is h 4 . numerals at the top of the tables indicate electrical power consumption of each head . the units of the numerals are wh . the total amount of the electrical power consumptions is obtained for six arrangements of the recording heads as shown in fig5 a to 5 f . from the comparison of the amounts of the electrical power consumptions , it is understood that the electrical power consumption maximum value of the arrangement of fig5 a is the lowest . specifically , the black recording head kh is located at the position h 1 ; the cyan recording head ch at the position h 2 ; the magenta recording head mh at the position h 3 ; and the yellow recording head yh at the position h 4 . in the arrangements of the recording heads , according to the embodiment , by arranging the recording head with the maximum electrical power consumption at a position other than those on the most upstream side and the most downstream side in the arranging direction of the recording heads , the peak value of the total electrical power consumptions can be reduced to the lowest . according to a fourth embodiment , the recording heads have an arrangement shown in fig7 . the drawing is a schematic representation of a state that three recording sheets p 1 , p 2 , and p 3 are transferred when five recording heads h 1 , h 2 , h 3 , h 4 , and h 5 are arranged at substantially equal intervals . the distance between adjacent recording heads is 10 cm . the recording sheet p 1 is located under the recording head h 5 ; the recording sheet p 2 under the recording head h 3 ; and the recording sheet p 3 under the recording head h 1 , from each of which ink is ejected . the distances between the sheets p 1 and p 2 and between the sheets p 2 and p 3 are 10 cm , respectively . under the recording heads h 2 and h 4 , a recording sheet does not exist , so those recording heads are not driven . the sheet feeding section feeds a recording sheet about every 0 . 58 sec , so that the distances between the sheets p 1 and p 2 and between the sheets p 2 and p 3 are to be 10 cm , respectively . the recording sheets p 1 and p 2 are of a 6 size , and the distance between leading and trailing edges is 105 mm . the recording region initiates at 5 mm inside the leading edge and ends at 5 mm back from the trailing edge of the recording sheet . in this case , for one page of the recording sheet , recording is performed with one recording head . the electrical power consumptions of the recording heads have three classes as follows . a yellow recording head yh has a power consumption of 40 wh ; a magenta recording head mh has a power consumption of 60 wh ; a cyan recording head ch has a power consumption of 60 wh ; a light cyan recording head lch has a power consumption of 50 wh ; and a black recording head kh has a power consumption of 60 wh . fig8 shows calculated results of the total amount of the electrical power consumptions in the cases that three recording sheets are continuously transferred , and two recording sheets are transferred in the recording apparatus formed of five recording heads . a first head is h 1 ; a second head is h 2 ; a third head is h 3 ; a fourth head is h 4 ; and a fifth head is h 5 . numerals at the top of the tables indicate electrical power consumptions of each head . the units of the numerals are wh . the total amount of the electrical power consumptions is obtained for eight arrangements of the recording heads as shown in fig8 a - 8h . for example , in the arrangement of fig8 a , the amount of the electrical power consumption of the first head is 50 wh ; that of each of the second through fourth heads is 60 wh ; and that of the fifth head , which is the most downstream , is 40 wh . in t 1 and t 2 , the symbol x denotes a non - driven state . when there is no recording sheet immediately under a recording head , that recording head is in a non - driven state . a lapse of time indicated by t 1 → t 2 shows the progress of the recording medium moving from upstream to downstream . in the state shown in fig8 a , t 1 indicates a state that the recording heads h 1 , h 3 , and h 5 are ejecting while the recording heads h 2 and h 4 are not driven . similarly , t 2 indicates a state that the recording heads h 2 and h 4 are ejecting while the recording heads h 1 , h 3 , and h 5 are not driven . from the comparison of the total amounts of the electrical power consumptions , it is understood that the electrical power consumption maximum values of the arrangements of fig8 a and 8c are the lowest . specifically , in fig8 a , the light cyan recording head lch is located at the position h 1 ; the black recording head kh at the position h 2 ; the cyan recording head ch at the position h 3 ; the magenta recording head mh at the position h 4 ; and the yellow recording head yh at the position h 5 . also , in fig8 c , the black recording head kh is located at the position h 1 ; the cyan recording head ch at the position h 2 ; the light cyan recording head lch at the position h 3 ; the magenta recording head mh at the position h 4 ; and the yellow recording head yh at the position h 5 . as in fig8 a , by arranging the recording head with the maximum electrical power consumption at a position other than those on the most upstream side and the most downstream side , the peak value of the total electrical power consumptions can be reduced to the lowest . according to a fifth embodiment , the recording heads have an arrangement as shown in fig2 . fig2 is a schematic representation of a state that two recording sheets p 1 and p 2 are transferred when recording heads are arranged at equal intervals . the distance between adjacent recording heads is 10 cm . the recording sheet p 1 is located under the recording heads h 3 , h 4 , and h 5 , from each of which ink is ejected ; and the recording sheet p 2 is located under the recording head h 1 , from which ink is ejected . the distance between the sheets p 1 and p 2 is 10 cm . immediately under the recording head h 2 , a recording sheet does not exist , so that recording head is not driven . the sheet feeding section feeds a recording sheet about every 0 . 58 sec , so that the distance between the sheets p 1 and p 2 is 10 cm . the recording sheets p 1 and p 2 are of a 4 size , and the distance between leading and trailing edges is 210 mm . the recording region initiates at 5 mm inside the leading edge and ends at 5 mm back from the trailing edge in the transfer direction . in this case , for one page of the recording sheet , recording is performed with a maximum number of three recording heads . a yellow recording head yh has a power consumption of 50 wh ; a magenta recording head mh has a power consumption of 60 wh ; a cyan recording head ch has a power consumption of 60 wh ; a light cyan recording head lch has a power consumption of 50 wh ; and a black recording head kh has a power consumption of 60 wh . fig3 a - 3e show calculated results of the total amount of the electrical power consumptions in the arrangement shown in fig2 . a first head is h 1 ; a second head is h 2 ; a third head is h 3 ; a fourth head is h 4 ; and a fifth head is h 5 . numerals at the top of the tables indicate electrical power consumption of each head . the units of the numerals are wh . the total amount of the electrical power consumptions is obtained for the five arrangements of the recording heads shown in fig3 a to 3 e . for example , in the arrangement of fig3 a , the amount of the electrical power consumption of the first head is 50 wh ; that of each of the second through fourth heads is 60 wh ; and that of the fifth head , which is the most downstream , is 50 wh . in t 1 and t 2 , the symbol x denotes a non - driven state . when there is no recording sheet immediately under a recording head , that recording head is in a non - driven state . lapses of time indicated by t 1 → t 2 → t 3 → t 4 show the progress of the recording medium moving from upstream to downstream . in the state of fig3 a , t 1 indicates a state that the recording heads h 1 , h 3 , h 4 , and h 5 are ejecting while the recording head h 2 is not driven . similarly , t 2 indicates a state that the recording heads h 1 , h 2 , h 4 , and h 5 are ejecting while the recording head h 3 is not driven ; t 3 indicates a state that the recording heads h 1 , h 2 , h 3 , and h 5 are ejecting while the recording head h 4 is not driven ; and t 4 indicates a state that the recording heads h 2 , h 3 , and h 4 are ejecting while the recording heads h 1 and h 5 are not driven . the total amount of electrical power consumption is 220 wh from t 1 to t 3 , and 180 wh at t 4 . from the comparison of the total amounts of the electrical power consumptions , it is understood that the electrical power consumption maximum value of the arrangement of fig3 a is the lowest . specifically , the light cyan recording head lch is located at the position h 1 ; the black recording head kh at the position h 2 ; the cyan recording head ch at the position h 3 ; the magenta recording head mh at the position h 4 ; and the yellow recording head yh at the position h 5 . in the arrangement of the recording heads , by arranging the recording head with the maximum electrical power consumption at a position other than those on the most upstream side and the most downstream side , the peak value of the total electrical power consumptions can be reduced to the lowest . from a different point of view , in the arrangement of the recording heads , by arranging the recording heads with the minimum electrical power consumptions at positions on the most upstream side and the most downstream side , the peak value of the total electrical power consumption can be reduced to the lowest . in the embodiments described above , the recording sheet has been described as an example of a recording medium ; however , it may be an ohp sheet or cloth . the driving unit of the recording element in each of the embodiments is an electro - thermal converter for generating heat to ink with a heater , etc . ; however , a piezo - element , for example , may be substituted for the electro - thermal converter . as for the resolution of the recording head , other than 600 dpi , it may be a higher resolution such as 1200 dpi or a lower resolution such as 360 dpi . the number of recording heads which are not driven on an interspace between adjacent recording media may be 3 or more . also , the number of classes of the recording heads with different electrical power consumptions may be 4 or more . the number of recording heads used in recording also is not limited to 4 and 5 . plural recording heads with the same colors may be used . the relationship between the color of the recording head and electrical power consumption is not limited to that in the embodiments ; a head for ejecting black ink may have two classes of electrical power consumptions , for example . the electrical power consumption of the recording head has been defined in the case when the entire nozzles eject ink simultaneously ; however , it may be in another state such as an operational state that one nozzle is thinned out . the cause of the difference in the electrical power consumption is not limited to the difference in a volume of one ejected ink drop ; it may be due to a circuit structure within the recording head or a driving method . the transfer speed is not limited to 170 mm / sec ; it may be a higher speed . the distance between recording media is not limited to those mentioned above , and the time interval of sheet - feeding operation is not also limited thereto as long as “ time = distance between recording media ÷ transfer speed ”. the recording head may be not only an ink jet head , but also a recording device employing an led array . a transfer detecting sensor on a transfer line closer to the recording head than the feed roller may be used for the timing reference of ejection . as described above , according to the present invention , in a recording apparatus formed of plural recording heads with different electrical power consumptions , when recording with the recording heads to be driven which are combined so as to be a combination of the recording heads with different electrical power consumptions , the total amount of electrical power consumptions can be reduced . while the present invention has been described with reference to what are presently considered to be the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . on the contrary , the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions .
| 1 |
in order to select which chunk to download for each video interval , an has client monitors the available network throughput it sees , in particular the throughput offered by tcp , and tries to match the video bit rate ( for the next chunk ) to this available network throughput . because the requested video bit rate cannot match the available network bit rate exactly , the client needs to maintain a play - out buffer . fig1 and 2 illustrate the rate decision algorithm ( rda ) which governs the client &# 39 ; s decisions . the client downloads the next chunk in such a version that the bytes needed by the decoder are already received some time before the moment at which the decoder needs them . with reference to fig1 and 2 , this means that the stepwise content receiving curve ( lower curve ) should not intersect the transmission rate envelope ( upper curve ), where the latter indicates how fast the bytes are arriving to the client and the former indicates how quickly the decoder needs them . the illustrated content receiving curve exhibits sharp steps , which represents the fact that the decoder empties its data buffer by chunks ; the consumption of a single chunk is represented by a vertical segment of the curve , while the time between the consumption of two consecutive chunks is represented by a horizontal segment of the curve . the present invention concerns a method and an apparatus that use improved rate decision algorithms . the invention will now be further explained with reference to a rate decision algorithm that uses statistical information pertaining to network throughput ( from server to client ). the knowledge associated with the evolution of the throughput , given a certain past behavior of the throughput , is captured in the conditional probability that the throughput t [ a ,.] immediately after decision point a takes a certain value t [ a ,.] given that the throughputs t [ b , a ] , t [ c , b ] , . . . over the previous intervals assumed the values t [ b , a ] , t [ c , b ] , . . . respectively : pr [ t [ a ,.] = t [ a ,.] | t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ] ( equation 1 ) fig3 illustrates this embodiment . at each decision point a , the current version of pr [ t [ a ,.] = t [ a ,.] | t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ] is used to determine the quality version in which the next chunk is to be downloaded . this strategy may readily be combined with known design principles of traditional decision algorithms . preferably , pr [ t [ a ,.] = t [ a ,.] | t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ] is updated after each ( successful ) decision and this information is maintained over all sessions of the client device in question . in this way , the rda according to the invention can predict the throughput evolution better than traditional algorithms can , and hence , it can make better decisions . equation 1 provides statistical information about the transmission rate under the form of an estimated conditional probability density function . for practical computational reasons , the statistical information is preferably used in a discretized form , which will be referred to herein as “ histogram information ”. one possibility to maintain pr [ t [ a ,.] = t [ a ,.] | t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ] up to date is to proceed as follows . the vector space of ( k + 1 )- dimensional vectors is quantized in bins ( covering the complete vector space , where the bins can be rectangular or have any other shape ), where k is the number of past interval that are considered . each bin maintains an estimate of pr [ t [ a ,.] = t [ a ,.] | t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ] ( in fact , an integral thereof over the area the bin covers ). at decision point a , the probability value of each bin ( where all probabilities sum to 1 before multiplication ) is multiplied by a and after it is determined in which of the bins the observed vector ( t [ a ,.] , t [ b , a ] , t [ c , b ] , . . . ) falls ( where t [ b , a ] , t [ c , b ] , . . . are the measured throughputs in k intervals prior to the decision point and t [ a ,.] is the throughput in the interval after the decision point ), the probability value of that particular bin is augmented by ( 1 − α ) ( ensuring that the sum of all probabilities remains 1 after the updating process ). the conditional probabilities required in the rda proposed in this invention is given by pr [ t [ a ,.] = t [ a ,.] | t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ]= pr [ t [ a ,.] = t [ a ,.] , t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ]/ pr [ t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ] ( equation 2 ) an alternative to maintain pr [ t [ a ,.] = t [ a ,.] | t [ b , a ] = t [ b , a ] , t [ c , b ] = t [ c , b ] , . . . ] is to just count ( over a sliding window ) the number of events falling in each bin and count and divide by the total number of events ( in the sliding window ). in a preferred variant of the invention , the knowledge associated with the evolution of the throughput given the past behavior of the throughput does not only depend on the past throughputs t k , but also on one or more other parameters , such as , the network over which the video is downloaded ( e . g ., wifi , 3g or lie ), the time of day ( e . g ., busy hour , non busy hour ), the sinr ( signal to interference and noise ) value ( in case of wireless ) and the number of competing clients ( if known ), etc . fig4 provides a flow chart of an embodiment of the method according to the present invention . the flow chart illustrates steps to be taken at the client side , the client being operatively connected to a server ( for instance in the general layout illustrated in fig5 ). in a preliminary first step 410 , the client receives a chunk of the video of interest ( as a result of a previous request , not illustrated ). upon receiving this chunk , the client determines 420 a current transmission rate r current for transmission from the server to the client . without loss of generality , fig4 only refers to a determination of the current rate of transmission . it shall be obvious to the skilled reader that the invention works in a fully analogous way when the method relies on multiple transmission rate observations , i . e . for a set of the past k chunks . in this case , the client stores the relevant previous values for future use . on the basis of at least the current level of network performance r current ( and optionally over the last k received chunks ), the client obtains 430 statistical information pertaining to an expected future level of network performance . the client may for example obtain the probability density function as described above , preferably parametrized in some appropriate form , or a discretized form of histogram information . finally , the client derives a target rate of transmission r target from the statistical information 440 , for instance a particular quantile of the probability density function or histogram information , and requests 450 a subsequent chunk of the video in accordance with the target rate of transmission . the latest observation of transmission rate at the client is preferably fed back to the statistics database to keep the latter up to date , for example according to the scheme described above ( not illustrated in fig4 ). preferably , the current level of network performance and one or more previous observed levels of network performance are combined to select the appropriate statistics . indeed , particular patterns in the evolution of network performance may be indicative of particular network types , or of particular recurring events pertaining to the usage of the network . more preferably , additional information is used to select the appropriate statistics . examples of additional information are time of day and the day of the week . indeed , given the fact that network performance may be severely influenced by the instantaneous number of active users , certain patterns in network usage , which may recur on a daily or weekly basis , can guide the choice of the most appropriate statistics . fig5 provides a schematic overview of a network comprising an apparatus according to an embodiment of the present invention . the illustrated network comprises a client 510 and a server 530 , operatively connected to each other via a network 550 , which may include an access network and a core network , such as the internet . the server 530 will not be described in detail . with a view to establishing a connection with the network 550 , the client 510 has a network interface 515 . the term “ interface ” designates the necessary hardware and software required to establish data communication connectivity across the various layers of the protocol stack , as is well known to a person skilled in the art . preferably , standardized protocols are used . an access interface may for instance include an interface for an xdsl , xpon , wman , or 3g link . a lan ( local area network ) interface may for instance include an interface for one or more of an ieee 802 . 3 “ ethernet ” link , an ieee 802 . 11 “ wireless lan ” link . a pan ( personal area network ) interface may for instance include a usb interface or a bluetooth interface . the network connection 550 is used to relay requests ( in particular , requests for individual chunks of the desired program ) from the client 510 to the server 530 , and to relay content ( in particular , the requested chunks ) from the server 530 to the client 510 . the client apparatus 510 also interfaces with a statistics database 520 . to this end , the client apparatus 510 comprises a database interface 512 . the database interface 512 and the statistics database 520 may be integrated in the client apparatus 510 , in particular in the form of non - volatile memory such as flash memory or a magnetic disk drive . although the database interface 512 is illustrated in fig5 as being separate from the network interface 515 , it is also possible to attach the statistics database 520 directly to the network 550 , in which case it could be accessed via the network interface 515 . the statistics database 520 may for example be stored in a network attached storage ( nas ) infrastructure or in a storage area network ( san ). in this configuration , a single networked statistics database 520 may aggregate the statistics from multiple client apparatus 510 , which may lead to more accurate statistics and hence better performance of the inventive method for all the clients involved . the client apparatus 510 further comprises a processor 513 , operatively connected to the network interface 515 and the database interface 512 , the processor 513 being configured to determine a current level of network performance ( e . g ., a rate of transmission ) for transmission from the server 530 to the client apparatus 510 , obtain statistical information pertaining to an expected future rate of transmission from the statistics database 520 , in function of the current ( and optionally the past k chunks ) rate of transmission , derive a target rate of transmission from the statistical information , and request a subsequent chunk of the video from the server 530 in accordance with the target rate of transmission . although methods and apparatus have been described hereinabove as separate embodiments , this is done for clarity purposes only , and it should be noted that features described only in connection with method embodiments may be applied in the apparatus according to the present invention to obtain the same technical effects and advantages , and vice versa . the functions of the various elements shown in the figures , including any functional blocks labeled as “ processors ”, may be provided through the use of dedicated hardware as well as hardware capable of executing software in association with appropriate software . when provided by a processor , the functions may be provided by a single dedicated processor , by a single shared processor , or by a plurality of individual processors , some of which may be shared . moreover , explicit use of the term “ processor ” or “ controller ” should not be construed to refer exclusively to hardware capable of executing software , and may implicitly include , without limitation , digital signal processor ( dsp ) hardware , network processor , application specific integrated circuit ( asic ), field programmable gate array ( fpga ), read only memory ( rom ) for storing software , random access memory ( ram ), and non volatile storage . other hardware , conventional and / or custom , may also be included . similarly , any switches shown in the figs . are conceptual only . their function may be carried out through the operation of program logic , through dedicated logic , through the interaction of program control and dedicated logic , or even manually , the particular technique being selectable by the implementer as more specifically understood from the context . a person of skill in the art would readily recognize that steps of various above - described methods can be performed by programmed computers . herein , some embodiments are also intended to cover program storage devices , e . g ., digital data storage media , which are machine or computer readable and encode machine - executable or computer - executable programs of instructions , wherein said instructions perform some or all of the steps of said above - described methods . the program storage devices may be , e . g ., digital memories , magnetic storage media such as a magnetic disks and magnetic tapes , hard drives , or optically readable digital data storage media . the embodiments are also intended to cover computers programmed to perform said steps of the above - described methods .
| 7 |
the general workflow outlined here is as also used in example 1 . here , in step 6 each subpool contains three classes of fragments . a ) fragments that contain the l1 ( linker 1 ) sequence . these sequences downstream of the l1 sequence ( or l1 sequence part ) depict the 5 ′ start of the original fragments of step 3 . b ) fragments that contain neither l1 nor l2 ( linker 2 ) sequences ( or l1 -, l2 sequence parts ). these fragments and their reads are from within the original fragments of step 3 . c ) fragments that contain l2 ( linker 2 ) sequences . the sequence upstream of the l2 sequence ( or l2 sequence part ) depict the 3 ′ end of the original fragments of step 3 . the knowledge of the start and end sequences aids the assembly in step 9 as start and end sites of the fragments are defined . the contig building of step 9 can be further advanced by assembling the contigs of step 9 ( and the remaining reads ) between the different subpools . for a general outline of the workflow see also fig3 a - 3c . dna was extracted from a sample containing 3 × 10 5 human diploid cells . the dna in the sample was fragmented to an average fragment size of 10 kb by sonication . the fragments were dephosphorylated on their 5 ′ ends by alkaline phosphatase ( to inhibit selfligation of the fragments in the following first ligation step ). the fragments were briefly denatured at 95 ° c . and rapidly cooled on ice to provide single strands . then a 5 ′ phosphorylated single stranded linker ( l2rc ; reverse complement to a l2 sequence ) was ligated to the 3 ′- oh end of the fragments by t4 rna ligase . after that the l2rc linked fragments were phosphorylated on their 5 ′ end by polynucleotide kinase and a second linker ( l1 ) was ligated to the 5 ′- phosphate end of the l2rc linked fragments by t4 rna ligase . now about 1 % of all fragments were ligated to the l1 and l2rc linker representing a dna content equivalent to about 3 × 10 3 cells . the ligated fragments were size separated through electrophoresis in an 0 . 5 % agarose gel . ligated fragments in the size range of 9 - 11 kb are cut out of the gel and purified . this fraction represents a dna content equivalent to about 1 . 5 × 10 2 cells . the 9 - 11 kb fraction was amplified by long pcr using the l1 and l2 sequences as primers to generate about 100 ng of pcr products . in a segregating pcr , primers that contain the universal l1 and l2 sequences and on their 3 ′ end a number of n selective nucleotides can reduce the complexity of the sample by a factor of 4 ′, were n was the combined number of selective nucleotides of both primers . to be able to reduce the complexity of 1 . 5 × 10 2 cells below one haploid genome 4 n must be greater than 3 × 10 2 . therefore n must be at least 5 . when n was 7 , the complexity was reduced by a factor of about 54 , or in other words each subpool would represent about 1 / 54th of a haploid genome equivalent . therefore a segregating pcr was carried out to create the subpools for a set a . 70 subpools of a 16 . 384 subpool matrix ( 4 7 ) were created by 70 individual pcr reactions containing each one of 70 possible primer combinations of 7 primers with l1 - nnn ( l1 - aca ,- tac ,- ctt ,- gat ,- caa ,- ttg ,- agt ) and 10 primer with l2 - nnnn ( l2 - caca ,- gtac ,- gctt ,- cgat ,- gcaa ,- cttg ,- cagt ,- agct ,- tctg ,- tacg ). set b consisted of a single sample that was amplified in a non - segregating pcr by using l1 and l2 primers only . in each pcr reaction 27 pg of dna was amplified to about 500 ng . the samples were then prepared for next generation sequencing on an illumina genome analyzer ii . each of the pcr samples was fragmented into fragments which are on average 200 - 600 bp long . linkers ( l3 , l4rc ) were ligated to the ends of the fragments , which are used to bind the samples to the flow cell , allow for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run . in addition for samples of set a each l3 linker contained a subpool specific sequence tag ( barcode ) to assign each sequencing read . linker ligated fragments in a size range of 200 - 600 bp were size selected for sequencing . the 70 barcoded samples of set a were loaded onto 2 channels of the flow cell by pooling 35 samples per channel . the single sample of set b was loaded onto 2 channels of a second flow cell . after cluster generation on a cbot instrument ( illumina inc ., usa ), a 76 bp sequencing run was carried out on a genomeanalyzer ii ( illumina inc .) for each flow cell . about 15 million reads were generated per channel . the reads of set a were segregated into the respective subpools according to the different channels and according to the different barcodes ( sequence tags ). in a first assembly contigs were built by first aligning reads within each subpool and then assembling contigs and remaining reads within all subpools together . in comparison , in a second assembly of set a contigs were built neglecting the sub - pool information . the average contig length of the first assembly was longer when contig building was done within each subpool first , compared to the second assembly , where the reads were not separated into subpools . in a third assembly contigs were built using reads of set b . in comparison the third assembly resulted in shorter contings than the second or the first assembly . therefore a larger portion of the genome could be assembled when segregation was carried out . in addition in the first alignment in the majority of the cases contigs will come from one of the two haploid genomes allowing to distinguish between maternal or paternally derived sequences . mrna was extracted from a sample containing 12 . 000 human cells that contain on average about 0 . 6 pg mrna . 3 . 6 ng of mrna could be recovered and was fragmented to an average fragment size of 100 bases . a reverse transcription was carried out using random hexamers and reverse transcriptase to copy the cleaved mrna fragments into cdna . second strand synthesis was carried out to remove the mrna strand and synthesize a replacement strand to generate double stranded cdna . cdna ends were blunted by t4 dna polymerase and klenow dna polymerase . next an “ a ” base was added to the 3 ′ end of the dsdna fragments to create a single nucleotide overhang . adapters ( l5 - l1 - t and l6 - l2 - t ) with a 3 ′ “ t ” base overhang were then ligated to the fragments . ligation products were size separated through gel electrophoresis . ligates in the size range of 200 (+/− 25 ) bases were cut out of the gel and purified . this yields ligates with an cdna insert content equivalent to an mrna content of about 50 cells . adapter ligated cdna was amplified by pcr using l5 and l6 sequences as primers to generate about 500 ng of pcr products . next two sets of samples were created . for set a the sample was segregated into n subpools and set b ( where a single nonsegregating pcr was carried out ) was analysed as a control . in principle set a was created using primers that contain the universal l1 and l2 sequences and on their 3 ′ end a number of n selective nucleotides , that can reduce the complexity of the sample by a factor of 4 n , were n was the combined number of selective nucleotides of both primers . to be able to segregate the transcripts of 50 cells with a cellular copy number below 30 into different subpools , 4 n must be greater than 50 × 30 . therefore n must be at least 6 . when n was 8 , each subpool has a 1 / 43 chance containing a transcript with a copy number below 30 . therefore a segregating pcr was carried out to create sub - pools . 22 subpools of a 65 . 536 subpool matrix ( 4 8 ) are created by 22 individual pcr reactions containing each one of 22 possible primer combinations of 22 primers with l1 - nnnn and 22 primers with l2 - nnnn . in each pcr reaction 27 pg of dna was amplified to about 500 ng . set b consists of a single control sample that was amplified in a non segregating pcr , using primers that contain only the universal l1 and l2 sequences . the samples are then prepared for next generation sequencing on an illumina genome analyzer ii . linkersequences ( l3 , l4 ) are added to the ends of the pcr products by 10 cycles of pcr using l3 - l1 and l4 - l2 primers , which are used to bind the samples to the flow cell , allow for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run . the 22 samples of set a were loaded onto one channels of the flow cell by pooling the 22 samples per channel . into a second channel the single sample of set b was loaded . after cluster generation on a cbot instrument ( illumina inc ., usa ), a 36 bp sequencing run was carried out on a genomeanalyzer ii ( illumina inc .). about 15 million reads were generated per channel . when analyzing the sequencing data sets , set a contained reads that are not part of set b . these reads represent low copy number transcripts . therefore set a encompassed low copy number reads that cannot be detected without segregation . mrna was extracted from a sample containing 24 . 000 human cells that contain on average about 1 pg mrna , 12 ng of mrna could be recovered and was fragmented to an average fragment size of 400 bases . the fragments were dephosphorylated on their 5 ′ ends by alkaline phosphatase ( to inhibit selfligation of the fragments in the following first ligation step ). the fragments were denatured at 92 ° c . for 30 seconds and rapidly cooled on ice to melt any secondary structure . then a 5 ′ phosphorylated single stranded linker ( l2rc + l6rc ; 50 nts ) was ligated to the 3 ′- oh end of the fragments by t4 rna ligase . after that the l2rc + l6rc linked fragments were phosphorylated on their 5 ′ end by polynucleotide kinase and a second linker ( l5 + l1 ; 50 nts ) was ligated to the 5 ′- phosphate end of the l2rc + l6rc linked fragments by t4 rna ligase . now about 1 % of all fragments were ligated to the l5 + l1 and l2rc + l6rc linker representing about 120 pg of mrna that was equivalent to the mrna content of about 120 cells . a reverse transcription was carried out copying 120 pg of ligated mrna fragments using a primer that contains l6 ( reverse complement to l6rc ) to generate cdna . 120 pg of cdna was amplified by pcr using the l5 and l6 as primers to generate about 500 ng of pcr products . the pcr products are size separated through electrophoresis in an 6 % polyacrylamide gel . amplified fragments in the size range of about 475 - 525 bases were cut out of the gel and purified . in a segregating pcr , primers that contain the universal l1 and l2 sequences and on their 3 ′ end a number of n selective nucleotides can reduce the complexity of the sample by a factor of 4 n , were n was the combined number of selective nucleotides of both primers . to be able to reduce the complexity of 120 cells below the mrna content of one cell 4 n must be greater than 120 . therefore n must be at least 4 . when n was 7 , the complexity was reduced by a factor of about 136 , or in other words each subpool would represent about 1 / 136th of the mrna content equivalent of a single cell . a segregating pcr was carried out to create the subpools of a set a . 70 subpools of a 16 . 384 subpool matrix ( 4 7 ) are created by 70 individual pcr reactions containing each one of 70 possible primer combinations of 7 primers with l1 - nnn ( l1 - aca ,- tac ,- ctt ,- gat ,- caa ,- ttg ,- agt ) and 10 primer with l2 - nnnn ( l2 - caca ,- gtac ,- gctt ,- cgat ,- gcaa ,- cttg ,- cagt ,- agct ,- tctg ,- tacg ). set b consisted of a single sample that was amplified in a nonsegregating pcr by using l1 and l2 primers only . in each pcr reaction 27 pg of dna was amplified to about 500 ng . the samples were then prepared for next generation sequencing on an illumina genome analyzer ii . each of the pcr samples was fragmented into fragments which are on average 100 bp long . adapters ( 50 bp ) were ligated to the ends of the fragments , which are used to bind the samples to the flow cell , allow for cluster generation and enable the hybridization of a sequencing primer to start the sequencing run . in addition each adapter - pair contained a subpool specific sequence tag ( barcode ) to assign each sequencing read . adapter ligated fragments in a size range of 175 - 225 bp were size selected for sequencing . the 70 barcoded samples were loaded onto 2 channels of the flow cell by pooling 35 samples per channel . after cluster generation on a cbot instrument ( illumina inc ., usa ), a 36 bp sequencing run is carried out on a genomeanalyzer ii ( illumina inc .). about 15 million reads are generated per channel . the reads of set a were segregated into the respective subpools according to the different channels and according to the different barcodes ( sequence tags ). in a first assembly contigs were built by first aligning reads within each subpool and then assembling contigs and remaining reads within all subpools together . in comparison , in a second assembly of set a contigs were built neglecting the sub - pool information . the average contig length of the first assembly was longer when contig building was done within each subpool first , compared to the second assembly , where the reads were not separated into subpools . in a third assembly contigs were built using reads of set b . in comparison the third assembly resulted in shorter contigs than the second or the first . the inventive method divides a pool of random fragments into different subpools . this greatly enhances the alignment and assembly of short reads , such as they are returned by next generation sequencing platforms . in this example a simple model pool of fragments ( 160 - 305 bases long ) is used to show the difference between an alignment of reads ( 4 bases long ) within the whole pool of fragments and when such an alignment is done within each separate subpool . ten random sequences between 160 and 305 were generated using a random letter sequence generator and arranged in a database , e . g . because of the small size it could be done in a spreadsheet , assembling the fragments of the model pool . all randomized numbers ( e . g . fragment identifier ) were generated using a randomizer . first , the fragments were ordered into 16 ( 4 × 4 ) different subpools according to their terminal bases ( tab . 3 ). because one particular pool of fragments ( all reads align to the blue print ) is selected and any reading errors are excluded , a simple alignment algorithm ( simple search function which provides the number of sequence matches ) could be used to probe the fragment pool . it selects all reads that have a perfect k - mer match to the reference sequence ( transcriptome ). so , 24 permutations of 4 bp reads ( without any base repeats like aatg ) were taken and aligned , once against the entire model pool of fragments ( tab . 2 ) and once against the segregated fragments within each subpool ( tab . 3 ). the number of unique hits is shown in both tables in the right column . i ) none of the 24 probed reads gave one unique hit when trying to align reads to the entire pool of fragments . the number of total hits was 224 . the most unique read aligned matched 4 different fragments . ii ) after segregation into 7 subpools , here according to the molecule ends ( first and last nucleotide ), 69 ( 31 %) of the reads could already be aligned uniquely . even without having a blue print the same principle applies . in the first case none of the investigated reads will belong to a unique position in the pool , whereas 31 % of the reads will have one unique position in their host subpool .
| 2 |
the process of the present invention will be better understood by comparing prior art fig1 with fig2 , which is in accordance with the present invention . the abbreviations in parentheses refer to the units , and the numbers in parentheses refer to the streams entering or leaving said units . fig1 is a layout of a process using a catalytic cracking unit ( fcc ) and an amine unit ( amn ) for treating flue gas coming from the regeneration section of said catalytic cracking unit ( fcc ). the unit for treatment of flue gas with amines is associated with a boiler ( chd ) which provides the heat necessary for regeneration of the amine . the catalytic cracking unit is supplied with a hydrocarbon feed of the vacuum distillate or atmospheric residue type ( 1 ) and provides products which are essentially c 1 , c 2 , c 3 gases , a gasoline cut , a gas oil cut , a heavy “ slurry ” cut , and a certain quantity of coke deposited on the catalyst . the coke is burned off in the regeneration zone supplied with air ( 2 ), which produces combustion flue gas principally constituted by co 2 , h 2 and co . the combustion flue gas are sent to a section for the treatment of flue gas in order to burn the co and co 2 and to reduce the quantities of particles and oxides of nitrogen and of sulphur in the flue gas . next , a portion ( 5 ) or all of the treated flue gas ( 4 ) is sent to the amine treatment unit ( amn ). the treatment of the flue gas in the fcc unit may be adjusted in order to satisfy certain constraints regarding inputs to the amine treatment , for example the quantity of no x and so x . the amine unit requires heat to regenerate the amine which is supplied by the boiler ( chd ) supplied with streams of oxidizer and fuel ( 8 ) and which generates a stream of steam ( 10 ). the condensed steam ( 11 ) is returned to the boiler ( chd ) in a loop which is well known by the skilled person . fig2 , in accordance with the invention , can be described in the same manner as for fig1 but no longer has a boiler associated with the amine treatment unit ( amn ). the heat necessary for regeneration of the amine is supplied integrally by the steam ( 10 ) generated in the catalytic cracking unit ( fcc ) using an external exchanger . ( not shown in fig2 ). a description of this type of exchanger can , for example , be found in patent u . s . pat . no . 5 , 324 , 696 . according to the invention , the amine unit does not necessarily treat all of the flue gas emitted by the fcc . the proportion of flue gas treated with the amine unit depends on a number of factors , the principal one being the production of coke in the fcc unit . the heavier the feed ( expressed as its conradson carbon residue , denoted ccr and measured in accordance with astm d 189 ), the more loaded is the catalyst with coke at the end of the reaction , and the more heat generated by the catalyst on regeneration is recovered by the external exchanger . at the same time , the quantity of co 2 in the flue gas is also increased . however , because available crudes are changing , fcc is now tending to use heavier feeds . presently , feeds with a conradson carbon residue of 8 to 10 are routinely being treated . the present invention is in this regard perfectly synchronized with the trend in catalytic cracking and can exploit the heat generated by the external exchanger in a particularly advantageous manner . a further trend in fcc is that known as petrochemical fcc , since it consists in operating the fcc under conditions encouraging the production of propylene . these operational conditions are severe conditions , corresponding to c / o ratios in the range 4 to 15 , and riser outlet temperatures of more than 550 ° c . these operational conditions are accompanied by an increase in the quantity of coke deposited on the catalyst at the end of the reaction , and thus an increase in the heat available to the external exchanger . here again , the present invention is perfectly synchronized with this second trend in fcc units . the following examples are intended to demonstrate that it is possible to treat between 51 % and 94 % of regeneration flue gas coming from the fcc unit in view of recovering co 2 , by using only the heat available at the external exchanger . in this example , we simulated catalytic cracking of an atmospheric residue ( arabian heavy ) in a fcc unit including an external exchanger . the functional characteristics and the principal yields of the catalytic cracking unit are shown in table 1 below . in order to regenerate the amine , the amine treatment unit had available steam produced by a coal boiler for the prior art process , and produced by the external exchanger of the fcc unit for the process of the invention . the heat power necessary to regenerate the amine was the same in the prior art and in the invention since the fcc and amine treatment units were identical . the heat power necessary for regeneration of the amine was equal to the excess energy from the fcc unit . in the case of this example , 51 % of the fcc flue gas were treated in the amine unit . the boiler associated with the amine unit generated combustion flue gas , namely 9 t / h of co 2 , to which the fraction of untreated co 2 derived from the flue gas from the cracking unit ( 24 . 1 t / h ) and the co 2 discharged from the amine unit ( 2 . 5 t / h ) linked to its absorption yield ( 90 %) had to be added . in total , 35 , 6 t / h of co 2 was discharged into the atmosphere in the prior art process , i . e . 72 % of the co 2 produced by the fcc unit . in the process of the invention , only 26 . 6 t / h of co 2 was discharged into the atmosphere , i . e . 54 % of the co 2 produced by the fcc unit . the total flow rate of co 2 discharged into the atmosphere was thus reduced by 25 % in the process of the invention compared with that which it would be in a prior art process with a boiler for amine regeneration . in this example , we simulated catalytic cracking of the same atmospheric residue as in example 1 , but with a catalyst which was less selective as regards coke . the operating conditions for the fcc were very close to those of example 1 . the functional characteristics and the principal yields are indicated in table 3 below . in order to regenerate the amine , the amine treatment unit had available steam produced by a coal boiler for the prior art process , and produced by the external exchanger of the fcc unit for the process of the invention . the heat power necessary to regenerate the amine was the same in the prior art and in the invention since the fcc and amine treatment units are identical . this heat power is equal to the excess energy of the fcc unit . in this example , 94 % of the fcc flue gas were treated in the amine unit . the boiler associated with the amine unit generated combustion flue gas , namely 20 . 9 t / h of co 2 , to which the fraction of untreated co 2 derived from the flue gas from the cracking unit ( 3 . 9 t / h ) and the co 2 discharged from the amine unit ( 5 . 9 t / h ) linked to its absorption yield ( 90 %) had to be added . in total , 30 . 7 t / h of co 2 was discharged into the atmosphere in the prior art process , i . e . 48 % of the co 2 produced by the fcc unit . in the process of the invention , only 9 . 8 t / h of co 2 was discharged into the atmosphere , i . e . 15 % of the co 2 produced by the fcc unit , the total flow rate of co 2 discharged into the atmosphere is thus reduced by 68 % in the process of the invention compared with what it would be in a prior art process with a boiler for amine regeneration . the summarizing table 5 clearly shows that with the layout of the invention , the capture of co 2 emitted by the regeneration flue gas coming from the catalytic cracking unit is very substantially increased with respect to the prior art layout , also saving on the equipment ( furnace or boiler ) providing the heat required for amine regeneration .
| 8 |
the invention is illustrated by way of example and not by way of limitation in the figures of the accompanying drawings in which like references indicate similar elements . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references mean at least one . in the following description , various aspects of the present invention will be described . however , it will be apparent to those skilled in the art that the present invention may be practiced with only some or all aspects of the present invention . for purposes of explanation , specific numbers , materials and configurations are set forth in order to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that the present invention may be practiced without the specific details . in other instances , well - known features are omitted or simplified in order not to obscure the present invention . parts of the description will be presented in data processing terms , such as data , selection , retrieval , generation , and so forth , consistent with the manner commonly employed by those skilled in the art to convey the substance of their work to others skilled in the art . as well understood by those skilled in the art , these quantities take the form of electrical , magnetic , or optical signals capable of being stored , transferred , combined , and otherwise manipulated through electrical and / or optical components of a processor and its subsystems . various operations will be described as multiple discrete steps in turn , in a manner that is most helpful in understanding the present invention , however , the order of description should not be construed as to imply that these operations are necessarily order dependent . in particular , these operations need not be performed in the order of presentation . various embodiments will be illustrated in terms of exemplary classes and / or objects in an object - oriented programming paradigm . it will be apparent to one skilled in the art that the present invention can be practiced using any number of different classes / objects , not merely those included here for illustrative purposes . furthermore , it will also be apparent that the present invention is not limited to any particular software programming language or programming paradigm . [ 0029 ] fig1 is an illustration of a virtual content management framework in one embodiment of the invention . a content repository 108 is a searchable data store . such systems can relate structured content and unstructured content ( e . g ., digitally scanned paper documents , extensible markup language , portable document format , hypertext markup language , electronic mail , images , video and audio streams , raw binary data , etc .) into a searchable corpus . content repositories can be coupled to or integrated with content management systems . content management systems provide for content life cycle management ( e . g . versioning ), content review and approval , automatic content classification , event - driven content processing , process tracking and content delivery to other systems . for example , if a user fills out a loan application on a web portal , the web portal can forward the application to a content repository which , in turn , can contact a bank system , receive notification of loan approval , update the loan application in the repository and notify the user by rendering the approval information in a format appropriate for the web portal . a virtual or federated content repository ( hereinafter referred to as “ vcr ”) 100 is a logical representation of one or more individual content repositories 108 such that they appear and behave as a single content repository from an application program &# 39 ; s 110 standpoint . this is accomplished in part by use of an api ( application program interface ) 104 and an spi ( service provider interface ) 102 . an api describes how an application program , library or process can interface with some program logic or functionality . by way of a non - limiting illustration , a process can include a thread , a server , a servlet , a portlet , a distributed object , a web browser , or a lightweight process . an spi describes how a service provider ( e . g ., a content repository ) can be integrated into a system of some kind . spi &# 39 ; s are typically specified as a collection of classes / interfaces , data structures and functions that work together to provided a programmatic means through which a service can be accessed and utilized . by way of a non - limiting example , apis and spis can be specified in an object - oriented programming language , such as java ™ ( available from sun microsystems , inc . of mountain view , calif .) and c # ( available from microsoft corp . of redmond , wash .). the api and spi can be exposed in a number of ways , including but not limited to static libraries , dynamic link libraries , distributed objects , servers , class / interface instances , etc . in one embodiment , the api presents a unified view of all repositories to application programs and enables them to navigate , perform crud ( create , read , update , and delete ) operations , and search across multiple content repositories as though they were a single repository . content repositories that implement the spi can “ plug into ” the vcr . the spi includes a set of interfaces and services that repositories can implement and extend including schema management , hierarchy operations and crud operations . the api and spi share a content model 106 that represents the combined content of all repositories 108 as a hierarchical namespace of nodes ( or hierarchy ). given a node n , nodes that are hierarchically inferior to n are referred to as children of n whereas nodes that are hierarchically superior to n are referred to as parents of n . the top - most level of the hierarchy is called the federated root . there is no limit to the depth of the hierarchy . in one embodiment , content repositories can be children of the federated root . each content repository can have child nodes . nodes can represent hierarchy information or content . hierarchy nodes serve as a container for other nodes in the hierarchy akin to a file subdirectory in a hierarchical file system . content nodes can have properties . in one embodiment , a property associates a name with a value of some kind . by way of a non - limiting illustration , a value can be a text string , a number , an image , an audio / visual presentation , binary data , etc . either type of node can have a schema associated with it . a schema describes the data type of one or more of a node &# 39 ; s properties . [ 0033 ] fig2 is an illustration of functional layers in one embodiment of the invention . api 200 is layered on top of spi 202 . the spi layer isolates direct interaction with repositories 212 from the api . in one embodiment , this can be accomplished at run - time wherein the api library dynamically links to or loads the spi library . in another embodiment , the spi can be part of a server process such that the api and the spi can communicate over a network . the spi can communicate with the repositories using any number of means including , but not limited to , shared memory , remote procedure calls and / or via one or more intermediate server processes . referring again to fig2 and by way of a non - limiting example , content mining facilities 204 , portlets 206 , tag libraries 208 , applications 210 , and other libraries 218 can all utilize the api to interact with a vcr . content mining facilities can include services for automatically extracting content from the vcr based on parameters . portlet and java serverpages ™ tag libraries enable portals to interact with the vcr and surface its content on web pages . ( java serverpages is available from sun microsystems , inc .) in addition , application programs and other libraries can be built on top of the api . in one embodiment , the api can include optimizations to improve the performance of interacting with the vcr . one or more content caches 216 can be used to buffer search results and recently accessed nodes . content caches can include node caches and binary caches . a node cache can be used to provide fast access to recently accessed nodes . a binary cache can be used to provide fast access to the data associated with each node in a node cache . the api can also provide a configuration facility 214 to enable applications , tools and libraries to configure content caches and the vcr . in one embodiment , this facility can be implemented as a java management extension ( available from sun microsystems , inc .). exemplary configuration parameters are provided in table 1 . [ 0036 ] fig3 is an illustration of objects used in connecting a repository to a vcr in one embodiment of the invention . in one embodiment , objects implementing api interface repositorymanager 302 can serve as an representation of a vcr from an application program &# 39 ; s standpoint . a repositorymanager connect ( ) method attempts to connect all available repositories with a current user &# 39 ; s credentials to the vcr . by way of a non - limiting example , credentials in one embodiment can based on the java ™ authentication and authorization service ( available from sun microsystems , inc .). those of skill in the art will recognize that many authorization schemes are possible without departing from the scope and spirit of the present embodiment . each available content repository is represented by an spi repository object 306 - 310 . the repositorymanager object invokes a connect ( ) method on a set of repository objects . in one embodiment , a repositorysession object ( not shown ) can be instantiated for each content repository to which a connection is attempted . in one embodiment , the repositorymanager connect ( ) method can return an array of the repositorysession to the application program , one for each repository for which a connection was attempted . any error in the connection procedure can be described by the repositorysession object &# 39 ; s state . in another embodiment , the repositorymanager connect ( ) method can connect to a specific repository using a current user &# 39 ; s credentials and a given repository name . in one embodiment , the name of a repository can be a uri ( uniform resource identifier ). [ 0037 ] fig4 is an exemplary content model in one embodiment of the invention . the content model is shared between the api and the spi . each box in fig2 represents a class or an interface . hollow tipped arrows connecting boxes indicate inheritance relationships wherein the class / interface from which the arrows emanate inherit from the class / interface to which the arrows point . solid tipped arrows indicate that the objects of the class / interface from which the arrows emanate can contain or have references ( e . g ., pointers or addresses ) to objects of the class / interface to which the arrows point . in one embodiment , each object in a vcr has an identifier that uniquely identifies it . an identifier can be represented by an id 400 ( or id ). an id can contain the name of a content repository and a unique id provided to it by the repository . in one embodiment , the id class / interface can be made available through a common super class / interface 414 that can provide services such as serialization , etc . in one embodiment , content and hierarchy nodes can be represented by a node 402 ( or node ). a node has a name , an id , and can also include a path that uniquely specifies an the node &# 39 ; s location in the vcr hierarchy . by way of a non - limiting example , the path can be in a unix - like directory path format such as ‘/ a / b / c ’ where ‘/’ is a federated root , ‘ a ’ is a repository , ‘ b ’ is a node in the ‘ a ’ repository , and ‘ c ’ is the node &# 39 ; s name . the node class provides methods by with a node &# 39 ; s parent and children can be obtained . this is useful for applications and tools that need to traverse the vcr hierarchy ( e . g ., browsers ). nodes can be associated with zero or more property 404 objects ( or properties ). a property can have a name and zero or more values 406 . in one embodiment , a property &# 39 ; s name is unique relative to the node to which the property is associated . a value 406 can represent any value , including but not limited to binary , boolean , date / time , floating point , integer or string values . if a property has more than one value associated with it , it is referred to as “ multi - valued ”. a node &# 39 ; s properties can be described by a schema . a schema can be referred to as “ metadata ” since it does not constitute the content ( or “ data ”) of the vcr per se . schemas can be represented by an objectclass 408 object and zero or more propertydefinition 410 objects . an objectclass has a schema name that uniquely identifies it within a content repository . a node can refer to a schema using the objectclass name . in another embodiment , a content node can define its own schema by referencing an objectclass object directly . in one embodiment , there is one propertydefinition object for each of a node &# 39 ; s associated property objects . propertydefinition objects define the shape or type of properties . schemas can be utilized by repositories and tools that operate on vcrs , such as hierarchical browsers . by way of a non - limiting example , a hierarchy node &# 39 ; s schema could be used to provide information regarding its children or could be used to enforce a schema on them . by way of a further non - limiting example , a vcr browser could use a content node &# 39 ; s schema in order to properly display the node &# 39 ; s values . in one embodiment , a propertydefinition can have a name and can describe a corresponding property &# 39 ; s data type ( e . g ., binary , boolean , string , double , calendar , long , reference to an external data source , etc . ), whether it is required , whether it is read - only , whether it provides a default value , and whether it specifies a property choice type . a property choice can indicate if a property is a single unrestricted value , a single restricted value , a multiple unrestricted value , or a multiple restricted value . properties that are single have only one value whereas properties that are multiple can have more than one value . if a property is restricted , its value ( s ) are chosen from a finite set of values . but if a property is unrestricted , any value ( s ) can be provided for it . propertychoice objects 412 can be associated with a propertydefinition object to define a set of value choices in the case where the propertydefinition is restricted . a choice can be designated as a default value , but only one choice can be a default for a given propertydefinition . a propertydefinition object may also be designated as a primary property . by way of a non - limiting example , when a schema is associated with a node , the primary property of a node can be considered its default content . the isprimary ( ) method of the propertydefinition class returns true if a propertydefinition object is the primary propertydefinition . by way of a further non - limiting example , if a node contained a binary property to hold an image , it could also contain a second binary property to represent a thumbnail view of the image . if the thumbnail view was the primary property , software applications such as browser could display it by default . [ 0042 ] fig5 is an exemplary service model in one embodiment of the invention . each box in fig5 represents a class or an interface . a dashed arrow indicates that the interface from which the arrow emanates can produce at run - time objects implementing the classes to which the arrow points . a content repository &# 39 ; s implementation of the spi is responsible for mapping operations on the content model to the particulars of a given content repository . repository interface 500 represents a content repository and facilitates connecting to it . the repository has a connect ( ) method that returns an object of type ticket 502 ( or ticket ) if a user is authenticated by the repository . in one embodiment , tickets are intended to be light - weight objects . as such , one or more may be created and possibly cached for each client / software application accessing a given repository . a ticket can utilize a user &# 39 ; s credentials to authorize a service . in one embodiment , a ticket can be the access point for the following service interfaces : nodeops 508 , objectclassops 506 , and searchops 510 . an application program can obtain objects that are compatible with these interfaces through the api repositorymanager class . the nodeops interface provides crud methods for nodes in the vcr . nodes can be operated on based on their id or through their path in the node hierarchy . table 2 summarizes nodeop class functionality exposed in the api . [ 0044 ] fig6 is an illustration of nopeops service interaction in one embodiment of the invention . application 600 utilizes a nodeops object 602 provided by the api which in turn utilizes one or more nodeops objects 606 - 610 provided by an spi ticket . each repository 612 - 616 is represented by a nodeops object . when the api nodeops 602 receives a request to perform an action , it maps the request to one or more spi nodeops objects 606 - 610 which in turn fulfill the request using their associated repositories . in this way , applications and libraries utilizing the api see a the vcr rather than individual content repositories . as with the nodeops service , there is one spi objectclassops object per repository and a single api objectclassops object . the api objectclassops object maps requests to one or more spi objectclassops which in turn fulfill the requests using their respective repositories . through this service , objectclass and propertydefinition objects can be operated on based on their id or through their path in the node hierarchy . table 3 summarizes objectclassops class functionality exposed in the api . as with the nodeops and objectclassops services , there is one spi searchops object per repository and a single api searchops object . the api searchops object maps requests to one or more spi searchops which in turn fulfill the requests using their respective repositories . among other things , the searchops services allows applications and libraries to search for properties and / or values throughout the entire vcr . in one embodiment , searches can be conducted across all property , value , binary value , objectclass , propertychoice and propertydefinitions objects in the vcr . search expressions can include but are not limited to one or more logical expressions , boolean operators , nested expressions , object names , function calls , mathematical functions , mathematical operators , string operators , image operators , and structured query language ( sql ). table 4 summarizes searchops class functionality exposed in the api . [ 0047 ] fig7 is an illustration of a vcr browser in one embodiment of the invention . a vcr browser 700 can include one or more tools built atop the api and has a graphical user interface ( gui ). in one embodiment , the browser can be rendered using microsoft windows ® ( available from microsoft , corp .). in yet another embodiment , the browser can be implemented as a web portal . browser window 700 includes a navigation pane 702 and a context - sensitive editor window 704 . the navigation pane displays a hierarchical representation of a vcr having one content repository (“ bea repository ”) which itself has four hierarchy nodes (“ hr ”, “ images ”, “ marketing ”, and “ products ”). selection of a hierarchy node can cause its children to be rendered beneath it in the navigation pane and cause an appropriate editor to be displayed in the editor window . selection may be accomplished by any means , including but not limited to mouse or keyboard input , voice commands , physical gestures , etc . in this case , the vcr 706 is selected and a repository configuration editor is displayed in the editor window . the editor allows a user to change the configuration parameters ( see table 1 ) of the vcr . in one embodiment , configuration parameters are manipulated via java management extensions ( see fig1 ). [ 0048 ] fig8 is an illustration of a content editor in one embodiment of the invention . navigation pane 802 is in “ content ” mode 812 such that it selectively filters out nodes that define only schemas . content node 806 (“ laptop ”) has been selected . node 806 is a child of hierarchy node “ products ”, which itself is a child of repository “ bea repository ”. selection of node 806 causes a corresponding content node editor to be rendered in editor window 804 . the editor displays the current values for the selected node . the content type 814 indicates that the schema for this node is named “ product ”. in this example , the node has five properties : “ style ”, “ description ”, “ color ”, “ sku ” and “ image ”. a user is allowed to change the value associated with these properties and update the vcr ( via the update button 808 ), or remove the node from the vcr ( via the remove button 810 ). [ 0049 ] fig9 is an illustration of a schema editor in one embodiment of the invention . navigation pane 902 is in “ type ” mode 910 such that it only displays nodes that have schemas but no content . schema node 906 (“ product ”) has been selected . node 906 is a child of repository “ bea repository ”. selection of node 906 causes a corresponding schema editor to be rendered in editor window 904 . the editor displays the current schema for the selected node ( e . g ., derived from objectclass , propertydefinition , propertychoice objects ). in this example , the node has five property definitions : “ style ”, “ description ”, “ color ”, “ sku ” and “ image ”. for each property , the editor displays an indication of whether it is the primary property , its data type , its default value , and whether it is required . a property can be removed from a schema by selecting the property &# 39 ; s delete button 912 . a property can be added by selecting the “ add property ” button 908 . a property &# 39 ; s attributes can be changed by selecting its name 914 in the editor window or the navigation pane 906 ( see fig1 ). [ 0050 ] fig1 is an illustration of a property editor in one embodiment of the invention . the schema named “ product ” is being edited . schema properties definitions are listed beneath their schema name in the navigation pane 1002 . schema property 1008 (“ color ”) has been selected . the editor window 1004 displays the property &# 39 ; s current attributes . the name of the attribute ( e . g ., “ color ”), whether the attribute is required or not , whether it is read - only , whether it is the primary property , its data type , default value ( s ), and whether the property is single / multiple restricted / unrestricted can be modified . changes to the a property &# 39 ; s attributes can be saved by selecting the update button 1006 . one embodiment may be implemented using a conventional general purpose or a specialized digital computer or microprocessor ( s ) programmed according to the teachings of the present disclosure , as will be apparent to those skilled in the computer art . appropriate software coding can readily be prepared by skilled programmers based on the teachings of the present disclosure , as will be apparent to those skilled in the software art . the invention may also be implemented by the preparation of integrated circuits or by interconnecting an appropriate network of conventional component circuits , as will be readily apparent to those skilled in the art . one embodiment includes a computer program product which is a storage medium ( media ) having instructions stored thereon / in which can be used to program a computer to perform any of the features presented herein . the storage medium can include , but is not limited to , any type of disk including floppy disks , optical discs , dvd , cd - roms , microdrive , and magneto - optical disks , roms , rams , eproms , eeproms , drams , vrams , flash memory devices , magnetic or optical cards , nanosystems ( including molecular memory ics ), or any type of media or device suitable for storing instructions and / or data . stored on any one of the computer readable medium ( media ), the present invention includes software for controlling both the hardware of the general purpose / specialized computer or microprocessor , and for enabling the computer or microprocessor to interact with a human user or other mechanism utilizing the results of the present invention . such software may include , but is not limited to , device drivers , operating systems , execution environments / containers , and user applications . the foregoing description of the preferred embodiments of the present invention has been provided for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many modifications and variations will be apparent to the practitioner skilled in the art . embodiments were chosen and described in order to best describe the principles of the invention and its practical application , thereby enabling others skilled in the art to understand the invention , the various embodiments and with various modifications that are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the following claims and their equivalents .
| 6 |
fig1 shows a thermoanalysis device 10 , comprising a thermogravimetric cell 12 with a sample chamber 14 formed therein , in which a sample 16 is disposed on a sample holder 18 . electrical heating ( e . g . microwave oven ) 20 also disposed in sample chamber 14 forms , together with a control unit st controlling the heating operation and a sensor ( not represented ) for measuring temperature t of sample 16 , a controllable temperature regulating device for the controlled change of sample temperature t in the course of a thermoanalysis . in the example of embodiment represented , control unit st is a processor - controlled device , on which a corresponding control algorithm runs software - based , said control algorithm bringing about , amongst other things , the controlled change in sample temperature t , here for example controlled heating - up of sample 16 at a , for example , constant time - related heating - up rate . for this purpose , control unit st emits a control signal s 1 for controlling the heat output of electrical heating 20 and thus regulates the desired heating - up of sample 16 taking account of continuously measured actual sample temperature t . during the change in sample temperature t in the course of the thermoanalysis , signals can be detected and recorded that are characteristic of different properties of sample 16 . in the example represented , the mass of sample 16 , for example , is continuously measured , for which purpose sample holder 18 is connected to a balance ( not represented ) or contains such a balance . a mass signal tg indicating the current sample mass is delivered by the balance to control unit st . the components of device 10 described hitherto form , as such , a thermogravimetric device of the conventional kind . it is thus possible to measure and record temperature - related changes in sample mass tg in a time - and temperature - resolved manner . fig2 represents , by way of example , the process of a thermogravimetric investigation of a specific rubber mixture by means of device 10 represented in fig1 . the dotted line in fig2 shows the course of sample temperature t , and the solid line shows the course of sample mass tg , in each case plotted against time t . it can be seen from this that , in the course of the heating - up of sample 16 , its mass tg diminishes , which in the represented example can be traced back to thermally induced decomposition processes . in the manner described below , device 10 permits a very informative thermoanalysis , inasmuch as a direct correlation between individual decomposition temperatures or “ mass loss stages ” and the composition of the volatile components ( gases ) thereby liberated is thus enabled . for this purpose , device 10 further comprises a gas analysis device 26 , which in the represented example is formed by a gas chromatograph gc with a downstream quadrupole mass spectrometer ms and is coupled with a thermogravimetric cell 12 via a heatable transfer line 32 , a controllable valve arrangement 28 and a controllable injector system 30 . transfer line 32 is connected via an adapter 34 to thermogravimetric cell 12 , wherein a bypass line 36 emerges in the region of adapter 34 , by means of which bypass line transfer line 32 and downstream components 28 , 30 and 26 can be “ swept ” with helium . valve arrangement 28 forms , together with injector system 30 , a valve / injection system for gas analysis device 26 , said valve / injection system being able to be triggered by control unit st , wherein helium ( or another inert gas ) flowing via bypass line 36 serves as a carrier gas for the gases which can thus be fed to gas analysis device 26 . controllable valve arrangement 28 comprises six valve connections , which are symbolised by six dots in fig1 and which can be connected to one another in different ways via individual valves ( not represented ), depending on the “ switching state ”. as can be seen from the figure , one of the valve connections is directly connected to the end of transfer line 32 . a further valve connection is permanently connected to a vacuum pump ( not represented ) ( an arrow 38 symbolises the removal by suction at this point ). a further valve connection is connected via valve 40 to a carrier gas supply connection ( an arrow 43 symbolises the carrier gas supply of this point ). the carrier gas here is , for example , helium , which is present at valve 40 at a pressure of , for example , several bar . a further valve connection is connected to an inlet of injector system 30 . valve arrangement 28 is driven into one of two possible switching states via a supplied control signal s 2 by the control algorithm running in control unit st . in a first switching state , the valve connections are connected to one another in the manner symbolised in the figure by the solid lines between the valve connections , and the carrier gas supply valve 40 is opened . in this first switching state , an investigation of gases originating from sample chamber 14 does not take place . on the contrary , “ sweeping with the inert gas ( helium )” takes place in this switching state . helium supplied via bypass line 36 flows through transfer line 32 and further through valve arrangement 28 to the suction connection ( see arrow 38 ). moreover , helium is supplied via opened valve 40 and is conveyed onward via valve arrangement 28 to injector system 30 . if a “ gas liberation process ” is detected in the course of the thermoanalysis of sample 16 , a “ control process ” is triggered by control unit st , said control process effecting a switch - over of valve arrangement 28 into a second switching state via control signal s 2 . in this second switching state of valve arrangement 28 , its valve connections are connected to one another in the manner symbolised in the figure by the dashed lines between the valve connections . the second switching state serves to supply injector system 30 with a “ gas sample ” stored in the region of valve arrangement 28 , said gas sample having previously been fed from sample chamber 14 via transfer line 32 into valve arrangement 28 . the supply of this gas sample is driven , while still in the first switching state , by the helium flowing through transfer line 32 . however , when valve arrangement 28 is then brought into the second switching state , a certain quantity of the gases originating from sample 16 is “ captured ” in a gas sample reservoir 42 of valve arrangement 28 and made available for supplying injector system 30 . carrier gas supply valve 40 is closed in this second switching state . in a manner known per se , the gas sample is then fed by means of injector system 30 to a capillary (“ separation column ”) 44 of gas chromatograph gc . the individual gases or gas components then arrive at mass spectrometer ms with respective time lags ( retention times ). injector system 30 is driven here by control unit st by means of a control signal s 3 in order to introduce the gas sample into capillary 44 . the results of the gas examination ( s ) carried out during the thermoanalysis by means of gas analysis device 26 , i . e . in this case one or more retention time - resolved mass spectra , are brought together in an evaluation device a with the information available or recorded in the region of control unit st concerning the course of sample temperature t and the other detected signal or signals and are evaluated at least partially automatically by means of evaluation device a . a distinctive design feature of thermoanalysis device 10 thus already consists in the fact that a gas analysis device ( 28 , 30 , 26 ) constituted so as to be controllable is used in a direct coupling ( via transfer line 32 ) with a device for thermoanalysis ( thermogravimetric cell 12 ). with regard to the embodiment of control unit st and the thermoanalytical method implemented therewith , a further distinctive feature of device 10 consists in the fact that , during the controlled change in sample temperature t in the case of the triggering of the “ control process ”, a special triggering / operational change of the temperature regulation of the sample temperature , described in greater detail below , is also carried out . a control algorithm running in control unit st comprises preliminary processing of mass signal tg delivered by the thermal balance , said preliminary processing consisting in the fact that a time - related rate of change dtg of the sample mass is continuous ascertained from signal tg ( in “ real time ”, e . g . periodically in small time intervals ). this mass change signal dtg is also entered in fig2 . the value of change signal dtg is monitored during the thermoanalysis . if the value of signal dtg meets a predetermined criterion , here for example if the absolute value of signal dtg is greater than a previously set threshold value of 5 %/ min , the “ control process ” is triggered , the effect of which in the represented example is that the increase in sample temperature t normally provided at a constant heating rate of 20 k / min is automatically interrupted and the previously described gas investigation by means of gas analysis device 26 is initiated ( triggering of valve arrangement 28 and injector system 30 ). in other words , the temperature regulation of sample 16 as well as the investigation of gases liberated therefrom is controlled in device 10 according to a control algorithm taking account of mass signal tg detected by means of thermogravimetry ( after further processing into a mass change signal dtg ). in the course of a thermoanalysis represented by way of example in fig2 , such a control process is triggered for the first time after a time t of 17 . 3 min and a sample temperature t of 368 ° c . the threshold value for mass change signal dtg relevant for this , in the example − 5 %/ min , has previously been set by the operator as a “ control parameter ”. as can be seen from fig2 , the heating - up of sample 16 is maintained from this point in time t = 17 . 3 min for a specific length of time ( in the example , approx . 15 min ) and the decomposition gas being liberated at sample 16 is allowed to flow for a short time into valve arrangement 28 or is fed via valve / injection system 28 , 30 to gas chromatograph cg with downstream mass spectrometer ms . a measurement of retention time - resolved mass spectra is automatically started . the control algorithm used here accordingly provides a predefined temperature program with a specific time - dependent change in temperature t of sample 16 , which however is always temporarily interrupted when a “ control process ” is triggered . during such an interruption of the change in sample temperature t , gas analysis device 26 is operated in order to investigate a “ gas sample ” taken at the time when the control process is triggered . the temperature change is automatically continued after termination of the operation of gas analysis device 26 . in the example of fig2 , this takes place at a time t of approx . 32 . 5 min . from this time , a “ normal operation ” of electrical heating 20 again takes place to achieve a heating rate of 20 k / min . in the represented example , a “ control process ” is then again triggered at a time t of 36 . 2 min and a temperature of 441 ° c . this control process in turn produces the same control processes as already described above for the control process lying at t = 17 . 3 . a gas investigation by means of gas analysis device 26 is therefore also automatically started at time t = 36 . 2 min and the heating - up of sample 16 is interrupted . after completion of this measurement , the temperature program is continued in thermogravimetric cell 12 . in the represented example , this “ normal operation ” starts again at a time t of 51 . 0 min . as can be seen from fig2 , no further control process is then triggered in the example until sample temperature t has finally reached its previously set end value ( here : approx . 925 ° c .) at a time t of 74 . 5 min and the thermogravimetric process is therefore ended . as a result of the special functional coupling of the thermogravimetry on the one hand and the gas analysis on the other hand , or as a result of the special triggering of the gas chromatography or gas chromatography with downstream mass spectrometry , it is advantageously possible to assign the results of the gas analysis directly to a “ temperature stage ” without an operator intervention being required for this . in the represented example , the results of the gas investigations ( at temperatures t of 368 ° c . and 441 ° c .) are automatically assigned to the respective temperature stages by means of evaluation unit a and can thus be delivered to the operator in a very informative form . to illustrate the result of the gas investigation delivered in this example for the “ liberation temperature ” of 368 ° c ., fig3 shows a total signal of mass spectrometer ms , which has been delivered over the total period of the gas investigation phase starting at t = 17 . 3 min . in fig3 , the counting rate (“ abundance ”) detected by mass spectrometer ms , corresponding to the total ion flow of the mass spectrometer , is plotted as a function of time t ret which has elapsed since the start ( t = 17 . 3 min ) of the measurement phase . time t ret corresponds to the preceding gas chromatography retention time of the gas component currently detected by mass spectrometer ms . the signal peaks in the total mass spectrometer signal shown in fig3 make clear that the gases liberated from sample 16 at respective temperature t of 368 ° c . comprise a plurality of components . for the precise identification of these gas components , time - resolved mass spectrograms are detected ( and fed to evaluation unit a ) over the entire duration of the retention ( here : approx . 5 min ). fig4 shows in the upper part , by way of example , one such mass spectrum measured with mass spectrometer ms for the peak in the total mass spectrometer signal of fig3 lying at a retention time t ret of 1 . 26 min . an identification of the gas components concerned can take place in the context of a comparison of such mass spectra with known mass spectra ( spectra from the literature ), said comparison being carried out partially or fully automatically by evaluation unit a . in the represented example , these components have been identified as methyl butadiene ( see spectrum from the literature at bottom of fig4 ).
| 7 |
the present invention relates to solid dosage forms with a film coating that contains natural honey . the film coating provides the consumer with a strong perception of honey flavor , while the film dosage forms are not so sticky as to deter efficient packaging and eventual handling by the consumer . the following text sets forth a broad description of numerous different embodiments of the present invention . the description is to be construed as exemplary only and does not describe every possible embodiment since describing every possible embodiment would be impractical , if not impossible , and it will be understood that any feature , characteristic , component , composition , ingredient , product , step or methodology described herein can be deleted , combined with or substituted for , in whole or part , any other feature , characteristic , component , composition , ingredient , product , step or methodology described herein . numerous alternative embodiments could be implemented , using either current technology or technology developed after the filing date of this patent , which would still fall within the scope of the claims . all publications and patents cited herein are incorporated herein by reference . unless otherwise noted , the percentage of the materials used in the solid dosage forms of this invention are by total weight of the respective elements of the film coating or the inner core of the solid dosage form . as previously mentioned , solid dosage forms may include a variety of product forms . non - limiting examples of the most common solid dose forms include , but are not limited to compressed tablets , caplets , softgel capsules , solid - filled capsules , liquid - filled capsules , enteric - coated forms , sustained - release forms , solid lozenges , liquid - filled lozenges , mouth and throat drops , effervescent tablets , orally disintegrating tablets and combinations thereof . in one example the solid dosage form is a compressed tablet . in another example , the solid dosage form is not a softgel capsule or a liquid - filled capsule . solid dosage forms are typically swallowed immediately , or slowly dissolved in the mouth . regardless of their form , the solid dosage form is essentially coated in a similar manner to that described below for coating compressed tablets . tablets to be coated are typically manufactured for sale using high speed equipment or machines to efficiently compress large numbers of tablets into solid dosage forms referred to as tablet cores . tableting machines generally referred to as a tablet presses are well known in the art . granulation is fed into the press &# 39 ; hopper by either by scooping or gravity feed through tubes from a granulation transport located in a mezzanine above the press . as the granulation enters the press &# 39 ; hopper an auger distributes it evenly in a consistent flow of granulation onto the press &# 39 ; table . a typical rotary press comprises a round metallic table having a series of consecutive holes about the periphery of the table . tableting dies that dictate the shape of the resulting compressed tablets are locked into the table &# 39 ; s holes by set screws . the dies , open at both ends , accommodate a set of complementary shaped lower punches to prevent the granulation fed into the die from falling or spilling out the bottom of the die . the table rotates as granulation is fed filling the dies . as the table continues to rotate , a second set of complimentary upper punches individually enters each die and are forced downward by a cam roller , compressing the granulation into a designed size and shape . while still rotating , the upper punches pull out of the die as the lower punches rise to push the compressed tablet core out of the die wherein it is directed to a discharge chute and collected in an appropriate receptacle . the compression forces acting on the punches is established by the press operator to provide a desired hardness . tablet press operators constantly check the tablet cores &# 39 ; thickness , weight , hardness and visual condition , making adjustments as necessary to produce tablets within designed specifications at low incidents of defects . this process is repeated until the supply of granulation is exhausted . coating the inner core of a solid dosage form involves pouring bulk product such as a tablet cores into spherical coating pans having an access port on one side of the pan . upon placing bulk product into the pans , the pans rotate wherein the equipment operator applies series of measured aliquots of film coating either by hand or automatically through nozzles suspended on booms within the pans . the film coating is applied to the tumbling product on a specific schedule for even coating , allowing the product to dry between applications . as a result the coating is a series of very thin coatings that form an aesthetically pleasing a smooth , even film coated product surface free of defects such as mottling or orange peeling . film coatings of the solid dosage forms of the present invention can comprise a honey flavor . honey flavor can be selected from the group comprising natural honey , artificial honey , synthetic honey , freeze dried honey , powdered honey solids , and combinations thereof . in one example , the honey flavor is natural honey . natural honey can hide any disagreeable flavors associated with the product medicaments and consumers believe it has inherent health benefits especially compared to other sweeteners such as refined sugar or artificial sweeteners such as aspartame ®. natural honey is increasingly being used in medicinal preparations , as well as food and beverage compositions . as used herein , the term “ natural honey ” includes products made by bees ( apis mellifera l .) or other insects from the nectar of plants or from secretions of living parts of plants that the bees collect , transforming it by combining substances of their own that they deposit , dehydrate , store and leave in the honey comb to ripen and mature including naturally occurring cellulosic enzyme . a supplier of natural honey , symrise inc ., lists that one of their honey products comprises from 45 % to 55 % natural honey as well as 45 % to 55 % propylene glycol , 1 % to 3 % water , 0 . 5 % to 1 % natural flavor , and less than 0 . 5 % disodium edta as a preservative . in one example , the honey flavor is not an artificial honey , synthetic honey , freeze dried honey , or powdered honey solids . in another example , the flavor consists of natural honey flavor . in one example , the natural honey is a liquid before it is combined with other ingredients and processing steps to form the film coated tablets . in one example , the film coating contains natural honey and artificial honey , synthetic honey , or another honey flavor that is not natural honey . as previously mentioned , the taste of natural honey is an important signal to the consumer to reinforce its advertised use in a solid dosage form . therefore , the more natural honey in the film coating the stronger the signal and the more positively the product is received by the consumer . when the level is too high , however , it is believed that the coated solid dose will eventually reach a point where the solid dosage form becomes sticky . as discussed above , when natural honey in film coatings result in being sticky and tacky , manufacturers and consumers alike will be discouraged from making and using respectively such film coated solid dosage forms . given the consumer &# 39 ; s interest to use natural honey containing film coated dosage forms , however , the applicants have striven to develop a film coating that while providing the consumer with a strong perception of honey , the film coated solid dosage forms are not so sticky as to deter efficient packaging and eventual handling by the consumer . the film coated dosage forms have levels of honey so as not to be objectionably sticky as determined by measuring the tablets &# 39 ; static coefficient of friction value or hereinafter referred to as the “ static cof ” of the solid dosage form . the static cof is a dimensionless scalar value that describes the ratio of the force of friction between two bodies and the force pressing them together . the static cof is measured by the following method : test method for determining film coated tablet static coefficient of friction the test is conducted at room temperature of about 20 ° c . to about 25 ° c . and atmospheric relative humidity from about 40 % to about 50 %. the instrument for measuring the frictional forces of the film coated tablets is the 32 - 07 series friction tester , manufactured by testing machines inc . the instrument comprises a weighted sled that is in directly attached to the machine &# 39 ; s pulling arm by a pin . the arm pulls the sled across an aluminum platen attached to the chassis of the tester . the weighted sled &# 39 ; s mass is 1360 grams or 3 pounds . the method of determining the static cof value of film coated solid dosage form such as a coated compressed tablet is determined using the following method : 1 . clean the platen &# 39 ; s aluminum surface by wiping the surface with alcohol swab and allow the platen to dry ; 2 . place a film coated tablet on about the center of the platen ; 3 . place the sled over the tablet on the platen , taking precautions to allow the sled to only rest on the top surface of the tablet ; 4 . insert the sled &# 39 ; s connecting pin into the pulling arm &# 39 ; s bushing and lock the anti - skid arm in the down position therein maintaining the pulling arm &# 39 ; s lateral motion as it crosses the platen in a straight line ; 5 . start the sled &# 39 ; s movement wherein the tester records the static cof value which is the value at the point immediately before the film coated tablet starts to be dragged laterally across the platen ; and 6 . repeat the test on two more film coated tablets from the same coating pan , add all the values and divide by three to obtain the static cof value of the film coated tablets . the relationship of the level of natural honey used in the film coating and the static cof is plotted on the graph corresponding to the figure . the graph in the figure plots the static cof of the film coated tablets of the present invention on the y - axis and the percent of natural honey in the film coating by weight of the film coating on the x - axis . this graph illustrates the nearly linear relationship of these two factors wherein upon reaching a certain percentage of natural honey in the film coating , its corresponding static cof determines whether the performance of the film coated tablets is acceptable in terms of being successfully packaged and handled by consumer without being sticky . the calculation for determining the percentage of honey , as shown on the x axis of the figure , is as follows : the symrise natural honey flavor 229946 is a mixture of real honey and propylene glycol at about a 50 : 50 percentage . therefore , the calculation of percentage honey takes into account the amounts of color coating , sweetener and propylene glycol in the coating ingredients , to determine the percentage of real honey in the coating on the tablet . according to the graph in the figure , the maximum level of natural honey in the tablet &# 39 ; s film coating is about 25 % corresponding to the maximum static cof of the product for successful packaging and handling or a static cof value of about 0 . 40 . it is assumed that the minimum level of natural honey consumers will recognize and taste in a film coating is about 10 % by total weight of the film coating prior to its application . the discrete data points on the graph correspond to examples 1 through 5 described hereafter . the range of natural honey in the film coating of the tablets of the present invention is greater than 0 % to about 25 %, alternatively from about 10 % to about 25 %, alternatively about 13 % to about 23 %, alternatively about 13 % to about 20 %, and alternatively from about 13 % to about 18 % by total weight of the film coating at a static cof value less than 0 . 40 , alternatively less than 0 . 35 , alternatively less than 0 . 30 , alternatively less than 0 . 25 , alternatively less than 0 . 20 . in another embodiment the static cof can be at a level of about 0 . 15 to about 0 . 40 . in another embodiment the static cof can be at a level of about 0 . 15 to about 0 . 35 . in an additional embodiment , the static cof can be at a level of about 0 . 15 to about 0 . 30 . film coating has a number of ingredients that are important in making successfully coated solid dosage forms that have a pleasing appearance as well as functionally provide the designed bioavailability of medicaments that are intended to deliver to the consumer . in one example , the film coating does not contain gelatin . the film coating of the present invention can comprise polymeric materials and a compatible delivery vehicle for the dissolution and distribution of the polymeric materials . additionally most film coatings also comprise adjunct sweeteners , colorants and flavorants in addition to the natural honey , the selection of the polymeric material ( s ) does not favor those that hinder the perception of flavor by the consumer due to “ trapping ” the flavors including that of the natural honey in the coating . the polymeric materials are usually dissolved in a vehicle to be delivered wherein upon delivery to a surface , the polymers experience cross linking of the polymeric chains to make up the polymer . these linkages are frequently covalent bonds , hydrogen bonds that crosslink and lay flat making a smooth film coating . this coating aids in the swallowing and taste masking of the tablet . the polymeric materials for use in the present include polymers selected from the group consisting of hypromellose , hydroxyethyl cellulose , hydroxymethyl cellulose , carboxymethylcellulose sodium , hydroxypropyl cellulose , polyethylene glycol , ethylcellulose and mixtures thereof . also useful in the film coating of the present invention are enteric polymers selected from the group consisting of hypromellose phthalate , polyvinyl acetate phthalate , cellulose acetate phthalate , polymethacrylates , shellac and mixtures thereof . the film coating comprises polymeric materials from about 5 % to about 30 %, alternatively from about 10 % to about 22 %, alternatively from about 15 % to about 20 % by total weight of the film coating prior to its application . lastly polymeric materials usually incorporate plasticizers to enhance the flexibility and or pliability of the cross - linked polymer . this is important when coating solid dosage forms so the coating completely envelops the variety shapes and sizes solid dosage forms presently found in commerce . plasticizers are selected from the group consisting of polyols such as glycerol , propylene glycol , polyethylene glycol ( peg ); organic esters including phthalate esters ; dibutyl sebacete and citrate esters ; castor oil ; acetylated or / and monoglycerides ; fractioned coconut oils and mixtures thereof . a liquid vehicle delivers the polymeric material and all of the other ingredients comprising the solid dosage forms film coating . environmental impact and economic considerations enter the decision of the selected vehicle ; however , the foremost decision resides in which vehicle is most compatible and useful with the polymeric materials . the vehicle is selected from the group consisting of water , alcohols , ketones , esters and mixtures thereof , but generally water is used . the film coating comprises a vehicle that is from about 50 % to about 95 %, alternatively from about 70 % to about 90 %, alternatively from about 80 % to about 85 % by total weight of the film coating prior to its application . notwithstanding the presence of natural honey in sufficiently high levels in the present invention sweeteners may optionally be added to the film coating of the present invention . in another example , sweeteners can be added to the inner core of the solid dosage forms . in one example , the coating , the inner core , and / or the solid dosage form is substantially free of artificial sweeteners . in one example , honey is not present in the inner core . suitable sweeteners for use herein can include aspartame , saccharin and its salts , sucralose ™ ( sold by the mcneil specialty products co ., new brunswick , n . j . ); prosweet ™ ( sold by the virginia dare extract co ., new york , n . y . ); magnasweet ™ ( sold by mafco worldwide corp ., licorice division , camden , n . j . ); ammonium glycyrrhizinate and its salts , talin ™ ( thaumatin ) and its diluted products , such as talin ga90 , ( sold by the talin food company , birkenhead , england ); and acesulfame k , or mixtures thereof . in one example , the sweetener is sucralose . in one example , the film coating can comprise sweeteners from about 0 . 05 % to about 5 %, alternatively from about 0 . 10 % to about 2 %, alternatively from about 0 . 25 % to about 1 . 0 % by total weight of the film coating prior to its application . other flavoring agents that may be used in the film coating and / or the core of the present invention . other flavoring agents can include anise , oil of peppermint , oil of clove , eucalyptus , lemon , lime , honey lemon , red fruit , mint , grapefruit , orange , cherry cola or mixtures thereof . the film coating and / or the core may comprise flavoring agents from about 0 . 05 % to about 25 %, alternatively from about 0 . 1 % to about 20 . 0 %, alternatively from about 2 . 5 % to about 15 . 0 %, and alternatively from about 2 . 5 % to about 8 % by total weight of the film coating prior to its application or by total weight of the core . colorants can also be added to the film coating and / or the core . colorants are selected by one skilled in the art for a number of reasons including marketing of the product . it has herein been found that certain colors assist in providing a signal to consumers regarding the content of the solid dosage form . the colorants may be natural or synthetic dyes and pigments selected from the group consisting of organic dyes and their lakes , iron oxide pigments , titanium dioxide , talc , anthocyanins , carmine , riboflavin , and mixtures thereof . in one example , the solid dosage form does not comprise synthetic dyes or synthetic pigments . in one example , the film coating can comprise a yellow or a honey coloring . the film coating may comprise colorants from about 0 . 05 % to about 3 . 0 %, alternatively from about 0 . 5 % to about 2 . 0 %, alternatively from about 0 . 5 % to about 1 . 5 % to about 0 . 5 % by total weight of the film coating prior to its application . the solid dosage form can comprise actives . the actives can be contained in the film coating and / or the inner core . in one example , the film coating is substantially free of actives . non - limiting examples of actives can include actives suitable for use with a respiratory condition , actives suitable for use with gastrointestinal conditions , vitamins , minerals , elements , plant - derived materials , energy - boosting materials , probiotics , supplements , fiber , prebiotics , and combinations thereof . such actives are grouped generally below for ease of presentation , but as would be understood by those of skill in the art , there is overlap in usage of many of the actives described herein — for example such actives as anti - inflammatory and / or pain actives which can be used with respiratory conditions , gastrointestinal conditions , muscle and joint conditions , menstrual conditions and the like . when used in the inner core , prescription or non - prescription actives can be administered according to a prescribed regimen and can be combined in a system or kit with additional , non - prescription actives as disclosed in co - pending patent application u . s . ser . no . 12 / 971 , 677 , filed dec . 17 , 2010 . the solid dosage forms can comprise from greater than 0 % to about 90 %, alternatively from about 0 . 0001 % to about 75 %, alternatively from about 0 . 001 % to about 50 %, alternatively from about 0 . 01 % to about 25 %, alternatively from about 0 . 01 % to about 15 %, and alternatively from about 0 . 01 % to 10 % active , by weight of the solid dosage form . in another example , the inner core can comprise from about 0 . 5 % to about 70 %, alternatively from about 1 % to about 65 %, alternatively from about 10 % to about 60 %, and alternatively from about 25 % to about 55 % pharmaceutical active , by weight of the inner core . the solid dosage forms can comprise from about 0 . 001 mg to about 1000 mg , alternatively from about 2 . 5 mg to about 750 mg , alternatively from about 5 mg to about 650 mg , alternatively from about 10 mg to about 550 mg , alternatively from about 25 mg to about 500 mg , alternatively from about 50 mg to about 400 mg , alternatively from about 100 mg to about 375 mg , and alternatively from about 200 mg to about 350 mg of the active , per solid dosage form . the solid dosage forms can be administered in a single daily dose or multiple daily doses . in one example , the solid dosage forms are administered every twelve hours , in another example one time every eight hours , in another example one time every six hours , in another example one time every four hours , and in another example the user can administer the solid dosage forms whenever they are needed . the solid dosage form can comprise one or more actives suitable for use with a respiratory condition . respiratory conditions encompass a broad range of conditions , including viral infections such as cold and flu , bacterial infections , as well as allergies , sinusitis , rhinitis , asthma , and the like . respiratory conditions may present with any of a variety of symptoms , such as runny nose , nasal and / or chest congestion , cough , sneezing , pressure , headache , aches , fever , fatigue and / or sore throat . actives suitable for use with a respiratory condition can treat or mitigate these symptoms and generally fall into the following classifications : decongestants , anti - cholinergics , expectorants , antihistamines , antitussives , pain relievers , anti - virals , mucolytics , demulcents , anesthetics , and antibiotics . such actives can include non - prescription pharmaceutical actives and prescription pharmaceutical actives . such solid dosage forms can be prepared by any known or otherwise effective technique as would be understood by those of skill in the art such as those described in this application as well as u . s . 2009 / 0082316 . non - limiting examples of decongestants can include pseudoephedrine , pseudoephedrine hydrochloride , phenylephrine , phenylephrine hydrochloride , phenylpropanolamine , oxymetazoline , xylometazoline , naphazoline , l - desoxyephedrine , ephedrine , propylhexedrine , and combinations thereof ; non - limiting examples anticholinergics can include ipratropium , chlorpheniramine , brompheniramine , diphenhydramine , doxylamine , clemastine , triprolidine , and combinations thereof ; non - limiting examples of expectorants can include guaifenesin , ambroxol , bromhexine , and combinations thereof ; non - limiting examples of antihistamines can include chlorpheniramine , desloratadine , levocetirizine , diphenhydramine , doxylamine succinate , triprolidine , clemastine , pheniramine , brompheniramine , dexbrompheniramine , loratadine , cetirizine , fexofenadine , amlexanox , alkylamine derivatives , cromolyn , acrivastine , ibudilast , bamipine , ketotifen , nedocromil , omalizumab , dimethindene , oxatomide , pemirolast , pyrrobutamine , pentigetide , thenaldine , picumast , tolpropamine , ramatroban , repirinast , suplatast tosylate aminoalkylethers , tazanolast , bromodiphenhydramine , tranilast , carbinoxamine , traxanox , chlorphenoxamine , diphenylpyraline , embramine , p - methyldiphenhydramine , moxastine , orphenadrine , phenyltoloxamine , setastine , ethylenediamine derivatives , chloropyramine , chlorothen , methapyrilene , pyrilamine , talastine , thenyldiamine , thonzylamine hydrochloride , tripelennamine , piperazines , chlorocyclizine , clocinizine , homochlorcyclizine , hydroxyzine , tricyclics , phenothiazines , mequitazine , promethazine , thiazinamium methylsulfate , azatadine , cyproheptadine , deptropine , isothipendyl , olopatadine , rupatadine , antazoline , astemizole , azelastine , bepotastine , clemizole , ebastine , emedastine , epinastine , levocabastine , mebhydroline , mizolastine , phenindamine , terfenadine , tritoqualine , and combinations thereof ; non - limiting examples of antitussives ( i . e . cough suppressants ) can include dextromethorphan , menthol , codeine , chlophedianol , levodropropizine , and combinations thereof ; non - limiting examples of pain relievers , can include acetaminophen , ibuprofen , ketoprofen , diclofenac , naproxen , aspirin , and combinations thereof , as well as prescription analgesics , non - limiting examples of which include propyxhene hcl , codeine , meperidine , and combinations thereof ; non - limiting examples of anti - virals can include amantidine , rimantadine , pleconaril , zanamivir , oseltamivir , and combinations thereof ; non - limiting examples of mucolytics can include ambroxol , n - acetylcysteine , bromhexine , and combinations thereof ; non - limiting examples of demulcents can include glycerin , honey , pectin , gelatin , slippery elm bark , liquid sugar , glycyrrhizin ( licorice ), and combinations thereof ; non - limiting examples of anesthetics can include phenol , menthol , dyclonine hcl , benzocaine , lidocaine , hexylresorcinol , and combinations thereof ; non - limiting examples of antibiotics can include nitroimidazole antibiotics , tetracyclines , penicillin - based antibiotics such as amoxicillin , cephalosporins , carbopenems , aminoglycosides , macrolide antibiotics , lincosamide antibiotics , 4 - quinolones , fluoroquinolones , rifamycins , macrolides , nitrofurantoin , and combinations thereof ; and any pharmaceutically acceptable salts , metabolites , and combinations thereof of the above - listed actives . in one example , the solid dosage form comprises one or more of the following : decongestants , expectorants , antihistamines , antitussives , and pain relievers . in one example the solid dosage form comprises a decongestant , an expectorant , an antitussive , and a pain reliever . in another example the solid dosage form comprises a decongestant , a pain reliever , and an antitussive . in one example , the decongestant is selected from the group consisting of pseudoephedrine hydrochloride , phenylephrine hydrochloride , and combinations thereof . in one example , the expectorant can be guaifenesin . in one example , the antihistamine can be chlorpheniramine . in one example the antitussive can be selected from the group consisting of dextromethorphan , codeine , and combinations thereof . in one example the pain relievers can include acetaminophen , ibuprofen , or combinations thereof . in one example , the dosage unit can be formulated as a daytime formula and can further comprise caffeine which is a stimulant . in another example , the dosage unit can be formulated as a nighttime formula and comprise a sedative and / or be formulated without a stimulant in one example , the dosage units comprise one or more actives suitable for use with a respiratory condition , in another example the dosage units comprise two or more actives suitable for use with a respiratory condition , in another example the dosage units comprise three or more actives suitable for use with a respiratory condition , and in another example the dosage units comprise four or more actives suitable for use with a respiratory condition . in one example , the dosage unit comprises exactly one active suitable for use with a respiratory condition , in another example exactly two actives suitable for use with a respiratory condition , in another example exactly three actives suitable for use with a respiratory condition , and in another example exactly four actives suitable for use with a respiratory condition . in one example the dosage units comprise acetaminophen , dextromethorphan , and phenylephrine . in another example the dosage units comprise acetaminophen , dextromethorphan , phenylephrine , and guaifenesin . the solid dosage form can comprise one or more actives suitable for use with a gastrointestinal condition . actives suitable for use with a gastrointestinal condition can treat or mitigate gastrointestinal symptoms and generally fall into the following classifications : anti - diarrheal actives , laxatives , antacids , anti - flatulent / anti - gas agents , h2 receptor antagonists , proton pump inhibitors , and anti - inflammatories . non - limiting examples of actives suitable for use with gastrointestinal conditions can include : non - limiting examples of anti - diarrheal actives can include loperamide , bismuth - containing compositions , bismuth subsalicylate , colloidal bismuth subcitrate , bismuth subcitrate , kaolin , pectin , clays such as attapulgite , activated charcoal , and combinations thereof ; non - limiting examples of laxatives can include fiber , resistant starch , resistant maltodextrin , pectin , cellulose , modified cellulose , polycarbophil , senna , sennosides , bisacodyl , sodium phosphate , docusate , magnesium citrate , mineral oil , glycerin , aloe , castor oil , magnesium hydroxide , and combinations thereof ; anti - nausea and anti - emetic agent , non - limiting examples of which include bismuth containing compositions , phosphated carbohydrates , diphenhydramine , cyclizine , meclizine , and combinations thereof ; non - limiting examples of antacids can include sodium bicarbonate , sodium carbonate , calcium carbonate , magnesium carbonate , magnesium hydroxide , aluminum hydroxide , magnesium silicates , alginic acids , sodium alginate , magaldrate , and combinations thereof ; non - limiting examples of anti - flattulent / anti - gas agents can include simethicone , activated charcoal , lactase , alpha - galactosidase enzymes , and combinations thereof ; non - limiting examples of h2 receptor antagonists can include famotidine , ranitidine , cimetidine , nitazidine , and combinations thereof ; non - limiting examples of proton pump inhibitors can include omeprazole , lansoprazole , esomeprazole , pantoprazole , rabeprazole , and combinations thereof ; non - limiting examples of anti - inflammatories can include mesalamine ; and any pharmaceutically acceptable salts , metabolites , and combinations thereof ; rafting agents non - limiting examples of which include alginates ; pectins and polysaccharides , and combinations thereof of the above - listed actives . the solid dosage forms can comprise one or more vitamins , including but not limited to provitamin and all forms of vitamins c , d , a , b , e , and combinations thereof . in one example , the vitamin is vitamin c in the form of ascorbic acid or the equivalent of a salt of ascorbic acid or the equivalent of a derivative of ascorbic acid . in one example , the vitamin c can be an immediate release form and in another example the vitamin c can be in a sustained release form . nonlimiting examples of vitamin d can include vitamin d3 ( cholecalciferol ), vitamin d2 ( ergocalciferol ) and combinations thereof . additional , nonlimiting examples also include metabolites of vitamin d , including calcidiol , calcitriol , and combinations thereof . the vitamin d , including cholecalciferol , ergocalciferol , calcidiol and calcitriol , may be derived from synthetic or natural sources . vitamin d , including cholecalciferol and calcitriol , may be sourced from an extract of solanum glaucophyllum ( malacoxylon ), trisetum flavescens ( goldhafer ) or cestrum diurnum . both the pure vitamin d and / or glycosides of the vitamin d , may be used . non - limiting examples of the vitamin a useful in the present invention can include vitamin a , retinol , retinyl palmitate , retinyl acetate , retinyl proprionate , beta - carotene , alpha - carotene , beta - cryptoxanthin , and mixtures thereof . non - limiting examples of vitamin b can include vitamin b1 ( thiamin ), vitamin b2 ( riboflavin ), vitamin b3 ( niacin ), vitamin b5 ( pantothenic acid ), vitamin b6 ( pyridoxine , pyridoxal , or pyridoxamine ), vitamin b7 ( biotin ), vitamin b9 ( folic acid ), vitamin b12 ( cyanocobalamin ), and combinations thereof . in one example , the inner core of the solid dosage forms can comprise vitamin e . vitamin e is a lipid soluble antioxidant and provides defenses against cellular oxidative damage . the term “ vitamin e ” typically includes eight different chemical forms : four tocopherols and four tocotrienols . the most active form of vitamin e is alpha - tocopherol . when certain vitamins , ( also certain minerals , metals , elements and the like ), are included as components in the solid dosage forms , the actual amounts of many of these components , in grams per unit dose , are often extremely small , and make the individual components difficult to handle , measure and process . therefore such components are commonly prepared or purchased as a premix in or on a carrier such as sucrose or lactose . with respect to the weight percent of a given vitamin as a percent of a premix or vitamin - carrier mix , such percentages can vary greatly depending on the vitamin and the amount of vitamin desired , as would be understood by one of skill in the art . generally , however , for vitamins in or on a carrier , the vitamin can comprise , as a weight percent of vitamin to carrier , from about 0 . 0001 % to about 50 %, alternatively from about 0 . 001 % to about 45 %, alternatively from about 0 . 001 % to about 40 %, by weight of the vitamin - carrier composition . the solid dosage forms can comprise minerals , metals and / or elements . non - limiting examples of minerals , metals , and elements useful in the systems of the present invention include : zinc , iron , calcium , iodine , copper and selenium . when present , the minerals , metals and / or elements can be on or in a suitable carrier , and comprise from about 1 % to about 50 % by weight and alternatively from about 2 % to about 30 %, by weight of the composition comprising the mineral , metal or element and the carrier . the minerals , metals , and elements can be administered in a single daily dose or multiple daily doses . the solid dosage forms can comprise plant - derived materials . as used herein , non - limiting examples of plant - derived materials include those used in traditional native american , chinese , aryuvedic and japanese medicine , including flowers , leaves , stems and roots of plants as well as extracts and isolated active components from the flower , leaves , stems , and roots of plants . some particularly useful plant - derived materials include , but are not limited to , andrographis ( andrographis paniculata ), garlic ( allium sativum l . ), eleutherococcus senticosus ( siberian ginseng ), ginseng ( american ginseng , asian ginseng , chinese ginseng , korean red ginseng , panax ginseng : panax ssp . including p . ginseng c . c . meyer , and p . quinquefolius l . ), propolis , slippery elm ( ulmus rubra muhl , ulmus fulva michx ), quercetin ( a flavanol ), and combinations and / or mixtures thereof . particularly useful plant - derived materials are those that have beneficial respiratory , gastrointestinal , overall health and energy effects . the plant - derived materials can be administered in a single dose or multiple daily doses . other plant - derived materials can exert beneficial effects on the gastrointestinal tract , non - limiting examples of which include soothing or demulcent effects , gas reducing or carminative effects , anti - diarrheal or astringent effects , laxative or aperient , cathartic , purgative or hydrogogue effects , analgesic , antispasmodic or relaxation effects , stimulant or bitter effects , or digestive aiding effects . non - limiting examples of such other plant - derived materials useful in the methods and systems include the ginger family ( zigiberaceae ), licorice root ( glycyrrhizin glabra ), marshmallow root ( althea officinalis , althea radix ), chamomile ( matricariae flos , chamaemelum nobile ), fennel oil , fennel seed ( foeniculum vulgare ), caraway oil , caraway seed ( carum carvi , carvi fructus , carvi aetheroleum ), lemon balm ( melissae folium , melissa ), horehound herb ( murrubii herba ), flaxseed alpha - linoleic acid ( lini semen ), and combinations thereof . the solid dosage forms can comprise materials having energy boosting / enhancing benefits . such energy benefits are useful for overall health and well - being , as well as being useful in treating conditions such as respiratory and gastrointestinal conditions , to provide individuals afflicted with such conditions with more energy or a perception of more energy to enable such individuals to maintain their daily routines while treating a condition such as a respiratory or gastrointestinal condition . non - limiting examples of such materials include the following , many of which have multiple benefits including benefits for respiratory and gastrointestinal conditions : caffeine ( a stimulant and diuretic ), vitamin b complex , green and black tea ( which can be used for stimulant and diuretic properties of the caffeine contained therein ), taurine , rhodiola rosea , siberian ginseng ( eleutherococcus senticosus ), vitamin c , iron , coq10 , l - carnitine , l - theanine , vitamin d , guarana ( paullinia cupana ), magnesium , schizandra chinensis , yerba mata ( ilex paraguariensis ), goji ( wolfberry ), quercetin ( a flavanol ), amalaki ( indian gooseberry ), acai ( from genus euterpe ), maca ( lepidium meyenii ), ginkgo biloba , glucuronolactone , panax ginseng ( from species within panax , a genus of 11 species of slow - growing perennial plants with fleshy roots , in the family araliaceae ), echinacea ( genus of nine species of herbaceous plants in the family asteraceae ), rooibos ( aspalathus linearis ), dhea , aromas and aromatherapy , noni ( morinda citrifolia ), mangosteen ( garcinia mangostana ), and selenium . the energy boosting material can be administered in a single daily dose or multiple daily doses . the inner core of the solid dosage forms can comprise from about 1 μg to about 10 g , alternatively from about 1 mg to about 5 g , and alternatively from about 100 mg to about 5 g of energy - boosting / enhancing material , per inner core of the solid dosage form . the solid dosage forms can comprise a probiotic . in one example , the inner core comprises probiotics . proboitcs can be useful in treating and / or preventing respiratory conditions , treating and / or preventing gastrointestinal conditions , as well as providing overall health benefits . as used herein , “ probiotic ” includes natural and / or genetically modified microorganisms , viable or dead ; processed compositions of micro - organisms ; their constituents and components such as proteins and carbohydrates or purified fractions of bacterial ferments ; that beneficially affect a host . the general use of probiotics herein is in the form of viable cells . however , use can be extended to non - viable cells such as killed cultures or compositions containing beneficial factors expressed by the probiotic . killed cultures may include thermally killed microorganisms , or microorganisms killed by exposure to altered ph or subjected to pressure . for the purpose of the present invention , “ probiotic ” is further intended to include metabolites generated by the microorganisms during fermentation , if they are not separately indicated . these metabolites may be released to the medium of fermentation , or they may be stored within the microorganism . as used herein “ probiotic ” also includes bacteria , bacterial homogenates , bacterial proteins , bacterial extracts , bacterial ferment supernatants , and mixtures thereof , which perform beneficial functions to a host animal when given at a therapeutically effective amount . non - limiting examples of probiotic bacteria suitable for use herein can include strains of streptococcus lactis , streptococcus cremoris , streptococcus diacetylactis , streptococcus thermophilus , lactobacillus bulgaricus , lactobacillus acidophilus , lactobacillus helveticus , lactobacillus bifidus , lactobacillus casei , lactobacillus lactis , lactobacillus plantarum , lactobacillus rhamnosus , lactobacillus delbruekii , lactobacillus thermophilus , lactobacillus fermentii , lactobacillus salivarius , lactobacillus reuteri , lactobacillus brevis , lactobacillus paracasei , lactobacillus gasseri , pediococcus cerevisiae , bifidobacterium longum , bifidobacterium infantis , bifidobacterium adolescentis , bifidobacterium bifidum , bifidobacterium animalis , bifidobacterium pseudolongum , bifidobacterium thermophilum , bifidobacterium lactis , bifidobacterium bulgaricus , bifidobacterium breve , bifidobacterium subtilis , escherichia coli and strains of the genera including bacillus , bacteroides , enterococcus ( e . g ., enterococcus faecium ) and leuconostoc , and mixtures and / or combinations thereof . as a portion of the compositions of the inner core of the solid dosage forms , the probiotic , as a freeze - dried powder ( as would be understood by one of skill in the art ) can comprise from about 1 % to about 50 %, alternatively from about 1 % to about 40 %, alternatively from about 1 % to about 30 %, and alternatively from about 2 % to about 20 %, by weight of the composition of the inner core of the solid dosage forms . the probiotic can be administered in a single daily dose or multiple daily doses . the solid dosage forms can also comprise fiber . fiber can be useful in treating and / or preventing gastrointestinal conditions , as well as providing overall gastrointestinal health benefits . as used herein , the term “ fiber ” means carbohydrate polymers including those naturally occurring in food as consumed ; those having been obtained from food raw material by physical , enzymatic or chemical means ; and synthetic carbohydrate polymers , which are resistant to digestion and absorption in the small intestine and have partial fermentation in the large intestine . non - limiting examples of fibers and analogous carbohydrate polymers can include pectins , psyllium , guar gum , xanthan gum , alginates , gum arabic , fructo - oligosaccharides , inulin , agar , beta - glucans , chitins , dextrins , lignin , celluloses , non - starch polysaccharides , carrageenan , reduced starch , and mixtures and / or combinations thereof . in one embodiment , the fiber is glucose polymers , preferably those which have branched chains . among such suitable fibers is one marketed under the tradename “ fibersol2 ”, commercially available from matsutani chemical industry co ., itami city , hyogo , japan . other non - limiting examples of suitable fibers include oligosaccharides , such as inulin and its hydrolysis products commonly known as fructo - oligosaccharides , galacto - oligosaccharides , xylo - oligosaccharides , and oligo derivatives of starch . the fiber can be administered in a single daily dose or multiple daily doses . the inner core of the solid dosage forms can comprise from about 10 mg to about 100 g , alternatively from about 50 mg to about 50 g , alternatively from about 100 mg to about 50 g , alternatively from about 500 mg to about 50 g , and alternatively from about 1 g to about 40 g of fiber , per inner core of the solid dosage form . the solid dosage forms can comprise a prebiotic . prebiotics can be useful in treating and / or preventing gastrointestinal conditions , as well as providing overall gastrointestinal health benefits . as used herein , the term “ prebiotic ” includes substances or compounds that beneficially affect the host mammal by selectively promoting the growth and / or activity of one or more probiotic bacteria in the gastro - intestinal tract of the host animal , thus maintaining normal health or improving health of the host . typically , prebiotics are carbohydrates , ( such as oligosaccharides ), but the term “ prebiotic ” as used herein does not preclude non - carbohydrates . many forms of “ fiber ” exhibit some level of prebiotic effect . thus , there is considerable overlap between substances that can be classified as “ prebiotics ” and those that can be classified as “ fibers ”. non - limiting examples of prebiotics suitable for use in the compositions and methods can include psyllium , fructo - oligosaccharides , inulin , oligofructose , galacto - oligosaccharides , isomalto - oligosaccharides , xylo - oligosaccharides , soy - oligosaccharides , gluco - oligosaccharides , mannan - oligosaccharides , arabinogalactan , arabinxylan , lactosucrose , glucomannan , lactulose , polydextrose , oligodextran , gentioligosaccharide , pectic oligosaccharide , xanthan gum , gum arabic , hemicellulose , resistant starch and its derivatives , reduced starch , and mixtures and / or combinations thereof . the prebiotic can be administered in a single daily dose or multiple daily doses . the inner core of the solid dosage forms can comprise from about 100 mg to about 100 g , alternatively from about 500 mg to about 50 g , and alternatively from about 1 g to about 40 g of prebiotic , per solid dosage form . the solid dosage forms can comprise additional ingredients which can be selected from , but are not limited to : polyphenols , non - limiting examples of which can include tea extract , rosemary extract , rosemarinic acid , coffee extract , caffeine , caffeic acid , turmeric extract , blueberry extract , grape extract , grape seed extract , soy extract and combinations thereof ; amino - acids ; fatty acids ; carotenoids ; anti - oxidants ; and combinations thereof . the additional ingredients may be administered in a single daily dose or multiple daily doses . the solid dosage forms can also comprise an excipient as would be understood by those of skill in the art with respect to production of various types of dosage units . in one example , the inner core comprises the excipient . non - limiting examples of excipients include microcrystalline cellulose , dicalcium phosphate , stearic acid , magnesium stearate , corn starch , lactose , sodium crosscarmellose , sodium starch glycolate , polyvinylpyrollidone , gelatin , and combinations thereof . the inner core of the solid dosage forms can comprise from about 1 % to about 99 %, alternatively from about 2 % to about 70 %, alternatively from about 3 % to about 50 %, alternatively from about 5 % to about 30 %, and alternatively from about 6 % to about 25 %, of the excipient , by weight of the inner core of the solid dosage form . in another example the solid dosage form comprises from about 15 % to about 55 % excipient , in another example from about 20 % to about 45 %, in another example from about 25 % to about 40 %, and in another example from about 30 % to about 38 %, by weight of the solid dosage form . the inner core of the solid dosage forms can also comprise one or more of a wide range of optional ingredients and process aids as would be understood by those of skill in the art with respect to production of various dosage forms . non - limiting examples of optional ingredients include plasticizers , colorants , flavorants , sweeteners , buffering agents , slip aids , carriers , ph adjusting agents , natural ingredients , stabilizers , biological additives such as enzymes ( including proteases and lipases ), chemical additives , coolants , chelants , denaturants , drug astringents , emulsifiers , external analgesics , fragrance compounds , humectants , opacifying agents ( such as zinc oxide and titanium dioxide ), anti - foaming agents ( such as silicone ), preservatives ( such as butylated hydroxytoluene ( bht ) and butylated hydroxyanisole ( bha ), propyl gallate , benzalkonium chloride , edta , benzyl alcohol , potassium sorbate , parabens and mixtures thereof ), reducing agents , solvents , hydrotropes , solubilizing agents , suspending agents ( non - surfactant ), solvents , viscosity increasing agents ( aqueous and non - aqueous ), sequestrants , keratolytics , and the like , and mixtures and / or combinations thereof . generally , unless otherwise specified herein , the inner core of the solid dosage forms can comprise from about 0 . 001 % to about 99 %, alternatively from about 0 . 01 % to about 80 %, alternatively from about 0 . 01 % to about 50 %, and alternatively from about 0 . 01 % to about 10 %, of optional ingredient ( s ) by weight of the composition of the inner core of the solid dosage form . sweeteners and flavors may optionally be added to the inner core of the solid dosage compositions and / or the film coating honey compositions of the present invention . suitable flavors for use herein include aspartame , saccharin and its salts , sucralose ™ ( sold by the mcneil specialty products co ., new brunswick , n . j . ); prosweet ™ ( sold by the virginia dare extract co ., new york , n . y . ); magnasweet ™ ( sold by mafco worldwide corp ., licorice division , camden , n . j . ); ammonium glycyrrhizinate and its salts , talin ™ ( thaumatin ) and its diluted products , such as talin ga90 , ( sold by the talin food company , birkenhead , england ); and acesulfame k , or mixtures thereof . the inner core and the film coating of the present invention may further comprise sensory agents . suitable non - limiting examples of sensory agents can include sensory agents selected from the group consisting of coolants , salivating agents , warming agents or mixtures thereof . when present , these agents are preferably present in the compositions at a level of from about 0 . 001 % to about 10 %, preferably from about 0 . 1 % to about 1 %, by weight of the composition . non - limiting examples of suitable cooling agents include but are not limited to , carboxamides , menthols , thymol , camphor , phenol , eucalyptus oil , benzyl alcohol , salicyl alcohol , ethanol , clove bud oil , and hexylresorcinol , ketals , diols , and mixtures thereof . preferred warming agents include thymol , camphor , capsicum , phenol , benzyl alcohol , salicyl alcohol , ethanol , clove bud oil , and hexylresorcinol , nicotinate esters such as benzyl nicotinate , ketals , diols , capsicum , and mixtures thereof . coolants can include the paramenthan carboxyamide agents such as n - ethyl - p - menthan - 3 - carboxamide ( known as “ ws - 3 ” supplied by sterling organics ), taught by u . s . pat . no . 4 , 136 , 163 , issued jan . 23 , 1979 , to watson et al . and carboxyamide agent is n , 2 , 3 - trimethyl - 2 - isopropylbutanamide , known as “ ws - 23 ”, or mixtures of ws - 3 and ws - 23 . in one example , the solid dosage form comprises ws - 3 . additional coolants can be selected from the group consisting of menthol , 3 - l - menthoxypropane - 1 , 2 - diol , known as tk - 10 or cool agent 10 , supplied by takasago perfumery co ., ltd ., tokyo , japan , menthone glycerol acetal known as mga , manufactured by haarmann and reimer , menthyl lactate known as frescolat ® manufactured by haarmann and reimer , or mixtures thereof . additional non - limiting examples of coolants include n -( 4 - cyanomethylphenyl )- ρ - menthanecarboxamide or n -( 4 - cyanomethylphenyl )- 5 - methyl - 2 -( 1 - methylethyl ) cyclohexanecarboxamide ( for example , commercially available from givaudan ), n -( 2 -( pyridin - 2 - yl ) ethyl - 3 - p - menthanecarboxamide ( for example , commercially available from givaudan ), n -( 4 - sulfamoylphenyl )- ρ - menthanecarboxamide , n -( 4 - cyanophenyl )- ρ - menthanecarboxamide , n -( 4 - acetylphenyl )- ρ - menthanecarboxamide , n -( 4 - hydroxymethylphenyl )- ρ - menthanecarboxamide , n -( 3 - hydroxy - 4 - methoxyphenyl )- ρ - menthanecarboxamide , ethyl 3 -( ρp - menthane - 3 - carboxamido ) acetate ( for example , known as ws - 5 ), ρ - menthane - 3 , 8 - diol ( for example , commercially available as pmd38 from takasago international ), isopulegol ( for example , commercially available under the name “ coolact p ®” from takasago international ), ( 1r , 2s , 5r )- 2 - isopropyl - 5 - methyl - n -( 2 -( pyridyn - 2 - yl ) ethylcyclohexane carboxamide , ( 1 - glyceryl - p - menthane - 3 - carboxylate ), ( ethyleneglycol - p - methane - 3 - carboxylate ), ( n - t - butyl - p - menthane - 3 - carboxamide ), ( n -( 4 - ethoxyphenyl )- p - menthane - 3 - carboxamide ), 3 -( 1 - menthoxy ) propane - 1 , 2 - diol , 3 -( 1 - menthoxy )- 2 - methylpropane - 1 , 2 - diol , menthyl pyrrolidone carboxylate ) ( for example , commercially available as questice ®), ( 1r , 3r , 4s )- 3 - menthyl - 3 , 6 - dioxaheptanoate ( for example , commercially available from firmenich ), ( 1r , 2s , 5r )- 3 - menthyl methoxyacetate ( for example , commercially available from firmenich ), ( 1r , 2s , 5r )- 3 - menthyl 3 , 6 , 9 - trioxadecanoate ( for example , commercially available from firmenich ), ( 1r , 2s , 5r )- menthyl 11 - hydroxy - 3 , 6 , 9 - trioxaundecanoate ( for example , commercially available from firmenich ), ( 1r , 2s , 5r )- 3 - menthyl ( 2 - hydroxyethoxy ) acetate ( for example , commercially available from firmenich ), cubebol ( for example , commercially available from firmenich ), 1 -[ 2 - hydroxyphenyl ]- 4 -[ 2 - nitrophenyl -]- 1 , 2 , 3 , 6 - tetrahydropyrimidine - 2 - one ), 4 - methyl - 3 -( 1 - pyrrolidinyl )- 2 [ 5h ]- furanone ( for example , known as icilin or ag - 3 - 5 ), menthyl lactate , menthone glycerin acetal , l - monomenthyl succinate , l - monomenthyl glutarate , 3 - l - menthoxypropane - 1 , 2 - diol ( for example , known as coolact 10 ), 2 - l - menthoxyethanol ( for example , known as cooltact 5 ), and mixtures thereof . additional coolants are described in u . s . pat . no . 7 , 414 , 152 , us20100086498 a1 and wo2010 / 128026 a2 . in one embodiment , the coolant is n -( 4 - cyanomethylphenyl )- ρ - menthanecarboxamide including all 8 stereoisomers arising from the 3 chiral centers . in particular , the [ 1r , 2s , 5r ]- n -( 4 - cyanomethylphenyl )- ρ - menthanecarboxamide can be readily synthesized from natural 1 - menthol . the film coated tablets described herein can be made by any suitable tableting and coating process . examples 1 - 4 , described hereafter , describe a pan coating process . the film coating can be applied as a liquid film coating . in one example the liquid film coating comprises from about 8 % to about 25 % solids , in another example from about 12 % to about 24 % solids , in another example from about 13 % to about 21 % solids , and in another example from about 14 % to about 19 % solids , by weight of the liquid film coating . in one example , when the pan coating process is complete , the tablet cores have a total weight gain of about 0 . 5 % to about 10 %, in another example from about 1 % to about 8 %, in another example from about 2 % to about 6 %, and in another example from about 2 . 5 % to about 5 %. in one example , the tablet cores have a total weight gain of about 3 %. tablet cores are prepared by normal tableting practices on a high speed tablet press at medium compression pressure . 3 available as a powder from tate and lyle inc . singapore pte ltd . the tablets are then coated in a vector tablet coater lcd 5 with a 1 . 3 l spray pan . prepare coating solution by weighing out the water and with mixing using for example a four blade propeller , slowly add colorant with an agitation speed of 200 - 700 rpm for 45 minutes or until completely dispersed . slowly add flavor and sweetener with mixing for about 15 minutes until homogeneous . at this point the 14 . 3 % solids coating solution is ready for use for coating tablet cores . weigh out about 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start spray about 3 grams per minute until the coating is evenly found on the tablet cores and then increase the level of coating solids sprayed to between 7 and 8 grams per minute . the total spraying time of the coating is typically less than about 30 minutes to achieve the final tablets weight gain of 3 %. time and volume of film coat applied varies depending on what is the desired weight gain . tablet cores are prepared by normal tableting practices on a high speed tablet press at medium compression pressure . these tablets are then coated in a vector tablet coater lcd 5 with a 1 . 3 l spray pan . prepare coating solution by weighing out the water and with mixing using for example a four blade propeller , slowly add colorant with an agitation speed of 200 - 700 rpm for 45 minutes or until completely dispersed . slowly add flavor and sweetener with mixing for about 15 minutes until homogeneous . at this point the coating is ready for use for coating tablet cores . weigh out about 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start spray about 3 grams per minute until the coating is evenly found on the tablet cores and then increase the level of coating solids sprayed to between 7 and 8 grams per minute . the total spraying time of the coating is less than 30 minutes wherein the final weight gain of the tablet by coating is 3 . 0 %. coating ingredients % purified water 83 . 6 opadry ii yellow 57u120009 1 9 . 53 natural honey flavor 229946 2 6 . 35 sucralose nf 3 0 . 53 1 available from colorcon inc . 2 available as a liquid from symrise inc . 3 available as a powder from tate and lyle inc . singapore pte ltd . the coating solution is prepared by weighing out the water and mixed with a four blade propeller the colorant is added slowly with agitation speed of 200 - 700 rpm for 45 minutes to disperse . then the flavor and sweetener are added slowly and mixed for another 15 minutes . the 16 . 4 % solids dispersion is then ready to be sprayed on the tablet cores . weigh out about 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start the amount of coating solids sprayed per minute is about 3 grams and is increased to between 7 and 8 grams per minute after a base coat is applies to the tablets . the total spraying time of the coating is typically less than about 30 minutes to achieve the final tablets weight gain of 3 %. time and volume of film coat applied varies depending on what is the desired weight gain . tablet are prepared by normal tableting practices on a high speed tablet press at medium compression pressure . these tablets are then coated in a vector tablet coater lcd 5 with a 1 . 3 l spray pan . prepare coating solution by weighing out the water and with mixing using for example a four blade propeller , slowly add colorant with an agitation speed of 200 - 700 rpm for 45 minutes or until completely dispersed . slowly add flavor and sweetener with mixing for about 15 minutes until homogeneous . at this point the 18 . 5 % solids coating solution is ready for use for coating tablet cores . weigh out about 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start spray about 3 grams per minute until the coating is evenly found on the tablet cores and then increase the level of coating solids sprayed to between 7 and 8 grams per minute . the total spraying time of the coating is typically less than about 30 minutes to achieve the final tablets weight gain of 3 %. time and volume of film coat applied varies depending on what is the desired weight gain . 3 available as a powder from tate and lyle inc . singapore pte ltd . the coating solution is prepared by weighing out the water and mixed with a four blade propeller the colorant is added slowly with agitation speed of 200 - 700 rpm for 45 minutes to disperse . then the flavor and sweetener are added slowly and mixed for another 15 minutes . the dispersion is then ready to be sprayed on the tablet cores . weigh out about 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start the amount of coating solids sprayed per minute is about 3 grams and is increased to between 7 and 8 grams per minute after a base coat is applies to the tablets . the total spraying time of the coating is less than 30 minutes . the total spraying time of the coating is typically less than about 30 minutes to achieve the final tablets weight gain of 3 %. time and volume of film coat applied varies depending on what is the desired weight gain . tablet cores are prepared by normal tableting practices on a high speed tablet press at medium compression pressure . these tablets are the coated in a vector tablet coater lcd 5 with a 1 . 3 l spray pan . prepare coating solution by weighing out the water and with mixing using for example a four blade propeller , slowly add colorant with an agitation speed of 200 - 700 rpm for 45 minutes or until completely dispersed . slowly add flavor and sweetener with mixing for about 15 minutes until homogeneous . at this point the coating solution containing 20 . 6 % solids is ready for use for coating tablet cores . weigh out about 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start spray about 3 grams per minute until the coating is evenly found on the tablet cores and then increase the level of coating solids sprayed to between 7 and 8 grams per minute . the total spraying time of the coating is typically less than about 30 minutes to achieve the final tablets weight gain of 3 %. time and volume of film coat applied is varies depending on what is the desired weight gain . 3 available as a powder from tate and lyle inc . singapore pte ltd . the coating solution is prepared by weighing out the water and mixed with a four blade propeller the colorant is added slowly with agitation speed of 200 - 700 rpm for 45 minutes to disperse . then the flavor and sweetener are added slowly and mixed for another 15 minutes . the dispersion is then ready to be sprayed on the tablet cores . weigh out about 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start the amount of coating solids sprayed per minute is about 3 grams and is increased to between 7 and 8 grams per minute after a base coat is applies to the tablets . the total spraying time of the coating is typically less than about 30 minutes to achieve the final tablets weight gain of 3 %. time and volume of film coat applied varies depending on what is the desired weight gain . tablet cores are prepared by normal tableting practices on a high speed tablet press at medium compression pressure . these tablets are then coated in a vector tablet coater lcd 5 with a 1 . 3 l spray pan . prepare coating solution by weighing out the water and with mixing using for example a four blade propeller , slowly add colorant with an agitation speed of 200 - 700 rpm for 45 minutes or until completely dispersed . at this point the coating is ready for use for coating tablet cores . weigh out tablets 1 kg of tablets and place in the tablet coater . set bed temperature to 45 ° c . and inlet temperature to 75 ° c . allow the tablets to come to a bed temperature of 40 - 50 ° c . at a pan speed of 12 rpm and equilibrate for 15 minutes . the spray nozzle is centered in the pan with a working distance of 7 . 5 cm from the tablet bed at a 45 degree angle or at just the peak of the tablet fall in the coater . at the start spray about 3 grams per minute until the coating is evenly found on the tablet cores and then increase the level of coating solids sprayed to between 7 and 8 grams per minute . the spraying takes place to a final weight gain on the tablet of about 3 %. 1 available from protec ingredia ltd , uk as xanthan gum novaxan 80t 1 the liquid composition of example 6 can be made by first mixing the water and high fructose corn syrup to make the water phase . separately , propylene glycol , polyethylene glycol , flavors / sensates , natural honey flavor , acetaminophen , dextromethorphan hydrobromide and doxylamine succinate are combined and mixed to form a glycol premix . xanthan gum and pectin are added to the glycol pre - mix and mixed until dispersed . the glycol premix is added to the water phase and mixed to combine . the sodium citrate dihydrate , citric acid anhydrous , sodium benzoate and potassium sorbate are added to the batch and mixed until dissolved . the solid dose honey coated tablet of example 1 is compared to a liquid composition containing 2 . 5 % w / w liquid honey of example 6 . participants suffering from cold - related symptoms within the last 36 hours , with at least 2 symptoms selected from body aches , chest congestion , cough , fatigue , fever , headache , post nasal drip , runny nose , sneezing , sinus congestion / nasal congestion / stuffy nose , sinus pressure , sinus pain , or sore throat , and intend to treat their symptoms with an over - the - counter cough cold product are recruited . participants include both males and females , over the age of 18 . participants are divided into two groups . the first group of participants ( n = 77 ) are directed to ingest 2 solid dose caplets per dose , with water as they would normally treat their cold / flu symptoms , over 3 days . alternatively , the second group of participants ( n = 200 ) are directed to ingest 30 ml of the liquid composition per dose , as they would normally treat their cold / flu symptoms , over 3 days . following completion of the study , participants are asked to rate the honey flavor of the example 1 , the solid dose tablet , or example 6 , the liquid composition , using a scale of excellent (= 100 ), very good (= 75 ), good (= 50 ), fair (= 25 ) or poor (═ o ). then the scores , are averaged to determine the final score for each example . the liquid composition of example 6 had a score of 66 and the solid dose of example 1 had a score of 82 the difference is statistically significant ( p & lt ; 0 . 05 ). the dimensions and values disclosed herein are not to be understood as being strictly limited to the exact numerical values recited . instead , unless otherwise specified , each such dimension is intended to mean both the recited value and a functionally equivalent range surrounding that value . for example , a dimension disclosed as “ 40 mm ” is intended to mean “ about 40 mm .” while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention . it is noted that terms like “ preferably ,” “ generally ,” “ commonly ,” “ typically ” and “ alternatively ” are not utilized herein to limit the scope of the claimed embodiments or to imply that certain features are critical , essential , or even important to the structures or functions . rather , these terms are merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment . for the purposes of describing and defining the various embodiments it is additionally noted that the term “ substantially ” is utilized herein to represent the inherent degree of uncertainty that may be attributed to any quantitative comparison , value , measurement , or other representation . the term “ substantially ” is also utilized herein to represent the degree by which a quantitative representation may vary from a stated reference without resulting in a change in the basic function of the subject matter at issue . every document cited herein , including any cross referenced or related patent or application , is hereby incorporated herein by reference in its entirety unless expressly excluded or otherwise limited . the citation of any document is not an admission that it is prior art with respect to any invention disclosed or claimed herein or that it alone , or in any combination with any other reference or references , teaches , suggests or discloses any such invention . further , to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference , the meaning or definition assigned to that term in this document shall govern .
| 0 |
table 1 provides a list of the main chitosan materials acquired for hemorrhage control testing . with the exception of the gelfoam ™+ thrombin , and surgicel ™ controls for swine spleen experiments and the johnson and johnson 4 ″× 4 ″ gauze control for use in swine aortic perforations , the dressing materials were all chitosan - based . aqueous solutions ( 2 . 00 % w / w ) were prepared in clean , sterile , 1 liter pyrex flasks from ametek uf water and dry chitosan . in the case of the carbomer , primex and genis chitosan materials , 1 . 0 % or 2 . 0 % w / w of glacial acetic acid ( aldrich 99 . 99 %) was added to the aqueous mixtures . dissolution was achieved by shaking of the flask at 40 ° c . for 12 to 48 hours . the solutions were degassed by application of vacuum at 500 mtorr at room temperature immediately prior to freezing . wound dressings were prepared from the 2 % aqueous solutions of chitosan that were poured into teflon ™- coated aluminum or polystyrene molds to at least 1 . 5 cm deep and frozen in a − 80 ° c . revco freezer at − 45 ° c . for 3 hours . alternatively , freezing was carried out on the shelves inside a virtis genesis 35el freeze drier . there was at most 10 % shrinkage in the wound dressings and the final freeze - dried wound dressing density was near 0 . 033 g / cm 3 . transverse cross sections of two types of molded wound dressings are shown in fig1 & amp ; 2 ( different freezing rates ). the structures observed ( see also fig3 ) were affected by the rates of cooling in the bulk solution and at the different surfaces . subsequently , structures in the wound dressings were controlled by formulation , mold ( size & amp ; shape ) and freezing conditions . optimal wound dressing structures were those that were open - porous consisting of uniform interconnected pores of close to 50 microns in diameter or lamella and hexagonal structures normal to the plane of cooling , these structures could be controlled , yielding flexible yet strong wound dressings of large specific surface areas for highly efficient and rapid blood coagulation . typically the available specific surface area for such structures were greater than 500 cm 2 / g . the scanning electron photomicrograph in fig5 shows the typical open cell structure in the base surface of a wound dressing . the wound dressings were heated in a convection oven at 80 ± 1 ° c . for one half hour to optimize the structure and distribution of acetic acid concentration . it was found that this step was essential to optimize the adhesive properties of the wound dressing in a bleeding field ( typically adhesion to dermis & gt ; 40 kpa ). the wound dressings were immediately compressed from 17 mm thickness to 5 . 5 ± 0 . 5 mm at 80 ± 5 ° c . under a loading of close to 50 kpa . ( from ca . density 0 . 03 ± 0 . 005 g / cm 3 to 0 . 12 ± 0 . 02 g / cm 3 ). fig4 shows the appearance of the base of a typical preferred chitosan wound dressing for hemorrhage control after heating and compression . a preferred method preparation of hemostatic wound dressings is as follows : a ) dry chitosan powder or flake with degree of deactylation above 85 %, less than 26 ppm metallic component and greater than 90 % dry solids content was made into a 2 % aqueous solution ( w / w ) with 2 or 1 % acetic acid ( w / w ) at 40 ° c . b ) the solution of chitosan from a ) above was degassed under reduced pressure at up to 500 mtorr under agitation for at least 5 minutes and poured into a mold to a depth of 1 . 7 cm . certain low - density , foam structures exhibited problems due to their ready dissolution in a bleeding field . these problems were generally avoided by thorough degassing of the solution . c ) the mould containing the degassed chitosan solution was frozen by cooling from room temperature to − 45 ° c . a linear cooling ramp was used over a 90 minute period , and the temperature was maintained at − 45 ° c . for at least another hour . d ) the frozen chitosan was then freeze dried using a condenser which was at a temperature below − 70 ° c . and a vacuum at about 100 mtorr . the shelf temperature was ramped from − 45 ° c . to − 15 ° c . and held at that level for 10 hours . a further 36 - 48 hours of freeze drying at 10 ° c . was then performed . freeze drying was performed until achieving close to about 2 . 8 % of the original frozen plaque mass . e ) at 2 . 8 % of original mass , the process was stopped and the freeze dried wound dressing removed from the mold . f ) the product formed was an acid buffered , water soluble , high specific surface area wound dressing that had shrunk 10 % from its original frozen volume . the wound dressing structure was generally a uniform open porous structure with 50 to 80 micron diameter interconnecting pores . using a slightly different cooling regime in which super - cooling was not affected , a lamella / hexagonal structure ( with uniformly thin chitosan sheets close to 5 microns thick with close to 50 microns separation between sheets ) was achieved . g ) the wound dressing was then compressed ( from 1 . 7 cm to ca . 0 . 5 cm thick ) between smooth and flat platens heated to 80 ± 2 ° c . under application of 60 ± 20 kpa pressure . h ) next , the dressing was conditioned in a convection oven by heating at 80 ± 5 ° c . for 30 minutes . i ) each wound dressing was then stored in labeled kapak 530 heat sealed pouches . j ) the resultant pressed wound dressing was tough , flexible , hemostatic , adherent to wet tissue and resistant to dissolution by streaming blood . k ) improved dissolution properties , improved adhesion strength and sterilization were achieved by exposure of the wound dressing to 15 kgy gamma irradiation under nitrogen atmosphere . in vivo evaluation of hemostasis of candidate hemorrhage control dressings of varying composition and structure was screened in increasingly challenging animal models of hemorrhage as hereinafter described . a spleen laceration model was utilized in order to be able to screen large numbers of candidate dressings in a simple reproducible model and to compare them to conventional materials . although this is the least challenging bleeding model ( mild oozing bleeding ca . 2 - 5 ml / min ), most initial wound dressing formulations failed this test . also all chitosan gels , powders failed in this test while films performed poorly . prior to testing in a severe hemorrhage model , swine were anticoagulated with systemic intravenous heparin and better materials were tested in a capsulated spleen stripping model ( strong oozing bleeding ca . 10 - 20 ml / min ). those few materials that passed this test were then evaluated in the carotid laceration model ( ca . 50 ml / min ) in anticoagulated swine . wound dressing formulations of candidate materials passing this test were then tested on the swine aortotomy model with in which 4 mm diameter perforations in were made in the thoracic or abdominal aortas . materials passing these challenging models of severe vascular hemorrhage ( bleeding rates in excess of 100 ml / min ) were also tested in a severe ( grade v ) model of hepatic trauma . the testing described here was carried out on healthy animals that had previously undergone procedures and were scheduled to be sacrificed for evaluation . all experiments were performed in accordance with the 1996 nation research council , “ guide for the care and use of laboratory animal ” and applicable federal regulations . after identification of the animal , anesthesia was induced with telazol 4 - 9 mg / kg i / m . isoflurane was given by mask and the animal was intubated . the chitosan patches for the laceration and capsular stripping experiments were either equal size quarter pieces cut from a 37 mm diameter wound dressing or 1 . 5 cm × 1 . 5 cm wound dressing pieces cut from a larger wound dressing . control materials of gelfoam ™+ thrombin or surgicel ™ were prepared from 1 . 5 cm × 1 . 5 cm pieces . gelfoam ™ size 100 , absorbable gelatin wound dressing , was supplied by pharmacia . oxidized cellulose , surgicel ™, was supplied by ethicon . topical thrombin ( bovine origin ) 10 , 000 u . s . units was supplied by jones pharma . the gelfoam ™+ thrombin was prepared before use by soaking of 1 . 5 cm × 1 . 5 cm × 0 . 8 cm wound dressings in the thrombin for 30 minutes . a midline ventral laporatomy was performed . the top half of the spleen was exteriorized ( apposing the surgical wound with towel clamps ). the surface was kept moist by the application of sterile saline solution from a wet lap pad . for anticoagulation , the right femoral artery was surgically isolated and cannulated with a 6f sheath , allowing for collecting blood samples . the activated clotting time ( act ) was measured before administration of 5000 units of heparin intravenously , 10 minutes after administration of heparin and every 20 minutes thereafter . if the act level was less than 200 seconds , 2000 units of heparin were given and the act was remeasured after 10 minutes . this was repeated until the act & gt ; 200 seconds to ensure that the animal was anticoagulated . the area of splenic testing was demarcated and kept moist by using the towel clamps and wet pads and only exposing the most immediate untested surface . a single injury was made prior to the application of a test patch , as follows : ( i ) in the laceration model , the injury ( 8 mm long × 4 mm deep ) was made using a # 11 surgical blade positioned in a right - angled forceps so that 4 mm of blade was protruding . ( ii ) in the capsular stripping model , the injury ( 5 mm × 5 mm × 4 mm deep ) was made using the clamped # 11 blade and a pair of surgical scissors . after making the injury , bleeding was allowed for 30 seconds . the surface blood was removed with gauze , following which a test patch was applied digitally to the injury using a constant uniform pressure for 30 seconds . the digital pressure was then removed and the patch was observed for two minutes . at this stage , the trial number was recorded . if observable rebleeding occured , the time to rebleed was recorded and the next trial ( 30 second bleed , clean away blood with gauze , 30 seconds digital pressure followed by up to 2 minutes observation ) commenced . the trial for a test patch was complete when no rebleeding occurred in the 2 minute observation period or if 6 trial rebleeds were observed . if the wound continued to rebleed for 6 trial periods , then the failed patch was removed and a gelfoam + thrombin patch applied . a new injury was made and another patch tested . in the case of the carotid laceration model , chitosan patches ( 37 mm × 25 mm ) were cut from the 37 mm diameter compressed wound dressing or larger wound dressings . for facility in application , some of the wound dressings had a top layer of 3m 9781 foam medical tape attached to the chitosan with 3m 9942 skin adhesive . gelfoam ™+ thrombin was used as a control . a vertical incision was made exposing a 10 cm length of carotid artery . the fascia was retracted and the surrounding soft tissue was dissected until the artery was supported on a flat base of tissue . tie - off sutures were placed proximal and distal to the exposed artery . these were clamped and a 1 . 5 cm incision was made longitudinally in the artery . for anticoagulation , the right femoral artery was surgically isolated and cannulated with a 6f sheath , allowing for collecting blood samples . the activated clotting time ( act ) was measured before administration of 5000 units of heparin intravenously , 10 minutes after administration of heparin and every 20 minutes thereafter . if the act level was less than 200 seconds , 2000 units of heparin were given and the act was remeasured after 10 minutes . this was repeated until the act & gt ; 200 seconds to ensure that the animal was anticoagulated . after making the incision , the artery was allowed to bleed for 2 seconds and then was compressed for 1 minute . the compression was removed and the ties were re - clamped . the area was flushed with saline . the ties were unclamped 2 seconds before application of a patch . pressure was applied uniformly over the patch for 3 minutes . if bleeding was observed within 30 minutes after application of pressure , then another 3 minutes of pressure was re - applied . if the patch was not adhering then it was replaced with a new patch . each re - application of pressure , or replacement of a patch of the same type were treated as trial periods for that patch type . a trial for a particular wound dressing was considered complete if no bleeding was observed from around , or through the patch in a 30 minute period . a material was rated on the number of trials it took to achieve 30 minutes of hemostasis ( no observable bleeding from the wound ). in the case of swine aorta perforation , sample patches of compressed chitosan wound dressing cut to 2 . 5 cm diameter pieces or controls of 4 ″× 4 ″ surgical gauze were used . either or both the abdominal and the thoracic aortas were exposed by midline ventral laporatomies in the former and sternotomies in the latter . the fascia and sternum were clamped and ties were placed proximal and distal to the sites of incision . while the tie - off clamps were applied , a # 11 scalpel blade was used to make a 3 mm incision through the wall of the aorta and a 4 mm diameter medtronic ™ vascular punch was inserted through the incision to make a 4 mm diameter hole in the aorta . the punch was removed and the tie - off clamps released with digital pressure applied to the hole . the patch was held between thumb and forefinger with the middle finger applying pressure to the hole in the aorta . the pressure from this middle finger was released for 1 second before application of the wound dressing to the bleeding field . the wound dressing was held in place by firm pressure applied through the forefinger to the patch over the aortic hole . the pooled blood that escaped the wound during application of the patch was suctioned away . after 3 minutes of digital pressure , the finger was removed and the patch observed for any sign of continued bleeding and poor adherence . if continued bleeding or re - bleeding was observed in the first 30 minutes after application of the patch , then a further 3 minutes of pressure was applied . if hemostasis was still not complete , then another patch of the same wound dressing was prepared , the old patch removed and a new trial commenced . a trial was considered complete if no bleeding was observed from around or through the patch in a 30 - minute period . a material was rated on the number of trials it took to achieve 30 minutes of hemostasis ( no observable bleeding from the wound ). control samples of gauze were applied in the same manner as the chitosan wound dressing during a trial . all animals were euthanized while under anesthesia with an injection of barbiturates ( euthasol , 1 ml / 10 lb ) via an auricular vein . animals were euthanized at the end of the experimental procedure or prior to the end if the animal experienced any untoward effects . tests were ranked from 0 . 0 to 6 . 0 according to the number of trials necessary before hemorrhage control was achieved and the time to rebleed ( only in the case of the spleen trials ). a test in which only one trial was necessary and there was no rebleed was ranked as 0 . 0 . a test which required a second trial and the time to rebleed of the first was 90 seconds was ranked : ( in the case of a spleen ) or 1 . 0 in the other models . a test which needed four trials to achieve hemostasis and where the time to splenic rebleed in the third trial was 30 seconds was ranked : ( in the case of a spleen ) or 3 . 0 in the other models . a sample which failed completely by rapid dissolution , lack of adherence or uncontrolled bleeding was ranked 6 . 0 +. in summary , the worse the hemostasis , the higher the ranking as defined by the following : the results of the spleen studies are summarized in tables 2 , 3 and 4 . table 2 shows the behavior of chitosan test samples that were non - optimized with respect to composition and structure . these non - optimized materials ranged from , worse to the surgicel ™ negative control ( table 4 ), to comparable and to only partially better . the presence of phosphate buffer solution produced a poorly adherent , slowly hemostatic patch which was only slightly more effective than surgicel ™. the chitosan film was moderately adherent , providing a reasonable seal to bleeding , however it was only very slowly hemostatic as evidenced by the slow welling of blood beneath its transparent surface . the earlier trials generally showed signs of a low density foam in the top surface of the molded wound dressing . it was found that this low density foam was susceptible to dissolution and collapse if the top surface of the wound dressing was applied to a bleeding field . it was subsequently discovered that this foam effect could be avoided by degassing of solutions before freezing . low molecular weight chitosan wound dressings ( relative 1 % solution viscosity & lt ; 50 cps ) were found to be very susceptible to dissolution in a bleeding field making them unsuitable for the patch application . the glutamate counter anion produced softer wound dressings but at the cost of producing wound dressings that were readily dissolved in a severely bleeding field . low density wound dressings ( those less than 0 . 05 g / cm 3 ) with acetate counterions were also found to be readily compromised by dissolution and collapse . table 3 shows the result rankings of the optimized chitosan wound dressings of preferred composition and structure . these wound dressings were composed of chitosan with higher molecular weights ( relative 1 % solution viscosity greater than 100 cps ) and had wound dressing densities close to 0 . 12 g / cm 3 . in the moderately bleeding spleen tests , the results for the optimized wound dressings were found , using a wilcoxon rank sum w test , to be indistinguishable from the positive control of gelfoam ™+ thrombin ( z =− 0 . 527 , p = 0 . 598 ). using the same statistical method , the wound dressings were shown to be significantly different from the poorly performed surgicel ™ control ( z =− 3 . 96 , p = 0 . 0001 ). fig6 demonstrates ( via a h & amp ; e stained histological section ) the close adherence of the optimized chitosan wound dressings patches to the spleen surface as well as the agglutination of erythrocytes at the immediate vicinity of the injury . the rankings for the carotid injury model are summarized in table 5 . in this model , the optimized chitosan patch performed very well in trials 3 , 5 and 6 . the improvement in performance over the first trials 1 and 2 was due to the application of the support backing ( 3m 9781 foam bandage ) to the immediate top surface of the wound dressing . this backing enabled more uniform pressure to be applied over the wound dressing and allowed for the person applying the dressing to remove their fingers easily from the patch surface without them sticking and inducing patch detachment from the wound . the carotid model was used to investigate more severe arterial bleeding conditions than were possible in the spleen injury model . gelfoam ™+ thrombin was investigated as a possible positive control but was found to dissolve in a highly bleeding field . table 6 summarizes the results of the aortic injury model . gauze bandage ( 4 ″× 4 ″) was used as a control bandage . it was found that the control was unable to stop severe bleeding in all trial periods whereas the optimized chitosan aortic patches were able quickly to stop and subsequently clot the very high level of bleeding observed in this wound after only 1 or 2 applications of the patch . the exact significance ( two - tailed p = 0 . 002 ) was determined for the probability that there was no difference between rankings of sample and control . on average the blood loss after patch application was minimal (& lt ; 50 ml ) if the wound was stanched on the first attempt . if a second attempt was required blood loss after patch application was greater than 100 ml but less than 300 ml . on average less than 150 ml of blood was lost after patch application in the case of the chitosan wound dressing while , in the case of the 3 gauze control studies , more than 1 liter of blood was lost for each animal . in the case of the chitosan wound dressing study , survival was 100 %, while in the case of the gauze study , none ( 0 %) of the animals survived . the chitosan patches demonstrated continued hemostatic efficacy over the trial period of 30 minutes and until the animals were sacrificed which was generally 1 to 2 hours later . fig7 demonstrates a typical chitosan patch sealing a severe thoracic wound . the lumen side ( showing the injury ) of the resected aorta sealed by the patch in fig7 is shown in fig8 . fig9 shows a photomicrograph of a stained histological section taken through the injury of fig7 & amp ; 8 . evidence of strong clotting at the injury site was found on removal and inspection of aortas on animal sacrifice ( fig9 ) and , in the case of trial number 16 , where after dislodging a patch in a live animal ( after more than 30 minutes of application ) there was no subsequent re - bleeding . preferably , the hemorrhage control dressing described above includes a surface , which grips the wound area to substantially avoid slipping of the dressing during use . typically , this non - slip surface of the dressing comprises a traction surface . the subject hemorrhage control dressing may benefit from having an effective non - slip surface , such as a traction surface . the subject hemorrhage control dressing can have a smooth and rough side . the rougher side would preferably be the tissue or bleeding surface side if that side also demonstrated better adhesive properties . a traction surface may improve a dressing ability to control rapid arterial bleeding by providing increased stability of surface contact ( better traction ) on a well lubricated surface ( such as those surfaces which present in the case of severe bleeding ). such a traction surface would help to channel blood , without adversely affecting adhesion kinetics while allowing for a more controlled and stable tissue contact during the critical period of dressing application . for example , the tissue side of the bandage could have a traction surface in the form of a tread design . this could prevent the dressing from undergoing traction loss in a direction away from the wound when undergoing application to the wound . the non - slip surface of the hemorrhage control dressing could be produced with ridges that are non - connecting or blinded to one another . thus , in turn , the channels formed between the ridges would be fully or partially blinded to one another and thus provide a controlled connection that would provide for a controlled blood flow back into or out of the wound area . the controlled blood flow in area of dressing application could be maintained by the ridges or specific types of responsive gates in the hemorrhage control dressing . ridges on bottom of a mold for producing the hemorrhage control dressing may include depressions of the type which will permit a non - slip surface , for example , in the form of traction controls such as ridges or the like , in the subject dressings . a hemorrhage control dressing could therefore be produced having at least one non - slip surface , such as a traction surface . also , a method of producing such a dressing could be provided . finally , a mold to a produce a hemorrhage control dressing , as described above , can be fabricated . so as to treat severe hemorrhage in cases where adhesive base and top surfaces are advantageous , it is possible to design the support backing so that if necessary it could be readily peeled away when adhesion and clotting are required on both surfaces . there are numerous hemorrhage control configurations of the dressing described above to address a wide range of possible types of hemorrhagic wound . it is envisioned there be will a need to be able to carry ( in a battlefield situation ) several bandages of differing configurations so that the injured persons can be treated by the first responder or even potentially by injured persons themselves . the dressing of the invention claim is robust and can tolerate a great deal of physical abuse and still remain an active hemorrhage control platform . the dressing is ideal for treating focal vascular bleeding and small topical wounds . it is also well suited to packing into complex entry wounds where the bleeding site cannot be easily compressed . once hemorrhage control is achieved with the current invention , stabilizing an extremity wound , approximating wound edges and creating a durable dressing that will prevent contamination and allow evacuation of the injured for definitive repair are the main requirements for a civilian and a battlefield hemorrhage control dressing . one envisioned configuration of the hemorrhage control dressing is a 10 ″× 18 ″ dressing with a flexible , elastic backing that can be tightly attached around an extremity and secured with a locking tab such as a permanent adhesive glue via a peel back surface to itself . such a device configuration would approximate wound surfaces and add a hemorrhage control surface without compromising blood flow to the distal extremity . such a dressing could be applied by a first responder or in some instances by the injured soldier and would be stable under ambulation or extremity movement during transport . it is envisioned that the bandage would be removed by cutting it apart with no adverse adhesion to the wound or skin . the us army science and technology objective ( sto ) a , hemorrhage control , was established in 2000 to advance the need for hemorrhage control on the battlefield . the general strategic objective of the sto can be summarized as the development of products and methods that will reduce the number of deaths due to hemorrhage in battlefield casualties . the requirements for hemorrhage control products and methods were stated thus : they must be practicable for use by one or more of the following : self ( wounded combatant ), buddy ( fellow non - medical soldier who aids the wounded soldier ), combat lifesaver , combat medic , physician assistant , and battalion surgeon . they must be practicable for use in far forward field conditions including rugged terrain , limited visibility , and environmental extremes . products and methods must not require external electrical sources . all devices must be man - portable and durable . it is expected that products and methods that are useable far forward will also be used at higher echelons of care . a specific strategic objective of the sto is the development of new or improved hemostatic agents for use on compressible hemorrhage under far forward field conditions . a single product for use on compressible and non - compressible sites is desired . as part of sto , a study of hepatic hemorrhage control in a swine liver model was conducted at the us - army institute of surgical research ( isr ) at fort sam houston , san antonio , tex . using the hemorrhage control bandage of this invention . the study was conducted to determine the effect of the chitosan hemorrhage control bandage on blood loss and survival in a standardized model of severe venous hemorrhage and hepatic injury in swine . this model has been used to study numerous other hemostatic bandages at us - army isr . cross - bred commercial swine were used in this study . animals were maintained in a facility accredited by the association for the assessment and accreditation of laboratory animal care , international . this study was approved by the institutional animal care and use committee of the us army institute of surgical research , fort sam houston , tex . animals received humane care in accordance with the guide for the care and use of laboratory animals ( national institutes of health publication 86 - 23 , revised 1996 ). animals were assigned randomly to receive either the chitosan bandages or gauze sponges ( see table 7 ). surgical preparation consisted of the following : animals were fasted 36 - 48 hours prior to the surgical procedure , with water allowed ad libidum . after premedication with glycopyrrolate and a combination of tiletamine hcl and zolazepam hcl ( telazol ®, fort dodge laboratories , fort dodge , iowa ), anesthesia was induced by mask using 5 % isoflurane . the swine were intubated , placed on a ventilator , and maintained with isoflurane . carotid arterial and jugular venous catheters were placed surgically . laparotomy was performed and splenectomy and urinary bladder catheter placement were completed . a rectal temperature between 37 . 0 ° and 39 . 0 ° c ., and 15 minutes of stable mean arterial pressures ( map ) were required prior to further experimental procedures . blood pressure and heart rate were recorded at 10 - second intervals throughout the study period using a continuous data collection system ( micro - med ®, louisville , ky .). baseline arterial blood samples were collected from each animal to confirm that each animal exhibited normal platelet count , prothrombin time , activated partial thromboplastin time , and plasma fibrinogen concentration . liver injuries were induced as previously reported . the method included the following . the liver was retracted by manually elevating the left and right medial lobes to allow adequate exposure . next , a specially designed clamp with two 4 . 5 cm sharpened tines configured in the form of an ‘ x ’ was positioned with the center approximately 2 - 3 cm dorsal to the intersection of the left and right medial lobes , on the diaphragmatic surface of the liver . the base plate of the instrument was positioned beneath the quadrate lobe , on the visceral surface . the injury was induced by clamping the tines of the instrument through the parenchyma and underlying vessels of the two medial lobes so that the tines were seated in corresponding grooves in the base plate of the instrument . after the first penetration of the liver , the instrument was opened and the tines were withdrawn and repositioned to the animals left such that the second application would overlap the first by 50 percent . following this repositioning , the liver was penetrated a second time . documentation of the liver injury was achieved by excision and inspection of the liver at the conclusion of the experimental period . the injuries appeared as large stellate wounds with a small island of tissue in the center , and measured approximately 10 × 8 × 4 cm . the injuries were through and through , with one or more of the left medial lobar vein , right medial lobar vein , and portal hepatic vein lacerated . thirty seconds after injury , resuscitation was initiated with warm ( 38 ° c .) lactated ringer &# 39 ; s solution in all animals . the goal of resuscitation was return to baseline map . fluid was administered at 260 ml / min . this resuscitation regimen was continued until the goal was reached and reinitiated if map decreased , throughout the 60 minute study period . simultaneously with initiation of resuscitation ( 30 seconds post - injury ), treatments were applied as follows . one dressing was applied to the surface of the quadrate lobe to cover the penetrating injury and two other dressings were stuffed into the injury from the diaphragmatic aspect . compression was applied for 60 seconds in the dorso - ventral direction . after 60 seconds , the injury was inspected to determine whether hemostasis was achieved . next , the applicator &# 39 ; s hands were repositioned and pressure was applied for 60 seconds in the latero - medial direction , and the observation for hemostasis was performed . this sequence was repeated for a total of four 60 second compressions . if hemostasis was complete after any compression , no further compressions were performed . hemostasis was defined as the absence of visually detectable bleeding from the injury site . following completion of treatment application , the abdomen was closed and the animal was monitored for 60 minutes after injury or until death , whichever came first . death prior to 60 minutes was defined as a heart rate of 0 . at 60 minutes , surviving animals were euthanized by an overdose of pentobarbital . immediately after induction of the injury , blood was continuously suctioned from the peritoneal cavity until the start of treatment application . the volume was determined and designated as pre - treatment blood loss . at the end of the study period , each abdomen was opened and the liquid and clotted intra - peritoneal blood were suctioned and measured . this was designated as post - treatment blood loss . additionally , total resuscitation fluid use was recorded . preinjury animal blood volume was estimated using the equation : estimated blood volume ( ml )= 161 . 4751 ( body weight − 0 . 2197 )( body weight ), as we have previously reported ( pusateri , 2001 ). body weight , estimated blood volume , number of vessels lacerated , baseline map , survival time , preinjury map , pretreatment blood loss , and bandage adherence scores were analyzed by analysis of variance using the glm procedure of sas . data are reported as least squares mean ± standard error of least squares mean . data were examined for heterogeneity of variance and non - normality . these conditions were detected for post - treatment blood loss and fluid use data . therefore , blood loss and fluid use data were log transformed prior to analysis . the transformed data were analyzed by analysis of variance . these data are expressed as back transformed means and 95 % confidence interval ( 95 % ci ). distribution of females and males , hemostasis , and survival data were analyzed by fishers exact test using the freq procedure of sas . data are reported as proportions or percentages . two sided tests were used for all comparisons . there were no differences among treatment groups in animal body weight , estimated blood volume , distribution of animal sexes , baseline map , preinjury map , number of major vessels lacerated within the liver injury , or pretreatment blood loss ( see tables 8 and 9 ). post - treatment blood loss was reduced in the chitosan group , compared to the gauze wound dressing control ( p = 0 . 01 ). no significant difference in fluid use was observed . survival percentage was increased in the chitosan group ( p = 0 . 04 ). hemostasis occurred more frequently in the chitosan group at 3 and 4 minutes post - injury ( p = 0 . 03 ). survival times could not be statistically compared because of the high level of survival in the chitosan group ( see table 10 ). this us - army isr study ( pusateri et al 2002 ) demonstrates , in an independent study , the significantly improved performance of the chitosan wound dressing over standard 4 ″× 4 ″ gauze . the us - army isr has only been able to demonstrate significantly improved performance over 4 ″× 4 ″ gauze in the stanching of severe blood flow in the case of the dressing of this invention claim and in the case of a dry fibrin thrombin wound dressing being developed by the red cross . the red cross bandage is costly , as well as being delicate and prone to breakage . high molecular weight 4 ″× 4 ″ chitosan hemorrhage control dressings with 3m 9781 porous foam backing have been prepared from an icelandic shrimp source ( genis lot # so1115 - 1 ). these were prepared with 2 % acetic acid and 2 % chitosan solution using a commercial freeze drying company to prepare a large sterile lot of chitosan bandages ( lot # omlc — 2sm114 ). the bandages were irradiated at 15 kgy under nitrogen . they were subsequently tested for uniaxial tensile strength , burst strength , blood adsorption , water adsorption as well as for sterility . swine aorta perforations were carried out on non - gamma irradiated samples in abdominal and thoracic injuries . seven patches were used . on average blood loss after patch application was & lt ; 50 ml . all patches were adherent , wound sealing and hemostatic on their first application ( 7 × 0 rankings ). all animals survived . both gamma - irradiated and un - irradiated bandages ( lot # omlc — 2sm114 ) were tested with an in vitro burst pressure test developed at oregon medical laser center in portland oreg . to perform a burst test , a 25 mm diameter circular test piece of the bandage is immersed in citrated whole blood for 10 seconds . the test piece is then placed centrally over , and firmly held with digital pressure , on a 4 mm diameter perforation in the side of a 50 mm diameter pvc pipe for 3 minutes . after this initial attachment , fluid pressure inside the pipe is ramped at 4 . 5 ± 0 . 5 kpa . s − 1 , with pressure and time recorded at 0 . 1 second intervals . burst pressure is recorded as the maximum pressure recorded prior to failure . an adhesive failure ranking is assigned to assess the relative adhesiveness of the bandage to the test site . the ranking system is separated into 3 distinct modes of failure . a ranking of 1 is given to a test piece which is readily separated from the pvc surface with no chitosan remaining adhered . a ranking of 2 is assigned when the test piece is less readily detached and some of the chitosan remains attached to the test site . a ranking 3 is assigned when the test piece can only be removed by cohesive separation of the bulk wound dressing from the base structure which remains firmly fixed to the pvc surface . the average burst pressure of gamma irradiated and un - irradiated chitosan bandages ( mean ± sd , n = 6 ) on a pvc substrate using blood as wetting medium was 122 ± 1 . 9 kpa and 86 ± 20 kpa , respectively . the results were analyzed statistically using a t - test ( p = 0 . 007 ). the average adhesive failure rankigs of gamma irradiated and un - irradiated chitosan alpha bandages ( mean ± sd , n = 6 ) on a pvc substrate using blood as wetting medium were both 3 ± 0 . fig1 shows an image of a high ranking failure where cohesive failure has occurred within the chitosan structure . the blood and water adsorption properties of the dressings ( lot # omlc — 2sm114 ) were determined by immersing small test pieces ( ca . 0 . 02 g ) in blood or water for 3 . 0 seconds . difference in mass before and after immersion was recorded . the average mass of medium adsorbed in 3 seconds per one gram of wound dressing was determined for gamma irradiated and un - irradiated chitosan samples ( n = 4 ) using blood or water as the wetting medium ( see fig1 ). the results were analyzed statistically using a one - way anova with a tukey - hsd test , p = 0 . 001 . gamma irradiation significantly reduced the excessive adsorption of water in the case of the non - irradiated material . such excessive water adsorption would cause wound dressing collapse ( into a gel ) with subsequent adhesive and structural failure . tensile test pieces of the chitosan dressings ( lot # omlc — 2sm114 ) were evaluated using a uniaxial chatillon materials testing vitrodyne v1000 equipped with a 5 kg load cell . samples were cut into dog - bone pieces ( 15 ± 1 mm × 6 . 5 ± 0 . 5 mm × 5 ± 0 . 5 mm gauge × thickness × width ) and held between two clamps . the crosshead speed was 10 mm . s − 1 . load and displacement were recorded at 0 . 1 second intervals . tensile results are shown in table 11 . there were no significant differences between gamma irradiated and un - irradiated samples with respect to both stress and strain . there was a small increase in youngs modulus with irradiation at 15 kgy . fifty two 4 ″× 4 ″ chitosan wound dressings ( lot # omlc — 2sm114 ) were prepared cleanly . of these 4 ″× 4 ″ wound dressings , 46 were packaged in a double pack envelope and were sent to the isomedix facility in ontario , calif . for irradiation with gamma radiation at a certified dose between 14 - 15 kgy . boxed with these samples were a set of 8 staphylococus aureus ( atcc 29213 ) doped chitosan wound dressing bars ( 1 ″× 0 . 21 ″× 0 . 21 ″) cut from wound dressing 2sm114 # 1 . each bar was inoculated with 100 microliters of 0 . 5 macfarlane inoculum . the staphylococcus aureus was swabbed from a demonstrably active control culture . a control set of 4 bars with no staphylococus was also included . control samples with no gamma radiation treatment were kept in small sterile containers in heat sealed envelopes at room temperature and in the dark ( see table 12 for a summary of the controls ). the 46 irradiated wound dressing packages were opened under sterile conditions with sterile handling , an ethylene oxide sterile adhesive coated foam backing ( 3m 9781 tape ) was attached , a small off - cut piece ( ca . 1 . 2 ″× 0 . 2 × 0 . 12 ″) of each wound dressing and backing was removed for individual wound dressing sterilization testing and the wound dressings were repackaged inside the original inner pack by heat sealing . 40 of these wound dressings were labeled with lot number and wound dressing number and sent out for evaluation . the off - cut and control pieces were given to the microbiology facility at st vincent &# 39 ; s phs for sterility testing . the off - cut pieces and control pieces were placed aseptically in labeled sample vessels ( 0 . 6 ″ diam .× 5 ″) containing enriched thioglycolate growth media and incubated aerobically at 35 ° c . the culture media were examined at 7 , 14 and 21 days for indications of growth . the samples were subcultured in tsa w / 5 % sheep &# 39 ; s blood , incubated at 35 ° c . and examined for growth after 48 hours . the individual cultures were analyzed by turbidity testing and subculture swabbing . absence of any growth in all the cultures and all the subcultures at 7 , 14 and 21 days was demonstrated , even those cultures which were un - irradiated and dosed with staphylococcus aureus . gram positive staining of particular cultures collaborated these findings .
| 0 |
referring to fig1 a mirror 4 for use in the photometry is fixed at the back of a movable mirror 3 provided for observation use and which is rotatably attached by a support pin 2 to a mirror box ( not shown ) within a camera body 1 . a condenser lens 5 and a photoelectric transducer element 6 such as a silicon photodiode are disposed outside the taking optical path under the movable mirror 3 . a light receiving plane of the transducer element 6 is opposed to a reflecting plane of the mirror 4 when the movable mirror 3 is lowered in a state inclined at 45 ° as shown in fig1 and a front surface of a first shutter blind 12 of a focal plane shutter . accordingly , light from an object being photographed which passes through a taking lens 7 and a diaphragm member 14 and is transmitted through a half mirror portion 3a of the movable mirror 3 is reflected by the mirror 4 and is projected on the light receiving plane of the transducer element 6 by the condenser lens 5 . as a result , the light from the object being photographed , when the diaphragm member 14 is fully opened , is measured by the transducer element 6 before a shutter is released . additionally , the light from the object being photographed which is reflected by the movable mirror 3 impinges on a photographer &# 39 ; s eye 11 as observation light through a focusing screen 8 , a pentagonal prism 9 and an eyepiece 10 . then , when the shutter is released , a stop - down operation of the diaphragm member 14 is initiated by an aperture control circuit . the amount of the stop - down of the diaphragm member 14 , as will be described later , is automatically set based on the amount of light received by the transducer element 6 , namely a brightness of the object being photographed and a film sensitivity . when the stop - down operation of the diaphragm member 14 is completed to the value to be set as the aperture control goes on , the movable mirror 3 is raised to a position 3a shown in fig1 with a double dot - dash - line so that the observation optical path is closed by the movable mirror 3 and the taking optical path is opened . whereupon , the first shutter blind 12 starts its running and hence light from the object being photographed is focused on the front surface of the first shutter blind 12 while in its running and therafter on the sensitive surface of a film 13 which is exposed as the first shutter blind 12 runs . thus focused light is reflected by both of the surfaces of the first shutter blind 12 and the film 13 to impinge on the light receiving surface of the transducer element 6 through the condenser lens 5 so that the light from the object being photographed is measured by the transducer element 6 even after the shutter has been released . referring now to fig2 an operational amplifier 21 has its non - inverting input terminal connected to a terminal 22 to which a reference voltage v ref is applied and its output terminal connected to the emitter of an npn transistor 23 which serves as a switching element and the base of the transistor 23 through a resistor 24 . the base of the transistor 23 is also connected to a terminal 25 to which a trigger signal s o is applied which turns from an &# 34 ; h &# 34 ; level to an &# 34 ; l &# 34 ; level in synchronism with the initiation of running of the first shutter blind after the aperture control has been completed by the shutter release operation . the collector of the transistor 23 is connected to the cathode of a diode 26 for a logarithmic compression and an inverting input terminal of the amplifier 21 through a resistor 27 . the anode of the diode 26 is connected to a non - inverting input terminal of an operational amplifier 28 for integration . the photoelectric transducer element 6 has its anode connected to the non - inverting input terminal of the amplifier 28 and its cathode connected to the inverting input terminal thereof . a capacitor 29 for integration is connected between the non - inverting input terminal of the amplifier 28 and the ground . the output terminal of the amplifier 28 is connected to the inverting input terminals of amplifiers 21 and 28 to form a feedback loop circuit therebetween and further to a non - inverting input terminal of an operational amplifier 30 for comparison which forms a comparator for an exposure control . the amplifier 30 has its inverting terminal connected through a resistor 31 to the terminal 22 for the reference voltage and its output terminal connected through an electromagnet 32 for locking a second shutter blind to a terminal 33 to which a supply voltage v dd is applied . pnp transistors 34 , 35 , 36 have their emitters connected to the terminal 33 and their bases connected to each other and to the emitter of a pnp transistor 37 . the transistor 37 has its collector connected to the ground and its base connected to the collector of the transistor 34 . these transistors 34 to 37 have the same properties and form a well known current mirror circuit . accordingly , when a current flows through the collector of the transistor 34 , the same amount of current will flow also through the collectors of the transistors 35 , 36 . resistors 38 , 39 are connected in series between the terminal 22 and the ground and the junction between the resistors 38 , 39 is connected to a non - inverting input terminal of an operational amplifier 40 . an inverting input terminal of the amplifier 40 is connected to the emitters of npn transistors 41 , 42 which have the same properties and through a variable resistor 43 for setting information of a film sensitivity to the ground . the output terminal of the amplifier 40 is connected to the base of each of the transistors 41 , 42 . the collector of the transistor 41 is connected to the collector of the transistor 34 and the collector of the transistor 42 is connected to an inverting input terminal of an operational amplifier 44 in the next stage thereof . a diode 45 for a logarithmic compression which has the same properties as that of the diode 26 and is disposed between an inverting input terminal and the output terminal of the amplifier 44 has an anode connected to an output terminal of the latter . a non - inverting input terminal of the amplifier 44 is connected to the junction between the collector of transistor 23 and the diode 26 . the amplifier 44 serves to combine and operate photographing information for a brightness bv of an object being photographed and a film sensitivity sv in order to control an aperture . the output terminal of the amplifier 44 is connected through a semiconductor analog switch 46 to a non - inverting input terminal of an operational amplifier 49 for an impedance conversion . the control terminal of the analog switch 46 is connected to a terminal 48 to which a memory signal s m is applied . the memory signal s m is at the &# 34 ; h &# 34 ; level before a shutter is released and turns to the &# 34 ; l &# 34 ; level in synchronism with the shutter release . a capacitor 47 connected between a non - inverting input terminal of operational amplifier 49 and the ground is charged by an output voltage of the amplifier 44 and stores the charged voltage at the same time when the analog switch 46 turns off . an inverting input terminal of the amplifier 49 is connected to the output terminal thereof which is connected a non - inverting input terminal of a three - input type operational amplifier 50 in the next stage of the amplifier 49 . a resistor 51 is connected between a first inverting input terminal of the amplifier 50 and the output terminal of the amplifier 44 and a resistor 52 is connected between the first input terminal and the output terminal of the amplifier 50 . a resistor 53 is connected between a second inverting input terminal of the amplifier 50 and the output terminal of the amplifier 44 and a resistor 54 is connected between the second input terminal and the output terminal of the amplifier 50 . resistors 51 , 52 and 53 , 54 determine the amplification of the amplifier 50 and these resistors and the amplifier 50 determine an inclination of the program characteristic for the aperture control . the output terminal of the amplifier 50 is connected to a non - inverting input terminal of a three - input type operational amplifier 55 for a comparison which forms a comparator for the aperture control . a first inverting input terminal of the amplifier 55 is connected through a semifixed resistor 56 for setting a decision voltage to initiate a stop - down operation of a taking lens to the terminal 22 for the reference voltage and a second inverting input terminal thereof is connected through a semifixed resistor 57 for setting a decision voltage in the same manner as the resistor 56 to the terminal 22 . the output terminal of the amplifier 55 is connected through an electromagnet 58 for the aperture control to the terminal 33 for the power supply which is also connected to the emitters of pnp transistors 59 , 60 , 61 . the bases of these transistors 59 , 60 , 61 are connected to each other and to the emitter of a pnp transistor 62 . the collector of the transistor 62 is connected to the ground and the base thereof is connected to the collector of the transistor 61 and through a constant voltage supply 63 to the ground . these transistors 59 to 62 have the same properties to form a well known current mirror circuit . thereby , when a constant current flows through the collector of the transistor 61 by means of the constant voltage supply 63 , the same current flows also through the transistors 59 , 60 . the collector of the transistor 60 is connected to a first inverting input terminal of the amplifier 55 and the collector of the transistor 59 is connected to a second inverting input terminal of the amplifier 55 . the terminals for changing a bias of the amplifiers 50 , 55 are connected to the output terminal of an operational amplifier 67 for a comparison which forms a comparator for changing a program constant by producing a selection signal in accordance with a region for information of a film sensitivity . accordingly , the biases for the amplifiers 50 , 55 are changed by a level of the selection signal which is produced from the amplifier 67 to select either the first or the second inverting input terminals of the amplifiers 50 , 55 . a non - inverting input terminal of the amplifier 67 is connected to the junction between resistors 64 and 65 for setting a decision voltage , which resistors are connected in series between the terminal 22 and the ground . an inverting input terminal of the amplifier 67 is connected to the collector of the transistor 36 and through a resistor 66 to the ground . in operation , when a power supply switch for a camera of the film surface reflection photometry type including the program type automatic exposure controller is closed , the supply voltage v dd is applied to the terminal 33 and the reference voltage v ref is applied to the terminal 22 . prior to a photographing , the variable resistor 43 is set in accordance with information for a sensitivity of a film loaded in the camera by turning a dial for setting a film sensitivity . a voltage v p1 between the variable resistor 43 and the junction between the transistors 41 , 42 , that is , a voltage at the inverting input terminal of the amplifier 40 , which is equal to a voltage at the non - inverting input terminal threof , is expressed as follows : ## equ1 ## where r 1 and r 2 represent the resistances of the resistors 38 , 39 , respectively . accordingly , a current i sv flowing through each collector of the transistors 41 , 42 is expressed as follows : ## equ2 ## where r sv represents the resistance of the variable resistor 43 . since the current i sv flowing through the collector of the transistor 41 flows through the collector of the transistor 34 , it flows also through the collectors of the transistors 35 , 36 . since the current i sv flowing through the collector of the transistor 35 flows through the resistor 31 to the terminal 22 , the following voltage v p2 is applied to the inverting input terminal of the amplifier 30 as a decision voltage for a shutter speed : where r 3 represents the resistance of the resistor 31 . in addition , since the current i sv flowing through the collector of the transistor 36 flows through the resistor 66 , the following voltage v p3 is applied to the inverting input terminal of the amplifier 67 : where r 6 represents the resistance of the resistor 66 . also , the following voltage v p4 is applied to the non - inverting input terminal of the amplifier 67 as a decision voltage thereof : ## equ3 ## where r 4 and r 5 represent the resistances of the resistors 64 , 65 , respectively . accordingly , the amplifier 67 compares the voltages v p3 and v p4 and its output assumes the &# 34 ; l &# 34 ; level when v p3 & gt ; v p4 and the &# 34 ; h &# 34 ; level when v p3 ≦ v p4 . for example , when adjusted so as to be v p3 = v p4 at asa 200 of a film sensitivity , the output of the amplifier 67 is at the &# 34 ; l &# 34 ; level as v p3 & gt ; v p4 when a film sensitivity is less than asa 200 and at the &# 34 ; h &# 34 ; level as v p3 ≦ v p4 when asa 200 or over . the biases for the amplifiers 50 , 55 are changed in such a manner that when the output of the amplifier 67 is at the &# 34 ; l &# 34 ; level , the first inverting input terminals thereof are selected and when at the &# 34 ; h &# 34 ; level , the second inverting input terminals thereof are selected . further , the supply voltage v dd is applied to the terminal 33 and hence a constant current i r flows through the collector of the transistor 61 by means of the constant current supply 63 . accordingly , the current i r flows also through the collectors of the transistors 60 , 59 and through the resistors 56 , 57 to the terminal 22 . as a result , the following voltages v p6 and v p7 are applied to the first and second inverting input terminals of the amplifier 55 as a decision voltage for the aperture control of the latter : where r 16 , r 17 represent the resistances of the resistors 56 , 57 , respectively . subsequently , when a shutter and a film are wound , the trigger signal terminal 25 turns to the &# 34 ; h &# 34 ; level and the memory signal terminal 48 also turns to the &# 34 ; h &# 34 ; level . when the camera is directed to an object being photographed , light passing through the taking lens 7 and the diaphragm member 14 which is fully opened is reflected by the mirror 4 and received by the transducer element 6 , as shown in fig1 . as a result , the transducer element 6 produces a light current i p corresponding to the amount of the light received thereby . the transistor 23 , to which the &# 34 ; h &# 34 ; level signal at the terminal 25 is now applied at its base , is in the activated condition so that a feedback loop is formed by the amplifiers 21 , 28 . as a result , the reference voltage v ref is applied to the non - inverting input terminal of the amplifier 28 and hence the capacitor 29 is charged to the reference voltage v ref . when the photocurrent i p is produced in the transducer element 6 , the i p flows also from the anode of the diode 26 to the cathode thereof . accordingly , a voltage v p5 at the cathode of the diode 26 is given as follows : ## equ4 ## where k is the boltzmann constant , t is an absolute temperature , q is the charge of an electron and i s1 is the saturation current in the opposite direction of the diode 26 . the voltage v p5 is applied to the non - inverting input terminal of the amplifier 44 . a current equal to the current i sv which flows through the collector of the transistor 41 flows through the collector of the transistor 42 and the current i sv also flows through the diode 45 . accordingly , an output voltage v p8 of the amplifier 44 is defined as follows : ## equ5 ## where i s2 is the saturation current in the opposite direction of the diode 45 . since the diode 45 has the same properties as that of the diode 26 , then i s1 = i s2 and substituting the equation ( 8 ) for the equation ( 9 ) the following is obtained . ## equ6 ## as will be clear from the equation ( 10 ), the output voltage v p8 of the amplifier 44 is an information voltage for a brightness bv of the object being photographed plus a film sensitivity sv . at this time , since the analog switch 46 , to which the &# 34 ; h &# 34 ; level signal from the terminal 48 is applied at its control terminal , is in the activated condition , the voltage v p8 is applied through the analog switch 46 to the non - inverting input terminal of the amplifier 49 to charge the capacitor 47 . then , when the shutter is released , the memory signal s m turns to the &# 34 ; l &# 34 ; level and the analog switch 46 turns off . at this time , the output voltage v p8 of the amplifier 44 is stored in the capacitor 47 as a full - open photometry value and the stored voltage is produced at the output terminal of the amplifier 49 . the voltage v p9 at the output terminal of the amplifier 49 is derived from the equation ( 10 ) as follows : ## equ7 ## where i p0 is a photocurrent at the time of the full - open photometry . the voltage v p9 which is held at the time of the full - open photometry is applied to the non - inverting input terminal of the amplifier 50 and the voltage v p8 is applied through the resistors 51 , 53 to the first and the second inverting input terminals of the amplifier 50 , respectively . accordingly , an output voltage v p10 of the amplifier 50 can be obtained from the equations ( 10 ) and ( 11 ) as follows : when the first inverting input terminal is selected , ## equ8 ## when the second inverting input terminal is selected , ## equ9 ## where r 11 to r 14 are the resistances of the resistors 51 to 54 , respectively . when the output voltage v p10 of the amplifier 50 is introduced to the non - inverting input terminal of the amplifier 55 , the voltage v p10 is compared with the decision voltage vp 6 when the first inverting input terminal is selected and the decision voltage v p7 when the second one is selected . when the voltage v p10 is higher than the voltage vp 6 , v p7 , an output of the amplifier 55 turns to the &# 34 ; h &# 34 ; level and the open aperture is obtained since the electromagnet 58 for the aperture control is not energized . when the voltage v p10 is lower than the voltage v p6 , v p7 , the output of the amplifier 55 turns to the &# 34 ; l &# 34 ; level and a stop - down operation is initiated after the shutter is released since the electromagnet 58 is energized . upon the initiation of the stop - down operation , a voltage difference δv corresponding to a variation in a photocurrent equivalent to a stop - down value δav is produced between the output voltage v p8 of the amplifier 44 and the output voltage v p9 of the amplifier 49 . the voltage difference av can be expressed as follows : ## equ10 ## where i p0 is a photocurrent at the time of the full - open photometry , i p is a photocurrent while in the stop - down operation , and i p0 & gt ; i p . it follows from the equation ( 14 ) that an inclination of the program characteristic line is determined by the value δv , namely the amplification factors ## equ11 ## ( both 1 and less ) of the amplifier 50 , as shown in the equations ( 12 ), ( 13 ). in addition , the initiation of the stop - down operation is determined by the decision voltages v p6 , v p7 at the inverting input terminal of the amplifier 55 and the second terms of the equations ( 12 ), ( 13 ), namely ## equ12 ## at this time , when the variable resistor 43 for setting information for a film sensitivity is set to asa 100 of a film sensitivity , an output of the amplifier 67 is at the &# 34 ; l &# 34 ; level and the amplifiers 50 , 55 select the first inverting input terminals . thus , the program characteristic for the aperture control by the amplifiers 50 , 55 are as shown in fig3 . when a film sensitivity is set to asa 400 , the output of the amplifier 67 is at the &# 34 ; h &# 34 ; level and the amplifiers 50 , 55 select the second inverting input terminal . thus , the program characteristic for the aperture control by the amplifiers 50 , 55 are as shown in fig4 . specifically , for asa 100 , the decision voltage v p6 = i r · r 16 ( on the basis of the reference voltage v ref ) as a bias for initiating the stop - down operation and ## equ13 ## as an inclination of the program characteristic line are automatically selected . also , for asa 400 , the decision voltage v p7 = i r · r 17 as a bias for initiating the stop - down operation and ## equ14 ## as an inclination of the program characteristic line are automatically selected . by way of example , in fig3 when asa = 100 and the setting is made in such a manner that the stop - down operation is initiated at an exposure value ev = 6 by adjusting the decision voltage v p6 = i r · r 16 , the stop - down operation in asa = 400 will be initiated at an ev = 4 . at this time , as shown in fig4 when the decision voltage v p7 = i r · r 17 is set to the smaller side by 1 ev than the decision voltage vp 6 , the setting can be made in such a manner that the stop - down operation is initiated at a point ev = 7 in asa 100 or at a point ev = 5 in asa 400 . in addition , the program shown in fig3 is a combination program in which 0 . 5 ev in the time value tv and 0 . 5 ev in the aperture value av vary with a variation of 1 in an inclination of the program characteristic line or a variation of 1 ev in the exposure value . this is achieved by setting the amplification factor ## equ15 ## of the amplifier 50 to 1 / 2 . assuming that the program characteristic line of asa 400 has the inclination as set forth above , the inclination is shown with a dotted line in fig4 . however , in consideration of making a good use of the film properties of asa 400 and the best combination of a shutter speed tv and an aperture av , the program characteristic line of inclination as shown in fig4 with a solid line is obtained by setting an amplification factor of the amplifier 50 to 2 / 3 . since the voltage v p10 increases as the diaphragm member 14 is gradually stopped down by the electromagnet 58 for the aperture control , with a film of asa 100 used an output of the amplifier 55 turns to the &# 34 ; h &# 34 ; level when the output voltage v p10 of the amplifier 50 reaches the decision voltage vp 6 and with a film of asa 400 used an output voltage of the amplifier 55 turns to the &# 34 ; h &# 34 ; level when the output voltage v p10 reaches the decision voltage v p7 . thus , the aperture control is completed . at this time , in case of a film of asa 100 , the following equation is derived from the equations ( 6 ) and ( 12 ): ## equ16 ## in case of a film of asa 400 , the following equation is derived from the equations ( 7 ) and ( 13 ): ## equ17 ## in the equations ( 15 ), ( 16 ), i p &# 39 ; represents a photocurrent at the time the stop - down operation is completed . both equations ( 15 ), ( 16 ) indicate the criteria for judging the completion of the stop - down operation . when the stop - down control of the diaphragm member 14 is completed , the movable mirror 3 is raised to initiate the running of the first shutter blind 12 . whereby , the trigger signal s 0 at the &# 34 ; l &# 34 ; level is applied to the terminal 25 to turn the transistor 23 off . at this time , since the feedback loop of the amplifier 21 is broken , no photocurrent flows through the diode 26 and a photocurrent i p which is caused by the photometry of light reflected by the film surface flows through the capacitor 29 . accordingly , the integration is initiated from the time the transistor 23 turns off and the capacitor 29 is charged by the photocurrent i p to further raise the voltage thereacross over the reference voltage v ref the voltage vc across the capacitor 29 is applied from the output terminal of the amplifier 28 to the non - inverting input terminal of the amplifier 30 and is compared with the decision voltage v p2 for a shutter speed which is applied to the inverting input terminal of the latter . the voltage vc can be expressed as follows : ## equ18 ## where c 1 represents the capacity of the capacitor 29 . while the voltage vc is lower than the decision voltage v p2 , namely , the relation ## equ19 ## from the equations ( 3 ) and ( 17 ) holds , an output of the amplifier 30 is at the &# 34 ; l &# 34 ; level so that the electromagnet 32 is in the energized condition to lock a second shutter blind . then , the voltage vc is raised with an inclination indicated by the equation ( 17 ) until it reaches the decision voltage . when the relation ## equ20 ## holds , the output of the amplifier 30 turns to the &# 34 ; h &# 34 ; level . thereupon , the magnet 32 is deenergized and the locking of the second shutter blind is released , resulting in that the latter runs and the exposure is completed .
| 6 |
this invention relates to a method and apparatus for prestressing fastener holes . in the prior art , pulling guns for retracting a mandrel through a hole being prestressed are of large diameter relative to the size of the fastener holes and are made for operating in contact with a workpiece having the hole being prestressed . in many situations , multiple holes , that are going to be prestressed , are drilled through drill bushings in a drill fixture temporarily secured in front of the workpiece . because reaming is performed after prestressing , it is very desirable to leave the fixture in place for the reaming , but this is not possible when the large diameter prior art prestressing tools are used . in addition there are proturbances adjacent to some fastener holes so as to prevent access of the relatively large pull gun to the workpiece at such holes . the basic patent relating to prestressing or cold - expansion of fastener holes , by use of a lubricated spacing sleeve , is u . s . pat . no . 3 , 566 , 662 , granted mar . 2 , 1971 to louis a . champoux , and entitled coldworking method and apparatus . a method and apparatus for making sleeves is disclosed in u . s . pat . no . 3 , 665 , 744 , granted may 30 , 1972 to clair m . harter . it should be noted that there also are prestressing sleeves in use that are not split . u . s . pat . no . 3 , 892 , 121 , granted july 1 , 1975 , to louis a . champoux , horace e . hill and joseph l . phillips , and entitled apparatus for cold - working holes , discloses a form of mandrel and mandrel pulling tool and gun . u . s . pat . no . 4 , 187 , 708 , granted feb . 12 , 1980 , to louis a . champoux entitled pulling apparatus and method , discloses a preferred form of pull gun . the aforementioned patents , the references cited against them , and a paper by joseph l . phillips , entitled &# 34 ; fatigue improvement by sleeve coldworking &# 34 ;, should be carefully considered for the purpose of putting the present invention into proper perspective relative to the prior art . the present invention provides an apparatus and method of prestressing fastener holes in a workpiece wherein the holes have been drilled through a drill bushing in a drill fixture temporarily secured in front of the workpiece . multiple drill bushings in the fixture are used to guide the drill so as to position all of the holes in the current locations . the present invention permits the prestressing through the individual drill bushings and permits the reaming after the prestressing through the same drill bushings without removing the fixture until all of the operations on the holes have been completed . the completion of the operations with the fixture in place is particularly desirable where close tolerances are required . without the present invention , it would be necessary to drill and ream the holes with the drill fixture in position . the fixture would then be removed for the prestressing operation , and then it would be replaced for the final reaming operation . the present invention eliminates the requirement for removing the fixture for prestressing by the provision of a relatively small diameter nose piece or sleeve retainer at the prestressing end of the pull gun . in one embodiment , the retainer is adapted to be extended through each drill bushing to be positioned against the workpiece around a fastener hole being prestressed . a mandrel extends through the retainer during the prestressing operation . the mandrel is retracted through the retainer , the retainer being adapted to retain a spacing , internally lubricated sleeve within the fastener hole . the lubricated sleeve has a flared end which fits into a recess in a flat outer end of the pull gun sleeve retainer and in addition the retainer is made so that it fits tightly but slidably on the mandrel so that the lubricated sleeve cannot slide on the mandrel and into the small diameter nose piece retainer according to the invention . a pull gun , as disclosed in u . s . pat . no . 4 , 187 , 708 , is adapted to receive a retainer or extension according to the invention so that the aforesaid gun can be operated in the same manner as described in the patent . one sleeve retaining nose piece , as used in the apparatus and method according to the invention , has the general appearance of a collet chuck , but not the function , and has an elongated generally cylindrical portion having an outer substantially flat end with a recess therein surrounding the end of a passageway extending through the retainer . at the inner end of the retainer there is a continuous circumferential portion terminating in an annular flange so as to provide a strong supporting member and to facilitate retention of the extension in the pull gun . the retainer is made from unhardened ultra high strength alloy steel . a multiple number of axially directed slots are cut into the cylindrical wall of the retainer radially outwardly of the passageway and extending inwardly from the outer end . the slots are terminated adjacent the inner end outwardly of the retention flange . an axially directed finger is thus formed between each pair of adjacent slots . to prepare the retainer for heat treating , an annular clamping device , such as a ring , is fitted over the outer cylindrical end of the retainer so as to move the axially directed surfaces of each slot into contact adjacent the outer end , and thereby form slits at the outer portion of the respective slots . the retainer is then heat treated in the conventional manner and quenched . after the clamping means is removed , the heat treated extension retains its clamped position with narrow slits at the outer ends , having their axial surfaces normally in contact , and the fingers functioning as axially outwardly tapering , relatively stiff springs , biased radially inwardly . with the above retainer , having an outer flat nose , the load is transferred through the workpiece directly onto the nose end . the flat end configuration has a very high load transfer through the relatively small diameter that almost always leaves some form of a mark on the workpiece . such marks are considered to be undesirable on the skin of an aircraft , for example , particularly where they may be seen on an exterior surface . in order to avoid the foregoing marking problem with the present invention , another embodiment of the invention is provided in which an extension nose piece or retainer has a conical outer end , sized so as to fit inside the flare on the end of a lubricated sleeve . thus , when the mandrel is drawn through the sleeve , the load is transferred directly through the periphery of the fastener hole . the advantage of this embodiment is that it does not leave any marks on the workpiece . the structure and the means for manufacture of the conical - ended sleeve retainer are substantially the same as that of the first mentioned retainer having the flat outer end , the difference being generally only in the end configuration . by having small diameter sleeve retainers extending outwardly from the pulling gun , the present invention presents the additional advantage of being adapted for prestressing of holes on workpieces that have protuberances that would prevent the application of a relatively large diameter prior art pulling gun and nose piece from being used because it could not be positioned against the workpiece because of the protuberances . thus , the relatively small diameter nose piece or sleeve retainer , which is insertable through drill bushings in the drill fixture , is also available for engaging the workpiece where only a small space thereon is available for making contact with the retainer around the holes to be prestressed . both embodiments may be comprised of an elongated retainer nose piece which is made of a single piece of metal and is threadedly engaged at its inner end to the outer end of the gun . the outer end of the elongated nose piece has a small diameter as discussed above . the single piece retainer nose piece provides for the use of a mandrel extension which is secured to the end of the gun at its inner end and extends into the retainer , having a mandrel secured to its outer end . the mandrel extends through the retainer outer passage and in the sleeve in the same manner as described above . further advantages of the invention may be brought out in the following part of the specification wherein small details have been described for the competance of disclosure , without intending to limit the scope of the invention which is set forth in the appended claims . fig1 is a pictorial view of the invention with a sleeve retainer or extension being held against the workpiece and an unshown mandrel extending through a fastener hole , the mandrel being in position for retraction into the extension and the pulling gun ; fig2 is an isometric , exploded view illustrating the position of a split , internally lubricated sleeve adapted to be slipped onto a mandrel , where it is to be positioned on the small cylindrical diameter thereof outwardly of the outer end of the extension of the pull gun ; fig3 is an exploded view of a mandrel , an extension of the pull gun according to the invention , an outer cap of the pull gun which secures the extension in the gun , and of an internally lubricated , axially split sleeve having a flared end , the flared end being adapted to fit into the recess at the outer end of the extension when the mandrel and sleeve are being retracted from the workpiece ; fig4 is the first of three similar longitudinal sectional views illustrating the sequence of the prestressing operation according to the invention , the first view showing the capped nose portion of a pull gun , a portion of a workpiece immediately surrounding the fastener hole to be prestressed , a prestressing sleeve in section , the mandrel in side elevation , and the sleeve retainer secured in the cap of the gun and in abutment with the workpiece and surrounding the cylindrical portion of the mandrel , the first view showing the position of the prestressing tools immediately following the insertion of the mandrel and sleeve into the fastener hole with the flared end of the sleeve in the recess in the end of the retainer ; fig5 is a view similar to fig4 illustrating the retraction of the mandrel by the pull gun , the increasing diameter portion and maximum diameter portion of the mandrel in prestressing action of the metal surrounding the fastener hole ; fig6 is a view similar to fig5 illustrating the retraction of the mandrel by the pull gun , the increasing diameter portion and maximum diameter portion of the mandrel having completed the prestressing of the fastener hole ; fig7 is an end view of the sleeve retainer , with sleeve and mandrel shown in section , taken along the line 7 -- 7 in fig6 ; fig8 is a cross - sectional view of a generally cylindrical sleeve retainer made out of a single piece of metal , elongated to provide for the use of a mandrel extension , the latter being secured to the gun ; and fig9 is a cross - sectional fragmentary view of another embodiment of the invention wherein the sleeve retainer has a conical end to fit into a flared end of a prestressing sleeve so as to avoid direct contact with the workpiece and to avoid marking the same during the prestressing operation . referring again to the drawings , in fig1 - 3 , devices for prestressing a fastener hole are shown in detail . a pull gun , generally designated as 10 , is shown in general outline in fig1 and fragmentarily in fig2 and 3 . the pull gun 10 may be of the type disclosed in u . s . pat . no . 4 , 187 , 708 , granted feb . 12 , 1980 . the pull gun 10 is operated hydraulically to remove a mandrel 12 from an extended , fig2 and 4 , to a retracted position , fig6 . the hydraulic operating means is disclosed in detail in u . s . pat . no . 4 , 187 , 708 . a generally cylindrical nose cap 14 , fig1 - 4 , is provided adjacent the working end of the pull gun and is adapted to secure a small diameter nose piece , in the form of a generally cylindrical elongated sleeve retainer or extension 16 within the outer end of the gun . the cap 14 has an outer radial end wall 18 formed to include a cylindrical center opening 20 . inwardly of the wall 18 is a cylindrical wall 22 having internal threads 24 , terminating forwardly in a small diameter portion 26 forming an inwardly extension of the opening 20 . rearwardly of and radially outwardly of the opening 20 is a flange formed by the wall 18 which is adapted to retain a radially extending circumferentially continuous , cylindrical flange base 32 of the sleeve retainer 16 . as best seen in fig2 and 3 , the flange 32 forms the inner end of the retainer along with an outer continuous circumferential generally cylindrical portion 30 . a tapering tubular portion 34 of the nose piece terminates in an outer flat radially directed end 36 . the tapering portion 34 is formed of six axially directed spring fingers 38 , spaced at their inner ends by adjacent slits or slots 40 ; the slots narrow outwardly to slits 42 in which axial surfaces of the slots normally make contact with each other to form the slits . at the outer end , radially inwardly of the wall 36 is an annular recess 44 formed along the outer surfaces of the six fingers 38 . extending inwardly of the recess is small diameter central generally cylindrical passage 46 and inwardly thereof is an enlarged diameter passage 48 , fig4 and 5 . the retainer 16 is made from ultra high strength alloy steel , and in the unhardened state the slots 40 are cut therein so as to have generally axially directed parallel sides , not shown . in preparation for heat treating , an annular clamping device , such as a ring , is positioned around the outer circumference of the extension adjacent the outer end so as to cause the slots adjacent the outer end to be narrowed into slits . the retainer is then heat treated and quenched and when the clamping means is removed , the retainer remains in the form as clamped , and as shown . the fingers 38 are in the form of hardened springs , biased radially inwardly , and adapted to fit tightly on all portions of the mandrel that pass through the small diameter passage portion 46 , fig4 and 5 . the retainer 16 is secured within the gun 10 by a retainer nut 50 having a central passage 52 for the mandrel 12 . inwardly of the nut 50 is an annular wall 54 on which the cap 14 is threadly engaged . inner end 56 of the mandrel is threadedly engaged with an adapter 60 , secured to a pneumatic piston , not shown . the end 56 is hand tightened into the adapter and is locked in place by an o - ring 62 . extending outwardly of its inner end , the mandrel has a small diameter cylindrical portion 64 on which the fingers 38 of the sleeve retainer are normally tightly but slidably engaged , fig4 and 5 . outwardly of the portion 64 is an increasing diameter conical portion 66 , terminating in a maximum diameter cylindrical portion 68 . tapering outwardly from the maximum diameter cylindrical portion is a decreasing diameter frusto - conidcal end portion 70 . when the mandrel 12 is extended , fig2 a thin axially split , cold - expansion or prestressing steel sleeve 74 is slipped over the outer end of the mandrel onto the small diameter portion 64 . the sleeve has an inner flared end 76 . the cold - expansion sleeve has a comparable or higher modulus and yield than the material of the workpiece . interior surface 78 of the sleeve has a solid film lubricant of a commercial type which includes lead oxide , graphite and molybdenum disulfide . the lubricant film is capable of withstanding more than 400 , 000 psi . see the aforementioned u . s . pat . no . 3 , 566 , 662 and u . s . pat . no . 3 , 665 , 744 for detailed descriptions of the sleeves and a manner of constructing them . the preferred lubricant comprises a molybdenum disulfide , graphite , a binder , a solvent ( e . g . toluol ) and possibly some lead oxide . as is known to those skilled in the art , the coefficient of friction of this lubricant can be varied by changing the various components . in fig4 - 7 , the prestressing operation of the invention is illustrated . two abutting workpieces 82 and 84 , adapted to be secured together by a fastener , have holes 86 and 88 , respectively , drilled therethrough . in fig4 the mandrel 12 is in the fully extended position relative to the gun 10 and has been moved through the holes 82 and 84 . the sleeve 74 is positioned on the small diameter portion 64 of the mandrel 12 . the outer end surface 18 of the nose cap 14 is spaced from the workpiece surface 90 by the retainer 16 . the outer end surface 36 of the retainer 16 is held against the workpiece surface 90 and the flare 76 on the sleeve 74 is engaged in the recess 44 in the end of the retainer . the small diameter surfaces 46 of the fingers 38 are in spring held abutment with the cylindrical surface of the mandrel portion 64 so as to tightly hold the mandrel but be slidably engaged therewith . because the prestressing process is a one - sided operation , the split sleeve 74 is installed on the mandrel 12 prior to inserting the mandrel and sleeve into the hole to be expanded and prestressed . a clearance between the sleeve and the wall of the hole is necessary and is equal to approximately 0 . 003 inch . as may be visualized from fig4 and 5 , to overcome this clearance , it is necessary for the beginning of the tapered section 66 of the mandrel to travel axially , after contact , approximately 0 . 065 inch before starting to expand the hole 86 . as shown in fig5 the mandrel has been retracted substantially with respect to the workpiece 82 , and the increasing diameter portion 66 and the maximum diameter portion 68 have prestressed the area around the hole 86 as indicated by the cold - expansion of the sleeve portion in the hole 86 . that is , the metal around the hole 86 is in compression and as the increasing diameter portion 66 moves into the hole 88 , expansion of the sleeve and hole 88 has commenced . as shown in fig6 the prestressing of the hole 88 has been completed when the large diameter portion has been withdrawn from the hole 88 . a considerable pulling force is required to pull the increasing and large diameter portions of the mandrel through the sleeve and cold - expand or prestress the holes . as the increasing diameter portion of the mandrel 66 starts to expand the sleeve in the hole 86 , a holding force is exerted on the flared end 76 in the recess 44 in the end of the retainer 16 . at this time , the ends 36 of the fingers 38 are in a very substantial pressure engagement with the surface 90 of the workpiece and the fingers 38 are adapted to remain in contact with the smaller diameter portion 64 of the mandrel , fig4 so that the sleeve does not slip between the mandrel and the fingers . this is made possible by the recess arrangement and the spring force of the fingers on the cylindrical portion of the mandrel . as the mandrel is further retracted through the holes 86 and 88 , the force on the sleeve in the recess is increased to retain it therein even though the larger diameter portions of the mandrel radially expand the small diameter portion 44 of the fingers . during the expansion , the fingers remain in tight contact with the mandrel , to aid in retaining the sleeve in the recess , fig6 and 7 . as indicated , a considerable pulling force is required to pull the mandrel through the sleeve and cold - expand or prestress the holes . the maximum diameter cylindrical portion 68 of the mandrel substantially increases the friction and pulling forces around the hole during the prestressing operation . for 3 / 16 inch to 1 / 2 inch diameter holes in various aluminums these forces are in the range of between 2 , 000 and 9 , 000 lbs . this same pulling force on the mandrel reacts on the flared end 76 of the sleeve in the recess 44 and as stated , prevents the sleeve from slipping on the mandrel . in fig8 another embodiment of the invention is illustrated . here , a nose piece or sleeve retainer 100 is made of a single piece of metal of the same type as the nose piece 16 and by the same heat treating process . the nose piece 100 is elongated substantially to prestress the holes , as 102 and 104 , in workpieces 106 and 108 respectively , where a protuberance as 110 is fixed on a surface 112 of the workpiece 108 . an inner large diameter end 116 of the retainer is threadedly engaged with an outer end 120 of a pull gun . in order to use a retainer , as 100 , in the space provided adjacent the protuberance 110 , or through a drill bushing to be described , the long retainer , shown interrupted , has a relatively small diameter portion 124 extending from adjacent the inner end to an outer end portion 126 . the small diameter parts of the retainer are cylindrical and tubular . the outer end portion is formed of spring fingers 130 of the same type as the fingers 38 in fig4 - 7 . the fingers 130 are spaced by axially outwardly narrowing slots 132 , terminating as slits 134 so that the fingers tend to be in contact along their axial surfaces at the outer end . the outer end of the extension retainer 100 has a flat annular surface 138 . radially inwardly thereof is an annular groove 140 to receive a flared end 142 of a prestressing sleeve 144 within the workpiece holes 102 and 104 and surrounding a small diameter portion 146 of a mandrel 150 . inwardly of the groove 140 the fingers have axial surfaces 152 which are biased into contact with the small diameter portion of the mandrel , forming a small diameter passageway for the tubular retainer 100 . the mandrel 150 functions in the same manner as the mandrel 12 and has a increasing diameter portion 156 and a maximum diameter portion 160 . the mandrel is shown in its extended position and because of the length of the retainer 100 , it is convenient to secure the inner end 162 of the mandrel in a solid cylindrical mandrel extension 164 , the mandrel being threadedly engaged in a tapped bore in the outer end of the extension . the inner end 168 of the extension is threadedly engaged with a pull gun adapter secured to a pneumatic piston , not shown . the prestressing operation using the extension nose piece 100 is the same as that described with respect to fig4 - 6 . in fig9 a mandrel 170 , workpieces 172 , 174 , respective holes 176 and 178 , and prestressing sleeve 180 are the same as those shown in fig4 - 6 . a nose piece retainer 182 is generally cylindrical and has on its inner end a cylindrical flange base , as that shown in fig4 and is secured in a pull gun cap 184 , as shown in fig4 . the mandrel is similarly secured to an adapter , as 60 , which is also secured to a pneumatic piston , not shown . the sleeve retainer 182 has a tubular passage therethrough in which the mandrel travels during a prestressing operation . a tapering outer end portion 186 of the retainer terminates in a conical outer end 188 . the portion 186 is formed of four axially directed spring fingers 190 , spaced at their inner ends by narrow axial slots 192 and in the conical portion 188 , the slots are narrowed to slits 196 so that the axially directed surfaces of the fingers forming the slits are generally in contact , the spring fingers fitting tightly on the mandrel . as shown , the outer portion of the conical end is adapted to be fitted within flared end 200 on the sleeve . the retainer 182 is formed with narrow transverse slots 202 at the inner end of the slots 192 . retainer 182 is made of the same material as the retainer 16 and is formed by the same type of clamping and heat treating operation . the sleeve retainer 182 is made with a relatively small outside diameter relative to the prior art retainers , having their ends adjacent or within the large diameter pull guns . the small outside diameter of the retainer 182 is particularly adapted for use in prestressing through a drill bushing 206 in a drill fixture 208 . such drill fixtures are typically positioned and temporarily fixed in front of a workpiece in which holes are to be drilled and then prestressed by cold expansion . in the drilling operation , the fixtures are used to guide drills through the drill bushings so as to position all of the holes in the correct location . because reaming is performed after the cold expansion of the holes , use of a sleeve retainer in the form of retainers 16 , 100 and 182 allows the manufacturer to leave the drill fixture in position after the drilling , for the cold expansion portion of the operation , and thus enabling final reaming operation to be made through the drill bushing holes which remain in register with the original holes as drilled . this is an important advantage of the three types of sleeve retainers described and disclosed herein and is in addition to the advantage illustrated in fig8 in regard to protuberances extending from the workpiece . the conical end 188 on the nose piece retainer 182 , inside the flare of the prestressing sleeve transfers the load during the prestressing operation directly through the periphery of the hole 178 . in the prestressing operation , the conical end in the flare of the sleeve also provides coining on the edge of the hole . this embodiment provides the additional advantage of not leaving any circular marks on the workpiece , as may be left by the outer flat ends 36 and 138 of the retainers 16 and 100 , respectively . the flat ends have a high load transfer through a small cylindrical area so as to tend to leave some form of a mark on the workpiece . the aircraft industry prefers not to have such marks on the outer skin of an aircraft , as they tend to suggest that the aircraft may have been scarred or the surface somewhat damaged . from the foregoing , it is clear that the relatively small outer diameters of the three sleeve retainer embodiments , according to the present invention , provide considerable additional advantages in prestressing of fastener holes over the prior art devices . the invention and its attendant advantages will be understood from the foregoing description and it will be apparent that various changes may be made in the form , construction and arrangements of the parts of the invention without departing from the spirit or scope thereof or sacrificing its material advantages , the arrangements hereinbefore described being merely by way of example . we do not wish to be restricted to the specific forms shown or uses mentioned except as defined in the accompanying claims .
| 8 |
fig1 , 1 a , 2 , 2 a , 3 , and 3 a illustrate prior art methods of allocating area codes and dialing , as was discussed earlier in the background of the invention . fig4 , 4 a illustrate a dialing system which supports the implementation of overlays for area code relief by eliminating the public &# 39 ; s main objections to them . the plan preserves established dialing patterns to existing ( pre - relief ) telephone numbers , and unifies all levels of an overlay area with a consistent abbreviated dialing method . long term relief is provided for exhausted area codes without impacting dialing , switching or software in any other areas of the north american numbering plan ( nanp ). defining the following terms will be helpful for the discussions that follow : parent level of overlay : the original area code ( in these examples the 818 area code ). child level of overlay : a new overlaid area code ( in these examples the 626 area code is the first child level ). overlay area : a single geographic area which contains the parent level and all of the child overlay levels . intra - overlay area calls : refers to calls where the origin and the destination area codes both reside within the geographic overlay area . abbreviated dialing : dialing which requires fewer than 11 digits to complete ( abbreviated dialing within an area code is typically 7 digits ). timing : as used in this unified dialing plan , a predetermined interval ( probably 3 - 4 seconds ) invoked after the 7th digit of a phone number is dialed . if this interval elapses and no further digits have been entered , the phone system switch will run an analysis on the 7 digit number that has been dialed . this technique will allow customers to dial valid phone numbers of varying lengths ( 7 or 8 digits ). in accordance with the invention , an overlay is implemented such that local dialing within the overlay area is facilitated by : ‘ 7 digit ’+ timing dialing for intra - overlay area calls directed to the parent level of the overlay from any level of the overlay . this ensures that dialing patterns to existing numbers ( parent level numbers ) are not disrupted with the introduction of an overlay , and can continue to be dialed with 7 digits plus a brief wait . ‘ 8 digit ’ ( 7 + suffix ) dialing for intra - overlay area calls directed to any level of the overlay ( parent or child ). this is a ‘ 7 + x ’ system , where the 8th digit is a suffix and acts as an overlay selector . each area code within the overlay area is assigned a unique identifier , which is to be used as the ‘ 8th digit suffix ’ or ‘ overlay selector ’ in dialing . this feature unifies all levels of the overlay area with consistent abbreviated dialing , regardless of the originating or destination overlay area codes . the parent is assigned a “ 0 ” for the eighth - digit suffix , the first child is assigned a “ 1 ”, and subsequent children are assigned “ 2 ” through “ 9 ”. when only seven digits are dialed followed by the timing delay , it is assumed by default that the eighth digit is a “ 0 ”, and the call is routed accordingly . 10 or 1 + 10 digit dialing , as used in the standard overlay method , is permissive , but not mandatory , throughout the entire overlay area . every 7 or 8 digit number has a unique correspondence with ( mapping to ) a 10 or 1 + 10 digit number . fig4 and 4a , and fig5 and 6 , illustrate how these three dialing methods are integrated in accordance with the invention . while this plan is applicable to any area where an overlay might need to be implemented , for ease of illustration it will be described by example using 818 as the original area code , and 626 as the first new ‘ overlaid ’ ( child ) level . within the overlay area only ( i . e ., the example 818 / 626 overlay area ), the suffixes for intra - overlay area dialing are determined as follows : all 818 numbers receive a suffix of ‘ 0 ’ ( representing the parent level ). all 626 numbers receive a suffix of ‘ 1 ’ ( representing the first child level ). any future overlay levels receive a suffix of ‘ 2 ’-‘ 9 ’ in that order . this framework allows for easy future expansion when more telephone numbers are needed . thus , for calls originating anywhere within the 818 / 626 overlay area , dialing 123 - 4567 - 0 ( to the parent level ) is fully equivalent to dialing 1 - 818 - 123 - 4567 , and indeed either style of dialing is valid and will successfully place the call . similarly , dialing 123 - 4567 - 1 ( to the first child level ) is fully equivalent to dialing 1 - 626 - 123 - 4567 , and again , either style of dialing is valid and will successfully place the call . for dialing to a second child level within an 818 / 626 /??? overlay area , with a second child area code designated by ?? ?, dialing 123 - 4567 - 2 ( to the second child ) is fully equivalent to dialing 1 -?? ?- 123 - 4567 , and again , either style of dialing is valid and will successfully place the call . further , all 818 ( parent ) numbers can also be reached from any level of the overlay area simply by dialing the original 7 digit number and then waiting for a short timing delay . this feature of the invention makes the introduction of an overlay completely non - disruptive to the existing dialing patterns of the original area code . for example , for calls originating anywhere within the 818 / 626 /??? overlay area , dialing 123 - 4567 and then waiting for the timing delay is fully equivalent to dialing 1 - 818 - 123 - 4567 . that is , 7 - digit dialing , followed by the timing delay , defaults to the 7 digit number in the original area code , which accommodates established 7 digit dialing patterns to pre - relief phone numbers . for a switch - based implementation , the telephone industry and / or appropriate government agencies would determine the appropriate length for this timing delay , which could range from perhaps 1 to 10 seconds , and ideally might be about 3 to 4 seconds . the industry could also customize the length of the timing delay on a customer - by - customer ( number - by - number ) basis . thus , one customer might request that all calls dialed from his or her phone use a 3 second delay . another customer might similarly request an 8 second delay for calls from his or her phone . finally , customer premises equipment used to achieve this dialing functionality in a standard overlay area can readily be programmed with the precise timing delay desired by the user , using methods well - known in the art . other variations on the timing delay may be necessary in order to avoid misdials . these variations might include : 1 ) when the child overlay is first implemented , there will not be many numbers in the new area code ( same as a standard overlay ), so the chances of too short of a delay causing a misdial early on is very low . this might justify a relatively short timing delay at first implementation — say 3 to 4 seconds . as the months go by — if warranted by frequent misdials — the delay could be gradually increased as the new area code grows more populated . 2 ) a few seconds after 7 digits have been entered , a recorded message could play that would give instructions on how to input the 8th digit —“ for 818 area code — enter 0 , for 626 area code — enter 1 ,” etc . after a few more seconds it might say “ at the tone , your call will default to the 818 area code . . . beep .” 3 ) if certain numbers were consistently misdialed , those numbers might be selectively blocked from 7 digit default dialing — or people could request that they never receive any 7 digit default calls . this would not harm the functionality of the plan . these customers would still be able to dial with 7 digit default ( protecting auto dialers , burglar alarms , fire alarms , etc . ), but their own number would no longer be reachable that way . 4 ) or , the 7 digit default method might serve only as a transition device during the first 6 months to 1 year of implementation . if misdials do become problematic , it could be phased out altogether . this would still leave the overlay area with a very functional and efficient 8 digit abbreviated dialing plan . for calls originating within the overlay area , the telephone number conversion device , whether in a telephone company switch , a modified custom calling service , or in customer premises equipment , would operate as follows : once 7 digits are received , the call will be considered legal . however the number conversion device will wait an additional predetermined timing period for a possible 8th digit , which is the ‘ overlay area code selector ’. if the timing delay elapses before the 8th digit is received , a suffix of ‘ 0 ’ is assumed , and the 7 digit call will automatically be directed to the 818 ( parent ) level of the overlay . if 8 digits are received before the timing delay elapses , the conversion device will analyze the number , examining the 8th digit first . if the 8th digit is a ‘ 0 ’, the call will be directed to the 818 ( parent ) level of the overlay . if the 8th digit is a ‘ 1 ’, the call will be directed to the 626 ( first child ) level of the overlay . if the predetermined ‘ timing delay ’ elapses and less than 7 digits have been received , the call is considered abandoned , and the standard ‘ try again ’ message is given . once the proper overlay level is determined and the call is routed to the proper area code within the overlay area , the suffix is discarded , leaving a standard 7 digit number to be routed by traditional 7 digit switching logic . all of the above is readily implemented , using methods well - known in the art , in the switching or custom calling service device at telephone company central offices , and / or in customer premises equipment , by taking a 7 or 8 digit number and converting it into the appropriate 7 digit or 10 or 1 + 10 digit number , then signaling it to a normal telephone company switch in a standard overlay , or even non - overlaid , situation . to summarize , all ‘ 7 digit + timing ’ or ‘ 7 digit + suffix ’ calls are converted to 10 or 1 + 10 or 7 digit numbers as appropriate , by the phone system or by the customer premises equipment , and are then transparently routed to the proper overlay level . it is to be noted that 10 or 1 + 10 digit dialing for intra - overlay area calls would also be supported , if that is how an individual preferred to dial , but it would not be mandatory . as such , the dialing plan according to the invention integrates seamlessly with the standard overlay method . for local or toll calls originating within the overlay area , but directed outside of that area , mandatory 10 or 1 + 10 digit dialing would be used . this requires no change whatsoever to the existing method of placing calls outside an overlay area . if someone in the overlay area were to accidentally use the ‘ 10 + x ’ or ‘ 1 + 10 + x ’ format ( because they had become accustomed to dialing 8 digit phone numbers ) it wouldn &# 39 ; t matter because in 10 or 1 + 10 dialing , all extra digits beyond 10 or 1 + 10 are ignored , just as they have always been . for calls originating outside the overlay area which are directed into the overlay area , standard 10 or 1 + 10 digit dialing would be used . if someone from outside the overlay area were to accidentally use the ‘ 10 + x ’ or ‘ 1 + 10 + x ’ format ( because they were unclear as to the correct dialing rules in the overlay area ) it wouldn &# 39 ; t matter because in 10 or 1 + 10 dialing , all additional digits are ignored . again , this does not in any way change how someone outside the overlay area dials into the area . the overlay method heretofore described integrates well with existing directory listing practices , because numbers within an overlay area can all be listed with 8 digits . thus , for example , in the 818 / 626 telephone directories the numbers will be listed as follows : 818 number 999 - 3360 - 0626 number 956 - 2200 - 1213 number 213 - 462 - 2110 ( out of ‘ overlay area ’ number ) 626 number 347 - 9426 - 1818 number 883 - 6234 - 0310 number 310 - 244 - 0177 ( out of ‘ overlay area ’ number ) in the above , 7 digits +‘ 0 ’= 818 area code ; 7 digits +‘ 1 ’= 626 area code . because no area codes would need to be listed for intra - overlay area phone numbers , the ‘ new ’ 626 numbers ( which a new business might have ) will not stand out as red flags to customers looking for experienced services . only out of ‘ overlay area ’ phone numbers would stand out , the same as they already do in current directories . this would not be a flag for the business being “ new ,” it would simply be a flag for the business being out - of - area , as it is at present . to further remind people how the system works , a sticker could be supplied to customers in the 818 / 626 area that said , e . g ., “ 8 digit dialing supported : 7 digit phone number + 0 = 818 area code ; 7 digit phone number + 1 = 626 area code .” the public can be informed about the use of the new plan , for example , with easy - to - understand language such as : “ for calls made from any telephone within the 818 / 626 overlay area to any phone number with an 818 area code ( 818 is the original ( or “ parent ”) level of this overlay area ): you may dial all 818 area code telephone numbers exactly as you always have in the past using just 7 digits . after a short delay your call will go through . you may avoid this delay by dialing the 7 digit number + 0 . for calls made from any telephone within the 818 / 626 overlay area to any phone number with a 626 area code ( 626 is the first new ( or “ child ”) level of this overlay area ): you must dial all new 626 area code telephone numbers as the 7 digit number + 1 . for calls made from any telephone within the 818 / 626 overlay area to phone numbers in area codes outside of the 818 / 626 overlay area : dial 1 + area code + 7 digits — the same as you would before the overlay went into effect . for calls made from area codes outside of the 818 / 626 overlay area to any area code within the 818 / 626 overlay area : dial 1 + area code + 7 digits — the same as you would before the overlay went into effect . “ this plan addresses customers &# 39 ; objections to using overlays which they fear would result in confusion and / or the inconvenience of having to dial 11 digits just to call across the street . to ease the public &# 39 ; s transition to overlays , simple 7 digit dialing to all existing ( pre - relief ) parent level numbers is maintained ( this is also a benefit for children , the elderly / handicapped , and automatic dialing systems ). the plan allows for abbreviated ‘ 7 digit + suffix ’ dialing from and to any phone within the entire overlay area , without affecting how 10 or 1 + 10 digit calls ‘ out - of ’, ‘ into ’, or ‘ within ’ the overlay area are handled . it is expandable to 10 levels ( 0 - 9 ) of overlay within a single geographic dialing area , allowing for painless addition of many new numbers in the future . additionally , the new style of directory listings which this dialing plan permits won &# 39 ; t be a disadvantage for new businesses . for the public , this plan will have the psychological appeal of being a new ‘ high tech ’ solution to the challenges presented by splits and standard overlays . it responds to all of the public &# 39 ; s concerns about overlays , and will leave citizens and businesses with a feeling that something is finally being done to protect them from the expense and disruption that traditionally comes with area code exhaust and relief . when the advantages of this plan are weighed against the disadvantages of area code splits and standard implementations of overlays ( expense , disruption , confusion , inconvenience , permanent impact on the size of geographic dialing areas , etc . ), this unified dialing plan for overlays clearly makes sense as a solution for both the short and the long term . this system can be applied to any area that is faced with the need to introduce an overlay . if this system becomes a standard , over time large areas of north america would be able to locally take advantage of this plan without affecting how any ‘ out of area ’ or ‘ into area ’ dialing and switching is handled . in short , this numbering plan greatly reduces the confusion and inconvenience that is associated with having multiple area codes within individual neighborhoods and households . because the plan is non - disruptive to existing 7 digit and 10 or 1 + 10 digit dialing patterns , no one is put in jeopardy by a change to their local dialing plan ( especially children and elderly / handicapped ), and it ensures that existing auto dialers can complete calls without reprogramming . this plan reduces the likelihood that the new overlay area code will be a stigma for new businesses . finally , it ensures that costs to businesses and disruption overall will be kept to a minimum . it is important to note that this plan according to the invention can be used even when there is not a unique original area code . in these cases , only the 8 digit “ unifying ” feature of the plan would be implemented . this situation would occur if an overlay were implemented on top of two existing distinct area codes . in this case , the 7 digit default would only be used as a transition vehicle for each of the original area codes , and then would be phased out , leaving the 8 digit system in place . the 8 - digit - only version of the plan could also be used where a standard overlay has already been implemented . in these cases , the 7 digit feature of the plan would not be used at all , but the 8 digit feature could be implemented and save callers 3 digits on each call . the 8 digit feature could also be used to tie together geographically distinct area codes that will not be overlaid , simply as a way to avoid having to dial 10 or 1 + 10 for out of area code calls . where two existing npas are overlaid , the transition would take place in two phases . in the discussion following , area code a signifies either of the existing area codes , area code b signifies the other existing area code , and area code c signifies the new overlay area code . note , to avoid confusion with situations where there is only one original area code , the ‘ 0 ’ suffix should not be used in cases where there are two or more original area codes . in phase one , before implementing the overlay , each of the two existing npas would separately migrate from 7 digit to 8 digit dialing using the 7 digit default as the transition vehicle ( 10 or 1 + 10 digit dialing within each area code would also be enabled at this time ). area code a would migrate to 7 digit +‘ 1 ’ suffix , and area code b would migrate to 7 digit +‘ 2 ’ suffix . in either case , 7 digit calls ( with a delay ) would default to the area code of origin during the permissive period . it is important to recall that in this situation , the two area codes are in separate geographic areas , so 7 digits can default to the area code of origin without confusion . during this period it might be possible to dial between the two area codes using either the 8 digit option or standard 10 or 1 + 10 digit dialing . in phase two , at the end of the permissive dialing period , each of the existing area codes would have separately migrated to 8 digit or 10 or 1 + 10 digit dialing for all calls , and the 7 digit default method will no longer be available for either area code . at this point 8 digit dialing and 10 or 1 + 10 digit dialing would be available for all calls within and between area codes “ a ” and “ b ”. the third area code would now be overlaid and could immediately use 8 digit or 10 or 1 + 10 digit dialing for all calls within the “ a b c ” area code grouping . the 8 digit numbers in this new overlaid area code (“ area code “ c ”) would be 7 digit +‘ 3 ’ suffix . this results , finally , in all three area codes being unified with the 8 digit dialing option . naturally 10 or 1 + 10 digit dialing would also be an available dialing method , for anyone who wishes to use it . even if this plan is not adopted as a north american standard , it integrates seamlessly with the existing standard overlay method , as well as with established methods for dialing within and between non - overlaid area codes . thus it is possible for computerized customer premises equipment ( cpe ), using methods well - known in the art , to operate according to the lower flowchart of fig5 , and thus convert 7 and 8 digit numbers into the appropriate 10 or 1 + 10 - digit numbers , and then transmit these 11 - digit numbers out to phone company switching equipment that uses only the standard techniques for dialing within and between overlaid and non - overlaid area codes . this cpe could optionally be supplemented with a set “ hot buttons ” on the phone which would be programmed to specific 3 or 1 + 3 digit area codes . by pressing one of these buttons at the start of a call , one could dial a 10 or 1 + 10 digit phone number with only 8 key presses ( hot button + 7 digit number ). or , the 7 digit number plus 1 digit suffix method earlier described can be used , as desired by the user . users of such a cpe device , using programming “ setup ” methods that are well known in the art , could choose their own suffixes to associate with each area code within the overlay area , and could determine for themselves which area code gets the “ 0 ” suffix and hence can be dialed merely by 7 digits plus a timing delay . additionally , such a cpe device can work in situations other than overlays if a user wishes to enjoy abbreviated dialing between separate non - overlaid area codes . thus , for example , not limitation , a user can associate a digit ( e . g ., 0 through 9 ) with the ten area codes he / she dials most often . then , by dialing a seven digit number plus one of the area code - associated digits , the user can achieve 8 - digit dialing into ten different area codes . this cpe can be attached to a phone line or to a preexisting phone as an add - on module , or it can be integrated directly with the telephone as a unitary device . use of the word “ telephone ” above , and throughout this disclosure , is intended and understood to include facsimile machines , autodialers , computers , and any other devices that can be connected to a phone line or a wireless service connection , and which can generate the tones and / or pulses necessary to place a telephone call . it should be noted that while numbers in all of the area codes within the geographic overlay area can be reached by dialing either ‘ 7 + suffix ’ or ‘ 10 or 1 + 10 ’, the ‘ 7 digit default ’ dialing option ( which requires a timing delay ) applies only to numbers in the original area code and only under default conditions . on the surface this would seem to offer preferential dialing to certain numbers ( which would be counter to the fcc &# 39 ; s mandate for dialing parity in overlays ). however , on closer examination it becomes clear that very few people would intentionally take advantage of this option . because of the timing delay when only 7 digits are dialed , customers will quickly opt for dialing the 8th digit ( in this case ‘ 0 ’) in order to complete calls in the most expedient way . this 7 digit option is really only provided in order to ease the transition into an overlay scenario , and to act as a safety net for old “ 7 digit style ” calls which would otherwise be lost . it provides an extremely long permissive dialing period , ensures that any phone number that had been dialed with 7 digits in the past could still be dialed the same way , and minimizes the need to immediately update auto dialers and databases . more than likely , ( after implementation of this invention ), 7 digit calls will only be initiated by auto dialers which had been programmed pre - relief ( i . e . alarm system auto dialers ), and which are typically difficult or costly for their owners to update . in short , from a dialing parity standpoint , 7 digit dialing plus a timing delay is on a par with 8 digit dialing and no timing delay , i . e ., the dialing of an eighth digit and the waiting for a timing delay are equivalent with one another insofar as they might deter a user from choosing a service provider for whom one option would be used over the other . as has been mentioned several times , this invention can also be implemented by telephone company switching equipment as a modified custom calling service . it could be integrated into the network either as a general feature available to all customers as part of their basic monthly service , or as a subscription based feature available only to customers who pay a monthly fee or a pay per use premium . as an example , if this custom calling service were activated when the customer entered *?? ( where ?? are any two digits selected by a telephone company for this purpose ), the switch would be signaled that a 7 or 8 digit ( rather than 10 or 1 + 10 digit ) call is about to be dialed . but entering the *?? would of course reintroduce extra dialing digits which this invention is designed to eliminate , so other approaches might also be considered . for example , not limitation , instead of initiating the custom service by dialing a *? ?, this service could be automatically triggered if the customer began his call with a “ 2 ” through “ 9 ”. the custom service would then “ watch ” as digits were entered , and “ decide ” what to do with any given number . naturally 411 , 911 and other special services would immediately be released to the network after only 3 digits are entered . seven ( 7 ) digit calls would not be released until after the timing delay , and both 7 and 8 digit calls would be translated into the proper 3 digit area code + 7 digit phone number before entering the network . calls beginning with a 0 or a 1 would not trigger this service , since it could be assumed that these numbers were going to be dialed as full 10 or 1 + 10 or 0 + 10 digit numbers ( and thus would not be using 7 or 8 digit dialing ). and , since a caller can always choose to dial with either the reduced - digit option , or the full 10 or 1 + 10 digit number , using 7 or 8 digit dialing might automatically be billed as a premium service , while the use of full 10 or 1 + 10 digit dialing would be billed as a standard ( non - custom ) service . if this dialing method is implemented by the phone companies as a custom calling feature , or through cpe , the customer might be able to specify that any given area code is the “ parent style ” area code . this would allow for 7 digit default dialing to any area code of the customer &# 39 ; s choosing , and could be used for both overlaid and non - overlaid situations . if each customer could select which area code defaulted to 7 - digit dialing , then every customer would get to choose exactly one area code for 7 digit dialing , and there would be no possible advantage or disadvantage to anyone , either placing calls or receiving calls . this further overcomes any concerns that may arise regarding dialing parity . the same user - selectable approach can be used for the “ child style ” area codes . here , using a customized calling service , or cpe , each user could specify that a certain group of area codes is to be dialed with either one digit at the beginning of the dialing or one digit at the end , and the user could specify which area codes are associated with which digits . further , the user could select one area code for pure 7 digit dialing ( no timing delay ). thus , if a user wanted to still be able to make all of his or her 818 calls by only dialing 7 digits , the user would tell the switch that any call placed by that user which doesn &# 39 ; t start with a 0 or a 1 will always be a call intended for the 818 area code . another customer might prefer to make 626 his or her special 7 digit area code . if this feature could be changed at will , the user could make his or her phone behave as if it were located in any area code , at any time . a phone in california , for example , would be able to dial 7 digit numbers in a new york area code ! a display on the user phone or similar device could show what area code is assigned as the special 7 digit area code ( similar to the caller id display ). a device or telephone similar to the “ hot button ” device disclosed earlier can also be included . thus , when the user presses the hot button , it remains selected ( or on ) until it is turned off , or until a different area code “ hot button ” is selected . in this way , after choosing an area code , all calls dialed afterwards may be dialed with only 7 digits ( not 8 ). this could make the user &# 39 ; s telephone behave exactly as it did before the overlay . or , if the user wanted to place many calls to the 202 area code , he or she could press or program the 202 button , and from then on dial all calls to that area code using only 7 digits . similarly , an off switch can be provided , so that one can bypass any of these special dialing features . this would help new users feel “ safe ” with this device . all of the above , it is again noted , can readily be implemented through phone company switches , and / or through computerized cpe . fig9 illustrate a preferred embodiment of the underlying computerized device of the invention . fig9 a , using an 818 / 626 /??? overlay area as an example , illustrates computerized telephone number conversion device 1 which accepts the dialing tones of a 7 or 8 digit telephone number as input , determines by means of an association table which area code to associate with each overlay selector ( including timing delay expiration with no selector , which defaults to the parent ( e . g . “ 0 ”) selector , and outputs a 10 or 1 + 10 digit number corresponding to the full 1 + area code + local number of the number being dialed . the direct , one - to - one mapping between 8 - digit numbers and 10 or 1 + 10 digit numbers according to the invention makes the device 1 extremely simple to implement using methods well - known in the art . naturally , any time it is detected that a “ 0 ” or a “ 1 ” is the first digit dialed ( e . g ., the caller dials 1 - 818 - n23 - 4567 ), the conversion is deactivated , and the number as dialed is simply passed through conversion device 1 unaltered . similarly , the association table would contain special numbers such as “ 911 ”,“ 411 ”, etc . that , if detected , are simply passed through unchanged . the modular device 1 , in turn , easily integrates into a number of settings . as shown in fig9 b , it can easily be incorporated into a telephone company switch 2 ( or a pbx - type system at a customer site ), and can thus be used to detect incoming 7 or 8 digit numbers , convert them into 10 or 1 + 10 digit numbers , and signal the full 10 or 1 + 10 digit number associated with the incoming 7 or 8 digit number . as noted earlier , this may or may not be provided to the customer as a custom calling service . in the cpe variation , module 1 is connected to an ordinary , preexisting telephone 3 . it converts 7 or 8 digit numbers dialed at the telephone keypad 5 into the correct associated 10 or 1 + 10 digit numbers , and then sends these converted numbers to the telephone switch over telephone line 6 . alternatively , telephone 3 and module 1 can be incorporated together into a unitary “ enhanced ” telephone 4 , which similarly converts the input 7 or 8 digit number into a 10 or 1 + 10 digit number and sends that number out over the telephone line 6 . in either event , this cpe device gives the telephone user the option to simplify his or her dialing whether or not the telephone company itself chooses to implement this invention systemwide . and , in the event the simplified dialing of this invention is implemented as a custom ( premium ) calling service , this cpe device enables the user to avoid paying the premium for this custom calling service , and at the same time enjoy the benefits of this simplified dialing . for all of these variations , programming means 7 are used to program and customize module 1 , using methods well - known in the art . this can include establishing the relationships between overlay selectors and area codes , setting the timing delay , programming “ hot button ” for the cpe device , etc . finally , the methods described above lend themselves as well to a non - disruptive method for what to do when all 800 = 8 × 10 × 10 of the original 3 digit ( nxx ) area codes are used up . ( n = 2 through 9 , x = 0 through 9 .) this method involves introducing new 5 digit area codes , where the 4th digit will always be a 0 or a 1 , and the fifth digit may be 0 through 9 . this will create a system for adding 800 × 2 × 10 = 16 , 000 more area codes without disrupting how existing numbers are dialed . in this method , all 800 original area codes will be able to be known as either the nxx00 or as the original nxx . all new area codes will be nxx01 - nxx09 or nxx10 - nxx19 , when the dialing doesn &# 39 ; t start with a 0 or a 1 , the telephone number conversion device detects this and determines that the number is being dialed without an area code prefix , so it will treat the call as a conventional 7 digit call , or a 7 or 8 digit call according to the invention as heretofore described . if the dialing does start with a 0 or 1 , the telephone number conversion device detects this and determines that the number following will be either a 3 digit or 5 digit area code . in this case , if the 4th digit that follows the ‘ original 0 or 1 ’ is not a 0 or a 1 ( i . e ., if it is a 2 through 9 ), then the telephone number conversion device interprets this to mean that an original 3 digit area code is being used , and the call will be able to be completed without dialing the full 5 digits for the area code . this takes advantage of the fact that standard 7 digit numbers are always in the form n23 - 4567 , where the first digit n runs from 2 to 9 . as such , this method is non - disruptive for dialing to these original 800 established 3 - digit area codes , since a call to a number in these area codes will always be able to be completed the same as it is today — with a 1 + nxx + 7 digit number — or — optionally , with a 1 + nxx00 + 7 digit number . if the 4th digit that follows the ‘ original 0 or 1 ’ is a 0 or a 1 , the telephone number conversion device will recognize that a 5 - digit area code is being dialed , will await the fifth number of the 5 digit area , and will then signal the seven digits provided thereafter into the given 5 - digit area code . that is , all new 5 digit area codes will be recognized because of the 0 or 1 in the 4th position , and these will only be reachable by dialing the full 5 digit area codes . while the use of a single - digit suffix will suffice for an overlay area encompassing up to ten area codes ( which should cover any overlay situations likely to develop for the foreseeable future ), if an overlay area in the future were to include more than ten area codes , then a two - digit suffix would be required . in essence , the single - digit overlay codes would be supplemented with a second overlay selector code digit , enabling up to 100 area codes to coexist within one overlay area . intra - overlay calling would then use either 7 digit plus timing delay , 8 digit plus timing delay or 9 digit dialing , rather than just 7 digit plus timing delay or 8 digit dialing as described above . while it is unlikely that an overlay area will grow to cover more than ten area codes anytime soon , such a two - digit suffix is nevertheless encompassed by this disclosure and its associated claims . irrespective of whether this system is uniformly adopted , cpe can readily be programmed using methods well known in the art to enable a telephone user to enter area codes in accordance with the above . an alternate embodiment of this invention illustrated by fig7 and 8 involves implementing overlays in a manner which would create “ child ” area codes spawned from the original area code , but these new codes would appear to actually share the original area code &# 39 ; s name . to the network , these area codes would be known as , for example , 818 - a , 818 - b , 818 - c , etc . this method would allow customers everywhere ( even outside of the overlay area ) to be able to dial “ 1 ”+ the 3 digit “ 818 ” area code + an 8 digit ( 7 digit + x ) number , and have the suffix digit determine the intended overlay ( area code ) level . as with the earlier embodiments , the original area code could have the suffix “ 0 ”, and be dialable with either 1 + 3 + 7 digits + timing delay or 1 + 3 + 7 + x . within the affected area , all calls could be made by dialing only 8 digits or 7 digits + timing delay . this alternate variation will in practice be transparent to the user , while in execution ( at the switching level ) it will be functionally the same as a standard overlay . the 8th digit ( 0 - 9 ) will be treated as a suffix , and will determine which of the overlaid area codes is to be accessed . the actual switching at the local level would still be based on traditional 7 digit dialing . customers in area codes which have not been overlaid in this manner , do not need to use 8 digit numbers when dialing local calls , or to use 1 + 3 + 8 digit numbers when dialing out of area calls , unless those calls are being sent to a multiple area code 8 digit dialing region . in this alternate variation , local calls for the multiple 818 area code region would be handled as follows : on the switching level , the original area code , for example “ 818 ”, will be known as 818 - a and the first level of overlay will be known as 818 - b , etc . after the central office receives the traditional 7 digits , there will be a courtesy pause of 3 to 7 seconds , which will allow the user to enter a ‘ 0 ’ or ‘ 1 ’ or nothing . if no 8th digit is entered , the system assumes ‘ 0 ’ and directs the call to 818 - a . this feature allows all existing phone numbers to still be accessible by dialing only the original 7 digit number . if a ‘ 0 ’ is entered , the system also directs the call to 818 - a . if a ‘ 1 ’ is entered , the system directs the call to 818 - b . once the number arrives at 818 - a or 818 - b , it is switched at the central office as a normal 7 digit number ( the new 8th digit is ignored at this level — it was only necessary in determining which of the overlaid area codes to access ). on the dialing level , for example , 818 - a can be accessed the same as always , by dialing only the 7 digit phone number . the 8th digit ‘ 0 ’ could be added by the user , but it is not mandatory . thus no directories , stationary , auto dialing systems , etc ., need to be changed . 818 - b will be accessed when the user supplies a ‘ 1 ’ for the 8th digit . these new numbers will always be known to the users as 8 digit phone numbers , and so no existing databases will need to be updated . in this alternate variation , calls coming into the region from outside of the region will be handled as follows : on the switching level , when an out of region call is initiated with a 0 or a 1 ( to access long distance or operator services ), the phone system normally listens for the completion of a 10 digit number . i . e . 818 - 956 - 3360 . with this variation of the invention , the phone system will listen for the traditional 10 digits , and will then supply a courtesy pause of 3 to 7 seconds which will give the opportunity for the user to enter an 11th digit ( if necessary ). the 10 or 11 digit phone number will then be routed to the appropriate destination area code . if the call was intended for 818 , when it arrives at 818 the number is tested for a ‘ 0 ’ or ‘ 1 ’ suffix in the same manner as described for local calls above . if there is no 8th digit , the system assumes ‘ 0 ’ and directs the call to 818 - a . if the 8th digit is ‘ 0 ’, the system also directs the call to 818 - a . if the 8th digit is ‘ 1 ’, the system completes the call to 818 - b . once the number arrives at 818 - a or 818 - b , it is switched at the central office as a normal 7 digit number . on the dialing level , 818 - a can be accessed the same as always , by dialing only 1 - 818 + the original 7 digit phone number . the 8th digit ‘ 0 ’ can be added by the user , but it is not mandatory . thus no out of town directories , auto dialing systems , etc ., need to be updated . 818 - b will be accessed when the user dials 10 or 1 + 818 + the 8 digit phone number , using a ‘ 1 ’ for the 8th digit . these new numbers will always be known to the users as 8 digit phone numbers , and so there is no existing data that needs to be updated . in the future numbering demands could be met by implementing overlay levels 2 through 9 as needed . the unified method and apparatus to simplify telephone area code dialing is a non - disruptive solution for area code relief which is both competitively neutral and consumer friendly . it provides a technically workable alternative for area code relief which minimizes hardship to local business and the public . new numbers can be added to a geographic area without changing the way that existing numbers are dialed . established 7 and 10 or 1 + 10 digit dialing patterns are maintained and a new 8 digit option is enabled which allows for abbreviated dialing within and between all area codes in the geographic overlay area . further , the plan demonstrates how dialing parity ( mandated by the fcc ) can be maintained in an overlay without requiring the full 10 digit ( or actually 1 + 10 digit ) phone number to be dialed . the invention disclosed herein might , at first glance , seem to call upon techniques which previously have been rejected by the telecommunications industry and public utility commissions . but a closer examination demonstrates that these techniques , as proposed here , solve rather than create problems . the cost of implementing the plan for an affected region may well be less than the overall cost ( cost to business , cost to public and cost to telecommunications industry ) of an area code split . fig1 through 12 illustrate in varying levels of detail how the unified dialing plan for overlays is achieved in connection with traditional testing and routing methods , and in connection with interactive and non - interactive announcements ( messages ). in particular , to conserve numbering resources , many telephone companies define a limited number of 3 - digit area codes that can be dialed in a given local region without a leading “ 1 ”, while the remaining combinations of three leading digits are defined ( or deduced from the defined area codes ) to be the three - digit prefixes of seven - digit local telephone numbers . ( see , for example , the box labeled “ co code ambiguity testing ” in fig1 and 12 .) this information locally defining which three digits sequences are to be regarded as area codes and which are to be regarded as central office codes is typically contained in a database maintained by a telephone company , and it varies both by region , and over time as numbering resources are assigned or reassigned . if the user employs customer premise equipment in accordance with the practice of this invention , then the user may locally define his or her own such database . thus , these figures illustrate in the flowchart boxes labeled “ traditional testing and routing ” how if an initial dialed digit is detected to be a digit “ 1 ”, then the next three digits are regarded to be a three - digit area code , while if the initial dialed digit is detected to be a digit other than “ 1 ”, then further test are made on the first three digits including the initial dialed digit . if it is determined that the initial dialed digit combined with said first and second digits following , comprises a three - digit area code , then a call is signaled to the receiving telephone device at a three - digit area code represented by the initial dialed digit combined with the first and second digits following , and at a 7 - digit telephone number represented by third through ninth detected digits following the initial dialed digit . alternatively , if the initial dialed digit combined with the first and second digits following are determined to not comprise an area code , then the initial dialed digit combined with the first and second digits following is regarded to comprise a central office code , and the central office code combined with third through sixth detected digits following the initial dialed digit is regarded to be the 7 - digit telephone number of said receiving telephone device . the overlay selector code is then set to the seventh detected digit following the initial dialed digit . also shown in these figures , for example not limitation , are various interactive and non - interactive messages / announcements that can be used to help the telephone user easily place calls . in the discussion and claims , the word “ digit ” is often used to refer to the traditional numbered keys “ 0 ” through “ 9 ” and the “*” and “#” keys traditionally found on a telephone . however , insofar as particular “ digits ” are used as shorthand “ codes ” to represent and enable simplified dialing of overlays and / or area codes , it is understood that the word “ digits ” is more broadly defined and understood to comprise , for example , telephone device function “ keys ” that by a single depression also represent and enable simplified dialing of overlays and / or area codes . this is illustrated , for example , in the block diagram of fig1 illustrating a customer premises equipment embodiment of the invention which includes area code function keys . in the particular illustrated embodiment , the user can have up to 20 “ speed - dial ” area code “ digits ,” ten of which are associated with the traditional “ 0 ” through “ 9 ” keys , and the other ten of which are associated with the ten illustrated area code keys . it is also noted that the telephone number memories found on many telephones can , if desired , be programmed to hold three - digit area codes that can then be recalled from memory and used in a similar manner to the ten illustrated area code keys . it is also noted that the customer premises equipment can set any additional detected digit in any user - predetermined position in the dialing sequence to be the area code selector code , i . e ., that the user ought not be restricted to having this additional detected digit be the final digit dialed after the local telephone number . it is also noted , since telephone companies in some areas permit 1 + 10 or 10 digit dialing , while in other areas only 1 + 10 digit dialing is permitted , that customer premises equipment preferably will comprise a switch or similar means for setting the customer premises equipment to send out touch tone signals in a manner consistent with the local dialing rules . finally , it is noted that the aforementioned information locally defining which three digits sequences are to be regarded as area codes and which are to be regarded as central office codes is typically contained in a database maintained by a telephone company , and varies both by region , and over time as numbering resources are assigned or reassigned . as noted , if the user employs customer premise equipment in accordance with the practice of this invention , then the user may locally define his or her own such database , or may even download this database from the pertinent telephone company . however , in the preferred embodiment , the customer premise equipment simply transmits any suitable dialing sequence without a preceding “ 1 ” directly to the telephone company as is , so that the telephone company &# 39 ; s own database , which will always be accurate and timely , completes all of the testing ( and user advisory messaging as necessary ) to determine which leading three - digit sequences are area codes , which are central office codes , and which are invalid codes . while only certain preferred features of the invention have been illustrated and described , many modifications and changes will occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention .
| 7 |
certain terminology is used herein for convenience only and is not to be taken as a limitation on the invention . for example , words such as “ upper ,” “ lower ,” “ left ,” “ right ,” “ horizontal ,” “ vertical ,” “ upward ,” and “ downward ” merely describe the configuration shown in the figs . indeed , the components may be oriented in any direction and the terminology , therefore , should be understood as encompassing such variations unless specified otherwise . the latch bolt assembly according to the present invention is for use in a mortise lock and may be used with any conventional mortise lock such as , for example , the mortise locks described by u . s . pat . nos . 4 , 118 , 056 ; 5 , 678 , 870 ; 6 , 349 , 982 and 6 , 393 , 878 , the contents of all which are hereby incorporated by reference . accordingly , detailed explanations of the functioning of all of the mortise lock components are deemed unnecessary for an understanding of the present invention by one of ordinary skill in the art . referring now to fig1 an embodiment of a mortise lock according to the present invention is shown and is generally designated by reference numeral 20 . the lock 20 comprises a generally rectangular box , or case 22 , for housing the lock components and is adapted to be received in a mortise in the free , or unhinged , edge of a door ( not shown ). one of the side walls of the case 22 comprises a cap 24 which is secured to and forms a closure for the case 22 . [ 0017 ] fig2 shows the mortise lock 20 with the cap side wall 24 removed . the case 22 includes a side wall 26 and integral top 28 , bottom 30 , front 32 and rear 34 walls . as seen in fig1 the front wall 32 has a latch bolt opening 36 , a deadbolt opening 38 , an auxiliary bolt opening 40 and an opening 42 for a flush - mounted toggle . a face plate 44 is secured with screws 46 to the front wall 32 of the case 22 and has an opening 48 for the latch bolt corresponding to the latch bolt opening 36 in the case 22 . it is understood that other openings can be provided in the face plate 44 which correspond to the openings in the front wall 42 when the associated lock components are present . an embodiment of the latch assembly according to the present invention is shown in fig3 and designated generally at 50 . the latch assembly 50 comprises a latch bolt including a bolt head 54 and a latch tail 56 , an anti - friction lever 58 , a coil spring 60 , spring washers 62 , a guide block 64 and a spring clip 66 . the bolt head 54 includes a beveled face 68 and a slot 70 . a pin 72 extends through a hole 74 in the bolt head 54 , into the slot 70 and a hole in the anti - friction lever 58 for pivotally mounting the anti - friction lever to the bolt head 54 . an arm 76 extends from one side of the anti - friction lever and transversely from the beveled face 68 of the bolt head 54 . when the latch assembly 50 is in the case ( fig2 and 4 ), the arm 76 engages behind the face plate 44 . the inner end 78 of the bolt head 54 is generally cylindrical and has an axial bore 79 ( not seen in fig3 ) for receiving the outer end of the latch tail 56 . the latch tail 56 has a cylindrical body and a circumferential groove 80 adjacent the outer end of the latch tail 56 . the body of the latch tail 56 tapers inwardly beginning at a point spaced longitudinally outwardly from the groove 80 . the tapered portion 82 of the latch tail 56 terminates at the outer end of the latch tail 56 forming a disc - like outer end 83 to the latch tail 56 . a tail plate 84 is fixed to the inner end of the latch tail 56 transversely to the axis of the latch tail 56 . the guide block 64 is generally cube - shaped and has a pass - through opening 86 for slidably receiving the latch tail 56 . the sides of the base 88 of the guide block 64 are flat and slide against the side walls 24 , 26 of the case 22 for supporting linear movement of the latch tail 56 . the front surface of the base 88 of the guide block 64 serves as a retraction surface 89 . the spring clip 66 is an l - shaped piece , the longer leg 94 of the spring clip defining a circular opening 96 . the inner end 78 of the bolt head 54 has a transverse slot 92 for receiving the spring clip 66 and which intersects the axial latch tail bore 79 . two coil springs 98 are disposed in depressions 100 in a transverse channel 102 in the inner end of the bolt head 78 . in fig2 and 4 , the latch bolt is shown in an extended position in the mortise lock 20 with the bolt head 54 partially projecting from the opening 36 in the front wall 32 and face plate 44 . the latch tail 56 extends rearwardly from the bolt head 54 through a guide slot formed in a boss 104 fixedly mounted between the side walls 24 , 26 for guiding and supporting the linear reciprocal movement of the latch bolt . the spring clip 66 is disposed in the slot 92 in the bolt head 54 such that the opening 96 in the spring clip 66 aligns with the axial bore 79 in the bolt head 54 . the springs 98 under the shorter leg 95 of the spring clip 66 bias the spring clip 66 away from the bolt head 54 . as shown in fig4 the edge of the spring clip opening 96 fits into the groove 80 in the latch tail 56 . the bolt head 54 and latch tail 56 are thus secured to move together during normal operation of the mortise lock 20 . the coil spring 60 is held in compression between the bolt head 54 and the boss 104 for biasing the latch bolt outwardly to the extended position . as is conventional , the latch bolt is moveable in the openings in the front wall 32 of the case 22 and face plate 44 to the retracted position inside the case 22 by operation of a latch operator comprising either an inside or outside knob or lever handle or a cylinder lock ( not shown ). in the embodiment shown , retracting means comprises at least one rollback hub 120 rotatably mounted in the case 22 below the latch assembly 50 ( fig2 ). the hub 120 includes a square aperture 122 for non - rotatable connection to a spindle drive ( not shown ) connected to the knobs or lever handles for rotating the hub 120 . the hub 120 has an upwardly extending leg 124 . the upper portion of the leg 124 has a rearwardly facing bearing surface 130 for engaging the front retraction surface 89 of the guide block 64 . the latch bolt is retracted by rotating the hub 120 in a clockwise direction , as seen in fig2 . rotation of the hub 120 causes the bearing surface 130 to engage the retraction surface 89 of the guide block 64 to move the latch bolt linearly inward to the retracted position . a spring arm 126 is mounted transversely in the rear wall 34 of the case 22 . a coil spring 128 fits around the arm 126 and acts between the rear wall 34 and the hub 120 to urge the hub 120 toward engagement with the boss 104 for restoring the hub 120 to the neutral or home position , shown in fig2 when the latch operator is released . it is understood that the mortise lock assembly may have independent hubs to which inside and outside spindle drives are connected , respectively . in addition , the latch bolt automatically retracts when the anti - friction lever 58 and the beveled face 68 of the bolt head 54 engage the door frame or strike upon closing of the door . initially , the anti - friction lever 58 engages the door frame pivoting the anti - friction lever on the pin 72 in the bolt head 54 . as the anti - friction lever 58 pivots , the arm 76 works against the inner surface of the face plate 44 driving the latch bolt 52 rearward into the case 22 . when the latch operator is released , or the door is in the door frame , the coil spring 60 returns the latch bolt to the extended position . according to the present invention , the latch bolt is reversible for use with a door of the opposite hand . in order to reverse the latch bolt , it is necessary to disconnect the bolt head 54 from the latch tail 56 , rotate the bolt head 54 relative to the latch tail 56 and the lock case 22 , and reconnect the bolt head 54 to the latch tail 56 . this operation is shown in fig1 and 5 - 7 . the first step is to remove the face plate 44 , as seen in fig1 . next , the spring clip 66 is manually depressed by inserting a tool , such as a screw driver 108 , through an opening 106 in the cap side wall 24 . as seen in fig5 pressing on the spring clip 66 with a screw driver 108 pushes the spring clip 66 downwardly against the force of the springs 98 thereby aligning the opening 96 in the spring clip 66 and the axial bore 79 in the bolt head 54 freeing the latch tail 56 from the spring clip 66 for movement relative to the bolt head 54 . the bolt head 54 is then biased by the spring 60 outwardly of the case 22 through the opening 36 in the front wall 32 ( fig1 and 6 ). as bolt head 54 moves outward of the case 22 , the flange 95 on the spring clip 66 moves out from under the tip of the screwdriver 108 . this allows the spring clip 66 to snap outward of the bolt head 54 under the force of the springs 98 . as the bolt head 54 continues to move outward , the spring clip 66 advances along the tapered portion 82 of the latch tail 56 until the spring clip engages behind the disc - like outer end 83 of the latch tail 56 . in this position , only the inner cylindrical portion 78 of the bolt head 54 remains in the case 22 so that the bolt head 54 is free to rotate on the latch tail 56 . the bolt head 54 is rotated 180 ° ( fig1 and 6 ) and pushed back into the case 22 . fig7 shows the bolt head 54 during reinsertion into the case 22 along the latch tail 56 . since the outer end of the latch tail 56 is already in the axial bore 79 in the bolt head 54 , reinsertion of the bolt head 54 is guided by the latch tail 56 . as the bolt head 54 moves into the case 22 along the latch tail 56 , the edge of the opening 96 in the spring clip 66 engages and advances along the tapered portion 82 of the latch tail 56 forcing the spring clip 66 into the 92 ( as seen in fig7 ) against the force of the springs 98 . the bolt head 54 is advanced into the case 22 until the relative position of the bolt head 54 and latch tail 56 is such that the spring clip 66 is again received in the circumferential groove 80 in the latch tail 56 securing the bolt head 54 and latch tail 56 . the face plate 44 is replaced such that the arm 76 on the anti - friction latch 58 is behind the face plate 44 . it is understood that the spring clip 66 is now accessible through an opening 106 in the cap side wall 26 in the event that the user desires to reverse the described process and return the bolt head 54 to the prior position . it is understood that the embodiments of the inner portion 78 of the bolt head 54 and the spring clip 66 are exemplary and other structures are possible , as long as such other structures releasably hold the bolt head 54 and latch tail 56 for movement together and , when released , allows the bolt head 54 to move axially relative to the latch tail 56 and rotatably relative to the case 22 without disconnection from the latch tail 56 . other means for biasing the spring clip 66 to the position where the spring clip 66 partially blocks the axial bore 79 in the bolt head 54 are possible . for example , an alternative embodiment of the spring clip 66 for use in the latch assembly 50 of the present invention would replace the short leg of the l - shaped spring clip 66 with an angled tab extending from one edge of the clip . the spring clip tab would work against the surface of the inner end 78 of the bolt head 54 . this embodiment of the spring clip 66 could function without the coil springs 98 if the material of the spring clip 66 was flexible enough to allow the clip to be pushed down to clear the bolt head bore 79 . thus , we do not intend to limit ourselves to the specific embodiments of the bolt head and spring clip , or the spring clip biasing means , shown herein . the previously described embodiments of the present invention have many advantages , including the provision of a reversible mortise lock which cannot be tampered with after installation . the releasing mechanism of the latch assembly is only accessible through the side walls of the mortise lock case . therefore , latch bolt reversal must be performed before the lock is installed in the door . moreover , the latch bolt reversal does not require removal of the entire latch bolt from the case . the mortise lock incorporating the new latch assembly is easily modified for use with either a right - hand door or a left - hand door from outside of the lock casing with a screw driver . the latch assembly is simple to reverse in the field prior to installation in the door . although the present invention has been shown and described in considerable detail with respect to only a few exemplary embodiments thereof , it should be understood by those skilled in the art that we do not intend to limit the invention to the embodiments since various modifications , omissions and additions may be made to the disclosed embodiments without materially departing from the novel teachings and advantages of the invention , particularly in light of the foregoing teachings . for example , several means are possible for releasably securing the latch tail to the bolt head . accordingly , we intend to cover all such modifications , omission , additions and equivalents as may be included within the spirit and scope of the invention as defined by the following claims . in the claims , means - plus - function clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents but also equivalent structures . thus , although a nail and a screw may not be structural equivalents in that a nail employs a cylindrical surface to secure wooden parts together , whereas a screw employs a helical surface , in the environment of fastening wooden parts , a nail and a screw may be equivalent structures .
| 4 |
the following description should be read with reference to the drawings wherein like reference numerals indicate like elements throughout the several views . the drawings , which are not necessarily to scale , are not intended to limit the scope of the claimed invention . the detailed description and drawings illustrate example embodiments of the claimed invention . all numbers are herein assumed to be modified by the term “ about .” the recitation of numerical ranges by endpoints includes all numbers subsumed within that range ( e . g ., 1 to 5 includes 1 , 1 . 5 , 2 , 2 . 75 , 3 , 3 . 80 , 4 , and 5 ). as used in this specification and the appended claims , the singular forms “ a ”, “ an ”, and “ the ” include the plural referents unless the content clearly dictates otherwise . as used in this specification and the appended claims , the term “ or ” is generally employed in its sense including “ and / or ” unless the content clearly dictates otherwise . it is noted that references in the specification to “ an embodiment ”, “ some embodiments ”, “ other embodiments ”, etc ., indicate that the embodiment described may include a particular feature , structure , or characteristic , but every embodiment may not necessarily include the particular feature , structure , or characteristic . moreover , such phrases are not necessarily referring to the same embodiment . further , when a particular feature , structure , or characteristic is described in connection with an embodiment , it would be within the knowledge of one skilled in the art to effect such feature , structure , or characteristic in connection with other embodiments whether or not explicitly described unless cleared stated to the contrary . fig1 , illustrates a thermal suture cutting device comprising a first compression bead component 12 , a second compression bead component 14 , an electrically activated heating element 24 ; and a push rod 30 . compression bead components 12 , 14 form the distal end of suture cutting device and may be used to position and compress a plug of hemostatic material ( not shown ) adjacent to a vessel puncture . the first compression bead component 12 defines an opening 16 sized and adapted to sliding receive a suture 50 as well as passages for wires 20 and their insulation 22 . the first compression bead component 12 may be fixedly attached to a push rod 30 which also includes at least one lumen ( not shown ) for the suture 50 , and optionally additional lumens for wires 20 , and insulation 22 . in some embodiments , the push rod 30 and the first compression bead component 12 may be fabricated from a single piece . in other embodiments , the push rod 30 may be attached to the first compression bead component 12 by a coupling ( not shown ) which allows a minor amount of deflection therebetween . in yet other embodiments , insulation 22 may be omitted if the push rod 30 is formed from an insulating material . in some such embodiments , the wires 20 may be embedded directly in the material of the push rod 30 . second compression bead component 14 also defines an opening 18 sized and adapted to sliding receive the suture 50 . in some embodiments , opening 18 can also be sized and adapted to sealingly receive suture 50 . the sealing capability , if present , associated with opening 18 may be provided by sizing the opening 18 to lightly compress the suture 50 or may be provided by an elastomeric seal ( not shown ). in some embodiments the sealing capability may be provided by contact with a cinch button ( not shown ) associated with the suture 50 . in other embodiments the sealing capability may be provided by a pressure differential between the interior of the device and a fluid of a fluid environment surrounding the first and second compression bead components 12 , 14 . in yet other embodiments the sealing capability may result from a selection of material for one or both of the second compression bead components 12 , 14 and the suture such that surface tension of the fluid of the fluid environment substantially prevents the fluid of the fluid environment from entering the opening 18 . other sealing means may also be used . as illustrated in fig2 a and 2b , first compression bead component 12 and the second compression bead component 14 , in cooperation with suture 50 and any associated sealing elements ( not shown ), serve to define a chamber 60 within the space between the first and second compression bead components 12 , 14 , which remains substantially free of the fluid of the external fluid environment at least until the suture 50 has been cut by the electrically activated heating element 24 . electrically activated heating element 24 can be positioned within chamber 60 and proximate suture 50 . electrically activated heating element 24 , capable of generating a temperature within the chamber 60 greater than the melting temperature of the suture 50 to be cut , is connected to electrical leads , or wires 20 , which are connected to a source of electrical current sufficient to allow the electrically activated heating element to generate the temperature within the chamber 60 of greater than the melting temperature of the suture to be cut . the source of electrical current may include a switch 222 ( fig4 ) which is capable of connecting and / or disconnecting the source to the wires 20 and thence to the electrically activated heating element 24 such that when the switch is closed , a current flows through the electrically activated heating element 24 , heating at least a portion of the interior of the chamber 60 to a temperature greater than the melting temperature of the suture 50 to be cut , whereupon the suture 50 melts . in some embodiments melting of the suture 50 not only cuts the suture 50 , but may also result in the formation of a generally ball - shaped tip on the proximal end of the distal portion of the cut suture 50 which may serve as a mechanical stop to prevent the cinch button 120 ( fig4 ), to be discussed further herein , from being displaced when an associated hemostatic plug 100 ( fig4 ) expands . in those embodiments in which a ball - shaped tip is to be formed on the proximal end of the distal portion of the cut suture 50 , it may be desirable to employ a somewhat larger opening 18 to allow the ball - shaped tip to pass through . it will be understood that the terms “ cut ” and “ cutting ” as used in this disclosure broadly include related terms such as “ melting ”, “ breaking ”, “ brittle fracture ”, and the like which indicate that the suture 50 is severed thereby . similarly , the term “ suture ” should be broadly interpreted to include thread , string , monofilament materials , twisted multifilament materials , braided materials , and the like . the first and second compression bead components 12 , 14 may assume a number of geometries in addition to the non - limiting examples provided . for example , the second compression bead component 14 may take the form of an open cup , as illustrated in fig2 a , which mates with and partially surrounds first compression bead component 12 and the electrically activated heating element 24 . the first and second compression bead components 12 , 14 may form a frictional interference fit , may be bonded together by conventional means , or may be joined by additional joining and / or sealing members ( not shown ). in the embodiment illustrated in fig2 b , the arrangement of fig2 a is generally inverted such that the first compression bead component 12 is a distally facing cup which receives a second compression bead component 14 . as in fig2 a , first and second compression bead components 12 , 14 may form a frictional interference fit , may be bonded together by conventional means , or may be joined by additional joining and / or sealing members ( not shown ). in some such embodiments the second compression bead may be formed of a biodegradable material and may provide the function of and / or replace cinch button 120 . the first and second compression bead components 12 , 14 may desirably be formed from a material or materials which are not adversely affected by exposure to temperatures produced within chamber 60 by the electrically activated heating element 24 . for example , first and second compression bead components 12 , 14 may be formed from biocompatible metals and / or ceramics . the materials may be cast or machined to their final shapes . in those embodiments in which the second compression bead component 14 also serves as a cinch button 120 which remains after the suture is cut , it may be desirable for the fabrication material to be bioerodible or biodegradable as mentioned above . push rod 30 may be formed integrally with the first compression bead component 12 or may be formed separately and joined to the first compression bead component 12 in a later step . the attachment of the push rod 30 to the first compression bead component 12 may be permanent or temporary . temporary attachment may be desirable in embodiments in which the push rod 30 and an associated handle 200 ( fig4 ), to be discussed herein , are to be reused . push rod 30 may be rigid or it may be flexible to allow the thermal suture cutting device to better align with other devices with which it may be used . push rod 30 may be made from the same material as the first compression bead component 12 or it may be made from a different material . for example , the first compression bead component 12 may be made from a metal or ceramic to better resist damage from the heat produced within chamber 60 , while the push rod 30 may be made from a polymer for lighter weight and / or to impart somewhat greater flexibility . push rod 30 may have one or more partial or complete lumens 32 . the lumens 32 may accommodate the suture 50 , electrical leads , wires 22 , and optionally other devices . any of the lumens 32 may extend the entire length of the push rod 30 or may terminate along the shaft of the push rod 30 . for example , lumen 32 may terminate near the proximal end of push rod 30 to allow tension to be applied to the suture 50 prior to cutting and to allow the proximal portion of suture 50 to be removed following cutting to confirm that the cut has been successful with a well formed end . alternatively , lumen 32 may terminate near first compression bead component 12 to allow the suture 50 to lie alongside the exterior of push rod 30 which may allow for the use of a smaller and / or more flexible push rod 30 . similarly , electrical leads or wires 20 may be routed either within optional lumens 32 , with suture 50 in a single lumen 32 , or externally along push rod 30 . electrical leads or wires 20 may optionally be covered by insulation 22 and / or may be embedded in and / or insulated by the material of push rod 30 . one or more electrically activated heating element ( s ) 24 can be located within chamber 60 and proximate suture 50 . within the chamber 60 , one or more electrically activated heating element ( s ) 24 can be isolated from the thermal mass of components of the fluid environment outside of the thermal suture cutting device which isolation tends to minimize the energy which would otherwise be required to cut the suture 50 . in addition , isolation of the electrically activated heating element 24 from the fluid of the fluid environment outside of chamber 60 reduces the need for protective coatings or insulation on the electrically activated heating element 24 itself which further reduces the energy which would otherwise be required to cut the suture 50 . electrically activated heating element 24 may be fabricated from any of the high resistance materials commonly employed in electrically activated heating elements such as platinum , nichrome , nitinol , tungsten , thick film resistor or thermistor pastes , and the like . the electrically activated heating element ( s ) 24 may partially or completely surround the suture 50 to be cut although contact is not necessary and may not be desirable . an electrically activated heating element 24 may take any of a number of shapes such as those of the non - limiting examples of fig3 a , 3 b , and 3 c . it will be appreciated that additional mechanical features within chamber 60 may position or stress the suture to facilitate cutting by one or more electrically activated heating elements 24 . in some embodiments , such as that of fig3 b , the electrically activated heating element 24 may include mechanical positioning features such as arm 26 . other electrically activated heating elements 24 may take the form of coils , such as illustrated in fig3 c , sleeves , parallel bars , and the like . fig3 c also illustrates an alternate form of mounting the electrically activated heating element 24 in which bent portions of the heating element 24 engage recesses in the first compression bead component 12 . in some embodiments , thermomechanical components of the electrically activated heating element 24 may further serve to cut , melt , or otherwise disrupt the suture 50 . the devices of the present disclosure can have associated therewith a source ( not shown ) of electrical current capable of supplying sufficient current to the electrically activated heating element 24 to generate a temperature within chamber 60 greater than the melting temperature of the suture 50 to be cut . in alternate embodiments in which the thermally mediated cutting of suture 50 is supplemented by other means , a lesser temperature may suffice . for example , it may suffice to soften the suture 50 when the softened suture 50 is in contact with a displacing sharp edge . the source 220 of electrical current may include a battery , as illustrated in fig4 , or an external power supply . in some case , the source 220 may include circuitry to enhance the current which the device is capable of delivering in a short period of time . in addition , the source 220 of electrical current may include a switch 222 or other means of directly or indirectly controlling the flow of current . in some embodiments , a momentary contact switch 222 will allow manual activation of the electrically activated heating element 24 . in other embodiments , the momentary contact switch 222 may activate circuitry which allows current to flow for a specified length of time . in yet other embodiments , switch 222 may be activated by axial pressure applied to one or both of push rod 30 and first compression bead component 12 to ensure that the thermal suture cutting device is properly engaged with a proximal surface of a device to be secured by suture 50 . in some embodiments , the source 220 of current and / or switch 222 or other means of directly or indirectly controlling the flow of current may be housed in a handle 200 for convenient manipulation of the thermal suture cutting device . the handle 200 may be connected directly or indirectly to push rod 30 . fig4 illustrates an exemplary system for sealing a vascular puncture which includes handle 200 as well as additional elements of a conventional hemostatic plug 100 and anchor 110 system which may be secured in place by a suture 50 . in fig4 , elements 100 , 110 , and 120 are depicted as spread somewhat apart as they might be disposed prior to being urged toward each under the influence of thermal suture cutting device prior to cutting suture 50 proximal of cinch button 120 . anchor 110 may be positioned in a vessel having a puncture to be sealed such that the suture 50 extends through a plug of hemostatic material 100 and a cinch button 120 or other means of securing the combination of anchor 110 and hemostatic material 100 in their respective positions relative to the vessel wall . in prior art systems , the anchor 110 and hemostatic material 100 have been secured by tying a knot in the suture 50 proximal of the hemostatic material 100 with or without an element analogous to cinch button 120 . in systems including a cinch button 120 , the knot may be positioned proximal of cinch button 120 ) which serves to distribute forces generated as the hemostatic material 100 swells in response to contact with blood or other body fluids escaping from the vessel . the location of a knot or other securing means within a narrow tissue tract which may be filled with fluid tends to make tying and positioning the knot , as well as cutting the suture 50 adjacent to the knot or cinch button 120 difficult . further , slippage of the knot or tearing of the hemostatic material 100 may lead to undesirable failure of the vascular sealing system . in use , the system may be advanced within a sheath or simply advanced within a tissue tract adjacent to the punctured vessel . anchor 110 may be positioned within the vessel and tension applied to the suture 50 to seat the anchor 110 against the vessel wall . in some embodiments , anchor 110 may instead be present in another form such as a hook or hooks or even a simple stitch formed by the suture 50 . hemostatic material , often in the form of a gelatin sponge or pledget , may then be advanced along the suture 50 to a position adjacent to the puncture in the vessel wall . various means ( not shown ) may be used to ensure that the hemostatic material 100 is properly positioned relative to anchor 110 and / or the vessel wall . a cinch button 120 may be advanced along the suture 50 and positioned adjacent to hemostatic material 100 where it serves to distribute compressive forces applied by the thermal suture cutting device and / or by the hemostatic material 100 as it expands upon contact with blood or other body fluid . in some embodiments , second compression bead component 14 may provide the function of a cinch button . in such embodiments , the second compression bead component 14 may be formed of a biodegradable or bioerodible material . in either event , the thermal suture cutting device is advanced along the suture 50 to position and / or slightly compress hemostatic material 100 . this may be accomplished by advancing push rod 30 and / or handle 200 . it may be desirable to maintain tension on the suture 50 throughout the positioning and cutting processes . this may be accomplished manually by grasping the suture 50 after it exits thermal suture cutting device or additional apparatus ( not shown ) may apply tension to the suture 50 . when it has been determined that the hemostatic material 100 and the thermal suture cutting device are properly positioned , current may be passed through the electrically activated heating element 24 thereby heating a portion of suture 50 within chamber 60 as described above and cutting suture 50 . in some embodiments , cutting the suture may form a ball - shaped tip on the proximal end of the distal portion of the cut suture 50 which may serve as a mechanical stop to prevent the cinch button 120 , or second compression bead component 14 , from being displaced . the formation of a ball - shaped tip on the suture 50 may greatly increase the force required to displace the cinch button 120 from the suture . following cutting of suture 50 , the thermal suture cutting device and the proximal portion of suture 50 may be removed . although the illustrative examples described above relate to cutting a suture which is a component of a vascular sealing system is also contemplated that devices of this disclosure will be useful in cutting sutures , ribbons , or other similar materials submerged in other fluid environments . various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the scope and principles of this invention , and it should be understood that this invention is not to be unduly limited to the illustrative embodiments set forth hereinabove . all publications and patents are herein incorporated by reference to the same extent as if each individual publication or patent was specifically and individually indicated to be incorporated by reference .
| 0 |
example embodiments will now be described more fully with reference to the accompanying drawings . ( 1 ) the fuel cell gasket is characterized in that in the one - piece plate seal formed by integrating the gaskets on both faces in plates such as separators and end plates comprising the fuel cell , the through - hole in the plate and the injection - molding gate for the gasket are oval - shaped . ( 2 ) a circular shape is usually considered when a through - hole is provided on a plate . then , for the reasons , for example , that the molded gasket is set firmly on the top and bottom faces of the plate , and the sealing properties must be very reliable , the plate through - hole must be covered completely by the gasket . consequently , the gasket width is very much controlled by this through - hole part . in other words , in order to make the seal width small , it is necessary to find out how to make the gasket width in the through - hole section small . when this through - hole is circular in shape , φ ≧ 0 . 5 , preferably φ ≧ 0 . 8 . the through - holes are arranged , with spaces between them , so that the rubber material fills the cavities on both faces at the time of molding . then the injection gate is placed directly on top of the through - hole so that the plate is not deformed by the effects of the injection pressure , and additionally , so that the cavity faces on the side opposite the gate section are filled quickly . consequently , it is necessary to have the gate diameter smaller than the through - hole diameter so that plate deformation from injection does not occur . there are techniques available to make the gasket width smaller by making this through - hole and the injection gate smaller . however , when the molding properties of rubber are considered , although it also depends on the materials , it is necessary in the case of the circular shape to have the diameter of the injection gate φ ≧ 0 . 3 , preferably φ ≧ 0 . 4 . here , to solve these problems , the oval shape that is used does not decrease the opening area of the through - hole in this plate . by having the oval shape along the seal line of the gasket , the gasket part of the through - hole can be designed to be small . furthermore , the injection gate also has an oval shape similar to that of the through - hole , and has a shape about the same size as the through - hole , or somewhat smaller . the gasket can be made compact by the above means . ( 3 ) by forming the through - hole in the plate as an oval opening along the seal line , the width of the gasket can be designed to be small ; as the result , space - saving in the stack and increase in the power generation area can be anticipated . furthermore , by forming the injection gate similarly as an oval , plate deformation can be suppressed . next , practical examples of the present invention are explained according to the figures . fig1 shows the fuel cell constituent part relating to the first practical example of the present invention . further , fig2 shows the manufacturing method thereof . the fuel cell constituent part relating to said practical example comprises both the top and bottom faces of plate attachment part 1 , comprising separators , mea , or resin plates and the like , on which a pair of gaskets 2 , 2 , comprising rubber - type elastic bodies , are molded in one piece . the gaskets 2 , 2 comprise layout on the flat face of plate 1 , surrounding the power generation area of the fuel cell or the fluid manifold . in the cross - sectional view in fig1 a , the lengthwise direction of the gasket extends in the direction orthogonal to the paper face ; in the top view in fig1 b , the lengthwise direction extends in the up - and - down direction . furthermore , the pair of gaskets 2 , 2 mutually face each other from the top and the bottom , and are integrated with the seal lip 3 , having a cross - sectional mound shape and extending in the lengthwise direction of the gasket , and the flat side section 4 , located on both sides or on one side of seal lip 3 ( on both sides in the figure ), and at the same time , being lower in height to seal lip 3 . on the other hand , plate 1 , at the location where the member side sections 4 , 4 of the pair of gaskets 2 , 2 connect through , has a through - hole 5 that penetrates in the thickness direction ; one pair of gaskets 2 , 2 are mutually molded in one piece through this through - hole 5 . a plurality of through - holes 5 are provided with spacing along the lengthwise direction of gasket 2 . further , in said practical example , in particular , in order to make the width of the side section 4 as small as possible , the opening shape of through - hole 5 is set in a long shape in the lengthwise direction of the gasket ; in concrete terms , the lengthwise direction of the gasket is set by the elliptical shape ( oval shape ) that has the long axis positioned in the lengthwise direction of the gasket . in conjunction with this , the width w4 of the side section 4 is set to have the same width ( short axis ) w5 as this through - hole 5 , or otherwise , is set to be slightly larger than the width ( short axis ) w5 of through - hole 5 ( w4 ≧ w5 ). consequently , in the conventional comparison to the case where the opening shape was circular , because the width ( short axis ) w5 of the elliptical through - hole 5 is set to be smaller than the width ( diameter ) of the circular through - hole , the width w4 of the side section 4 can be set to be smaller than what it was heretofore . ( for example , when the width ( diameter ) of the circular through - hole is 0 . 8 mm , it is necessary to set the width w4 of the side section 4 to be 0 . 8 mm or greater . in contrast to this , when the width ( short axis ) w5 of the elliptical through - hole 5 is halved to 0 . 4 mm , the width w4 of the side section 4 can be set to be 0 . 4 mm or greater , but less than 0 . 8 mm , the width w4 of the side section 4 can be set to be smaller than what it was heretofore .) moreover , the width ( short axis ) of the elliptical through - hole 5 is set to be not greater than the width w4 of the side section 4 , but the length ( long axis ) l of the elliptical through - hole 5 is set to be larger than the width w4 of the side section 4 . as shown in fig2 a , the aforementioned gasket 2 is molded in the metal mold 11 by injection molding ; the metal mold 11 has as one piece , the space 15 for setting the plate on the parting section 14 for the plurality of partition molds 12 , 13 , and space 16 for molding one of the gaskets 2 , and space 17 for molding the other gasket 2 . on the other hand , input gate 18 for the molding material has its opening on the inside face of the space 16 for molding one of the gaskets 2 . as shown in fig2 b , the opening section 19 of this input gate 18 is located in the position directly on top of the through - hole 5 on plate 1 that is in a set state in space 15 and the flat face . moreover , the opening shape of the input gate is set in a long shape in the lengthwise direction of the gasket as in the case of through - hole 5 ; in concrete terms , it is set in an elliptical shape ( oval shape ) where the long axis is positioned in the lengthwise direction of the gasket , and is set to have an elliptical shape ( oval shape ) somewhat smaller than the opening shape of through - hole 5 . consequently , because the opening shape of the input gate is not crowded out at all on the flat face from the opening shape of through - hole 5 , by maintaining the opening area of the input gate 18 , it becomes possible to suppress the deformation of the periphery section of through - hole 5 on plate 1 from the effects of injection pressure at the time of molding . fig3 shows the fuel cell constituent part relating to the second practical example of the present invention . further , fig4 shows the manufacturing method thereof . the fuel cell constituent part relating to said practical example is provided with gasket attachment groove 6 , corresponding to both the top and bottom faces of plate attachment part 1 , comprising separators , etc . in this attachment groove 6 , a pair of gaskets 2 , 2 , comprising rubber - type elastic bodies , are molded in one piece . the attachment groove 6 and the gaskets 2 , 2 comprise layout on the flat face of plate 1 , surrounding the power generation area of the fuel cell or the fluid manifold . in the cross - sectional view in fig3 a , the lengthwise direction of the gasket extends in the direction orthogonal to the paper face ; in the top view in fig3 b , the lengthwise direction extends in the up - and - down direction . furthermore , the pair of gaskets 2 , 2 mutually face each other from the top and the bottom , and are integrated with the seal lip 3 , having a cross - sectional mound shape and extending in the lengthwise direction of the gasket , and the flat side section 4 , located on both sides or on one side of seal lip 3 ( on both sides in the figure ), and at the same time , being lower in height to seal lip 3 . moreover , groove depression 7 that extends in the lengthwise direction of the gasket is provided on the flat face of the side section 4 . on the other hand , plate 1 , in the bottom section of the attachment groove 6 , at the location where the member side sections 4 , 4 of the pair of gaskets 2 , 2 connect through , has a through - hole 5 that penetrates in the thickness direction ; one pair of gaskets 2 , 2 are mutually molded in one piece through this through - hole 5 . a plurality of through - holes 5 are provided with spacing along the lengthwise direction of gasket 2 . further , in said practical example , in particular , in order to make the width of one of the side sections 4 as small as possible , the opening shape of the through - hole 5 is set in a long shape in the lengthwise direction of the gasket ; in concrete terms , is set in an elliptical shape ( oval shape ) that has the long axis set in the lengthwise direction of the gasket . in conjunction with this , the width w4 of the side section 4 is set to be the same as the width ( short axis ) w5 of this through - hole 5 , or otherwise , is set to be somewhat larger than the width ( short axis ) w5 of through - hole 5 ( w4 ≧ w5 ). consequently , in the conventional comparison to the case where the opening shape is circular , because the width ( short axis ) w5 of the elliptical through - hole 5 is set to be smaller than the width ( diameter ) of the circular through - hole , the width w4 of the side section 4 can be set to be smaller than what it was heretofore . moreover , the width ( short axis ) of the elliptical through - hole 5 is set to be not greater than the width w4 of the side section 4 , but the length ( long axis ) l of the elliptical through - hole 5 is set to be greater than the width w4 of the side section 4 . moreover , the elliptical through - hole 5 is located in the position directly on top of the groove depression 7 , provided on top of the flat face on the side section 4 , and the flat face ; furthermore , the width ( short axis ) w5 of the through - hole 5 is set to be not greater than the width w7 of the groove depression 7 . as shown in fig4 a , the aforementioned gasket 2 is molded in the metal mold 11 by injection molding ; the metal mold 11 includes as one entity , the space 15 for setting the plate on the parting section 14 for the plurality of partition molds 12 , 13 , and space 16 for molding one of the gaskets 2 , and space 17 for molding the other gasket 2 . furthermore , the input gate 18 for the molding material has its opening on the inside face of the space 16 for molding one of the gaskets 2 . as shown in fig4 b , the opening section 19 of this input gate 18 is located in the space 15 in the position directly on top of the through - hole 5 on plate 1 that is in a set state , and the flat face . moreover , the opening shape of the input gate 18 is set in a long shape in the lengthwise direction of the gasket as in the case of through - hole 5 ; in concrete terms , it is set in an elliptical shape ( oval shape ) where the long axis is positioned in the lengthwise direction of the gasket , and is set to have an elliptical shape ( oval shape ) somewhat smaller than the opening shape of the through - hole 5 . consequently , because the opening shape of the input gate 18 is not crowded out at all on the flat face from the opening shape of the through - hole 5 , by maintaining the opening area of the input gate 18 , it becomes possible to suppress the deformation of the periphery section of through - hole 5 on plate 1 from the effects of injection pressure at the time of molding . fig5 shows the fuel cell constituent part relating to the third practical example of the present invention . the fuel cell constituent part relating to said practical example comprises the plate attachment part 1 , comprising separators , mea , and resin plates , etc ., wherein a pair of gaskets 2 , 2 , comprising rubber - type elastic bodies , are molded in one piece on both the top and bottom faces . the gaskets 2 , 2 comprise layout on the flat face of plate 1 , surrounding the power generation area of the fuel cell or the fluid manifold . in the cross - sectional view in fig5 b , the lengthwise direction of the gasket extends in the direction orthogonal to the paper face ; in the top view in fig5 c , the lengthwise direction extends in the up - and - down direction . furthermore , the pair of gaskets 2 , 2 mutually face each other from the top and the bottom , and are integrated with the seal lip 3 , having a cross - sectional mound shape and extending in the lengthwise direction of the gasket , and the flat side section 4 , located on both sides or on one side of seal lip 3 ( on both sides in the figure ), and at the same time , being lower in height to seal lip 3 . moreover , in one section in the lengthwise direction of the gasket , on one of the side sections 4 , the width expansion section ( also termed tongue section ) 8 is provided , that protrudes in a tongue - shape to expand the width of the side section 4 . on the other hand , plate 1 , at the location where the member side sections 4 , 4 of the pair of gaskets 2 , 2 connect through , has the through - hole 5 that penetrates in the thickness direction ; one pair of gaskets 2 , 2 are mutually molded in one piece through this through - hole 5 . a plurality of through - holes 5 are provided with spacing along the lengthwise direction of gasket 2 . further , in said practical example , in particular , in order to locate through - hole 5 at the position on top of width expansion section 8 and the flat face , and at the same time , to make the width of one of the side sections 4 , provided with this width expansion section 8 , as small as possible , the opening shape of through - hole 5 is set in a long shape in the lengthwise direction of the gasket ; in concrete terms , it is set in an elliptical shape ( oval shape ) that has the long axis positioned in the lengthwise direction of the gasket . in conjunction with this , the width w4 of one of the side sections 4 , containing the width expansion section 8 , is set to have the same width ( short axis ) w5 as this through - hole 5 , or otherwise , is set to have width larger than the width ( short axis ) w5 of through - hole 5 ( w4 ≧ w5 ). consequently , in the conventional comparison to the case where the opening shape is circular , because the width ( short axis ) w5 of the elliptical through - hole 5 is set to be smaller than the width ( diameter ) of the circular through - hole , the width w4 of the side section 4 can be set to be smaller than what it was heretofore . moreover , the width ( short axis ) w5 of the elliptical through - hole 5 is set to be not greater than the width w4 of the side section 4 containing the width expansion section 8 , but the length ( long axis ) l of the elliptical through - hole 5 is set to be greater than the width w4 of one of the side sections 4 , containing the width expansion section 8 . furthermore , although not pictured , the opening section 19 ( only this opening section 19 is shown in fig5 ), in the metal mold for molding the aforementioned gasket 2 , is located in the position directly on top of the through - hole 5 on plate 1 in a set state , and the flat face . moreover , the opening shape of the input gate is set in a long shape in the lengthwise direction of the gasket as in the case of through - hole 5 ; in concrete terms , it is set in an elliptical shape ( oval shape ) where the long axis is positioned in the lengthwise direction of the gasket , and is set to have an elliptical shape ( oval shape ) somewhat smaller than the opening shape of through - hole 5 . consequently , because the opening shape of the input gate is not crowded out at all on the flat face from the opening shape of through - hole 5 , by maintaining the opening area of the input gate , it becomes possible to suppress the deformation of the periphery section of through - hole 5 on plate 1 from the effects of injection pressure at the time of molding . moreover , the structure of said third practical example is particularly effective when the width w44 of the side section 4 that does not contain the width expansion section 8 is to be set extremely small . 1 plate attachment part 3 gasket 3 seal lip 4 side section 5 through - hole 6 gasket attachment groove 7 groove depression 8 width expansion section 11 metal mold 12 , 13 partition mold 14 parting section 15 , 16 , 17 space 18 input gate 19 opening section the foregoing description of the embodiments has been provided for purposes of illustration and description . it is not intended to be exhaustive or to limit the disclosure . individual elements or features of a particular embodiment are generally not limited to that particular embodiment , but , where applicable , are interchangeable and can be used in a selected embodiment , even if not specifically shown or described . the same may also be varied in many ways . such variations are not to be regarded as a departure from the disclosure , and all such modifications are intended to be included within the scope of the disclosure .
| 8 |
the following description of the preferred embodiment is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . that is , it should be understood that although the present invention is discussed in connection with robotic devices , the present invention might find utility in a wide variety of applications . briefly , by way of background , there are a number of desirable design criteria that ideally would be met in a commercially viable serpentine robot . serpentine robots are typically relatively long compared to their diameter , so that their lead segments can reach up and over a high step while still being able to fit through small openings . because of this geometric constraint , as well as other unique characteristics of serpentine robots , the following requirements can be derived ( in decreasing order of importance ). it is primarily desirable that a serpentine robot be able to compliantly conform to terrain , such that the maximum number of driving segments are in contact with the ground at any times to provide reliable propulsion . serpentine robots that do not conform compliantly often require complex sensor systems that measure contact forces and command a momentary angle for each non - compliant joint so as to force contact with the ground . such actively controlled compliance has not yet been successfully demonstrated , and may well be unfeasible for many years . additionally , it is often desirable that the stiffness of a joint may be selectively increased for specific applications , such as crossing a gap or reaching over an obstacle . while other times , it is necessary to adjust carefully the stiffness to an intermediate level , such as when the lead segment leans against a vertical wall while being pushed up that wall by the following segments . serpentine robots must thus be capable of adjusting the stiffness of every degree of freedom individually and proportionally . still further , it is desirable in serpentine robot applications that the joint angles be controllable proportionally to allow “ steering ” of the front segment with “ follow - the - leader ” control of all following segments . additionally , certain motion sequences , such as climbing over a step , require gradual or proportional control of all joint angles . it is also desirable that any actuators disposed between adjacent segments of the serpentine robot ( hereinafter “ joint actuators ”) be capable of developing sufficient force to lift at least two lead segments to the edge of a step in order to climb over it . this requirement is particularly difficult to meet in small - diameter serpentine robots because of the short moment arm available to an actuator applying a force in longitudinal direction . a further desired feature is that joint actuators take up as little space as possible , because space in a small - diameter serpentine robot is extremely limited . finally , it is desirable that energy consumption and weight of the joint actuators be minimized , because energy is a limited resource in an untethered mobile robot . weight minimization is a related requirement because it translates directly into a reduction in energy consumption . prior implementations of serpentine robots did not meet all of these requirements , mainly because no joint actuator existed that would meet these requirements . for that reason , many serpentine robots exist only in the form of research subjects but not as commercially viable products . there are many different ways of actuating joints in a mechanical structure . however , only a few of them can provide the range of motion and force required to actuate the joints of a serpentine robot . those actuators include electrical motors , hydraulic motors or actuators , and pneumatic actuators . of these , only pneumatic actuators are naturally compliant . the present invention recognizes this fact and employs pneumatic actuators . this realization , however , is far from trivial in that no other known serpentine robot employs pneumatic actuators . referring now to fig1 and 2 , an integrated joint actuator assembly 100 is illustrated in connection with a first embodiment ( fig1 ), generally indicated at 10 , having an elongated , flexible body and a coordinated millipede - type propulsion and a second embodiment ( fig2 ), generally indicated at 10 ′, having an elongated , flexible body , and a drive track propulsion system . the present invention is primarily related to the construction and operation of integrated joint actuator assembly 100 with apparatus 10 and apparatus 10 ′ or the like . it should be appreciated that apparatus 10 and apparatus 10 ′ are similar in construction to those described in detail in u . s . pat . no . 6 , 512 , 345 and u . s . patent application ser . no . 10 / 318 , 452 , which were incorporated herein . in the interest of brevity , only those areas in the present invention that differ will be discussed in detail herein . referring now to fig1 - 3 , apparatus 10 and apparatus 10 ′ are provided for traversing obstacles . each of these apparatuses includes a plurality of identical segments 12 , 12 ′. each of the plurality of segments 12 , 12 ′ includes a plurality of articulating leg mechanisms 14 ( fig1 ) or a plurality of drive track assemblies 14 ′ disposed about the periphery of each segment 12 , 12 ′. the plurality of articulating leg mechanisms 14 and the plurality of drive track assemblies 14 ′ are adapted to propel apparatus 10 and apparatus 10 ′, respectively . adjacent segments 12 , 12 ′ are joined together via integrated joint actuator assembly 100 and a drive shaft 16 . preferably , drive shaft 16 is a two - degree of freedom universal joint . however , it should be appreciated that drive shaft joints having higher or lower degrees - of - freedom may be used . as best seen in fig3 - 6 , integrated joint actuator assembly 100 generally includes preferably four inflatable , pressure - resistant , flexible , hollow bodies , similar in function to pneumatic bellows and hereafter referred to as bellows 102 . each closed end of bellows 102 is coupled between adjacent segments 12 , 12 ′ along walls 104 via a fastener 106 . fluid communication is established with each bellows 102 to permit selective inflation and deflation of bellows 102 for proper control of integrated joint actuator assembly 100 , which will be discussed below . it is preferred that bellows 102 are arranged in a general square - shaped orientation when viewed in cross - section ( fig5 ). however , it should be appreciated that any number of bellows may be used that provide adequate articulation control . it is believed that a description of the operation of integrated joint actuator assembly 100 will facilitate an understanding of its construction and method of use . with particular reference to fig4 and 6 , apparatus 10 ′ is illustrated employing integrated joint actuator assembly 100 . this arrangement is often useful for scaling or otherwise traversing a vertical obstacle 22 . to this end , the lifting of the first two segments 12 ′ ( hereinafter referred to as 12 ′ a and 12 ′ b ) relative to the remaining segments 12 ′ ( hereinafter referred collectively as 12 ′ c ) is often necessary . segment 12 ′ a and segment 12 ′ b are interconnected via integrated joint actuator assembly 100 a , which includes bellows 102 a , b and bellows 102 c , d . likewise , segment 12 ′ b and segment 12 ′ c are interconnected via integrated joint actuator assembly 100 b , which includes bellows 102 e , f and bellows 102 g , h . segment 12 ′ a has a weight generally indicated as wa and segment 12 ′ b has a weight generally indicated as wb . in order to accomplish this task , integrated joint actuator assembly 100 b inflated bellows 102 g , h and exhausts bellows 102 e , f . this creates a lifting moment m that must be sufficient to overcome the total reactive moment from the weight of each two segment 12 ′ a and 12 ′ b ( m react = l 1 w b + l 2 w a ). it should be understood that the apparatus of the present invention does not have a defined “ up ” or “ down ”; therefore it is intended to operate similarly from any orientation . additionally , it may be rotated on one of its edges ( as can be illustrated by rotating fig5 ° or 135 °). in such a case , only one single bellows would be necessary to contribute to the lifting moment m . in this case , the lever arm for producing this lifting moment would have length l , as shown in fig5 . the lifting moment produced by one bellows can be computed as : where a is the cross sectional area of the bellows , p is the air pressure inside the bellows , and d is the diameter of the bellows . it should be appreciated that for most serpentine robots , which are typically slender , the two geometric factors d and l are very limited . therefore , as eq . ( 1 ) suggests , the bellows &# 39 ; diameter d and the bellows &# 39 ; distance from the center l should be as large as possible to produce the largest lifting moment m needed to lift the two front segments 12 ′ a and 12 ′ b . furthermore , since the lifting moment m is proportional to d 2 , it is imperative that the diameter of the bellows be as large as possible . in order to select a desired bellows , a number of pneumatic actuators have been considered , specifically cylinders , bellows , and so - called mckibben pneumatic muscles . it is known that cylinders and bellows develop force in quadratic proportion to their diameter d . however , pneumatic muscles develop force in relation to their diameter and length . therefore , pneumatic muscles can produce an actuation force that is much larger than the force generated by a cylinder with the same diameter . however , a larger force requires greater length of the pneumatic muscle and the output force drops quickly as the pneumatic muscle contracts . the actuation force of bellows also drops with expansion , but not nearly as dramatically as that of mckibben pneumatic muscles . as a result their inherent geometric characteristics , cylinders and mckibben pneumatic muscles would have to be placed within segments 12 , 12 ′ to actuate the joint therebetween . accordingly , it is believed that the use of cylinders or mckibben pneumatic muscles would require excessive space within each segment 12 , 12 ′, thereby dramatically limiting the space available for the mechanical drive components , pneumatic valves , electronic components , and the like . in contrast to cylinders and mckibben pneumatic muscles , the present invention provides an ideal solution to these space constraints as it employs a plurality of large - diameter pneumatic actuators , bellows 102 , generally contained within the space between segments 102 , thereby maximizing the space available of other components . with particular reference to fig7 , it can be seen that in a flexed orientation ( see fig7 ( b )) there is very little room within the space between adjacent segments 12 , 12 ′ ( hereinafter referred to as joint space 108 ). additionally , as can be seen in fig7 ( a ) and 7 ( b ), this joint space 108 varies between a maximum space 108 a and a minimum space 108 b in response to joint angle . because of these variations , the largest rigid component that can be mounted in joint space 108 has to be limited in size to fit into minimum space 108 b . in practice , this means that a rigid actuator most likely cannot be used within joint space 108 due to the space requirements . in contrast to rigid components , bellows have the highly suitable property of taking up minimum space when deflated and maximum space when inflated . therefore , the bellows may be placed in joint space 108 without taking up any space within segments 12 , 12 ′. the location of bellows 102 in joint space 108 permits larger actuator diameters than what would be possible if the actuators had to be placed within a segment . as will be recalled , because the maximal actuation force is proportional to the square of the actuator diameter ( d 2 ) in bellows and cylinders , bellows - type actuators can produce a larger actuation force than cylinders . this comparison cannot be made with pneumatic muscles since the actuation force of pneumatic muscles is also dependent upon its length . however , as will be discussed , the stroke of pneumatic muscles is very limited . in most cylinder - type actuators , actuation strain is limited to less than 1 . 0 , because the piston and rod cannot move through a greater distance than one cylinder length . in pneumatic muscles , the actuation strain is about 0 . 3 , and in pneumatic bellows , the actuation strain can reach 4 . 0 . as is apparent from fig8 , bellows - type actuators have a slight advantage over cylinders and pneumatic muscles in terms of their actuation stress vs . actuation strain . this , together with the earlier discussed advantage of the placement of the bellows in joint space 108 allows for larger diameters and thus larger force , demonstrates that the present invention provides the best solution for force generation . although it is clear that pneumatic actuation , and especially bellows - type actuation is desirable over other methods , pneumatic systems require a source of compressed air , multiple valves , and control methods for those valves . the supply of compressed air is of particular concern for mobile robots — unless , of course , they are tethered . truly autonomous , untethered robots have to produce their own compressed air from very limited on - board resources , thus increasing weight , requiring space , and consuming power . traditionally pneumatic systems are designed for so - called pick - and - place operations . in these applications , the actuator moves from one end of its stroke to the other . compressed air consumption is limited to the amount of air used for performing the stroke . once the actuator reaches its desired end - point , no additional air is being consumed . such pick - and - place operation is too limited for the actuation of joints in serpentine robots . more advanced methods , which allow the proportional control of pneumatic actuators , were introduced in recent years . common to these proportional control methods is their continuing consumption of compressed air , both during motion and while remaining stationary . this is not a particular concern in conventional ( i . e ., industrial ) pneumatic systems where there is usually a local source of compressed air that can provide an unlimited supply of compressed air at little cost . however , for mobile robots requiring pneumatic actuation , these proportional control methods are not suitable . another conventional method of implementing proportional control pneumatic is based on the use of servo valves . while pneumatic servo valves can be very precise , they also tend to be heavy and bulky . they are thus more suitable for stationary manipulators than for mobile robots . for smaller mobile robots , much lighter and compact on - off valves are a more applicable solution . earlier solutions using on - off valves for implementing proportional control worked in a way that is similar to pulse width modulation ( pwm ) in electrical motors . that is , the valve rapidly moves between supplying and exhausting fluid . while rather good control is achieved this way , compressed air is continuously wasted even if the actuator is only holding but not moving . a reduction in air consumption may be achieved using a four - valve configuration , as shown in fig9 ( a ) and 9 ( b ), which closes the chambers of cylinder - type actuators in steady state and thereby preserves compressed air . however , in this configuration the stiffness of the joints was not controlled . in serpentine robots and certain other applications , stiffness must be controlled at all times . for example , when multiple segments of a serpentine robot span a gap , very high stiffness must be maintained , whereas when traveling across rugged terrain , minimal stiffness ( i . e . maximum compliance ) must be maintained . in order to provide proportional position control and proportional stiffness control , as well as zero - airflow at steady state , a novel proportional control system is provided as illustrated in fig1 , generally referred to as proportional position and stiffness controller 110 . proportional position and stiffness controller 110 can be represented by the following relationships : i — inertia , q — joint &# 39 ; s position , τ p = la ( p 1 − p 2 )— pneumatic torque , l — force arm as shown in fig5 , p 1 , p 2 — pressures in opposite bellows , τ s — spring - like torque , τ — load torque , a — bellows cross section area , s — reference stiffness of the joint , g = r k t m . = p . v + k p v . + k p v e p + k d v e . p d = g d p a s p s - p if g & gt ; 0 d = g - d p a e p if g & lt ; 0 ( 3 ) where dp represents the period of the pulse width modulation controller and d represents the length of a pulse in the pulse width modulated controller . four different signals d 1 . . . d 4 control appropriate valves according to fig9 . d is always a fraction of dp . additionally , ep represents the pressure error and k represents the proportional coefficient . the coefficients as = 68 and ae =− 72 were estimated using experimental data and a least square fit . with particular reference to fig1 ( a ) and 11 ( b ), experimental results are illustrated in which a pair of pneumatic bellows is controlled using a conventional proportional pneumatic control system ( fig1 ( a )) and proportional position and stiffness controller 110 ( fig1 ( b )) to move a joint in a sinusoidal fashion , for two full periods . as can be seen in fig1 ( a ), the absence of stiffness control in the conventional proportional pneumatic control system causes the stiffness of the bellows to vary arbitrarily as a function of position . fig1 ( b ) illustrates how proportional position and stiffness controller 110 maintains a near - constant stiffness of 20 % ( as was commanded in this example ). according to the present invention , stiffness may also be varied if desired throughout a full range of 0 %- 100 % under computer control . as can be seen from the lower air flowrate curve of fig1 ( a ) and 11 ( b ), the air consumption of the present invention is lower than that of the conventional proportional pneumatic control system as is shown by the concentration of flowrate data at a lower position on the flowrate graphs . in this particular example , proportional position and stiffness controller 110 of the present invention reduced airflow by a factor of two over the conventional proportional controller . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .
| 1 |
referring first to fig1 there is shown a component kit 10 comprising a sterile package 12 containing an incontinence prevention device 14 , a deployment base member 16 , a deployment tube 18 and a pusher plunger 20 . the kit may also conveniently contain a supply of a gel lubricant ( not shown ). following the sealing of the kit components in the package 12 , the package is subjected to a sterilization operation such as by subjecting the package to gamma radiation in a manner well known in the art or by introducing a sterilant such as ethylene oxide into the package . the incontinence prevention device 14 may be made in accordance with the teachings of my patent 6 , 311 , 689b1 , which is hereby incorporated by reference . it need not , however , have a stylet lumen therein . the device comprises an elongated , soft , elastomeric shaft 24 having an enlarged closed loop 26 , also formed from a soft elastomeric material preferably silicone rubber , affixed to the distal end of the shaft 24 . a proximal retention member 28 in the form of a wing - like projections , also of a soft material that is configured to conform to the vestibule proximate the urethral opening is disposed on a proximal end of the shaft 24 . those desiring more detailed information on the size and shape configuration of the incontinence prevention device 14 may derive same from a reading of the aforereferenced &# 39 ; 689 patent . as will be explained in greater - detail hereinbelow , the device 14 may be self - inserted into the urethra by a female subject by first loading the device 14 into the deployment tube 18 in a manner yet to be described and then positioning the distal end of the delivery tube proximate the urethral meatus and expelling the device 14 from the deployment tube 18 using the deployment plunger 20 as a pusher device . because the retention loop 26 of the device 14 can , with time , take on a permanent set if packaged with the device 14 already contained within the lumen of the deployment tube 18 , it is a feature that the placement of the incontinence prevention device 14 within the deployment tube can be achieved only a relatively short time prior to use of the deployment device to insure that the retention loop 26 will fully expand to its open - loop shape once the loop enters the urinary bladder where it is unconstrained either by the delivery tube 18 or the urethra . it is also important to insure that the device 14 remains sterile and that it does not come in contact with the subject &# 39 ; s fingers during the insertion process . the delivery kit 10 of the present invention assures these results . referring next to fig2 there is shown a side elevation view of the deployment base member 16 of fig1 . in the preferred embodiment , it comprises a finger grip element 30 which may be somewhat semi - circular in shape and having a recessed central portion 32 defined by a peripheral wall 34 . having this shape allows the device 16 to be readily gripped between the thumb and forefinger of a user &# 39 ; s hand . projecting longitudinally from a base 36 of the finger grip element 30 is a longitudinally extending rod 38 having an integrally molded , l - shaped hook as a device engagement element 40 formed at the distal end thereof . in accordance with the embodiment of fig2 the deployment base member 16 further includes a second rigid , longitudinally - extending , rail 42 that has an integrally molded stop member 44 at its distal end . the rail 42 preferably has a somewhat i - shaped cross - section , as best seen in the cross - sectional view of fig3 . the length of the rail 42 is greater than that of the first rigid rod 38 by a predetermined amount . without limitation , the length of the first rod 38 may be approximately 92 . 75 mm and the length of the rod 42 may be 107 . 25 mm . referring now to fig4 it shows a perspective view of the deployment tube 18 of the kit 10 . tube 18 has a distal end 44 and a proximal end 46 with a lumen 48 extending therebetween . integrally formed with and projecting perpendicularly to the longitudinal axis of the tube 18 at its distal end 44 is an insertion limit 50 . the lower end of the insertion limit member 50 includes a t - shaped notch 52 . it is dimensioned to engage the guide rail 42 comprising the second rod of the deployment base member 16 when the first rod 38 of the deployment base member 16 is disposed within the lumen 48 of the deployment tube 18 . the lumen 48 has a shape to accept the rigid rod 38 therein with sufficient clearance to permit the tube to slide relative to the road 38 . opposed sidewall surfaces of the tube 18 may be slightly indented as at 54 and these surfaces are preferably knurled to facilitate gripping thereof by the user . to facilitate entry of the retention loop 26 of the incontinence device 14 into the deployment tube 18 , it has been found expedient to provide a flared or oval opening on the proximal end of the deployment tube where the opening has a chamfered edge 49 . this shape on the distal end of the deployment tube causes the retention loop 26 to compress into two contiguous parallel , rectilinear segments as it is being drawn by the hook - shaped device engagement element 40 into the lumen 48 of the deployment tube . further , the lumen of the deployment tube may also be of an oval cross - section throughout its length or may transition to a circular cross - section at a predetermined point along the length thereof as reflected in fig4 . the cross - sectional view of fig5 shows the deployment tube 18 in surrounding relationship to the first rod 38 of the deployment base member 16 . here it can be seen how the t - shaped notch 52 on the retention limit member 50 engages the guide rail 42 . also visible in the view of fig5 is the fact that the length of the deployment tube 18 is slightly less than the length of the first rod 38 such that the hook - shaped engagement element 40 extends outward from the distal end 46 of the deployment tube . in loading the incontinence device 14 into the deployment tube 18 , the device comes packaged with the loop 25 , fitted over the hook - shaped element 40 in the space between the element 40 and the proximal end 46 of the deployment tube . that is to say , the kit comes with the loop 26 encircling the l - shaped hook element 40 , thus obviating the need for the users to touch the sterilized device 14 . now , when the finger grip 30 is grasped between the thumb and foregoing of the user &# 39 ; s one hand and the thumb and forefinger of the other hand are placed on the surfaces 54 of the deployment tube , the deployment tube may be slid in the distal direction causing the retention loop to be drawn into the lumen 48 of the deployment tube as the retention limit 50 slides along the i - shaped guide rail 42 of the base member 16 . the deployment tube is slid in the distal direction until the retention limit member 50 comes into abutment with the stop member 44 on the rail 42 , at which point only a predetermined portion of the retention loop 26 will extend out beyond the distal end of the deployment tube 18 , given the difference in length of the cylindrical rod 38 and the guide rail 42 . the extending portion is still maintained rectilinear in that the remainder of the loop is still constrained by the wall of the deployment tube . the described incontinence device loading system also assures proper orientation of the loop as it expands upon entry into the bladder . with the aid of the l - shaped hook , the loop exits the lumen of the deployment tube in the same orientation as it had upon entry into the proximal end of the tube . because the guide rail 42 has its upper flange notched , as at 56 , when the retention limit member 50 reaches the stop 44 , the guide tube with the incontinence prevention device contained therein can be lifted free of rail 42 of the deployment base member 16 . next , the portion of the retention loop projecting outward from the distal end of the deployment tube can be dipped into a sterile lubricating gel which may come with the kit and the user will next insert the distal end 58 of the plunger 20 ( fig6 ) into the lumen 48 at the proximal end 46 thereof and will then insert the protruding portion of the retention loop into the urethral meatus until the insertion limit member 50 is brought into contact with the subject &# 39 ; s vestibule . the insertion limit member 50 is sufficiently large to prevent the deployment tube from passing through the meatus . now , by depressing the finger rest 60 of the plunger 20 , the incontinence prevention device is forced out from the deployment tube 18 and through the urethra until the finger rest 60 of the plunger abuts the end 46 of the deployment tube as shown in fig7 . the length of the plunger is judiciously chosen such that when fully inserted , the retention loop will be disposed within the subject urinary bladder where it can expand to its open loop shape for nesting in the bladder neck . the deployment base member , deployment tube and pusher may be molded from a suitable medical grade plastic , such as abs , but limitation to this material is not to be inferred . [ 0035 ] fig8 illustrates an alternative embodiment of the deployment device of the present invention . here , the deployment base member includes only a single longitudinally extending rod 70 that is affixed to and projects from the finger grip member 72 . fitted over the rod 70 is a deployment tube 74 that has a stop member 76 at a distal end thereof . the rod 70 terminates in a hook 78 that extends outwardly beyond the distal end 80 of the deployment tube 74 when the stop 76 is in abutment with the base of the finger grip member 72 . an incontinence prevention device of the type already described is shown with its retention loop 26 looped over the hook 78 . the configuration shown in fig8 would be packaged in a sterile container with the hook 78 engaging the loop 26 . when removed by the user from the sterile package , she would grasp the finger grip 72 between the thumb and forefinger of one hand and the deployment tube 74 between the thumb and forefinger of the other hand and then slide the deployment tube 74 to the right as shown in fig8 drawing the retention loop 26 and the stem 14 into the deployment tube 74 . instructions with the device would advise the user to uncouple the hook from the loop once a portion of the loop , approximately 15 mm in length , is projecting from the distal end of the deployment tube . as before , the projecting portion of the loop remains collapsed and rectilinear . it would be dipped in a lubricant and the deployment tube positioned such that the lubricated tip of the retention loop is inserted into the urethral meatus and the stop 76 abuts the user &# 39 ; s vestibule . a pusher , like that shown in fig6 is again used to move the incontinence prevention device out of the deployment tube and through the urethra until the retention loop 26 enters the urinary bladder and expands to its open loop configuration . this invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be understood that the invention can be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment and operating procedures , can be accomplished without departing from the scope of the invention itself . for example , a piece of string could be substituted for the deployment base member hook where the string loops through the retention loop of the incontinence prevention device and through the lumen of the deployment tube . immediately prior to deployment , by pulling on the string , the incontinence prevention device will be drawn into and through the deployment tube with a portion of the retention loop extending beyond the end of the deployment tube as earlier described .
| 8 |
referring now to the drawings wherein like reference numerals are used to designate like or corresponding parts throughout the various figures thereof , there is shown in fig1 and 2 the nut and snap ring position locking device 100 of the present invention installed on a short length of round threaded shaft 12 having external threads 14 , an axial keyway 16 of rectangular cross section , and ends 18 . the position locking device 100 consists of two separate parts , a nut 20 and a snap ring 50 . the nut 20 illustrated herein is of conventional proportions for regular hex nuts , having six equally spaced nut flats 22 and six nut points 24 symmetrically located about the axis of the nut internal thread 40 , and a proximate nut face 26 and a distal nut face 27 each perpendicular to said axis ( although obviously the invention can be practiced with nuts of unconventional proportions ). a circumferential groove 28 of rectangualr cross section , having a cylindrical groove bottom surface 30 and a proximate groove wall surface 32 and a distal groove wall surface 34 , extends around the nut 20 in a plane perpendicular to the axis of the internal thread 40 ; the cylindrical groove bottom surface 30 is concentric with the axis of the internal thread 40 . the groove bottom surface 30 should be sufficiently deep so that the groove walls 32 and 34 can engage with and thus provide axial support for snap ring 50 , as illustrated in fig1 , 3 , and 4 . parallel - walled flat - bottomed radial slots 36 having a cross - section including parallel side walls 38 and a flat bottom 39 perpendicular thereto ( of a simple rectangular cross section as illustrated in fig1 and 2 , or alternatively of a &# 34 ; t &# 34 ; cross section having two additional parallel slot stem walls 42 as illustrated in fig7 and 8 ) extend radially outward from the axis of the internal thread 40 across the proximate nut face 26 , in a manner similar to the slots of a conventional castellated nut . four radial slots 36 , equally spaced about the axis of the internal thread 40 , are illustrated for the preferred embodiment ( although obviously other numbers or spacing arrangements could be used ). the radial slots are of a sufficient depth such that they intersect and extend into the circumferential slot 28 ( thus breaking up the continuity of the cylindrical groove bottom surface 30 and the proximate groove wall 32 ). the preferred slot depth tolerances for radial slots 36 having the simple rectangular cross section should be such that the radial slots 36 extend to or through ( but do not stop short of ) the distal circumferential groove wall 34 , as illustrated in fig1 and 2 . the preferred slot depth tolerances for radial slots 36 having the &# 34 ; t &# 34 ; cross section should be such that the entire portion of slot 36 bounded by walls 38 ( i . e ., the wider portion ) should lie between ( but not extend beyond ) the proximate 32 and the distal 34 circumferential groove walls , as illustrated in fig8 . the nut 20 can be made from metals ( e . g ., steel or brass ) or plastics ( e . g ., nylon ) or other materials suitable for an intended use ; for most applications mild steel will be the preferred nut material . the snap ring 50 illustrated herein has a general configuration similar to that of commercially available snap rings designed for radial insertion into shaft grooves ( for example , the snap ring sold by waldes kohinoor , inc ., under the trademark truarc series 5103 crescent retaining ring ), except that the snap ring 50 has an additional feature of an elongated central tang 68 . the snap ring 50 is of flat planar construction of generally semi - circular shape , symmetric about a central base region 52 , having two symmetrically - opposed inwardly - curving arms 58 extending outward from the base region 52 and one straight tang 68 centered between the arms 58 and extending from the central base region 52 in the direction toward the arm tips 60 . each arm 58 has an arm base region 56 and a rounded - off arm tip 60 . the tang has a tang base region 62 and either a tang tip 70 that is flat as shown in fig1 or a tang tip 70 having a sharp pointed edge 72 ( disposed to dig into the sides of adjacent external screw threads ) as shown in fig1 . a generous fillet radius 54 exists at the junction of each arm base region 56 with the tang base region 62 , necessitated by the high bending stresses which occur when the arm tips 60 are forced over the groove bottom surface 30 in nut 20 . the shape of snap ring 50 is influenced by the requirement that the arm tips 60 grip the groove bottom surface 30 in nut 20 when the tang tip 70 is fully seated ( fully seated in a shaft axial groove 16 or fully seated between adjacent shaft external threads 14 , depending upon the application ). for the preferred snap ring shape ( as illustrated in fig1 ) each arm tip contacts the nut groove bottom surface 30 at an angular position ( with respect to the axis of the nut internal thread 40 ) of approximately 105 degrees from the middle of the radial slot 36 in which the tang 68 is inserted , this particular arrangement being influenced by the number and location of the radial slots 36 and by the amount of elastic deformation the arms 58 can accommodate in being forced over the groove bottom surface 30 . for most applications the preferred material for the snap ring 50 will be a high strength spring steel ; for non - magnetic applications a beryllium - copper alloy would be practical . other materials that are suitable for efficient use as spring materials could also be used , depending upon the requirements of the application ( for example , aluminum alloy 7075 - t6 or even a plastic such as nylon ). the thickness of the snap ring 50 can vary depending upon the application . care must be taken to avoid making the snap rings too thin ( for example , if the thickness were chosen as a result of simple tang shear stress calculations ), as the tang 68 can also fail by bending in the axial direction ( i . e ., bending of the tang in the direction along keyway 16 toward the proximate nut face 26 ) and by twisting ( about the ring 50 axis of symmetry ). for those snap rings 50 having short tangs 68 ( as shown in fig9 , and 11 ) disposed to bear against shaft exterior threads 14 the preferred ring thickness should be approximately one - half of the distance between the points of adjacent threads , which will allow the tip 70 of the tang 68 to engage facing surfaces of external thread 14 ( as shown in cross - section in fig1 ). for example , the thickness for a snap ring to be used with a nominally one inch diameter shaft having a 1 - 8unc thread would be 0 . 062 inches ; the same thickness could also be used for the long tang ring so that different nuts would not be needed for applications with and without keyways on the same size threaded shaft . the tang width should be such that it has enough clearance to freely slip into a shaft having a standard width rectangular axial keyway , which usually has a width of about one - fourth of the shaft diameter . the preferred width of the nut radial slots should be a close but still free fit with the snap ring tang . the version of the snap ring 50 shown in fig5 and 6 has a wide stepped tang base region 64 having step surfaces 66 located where the tang 68 abruptly steps down in width ; this provides more ring area for engaging with the nut groove 28 near the ring central base region 52 when used with a version of nut 20 having simple rectangular radial slots 36 . the t - slot version of nut radial slots 36 ( shown in fig7 and 8 ) provides support for the tang 68 over a longer length than the simple rectangular slot version , and is the preferred radial slot design for heavy duty applications . although the above description contains many specificities these should not be construed as limiting the scope of the invention , to which variations and improvements may be made by those skilled in the art without departing from the scope of protection of the present patent and true spirit of the invention , but rather as exemplifications of preferred embodiments thereof . for example , a variation could be making the cross - section of the groove bottom surface 30 ( of the circumferential groove 28 in the nut 20 ) in the shape of a regular polygon rather than in the shape of a circle , with a complementary modification of the snap ring 50 shape to suit . accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents .
| 8 |
the seating module — or seat — according to the invention essentially includes a structural framework 10 , a fork - shaped frame 12 , a hinge 14 connecting , in a jointed manner , structural framework 10 and fork 12 , and an elastic membrane 16 , visible only in fig3 and 4 . the seat has a symmetrical structure with reference to a vertical plane passing through lines ii - ii of fig1 and 3 . more specifically , structural framework 10 , in plane , has a t - shape the vertical bar 18 of which , placed in axis ii - ii , extends forwards and is bent upwards to end in a pommel element 20 . the ends 22 a of arms 22 of the t , perpendicular to the axis , are raised and pierced with a hole that is not visible in the drawing . structural framework 10 has a central portion 24 provided with holes 24 a allowing the seat to be fixed onto a support , as will be explained hereinafter . in plane , fork 12 has a u - shape of axis ii - ii . its cross bar 26 , which is slightly raised and bent , acts as cantle element and its two teeth 28 extend forwards substantially as far as pommel element 20 , a few centimeters underneath it . it will be noted that , in the seat rest position , shown in the drawing , the tip of cantle element 26 is located at substantially the same height as pommel element 20 , and that fork 12 is inclined forwards by an angle of approximately 10 ° in relation to the ground . teeth 28 of the fork are provided , substantially in their middle , with a lug 30 a extending downward , each adjacent to one end 22 a of the structural framework and provided with a coaxial hole . bearings engaged in these holes and rods , engaged in the bearings , form hinge 14 , which thus enables fork 12 to be pivoted in relation to structural framework 10 about an axis a - a . advantageously , structural framework 10 and fork 12 are respectively made of aluminum and steel . firstly , between pommel element 20 and cantle element 26 ; secondly , between the two teeth 28 of fork 12 ; and thirdly , between the ends of teeth 28 and pommel element 20 . membrane 16 can be made of any elastic material , for example pvc , in the form of a fabric , as shown in fig3 and 4 , or film , in one piece or in strips . in the latter case , a first set of strips 16 a connects pommel element 20 to cantle element 26 , a second set 16 b connects the two teeth 28 to each other , this second set covering the first , and a third set 16 c connects the ends of teeth 28 to pommel element 20 . because of the shape of fork 12 and the position of pommel element 20 , membrane 16 has a horse - saddle shape , with a concavity between cantle element 26 and pommel element 20 and a convexity between the two teeth 28 . owing to these features , the function of membrane 16 is to : define the rest position of fork 12 in relation to structural framework 10 , the position taken when no - one is sitting on the seat , and return fork 12 to this rest position when the person who has tilted the seat forwards or backwards leaves it . as can be seen in fig4 , the seat according to the invention can advantageously be completed by a padding member 32 , forming a cushion , totally covering membrane 16 and permanently or removably fixed to the latter . this padding member can be formed by a fabric envelope containing an elastic filling or formed of a gel . advantageously , it is provided with a longitudinal groove 34 extending over the entire length of the cushion . consequently , the coccyx of the person occupying the seat is not compressed , which improves comfort and prevents certain damage , particularly as regards the vertebral column . fig5 shows that the seating module previously described is for fitting to a chair formed of a support 36 , which includes , in a known manner , a telescopic central column 38 and feet 40 disposed radially , each provided with a roller 42 . column 38 has , at its top end , a seating module 44 according to the invention , which is fixed by its structural framework 10 . such a chair , thus forming a stool , can advantageously be used by people essentially working in an “ active ” position , for example a dentist or a watchmaker . it can be completed , as shown in this figure , by a backrest 46 fixed to cantle element 26 and allowing a “ passive ” position to be taken . when the user frequently works in the “ active ” position , it is advantageous to provide the chair with a transverse support bar 48 for the knees , advantageously padded and covered with a fabric or leather , so that contact is comfortable . this bar is fixed to support 36 , permanently or removably , by means of an arm 50 . the latter has a roller 42 and is advantageously connected to support 36 so as to pivot or slide , so that it can be removed when the user often has to leave his chair . it should be stressed that the pressure of the knees against bar 46 is slight . the latter thus barely participates in the seating of the user . however , it prevents him crossing his legs , and thus , certain annoyances associated with this habit . as can be seen in fig5 , arm 50 is fixed to support 36 in proximity to feet 40 , i . e . very close to the ground . consequently , it does not interfere , or barely interferes , with movement when the user occupies his chair or leaves it . finally , in a very advantageous manner , seating module 44 can be jointed on column 38 owing to a conventional adjustable chair tilting mechanism 52 provided with an armrest 54 . owing to the construction described , when the user sits down to get into the “ active ” position , he finds seat 44 automatically placed in the rest position corresponding to maximum comfort , i . e . with the femoral articulation at right angles to joint 14 . if the user leans forwards , fork 12 accompanies his movement , allowing him to adjust his posture in a self - supporting process , which contributes to reinforcing the supporting musculature and thus tends to reduce the risk of health problems , as mentioned hereinbefore . when , in order to think or make a telephone call , the user gets into a “ passive ” position against backrest 46 , fork 12 tilt backwards , such that he finds himself in a posture in which his entire musculature is resting . this automatic adjustment provides optimum comfort due to the fact that the user &# 39 ; s weight is distributed very uniformly over the buttocks and the back of the thighs . in other words , in the “ active ” position , the chair according to the invention allows adjustments in posture facilitating the work of the self - supporting muscles , whereas in the “ passive ” position , these muscles can relax . both the seating module and the chairs described hereinbefore can be subject to numerous variants . it is , for example , possible to provide adjusting members , and more particularly , stops ( not shown ) limiting , on both sides , the tilting movement of fork 12 on structural framework 10 . pommel element 20 can also be provided with means for altering its position with reference to structural framework 10 . an asymmetrical structure can also be envisaged , for a handicapped user , either at padding member 32 , or in the form of cantle element 26 . the hinged connection , via hinge 14 , between structural framework 10 and fork 12 , can be achieved by means of a ball joint . in this case , the self - supporting mechanism would operate both from front to back and from the side . the position of hinge 14 can also advantageously be adjustable in the forward - backward direction , such that it is perfectly aligned on the ischium when the user is seated . other adjusting means are possible for varying the distance between pommel element 20 and cantle element 26 , in order to adjust the tension of elastic membrane 16 . seat 44 is advantageously fixed to support 36 by its structural framework 10 . it is also possible to envisage fixing via cantle element 26 itself . the spring function performed by elastic membrane 16 can also be reinforced by springs especially arranged for this purpose , for example , torsion , traction or compression springs . it will be noted , finally , that it may be advantageous to provide backrest 46 with an independent permanent contact lumbar support zone that can be disconnected .
| 0 |
referring to fig1 - 3 , a portable machine tool 100 having a geared motor 111 mounted on a magnetic base 112 is illustrated . a fluid reservoir 102 is attached to the portable machine tool 100 above the magnetic base 112 . a hose extends from the reservoir 102 to the arbor 115 to provide fluid flow to the cutting tool . the reservoir 102 is selectively moveable and repositionable to allow gravity - fed coolant flow to the cutting tool when the portable machine tool 100 is any position . more specifically , the preferred embodiment discloses a gravity - feed liquid delivery system 200 for a machine tool 100 . in the preferred embodiment , where the machine tool 100 is a portable drilling machine 100 , it may be advantageous to drill horizontally or any position in which the arbor 115 is level to or at a higher elevation than the reservoir 102 . in such instances , the removable reservoir 102 is moved from a first position on the portable power tool 100 to a second position remote from the portable power tool 100 . when the removable reservoir 102 is at its second position and elevated higher than the portable power tool 100 , the gravity - feed liquid delivery system 200 continues to deliver coolant or lubricant to the drilling surface . referring to fig3 a and 3 b where the drill 100 is in the horizontal drilling position , the reservoir 102 includes an attachment mechanism 201 to hold the reservoir 102 in its second position remote from the machine tool 100 . in the preferred embodiment and better illustrated in fig4 a - 4 d , the attachment mechanism 201 is a magnet 201 ; however , in alternative embodiments , the attachment mechanism 201 may include , but not limited to , a hook ( as shown in fig7 ), an adhesive material ( as shown in fig8 ), or manually held by an operator at the second position . in an alternative embodiment , a moveable member ( not shown ) combines the machine tool 100 with the reservoir 102 . the moveable member pivots outward from the machine tool 100 thereby moving the reservoir to a second position remote from the machine tool 100 . more specifically , the moveable member may be a plate that is pivotally attached to the machine tool 100 with the reservoir 102 attached thereon . the moveable member pivots outward and upward to position the reservoir 102 in a second position remote from the machine tool 100 when the machine tool 100 is in a horizontal drilling position . in the second position , the reservoir is elevated higher than the machine tool 100 and the force of gravity supplies liquid to the cutting surface . referring back to fig4 a - 4 d , the reservoir 102 is more specifically described . substantially near the bottom of the reservoir 102 is an outlet port 204 . a fitting 203 combines the outlet port 204 to a hose 104 or , alternatively , a valve 113 is disposed in the outlet port 204 of the reservoir 102 . the outlet port 204 is positioned to allow free flow of liquid out of the reservoir 102 and in to the hose 104 . if the valve 113 is used , the valve 113 provides controlled fluid flow from the reservoir 102 . obviously , however , the valve 113 can be disposed at any point in the hose 104 and still provide controlled flow from the reservoir 102 . the reservoir 102 and hose 104 are made of a translucent material to allow the operator to visualize the supply of liquid . a removable lid 202 at the top of the reservoir 102 is conveniently placed for easy filling of the reservoir 102 . in the preferred embodiment , the machine tool 100 is adapted to annular cutters , which have a hollow center portion . a ring assembly 106 is combined with the arbor 115 of the machine tool 100 . a hose 104 connecting the ring assembly 106 to the reservoir 102 provides a path for fluid flow . fluid flows through hose 104 to the inside of the annular cutter from the reservoir 102 when the machine tool 100 is cutting . in an alternate embodiment illustrated in fig5 a and 5 b , a gravity - feed liquid delivery system 200 is provided as a separate system adaptable to any type of machine tool 100 including , but not limited to , a knee mill 100 . in this embodiment , a ring assembly 106 is adaptable to combine with the arbor of the mill 100 . a hose 104 extends from the reservoir 102 to the ring assembly 106 . the reservoir 102 is attachable at any position on or around the mill 100 . in yet another alternative embodiment and illustrated in fig6 , the gravity - feed liquid delivery system 200 is provided as a stand - alone system 200 having a valve 113 at the outlet 204 of the reservoir 102 and a hose 104 . the hose 104 may be formed of a resilient yet flexible material that holds the hose in a temporarily fixed position . alternatively , the hose 104 may have an attachment mechanism ( not illustrated ) in the form of a hook , an adhesive , or a magnet . this allows the gravity - feed liquid delivery system 200 to be adapted for use on a wide range of machine tools 100 including , but not limited to , circular saws , hand drills , and lathes . various aspects of any of the embodiments can be combined in different combinations than the ones shown to create new embodiments that fall within the scope of the appended claims . while the present invention has been particularly shown and described with reference to exemplary embodiments thereof , it should be understood by those of ordinary skill in the art that various changes , substitutions and alterations can be made herein without departing from the scope of the invention as defined by appended claims and their equivalents . the invention can be better understood by reference to the following claims . for purpose of claim interpretation , the transitional phrases “ including ” and “ having ” are intended to be synonymous with the transitional phrase “ comprising .”
| 1 |
referring to the only figure , a high pressure hydraulic source 10 outputs a pressurized fluid to an input line 12 of hydraulic pressure intensifier 14 , shown in outline . input line 12 has a pressure of about 3000 psi therein . intensifier 14 outputs on an output line 16 a pressurized fluid having a pressure greater than the fluid in input line 12 . the pressurized fluid in output line 16 is passed through a one - way check valve 18 and is stored in an accumulator 20 for future use as described hereinabove . input line 12 is connected to a one - way check valve 22 and to a first restrictor 24 . check valve 22 is connected to check valve 18 and to a second restrictor 26 . the source pressure is able to pass directly into accumulator 20 thru one - way check valves 22 and 18 . intensifier 14 increases the output pressure above the source pressure in accumulator 20 . first restrictor 24 outputs into a first branch line 28 and a second branch line 30 . second resistor 26 outputs into a first branch line 32 and a second branch line 34 having therein a third restrictor 36 . unless otherwise stated , fluid may flow in either direction of a line . intensifier 14 further includes a piston driver 38 , a pilot valve 40 and a dump valve 42 connected together as described hereinbelow . piston driver 38 has a piston 44 moving inside of a cylindrical piston cavity 46 . piston 44 has a first area 48 and a second area 50 , second area 50 being smaller than first area 48 . second area 50 of piston 44 provides the increased pressure boost when moved to the right in a boost cavity 112 . a shaft 52 attached to piston 44 acts upon pilot valve 40 by a shaft end 65 intermittently . a first seal 54 made of polytetrafluoroethylene ( teflon ), for example , about piston 44 and in contact with a cavity wall 56 prevents the leakage of fluids between the different sides of piston 44 . a second seal 58 prevents fluid leakage by shaft 52 . a fluid return cavity 60 allows fluid to enter a vent line 62 . pilot valve 40 has therein a check ball 64 that makes sealing contact with a seat 66 . a spring 68 pushes against a flange 72 that is a part of and integral to a rod 70 . rod 70 has therein a first section 74 and a second section 76 integrally formed together . flange 72 has a hole 73 therethrough so that fluid can flow from one side to another . an end 78 of second section 76 of rod 70 is in intermittent contact with check ball 64 . first section 74 is in sliding contact with a housing hole 80 and in intermittent contact with shaft end 65 . a pilot return line 102 allows fluid to move from a pilot valve cavity 84 to fluid return cavity 60 and therefrom by vent line 62 . check ball 64 moves within a pilot cavity 88 and when fluid enters from second branch line 34 , check ball 64 will seat against seat 66 if not blocked by rod end 78 . dump valve 42 has therein a spring biased pressure actuated dump piston 90 moving within a spring cavity 92 . integrally attached to dump piston 90 is a valve piston 94 moving within a dump cavity 96 in a sealed manner to prevent the passage of pressurized fluid across piston 94 past a piston face 98 . dump cavity 96 has input second branch line 30 and outputs to a dump return line 104 when in a dump position as shown in the figure . a spring 106 in cavity 92 holds dump piston 90 against a stop 108 until a pressure greater than the pressure required to move piston driver 38 in an unload direction to the left is placed on piston face 98 of valve piston 94 . a sufficient pressure causes valve piston 94 to move to the right against stop 93 and close off second branch line 30 to dump cavity 96 by a sealing land 95 on valve piston 94 . a channel 91 through dump piston 90 allows fluid to flow between cavity 96 and cavity 92 when dump piston 90 moves . in operation , valve piston 94 is held in the open position as shown in the figure when in the no load postion . the fluid from first and second branch lines 28 and 30 , respectively , passes through dump cavity 96 to dump return line 104 and to vent line 62 . since spring 106 is biased at a higher pressure than is required to move dump piston 90 , dump piston 90 will not move . since first branch line 28 is dumping when piston 44 is moving in a no load direction to the left , a lower pressure will exist on first area 48 of piston 44 of piston driver 38 . since second branch line 34 has a third restrictor 36 therein the pressure from first branch line 32 onto second area 50 will be greater than the pressure on first area 48 thereby causing piston 44 to move to the left . as this occurs , check ball 64 of pilot valve 40 will seat on seat 66 because of fluid flow from line 34 and because rod 70 moves to the left as biased by spring 68 as shaft 52 moves to the left . as this occurs piston 44 will continue to move to the left until stopped by a wall 110 . fluid from piston cavity 46 flows to vent line 62 in the process . when piston 44 &# 34 ; bottoms out &# 34 ; on wall 110 , pressure in a boost cavity 112 increases to 3000 psi and this increased pressure acts on piston face 98 of valve piston 94 of dump valve 42 causing dump piston 90 to move to the right closing off line 30 to dump cavity 96 . check ball 64 is further still held against seat 66 . the force acting on first face 48 of piston 44 is greater than the force acting against second face 50 due to face 48 having a greater area than face 50 with the same fluid pressure on both sides of piston 44 . piston 44 will thus move to the right . since the moving force is acting on a smaller area for displacing fluid from boost cavity 112 , the pressure is increased above the input pressure of 3000 psi a given amount . this boost pressure is transmitted from boost cavity 112 , through first branch line 32 , through second restrictor 26 , through one - way check valve 18 , from output line 16 to accumulator 20 . the boost pressure is held by check valve 18 in accumulator 20 . boost pressure cannot reach source 10 because of second check valve 22 . when piston 44 bottoms out on a wall 114 of boost cavity 112 , boost pressure stops . as this occurs dump valve 42 opens and pilot valve 40 opens , when check ball 64 is pushed off seat 66 by rod 70 when shaft end 65 hits first section 74 of rod 70 . when the pilot valve 40 opens , boost pressure is removed from dump valve 42 . when dump valve 42 opens , pressure is lowered in piston cavity 46 of pistion driver 38 and first restrictor 24 . this is a no load position from which the above cycle repeats until a predesignated psi of about 4000 psi is held in accumulator 20 . when the predesignated pressure is reached in accumulator 20 , piston 44 stalls out . accumulator 20 has an initial pressure of about 3000 psi before intensifier 14 starts pressure boost due to the flow from pressure source 10 through check valves 22 and 18 . clearly , many modifications and variations of the present invention are possible in light of the above teachings and it is therefore understood , that within the inventive scope of the inventive concept , the invention may be practiced otherwise than specifically claimed .
| 5 |
referring now to fig1 of the drawing , a bracket shown generally at 10 , is illustrated , having a base 11 , a web portion 12 and a semi circular clip portion 13 attached to and spaced from the base 11 by the web 12 . in keeping with one of the objects of the invention , provision is made for the bracket of the present invention to be utilized in the installation in a large number of different vehicle and guard configurations . in general , most aftermarket rear light guards are mounted to its respective vehicle utilizing two areas of attachment . the first is a bracket or tab 15 permanently affixed to the rear of the guard 16 as shown in fig2 and attached to the vehicle in the rear door frame utilizing sheet metal or self tapping screws . while this part of the installation provides a secure mounting with attachment points that are concealed when the rear door or hatch is closed , the problem in aftermarket installation arises with the forward mounting of the guard . in general , dealers and installers of aftermarket accessories are very reluctant to drill holes in finished portions of the vehicle body . one reason is that many vehicles are specially treated to resist rust and corrosion and drilling through a painted surface could result in compromising such treatment . in order to avoid a forward attachment using screws , rivets or other attaching means requiring drilling into a finished body panel , several methods have been employed to date , each with its own problems or limitations . some manufacturers have provided forward attachment tabs or brackets that are secured to the vehicle body with double sided adhesive tape or velcro material adhesively attached to both the vehicle surface and such forward mounting bracket or tab . neither of these two methods have been without problems since the surface of a painted body section of a vehicle reaches such extremes in both hot and cold temperature , adhesively applied fastening simply does not hold up for any prolonged period . another method utilized in some designs is to let the entire mounting of the rear light guard be at the rear with secure mechanical fasteners hidden in the rear door or hatch frame . in this type of mounting , the guard is essentially cantilevered from the rear and designed to be biased toward and the vehicle body at the front with a resilient bumper provided therebetween to prevent finish damage or vibration . while this design provides satisfactory mounting in most situations , the protection at the forward portion of the guard is still not as secure as with reliable attachment means . in the present invention the bracket 15 is designed to overcome the previously mentioned problems and limitations . as seen in fig1 the base 11 of the bracket 10 is formed from very flexible thermoplastic material so that it will conform to the plastic lens of the rear light . it has been found that the plastic lens goes through a far less temperature range than metal or laminated plastic body panels so that a properly chosen adhesive will provide far more reliable service . it has been found that double sided foam base adhesive tape manufactured by the 3 - m corporation will provide long term and reliable service . as shown in fig1 and 3 , the two sided foam base tape 18 secures the bottom of the flexible bracket base 11 to a plastic rear light lens 20 . in order to securely attach the top portion of the bracket 10 to the guard 16 , it is formed in a semi circular configuration 13 and sized to securely snap onto one of the tubular members of the guard 16 as depicted in fig2 and 3 . in order to provide a semi circular portion that will securely snap onto a guard member , it has been found that generally rigid thermoplastic material should be utilized . in order to provide such a generally rigid portion 13 and let still have a base portion 11 that is flexible to conform to the shape of a rear light lens , it has been found that the bracket 10 of the instant invention provides the required performance when it is molded or formed with a flexible base 11 and a generally rigid guard engaging portion 13 . it is well known in both the thermoplastic molding and extruding art to form molded or extruded parts having portions with different durometer readings for rigidity and it is contemplated that such a procedure could be utilized in producing the within brackets embodying the instant invention . there is thus described a bracket for installing a rear light guard on a vehicle . obviously , variations thereof may occur to any artisan and the scope of the invention should only be considered to be limited by the scope of the appended claims .
| 1 |
[ 0025 ] fig1 shows the java run - time environment . in this environment , java program class files 10 and java api class files 12 are loaded by a class loader 14 which supplies the byte codes of the class files to the java interpreter 16 , which is supported by a host operating system 18 . as described above , this environment offers a variety of advantages but lacks scalability and availability properties . [ 0026 ] fig2 shows a system setting for the present invention . it is very common for java applications to be run on one or more server systems 20 , 22 to service the requests of clients 24 , 26 , 28 that are made over a network 30 , which can be a local area network , a wide - area network or a network of networks such as the internet . such networks typically employ standardized transport service protocols for communicating between the clients and the server . one such transport service conforms to the tcp / ip protocol . in addition to the protocol , the operating system on the server typically employs a standard set of transport service primitives to access the transport service . a standard set of primitives for a server includes primitives such as a socket call , in which a server first establishes a communication endpoint , a bind call in which a server assigns an address to the socket , a listen call , by which the server sets up storage for incoming client connection requests , an accept call to await an incoming connection , send and receive primitives to transmit and receive data over the connection and a close primitive to end the connection . a client also makes use of these primitives , with the exception of the accept , bind and listen calls . [ 0028 ] fig3 shows a server system 32 a , 32 b for use in the present invention . such a server system 32 a , 32 b has multiple , similar processing elements 34 a , 34 b that are interconnected via an interprocessor bus 36 a , 36 b . each processing element 34 a is preferably independent of the others 34 b , 38 a , 38 b in that it shares little or nothing with the other processors such that a failure of one processing element 38 a does not cause a failure of the other processing elements . in one type of server system , this means that each processing element has its own memory , operating system and support systems ( not shown ). each server system also has a pair of disk controllers 40 a , 40 b , 42 a , 42 b , that respectively connect the processing elements 34 a , 34 b , 38 a , 38 b to respective data volumes 44 a , 44 b , 46 a , 46 b as shown . [ 0029 ] fig4 shows the major software components of the present invention . these components include an application class - specific distributor 50 that connects to one or more clients 52 a , 52 b , 52 c 52 d , and one or more java - implemented application servers 54 a - d . a monitor program 56 is available for restarting the distributor 50 if the distributor 50 fails for some reason . in a multiple processing element server system , the distributor is configured to run on any of the processing elements 34 a - b , 38 a - b in fig3 and the application servers are configured to run on one or more available processing elements 34 a - b , 38 a - b in fig3 . the distributor module 50 , in accordance with the present invention , acts as a router that receives client connection requests 60 a - d for the java - implemented network application . the distributor 50 listens on the ports 62 that the network application would listen on if there were no distributor 50 , thus acting as a proxy for the network application . the distributor performs load balancing by routing , when possible , client connection requests to the network application server that is least busy . the java - implemented network application server modules 54 a - d , in accordance with the present invention , and , with them , java virtual machines , are configured to receive client connection requests 60 a - d and to complete the connections to one of the clients 52 a - d . once the connection 64 a - d is established , one of the network application servers 54 a - d performs services requested by the client until the client disconnects from the network application server to which it was connected . a modified java virtual machine is configured to assist in the establishing of the connection . a set of configuration tools , in accordance with the present invention , is provided to allow the system manager to configure , reconfigure and manage the java - implemented network application server . as mentioned above , the distributor module 50 acts as a router for the network application server modules . more particularly , the distributor module is an instance of a server class process . the distributor executes a bind call to assign ports to a socket of the distributor . the ports that are assigned are the ports that the network application server modules would otherwise listen on . the distributor module then executes a listen call to set up a data buffer for client connection requests and then an accept to accept the incoming requests . once a connection request is received , the distributor uses a modified round - robin mechanism to find the least busy network application server module . if a suitable network application server module is found , the distributor forwards the client connection request to the found server , after which the client and the found server continue their conversation without the distributor involved , until the connection is closed . fig5 shows a flow chart for the set up of the distributor module of the present invention . the distributor has an initialization phase 80 , a main operating phase 82 and a restart phase 84 ( if and when a failure 86 occurs ), each of which is described in more detail below . to get started , the distributor 50 obtains or collects information about the network application servers 54 a - d in fig4 associated with the distributor 50 , the maximum number of clients for each network application server and the ports to listen on . fig6 shows a flow chart for the initialization of the distributor module . step 90 sets forth the information obtained by the distributor at initialization . the obtained information includes the server class name of the distributor , the server class name of the application servers associated with the distributor , the maximum number of clients of each application server , the number of static application servers running in the application server class , the number of dynamic application servers running in the application server class , and the assigned ports on which to listen . in step 92 , the distributor opens $ receive , ( a system wide file which acts as a message queue for many interprocess communication messages ) and awaits the client connections . the modified java virtual machine ( jvm ) assists in the $ receive operation and the second phase of the accept method ( i . e ., accept_nw2 ( ), a method that creates a new socket for data transfer , and accepts a connection on the new socket ), discussed below . if $ receive is successful , in step 94 , the distributor then creates , in step 96 , the serverstatus structure ( table ). the serverstatus structure is an internal structure that contains an entry for each of the static application servers in the server class associated with the distributor . the distributor stores the serverstatus information about each application server in a linked list of these structures : { serverid , dialogid , numclients , sendoutstanding , tag , reqbuf }, where serverid holds a unique identifier for an application server , dialog_id holds an identifier for the dialog established with an application server , numclients is the number of clients the server is currently handling , sendoutstanding is a boolean indicating whether a serverclass_dialog_send is outstanding for the application server , tag indicates the port associated with an outstanding dialog , if any , and reqbuf is a pointer to a request buffer allocated for the application server . next , in step 98 , the serverclass_dialog_begin , a procedure call to initiate a dialog with a server , is invoked for each server . after this function is invoked for all servers as determined by step 100 , the portinfo structure ( table ) is created for a port , in step 102 . the port info structure is an internal structure that contains information associated with the ports on which the distributor is listening . the distributor creates a linked list of such structures : { portnumber , filenum , listenfromsocketaddr , acceptfromsocketaddr }, where portnumber is the port number , filenum is the file number of the socket that is bound to the port , and listenfromsocketaddr is a pointer to storage that contains the remote address and port number for the connection when the first phase of the accept ( accept_nw ( )) completes , and acceptfromsocketaddr contains the remote address and port number of a new connection . next , in step 104 , the listen ( ) function is invoked for the port , and then , in step 106 , the accept_nw ( ) ( the first part of a two - phase accept process ) for each port , which places the module in a state in which it is ready to receive client connections . this continues until all ports , in step 108 , are ready to receive client connections . [ 0042 ] fig7 shows a flow chart for the main processing loop of the distributor module . in step 120 , the awaitiox function is invoked to look for a message . the message can be one of three different message types , a client connection request , a message from a application server or a system message . if a client_connection_request is received , the distributor , in step 122 , attempts , in step 124 , to find the server process that is currently handling the fewest number of clients . in step 126 , if a qualifying server is found , the distributor performs a serverclass_dialog_send function 128 , which initiates a data transfer to an application server with an established dialog , to send a message containing the address of the client requesting a connection to the found application server . if a qualifying server is not found , as determined in step 126 , the client connection request is placed on a waiting list , in step 130 , for the next available application server that meets the qualification and in step 132 , the distributor reissues an accept_nw ( ), a method that listens for connects on an existing socket , to accept the next message . if a server process message is received , in step 122 , the distributor , in step 134 , finds the application server and updates the number of current clients for that application server , because the message is a disconnect message from the application server . if there are any clients waiting to connect to the application server that just disconnected from a client , as determined in step 136 , then a serverclass_dialog_send function , in step 128 , is performed to send to the application server the address of the client waiting for a connection to that application server . if a system message is received , in step 122 , the distributor , in step 138 , checks to determine whether the message is either an open , close or signaltimeout message . the signaltimeout procedure sets a timer to a given number of units of elapsed time , as measured by the processor clock . when the timer expires , the calling process receives an indication in the form of a system message on $ receive . if the received message is a close message as determined in step 140 , the operation phase of the distributor is ended . otherwise , the distributor takes the appropriate steps based on the message and returns to the awaitiox call , in step 120 , which completes a previously initiated i / o operation , to look for another message . [ 0047 ] fig8 shows a flow chart that sets out the main processing loop of the distributor module in more detail in accordance with one embodiment . the main processing loop relies on the above - mentioned serverstatus structure and the portinfo structure , both of which are created during the distributor initialization phase . referring to fig8 the distributor executes a awaitiox call in step 150 and waits for a new message to arrive in step 152 . by testing the filenum parameter that is returned , the distributor can determine the message type . if the filenum parameter matches receive_filenum , then a message from the application server is received in step 154 . responding to the message may require that the serverstatus structure be updated because a disconnect has occurred . if the filenum parameter matches the scsend_op_num in step 152 , then the serverstatus structure is updated , in step 156 , by calling the updateserverstatus function . if filenum does not match either receive_filenum or scsend_op_num , in step 152 , then the message is determined to be a client connection request ( this is the default case ). upon making this determination , a connectionrequest ( ) function 160 is called to verify that the port at which the accept_nw ( ) function was just completed 158 is valid . the distributor then calls findbestserver ( ) 162 to find a server to accept the new connection . this routine uses the serverstatus linked lists to find the best available server . the best server available is the one that will be handling the fewest number of clients after the client connection is assigned . the best server available also will not have an outstanding dialog because this would mean that the server had received a previous client connection request but had not yet responded to the distributor that it had accepted the request . if no such server is available , the distributor performs a server_class_dialog_begin in step 162 , a procedure call to initiate a dialog with a server , to force the pathmon module to start an new application server ( assuming that not all dynamic servers are running ). if the server_class_dialog_begin fails , in step 164 , then findbestserver ( ) returns a dialog_id value of (− 1 ). because there are no available servers , the client request is next put on a waiting list , in step 166 , accept_nw ( ) is invoked , in step 168 , and the distributor returns to wait for another message in step 150 . if findbestserver ( ) succeeds , in step 164 , then findbestserver ( ) returns with a dialog_id value for the server and a buffer pointer to the request buffer allocated from memory , in step 170 , for the application server . next , the distributor performs a serverclass_dialog_send , in step 172 , to commence communication between the client and the application server . [ 0052 ] fig9 shows a flow chart for the restarting of the distributor module . if the distributor terminates because of a processor element failure , the pathmon module restarts the distributor , which then performs the steps in the process of reading the configuration parameters . this process includes beginning a dialog with each static application server and sending an initialmsg message to each application server . if the server has already received the message , the server assumes that the distributor is restarting and reply with a restartreply message . the distributor updates the serverstatus structure for the application server and continues processing in the operation phase . an application server includes any java - implemented program that uses the java . net . serversocket class accept method . this class is normally used to wait for connections from clients . an application server using the serversocket class , creates a serversocket object and calls the class &# 39 ; s accept ( ) method to wait for a client connection . when the connection arrives , the accept ( ) method then creates a socket object which the application server uses to actually communicate with the client . in one embodiment of the present invention , a customized serversocket class is provided for the application server to simplify and include a two - phase accept protocol without altering the api of the object . in the customized serversocket class , an interprocess communications routine $ receive is opened , and the code that performs a listen , bind and accept is disabled . instead , when the accept method is invoked , the application server employing the customized serversocket class waits on $ receive for a message from the distributor containing the address of the client to accept . next , the application server replies with a message containing the current number of clients being serviced by the application server and a new threads routine ( accept_nw 2 ( )) is called which returns a socket that the application server can use to communicate with the client . when the client disconnects from the application server , the custom serversocket class performs a serverclass_send to the distributor with a message than contains the current number of clients . the distributor responds with an acknowledge which the application server receives and discards . additionally , an application server of the present invention , preferably communicates with a client until the client &# 39 ; s request is fully processed . after the communication with the client has terminated , the application server closes the socket it used to communicate with the client . the application server should not retain a client &# 39 ; s state after the client disconnects from the application server , because the distributor cannot guarantee that a particular client will reconnect to the same application server . in accordance with the present invention , a java - implemented server becomes an application server by means of a configuration tool . a program can have several types of application servers , with each type performing a different service . each different application server runs in a different server class . as mentioned above , for each server class there is one distributor in that class . [ 0058 ] fig1 shows an example of the operation of the present invention in which a single application server 54 a - d runs on each processing element 34 a - b , 38 a - b in a single server class 180 . pathmon 65 is shown running on processing element 34 a and the distributor 50 is shown running on processing element 34 b , though neither module is dedicated to running on any specific processing element . the distributor 50 creates a socket and binds port 4049 to the socket so that it can accept client connections . a client 52 a constructs a socket for itself that specifies port 4049 as the connection endpoint . the distributor accepts the client request and forwards the request to one 54 a of the application servers ( depending on the least busy condition ), and thereafter the selected application server 54 e continues the communication with the client until the connection is closed . [ 0059 ] fig1 shows the configuration of fig1 , wherein a new client 52 e makes a connection request and a new server 54 e is created . in the figure , client 52 e creates a new socket for itself specifying the host and port number . the distributor 50 receives the new connection request and attempts to forward the request to an application server , but no qualifying server is available . pathmon 56 is called upon to create a new copy of an application server 54 e and the request is forwarded to the new application server 54 e , after which that server communicates with client 52 e . [ 0060 ] fig1 shows the case of a processor element failure . in this figure , processing element 34 c fails . this prompts pathmon 56 to start a new application server 54 f on an operating processing element , say processing element 34 b . a client 52 c , which was connected to the application server on the failed processing element , reconnects to the distributor 50 . the distributor 50 forwards the connection request to the new application server 54 f on processing element 34 b . the new application server 54 f continues the communication with the client 52 c . [ 0061 ] fig1 shows the case in which there are two server classes for the application servers . one server class 180 is employee_svc and the other 182 is manager_svc . each type of application server listens on a different port . in the figure , client 52 a connects to an application server 54 a running in the employee_svc server class and client 52 b connects to an application server 53 c running in the manager_svc class 182 . there are two distributors 50 , 51 , one for each class 180 , 182 . the distributor 50 for the employee_svc class listens on port 4049 and the distributor 51 for the manager_svc class listens on port 6157 , in one embodiment . the configuration utility aids in the capture , from the user , of critical information for configuring and starting the distributor and the application servers . this information includes a the name of the tcp / ip process to be associated with a particular application server ; number of connection requests that each application server is able to handle concurrently , the number of application servers that should always be running in a particular server class , optionally , the number of application servers that can be started if the load on the server system increases , the path to any . class files , . jar or . zip files that are needed by the application servers , any interpreter options required by the application server such as property name / value pairs , how much memory is allocated on the heap on startup and the maximum heap size required by the application server ; after receiving this information the configuration tool creates a configuration file and a start file which is used to start the application servers . the configuration file provides the distributor the information it needs to begin listening and accepting client connection requests . the configuration also provides an application server the information it needs to run as a application server in a specific server class . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred versions contained herein .
| 7 |
an example of the &# 34 ; active &# 34 ; portion of a known mos - gated semiconductor device 10 is shown in fig1 . fig1 shows a semiconductor ( typically silicon ) substrate 12 having various doped regions therewithin and some of the various layers , sequentially cut - away , overlying the upper surface 14 of the substrate 12 . also shown is a metal layer 16 covering the bottom surface 18 of the substrate . fig2 is a cross - section of a portion of the device taken , as indicated in fig1 where only a bottom - most pair of all the layers on the substrate upper surface are present ( the overlying layers having been cut - away for greater clarity ). the device 10 is an igbt , and fig2 shows , essentially , a gate control structure which is repeated many times on the surface of the device 10 . the gate control structure is typical of gate control structures used in the aforementioned cmos , mosfet , and mct devices . the device 10 is a single device having but one set of terminals , but comprises a plurality of individual cells connected together in parallel . one such cell c is indicated in cross - section in fig2 with the cell extending the full front to back length of the substrate portion shown in fig1 . each cell comprises a discrete &# 34 ; gate electrode structure 20 &# 34 ; ( although all the gate structures are connected in parallel by means of an interconnecting metal layer , not shown ) comprising a metal layer 22 ( typically of doped polycrystalline silicon ) precisely aligned with an underlying layer 24 ( typically of silicon dioxide ) integrally bonded to the surface 14 of the substrate 12 . the gate electrode structure 20 is part of a &# 34 ; gate control structure &# 34 ; including a source region 26 ( of n + conductivity in this example ) spaced from an n - drain region 28 by a p type composite region including a p - region 30 and a p + region 32 . the portion of the p - region adjoining the substrate surface 14 comprises a channel region 34 of the mos control structure , and the p + region 32 underlying the source region 26 is referred to as a body region . as mentioned , various layers overlie the substrate 12 . one such layer 34 ( fig1 ) of metal , e . g ., aluminum , has downward extensions 36 which contact the n + regions 26 at the surface 14 of the substrate 12 and additionally contact the p + regions 32 by means of portions 38 extending vertically through the n + regions 26 . as shown in fig1 the n - region 28 underlies all the cells of the device and overlies a higher conductivity n region 40 overlying , and forming , a p - n junction with a p + region 42 of the device . as mentioned , the device 10 is of known structure . as also known , other types of mos - gated devices can be substantially identical to the device shown in fig1 and 2 including substantially identical gate control structures , but with different arrangements of doped regions beneath the gate control structures . for example , by replacing the n region 40 and the p + region 42 , shown in fig1 with a single n + layer disposed between the n - region 28 and the metal layer 16 , a mosfet device is provided . the present invention is directed to the gate control structures which can be used in all such mos gated devices . as mentioned , the channel 34 ( fig2 ) of the mos structure is provided by an upper portion of the p - region 30 disposed between the n + source region 26 and the n - drain region 28 . disposed beneath the n + region 26 and extending almost , but not quite , to the channel region 34 is the p + region 32 . the purpose of the p + region , as known , is to reduce the gain of a vertical parasitic npn bipolar transistor formed by the n conductivity type source region 26 , the p type composite region 30 , 32 and the n type drain region 28 . to this end , the p + region 32 ( of high conductivity ) is preferably disposed along the full length of the p - n junction formed between the n + source region 26 and the p - region 30 ( an emitter at an n + p + junction being far less efficient than an emitter at an n + p - junction ). conversely , however , for providing a desired low threshold voltage for controlling the conductivity of the channel region 34 , the channel region 34 should be of low ( p -) doping concentration . an accepted compromise is to have the p + region 32 extend to a preselected close distance to the channel region 34 while not extending into it . as a practical matter , no devices can be made with absolute precision , particularly on a mass produced basis , and the actual design or nominal location of the p + region 32 relative to the channel region 34 must take into account dimensional tolerances dependent upon the fabrication process used . the more critical requirement concerning the location of the p + region 32 relative to the channel region 34 is that the p + region 32 not enter into the channel region 34 . accordingly , the nominal distance d between the p + region 32 and the channel region 34 is deliberately selected to be slightly greater than the optimum distance . accordingly , a desired goal is a means for reducing the previously necessary excessive distance d . a further reason for reducing the distance d is that it is a factor in the total width of each cell c . assuming that the cell width is already as small as possible as limited , for example , by the minimum widths obtainable for the p + region 32 and the channel region 34 as determined by the fabrication process used ( described hereinafter ), the greater the distance d , the greater is the cell width . as previously explained , cells c of the smallest possible width are desired . fig3 through 7 show a sequence of processing steps according to a preferred prior art process for fabricating the gate control structure shown in fig2 . as previously explained , the fig2 structure , or known variations thereof , is used in many different types of gated semiconductor devices . fig3 shows a workpiece which has been fabricated using known processes . at this point in the fabrication process , the device underlying layers 28 , 40 and 42 shown in fig1 have been formed along with the gate electrode structure 20 and the p - region 30 . the p - region 30 has been formed by an ion implantation process using the gate electrode structure 20 as a mask whereby the edge surface 52 of the p - region 30 is precisely aligned with a vertical side wall 54 of the gate electrode structure 20 . the p + region 32 ( shown in fig2 ) is next to be formed using known photolithographic processing techniques . this comprises coating the entire upper surface of the substrate workpiece with a photoresist layer and , by means of a photomask , exposing the photoresist layer through the photomask for defining areas in the photoresist which are then etched away to provide windows , such as the window 56 shown in fig4 through the photoresist layer 58 for exposing an area of the substrate surface . ions are then implanted through the window 56 for providing the desired p + region 32 . the width of the window 56 is as small as reliably obtainable using known photolithographic properties . as previously described in connection with fig1 and 2 , the edge surface 52 of the p - region 30 defines the drain end of the channel region 34 ( fig2 ), hence the edge surface 60 of the p + region 32 must be spaced well away from the edge surface 52 of the p - region 30 . this spacing is determined by the distance e between the edge 62 of the window 56 formed through the photoresist layer 58 and the vertical wall 54 of the gate structure 20 . herein lies the problem addressed by the present invention . while known photolithographic processes are extremely precise , some tolerances must still be provided , and , as previously explained , the distance e between the window edge 62 and the electrode structure edge 54 is necessarily somewhat greater than the preferred optimum distance . with the p + region 32 now in place , the workpiece is heated to cause diffusion of both regions 30 and 32 for moving the edge surface 52 of the p - region 30 , but not the edge surface 60 of the p + region 32 , beneath the gate structure 20 . the result is shown in fig5 . then ( fig6 ) using the gate structure 20 for defining an ion implantation window 68 , n type conductivity ions are implanted into the substrate 12 to form the n + region 26 . because the gate electrode structure 20 is used as a mask for locating the edge surfaces of both the n + region 26 and the p - region 30 , the channel region 34 is defined with great precision . conversely , because the edge 62 of the window 56 ( fig4 ) through a patterned photoresist layer 58 was used to define the surface 60 of the p + region 32 , somewhat less precision is obtainable . in a next processing step , the workpiece is heated to cause diffusion of the doped regions to the positions shown in fig7 . the edge surface 69 of the n + region 26 is moved beneath the gate structure 20 and intercepts the substrate surface 14 along a line 69a precisely spaced from the substrate surface intercept 52a of the p - region 30 . thereafter , the device 10 is completed using known processes not requiring description for an understanding of the present invention -- which is now described . a semiconductor substrate workpiece is first processed according to known processes until the condition shown in fig3 . then , rather than immediately providing a p + region 32 as shown in fig4 and 5 , followed by providing the n + region 26 ( fig6 ) in accordance with the prior art , the sequence of steps is reversed and , additionally , use is made of a processing technique not used in the aforedescribed prior art process . first , and starting with a workpiece as shown in fig3 the workpiece is heated to cause ( fig8 ) a precise diffusion of the p - region 30 for increasing its depth a desired amount and for moving the edge surface 52 of the p - region 30 , precisely aligned with the gate structure 20 in fig3 to a precisely known position underlying the gate structure 20 . next ( fig9 ), using the gate structure as a mask , n conductivity type impurities are then implanted to form the n + regions 26 . because the side wall 54 of the electrode structure 20 has been used as a mask , the edge surface 69 of the n + region 26 is precisely positioned relative to the edge surface 52 of the p - region 30 . the portion of the p - region 30 adjacent to the substrate surface 14 between these region surfaces 69 and 52 is the channel region 34 . then , in a further deviation from the prior art process previously described , a layer 76 ( fig1 ) of a masking material is deposited on the workpiece . in the present embodiment , using a silicon substrate 12 , a polysilicon gate electrode 22 and a silicon dioxide layer 24 , the masking layer 76 is preferably of silicon dioxide deposited by a known low temperature deposition process , the resulting layer 76 being referred to as a &# 34 ; low temperature oxide &# 34 ; ( lto ). a known suitable lto deposition process comprises reacting silane gas with oxygen in a reactor for forming and depositing fine particles of silicon dioxide on the workpiece . as deposited , the lto layer 76 is in the form of particles and the workpiece is then heated for vitrifying the layer 76 . only a relatively low heating temperature ( e . g ., around 900 degrees c .) is required which is important for causing little diffusion of the carefully previously positioned regions 26 and 30 . this is important because , to the extent that the n + region surface intercept 69a is disposed excessively inwardly of the vertical wall 54 of the gate structure 20 , the length of the channel region 34 is excessively reduced thus changing the device operating characteristics . it is an important characteristic of the lto layer 76 that it can be made quite thin , e . g ., 500 a - 3 , 000 a , and typically 1 , 500 a , ( in comparison with a thickness of the gate structure 20 of around 9 , 000 a ), with a precise thickness , e . g ., with a tolerance of ± 5 % ( i . e ., 75 a , or even less , for an lto layer 76 thickness of 1 , 500 a ), and that it adheres well , with a uniform thickness , to the vertical wall 54 of the electrode structure . significantly , the lto layer 76 is not thereafter patterned . rather , with the lto layer 76 in place , p type impurity dopant ions ( e . g ., boron ) are projected towards the substrate surface 14 using a known ion implantation process . the ion implantation energy used is sufficient for the ions to penetrate through the horizontal portions of the lto layer 76 where they directly overlie the surface 14 of the substrate 12 . conversely , primarily because the ions are projected towards the substrate along directions normal to the substrate surface 14 and parallel to the gate structure vertical wall 54 , the ions do not penetrate the vertical length of the lto layer 76 . the quite thin lto layer 76 is thus effective for increasing the lateral extent of the gate structure 20 with the result that the p + region 32 thus implanted is spaced away from a projection of the wall 54 into the substrate 12 by a distance equal to the thickness of the lto layer 76 . the beam energy of the implantation process is sufficient to drive the p type dopant ions through the n + region 26 and into the underlying p - region 30 . within the p - type region 30 , the implanted ions provide the p + region 32 shown . of significance , the spacing between the edge surface 60 of the p + region 32 and the edge surface 69 of the n + region 26 is determined primarily by the thickness of the lto layer 76 on the electrode structure 20 and , to a quite minor degree , on any small diffusion of the n + region 26 during the lto low temperature layer heating step which occurs prior to the p + implantation step . comparing the structure resulting from the inventive process as shown in fig1 with the structure resulting from the prior art process shown in fig7 the structures appear substantially identical . a difference , however , is that the accuracy of the positioning of the p + region 32 relative to the n + region 26 is a function , in the inventive process , of the lto deposition process described ( not using a photolithographic process ) whereas , in the prior art process , it is a function of the described photolithographic patterning process . the positioning tolerances of the lto process , e . g ., ± 75 a , or less , are smaller than the photolithographic tolerances , ( e . g ., ± 5 , 000 a , or higher ) whereby the p + region surface edge 60 , using the inventive process , can be positioned more closely to the n + region surface edge 69 by the difference in the tolerances , e . g ., close to 5 , 000 a . accordingly , and as previously discussed in connection with the description of fig2 the closer positioning of the p + region 32 to the side edge surfaces 69 of the n + region 26 allows for narrower cells c by , typically , 10 %, and corresponding better device performance . additionally , and as previously discussed , allowing disposition of the p + region 32 edge surface 60 closer to the n + region 26 edge surface 69 , thus minimizing the length of the junction between the n + region 26 and the p - region 30 , reduces the gain of the parasitic npn bipolar transistor present adjoining the channel region 34 . other materials known for use in semiconductor devices can be used for the spacer layer 76 . for example , the layer 76 can be of silicon nitride preferably also applied by a known relatively low temperature deposition process . various glass layers typically used for passivation purposes , e . g ., boron - phosphosilicate ( bpsg ) or phosphosilicate ( psg ) glasses can be used . also , known organic , e . g ., photoresist materials can be used , but unlike the other materials mentioned , would have to be eventually removed from the workpiece . also , the described lto layer 76 can be applied by other known processes , e . g ., the known &# 34 ; liquid spin - on &# 34 ; process .
| 7 |
the present invention provides a highly efficient method for treating pcp addiction and for changing pcp addiction - related behavior of primates , for example mammals . as used herein , addiction - related behavior means behavior resulting from compulsive pcp use and is characterized by apparent dependency on the substance . symptomatic of the behavior is ( i ) overwhelming involvement with pcp , ( ii ) the securing of its supply , and ( iii ) a high probability of relapse after withdrawal . pcp addiction is defined herein to include pcp addiction together with addiction to other drugs of abuse . drugs of abuse include but are not limited to psychostimulants , narcotic analgesics , alcohols and addictive alkaloids such as nicotine or combinations thereof . drugs of abuse also include cns depressants such as barbiturates , chlordiazepoxide , and alcohols such as ethanol , methanol and isopropyl alcohol . compulsive drug use includes three independent components : tolerance , psychological dependence , and physical dependence . tolerance produces a need to increase the dose of the drug after it is used several times in order to achieve the same magnitude of effect . physical dependence is an adaptive state produced by repeated drug administration and which manifests itself by intense physical disturbance when drug administration is halted . psychological dependence is a condition characterized by an intense drive , craving or use for a drug whose effects the user feels are necessary for a sense of well being . see feldman , r . s . and quenzer , l . f . “ fundamentals of neuropsychopharmocology ” 418 - 422 ( sinaur associates , inc .) ( 1984 ) incorporated herein by reference as if set forth in full . based on the foregoing definitions , as used herein “ dependency characteristics ” include all characteristics associated with compulsive drug use , characteristics that can be affected by biochemical composition of the host , physical and psychological properties of the host . as used herein the rewarding / incentive effects of pcp refers to any stimulus ( in this case , a drug ) that produces anhedonia or increases the probability of a learned response . this is synonymous with reinforcement . with respect to experimental animals , a stimulus is deemed to be rewarding by using paradigms that are believed to measure reward . this can be accomplished by measuring whether stimuli produce an approach response , also known as an appetitive response or a withdrawal response , as when the animal avoids the stimuli , also known as an aversive response . conditioned place preference ( cpp ) is a paradigm which measures approach ( appetitive ) or withdrawal ( aversive ) responses . one can infer that rewarding stimuli produce approach behavior . in fact , one definition of reward is any stimulus that elicits approach behavior . furthermore , the consequences of reward would be to enhance the incentive properties of stimuli associated with the reward . reward can also be measured by determining whether the delivery of a reward is contingent upon a particular response , thereby increasing the probability that the response will reappear in a similar situation , i . e . reinforcement paradigm . for example , a rat pressing a bar a certain number of times for an injection of a drug is an example of reinforcement . yet another way to measure reward is by determining if a stimulus ( e . g . a drug ), through multiple pairings with neutral environmental stimuli , can cause the previously neutral environmental stimuli to elicit behavioral effects initially only associated with the drug . this is conditioned reinforcement . cpp is considered to be a form of conditioned reinforcement . the incentive motivational value of a drug can be assessed using conditioned place preference ( cpp ). animals are tested in a drug - free state to determine whether they prefer an environment in which they previously received the drug as compared to an environment in which they previously received saline . in the cpp paradigm , animals are given the drug in one distinct environment and are given the appropriate vehicle in an alternative environment . the cpp paradigm is widely used to evaluate the incentive motivational effects of drugs in laboratory animals ( van der kooy , 1995 ). after conditioning or pairing with the drug , if the animal , in a drug - free state , consistently chooses the environment previously associated with the drug ; the inference is drawn that the appetitive value of the drug was encoded in the brain and is accessible in the drug - free state . cpp is reflected in an increased duration spent in the presence of the drug - associated stimuli relative to vehicle - injected control animals . it has been postulated that since craving at the human level is often elicited by sensory stimuli previously associated with drug - taking , conditioning paradigms like cpp may be used to model craving in laboratory animals . as used herein , craving an abused drug or a combination of abused drugs is a desire to self - administer the drug ( s ) previously used by the mammal . the mammal does not necessarily need the abused drug to prevent withdrawal symptoms . the addictive liability of pcp has been linked to its pharmacological actions on mesotelencephalic dopamine ( da ) reinforcement / reward pathways in the central nervous system ( cns ). dopaminergic transmission within these pathways is modulated by gamma - amino butyric acid ( gaba ). pcp inhibits the presynaptic reuptake of monoamines . dopaminergic neurons of the mesocorticolimbic da system , whose cell bodies lie within the ventral tegmental area ( vta ) and project primarily to the nucleus accumbens ( nacc ), appear to be involved in pcp reinforcement . electrical stimulation of reward centers within the vta increases extracellular da levels in the nacc , while 6 - hydroxy dopamine lesions of the nacc abolish pcp self - administration . in vivo microdialysis studies confirm pcp &# 39 ; s ability to increase extracellular da in the nacc . γ - amino butyric acid ( gaba ) ergic neurons in the nacc and ventral pallidum project onto da neurons in the vta . pharmacologic and electrophysiologic studies indicate these projections are inhibitory . inhibition of vta - da neurons is likely the result of gaba b receptor stimulation . in addition , microinjection of baclofen into the vta , acting via these receptor subtypes , can decrease da concentrations in the nacc . taken together , it is evident that pharmacologic manipulation of gaba may effect da levels in the nacc through modulation of vta - da neurons . gamma vinyl gaba gamma vinyl gaba ( gvg ) is a selective and irreversible inhibitor of gaba - transaminase ( gaba - t ) known to potentiate gabaergic inhibition . gvg is c 6 h 11 no 2 or 4 - amino - 5 - hexanoic acid available as vigabatrin ® from hoechst marion roussel and can be obtained from marion merell dow of cincinnati , ohio . gvg does not bind to any receptor or reuptake complex , but increases endogenous intracellular gaba levels by selectively and irreversibly inhibiting gaba - transaminase ( gaba - t ), the enzyme that normally catabolizes gaba . as used herein gvg includes the racemic compound or mixture which contains equal amounts of s (+)- gamma - vinyl gaba , and r (−)- gamma vinyl gaba . this racemic compound of gvg is available as sabril ® from aventis pharma ag . gvg contains asymmetric carbon atoms and thus is capable of existing as enantiomers . the present invention embraces any enantiomeric form of gvg including the racemates or racemic mixture of gvg . in some cases there may be advantages , i . e . greater efficacy , to using a particular enantiomer when compared to the other enantiomer or the racemate or racemic mixture in the methods of the instant invention and such advantages can be readily determined by those skilled in the art . for example , the enantiomer s (+)- gamma - vinyl gaba is more effective at increasing endogenous intracellular gaba levels than the enantiomer r (−)- gamma - vinyl gaba . different enantiomers may be synthesized from chiral starting materials , or the racemates may be resolved by conventional procedures which are well known in the art of chemistry ; such as chiral chromatography , fractional crystallization of diastereomeric salts , and the like . in living mammals ( in vivo ), gvg or pharmaceutically acceptable salts thereof , can be administered systemically by the parenteral and enteral routes which also includes controlled release delivery systems . for example , gvg can easily be administered intravenously , or intraperitoneal ( i . p .) which is a preferred route of delivery . intravenous or intraperitoneal administration can be accomplished by mixing gvg in a suitable pharmaceutical carrier ( vehicle ) or excipient as understood by practitioners in the art . oral or enteral use is also contemplated , and formulations such as tablets , capsules , pills , troches , elixirs , suspensions , syrups , wafers , chewing gum and the like can be employed to provide gvg or pharmaceutically acceptable salts thereof . as used herein , pharmaceutically acceptable salts include those salt - forming acids and bases which do not substantially increase the toxicity of the compound . some examples of suitable salts include salts of mineral acids such as hydrochloric , hydriodic , hydrobromic , phosphoric , metaphosphoric , nitric and sulfuric acids , as well as salts of organic acids such as tartaric , acetic , citric , malic , benzoic , glycollic , gluconic , gulonic , succinic , arylsulfonic , e . g . p - toluenesulfonic acids , and the like . an effective amount as used herein is that amount effective to achieve the specified result of changing addiction - related behavior of the mammal . it is an amount which will diminish or relieve one or more symptoms or conditions resulting from cessation or withdrawal of the drug . it should be emphasized , however , that the invention is not limited to any particular dose . mammals include , for example , humans , baboons and other primates , as well as pet animals such as dogs and cats , laboratory animals such as rats and mice , and farm animals such as horses , sheep , and cows . preferably , gvg is administered in an amount which has little or no adverse effects . for example , to treat pcp addiction , gvg is administered in an amount of from about 15 mg / kg to about 2 g / kg , preferably from about 100 mg / kg to about 300 mg / kg or from about 15 mg / kg to about 600 mg / kg and most preferably from about 150 mg / kg to about 300 mg / kg or from about 75 mg / kg to about 150 mg / kg . based on the knowledge that pcp increases extracellular nacc da and the fact that gaba inhibits da in the same nuclei , we have shown that gvg can attenuate pcp - induced changes in extracellular da . for example , gvg significantly attenuated pcp - induced increases in neostriatal synaptic da in the primate ( baboon ) brain as assessed by positron emission tomography ( pet ). these findings suggest the possible therapeutic utility in pcp addiction of a pharmacologic strategy targeted at the gabaergic neurotransmitter system , a system distinct from but functionally linked to the da mesotelencephalic reward / reinforcement system . however , rather than targeting the gaba receptor complex with a direct gaba agonist , this novel approach with gvg takes advantage of the prolonged effects of an irreversible enzyme inhibitor that raises endogenous gaba levels without the addictive liability associated with gaba agonists acting directly at the receptor itself . although gvg is used in the present examples , it will be understood by those skilled in the art that other compositions or medicaments can be used which are known to potentiate the gabaergic system or increase extracellular endogenous gaba levels in the cns . such compositions or medicaments include drugs that enhance the production or release of gaba in the cns . these drugs include , but are not limited to , gabapentin , valproic acid , progabide , gamma - hydroxybutyric acid , fengabine , cetylgaba , topiramate , tiagabine , acamprosate ( homo - calcium - acetyltaurine ) or a pharmaceutically acceptable salt thereof , or an enantiomer or a racemic mixture thereof . the present invention embraces any enantiomeric form of gabapentin , valproic acid , progabide , gamma - hydroxybutyric acid , fengabine , cetylgaba , topiramate , tiagabine , or acamprosate , including the racemates or racemic mixtures thereof . as previously stated , in some cases there may be advantages , i . e . greater efficacy , to using a particular enantiomer when compared to the other enantiomer or the racemate or racemic mixture in the methods of the instant invention and such advantages can be readily determined by those skilled in the art . the present invention embraces compositions or medicaments which include prodrugs of gaba or drugs which contain gaba as a moiety in its chemical structure . these prodrugs become pharmacologically active when metabolically , enzymatically or non - enzymatically biotransformed or cleaved into gaba in the cns . an example of a prodrug of gaba is progabide which , upon crossing the blood brain barrier , increases endogenous cns gaba levels . as previously stated , gamma vinyl gaba ( gvg ) is a selective and irreversible inhibitor of gaba - transaminase ( gaba - t ) known to potentiate gabaergic inhibition . other compositions or medicaments which inhibit gaba re - uptake in the cns are also encompassed by the present invention . an example of a gaba re - uptake inhibitor is tiagabine . the method of the present invention is useful in potentiating the gabaergic system or increasing extracellular endogenous gaba levels in the cns . as used herein , enhancing or increasing endogenous cns gaba levels is defined as increasing or up - regulating gaba levels substantially over normal levels in vivo , within a mammal . preferably , endogenous cns gaba levels are enhanced at least by from about 10 % to about 600 % over normal levels . as previously stated , an effective amount as used herein is that amount effective to achieve the specified result of changing addiction - related behavior of the mammal . it is an amount which will diminish or relieve one or more symptoms or conditions resulting from cessation or withdrawal of pcp . it should be emphasized , however , that the invention is not limited to any particular dose . for example , an effective amount of gabapentin administered to the mammal is an amount from about 500 mg to about 2 g / day . gabapentin is available as neurotonin ® from parke - davis in the united states . an effective amount of valproic acid administered to the mammal , for example , is preferably an amount from about 5 mg / kg to about 100 mg / kg / day . valproic acid is available as depakene ® from abbott in the united states . preferably , an effective amount of topiramate administered to the mammal is , for example , an amount from about 50 mg to about 1 g / day . topiramate is available as topamax ® from mcneil in the united states . an effective amount of progabide administered to the mammal is , preferably , an amount from about 250 mg to about 2 g / day . progabide is available as gabrene ® from synthelabo , france . the chemical formula of progabide is c 17 h 16 n 2 o 2 . an effective amount of fengabine administered to the mammal is , preferably , an amount from about 250 mg to about 4 g / day . fengabine is available as sl 79229 from synthelabo , france . the chemical formula of fengabine is c 17 h 17 c 12 no . preferably , an effective amount of gamma - hydroxybutyric acid administered to the mammal is an amount from about 5 mg / kg to about 100 mg / kg / day . gamma - hydroxybutyric acid is available from sigma chemical . the chemical formula of gamma - hydroxybutyric acid is c 4 h 7 o 3 na . details of the invention have been set forth herein in the form of examples which are described below . the full scope of the invention will be pointed out in the appended claims . we explored the effects of increased endogenous gaba activity on pcp - induced extracellular da concentrations in the prefrontal cortex ( pfc ) and nucleus accumbens ( nacc ) of freely moving rats . all animals were used under an iacuc - approved protocol and with strict adherence to the nih guidelines . adult male sprague - dawley rats ( 200 - 300 g , taconic farms ), housed in the animals care facility under 12 : 12 light / dark conditions , were placed into 6 groups ( n = 3 - 6 ), anesthetized and siliconized guide cannulae were stereotactically implanted into the right nacc ( 2 . 0 mm anterior and 1 . 0 mm lateral to bregms , and 7 . 0 mm ventral to the cortical surface ) and prefrontal cortex ( pfc ) at least 4 days prior to study . microdialysis probes ( 2 . 0 mm , bioanalytical systems , bas , west lafayette , ind .) were positioned within the guide cannulae and artificial cerebrospinal fluid ( acsf , 155 . 0 mm na − , 1 . 1 mm ca 2 − , 2 . 9 mm k − , 132 . 76 mm c1 31 , and 0 . 83 mm mg 2 − ) was administered through the probe using a cma / 100 microinfusion pump ( bas ) at a flow rate of 2 . 0 μ / min . animals were placed in bowls , and probes were inserted and flushed with acsf overnight . on the day of the study , a minimum of three samples were injected to determine baseline stability . samples were collected for 20 min . and injected on - line ( cma / 160 , bas ). the average dopamine concentration of these three stable samples was defined as control ( 100 %), and all subsequent treatment values were transformed to a percentage of that control . upon establishing a stable baseline , the pcp was administered by intraperitoneal ( i . p .) injection . the high performance liquid chromatography ( hplc ) system consists of a bas reverse - phase column ( 3 . 0μ c - 18 ), a bas lc - 4c electrochemical transducer with a dual / glassy carbon electrode set at 650 mv , a computer that analyzes data on - line using a commercial software package ( chromograph bioanalytical systems ), and a dual pen chart recorder . the mobile phase ( flow rate 1 . 0 ml / min ) consisted of 7 . 0 % methanol , 50 mm sodium phosphate monobasic , 1 . 0 mm sodium octyl sulfate , and 0 . 1 mm edna , ph 4 . 0 . da eluted at 7 . 5 min . gamma - vinyl gaba ( gvg ), an irreversible inhibitor of gaba - transaminase , was administered by intraperitoneal injection 2 . 5 hours prior to pcp ( 7 mg / kg ). in all studies , animals were placed in the microdialysis bowls the night before the experiment and artificial cerebrospinal fluid ( acsf ) was perfused through the microdialysis probes at a flow rate of 2 . 0 μl / min . at the end of each study , animals were sacrificed and their brains were removed and sectioned for probe placement verification . levels of extracellular da were sampled from the nacc continuously using a stereoaxically implanted probe . the results are shown in fig1 ( pcp controls , n = 6 ; 150 mg / kg gvg , n = 3 ; 300 mg / kg gvg , n = 4 and 500 mg / kg gvg , n = 4 ) and pfc ( pcp controls , n = 5 ; 300 mg / kg gvg , n = 5 ). pcp alone increases da concentrations 407 % above baseline in the pfc and 117 % in the nacc ( p & lt ; 0 . 01 , t = 3 . 79 ). gvg dose dependently diminished the da response to pcp in the nacc , with no significant inhibition after 150 mg / kg , 62 % attenuation following 300 mg / kg ( p & lt ; 0 . 01 , t = 4 . 97 ) and 67 % attenuation following 500 mg / kg ( p & lt ; 0 . 001 , t = 6 . 02 ). pfc da activity was attenuated 67 % after gvg pretreatment ( p & lt ; 0 . 01 , t = 3 . 54 ), indicating the involvement of cortical gabaergic activity in nmda - antagonist induced da release . this data indicates the gabaergic system as a target for pharmacotherapies aimed at nmda antagonist models of pathophysiology . studies using 11c - raclopride , gvg , and pcp were performed in primates in an effort designed to extend these findings from changes in extracellular da concentration ( in vivo microdialysis ) to changes in synaptic concentrations measured by positron emission tomography ( pet ). pet studies were performed on four papio anubis baboons . in all cases , prior intravenous administration of 300 mg / kg gvg prevented the diminution of 11 c - ralcopride binding as a consequence of increases in synaptic dopamine following pcp administration ( 1 mg / kg ). the results of this example show that gvg effectively attenuates the elevations in nacc da produced by a pcp challenge . thus , drugs that selectively target the gabaergic system can be beneficial for the treatment of pcp addiction . more specifically , gvg - induced gaba - t inhibition , which produces an increase in extracellular brain gaba levels , represents an effective drug and novel strategy for the treatment of pcp addiction . while there have been described what are presently believed to be the preferred embodiments of the present invention , those skilled in the art will realize that other and further embodiments can be made without departing from the spirit of the invention , and it is intended to include all such further modifications and changes as come within the true scope of the claims set forth herein . bardo , m . t . ( 1998 ) neurophamacological mechanism of drug reward : beyond dopamine in the nucleus accumbens . crit . rev . neurobiol ., 12 : 37 - 67 . bolser , d . c ., blythin , d . j ., chapman , r . w ., egan , r . w ., hey , j . a ., rizzo , c ., kuo s .- c ., kreutner , w . ( 1995 ) the pharmacology of sch 50911 : a novel , orally - active gaba - b receptor antagonist . j . pharmacol . exp . ther ., 274 : 1393 - 1398 . bowery , n . g ., pratt , g . d . ( 1992 ) gabab receptors as targets for drug action arzneim . forsch ., 42 : 215 - 223 . brazell , m . p ., mitchell , s . n ., joseph , m . h ., gray , j . a . ( 1990 ) acute administration of nicotine increases the in vivo extracellular levels of dopamine , 3 , 4 - dihydroxyphenylacetic acid and ascorbic acid preferentially in the nucleus accumbens of the rat : comparison with caudateputamen . neuropharmacology , 29 : 1177 - 1185 . chesselet , m .- f . ( 1984 ) presynaptic regulation of neurotransmitter release in the brain : facts and hypothesis . neuroscience , 12 : 347 - 375 . childress , a . r ., mclellan , a . t ., o &# 39 ; brien , c . p . ( 1988 ) the role of conditioning factors in the development of drug dependence . psychiatr . clin . north amer ., 9 : 413 - 426 . childress , a . r ., mclellan , a . t ., ehrman , r . n ., o &# 39 ; brien , c . p . ( 1986a ) extinction of conditioned responses in abstinent cocaine or opioid users . nida res . monogr ., 76 : 189 - 195 . childress , a . r ., mclellan , a . t ., ehrman , r . n ., o &# 39 ; brien , c . p . ( 1986b ) classically conditioned responses in abstinent cocaine or opioid users . nida res . monogr ., 76 : 24 - 43 ). clarke , p . b . s ., fibiger , h . c . ( 1987 ) apparent absence of nicotine - induced conditioned place preference . psychopharmacology , 92 : 84 - 88 . clarke , p . b . s ., fu , d . s ., jakubovic , a ., fibiger , h . c . ( 1988 ) evidence that mesolimbic dopaminergic activation underlies the locomotor stimulant action of nicotine in animals . j . pharmacol . exp . ther ., 246 : 701 - 708 . damsma , g ., day , j ., fibiger , h . c . ( 1989 ) lack of tolerance to nicotine - induced dopamine release in the nucleus accumbens . eur . j . pharmacol ., 168 : 363 - 368 . dewey , s . l ., chaurasia , c . s ., chen , c ., volkow , n . d ., clarkson f . a ., porter , s . p ., straughter - moore , r . m ., alexoff , d . l ., tedeschi , d ., russo , n . b ., fowler , j . s . and brodie , j . d . gabaergic attenuation of cocaine - induced dopamine release and locomotor activity . synapse 25 : 393 - 398 , 1997 . dewey , s . l ., morgan , a . e ., ashby , jr ., c . r ., horan , b ., gardner , e . l ., logan , j ., volkow ,. n . d ., fowler , j . s ., kushner , s . a ., brodie , j . d . ( 1998 ) a novel strategy for the treatment of cocaine addiction . synapse , 30 : 119 - 129 . dewey , s . l ., smith , g . s ., logan , j ., brodie , j . d ., yu , d - w ., ferrieri , r . a ., king , p . t ., macgregor , r . r ., martin , t . p ., wolf , a . p ., volkow , n . d ., fowler , j . s . gabaergic inhibition of endogenous dopamine release measured in vivo with 11c - raclopride and positron emission tomography . j . neuroscience 12 , 3773 - 3780 , 1992 . dewey , s . l ., smith , g . s ., logan , j ., brodie , j . d ., fowler , j . s ., wolf , a . p . striatal binding of the pet ligand 11c - raclopride is altered by drugs that modify synaptic dopamine levels . synapse 13 , 350 - 356 , ( 1993 ). dewey , s . l ., smith , g . s ., logan , j ., simkowitz , p ., brodie , j . d ., volkow , n . d ., fowler , j . s ., wolf , a . p . ( 1993 ) effects of central cholinergic blockade on striatal dopamine release measured with positron emission tomography ( pet ) in normal human subjects . proc . natl . acad . sci ., 90 : 11816 - 11820 . di chiara , g ., imperato , a . ( 1988 ) drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving animals . proc . natl . acad . sci . usa , 85 : 5274 - 5278 . ehrman , r . n ., robbins , s . j ., childress , a . r ., o &# 39 ; brien , c . p . ( 1992 ) conditioned responses to cocaine - related stimuli in cocaine abuse patients . psychopharmacology , 107 : 523 - 529 . fudala , p . j ., iwamoto , e . t . ( 1986 ) further studies on nicotine - induced conditioned place preference . pharmacol . biochem . behav ., 25 : 1041 - 1049 . fudala , p . j ., teoh , k . w ., iwamoto , e . t . ( 1985 ) pharmacologic characterization of nicotine induced conditioned place preference . pharmacol . biochem . behav ., 22 : 237 - 241 . gardner , e . l . ( 1997 ) brain reward mechanisms in substance abuse : a comprehensive textbook , 3rd end ., eds . lowinson , j . h ., ruiz , p ., millmna , r . b . & amp ; langrod , j . g ., 51 - 85 ( williams and wilkins , baltimore , md ., 1997 ). grant , s . m . and heel , r . c . vigabatrin : a review of its pharmacodynamic and pharmacokinetic properties , and therapeutic potential in epilepsy and disorders of motor control . drugs , 41 : 889 - 926 , 1991 . henningfield , j . e . ( 1995 ) nicotine medications for smoking cessation . new eng . j . med ., 333 : 1196 - 1203 . 26 henningfield , j . e ., goldberg . s . r . ( 1983 ) control of behavior by intravenous nicotine injections in human subjects . pharmacol . biochem . behav ., 19 : 1021 - 1026 . henningfield , j . e ., london , e . d ., jaffe , j . h . ( 1987 ) nicotine reward : studies of abuse liability and physical dependence potential . in : brain reward systems and abuse , ed . by j . engel and l . oreland , new york , raven press , pp . 147 - 164 . henningfield , j . e ., miyasato , k ., d . r . jasinski ( 1983 ) cigarette smokers self - administer intravenous nicotine . pharmacol . biochem . behav ., 19 : 887 - 890 . horan , p ., smith , m ., gardner , e . lepore , m ., ashby , jr . c . r . ( 1997 ) (−)- nicotine produces conditioned place preference in lewis , but not fischer 344 animals . synapse , 26 : 93 - 94 . hurd , y . l ., mcgregor , a ., ponten , m . ( 1997 ) in vivo amygdala dopamine levels modulate cocaine self - administration behavior in the rat : d1 dopamine receptor involvement . eur . j . neuroscience , 12 : 2541 - 2548 . hurt , r . d ., sachs , d . p ., glover , e . d ., offord , k . p ., johnston , j . a ., dale , l . c ., khayrallah , m . a ., schroeder , d . r ., glover , p . n ., sullivan , c . r ., croghan , i . t ., sullivan , p . m . ( 1997 ) a comparison of sustained - release bupropion and placebo for smoking cessation . n . eng . j . med ., 237 : 1195 - 1202 . imperato , a ., mulas , a ., di chiara , g . ( 1986 ) nicotine preferentially stimulates dopamine release in the limbic system of the freely moving rat . eur . j . pharmacol ., 132 : 337 - 338 . jarvik , m .., henningfield , j . e . ( 1988 ) pharmacological treatment of tobacco dependence . pharmacol . biochem . behav ., 30 : 279 - 294 . jung , m . j ., lippert , b ., metcalf , b . w ., bohlen , p ., schechter , p . j . ( 1977 ) gamma - vinyl gaba ( 4 - amino - hex - 5 - enoic acid ), a new selective irreversible inhibitor of gaba - t : effects on brain gaba metabolism in mice . j . neurochem ., 29 : 787 - 802 . kerr , d . i . b ., ong , j ., prager , r . h . ( 1990 ) gabab receptor agonists and antagonists . in : gabab receptors in mammalian function , bowery , n . g ., bittiger , h . and olpe , h .- r . ( eds .) john wiley and sons , new york , pp . 29 - 45 . kushner , s . a ., dewey , s . l ., kornetsky , c . comparison of the effects of vigabatrin on cocaine self - administration and food reinforcement . soc . neuro . abstr . 23 : 1942 ( 1997a ). kushner , s . a ., dewey , s . l ., kometsky , c . the effects of gamma - vinyl gaba on cocaine - induced lowering of brain - stimulation reward thresholds . lacey , m . g ., mercuri , n . b . and north , a . n . on the potassium conductance increase activated by gabab and dopamine d 2 receptors in rat substantia nigra neurones . j . physiol . 401 : 437 - 453 , 1988 . logan , j ., fowler , j . s ., volkow , n . d ., wolf , a . p ., dewey , s . l ., schlyer , d . j ., macgregor , r . r ., hitzemann , r ., bendriem , b ., gatley , s . j ., christman , d . r . ( 1990 ) graphical analysis of reversible radioligand binding from time activity measurements applied to [ n - 11 c - methyl ]-(−)- cocaine pet studies in human subjects . j . cereb . blood flow and metab ., 10 : 740 - 747 . marshall , d . l ., redfern , p . h ., wonnacott , s . ( 1997 ) presynaptic nicotinic modulation of dopamine release in the three ascending pathways studied by in vivo microdialysis : comparison of naive and chronic nicotine - treated rats . j . neurochem ., 68 : 1511 - 1519 . morgan , a . e ., dewey , s . l . effects of pharmacologic increases in brain gaba levels on cocaine - induced changes in extracellular dopamine . synapse 28 , 60 - 65 ( 1998 ). nisell , m ., nomikos , g . g ., svensson , t . h . ( 1994a ) systemic nicotine - induced dopamine release in the rat nucleus accumbens is regulated by nicotinic receptors in the ventral segmental area . synapse , 16 : 36 - 44 . nisell , m ., nomikos , g . g ., svensson , t . h . ( 1994b ) infusion of nicotine in the ventral segmental area or the nucleus accumbens differentially affects accumbal dopamine release . pharmacol . toxicol ., 75 : 348 - 352 . nisell , m ., nomikos , g . g ., svensson , t . h . ( 1995 ) nicotine dependence , midbrain dopamine systems and psychiatric disorders . pharmacol . toxicol ., 76 : 157 - 162 . n . r ., van der kooy , g . f . & amp ; wenger , j . r . cholecystokinin produces conditioned place - aversion , not place - preferences , in food - deprived rats : evidence against involvement in satiety . life sci . 32 , 2087 - 2093 , ( 1989 ). o &# 39 ; brien , c . p ., childress , a . r ., mclellan , a . t ., ehrman , r . ( 1992 ) a learning model of addiction ,. in : addictive states , o &# 39 ; brien , c . p . and jaffe , j . h ., ( eds ), raven press , new york , pp . 157 - 177 . pontieri , f . e ., tanda , g ., orzi , f ., di chiara , g . ( 1997 ) effects of nicotine on the nucleus accumbens and similarity to those of addictive drugs . nature , 382 : 255 - 257 . porter , r . j ., meldrum , b . s . ( 1998 ) antiepileptic drugs . in : basic and clinical pharmacology , ed . by katzung , b . g ., appelton and lange , stamford , conn ., pp . 386 - 408 . roberts , d . c ., andrews , m . m . ( 1997 ) baclofen suppression of cocaine self - administration : demonstration using a discrete trials procedure . psychopharmacology , 131 : 271 - 277 . roberts , d . c ., andrews , m . m ., vickers , g . j . ( 1996 ) baclofen attenuates the reinforcing effects of cocaine in animals . neuropsychopharmacology , 15 : 417 - 423 . rocha , b . a ., scearce - levie , k ., lucas , j . j ., hiroi , n ., castanon , n ., crabbe , j . c ., nestler , e . j ., hen , r . ( 1998 ) increased vulnerability to cocaine in mice lacking the serotonin - 1b receptor . nature neuroscience , 393 : 175 - 178 . seeman , p ., guan , h . c ., niznik , h . b . ( 1989 ) endogenous dopamine lowers the dopamine d2 receptor density as measured by [ 3h ] raclopride : implications for positron emission tomography of the human brain . synapse , 3 : 96 - 97 . sora , i ., wichems , s . i ., takahashi , c ., li , x . f ., zeng , z ., revay , r ., lesch , k . p ., murphy , d . l ., uhl , d . r . ( 1998 ) cocaine reward models : conditioned place preference can be established in dopamine - and serotonin - transporter knockout mice . proc . natl . acad . sci ., u . s . a ., 95 : 7699 - 7704 . takada , k ., yanagita , t . ( 1997 ) drug dependence study on vigabatrin in rhesus monkeys and animals . arzneim - forsch drug res . 47 : 1087 - 1095 . tsuji m , nakagawa y , ishibashi y , yoshii t , takashima t , shimada m , suzuki t . ( 1995 ) activation of ventral segmental gaba - b receptors inhibits morphine - induced place preference in animals . eur . j . pharmacol ., 313 : 169 - 173 . valentine , j . d ., hokanson , j . s ., matta , s . g ., sharp , b . m . ( 1997 ) self - administration in animals allowed unlimited access to nicotine . psychopharmacology , 133 : 300 - 304 . van der kooy , k . ( 1987 ). in methods of assessing the properties of abused drugs , m . a . bozarth , ed ., springer - verlag , new york , pp . 229 - 241 . volkow , n . d ., wang , g . j ., fowler , j . s ., logan , j ., schlyer , d ., hitzemann , r ., liberman , j ., angrist , b ., pappas , n ., macgregor , r ., burr , g ., cooper , t ., wolf , a . p . imaging endogenous doparnine competition with [ 11c ] raclopride in the human brain . synapse , 16 , 255 - 262 ( 1994 ). wikler , a . ( 1965 ) conditioning factors in opiate addiction and relapse . in : narcotics , kassenbaum , g . g . and wilner , d . i . ( eds ), mcgraw - hill , new york , pp . 85 - 100 .
| 0 |
as used herein , the term “ automobile ” refers to a device for the ground transportation of passengers or cargo , where the device may or may not be independently powered . for example , the term “ automobile ” may refer to various types of cars , buses , pick - up trucks , flatbed trucks , trailers , 18 - wheelers , cargo vans , minivans , suv &# 39 ; s and the like . as used herein , “ mating ” of tiles may be accomplished when two or more tiles are sized and shaped to join or fit together in an interconnected and interlocking manner . interlocking of mated tiles provides a substantially snug fit , such that motion of each tile is constrained relative to the tile ( s ) with which it is mated , and little or no space exists between the edges of mated tiles . for example , two or more tiles may be mated using interlocking or interdigitated tabs . reference will now be made to the attached drawings , where like numbers represent similar elements in multiple figures . numbering without parentheses is used to denote a genus ( e . g ., modular weight system 100 ), whereas numbering with parentheses denotes a species within a genus ( e . g ., modular weight system 100 ( 2 )). multiple elements within a figure may not be labeled for the sake of clarity . fig1 is a top perspective view of an exemplary modular weight system 100 ( 1 ) configured for placement in a bed of a pick - up truck ( not shown ). in operation , modular weight system 100 ( 1 ) is sized and shaped to fit snuggly within the bed of a particular model and brand of truck , thereby minimizing movement of system 100 ( 1 ) during driving . modular weight system 100 ( 1 ) includes a plurality of individual tiles 102 ( 1 ) and 102 ( 2 ), which are releasably mated to one another at edges 104 of tiles 102 ( e . g ., by aligning edges 104 and setting them in place with a rubber mallet ). within system 100 ( 1 ), tiles 102 ( 1 ) are configured as corner pieces , and tiles 102 ( 2 ) are configured as center pieces having cutout portions 106 to accommodate wheel wells of a pick - up truck . in an alternate embodiment , when it is unnecessary to accommodate wheel wells of an automobile , tiles 102 ( 3 ) may be aligned with cutout portions 106 . in one example , tiles 102 ( 3 ) may contain interlocking tabs for mating of tiles 102 ( 3 ) with tiles 102 ( 2 ). use of tiles 102 ( 3 ) converts system 100 ( 1 ) into a rectangular weight system similar to system 100 ( 2 ) of fig2 . although fig1 shows six ( or eight ) tiles 102 , it will be appreciated that various layouts involving two , three , four , five , six , seven , eight , nine , ten or more tiles 102 may be used to create modular weight system 100 . modular weight system 100 may form various regular or irregular shapes without departing from the spirit and scope of what is described herein . further , tabs 202 ( fig2 ), which are used to releasably mate edges 104 of tiles 102 , may be formed in various sizes and shapes . fig2 is a top plan view of one exemplary modular weight system 100 ( 2 ) configured for placement in a square or rectangular cargo space of an automobile , such as a trunk or trailer . length , l , and width , w , of system 100 ( 2 ) may be adjusted to accommodate cargo spaces of various sizes by the addition or subtraction of tiles 102 ( 4 ). as discussed above , tiles 102 ( 3 ) may be used to convert system 100 ( 1 ) into a rectangular system such as system 100 ( 2 ). in another embodiment , tiles 102 ( 1 ) of fig1 may be joined directly to form a square or rectangular system such as system 100 ( 2 ). in general , tiles 102 have substantially flat top and bottom surfaces , which provide for the stable transport of most items , and the tiles are generally fabricated from chemically inert and durable material ( s ). tiles 102 may , for example , be fabricated from metal , rubber , plastic ( e . g ., polyurethane ) or a combination thereof ( e . g ., silicon rubber coated metal ). rubber or plastic tiles 102 may be fabricated using well known extrusion and injection molding procedures , whereas metal tiles 102 may be created using known metal working or melt casting techniques . in an embodiment , use of materials which are resistant to ultraviolet radiation ( uv ) may decrease a rate of decomposition of a modular weight system that experiences extended sun exposure ( e . g ., in an open pick - up truck ). uv resistant material may be used to form a monolithic tile 102 , or it may be used as a coating disposed around tile 102 . in an embodiment , a tile 102 may be fabricated , at least in part , from a magnetic material , such as stainless steel , ceramic or iron oxide , fe 3 o 4 . magnetic attraction between the tile and body of the automobile may help to immobilize the tile ( s ) during automobile movement . for example , a surface of tile 102 intended to contact the automobile may be fabricated of stainless steel , and other surfaces , e . g ., top and / or side surfaces , may be coated with a plastic , rubber or uv coating . in another embodiment , the magnetic field associated with a magnetic material may be sufficient to penetrate a coating that covers the entirety of tile 102 . the weight of each tile 102 is , for example , between 20 - 200 pounds , preferably between 40 - 100 pounds , and most preferably between 50 - 80 pounds . for personal vehicles , it is desirable that tiles 102 each weigh an amount that an average , healthy adult can lift without strain or injury . for commercial vehicles , heavier tiles may be used and , if necessary , the tiles may be placed in a cargo space using machinery ( e . g ., a fork lift ). modular weight systems 100 typically weigh between 40 - 2000 pounds , preferably between 100 - 1000 pounds , and most preferably between 200 - 800 pounds . generally , each tile 102 has a width of about 24 - 75 inches , a length of about 24 - 75 inches , and a height or thickness of about 1 - 4 inches . tiles 102 typically have a ratio of surface area ( in inches ) to weight ( in pounds ) that is less than 30 : 1 , preferably between 2 . 5 : 1 to 25 : 1 , more preferably between 3 . 5 : 1 to 15 : 1 , and most preferably between 4 . 5 : 1 to 10 : 1 . the weight of each tile 102 may be controlled by appropriate selection of the fabrication material ( s ). in an embodiment , tile 102 may be formed as a monolithic mass where the physical weight of the fabrication material may be sufficient to improve automobile traction . in another embodiment , tile 102 may be filled or doped with a heavy filler material , such as sand , stone or shot . when the filler material is stone or shot , for example , the material may have a diameter between 0 . 1 and 1 inch , preferably between 0 . 1 and 0 . 5 inches . additionally , a coating may be disposed around a monolithic tile , a filled tile , or a doped tile to maintain integrity and / or increase durability of the tile . for example , tile 102 may comprise a monolithic steel plate coated with rubber . fig3 is a top perspective view of a tile 102 ( 5 ) having an internal cavity 302 for receiving filler material 304 . following insertion of filler material 304 into cavity 302 , a lid 306 ( 1 ) may be factory bonded or glued to a base 308 . alternatively , cavity 302 may be filled by an end user and lid 306 ( 1 ) may securely , and optionally releasably , mate with base 308 . in an embodiment , a latching and / or locking mechanism may be used to secure lid 306 ( 1 ) to base 308 . in another embodiment , epoxy may be used to permanently mate lid 306 ( 1 ) and base 308 . as described above with respect to fig2 , tabs 202 may releasably mate edges of one tile 102 ( 5 ) with an adjacent tile 102 ( 5 ). fig4 is a top perspective view of a tile 102 ( 6 ) having an internal cavity 302 and hinged lid 306 ( 2 ). in addition to one or more hinges 402 , tile 102 may contain a latching and / or locking mechanism to secure filler material 304 within tile 102 ( 6 ). in another example , filler material 304 may be distributed throughout the fabrication material . fig5 is a partial cutaway view of one tile 102 ( 7 ) having a doped inner material 502 and an outer coating 504 . for example , inner material 502 may be rubber doped with a filler material 304 ( e . g ., steel shot ), which is then encased within a coating 504 of silicone rubber . in another embodiment , inner material 502 and coating 504 may be formed of the same fabrication material ( e . g ., rubber ) except that inner material 502 may be doped and coating 504 may not contain filler material . in yet another embodiment , inner material 502 may be doped with a fine grain filler material 304 , such as sand , and coating 504 may not be present . fig6 is a top perspective view of a tile 102 ( 8 ) having a top portion 602 and a bottom portion 604 that are permanently or semi - permanently bonded together . for example , top and bottom portions 602 , 604 may be bonded together using epoxy , rubber cement , glue , caulk , welding material or another bonding material known in the art . although fig6 shows tile 102 ( 8 ) containing only two portions 602 and 604 , it will be appreciated that tile 102 ( 8 ) may alternatively include three , four , five , ten , twenty or more portions . in an embodiment , top portion 602 and bottom portion 604 may be similarly shaped so that there are no overhanging parts when portions 602 and 604 are aligned and bonded . in another embodiment ( shown in fig6 ), top portion 602 and bottom portion 604 have different shapes , and one or more overhanging parts 606 exist . it will be appreciated that a second tile 102 ( 8 )′ ( not shown ) that is configured to be joined with tile 102 ( 8 ) will have an arrangement of overhanging parts 606 that is complementary to that of tile 102 ( 8 ). tiles 102 ( 8 ) and 102 ( 8 )′ may therefore be interdigitated or interlocked along a vertical axis defined by the thickness of a tile 102 . interdigitation along the vertical axis , as well as along the lateral and longitudinal axes ( fig2 , l and w ) using tabs 202 , provides improved stability during vehicle movement . in one example , one or more overhanging parts 606 of tile 102 ( 8 ) may be bonded to one or more complementary overhanging parts 606 ′ of tile 102 ( 8 )′. bonding of the overhanging parts 606 , 606 ′ may be permanent , semi - permanent or temporary . for example , temporary bonding may be accomplished using velcro ®, magnets , reusable adhesives and / or other means known in the art . changes may be made in the above systems and methods without departing from the scope hereof . it should thus be noted that the matter contained in the above description or shown in the accompanying drawings should be interpreted as illustrative and not in a limiting sense . the following claims are intended to cover all generic and specific features described herein , as well as all statements of the scope of the present systems and methods , which , as a matter of language , might be said to fall there between .
| 1 |
in the description of the preferred embodiments , and with reference to the drawings , the following designations are used : drawing designation definition ra right atrium rv right ventricle rh ra and rv lh la and lv la left atrium lv left ventricle las left atrial sense ras right atrial sense lap left atrial pace pulse lvp left ventricular pace pulse rmavd time interval between ras and mechanical contraction of rv ( as measured , e . g ., by valve closure ) lmavd time interval between las or lap and mechanical contraction of lv ravd time interval between ras and qrs in rv lavd time interval between las or lap , and qrs in lv referring now to fig1 there is shown a schematic representation of a four - chamber pacing system , illustrating four pacing leads providing bipolar electrodes positioned for pacing and sensing in each of the respective heart chambers , and also for impedance measurements . pacing lead 38 is positioned conventionally such that its distal end is in the right ventricular apex position . it carries bipolar electrodes 38 a and 38 b adapted for pacing and sensing ; additionally , these electrodes can also be used for impedance sensing as discussed below . likewise , atrial lead 36 is positioned so that its distal end is positioned within the right atrium , with bipolar electrodes 36 a , 36 b . lead 34 is passed through the right atrium , so that its distal end is positioned in the coronary sinus for pacing , sensing and impedance detection through electrodes 34 a , b , as shown . likewise , lead 32 is positioned via the coronary sinus a cardiac vein , e . g ., the middle or great cardiac vein , so that distal electrodes 32 a and 32 b are positioned approximately as shown for pacing , sensing and impedance detection with respect to the left ventricle . the pacing leads are connected to pacemaker 30 in a conventional manner . it is to be understood that each of the four leads can have one or more additional electrodes ; however , by using time multiplexing techniques as discussed below and in the referenced u . s . pat . no . 5 , 501 , 702 , pacing , sensing and impedance detection can be accomplished with only two electrodes per lead . referring now to fig2 a and 2b , there is shown a simplified block diagram of a four channel pacemaker in accordance with this invention , having the additional capability of impedance detection to sense valve movement of the left and right ventricles . although discussion of fig2 a is presented with respect to valve movement , it is to be understood that the impedance detection scheme may be altered to detect other mechanical events , such as ventricular wall contraction , in a known manner . the system of fig2 a contains , in the pacemaker , a central processing block 40 , indicated as including timing circuitry and a microprocessor , for carrying out logical steps in analyzing received signals , determining when pace pulses should be initiated , etc ., in a well known fashion . referring to the upper left - hand corner of the block diagram , there is shown signal amplifier circuitry 41 , for receiving a signal from the right atrium . electrode 36 a is illustrated as providing an input , it being understood that the second input is received either from bipolar electrode 36 b , or via an indifferent electrode ( the pacemaker can ) in the event of unipolar sensing . likewise , a pulse generator 42 , acting under control of block 40 , generates right atrial pace pulses for delivery to electrode 36 a and either electrode 36 b or system ground . in a similar manner , right ventricular pace pulses ( rvp ) are generated at output stage 43 and connected to electrode 38 a , and sensed right ventricular signals are inputted to sense circuitry 44 , the output of which is delivered to control block 40 . also illustrated is impedance detector 45 , which receives inputs from electrodes 36 a , 38 a , for delivering information corresponding to right heart valve closure , which timing information is inputted into control block 40 . thus , the system enables pacing and sensing in each chamber , as well as impedance detection to provide an indication of the timing of right heart valve closure , which represents the time of mechanical contraction of the right valve . still referring to fig2 a , there are shown complementary circuit components for the left atrium and the left ventricle . output generator stage 47 , under control of block 40 , delivers left atrial pace pulses ( lap ) to stimulate the left atrium through electrode 34 a and either electrode 34 b or system ground . inputs from the left atrial lead are connected through input circuitry 46 , the output of which is connected through to control block 40 . in a similar fashion , output stage 48 , under control of block 40 , provides left ventricular stimulus pace pulses ( lvp ) which are delivered across electrode 32 a and either electrode 32 b or system ground ; and left ventricular signals are sensed from lead 32 and inputted to input circuit 49 , which provides an output to block 40 indicative of left ventricular signals . also , dual inputs from the left atrial electrode 34 a and left ventricular electrode 32 a are inputted into left heart impedance detector 50 , which provides timing pulses to block 40 indicative of the timing of left heart ( mitral ) valve closure . with this arrangement , the pacemaker has the basic timing and cardiac signal information required to program delivery of pace pulses to respective heart chambers in accordance with this invention . block 40 contains current generators for use in impedance detection ; microprocessor or other logic and timing circuitry ; and suitable memory for storing data and control routines . referring to fig2 b , there is shown a diagrammatic sketch of an arrangement for detecting left ventricular impedance change , which is processed in block 40 to obtain an indication of cardiac output . as shown , a current source 52 provides a constant current source across electrode 53 in the right atrium , which suitably can be electrode 36 a ; and right ventricular electrode 54 , which suitably can be electrode 38 a . the current source can be pulsed , or it can be multiplexed in a manner as discussed below . impedance sensors 57 and 58 provide signals representative of impedance changes therebetween , the impedance being a function of blood volume and valve closure , as discussed above . the outputs from electrodes 57 , 58 is connected across impedance detector 56 , which represents the microprocessor and / or other processing circuitry in block 40 for analyzing the impedance changes and making a determination of cardiac output . as is known , a measure of cardiac output can be obtained by extracting the first time derivative of cyclical impedance changes , dz / dt ; a linear relationship exists between peak dz / dt and peak ejection rate . referring now to fig3 there is shown a block diagram of a pacemaker 30 in accordance with a preferred embodiment of this invention , for multiplexing connections to electrodes so as to provide for pacing and sensing in any one of the four cardiac chambers , as well as for impedance determinations between respective different lead electrodes . reference is made u . s . pat . no . 5 , 501 , 702 , incorporated herein by reference , for a full discussion of this circuit , and in particular the multiplexing arrangement carried out by switch matrices 68 , 70 . the pacemaker 30 operates under control of circuitry 62 , which may include a microprocessor or custom integrated circuitry , as well as associated memory , in a manner well known in the pacemaker art . circuitry 62 provides for processing of data , and generation of timing signals as required . control circuitry 62 is coupled to pace / sense circuitry 64 , for processing of signals indicating the detection of electrical cardiac events , e . g ., p - waves , r - waves , etc . sensed from conductors which connect electrically to electrodes 32 a - 38 b , as shown . the aforementioned leads are also coupled to a first switch matrix 68 and a second switch matrix 70 . matrix 68 establishes a selectable interconnection between specific ones of the electrodes of leads 32 , 34 , 36 and 38 , and the current source 72 , is controlled by circuit 62 . in a similar manner , switch matrix 70 establishes a selectable interconnection between lead conductors corresponding to selected electrodes , and impedance detection circuit 74 , for the purpose of selecting impedance measurements . still referring to fig3 current source 72 receives control signals on line 73 from circuitry 62 , and is responsive thereto for delivering constant current rheography pulses onto lead conductors selected by switching matrix 68 , which in turn is switched by signals on bus 83 . impedance detection circuit 74 is adapted to monitor the voltage between a selected pair of electrodes which pair is selectably coupled by operation of switch matrix 70 which in turn is switched by signals on bus 80 . in this manner , circuit 74 determines the voltage , and hence the impedance , existing between two selected electrodes . the output of circuitry 74 is connected through a / d converter 76 to control circuitry 62 , for processing of the impedance signals and determination of the occurrence of mechanical events , such as left or right heart valve closure . the control of switch matrix 68 through signals on bus 78 , and the control of switch matrix 70 through signals on bus 80 , provides for multiplexing of different impedance signals . it is to be understood that in the system arrangement of fig3 pace / sense circuitry 64 may include separate stimulus pulse output stages for each channel , i . e ., each of the four - chambers , each of which output stages is particularly adapted for generating signals of the programmed signal strength . likewise , the sense circuitry of block 64 may contain a separate sense amplifier and processor circuitry for sensed signals from each chamber , such that sensing of respective wave portions , such as the p - wave , r - wave , t - wave , etc . from the rh and the lh , can be optimized . the pulse generator circuits and sense circuits as used herein are well known in the pacemaker art . in addition , other functions may be carried out by the control circuitry including standard pacemaker functions such as compiling of diagnostic data , mode switching , etc . referring now to fig4 there is shown a logic control flow diagram for controlling the system of this invention to pace a patient with lbbb . the assumption is that the rh is normal , and that sinus signals from the sa node are being normally conducted to the la ; but that the lbbb is manifested by slow conduction to the lv , such that the lv does not contract when it should . as a consequence , there is mitral regurgitation , or backflow of blood through the valve because the lv does not contract when it is filled from the la ; and the contraction of the lv , when it occurs , is later than that of the rv , further contributing to decrease of lh output . as seen at 101 , the pacemaker monitors the rh , and gets a measure of rmav . this is done by sensing right valve closure through rh impedance measurement , and timing the delay from the atrial depolarization ( ras ) to valve closure . then , at 102 , the pacemaker is controlled to pace lv with an lavd such that lmavd is about equal to rmavd . during this step , impedance measurements are made in the lv , and a measure of lmavd is obtained . based on this determination , the value of lavd is adjusted to substantially match lmavd with rmavd . note that normal conduction through the lv takes on the order of 50 - 60 ms , so it is expected that the lv should be paced in advance of the occurrence of rv valve closure , so that lv valve closure occurs at about the same time as , or even a bit before rv valve closure . causing the lv to contract just before the rv might provide an increase of lh output which outweighs the small resulting rv dysfunction due to the septum being pulled toward the lv first . thus , the timing of delivery of each lvp is adjusted to set lmavd approximately equal to rmavd . then , at 104 , the value of lavd is further adjusted , while r and l valve closure is monitored , and lmavd is adjusted relative to rmavd . this adjustment , or variation of lmavd , may be made by incrementally changing lavd each cycle , or each n cycles , to scan relative to the value of rmavd . cardiac output is obtained through a left heart impedance measurement , and appropriate signal processing , for each setting of the differential between the right and left valve closures , and respective values of co and lmavd are stored at 105 . the highest , or maximum value of cardiac output is determined , and lavd is set so that the resultant mlavd is at the differential compared to rmavd to yield the highest cardiac output . in this manner , the timing of left ventricular pace pulses is set to produce substantial bi - ventricular mechanical synchronization for the greatest cardiac output . the determined value of lavd and the corresponding lv - rv difference is stored . still referring to fig4 at 106 the pacemaker proceeds to pace the lv with this established value of lavd , providing mechanical synchronization . of course , if the natural sinus rate varies , the pacemaker wants to follow ; if the spontaneous ravd varies , but the lavd doesn &# 39 ; t follow the change , the mechanical synchronization will be lost . accordingly , at 107 the pacer monitors the natural sinus rate , or atrial pacing rate , and determines if there has been a significant change in atrial rate . if yes , at 109 , the pacer adjusts lavd accordingly to maintain mechanical sync for optimum output . although not shown , the pacemaker can periodically go back to block 101 to re - determine the desired value of lavd . referring now to fig5 there is shown a flow diagram for pacing of a patient with iab ; such patient may have lbbb as well . here , it is necessary to take control of the la by pacing before atrial depolarization is conducted ( late ) to the la . at 110 , the pacemaker monitors the pattern of la depolarization relative to ra depolarization , i . e ., it determines the inter - atrial delay . at 111 , it is determined whether the la should be paced , based on the atrial depolarization pattern . if yes , the pacemaker sets an ra - la delay at 112 , which corresponds to a healthy heart , and which enables capture of the la . at 114 , the value of rmavd is obtained , as was described in connection with fig4 . then , at 116 , lavd is determined for a first setting of mechanical sync ; this can be done by setting lavd to produce lv contraction at the same time as rv contraction ( valve closure ), or earlier by a small time increment . then , lavd is varied , as shown at 117 , and lmavd and co are determined corresponding to each value of lavd . the value of lavd is set to that value which corresponds to maximum cardiac output , and this value and the lv - rv mechanical relation , or mechanical sync value is stored for the chosen lavd . at 118 , the pacemaker paces la and lv , in accord with the values that have been determined . in the event of significant change in atrial rate , lavd is adjusted to compensate for the rate change , and to substantially maintain the lv - rv mechanical relationship previously found to correspond to maximum cardiac output , as shown at 120 , 121 . although not shown , in the event of large changes in the sinus rate , or passage of a predetermined amount of time , determination of inter - atrial delay and lavd can be repeated automatically . referring now to fig6 there is shown a simplified flow diagram for a procedure in accordance with this invention for carrying out bi - ventricular pacing so as to maximize cardiac output ( co ). this routine is adapted for patients who need right ventricular pacing , and who can benefit from synchronous left ventricular pacing as well . in this example , it is assumed that atrial pacing is not required , but if the patient requires atrial pacing , the routine can be adapted appropriately . at block 130 , a common value of av delay ( avd ) is first set . at block 132 , both the left ventricle and the right ventricle are paced , initially with the previously set value of avd , but then with a varying avd . as avd is varied , or scanned relative to the initial setting , the pacemaker makes determinations of cardiac output by processing impedance signals from the left heart , or left ventricle , in the manner discussed above . values of co are stored together with the different values of avd , and the optimum value of a common avd is determined corresponding to maximum co . then , at block 134 , the value of lavd is varied relative to ravd , such that the left pacing pulse is delivered at differing times from the right pacing pulse . it is to be remembered , as discussed above , that for maximum cardiac output , it may be desirable to pace the left ventricle shortly before the right ventricle , and this step is a searching step to determine the time relationship between the two ventricular pace pulses which results in the best cardiac output . co is determined as the ventricular sync relationship is varied , and the corresponding optimum lavd is determined . when this has been obtained , the routine goes to block 136 and paces the patient at the determined values of lavd and ravd . periodically , as indicated at 138 , the pacemaker can determine whether a test is desired . if yes , the routine branches back to 130 , to loop through the test and redetermine the optimum values of lavd and ravd . it is to be noted that the steps of blocks 132 and 134 can be done in a reverse sequence , i . e ., step 134 first and then step 132 . referring now to fig7 there is shown an alternate block diagram of component portions of a pacemaker in accordance with this invention , for providing maximum flexibility in terms of pacing , cardiac signal sensing and impedance sensing . at least two electrodes are positioned in or proximate to each heart chamber , in the manner as discussed above in connection with fig1 and connected in turn to block 150 . as indicated in fig7 block 150 is an output / input switch matrix , and interconnects with block 152 in the manner as described in fig3 . thus , block 152 provides pacing pulses which can be connected through matrix 150 to each of the four chambers , and has sense amplifier circuitry for sensing signals from each of the four chambers . block 150 further provides a multiplex switch array for switching a current source across selected pairs of the eight electrodes for impedance measuring purposes , again in accordance with the discussion of fig3 . the sensed impedance signals are suitably transferred from array 150 to digital signal processing circuitry 161 , which is part of block 152 . block 152 is in two - way connection with the timing modules shown in block 154 , for timing generation of pace pulses , current source pulses , and the generation of sensing windows . blocks 150 , 152 and 154 are further inter - connected by control bus 163 . data is transferred between signal processing block 170 and block 154 across data bus 157 . block 154 in turn is inter - connected with microprocessor 156 , through household bus 151 , data bus 153 and control bus 154 . by this arrangement , impedance sensing can be carried out across any combination of the four heart chambers , e . g ., right atrium vs . left atrium ; right ventricle vs . left ventricle ; right atrium vs . left ventricle ; and left atrium vs . right ventricle . impedance measurements between these combinations of chambers can be carried out in accordance with this invention , for purposes of analyzing and confirming arrhythmias , including fibrillation . further , changes in conduction patterns , as seen in the morphology of such impedance measurements , can be monitored and processed for making determinations of progression of heart failure . thus , cross - measurements of ra - lv and la - rv can be useful in obtaining histories to determine changes indicating progression of heart failure . referring now to fig8 a , at block 160 , the pacemaker first obtains impedance measurements either between la and ra , or between lv and rv . these impedance values are processed at 162 , and at 164 a determination is made as to whether the atrial or ventricular rhythms are regular or non - physiological . this determination can be made , for example , simply by sensing differences over time and comparing such differences to predetermined criteria . if a rhythm is determined not to be regular , then a determination of arrhythmia is made at 166 . a suitable response is made at 168 . referring to fig8 b , at block 170 the pacemaker obtains cross - measurements of impedances , e . g ., between ra and lv or between la and rv . these measurements are stored and processed as indicated at 172 , and evaluated at 174 to determined whether they indicate hf or progression toward hf . if yes , an appropriate response can be made , illustrated at 176 , e . g ., providing a warning which can be retrieved by an external programmer . the scope of the invention extends to other conditions of chf , in addition to the ones illustrated here . in each case , the condition of the patient must be responded to on an individual basis . however , in accordance with this invention , the system response includes a determination of mechanical events , e . g ., valve closure , preferably in each side of the heart , and programming of pacing escape intervals based on consideration of the mechanical events and a determination of variations of cardiac output with variations of lavd and / or mechanical ventricular synchronization . the system of this invention can be used in an implanted pacemaker system ; or , the system procedures can be carried out with an external system , for determination of optimum programming of a pacemaker which is to be implanted or re - programmed .
| 0 |
the following discussion describes in detail embodiments of the invention and variations of that embodiment . this discussion should not be construed , however , as limiting the invention to those particular embodiments , practitioners skilled in the art will recognize numerous other embodiments as well . fig1 is an illustrative view of the ges 100 design in use by an individual , the prime embodiment of the present invention . in ges 100 design , frameless glasses are fixedly attached to piercing studs within the eyebrow of the intended user wherein the gnb design 200 is such that the frameless glasses are fixedly attached to the bridge of a nose stud of the intended user . at a distance , such as seen in fig1 , it would not be easily determinable which design the user employs . in each design , the frameless glasses are easily attached or detached from the stud or nose bridge . fig2 is a close up illustrative view of ges 100 in use . ges 100 is designed to attach to pierced eyebrow studs . each lens 11 is attached to bridge 10 via a screw 20 , washers 19 , and nut 21 ( or other means ). nose rests 12 are attached to leg extensions of bridge 10 and supply comfort in user wear . metal arm 15 is attached at each end of each outer lens 11 via a screw 20 , two washers 19 , and a nut 21 ( see fig4 for detail ). it should be noted that the attachment of metal arm 15 to lens 11 could be accomplished by means other than a screw 20 / nut 21 combination . for example , a rivet or other means could accomplish the same functional result . flexible rubber clip insert 14 has an elastomeric c - shaped tip fixedly attached to one distal end for attachment to eyebrow stud 13 . further detail will be illustrated in fig3 and 4 . fig3 is a top perspective view of ges 100 design for attachment to user eyebrow pierced studs . ges 100 attaches to the eyebrow stud ( not shown ) via flexible rubber ( elastomeric ) c - clips 14 which are fixedly attached to each distal end of each metal arm 15 . each metal arm 15 is attached to each frameless lens 11 by means of metal arm attach assemble 16 which consist of a treaded bolt , two washers 19 , and a nut 21 . bridge 10 attaches to each lens 11 via a bridge attach assembly 17 , which is similar to metal arm attach assembly 16 ( threaded bolt , two washers , and a nut ). bridge 10 employs bridge extension arms 18 on each side to accommodate nose rest 12 attachments . it should be noted that lens 11 could be made of various materials and can be prescription or non - prescription type lens . lens 11 could be of various shades for sun protection , eye safety protection , night driving , etc . fig4 is a sectional end view of ges 100 design showing the eyebrow stud attachment end of the ges 100 . shown is frameless lens 11 attachment to metal arm 15 by means of screw 20 , and washer 19 on each side of lens 11 , and fastening nut 21 . flexible rubber clip insert 14 attaches to one distal end metal arm 15 . metal arm 15 employs metal arm internal dimple 22 to hold flexible rubber clip insert 14 in place . flexible rubber clip insert 14 attaches to an eyebrow stud ( not shown ) via its elastomeric c - shaped tip fixedly attached to one distal end . it should be noted that the assembly of metal arm 15 to lens 11 could be accomplished by alternate means ( not shown ) such as a rivet or compression type pin , etc . fig5 is a top view of the ges 100 design . shown are the frameless glass lenses 11 , that attach to a users pierced eyebrow studs by means of flexible elastomeric c - clip 14 , which is fixedly positioned to distal end of each metal arm 15 . metal arm 15 is attached to the frameless glass lens 11 by means of metal arm attach assembly 16 which consists of a threaded bolt , two washers 19 , and a nut 21 . also shown in fig5 top view is bridge 10 with bridge extension arms 18 to attach nose rest 12 . bridge 10 assemblies to each lens 11 by means of bridge attach assembly 17 . fig6 is a front view of the gnb 200 design attached to an individual for use with a pierced nose bridge stud 24 , an alternate embodiment of the present invention . shown is each frameless glass lens 11 , flexible rubber clip 14 , flexible rubber clip assembly 22 , which consists of a screw 20 , washers 19 , and a nut 21 , and nose rests 12 . gnb 200 attaches to pierced nose bridge stud 24 by means of a flexible elastomeric c - clip fixedly positioned to one distal end of flexible rubber clip 14 . fig7 is a top perspective view of the gnb 200 design , an alternate embodiment of the present invention , for attachment to pierced nose bridge stud 24 . short bridge 25 contains two distal ends and a center point for attachment to lens 11 . flexible rubber c - clip 14 is fixedly attached to one distal end of short bridge 25 . one distal end of each flexible rubber c - clip 14 is “ c ” shaped for attachment to pierced nose bridge stud 24 . short bridge 25 attaches to lens 11 via c - clip attach assembly 22 , which consists of a threaded bolt , two washers 19 , and a nut 21 , and the other distal end of each short bridge 25 , bridge extension arms 18 , and accepts each nose rest 12 . also shown is nose stud 23 , which holds pierced nose bridge stud 24 in place on user . fig8 is a top view of the gnb 200 design , an alternate embodiment of the present invention , for attachment to pierced nose bridge stud 24 . short bridge arm 25 contains two distal ends and a center point to attachment to lens 11 . flexible rubber c - clip 14 is fixedly attached to one distal end of short bridge 25 . one distal end of each flexible rubber c - clip 14 is “ c ” shaped for attachment to pierced nose bridge stud 24 , which consists of threaded bolt , two washers 19 , and a nut 21 , and the other distal end of each short bridge 25 , bridge extension arms 18 , accepts each nose rest 12 . also shown is nose stud screw 23 , which holds pierced nose bridge stud 24 in place on user . it should be noted that c - clip attach assembly 22 could easily be replaced with another attachment mechanism , such as a rivet , compression clip , etc . in attaching each lens 11 . fig9 is a detailed close top view of the gnb 200 design , an alternate embodiment of the present invention , for attachment to pierced nose bridge stud 24 . each lens 11 attaches to each short bridge 25 by means of c - clip assembly 22 . flexible rubber c - clip 14 is fixedly attached to one distal end of short bridge 25 and nose rest 12 is attached to bridge extension arms 18 of short bridge 25 . flexible rubber c - clip 14 is “ c ” shaped for attachment to pierced nose bridge stud 24 . nose stud screw 23 hold holds pierced nose bridge stud 24 in place on a user . it should be noted that c - clip attach assembly 22 could easily be replaced with another design mechanism , such as a rivet , compression clip , etc . in attaching each lens 11 . fig1 is an illustrative view of the gces 300 design , an alternate embodiment of the ges 100 design , shown in use and attached to eyebrow studs 13 , which are closer to the center face . in this glass to close eyebrow stud ( gces 300 ) design , all parts are common to ges 100 design shown previously . gces 300 is designed for application where eyebrow studs 13 have been moved to the nose bridge area of a user . one important aspect of this alternate embodiment is that all parts are a subset of ges 100 design . each lens 11 and metal arm 15 is attached to bridge 10 via a screw 20 , washers 19 , and nut 21 ( or other means ). nose rests 12 are attached to leg extension of bridge 10 and supply comfort in user wear . it should be noted that the attachment by means other than a screw 20 / nut 21 combination . for example , a rivet or other means could accomplish the same functional result . flexible rubber clip insert 14 has an elastomeric c - shaped tip fixedly attached to one distal end for attachment to eyebrow stud 13 . further detail will be illustrated in fig1 . it should be noted that although fig1 shows attachment to an eyebrow stud 13 , this design could easily attach to a nose stud . fig1 is a top view of the gces 300 design , alternate embodiment of the ges 100 design for attachment to dual eyebrow studs which are closer to the center face . in this glass to close eyebrow stud ( gces 300 ) design , many parts are common to ges 100 design shown previously . gced 300 is designed for application where eyebrow studs 13 have been moved to the nose bridge area of a user . one important aspect of this alternate embodiment is that all parts are a subset of ges 100 design . each lens 11 and metal arm 15 is attached to bridge 10 via a screw 20 , washers 19 , and nut 21 ( or other means ). nose rests 12 are attached to bridge extension arms 18 of bridge 10 and supply comfort to user wear . it should be notes that the attachment of metal arm 15 and bridge 10 to lens 11 could be accomplished by means other than a screw 20 / nut 21 combination . for example , a rivet or other means could accomplish the same functional result . flexible rubber clip insert 14 has an elastomeric c - shaped tip fixedly attached to one distal end for attachment to eyebrow stud 13 .
| 0 |
a preferred embodiment of the present invention is a compound of the formula ( i ): ## str3 ## wherein the dotted lines indicate a single or a double bond ; r 1 is selected from the group consisting of hydrogen , hydroxy , nitrite ester ( ono ), nitrate ester ( ono 2 ), halogen , haloalkyl , heterocyclic group of 2 to 5 carbon atoms and 1 to 2 hetero atoms , nitroxyalkanoyl group of 2 to about 6 carbon atoms , sulfhydryl , lower thioalkyl group of 1 to about 6 carbon atoms , lower alkoxy group of 1 to about 6 carbon atoms , alkylsilyloxy group of 3 to about 8 carbon atoms , lower alkyl group of 1 to about 6 carbon atoms , wherein all said radicals may optionally be substituted with hydroxy , halogen , lower alkyl , lower alkenyl , lower alkynyl , lower alkoxy , amino , nitro , nitril , carboxyl and haloalkyl radicals , oco -- r 7 wherein r 7 is alkanoic acid group of 2 to about 6 carbon atoms , lower alkyl group of 1 to about 6 carbon atoms , lower alkenyl group of 2 to about 6 carbon atoms , lower alkynyl group of 2 to about 6 carbon atoms , or lower alkoxy group of 1 to about 6 carbon atoms group ; r 2 is selected from the group consisting of hydrogen , hydroxy , oxygen , nitrite ester ( ono ), nitrate ester ( ono 2 ), nitroxyalkanoyl group of 2 to about 6 carbon atoms , lower alkoxy group of 1 to about 6 carbon atoms , alkylsilyloxy group of 3 to about 8 carbon atoms , lower alkyl group of 1 to about 6 carbon atoms , wherein all said radicals may optionally be substituted with hydroxy , lower alkyl , lower alkenyl , lower alkynyl , lower alkoxy , amino , nitro , nitril , carboxyl and haloalkyl radicals , oco -- r 8 wherein r 8 is alkanoic acid group of 2 to about 6 carbon atoms , lower alkyl group of 1 to about 6 carbon atoms , lower alkenyl group of 2 to about 6 carbon atoms , lower alkynyl group of 2 to about 6 carbon atoms or lower alkoxy group of 1 to about 6 carbon atoms group ; r 3 and r 4 are independently selected from the group consisting of hydrogen , hydroxy , nitrite ester ( ono ), nitrate ester ( ono 2 ), nitroxyalkanoyl group of 2 to about 6 carbon atoms , lower alkyl group of 1 to about 6 carbon atoms , lower alkenyl group of 2 to about 6 carbon atoms , lower alkynyl group of 2 to about 6 carbon atoms , lower alkoxy group of 1 to about 6 carbon atoms , wherein all said radicals may optionally be substituted with hydroxy , lower alkyl , lower alkenyl , lower alkynyl , lower alkoxy , amino , nitro , nitril , carboxyl and haloalkyl radicals ; and a group of formula oco -- r 9 wherein r 9 is 2 - furanyl , lower alkyl group of 1 to about 6 carbon atoms or lower alkoxy group of 1 to about 6 carbon atoms ; p and q are independently selected from a group consisting of hydrogen , chloro , fluoro and alkyl group of 1 to about 6 carbon atoms ; x is lower alkyl group , or sulfur if r 1 is a haloalkyl ; and with the proviso that at least one of the following r 1 , r 2 , r 3 or r 4 is a nitrite ester ( ono ) and that at least one of the following r 1 , r 2 , r 3 or r 4 is nitrate ester ( ono2 ). another preferred embodiment of the present invention is a compound of the formula ( i ): ## str4 ## wherein ; r 1 is selected from the group consisting of hydrogen , hydroxy , nitrite ester ( ono ), nitrate ester ( ono 2 ), halogen , haloalkyl , sulfhydryl , heterocyclic group of 3 to 4 carbon atoms and 1 to 2 hetero atoms , nitroxyalkanoyl group of 2 to about 4 carbon atoms , lower alkoxy group of 1 to about 4 carbon atoms , alkylsilyloxy group of 3 to about 6 carbon atoms , lower alkyl group of 1 to about 4 carbon atoms , wherein all said radicals may optionally be substituted with hydroxy , chloro , fluoro , lower alkyl , lower alkenyl , lower alkynyl , lower alkoxy , amino , nitro , nitril , carboxyl , haloalkyl radicals and oco -- r 7 wherein r 7 is alkanoic acid group of 2 to about 4 carbon atoms , lower alkyl group of 1 to about 4 carbon atoms , lower alkenyl group of 2 to about 4 carbon atoms , lower alkynyl group of 2 to about 4 carbon atoms , or lower alkoxy group of 1 to about 4 carbon atoms group ; r 2 is selected from the group consisting of hydrogen , hydroxy , oxygen ( ketone ), nitrite ester ( ono ), nitrate ester ( ono 2 ), nitroxyalkanoyl group of 2 to about 4 carbon atoms , lower alkoxy group of 1 to about 4 carbon atoms , and lower alkyl group of 1 to about 4 carbon atoms , wherein all said radicals may optionally be substituted with hydroxy , lower alkyl , lower alkenyl , lower alkynyl , lower alkoxy , amino , nitro , nitril , carboxyl , haloalkyl radicals ; and oco -- r 8 wherein r 8 is alkanoic acid group of 2 to about 4 carbon atoms , lower alkyl group of 1 to about 4 carbon atoms , lower alkenyl group of 2 to about 4 carbon atoms , lower alkynyl group of 2 to about 4 carbon atoms or lower alkoxy group of 1 to about 4 carbon atoms ; r 3 and r 4 are independently selected from the group consisting of hydrogen , hydroxy , nitrite ester ( ono ), nitrate ester ( ono 2 ), nitroxyalkanoyl group of 2 to about 4 carbon atoms , lower alkyl group of 1 to about 4 carbon atoms , lower alkenyl group of 2 to about 4 carbon atoms , lower alkynyl group of 2 to about 4 carbon atoms , and lower alkoxy group of 1 to about 4 carbon atoms , wherein all said radicals may optionally be substituted with hydroxy , lower alkyl , lower alkenyl , lower alkynyl , lower alkoxy , amino , nitro , haloalkyl radicalsand oco -- r 9 wherein r 9 is 2 - furanyl , lower alkyl group of 1 to about 4 carbon atoms or lower alkoxy group of 1 to about 4 carbon atoms ; p and q are independently selected from a group consisting of hydrogen , chloro , fluoro and alkyl group of 1 to about 4 carbon atoms ; x is a methylene group , or sulfur if r 1 is a fluoromethyl group ; with the proviso that at least one of the following r 1 , r 2 , r 3 or r 4 is a nitrite ester ( ono ) and that at least one of the following r 1 , r 2 , r 3 or r 4 is nitrate ester ( ono 2 ). another preferred embodiment of the present invention is a compound of the formula ( i ): ## str5 ## r 1 is selected from the group consisting of hydrogen , hydroxy , nitrite ester ( ono ), nitrate ester ( ono 2 ), chloro , sulfhydryl , n - methylpiperazin - 1 - yl , trimethylsilylmethyloxy , t - butyldimethylsilyloxy , lower alkyl group of 1 to about 4 carbon atoms and oco -- r 7 wherein r 7 is propanoic acid , methyl or ethyl group ; r 2 is selected from the group consisting of hydroxy , oxygen , nitrite ester ( ono ), or nitrate ester ( ono 2 ); r 3 and r 4 are independently selected from the group consisting of hydrogen , hydroxy , nitrite ester ( ono ), nitrate ester ( ono 2 ), methyl , and oco -- r 9 wherein r 9 is ethoxy , methyl , or ethyl ; p and q are independently selected from a group consisting of hydrogen , chloro , fluoro and methyl group ; with the proviso that at least one of the following r 1 , r 2 , r 3 or r 4 is a nitrite ester ( ono ) and that at least one of the following r 1 , r 2 , r 3 or r 4 is nitrate ester ( ono2 ). while it may be possible for the preparations or compounds as defined above to be administered as the raw chemical , it is preferable to present them as a pharmaceutical formulation . according to a further aspect , the present invention provides a pharmaceutical formulation comprising a preparation or a compound as defined above or a pharmaceutically acceptable salt or solvate thereof , together with one or more pharmaceutically acceptable carriers thereof and optionally one or more other therapeutic ingredients . the carrier ( s ) must be &# 34 ; acceptable &# 34 ; in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof . the formulations include those suitable for oral , parenteral ( including subcutaneous , intradermal , intramuscular , intravenous and intraarticular ), rectal and topical ( including dermal , buccal , sublingual and intraocular ) administration although the most suitable route may depend upon for example the condition and disorder of the recipient . the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy . all methods include the step of bringing into association a preparation or a compound as defined above or a pharmaceutically acceptable salt or solyarc thereof (&# 34 ; active ingredient &# 34 ;) with the carrier which constitutes one or more accessory ingredients . in general , the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both and then , if necessary , shaping the product into the desired formulation . formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules , cachets or tablets each containing a predetermined amount of the active ingredient ; as a powder or granules ; as a solution or a suspension in an aqueous liquid or a non - aqueous liquid ; or as an oil - in - water liquid emulsion or a water - in - oil liquid emulsion . the active ingredient may also be presented as a bolus , electuary or paste . a tablet may be made by compression or molding , optionally with one or more accessory ingredients . compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free - flowing form such as a powder or granules , optionally mixed with a binder , lubricant , inert diluent , lubricating , surface active or dispersing agent . molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent . the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein . formulations for parenteral administration include aqueous and non - aqueous sterile injection solutions which may contain antioxidants , buffers , bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient ; and aqueous and non - aqueous sterile suspensions which may include suspending agents and thickening agents . the formulations may be presented in unit - dose or multi - dose containers , for example sealed ampoules and vials , and may be stored in a freeze - dried ( lyophilized ) condition requiring only the addition of the sterile liquid carrier , for example , saline , water - for - injection , immediately prior to use . extemporaneous injection solutions and suspensions may be prepared from sterile powders , granules and tablets of the kind previously described . formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter or polyethylene glycol . formulations for topical administration in the mouth , for example buccally or sublingually , include lozenges comprising the active ingredient in a flavored basis such as sucrose and acacia or tragacanth , and pastilles comprising the active ingredient in a basis such as gelatin and glycerin or sucrose and acacia . formulations for administration by inhalation can be prepared for use as an aerosolized medicaments such as in the manner recited in u . s . pat . no . 5 , 458 , 135 and u . s . pat . no . 5 , 447 , 150 . preferred unit dosage formulations are those containing an effective dose , as hereinbelow recited , or an appropriate fraction thereof , of the active ingredient . it should be understood that in addition to the ingredients particularly mentioned above , the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question , for example those suitable for oral administration may include flavoring agents . the compounds of the invention may be administered orally or via injection at a dose of from 0 . 01 to 500 mg / kg per day . the dose range for adult humans is generally from 0 . 1 mg to 1 g / day . tablets or other forms of presentation provided in discrete units may conveniently contain an amount of compound of the invention which is effective at such dosage or as a multiple of the same , for instance , units containing 0 . 05 mg to 250 mg , usually around 0 . 1 mg to 100 mg . the compounds of formula ( i ) are preferably administered orally or by injection ( intravenous or subcutaneous ). the precise amount of compound administered to a patient will be the responsibility of the attendant physician . however , the dose employed will depend on a number of factors , including the age and sex of the patient , the precise disorder being treated , and its severity . also , the route of administration may vary depending on the condition and its severity . as utilized herein , the term &# 34 ; lower alkyl &# 34 ;, alone or in combination , means an acyclic alkyl radical containing from 1 to about 10 , preferably from 1 to about 8 carbon atoms and more preferably 1 to about 6 carbon atoms . examples of such radicals include methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl , sec - butyl , tert - butyl , pentyl , iso - amyl , hexyl , octyl and the like . the term &# 34 ; lower alkenyl &# 34 ; refers to an unsaturated acyclic hydrocarbon radical in so much as it contains at least one double bond . such radicals containing from about 2 to about 10 carbon atoms , preferably from about 2 to about 8 carbon atoms and more preferably 2 to about 6 carbon atoms . examples of suitable alkenyl radicals include propylenyl , buten - 1 - yl , isobutenyl , penten - 1 - yl , 2 - 2 - methylbuten - 1 - yl , 3 - methylbuten - 1 - yl , hexen - 1 - yl , hepten - 1 - yl , and octen - 1 - yl , and the like . the term &# 34 ; lower alkynyl &# 34 ; refers to an unsaturated acyclic hydrocarbon radicals in so much as it contains one or more triple bonds , such radicals containing about 2 to about 10 carbon atoms , preferably having from about 2 to about 8 carbon atoms and more preferably having 2 to about 6 carbon atoms . examples of suitable alkynyl radicals include ethynyl , propynyl , butyn - 1 - yl , butyn - 2 - yl , pentyn - 1 - yl , pentyn - 2 - yl , 3 - methylbutyn - 1 - yl , hexyn - 1 - yl , hexyn - 2 - yl , hexyn - 3 - yl , 3 , 3 - dimethylbutyn - 1 - yl radicals and the like . the term &# 34 ; alicyclic hydrocarbon &# 34 ; means a aliphatic radical in a ring with 3 to about 10 carbon atoms , and preferably from 3 to about 6 carbon atoms . examples of suitable alicyclic radicals include cyclopropyl , cyclopropylenyl , cyclobutyl , cyclopentyl , cyclohexyl , 2 - cyclohexen - 1 - ylenyl , cyclohexenyl and the like . the term &# 34 ; heterocyclic &# 34 ; means a saturated or unsaturated cyclic hydrocarbon radical with 2 to about 10 carbon atoms , preferably about 4 to about 6 ; wherein 1 to about 3 carbon atoms are replaced by nitrogen , oxygen or sulfur . the &# 34 ; heterocyclic radical &# 34 ; may be fused to an aromatic hydrocarbon radical . suitable examples include pyrrolyl , pyridinyl , pyrazolyl , triazolyl , pyrimidinyl , pyridazinyl , oxazolyl , thiazolyl , imidazolyl , indolyl , thiophenyl , furanyl , tetrazolyl , 2 - pyrrolinyl , 3 - pyrrolinyl , pyrrolindinyl , 1 , 3 - dioxolanyl , 2 - imidazonlinyl , imidazolidinyl , 2 - pyrazolinyl , pyrazolidinyl , isoxazolyl , isothiazolyl , 1 , 2 , 3 - oxadiazolyl , 1 , 2 , 3 - triazolyl , 1 , 3 , 4 - thiadiazolyl , 2h - pyranyl , 4h - pyranyl , piperidinyl , 1 , 4 - dioxanyl , morpholinyl , 1 , 4 - dithianyl , thiomorpholinyl , pyrazinyl , piperazinyl , 1 , 3 , 5 - triazinyl , 1 , 3 , 5 - trithianyl , benzo ( b ) thiophenyl , benzimidazolyl , quinolinyl , and the like . the term &# 34 ; lower alkoxy &# 34 ;, alone or in combination , means an alkyl ether radical wherein the term alkyl is as defined above and most preferably containing 1 to about 4 carbon atoms . examples of suitable alkyl ether radicals include methoxy , ethoxy , n - propoxy , isopropoxy , n - butoxy , iso - butoxy , sec - butoxy , tert - butoxy and the like . the term &# 34 ; lower thioalkyl &# 34 ; means the same as &# 34 ; alkoxy &# 34 ; except sulfur replaces oxygen . the term &# 34 ; alkylsilyloxy &# 34 ; means alkylsilyl ether radical wherein the term alkyl is as defined above and most preferably containing 3 to 8 carbon atoms . examples of suitable alkylsilyl ether radicals include trimethylsilyl , t - butyldimethylsilyl , and the like . the term &# 34 ; haloalkyl &# 34 ; means a lower alkyl as defined above having 1 - 5 preferably 1 - 3 halogens attached to said lower alkyl chain . the term &# 34 ; prodrug &# 34 ; refers to a compound that is made more active in vivo . as used herein , reference to &# 34 ; treatment &# 34 ; of a patient is intended to include prophylaxis . all references , patents or applications , u . s . or foreign , cited in the application are hereby incorporated by reference as if written herein . starting materials used to make the present invention are commercially available such as from sigma , fluka and aldrich chemical company . a general synthetic scheme is outlined below for the compounds of the present invention . ## str6 ## it will be obvious to one skilled in the art to make modifications in the choice of starting materials and process conditions to make all of the invention compounds disclosed herein . example 1 ## str7 ## prednisolone - 21 - acetate ( 0 . 4 g ; 1 mmole ), amylnitrite ester ( 0 . 36 g : 3 mmoles ) and acetic acid ( 2 drops ) were stirred in dioxane ( 10 ml ) and dimethylsulfoxide ( 1 ml ) at room temperature over weekend . the mixture was poured into water ( 50 ml ) and extracted with dichloromethane ( 3 × 10 ml ). the combined organic phase was dried over sodium sulfate and filtered . the filtrate was taken down to dryness under reduced pressure and the residue purified on a waters deltapak column ( 15 cm × 2 . 5 cm ) using a linear gradient of 5 - 70 % acetonitrile / water / trifluoroacetic acid . fab - ms : ( m + li ) + = 438 ; 1 h - nmr ( dmso - d 6 ) d 0 . 76 ( s , 3h , ch 3 ( c - 18 )), 1 . 37 ( s , 3h , ch 3 ( c - 19 )), 2 . 05 ( s , 3h , ch 3 co ), 4 . 7 - 4 . 9 ( q , 2h , co -- ch 2 -- o ), 5 . 6 ( s , 1h , ch ( c - 11 )), 5 . 98 ( s , 1h , ch ( c - 4 )), 6 . 2 ( d , 1h , ch ( c - 2 )), 7 . 0 ( d , 1h , ch ( c - 1 )). a solution of prednisolone ( 0 . 36 g ; 1 mmole ) in acetic acid ( 20 ml ) was warmed up to 55 ° c and treated with solid sodium nitrite ester ( 0 . 28 g ; 4 mmoles ) for 30 seconds . the product was precipitated by addition of ice water ( 25 ml ) and filtered . the solid was washed with water and dried over p 2 o 5 in vacuo to give a white solid material . fab - ms : ( m + li ) + = 396 . 4 . 1 h - nmr ( dmso - d 6 ) d 0 . 51 ( s , 3h , ch 3 ( c - 18 )), 1 . 08 ( s , 3h , ch 3 ( c - 19 )), 4 . 0 - 4 . 4 ( 2d , 2h , co -- ch 2 -- o ), 5 . 95 ( s , 1h , ch ( c - 4 )), 6 . 17 ( d , 1h , ch ( c - 2 ), 6 . 22 ( s , 1h , ch ( c - 11 )), 6 . 98 ( d , 1h , ch ( c - 1 )). a . preparation of prednisolone - 21 - nitrate ester : fuming nitric acid ( 0 . 5 ml ; d = 1 . 49 ) and acetic anhydride ( 2 ml ) were combined at - 10 ° c . to this solution , a pre - cooled suspension of prednisolone ( 1 g ; 2 . 8 mmoles ) in chloroform ( 10 ml ) was added dropwise with stirring . the progress of the reaction was monitored by tlc and hplc . the mixture was stirred for another hour in an ice bath and poured into ice water ( 50 ml ). the organic phase was separated and washed with water , saturated sodium bicarbonate solution and water . after drying over sodium sulfate overnight , the solid was filtered and the filtrate was taken down to dryness . the residue was purified on a waters μbondapak column ( 1 . 9 cm × 15 cm ) using a linear gradient of 25 - 75 % acetonitrile / water / trifluoroacetic acid . the desired fractions were collected and lyophilized to give 0 . 7 g of white material . fab - ms : ( m + li ) + = 412 ; 1 h - nmr ( dmso - d 6 ) d 0 . 80 ( s , 3h , ch 3 ( c - 18 )), 1 . 39 ( s , 3h , ch 3 ( c - 19 )), 4 . 24 ( s , 1h , ch ( c - 11 )), 5 . 2 - 5 . 6 ( q , 2h , co -- ch 2 -- o ), 5 . 95 ( s , 1h , ch ( c - 4 )), 6 . 18 ( d , 1h , ch ( c - 2 )), 7 . 34 ( d , 1h , ch ( c - 1 )). b . the title compound is prepared from prednisolone - 21 - nitrate ester and sodium nitrite ester in acetic acid by the method of example 2 . a . preparation of prednisolone - 17 - nitrate ester - 21 - acetate : the compound is prepared from prednisolone - 21 - acetate ( 1 g ; 2 . 5 mmoles ) in the same manner as described for example 3 to give 0 . 7 g of white material . fab - ms : ( m + h ) + = 448 ; 1 h - nmr ( cdcl 3 ) d1 . 07 ( s , 3h , ch 3 ( c - 18 )), 1 . 45 ( s , 3h , ch 3 ( c - 19 )), 2 . 20 ( s , 3h , ch 3 -- co ), 4 . 50 - 4 . 55 ( m , 1h , ch ( c - 11 )), 6 . 05 ( s , 1h , ch , ( c - 4 )), 6 . 25 ( d , 1h , ch ( c - 2 ), 7 . 25 ( d , 1h , ch ( c - 1 )). b . prednisolone - 17 - nitrate ester - 21 - acetate is treated with sodium nitrite ester in acetic acid by the method of example 2 to produce the title compound . a . preparation of 9a - fluoro - 16a - methylprednisolone - 21 - nitrate ester : the compound is prepared from 9a - fluoro - 16a - methylprednisolone ( 1 g ; 2 . 5 mmoles ) in the same manner as described for example 3 to give 0 . 75 g of white material . fab - ms : ( m + li ) + = 444 ; 1 h - nmr ( cdcl 3 ) d 0 . 91 ( d , 3h , ch -- ch 3 ), 1 . 05 ( s , 3h , ch 3 ( c - 18 )), 1 . 55 ( s , 3h , ch 3 ( c - 19 )), 4 . 38 ( d , 1h , ch ( c - 11 )), 5 . 2 ( q , 2h , co -- ch 2 -- o ), 6 . 07 ( s , 1h , ch ( c - 4 )), 6 . 38 ( d , 1h , ch ( c - 2 )), 7 . 21 ( d , 1h , ch ( c - 1 )). b . a solution of 9a - fluoro - 16a - methylprednisolone - 21 - nitrate ester is treated with sodium nitrite ester in acetic acid by the method of example 2 to produce the title compound . a solution of 9a - fluoro - 16a - methylprednisolone is treated with sodium nitrite ester in acetic acid by the method of example 2 to produce the title product . a . a solution of 9a - fluoro - 16a - methylprednisolone - 11 - nitrite ester ( 0 . 23 g ; 0 . 5 mmoles ) in chloroform / pyridine ( 10 ml ; 1 : 1 ) is treated with acetic anhydride ( 5 ml ) with stirring at room temperature . the reaction is monitored by hplc and carried out until completion . the crude product is purified by reversed - phase hplc to generate the title compound . b . alternatively , the title compound is prepared from 9a - fluoro - 16a - methylprednisolone - 21 - acetate by the method of example 2 . a . preparation of 9a - fluoro - 16a - hydroxyprednisolone - 21 - nitrate ester : the compound was prepared from 9a - fluoro - 16a - hydroxyprednisolone ( 1 g ; 2 . 5 mmoles ) in the same manner as described for example 3 . fab - ms : ( m + h ) + = 440 ; 1 h - nmr ( dmso - d 6 ) d 0 . 82 ( s , 3h , ch 3 ( c - 18 )), 1 . 29 ( s , 3h , ch 3 ( c - 19 )), 5 . 61 ( d , 1h , ch ( c - 11 )), 5 . 5 - 5 . 8 ( q , 2h , co -- ch 2 -- o ), 5 . 98 ( s , 1h , ch ( c - 4 )), 6 . 18 ( d , 1h , ch ( c - 2 )), 7 . 03 ( d , 1h , ch ( c - 1 )). b . the title compound is prepared from 9a - fluoro - 16a - hydroxyprednisolone - 21 - nitrate ester and sodium nitrite ester in acetic acid by the method of example 2 . 9a - fluoro - 16a - hydroxy - prednisolone is treated with sodium nitrite ester in acetic acid by the method of example 2 to produce the title compound . the product of example 9 is treated with acetic anhydride in pyridine / chloroform by the method of example 3 to give the title product . a solution of beclomethasone - 17 , 21 - dipropionate ( 0 . 01 g ; 0 . 019 mmoles ) in acetic acid ( 1 ml ) was warmed up to 55 ° c and treated with solid sodium nitrite ester ( 0 . 007 g ; 0 . 1 mmole ) for 30 seconds . the product was precipitated by addition of ice water ( 5 ml ) and filtered . the solid was washed with water and dried over p 2 o 5 in vacuo to give a white solid material . fab - ms : ( m + li ) + = 556 . 4 . the subject compounds of the formula ( 1 ) have been found to be nitric oxide donors while maintaining their steroid activities and possess useful pharmacological properties as demonstrated in one or more of the following tests : selected compounds were tested in three in vitro and two in vivo assays . the in vitro assays consisted of the following : measuring the effect of the compounds to inhibit the increase of prostaglandins following treatment of human fetal fibroblasts cells with interleukin - 1 followed by arachidonic acid , measuring the effect of the compounds on cyclic gmp in the human fetal fibroblasts , and measuring the smooth muscle relaxant activity in rat aortic rings . the in vivo assay consists of measuring the antiinflammatory properties of the compounds in the carageenan treated rat air pouch model and the relaxant activity on acetylcholine - induced bronchoconstriction in guinea - pigs . a . in vitro inhibiton of prostaglandin e 2 ( pge 2 ) synthesis assay : human fetal fibroblasts cells were treated with il - 1 for 16 hours and then with 10 mm arachidonic acid ( aa ). the prostaglandin e 2 levels were measured by an elisa . compounds were given at the time of addition of il - 1 . this assay provides an in vitro assessment of the compound to block the induction of the proinflammatory agent prostaglandin e 2 ( pge 2 ): ______________________________________treatment pge . sub . 2 ( ng ) ______________________________________basal 3 . 5il - 1 , aa 40 . 0il - 1 , aa and prednisolone ( 10 um ) 9 . 9il - 1 , aa and example 1 ( 10 um ) 9 . 2______________________________________ these data indicate that the steroids with the modifications for the generation of nitric oxide are effective at inhibiting the increase in pge 2 and maintain the glucocorticoid action in the prevention of prostaglandin formation . b . in vitro stimulation of cgmp production assay : human fetal fibroblasts in the presence of isobutylmethylxanthine , an inhibitor of phosphodiesterase , were treated with compounds for 120 min and the intra - cellular cyclic gmp levels are measured by a radioimmunoassay . the cell line is utilized as a reporter cell assay to monitor the production of no . these data show that the compounds possess the ability to increase cyclic gmp levels in the nitric oxide reporter cell assay , indicating that the compound releases nitric oxide during the treatment of the cells . c . in vitro smooth relaxant activity assay : selected compounds were examined for the ability to relax smooth muscle . the rat aortic ring assay was utilized as a bioassay to measure the relaxant activity . the rings were precontracted with phenylephrine ( 0 . 3 μm ) and subsequently compounds were added to the tissue bath in the presence of cysteine ( cys ) and n g - l - nitro - arginine methyl ester ( l - name ): ______________________________________in vitro smooth relaxant activityassay in the presence of cys and l - name : compound relaxation , ec . sub . 50 μm ! ______________________________________beclomethasone dipropionate & gt ; 100beclomethasone dipropionate - 11 - nitrate ester 2 . 0prednisolone & gt ; 100prednisolone - 11 - nitrate ester - 21 - acetate 25 . 0example 1 0 . 02example 2 0 . 03example 11 0 . 04______________________________________ these data indicate that these compounds have smooth muscle relaxant activity , while the control compounds prednisolone and beclomethasone dipropionate did not show any effect as is shown in fig1 and 2 . d . in vivo anti inflammatory assay : example 1 was tested for antiinflammatory activity in vivo in the rat carageenan air pouch assay . rats are injected subcutaneously with a volume of air over several days to form a pouch . inflammation is subsequently induced in the pouch by the addition of the proinflammatory agent carageenan . the inflammation is measured by assaying the pouch fluid for prostaglandin e 2 by elisa . examples 1 at 3 mg / kg dose blocked the increase in prostaglandin e 2 by 60 %. these data indicate that the compound possess the ability to reduce inflammation in vivo . e . relaxant activity on acetylcholine - induced bronchoconstriction in guinea - pigs in vivo : effect of example 1 on acetylcholine - induced increase in airway resistance ( rl ) was studied in guinea - pigs in vivo . animals were divided into three experimental groups . in group one ( naive group ), animals ( n = 5 ) were treated with aerosol acetylcholine ( 0 . 3m ) at zero time and at 50 min . in group two ( vehicle group ), animal ( n = 1 ) was given aerosol acetylcholine at zero time , aerosol vehicle ( 10 % ethanol / pbs ) given at 70 % of increased rl induced by the first acetylcholine challenge , and aerosol acetylcholine ( 0 . 3m ) at 50 minutes . in group three , animals ( n = 3 ) were given aerosol acetylcholine at zero time , aerosol example 1 ( 0 . 2 mm ) in 10 % ethanol / pbs given at 70 % of increased rl induced by the first acetylcholine challenge , and aerosol acetylcholine ( 0 . 3m ) at 50 min . data shown below are percentage increase in rl above the baseline . s . e mean were shown in verticle bars . ## str18 ## in a separate experiment , the animals were given varying concentration of example 1 ( 0 . 03 mm , 0 . 1 mm and 0 . 3 mm ) and the results are presented below . ## str19 ## these data indicate that the glucocorticoid containing nitric oxide donating group is effective in inhibiting acetylcholine - induced increase in airway resistance ( rl ) in guinea - pigs in vivo in a dose - dependent manner .
| 2 |
in the following detailed description , numerous specific details are set forth to provide a full understanding of the subject technology . it will be apparent , however , to one ordinarily skilled in the art that the subject technology may be practiced without some of these specific details . in other instances , well - known structures and techniques have not been shown in detail so as not to obscure the subject technology . a phrase such as “ an aspect ” does not imply that such aspect is essential to the subject technology or that such aspect applies to all configurations of the subject technology . a disclosure relating to an aspect may apply to all configurations , or one or more configurations . an aspect may provide one or more examples of the disclosure . a phrase such as “ an aspect ” may refer to one or more aspects and vice versa . a phrase such as “ an embodiment ” does not imply that such embodiment is essential to the subject technology or that such embodiment applies to all configurations of the subject technology . a disclosure relating to an embodiment may apply to all embodiments , or one or more embodiments . an embodiment may provide one or more examples of the disclosure . a phrase such “ an embodiment ” may refer to one or more embodiments and vice versa . a phrase such as “ a configuration ” does not imply that such configuration is essential to the subject technology or that such configuration applies to all configurations of the subject technology . a disclosure relating to a configuration may apply to all configurations , or one or more configurations . a configuration may provide one or more examples of the disclosure . a phrase such as “ a configuration ” may refer to one or more configurations and vice versa . fig1 a is a diagram illustrating interaction between modules of a decision support framework 100 , according to some embodiments . as illustrated in fig1 , the framework can comprise a decision strategy module 102 , a balance sheet module 104 , a dashboard module 106 , an ordinal ranking module 108 , a direct weighting module 110 , and an aph module 112 . in some embodiments , the integrated multi - criteria decision support framework can use an explicit , step - wise method for decision making although the method can be step - wise , the framework can permit selective , arbitrary movement among modules in some embodiment . for example , the framework can respond to received responses to move or return to a selected step ( or module ). fig1 b illustrates an exemplifying step - wise approach 200 . a step 202 can include explicitly defining the goal , the alternatives , and / or the factors that will be used as criteria to evaluate how well the alternatives meet the goal . a step 204 can include gathering and summarizing information about how well the alternatives fulfill each decision criterion . a step 206 can include converting the information about the alternatives into formal ratings that compare the alternatives on each decision criterion and , if there is no single dominant alternative , determining the priorities of the decision criteria relative to the goal . in a step 208 , the alternative ratings and criteria priorities can be combined to create a measure of how well the alternatives can be expected to fulfill the goal . a step 210 can include a sensitivity analysis . step 210 can include varying the parameters used for the initial analysis to explore the impact on the results of changes in the original judgments and assumptions . step 212 can include either making a decision or continuing the decision making by gathering additional information and / or changing the structure of the original decision model . if the latter option is chosen , one or more of the steps are repeated until a final decision is made . any combination of some or all of the foregoing steps is contemplated . fig2 is a schematic diagram illustrating an integrated multi - criteria decision system 120 , according to some embodiments . the integrated multi - criteria decision system can include the decision strategy module 102 , the balance sheet module 104 , the decision dashboard module 106 , the ranking module 108 , the direct weighting module 110 , the aph module 112 , memory 114 , one or more processors 116 , and a display 118 . the decision strategy module 102 is optional and can be configured to help the decision makers define the decision goal , the alternatives to be considered , and / or the criteria that will be used to compare the alternatives relative to the goal . once the decision parameters are defined ( either through use of the decision strategy module or some other means ), in the next step decision parameters can be summarized along with the information available . this can be accomplished in the balance sheet module 104 . the result can be a balance sheet table with one column for every decision criterion and one row for every alternative , as illustrated in fig3 for example . a database 122 can provide summaries of current data regarding outcomes expected for different alternatives categorized based on common decision criteria . in the context of evaluating medical treatment options , decision criteria can include , for example , effectiveness , risk of side effects , and cost . these links can be maintained throughout the entire framework . in some aspects the database can be an online database accessible via a network , such the internet , a local area network ( lan ), a wide area network ( wan ), a metropolitan area network ( man ), or the like , or a combination thereof . as illustrated in fig1 a , after reviewing the balance sheet table , a decision maker can decide to make a decision , redefine the decision parameters , or continue to explore the decision by moving on to any other module in the multi - criteria decision system . the decision dashboard module 106 can present the decision - related information contained in the balance sheet table graphically , using the display module , and can allow the decision makers to interactively explore the data . after reviewing the dashboard , the decision makers can decide to make a decision , refine the decision parameters by adding or deleting alternatives and / or criteria , retrace previous steps , or continue to explore the decision by moving on to the next step in the framework , the ranking module ( e . g ., ordinal ranking module ), or any other module in the framework . the ordinal ranking module 108 can engage the user in analyzing the decision by rank ordering the priorities of the criteria relative to the goal of the decision and the alternatives relative to the criteria . the latter step can be taken if the ranks of the alternatives relative to a criterion cannot be determined objectively . these ordinal rankings can then be combined to create a numeric score indicating how well the alternatives can be expected to meet the goal based on the input provided by the user . if desired , sensitivity analyses can be performed to determine the effects of changing the initial set of rankings . at this point , the decision makers can decide to make a decision , refine the decision parameters by adding or deleting alternatives and / or criteria , retrace previous steps , or continue to explore the decision by moving on to the either the next step in the framework , direct weighting module , or any other module in the system . in the direct weighting module 110 , users can directly assess the priorities assigned to decision criteria and the evaluations of the alternatives relative to the criteria . because the decision maker ( s ) can assign all weights used in the analysis , this step may involve judgments regarding both the criteria and the alternatives . once the weights are determined they can be combined to generate the overall score indicating the alternatives &# 39 ; priorities relative to the goal based on the input provided by the user . if desired , sensitivity analyses can then be performed to examine the effects of changing the initial set of weights . at this point , the decision makers can decide to make a decision , refine the decision parameters by adding or deleting alternatives and / or criteria , retrace previous steps , or continue to explore the decision by moving on to the ahp module . the ahp module 112 can engage the user in a full multi - criteria analysis of the decision using the ahp , a well - known and widely used multi - criteria method . the ahp can extend the sophistication of the analysis beyond simple direct weighting by : a ) deriving weights through a series of pairwise comparisons among the elements being compared , b ) providing information about the consistency of the pairwise judgments in the analysis , and c ) providing a thorough theoretical background for the weighting and score - generating process . once the weights are determined , they can be combined to generate the overall score indicating the alternatives &# 39 ; priorities relative to the goal based on the input provided by the user . if desired , sensitivity analyses can then be performed . further details of this process are provided below . at this point , the decision makers can decide to make a decision , retrace previous steps , or continue to explore the decision in some other way . one or more of the decision strategy module 102 , the balance sheet module 104 , the dashboard module 106 , the ordinal ranking module 108 , the direct weighting module 110 , the aph module 112 , or another module ( not shown ) can be configured to determine whether at least one response is inconsistent with another received response , such as a response received by another module . for example , the direct weighting module 110 can be configured to evaluate whether responses to directed weighting queries are inconsistent with responses received by the ordinal ranking module 108 to a set of ordinal ranking queries to determine whether the response are congruent . as another example , the aph module 112 can be configured to compare the responses receive by the ordinal ranking module 108 , the direct weighting module 110 , or both are congruent with each other and / or with responses to pairwise comparisons . in response to determining existence of an inconsistency among analyzed responses , the module ( s ) can perform at least one of : ( a ) displaying a notice regarding the inconsistency , ( b ) displaying a resolution query directed to resolution of the inconsistency , ( c ) identifying at least one objectively incorrect understanding of a user indicated by the inconsistency and displaying information directed to correction of the understanding , or ( d ) notifying a health care provider of the inconsistency . a notification of the inconsistency can be provided to a decision maker , person supporting the decision maker , or other interested individual . for example , the notification can be provided a patient , a family member of a patient , a physician , or other health care worker . the notification can prompt the notified individual to take remedial action . upon detection of an incongruence , one or more queries can be presented such that responses to those quires resolves the incongruence . inconsistency - resolution queries can be presented before , after , or together with a notification of the incongruence . for example , a individual , e . g ., system user , can be notified that response a conflicts with response b and requested to revise one of the response a and response b . as another example , an individual can be presented with a query that has not been presented to the individual in the same session and that resolves a conflict between prior responses . in some embodiments , one or more of the decision strategy module 102 , the balance sheet module 104 , the dashboard module 106 , the ordinal ranking module 108 , the direct weighting module 110 , the aph module 112 , or another module ( not shown ) can be configured to store , in a non - transitory computer - readable medium , data indicative of at least one of ( i ) responses received by that module , other modules , or both , and ( ii ) a set of criteria weights determined based on the received responses . the data can be transmitted over a network to be stored in non - transitory computer - readable medium at a remote location . a calculation module can be configured to calculate a composite score for an additional alternative , e . g ., treatment option , not presented to a user during a session when the responses were received , based on ( 1 ) data indicative of attributes of the additional alternative , and ( 2 ) at least a portion of the stored data . an output module can be configured to output an indicator of the composite score . the calculation module , the output module , or both can operate remotely , in time , space or both , from the decision strategy module 102 , the balance sheet module 104 , the dashboard module 106 , the ordinal ranking module 108 , the direct weighting module 110 , and / the aph module 112 . in some embodiments , the indicator of the composite score can be used to determine whether to present the decision maker with information regarding the additional alternative . in some embodiments , the indicator of the composite score can comprise an indication of a potential preference for the additional alternative ( e . g ., treatment option ) over at least one other alternative ( e . g ., treatment option ). in some embodiments , the indicator of the composite score can comprise an indication of potential preference for the additional alternative over all of the alternative that were presented or available to the decision maker during the session when the responses were received and stored . in some embodiments , the indicator of the composite score can comprise an indication that the composite score of the additional alternative is better than the composite score of at least one other alternative . in some embodiments , the indicator of the composite score can comprise an indication that the composite score of the additional alternative is better than composite scores of all of the alternative that were presented or available to the decision maker during the session when the responses were received and stored . in some embodiments , the output module can be configured to display the composite score . the calculation module can be configured in some embodiments to calculate a composite score for the alternatives presented or available to the user at the time responses were received based on ( 1 ) data indicative of attributes of the plurality of alternatives relative to the at least two criteria , and ( 2 ) at least a portion of one of ( i ) the received indicator responses or ( ii ) the set of criteria weights . the data indicative of the alternatives &# 39 ; attributes can be the same what was used as the basis of the user &# 39 ; s responses to the decision strategy module 102 , the balance sheet module 104 , the dashboard module 106 , the ordinal ranking module 108 , the direct weighting module 110 , and / the aph module 112 . in some embodiments , the data can be different that what was used at that time . for example , at the time of calculating composite scores after a session when responses were received , the merits of a particular alternative may have changed . for example , the cost of a particular alternative may increase or decrease over time . the integrated multi - criteria decision system can be implemented on a client device or a server . by way of illustration and not limitation , a client device can represent a computer , a mobile phone , a laptop computer , a thin client device , a personal digital assistant ( pda ), a portable computing device , or a suitable device with a processor . in one example , a client device can be a smartphone ( e . g ., iphone , android phone , blackberry , etc .). in one example , a client device can be mobile . in another example , a client device can be stationary . according to one aspect of the disclosure , a client device can be a device having at least a processor and memory , where the total amount of memory of the client device could be less than the total amount of memory in a server . in one example , a client device does not have a hard disk . in one aspect , a client device has a display smaller than a display supported by a server . in one aspect , a client device can include one or more client devices . in some embodiments , a server can represent a computer , a laptop computer , a computing device , a virtual machine ( e . g ., vmware ® virtual machine ), a desktop session ( e . g ., microsoft terminal server ), a published application ( e . g ., microsoft terminal server ) or a suitable device with a processor . in some embodiments , a server can be stationary . in some embodiments , a server can be mobile . in certain configurations , a server can be any device that can represent a client device . in some embodiments , a server can include one or more servers . fig3 is a simplified example of a table 300 generated by a balance sheet module 104 , such as shown in fig2 , according to some embodiments . the balance sheet table can be automatically generated by the balance sheet module . the balance sheet table includes a number of columns each representing a criteria ( e . g ., criteria a , b , c and d ) defined by a user ( e . g ., a decision maker ). also defined by the user are a number of alternatives ( e . g ., alternatives 1 , 2 , and 3 ). the cells in the table can contain information that describes the performance of each alternative relative to a criterion . for example , the cell denoted al can contain information about how well alternative 1 performs on criterion a . fig4 is an example of an interactive decision dashboard 400 , according to some embodiments . the decision dashboard module 106 can support decision making by presenting the information that is used in making the choice in a structured format ( steps 202 and 204 of the multi - criteria decision making framework of fig1 b ). decision dashboards can differ from balance sheets in the way the information is presented . as illustrated in fig4 , the dashboard 400 can present information graphically using formats designed to enhance understanding of the differences that exist among the decision options . interactive dashboards provide users with the ability to actively explore the information being presented by obtaining additional information about the alternatives and modifying the information displayed . although fig4 illustrates an implementation of a dashboard 400 via a browser , the dashboard can be implemented in other ways in some embodiments . for example , the dashboard , and / or other aspects of the subject technology ( e . g ., of the framework 100 or system 120 for example ) can be implemented using a dedicated application running on specific or general use hardware . in some embodiments , the subject technology can be implemented via a mobile device such as a phone or tablet computer , for example . in some embodiments , the dashboard 400 can illustrate differences between treatment options for treating a disease such as a pain related to osteoarthritis of the knee . information about the relative abilities of the alternatives relative to each decision criterion can be shown in separate panels . in the example dashboard shown in fig4 , five panels 402 , 404 , 406 , 408 , 410 are shown that summarize the relative performance of the treatment alternatives with regard to each of the included drug ( medication ) information categories . in four of the panels 402 , 404 , 406 , 408 , relative performances are shown graphically . as illustrated in fig4 , graphical representations can comprise bar graphs with a bar indicating how well a particular alternative performs relative to the criterion of a particular panel . other graphical representations can be used in some embodiments . buttons 412 for obtaining additional category - specific information can be included within some or all of the panels , as illustrated in fig4 for each of four panels 402 , 404 , 406 , 408 , but not for the panel 410 that corresponds to the administration category . in response to inputs received in response to selection of a button 412 , the dashboard module 106 can display more information about the alternatives relative to the criterion of the panel corresponding to the selected button 412 . buttons 414 , shown in fig4 at the bottom left of the display , can be used to prioritize the importance of each drug information category in making a treatment choice . a set of buttons 414 with each button representing a different priority can be provided for each criterion . as illustrated in fig4 for example , a selected priority level for a criterion can be displayed in a corresponding panel 402 , 404 , 406 , 408 . buttons 416 , shown in fig4 at the bottom right of the display , can be used to determine which alternatives ( e . g ., drugs in fig4 ) are included in the display . some panels , such as panel 410 , can indicates text descriptions , for example regarding various administration options . buttons 416 can be displayed as check boxes . in response to inputs received in response to selection of a button 416 , the dashboard module 106 can hide or display information about the corresponding alternative . one or more buttons 416 can be provided for each criterion . for example , one button 416 can toggle display of an alternative or separate buttons 416 can be provide to select display or omission of a criterion . fig5 is an example of a user interface 500 generated by the ranking module 108 , such as shown in fig2 , according to some embodiments . the user interface can receive user inputs via a number of selection options 502 . for example , the queries can request that a user input via radio buttons the criterion that the user considers most important , second most important , etc . the ranking module 108 presents queries requesting users to rank order the criteria in terms of their importance in meeting the decision goal and the alternatives relative to their abilities to fulfill each of the decision criteria . these rank order judgments can then be converted into numeric scores 504 that , when combined , can create a measure of how well the alternatives can be expected to meet the goal based on the input provided by the user . although the embodiment illustrated in fig6 indicates that the “ first step in exploring your options is to rank order the difference among the treatment options based on how important they are to you in making your decision ,” such a step is not the first in some embodiments that include it , and such a step can be omitted in some embodiments . fig6 is an example of a user interface 600 generated by the direct weighting module 110 , such as shown in fig2 , according to some embodiments . the direct weighting module of fig2 can ask user ( s ) ( e . g ., decision maker ( s )) to directly assess the priorities assigned to decision criteria and the evaluations of the alternatives relative to the criteria . because the decision maker ( s ) can assign all weights used in the analysis , this step may involve rank order judgments regarding both the criteria and the alternatives . the user interface can show graphs representing an overall score 602 , a summary of option evaluations 604 , and sliders 606 to receive user inputs . the graphs 602 , 604 summarize the results of the analysis . user input can be received via a series of sliders 606 used to adjust the weights . the sliders can adjust the weights of the major decision criteria and sub - criteria included in a decision making scenario . for example , in a disease treatment scenario , the user input can include , importance related to treatment , importance of minimizing risk of side effects , importance of out - of - pocket treatment and so on . the user input can also include inputs regarding effectiveness is controlling symptoms of the disease or risks of serious side effects . fig7 shows a table 700 of information related to several drugs , such as generated by a balance sheet module 104 in some embodiments . the drugs shown in fig7 can correspond to the options shown in the decision dashboard of fig4 , in some embodiments . table 700 can summarize the treatment - related information included in the dashboard of fig4 . to avoid respondent bias due to past treatment experiences or name recognition , the options on the dashboard can be identified using arbitrary letters rather than , for example , the actual drug names , where the decision making is related to selection of a drug for treating a disease . note that the data indicate that two options , e . g ., non - steroidal anti - inflammatory ( nsaid ) drugs plus misoprostol and non - steroidal anti - inflammatory drugs and proton pump inhibitors ( ppis ), can be considered inferior choices because other treatment options are available that are better with respect to every medication characteristic being considered . a study was conducted to quantitatively evaluate a dashboard according to an embodiment . fig8 shows a table 800 summarizing characteristics of participants in the study . the majority of participants were white women with at least an associate &# 39 ; s degree and good to excellent literacy and numeracy skills . they were recruited in almost equal proportions from office and departmental staff , patient volunteers , and clinical trial website respondents . fig9 a - b is a table illustrating results of a quantitative dashboard evolution . the responses incorporated in fig9 a and 9b show consistently positive answers for questions concerning mechanical and cognitive ease of use , decision aiding effectiveness , and effectiveness in reducing decisional conflict by providing needed information , clarifying values , and easing uncertainty . there seems to be no evidence of adverse emotional consequences . fig1 is a diagram illustrating ratings shown in the tables of fig9 a - b , according to some embodiments . the diagram summarizes the ratings and evaluation results shown in fig9 a - b . the vertical axis indicates the average rating and the horizontal axis shows abbreviations representing categories presented in fig9 a and 9b . the abbreviations include : mech = mechanical ease of use scale ( 4 items ); cog = cognitive ease of use scale ( 7 items ); emo = emotional ease of use scale ( 3 items ); dae = decision aiding effectiveness scale ( 7 items ); dcsi = decisional conflict scale , informed sub - scale ; dcsv = decisional conflict scale , values sub - scale ; dcsu = decisional conflict scale , uncertainty sub - scale . some embodiments can be implemented in a system including a server and a client device . when a client device and a server are remote with respect to each other , a client device may connect to a server over a network , for example , via a modem connection , a lan connection including the ethernet or a broadband wan connection including dsl , cable , t1 , t3 , fiber optics , wi - fi , or a mobile network connection including gsm , gprs , 3g , wimax or other network connection . a network can be a lan network , a wan network , a wireless network , the internet , an intranet or other network . a network may include one or more routers for routing data between client devices and / or servers . a remote device ( e . g ., client device , server ) on a network may be addressed by a corresponding network address , such as , but not limited to , an internet protocol ( ip ) address , an internet name , a windows internet name service ( wins ) name , a domain name or other system name . these illustrate some examples as to how one device may be remote to another device . but the subject technology is not limited to these examples . fig1 is a conceptual block diagram illustrating an example of a system , in accordance with various embodiments of the subject technology . a system 1101 may be , for example , a client device ( e . g ., client device 102 ) or a server ( e . g ., server 106 ). the system 1101 may include a processing system 1102 . the processing system 1102 is capable of communication with a receiver 1106 and a transmitter 1109 through a bus 1104 or other structures or devices . it should be understood that communication means other than busses can be utilized with the disclosed configurations . the processing system 1102 can generate audio , video , multimedia , and / or other types of data to be provided to the transmitter 1109 for communication . in addition , audio , video , multimedia , and / or other types of data can be received at the receiver 1106 , and processed by the processing system 1102 . the processing system 1102 may include a processor for executing instructions and may further include a machine - readable medium 1119 , such as a volatile or non - volatile memory , for storing data and / or instructions for software programs . the instructions , which may be stored in a machine - readable medium 1110 and / or 1119 , may be executed by the processing system 1102 to control and manage access to the various networks , as well as provide other communication and processing functions . the instructions may also include instructions executed by the processing system 1102 for various user interface devices , such as a display 1112 and a keypad 1114 . the processing system 1102 may include an input port 1122 and an output port 1124 . each of the input port 1122 and the output port 1124 may include one or more ports . the input port 1122 and the output port 1124 may be the same port ( e . g ., a bi - directional port ) or may be different ports . the processing system 1102 may be implemented using software , hardware , or a combination of both . by way of example , the processing system 1102 may be implemented with one or more processors . a processor may be a general - purpose microprocessor , a microcontroller , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ), a programmable logic device ( pld ), a controller , a state machine , gated logic , discrete hardware components , or any other suitable device that can perform calculations or other manipulations of information . a machine - readable medium can be one or more machine - readable media . software shall be construed broadly to mean instructions , data , or any combination thereof , whether referred to as software , firmware , middleware , microcode , hardware description language , or otherwise . instructions may include code ( e . g ., in source code format , binary code format , executable code format , or any other suitable format of code ). machine - readable media ( e . g ., 1119 ) may include storage integrated into a processing system , such as might be the case with an asic . machine - readable media ( e . g ., 1110 ) may also include storage external to a processing system , such as a random access memory ( ram ), a flash memory , a read only memory ( rom ), a programmable read - only memory ( prom ), an erasable prom ( eprom ), registers , a hard disk , a removable disk , a cd - rom , a dvd , or any other suitable storage device . those skilled in the art will recognize how best to implement the described functionality for the processing system 1102 . according to one aspect of the disclosure , a machine - readable medium is a computer - readable medium encoded or stored with instructions and is a computing element , which defines structural and functional interrelationships between the instructions and the rest of the system , which permit the instructions &# 39 ; functionality to be realized . in one aspect , a machine - readable medium is a non - transitory machine - readable medium , a machine - readable storage medium , or a non - transitory machine - readable storage medium . in one aspect , a computer - readable medium is a non - transitory computer - readable medium , a computer - readable storage medium , or a non - transitory computer - readable storage medium . instructions may be executable , for example , by a client device or server or by a processing system of a client device or server . instructions can be , for example , a computer program including code . an interface 1116 may be any type of interface and may reside between any of the components shown in fig1 . an interface 1116 may also be , for example , an interface to the outside world ( e . g ., an internet network interface ). a transceiver block 1107 may represent one or more transceivers , and each transceiver may include a receiver 1106 and a transmitter 1109 . a functionality implemented in a processing system 1102 may be implemented in a portion of a receiver 1106 , a portion of a transmitter 1109 , a portion of a machine - readable medium 1110 , a portion of a display 1112 , a portion of a keypad 1114 , or a portion of an interface 1116 , and vice versa . fig1 illustrates a simplified diagram of a system 1200 , in accordance with various embodiments of the subject technology . the system 1200 may include one ore more remote client devices 1202 ( e . g ., client devices 1202 a , 1202 b , 1202 c , and 1202 d ) in communication with a server computing device 1206 ( server ) via a network 1204 . in some embodiments , the server 1206 is configured to run applications that may be accessed and controlled at the client devices 1202 . for example , a user at a client device 1202 may use a web browser to access and control an application running on the server 1206 over the network 1204 . in some embodiments , the server 1206 is configured to allow remote sessions ( e . g ., remote desktop sessions ) wherein users can access applications and files on the server 1206 by logging onto the server 1206 from a client device 1202 . such a connection may be established using any of several well - known techniques such as the remote desktop protocol ( rdp ) on a windows - based server . by way of illustration and not limitation , in one aspect of the disclosure , stated from a perspective of a server side ( treating a server as a local device and treating a client device as a remote device ), a server application is executed ( or runs ) at a server 1206 . while a remote client device 1202 may receive and display a view of the server application on a display local to the remote client device 1202 , the remote client device 1202 does not execute ( or run ) the server application at the remote client device 1202 . stated in another way from a perspective of the client side ( treating a server as remote device and treating a client device as a local device ), a remote application is executed ( or runs ) at a remote server 1206 . by way of illustration and not limitation , a client device 1202 can represent a computer , a mobile phone , a laptop computer , a thin client device , a personal digital assistant ( pda ), a portable computing device , or a suitable device with a processor . in one example , a client device 1202 is a smartphone ( e . g ., iphone , android phone , blackberry , etc .). in certain configurations , a client device 1202 can represent an audio player , a game console , a camera , a camcorder , an audio device , a video device , a multimedia device , or a device capable of supporting a connection to a remote server . in one example , a client device 1202 can be mobile . in another example , a client device 1202 can be stationary . according to one aspect of the disclosure , a client device 1202 may be a device having at least a processor and memory , where the total amount of memory of the client device 1202 could be less than the total amount of memory in a server 1206 . in one example , a client device 1202 does not have a hard disk . in one aspect , a client device 1202 has a display smaller than a display supported by a server 1206 . in one aspect , a client device may include one or more client devices . in some embodiments , a server 1206 may represent a computer , a laptop computer , a computing device , a virtual machine ( e . g ., vmware ® virtual machine ), a desktop session ( e . g ., microsoft terminal server ), a published application ( e . g ., microsoft terminal server ) or a suitable device with a processor . in some embodiments , a server 1206 can be stationary . in some embodiments , a server 1206 can be mobile . in certain configurations , a server 1206 may be any device that can represent a client device . in some embodiments , a server 1206 may include one or more servers . in one example , a first device is remote to a second device when the first device is not directly connected to the second device . in one example , a first remote device may be connected to a second device over a communication network such as a local area network ( lan ), a wide area network ( wan ), and / or other network . when a client device 1202 and a server 1206 are remote with respect to each other , a client device 1202 may connect to a server 1206 over a network 1204 , for example , via a modem connection , a lan connection including the ethernet or a broadband wan connection including dsl , cable , t1 , t3 , fiber optics , wi - fi , or a mobile network connection including gsm , gprs , 3g , wimax or other network connection . a network 1204 can be a lan network , a wan network , a wireless network , the internet , an intranet or other network . a network 1204 may include one or more routers for routing data between client devices and / or servers . a remote device ( e . g ., client device , server ) on a network may be addressed by a corresponding network address , such as , but not limited to , an internet protocol ( ip ) address , an internet name , a windows internet name service ( wins ) name , a domain name or other system name . these illustrate some examples as to how one device may be remote to another device . but the subject technology is not limited to these examples . according to certain embodiments of the subject technology , the terms “ server ” and “ remote server ” are generally used synonymously in relation to a client device , and the word “ remote ” may indicate that a server is in communication with other device ( s ), for example , over a network connection ( s ). according to certain embodiments of the subject technology , the terms “ client device ” and “ remote client device ” are generally used synonymously in relation to a server , and the word “ remote ” may indicate that a client device is in communication with a server ( s ), for example , over a network connection ( s ). in some embodiments , a “ client device ” may be sometimes referred to as a client or vice versa . similarly , a “ server ” may be sometimes referred to as a server device or vice versa . in some embodiments , the terms “ local ” and “ remote ” are relative terms , and a client device may be referred to as a local client device or a remote client device , depending on whether a client device is described from a client side or from a server side , respectively . similarly , a server may be referred to as a local server or a remote server , depending on whether a server is described from a server side or from a client side , respectively . furthermore , an application running on a server may be referred to as a local application , if described from a server side , and may be referred to as a remote application , if described from a client side . in some embodiments , devices placed on a client side ( e . g ., devices connected directly to a client device ( s ) or to one another using wires or wirelessly ) may be referred to as local devices with respect to a client device and remote devices with respect to a server . similarly , devices placed on a server side ( e . g ., devices connected directly to a server ( s ) or to one another using wires or wirelessly ) may be referred to as local devices with respect to a server and remote devices with respect to a client device . as used herein , the word “ module ” refers to logic embodied in hardware or firmware , or to a collection of software instructions , possibly having entry and exit points , written in a programming language , such as , for example c ++. a software module may be compiled and linked into an executable program , installed in a dynamic link library , or may be written in an interpretive language such as basic . it will be appreciated that software modules may be callable from other modules or from themselves , and / or may be invoked in response to detected events or interrupts . software instructions may be embedded in firmware , such as an eprom or eeprom . it will be further appreciated that hardware modules may be comprised of connected logic units , such as gates and flip - flops , and / or may be comprised of programmable units , such as programmable gate arrays or processors . the modules described herein are preferably implemented as software modules , but may be represented in hardware or firmware . it is contemplated that the modules may be integrated into a fewer number of modules . one module may also be separated into multiple modules . the described modules may be implemented as hardware , software , firmware or any combination thereof . additionally , the described modules may reside at different locations connected through a wired or wireless network , or the internet . in general , it will be appreciated that the processors can include , by way of example , computers , program logic , or other substrate configurations representing data and instructions , which operate as described herein . in other embodiments , the processors can include controller circuitry , processor circuitry , processors , general purpose single - chip or multi - chip microprocessors , digital signal processors , embedded microprocessors , microcontrollers and the like . furthermore , it will be appreciated that in one embodiment , the program logic may advantageously be implemented as one or more components . the components may advantageously be configured to execute on one or more processors . the components include , but are not limited to , software or hardware components , modules such as software modules , object - oriented software components , class components and task components , processes methods , functions , attributes , procedures , subroutines , segments of program code , drivers , firmware , microcode , circuitry , data , databases , data structures , tables , arrays , and variables . the foregoing description is provided to enable a person skilled in the art to practice the various configurations described herein . while the subject technology has been particularly described with reference to the various figures and configurations , it should be understood that these are for illustration purposes only and should not be taken as limiting the scope of the subject technology . there may be many other ways to implement the subject technology . various functions and elements described herein may be partitioned differently from those shown without departing from the scope of the subject technology . various modifications to these configurations will be readily apparent to those skilled in the art , and generic principles defined herein may be applied to other configurations . thus , many changes and modifications may be made to the subject technology , by one having ordinary skill in the art , without departing from the scope of the subject technology . it is understood that the specific order or hierarchy of steps in the processes disclosed is an illustration of exemplary approaches . based upon design preferences , it is understood that the specific order or hierarchy of steps in the processes may be rearranged . some of the steps may be performed simultaneously . the accompanying method claims present elements of the various steps in a sample order , and are not meant to be limited to the specific order or hierarchy presented . terms such as “ top ,” “ bottom ,” “ front ,” “ rear ” and the like as used in this disclosure should be understood as referring to an arbitrary frame of reference , rather than to the ordinary gravitational frame of reference . thus , a top surface , a bottom surface , a front surface , and a rear surface may extend upwardly , downwardly , diagonally , or horizontally in a gravitational frame of reference . furthermore , to the extent that the term “ include ,” “ have ,” or the like is used in the description or the claims , such term is intended to be inclusive in a manner similar to the term “ comprise ” as “ comprise ” is interpreted when employed as a transitional word in a claim . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . a reference to an element in the singular is not intended to mean “ one and only one ” unless specifically stated , but rather “ one or more .” pronouns in the masculine ( e . g ., his ) include the feminine and neuter gender ( e . g ., her and its ) and vice versa . the term “ some ” refers to one or more . underlined and / or italicized headings and subheadings are used for convenience only , do not limit the subject technology , and are not referred to in connection with the interpretation of the description of the subject technology . all structural and functional equivalents to the elements of the various configurations described throughout this disclosure that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and intended to be encompassed by the subject technology . moreover , nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the above description . while certain aspects and embodiments of the invention have been described , these have been presented by way of example only , and are not intended to limit the scope of the invention . indeed , the novel methods and systems described herein may be embodied in a variety of other forms without departing from the spirit thereof . the accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the invention .
| 6 |
other features and advantages of the invention can be derived from the description below of an example of embodiment with reference to the attached figures , which show : fig1 : a schematic perspective view of a vehicle body according to the invention with the top up , fig2 : the same car body with the roof partially folded , fig4 : a vertical partial section through the car body transversely to the direction of travel with the top stowed , and fig5 : the car body in the position of fig1 but with the roof part omitted . fig1 is a perspective view of a motor vehicle body of hardtop design with a folding top according to the invention . the bottom part of the body with the hood 1 , front and rear fenders 2 , 3 , door 4 and load space hatch 5 is conventional and need not be explained in detail . the upper part of the body includes the windshield part 6 with a windshield held between a columns 7 and a cross member 8 , a windshield part 9 , a stiff roof part 10 and a rear window part 11 extending above the passenger compartment 12 . the roof part formed from a metal sheet 10 is detachably connected with its front edge to the cross member 8 and with its rear edge to the upper edge of the rear window part 11 . besides by connection to the adjacent body part the roof part 10 is supported on each side of the body by a pair of supporting beams 13 which are hinge - jointed to the roof part 10 and are capable of being tilted by a drive mechanism concealed in the rear fender 3 . the rear window part 11 is capable of swiveling about an axis which lies on its base slightly below the level of the storage space hatch 5 . in order to fold the top , first the rear window part 11 is tipped slightly upward in the direction of the arrow p 1 in order to release the connection between the upper edge of the rear window part 11 and the rear edge of the roof part 10 . the roof part 10 can now be folded away backward by swiveling the supporting beams 13 . the length of the supporting beams 13 and the position of their hinge axes , on the one hand on the fender 3 , on the other on the roof part 10 , is selected in such a way that the roof part 10 moves as a result of the backward tilting of the supporting beams 13 first into a steep position slightly to the rear , as shown in fig2 , so that the rear edge of the roof part 10 can be concealed under the rear window part 11 . when the swiveling support 13 has reached the end of its freedom of movement , the roof part 10 is in an approximately horizontal orientation slightly below the upper edge 18 of the door 4 and rear fender 3 . since the windows on the opposite side of the body are closer together in the upward direction , the width of the roof part 10 is slightly smaller than the distance between the upper edges of the rear fenders . therefore there is no difficulty in lowering the roof part 10 in this orientation slightly below the level of the upper edge 18 . thus it covers , if present , a rear seat ( not shown ) in the passenger compartment 12 . between a seat cushion of the rear seat and the roof part 10 in this case a storage space will remain which can be used for small luggage . in order to install more luggage in the storage compartment the rear seat can be designed to be removable so that it can be removed before the roof is closed . such a removal of the seat , however , is not necessary for the folding process . when the roof part 10 has reached its stowed position the rear window part 11 is also folded down in the direction of the arrow p 2 until ultimately — disregarding convexities present for aerodynamic reasons — it comes to lie flush with the storage space hatch 5 and the upper edge 18 of the rear fender 3 in the position shown in fig3 . in order for the roof part 10 to be covered completely by the rear window part 11 when the roof is stowed , the roof must be the longer of the two parts . its length is selected such that in the stowed state in fig3 it closes the rear part of the passenger compartment 12 essentially completely but without impairing the adjustability of the front seat 14 in the forward / backward direction . part of the roof part 10 in this position is visible through the flat - lying rear window 15 . since the roof part 10 in the folded down state does not protrude backward past the swivel axis of the rear window part , the storage space under the luggage hatch 5 is completely unimpaired by the stowing of the roof . since the moving parts 10 , 11 in the folded state are not concealed under their own lid but rather the rear window part 11 remains freely visible , a simple economically realizable structure of the folding top results . fig4 shows a vertical partial section through the car body with the top . one recognizes the rear window part 11 with the rear window 15 lying approximately flush with the upper edge 18 of the fender 3 and below it the roof part 10 . since the roof part 10 is somewhat narrower than the rear window part 11 , it fits with minimal space requirements between the side flanks 16 of the rear window part 11 which , in the open state of the roof , as shown in fig1 , assume the function of c columns . toward its upper edge where the rear window part 11 tapers to the width of the roof part 10 the pulled down flanks 16 become increasingly narrower so that there also no space problems arise , and the roof part 10 can be positioned practically parallel to the rear window 15 . to illustrate the supporting structures fig5 shows once more the car body in the configuration of fig1 but without the roof part 10 . here one recognizes that the supporting beams 13 are connected as one part in pairs to the opposite sides of the car body in each case by straight cross members 17 , which extend transversely below the roof part 10 and are hinge jointed to it . this one - part joining of the supporting beams 13 to each other provides considerable stiffening or reinforcement of the roof construction which acts as a roll bar in the event of an accident .
| 1 |
the innovation is now described with reference to the drawings , wherein like reference numerals are used to refer to like elements throughout . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding thereof . it may be evident , however , that the innovation can be practiced without these specific details . referring initially to the drawings , fig1 depicts a perspective view of one embodiment of the improved mounting device 100 of the present invention securely attached to a portion of a mlok rail 10 . by way of background , mlok rail 10 is an elongated bracket that may be attached to a firearm to provide a standard mounting platform for accessories and attachments such as a scope , light , bayonet and the like . rail 10 is typically comprised of a top 12 , an opposing bottom 14 , sides 16 and a continuous opening 18 that extends from top 12 to bottom 14 . the improved mounting device 100 of the present invention is preferably comprised of an upper portion 110 , a lower portion 140 removably attached to said upper portion 110 through the use of fasteners 190 and a locking mechanism 170 for detachably securing device 100 to rail 10 without the need for external tools . except as otherwise stated herein , device 100 is preferably comprised of durable materials , such as metal , plastic , etc . as best illustrated in fig1 and 6 , upper portion 110 is a generally elongated member that is comprised of a top 111 , an opposing bottom 112 , a pair of opposing side slots 114 , a rear end 115 and a front end 116 . top 111 is also comprised of a plurality of raised spaced apart lugs or ridges 1110 , with channels 1112 located between said ridges 1110 and formed by said ridges 1110 . opposing side slots 114 preferably extend between rear end 115 and front end 116 and are useful for attaching accessories ( such as a scope , light , bayonet , etc .) to device 100 . bottom 112 may comprise a plurality of spaced apart threaded openings therein ( not shown ) for receipt of fasteners 190 , which are used to fixedly attach upper portion 110 to lower portion 140 as described more fully below . as best shown in fig2 - 5 , 7a , 7b and 8 , lower portion 140 is preferably an elongated member comprised of a bottom portion 141 , a pair of rails 142 extending upwardly from said bottom portion 141 , a channel 143 and a block 144 . more specifically , each of said rails 142 is spaced apart and generally parallel to the other of said rails 142 which , along with bottom portion 141 , form channel 143 , as best illustrated in fig8 and 9 . block 144 is preferably positioned within channel 143 at approximately the midpoint of channel 143 , and attached to each of said rails 142 as described more fully below . each of said rails 142 further comprises a top 1420 , one or more continuous fastener openings 1422 extending from said top 1420 through bottom portion 141 for receipt of a fastener 190 , and a pin seat 1424 , as best illustrated in fig8 and 9 . pin seat 1424 further comprises a continuous pin seat opening 1426 that extends from the top surface of pin seat 1424 through bottom portion 141 , as described more fully below . in a further preferred embodiment of the present invention , and as best illustrated in fig4 , 7a , 7b , 9 and 9a , device 100 preferably comprises a side wedge 150 and side wedge spring 160 . side wedge 150 is further comprised of a generally d - shaped head portion 152 and a smaller , generally d - shaped body portion 156 . d - shaped head portion 152 is further comprised of a generally flat face 153 and a spring seat 154 , as best shown in fig9 a . similarly , generally d - shaped body portion 156 is further comprised of an inclined face portion 157 , which is preferably at an angle of between 5 and 15 degrees from the vertical plane ( which is parallel to opening 18 ). in this preferred embodiment of the present invention , lower portion 140 is further comprised of a generally d - shaped side wedge opening 145 that extends from top 142 through bottom portion 141 for receipt of side wedge 150 , and a side wedge seat 1452 , as best shown in fig9 and 9a . the purpose and function of side wedge 150 and side wedge spring 160 is further described below . as best shown in fig2 - 9a , device 100 is preferably also comprised of two locking mechanisms 170 . each of locking mechanisms 170 is preferably comprised of a releasing pin 170 , a channel spring 174 , a pin spring 176 and a wedge 178 . releasing pin 172 is further comprised of a body portion 1720 for insertion into pin seat opening 1426 and a head 1722 . head 1722 is shaped and sized to be capable of travelling in and out of pin seat 1424 , as described more fully below . as best illustrated in fig7 a and 7b , channel spring 174 is an elongated spring that is positioned within channel 143 between block 144 and wedge 178 for applying biased tension against wedge 178 , as described more fully below . pin spring 176 is an elongated spring that is positioned between bottom 112 of upper portion 110 and head 1722 of releasing pin 172 for applying biased tension against releasing pin 172 , as described more fully below . as best shown in fig5 and 9 , wedge 178 is preferably comprised of a top surface 1780 , a bottom surface 1782 , an inboard side 1784 with an indentation 1785 therein and a latch portion 1786 . more specifically , latch portion 1786 extends downwardly and outwardly from bottom surface 1782 of wedge 178 . wedge 178 is positioned within channel 143 immediately adjacent channel spring 174 opposite of block 144 . more specifically , channel spring 174 sits partially within a spring seat 1783 in wedge 178 . as shown in fig7 a , 7b , 8 and 9 , in a preferred embodiment of the present invention , a second locking mechanism 170 is located in the opposite end of channel 143 on the other side of block 144 and functions in the same manner . having now described the general structure of a preferred embodiment of device 100 , its function will now be described in general terms . fig4 is a bottom perspective view of the device 100 of the present invention in an unlocked position . when device 100 is in an unlocked position , the biased tension of pin spring 176 on head 1722 causes a section of body portion 1720 of releasing pin 172 to extend outwardly from pin seat opening 1426 and bottom portion 141 of lower portion 140 , as shown in fig4 . a user ( not shown ) desiring to securely attach improved mounting device 100 onto mlok rail 10 would simply place device 100 onto the top of rail 10 . as device 100 is placed onto rail 10 , latch portion 1786 of wedge 178 passes through opening 18 of rail 10 , and releasing pin 172 compresses pin spring 176 against bottom 112 of upper portion 110 . in an unlocked position , head 1722 of releasing pin 172 rests within pin seat 1424 adjacent to indentation 1785 on inboard side 1784 of wedge 178 , and wedge 178 is compressing channel spring 174 against block 144 . however , as pin spring 176 is compressed , head 1722 of releasing pin 172 leaves pin seat 1424 and clears the top 1420 of rail 142 thereby permitting the energy stored in channel spring 174 to be released against wedge 178 which , in turn causes wedge 178 to travel along channel 143 in a direction opposite of block 144 and for latch portion 1786 of wedge 178 to engage rail 10 , as best illustrated in fig2 . when latch portion 1786 of wedge 178 engages rail 10 , device 100 is securely and removably attached to rail 10 . fig5 depicts a bottom perspective view of device 100 in the locked position . in a further preferred embodiment of the present invention with a side wedge 150 and side wedge spring 160 installed thereon , as the user installs device 100 on rail 10 , the portion of body portion 156 that extends outwardly from side wedge opening 145 beyond bottom portion 141 comes into contact with rails 10 and inclined face 157 comes into contact with the side of rail opening 18 thereby causing side wedge spring 160 to partially compress and the incline of inclined face 157 applies pressure to rail 10 thereby reducing the likelihood and amount of lateral movement of device 100 in relation to rail 10 . when a user ( not shown ) desires to remove improved mounting device 100 from mlok rail 10 , the user simply applies pressure to the end of wedge 178 extending beyond channel 143 in the direction of channel spring 174 , thereby causing wedge 178 to travel along channel 143 and channel spring 174 to compress between wedge 178 and block 144 . as wedge 178 travels along channel 143 , latch portion 1786 of wedge 178 will disengage from rail 10 and indentation 1785 in inboard side 1784 of wedge 178 will again align with pin seat 1424 to permit receipt of head 1722 . once aligned and capable of receiving head 1722 of releasing pin 172 , the biased tension in pin spring 176 will cause head 1722 of releasing pin 172 to again be positioned within pin seat 1424 adjacent to indentation 1785 in inboard side 1784 of wedge 178 . at this time , the unlocked device 100 can be removed from mlok rail 10 , as best shown in fig6 . further , as device 100 is removed , the energy stored in compressed side wedge spring 160 is released thereby causing body portion 156 of side wedge 150 to again extend outwardly from bottom portion 141 of lower portion 140 . other variations are also within the spirit of the present invention . thus , while the invention is susceptible to various modifications and alternative constructions , a certain illustrated embodiment thereof is shown in the drawings and has been described above in detail . it should be understood , however , that there is no intention to limit the invention to the specific form or forms disclosed , but on the contrary , the intention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention , as defined in the appended claims . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . the term “ connected ” is to be construed as partly or wholly contained within , attached to , or joined together , even if there is something intervening . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate embodiments of the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventor expects skilled artisans to employ such variations as appropriate , and the inventor intends for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .
| 5 |
fig1 shows a front , elevational view of a water heater 5 comprising an outer shell 6 and an inner tank 6 a as shown in fig4 . the outer shell 6 of the water heater 5 has a substantially uniform curvilinear shape , which is in this embodiment substantially cylindrical . the top portion 8 of the outer shell 6 has a large radius fillet and acts as a gradual transition between the substantially cylindrical central portion 10 of the outer shell 6 and the substantially flat top 9 of the outer shell 6 . the bottom portion 12 of the outer shell 6 is also substantially cylindrical and contains at least one recess 13 . recess 13 has disposed therein a spigot 14 which may be a drain for the inner tank of the water heater 5 . the top 9 of the outer shell 6 is arranged to have pass therethrough an inlet 15 , an outlet 16 , and a pressure relief valve 17 , all arranged to be in fluidic connection with the inner tank 6 a of the water heater 5 and arranged in known manner to convey and control the flow of water through the water heater 5 . an electrical connection box 18 is mounted at the top portion 8 of the outer shell 6 and is arranged to receive electrical conductors ( not shown ) which power the heating elements ( not shown ) of the water heater 5 . the water heater 5 illustrated in fig1 also has attached thereto two junction boxes 19 . for the purposes of the present invention all junction boxes 19 are identical , irrespective of the size or shape of the water heater 5 . use of a standard junction box 19 , capable of being mounted upon any of a series of water heaters 5 having varying sizes , reduces the number of variously sized junction boxes that would otherwise be required to be kept on hand . the use of a standard junction box 19 therefore reduces overhead expenses and manufacturing costs associated with the production of the water heaters 5 . it must also be kept in mind that the box 19 may be arranged for uses other than as an electrical junction box . for instance , box 19 may be arranged to conceal or protect a valve , gauge , or spigot . for the purposes of this application the term “ electrical junction box ” should be construed to include boxes which may be mounted integral to and used in conjunction with a vessel for containing fluids as disclosed herein . fig2 illustrates in detail the construction of the junction box 19 . the junction boxes 19 are comprised of a housing member 20 and a cover 24 . the cover 24 is in turn comprised of an intermediate plate 26 and a cover panel 28 that is arranged to be releasably attachable to the intermediate plate 26 . as can be seen , the housing member 20 is comprised of a substantially rectangular housing 21 having an open outer surface defined by a plurality of curvilinear segments which form a flange 22 . the flange 22 of the housing member 20 is arranged to be complimentary with the inner surface of an area 32 of the wall of the outer shell 6 that is geometrically discontinuous , i . e . has a different curvilinear shape from the remainder of the outer shell 6 . the purpose of the area of geometric discontinuity 32 is to provide a common mounting surface on the outer shell 6 of a water heater 5 to which a junction box 19 may be attached . identical areas of geometric discontinuity 32 that are complementary to the flange 22 of the housing member 20 are formed into the outer shell 6 of each of a series of variously sized water heaters 5 , such that a standard junction box 19 that is identical for each distinctly sized water heater 5 may be attached thereto . this purpose is furthered by providing junction box 20 with an inner curved surface 25 having a radius permitting it to abut against inner shell 6 a in conforming relation thereto . insulation 11 fills the annular space between inner and outer shells 6 a and 6 . in order to facilitate the addition of necessary electrical components , the housing 20 of junction box 19 is provided with electrical conduit ports 35 at its top and bottom . conduit ports 35 permit electrical conductors ( not shown ) to be strung from the electrical connection box 12 , to the housing ( s ) 20 . where a water heater 5 has more than one junction box 19 , electrical conductors may be strung between the housings 20 of the junction boxes 19 . the electrical conductors are required to power electrical components such as heating elements ( not shown ) that may be mounted through component port 36 at the back of the housing 20 of the junction box 19 . referring next to fig4 a junction box 19 is seen as mounted to the outer shell 6 at an area of geometric discontinuity 32 . housing member 20 is mounted against the inner surface of the outer shell 6 at the area of geometric discontinuity 32 in registration with an opening 7 that is formed through the wall of the outer shell 6 . the opening 7 formed through the outer shell 6 is roughly the same size and shape as open face 23 of the housing member 20 bounded by the flange 22 . the opening 7 through the outer shell wall 6 permits communication between the exterior of the outer shell 6 and the interior of the rectangular housing 21 of the housing member 20 . the cover 24 is affixed to the outer surface of the outer shell 6 of the water heater 5 at the area of geometric discontinuity 32 in registration with the opening 7 through the outer shell wall 6 and the housing member 20 of the junction box 19 . typically , intermediate plate 26 is attached to the outer surface of the outer shell 6 by means of a mechanical fastener or an appropriate adhesive so as to secure the wall of the outer shell 6 between the flange 22 of the housing member 20 and the intermediate plate 26 as shown in fig4 . intermediate plate 26 has formed therein attachment means arranged to permit releasable attachment of the cover panel 28 to the intermediate plate 26 . the attachment means may comprise a plurality of apertures 27 arranged to mate with a plurality of tabs 29 extending from the cover panel 28 . hooks 30 formed on the distal ends of the tabs 29 extend through the apertures 27 of the intermediate plate 26 and engage the inner surface of the intermediate plate 26 to secure the cover panel 28 thereto . gentle prying pressure applied to an aperture 31 is sufficient to remove cover panel 28 from intermediate plate 26 . it is to be understood that the structure of the apertures 27 , tabs 29 , and aperture 31 may be altered significantly without exceeding the scope of the present invention . fig3 a - 3 d are a series of top plan views of the outer shell 6 illustrated in fig1 . fig3 a - 3 d illustrate the radially offset relationship between the area of standard radius and various water heater tank diameters . as indicated above , the outer shell 6 of a water heater 5 is a curvilinear substantially cylindrical shape having a substantially circular cross section as indicated in fig3 a - 3 d . in the preferred embodiment of the present invention , the area of geometric discontinuity 32 comprises a curvilinear shape having a fixed radius r 1 with a center point c 1 that is offset from the center c 2 of the outer shell 6 of the water heater 5 . depending upon the requisite volume of the outer shell 6 of the water heater 5 , it is possible that the radius r 2 and center point c 2 of the outer shell 6 may be the same as the radius r 1 and center point c 1 of the area of geometric discontinuity 32 . the outer shell illustrated in fig3 a - 3 d has been variously labeled with the reference numerals 6 , 6 ′, 6 ″, and 6 ′″, respectively , to distinguish the variously sized shells of differing embodiments . note that in fig3 a and 3 b that the radii r 1 of the areas of geometric discontinuity 32 are larger than the radii r 2 of outer shell embodiments 6 and 6 ′ of the water heater 5 and that in fig3 c and 3 d that the radii r 1 geometric discontinuity 32 are smaller than the radii r 2 of outer shell embodiments 6 ″ and 6 ′″ of the water heater 5 . though the shape of the water heater 5 and area of geometric discontinuity of the present invention are , in conjunction with the preferred embodiment , described as being essentially circular in cross section , it is to be understood that various curvilinear shapes that are not essentially circular in cross section may be utilized without exceeding the scope of the present invention . for example , the present invention may be readily adapted to the outer shell of a water heater that has an elliptical cross - sectional shape or an irregular curvilinear shape . likewise , the cross - sectional shape of the area of geometric discontinuity need not be circular , but instead could be elliptical , parabolic , or even an irregular curvilinear shape . the substantially circular cross section of the outer shell 6 is modified near the area of geometric discontinuity 32 so as to create a smooth transition t therebetween . one advantage to utilizing a substantially circular area of geometric discontinuity 32 with the substantially cylindrical outer shell 6 of the water heater 5 is that the area of transition t between the area of geometric discontinuity 32 and the remainder of the outer shell 6 may be made in a manner that is unobtrusive and generally pleasing to the eye . in fig1 the outer shell 6 of the water heater 5 is illustrated as having a single vertically oriented area of geometric discontinuity 32 which extends from below the lower junction box 19 to above the upper junction box 19 . while the embodiment of fig1 is the preferred embodiment of the present invention , it is to be understood that an area of geometric discontinuity 32 need only be large enough to permit a single junction box 19 to be mounted thereto . therefore , the areas of geometric discontinuity 32 may be varied in size , number , and location , depending upon the desired number and arrangement of junction boxes required for a given water heater 5 without exceeding the scope of the present invention . for example , the water heater outer shell 6 may comprise a single vertically oriented area of geometric discontinuity 32 that extends over substantially the entire height of the outer shell 6 , as illustrated in fig1 or , the water heater outer shell 6 may comprise a plurality of areas of geometric discontinuity 32 that are slightly larger than the junction boxes 19 and which are disposed in a predetermined pattern upon the surface of the water heater 5 . another example of a water heater 5 according to the present invention has areas of geometric discontinuity 32 formed on a front side and a back side of the water heater 5 or in the four quadrants of the water heater 5 and extending either the entire height of the outer shell 6 of the water heater or some portion thereof . forming an area of geometric discontinuity 32 into an outer shell 6 of a water heater 5 is an integral part of a method of manufacturing a water heater 5 . a vessel incorporating the present invention such as the outer shell 6 of a water heater 5 may be formed of plastic as by blow molding , fabricated from metals such as steel or aluminum , or formed of a composite material such as fiber glass or the like using fabrication techniques appropriate to the chosen material . in the preferred embodiment of the present invention , a vessel having a substantially regular curvilinear shape and having any one of a number of predetermined sizes is formed in a blow molding procedure utilizing a mold appropriate to the desired final shape and size of the vessel . areas of geometric discontinuity 32 are formed into the vessel in a desired arrangement by replacing portions of the mold used to form the vessel with mold portions which have formed thereon a negative image of the areas of geometric discontinuity 32 and transition areas t . it is important to reiterate that the areas of geometric discontinuity 32 are of uniform size and shape irrespective of the size or arrangement of the vessel into which they are being formed . in this manner , the areas of geometric discontinuity 32 of a vessel of a particular size will be identical to the areas of geometric discontinuity 32 formed into vessels of different sizes . where the vessels are formed of steel or other materials not suitable for a molding process , identical areas of geometric discontinuity may be formed using any number of well known stamping , rolling , replacement by welding or other suitable fabrication techniques . housing members 20 of junction boxes 19 , having mating surfaces defined by flange 22 , are next attached to the inner surface of the areas of geometric discontinuity 32 of each outer shell 6 such that the flange 22 is in mating contact with the inner surface of an area of geometric discontinuity 32 . it is preferred that the flange 22 be sealingly mated to the area of geometric discontinuity 32 . openings 7 , which allow access to the interior of the housing member 20 , may be preformed in the areas of geometric discontinuity 32 of the vessel or may be formed once the housing members 20 have been secured to the outer shells 6 . it is to be understood that a single , standard junction box 19 design is mounted to the identical areas of geometric discontinuity 32 of each of the outer shells 6 of varying size . in addition , the manner whereby a junction box 19 is attached to an outer shell 6 of a water heater 5 , i . e . by use of mechanical fastener or adhesive , is identical for the outer shells 6 of varying size . once the housing members 20 have been attached to the inner surface of the outer shells 6 at the areas of geometric discontinuity 32 , the cover 24 is secured to the exterior surface of the outer shells 6 over the housing members 20 . the intermediate plate 26 of the cover 24 is secured directly to the exterior surface of the outer shell 6 by means of mechanical fasteners or adhesives and cover panel 28 is releasably secured to the intermediate plate 26 by apertures 27 and tabs 29 . in the embodiment shown in fig2 aligned apertures 33 and 34 are provided in housing member 20 and plate 26 , respectively , to receive threaded fasteners . by forming identical areas of geometric discontinuity 32 into vessels of varying size , it is possible to utilize a standard configuration of a junction box 19 for each of the vessels of varying size , thereby obviating the need to maintain stocks of variously sized junction boxes 19 each usable for specific sizes of vessels only . while the preferred embodiments of the present invention have been described , it is to be understood that various changes , adaptations , and modifications may be made therein without departing from the spirit of the invention and the scope of the appended claims .
| 1 |
fig1 a - 23 depict a sample embodiment of a ladder support device 10 . ladder support device 10 ( fig1 a ) is used with a ladder 12 having spaced side rails 14 connected by spaced rungs 16 ; ladder 12 is leaned on wall 11 . ladder support device 10 comprises a support platform 18 and three support elements 20 . each of support elements 20 is longitudinal and comprises a cap 21 at the top and teeth 48 along the longitudinal dimension . for demonstrative purposes , each of support elements 20 is depicted as a square bar , although other shapes are acceptable . support platform 18 comprises handle 22 ( fig3 ) fixed to its upward side , a release lever 24 , a work area 26 ( best seen in fig2 ), and three guides 28 ( fig4 ). although , for demonstrative purposes , support platform 18 is chosen to be triangular , it can be circular , square , or have any other shape ; and the number of support elements 20 and guides 28 can be more than three , if desired . work area 26 is a ladder - supporting area incorporating vertical stopping elements 30 ( fig2 ) limiting the horizontal movement of a ladder lower end on the ladder - supporting area . each of the guides 28 comprises a latch 38 ( fig7 ) and two openings 32 in the upward and bottomward sides of support platform 18 for directing movement of one of support elements 20 ( fig6 ) perpendicularly to the upward side . latch 38 comprises a tension spring 52 and one tooth 46 ( fig7 ) or two teeth ( fig8 ), although more teeth can be used if desired . tension spring 52 is connected with one end to support platform 18 and with the other end to latch 38 ( see also fig1 b - 1e and 6 ). latch 38 is pivotally connected to support platform 18 with an axis 44 . release lever 24 is pivotally connected to handle 22 with an axis 34 ( best seen in fig1 - 20 ). one end of release lever 24 is kept above handle 22 ( fig1 ) by a torsion spring 50 ( fig2 ). another end of release lever 24 is connected to all latches 38 ( fig6 - 8 ) with cables 40 routed through an opening 31 ( fig4 and 10 ) of support platform 18 using pulleys 42 . cables 40 are attached to an axis 56 ( fig1 - 20 ) of release lever 24 with one end and to latches 38 with the other end . each of the pulleys 42 is installed between ribs of support platform 18 ( the ribs are not shown for clarity ). tension springs 52 , when not pulled , keep teeth 46 of latches 38 engaged with teeth 48 of support elements 20 preventing movement of support platform 18 about support elements 20 standing on solid surface 60 due to a force of gravity ( depicted as force f in fig1 b and 1d ) applied to support platform 18 . in use , a user positions support platform 18 above solid surface 60 at a desired location using handle 22 and levels it horizontally using reading of an inclinometer 54 ( fig2 ); then the user squeezes upper end of release lever 24 toward handle 22 ( fig9 , 10 , and 19 ); as a result , lever 24 is pivoted about axis 34 tensioning torsion spring 50 and pulling all cables 40 simultaneously which , in turn , pull all tension springs 52 causing pivotal movement of latches 38 about axes 44 and disengagement of all teeth 46 from teeth 48 ( fig1 c , 1 e , 9 , and 10 ); since support elements 20 are no longer fixated to support platform 18 with teeth 46 , support elements 20 move simultaneously toward solid surface 60 under force of gravity ; when all of support elements 20 meet solid surface 60 , the user stops squeezing release lever 24 ; as a result , release lever 24 is pivoted by decompression force of torsion spring 50 releasing all cables 40 and allowing the release force of springs 52 to pivot latches 38 about axes 44 until all teeth 46 engage with teeth 48 fixating the position of leveled by the user support platform 18 about solid surface 60 , regardless of the profile of solid surface 60 ( fig1 and 17 ). if any tooth 46 is not engaged right away with teeth 48 , tension spring 52 is not fully released keeping torsion spring 50 from being released by cable 40 and resulting in partial return of release lever 24 hiding markings 58 ( fig1 ) from being seen by the user ; hidden markings 58 indicate to the user that the ladder support device is not ready ; unrealized force of tension spring 52 will engage tooth 46 ( fig1 d , or teeth 46 in fig8 ) with teeth 48 as soon as the support element 20 is moved slightly about support platform 18 , for instance , when the user pushes support platform 18 toward solid surface 60 until markings 58 become visible ( fig1 ) indicating to the user that the ladder support device is ready ( deployed ). support elements 20 , due to their relative arrangement , provide a means for supporting orientation of the deployed ladder support device 10 when unattended . markings 58 are located on both sides of handle 22 ( only one marking 58 is visible in fig1 and 20 ). if pushing support platform 18 toward solid surface 60 does not make the ladder support device ready , the user is able to examine the guides 28 through transparent plates 36 for the reason ( an embodiment of support platform 18 with transparent plates 36 is shown only in fig9 ). support platform 18 must be positioned by a user close enough to solid surface 60 for all of support elements 20 to reach solid surface 60 when release lever 24 is squeezed . after support platform 18 stands on solid surface 60 , the user is able to readjust height and orientation of support platform 18 when squeezing release lever 24 . when a user wants to reposition support platform 18 , the user removes ladder 12 and carries support platform 18 to a new location using handle 22 . as an option , the user is able to squeeze release lever 24 and move support platform 18 toward solid surface 60 resetting position of support elements 20 about support platform 18 simultaneously before carrying support platform 18 to a new location . since each of support elements 20 is moving independently toward solid surface 60 when release lever 24 is squeezed , the support platform 18 can be leveled above even or uneven solid surface 60 ( fig1 and 17 ). support platform 18 accommodates ladders with the distance between side rails 14 falling within a predetermined range limited by vertical stopping elements 30 ( fig2 ). in order to improve stability of ladder support device 10 and preserve integrity of solid surface 60 , each of support elements 20 comprises a non - detachable shoe 62 ( fig1 a and 11b ) or a detachable shoe 63 ( fig1 a - 12c ). shoe 62 is flexibly installed by a ball joint 66 secured between ribs 67 at the bottom end of support element 20 to provide support at any orientation of shoe 62 about solid surface 60 . detachable shoe 63 comprises a female assembly 84 at the top . female assembly 84 is adapted to engage with a male assembly 86 installed at the bottom of support element 20 . male assembly 86 comprises hollow section 88 and two balls 92 kept apart by compression spring 94 within hollow section 88 ( fig1 c ). female assembly 84 comprises two opposing circular opening 98 ( only one is seen in fig1 b ) and a hollow section 96 . when detachable shoe 63 is snapped onto support element 20 , hollow section 96 slides over male assembly 86 causing balls 92 to go inside of hollow section 88 by compressing spring 94 until openings 98 are aligned with balls 92 . decompression force of spring 94 forces balls 92 out of hollow section 88 and inside of openings 98 when openings 98 are aligned with balls 92 . decompression force of spring 94 is enough to keep male assembly 86 attached to female assembly 84 despite force of gravity . a user detaches shoe 63 from support element 20 , for instance , by squeezing balls 92 and pulling female assembly 84 from male assembly 86 or by just pulling female assembly 84 from male assembly 86 with a force larger than force of gravity . either shoe 62 or detachable shoe 63 may comprise a detachable sole 64 . for demonstrative purposes fig1 a , 13 b , and 13 e depict detachable shoe 63 with a detachable sole 64 . detachable shoe 63 comprises a slot 68 and a latch 70 comprising a lever 72 pivotal about an axis 73 and a torsion spring 74 ( fig1 a - 13e ). one end of torsion spring 74 is positioned in a hole 75 of axis 73 and the other end is positioned against inner wall of lever 72 . detachable sole 64 comprises contact surface 78 adapted for a specific solid surface 60 and a profiled member 76 adapted to slide inside of slot 68 ( fig1 e ). in use , a user pivots lever 72 compressing torsion spring 74 to fully expose slot 68 ; then the user slides profiled member 76 of detachable sole 64 inside of slot 68 and releases lever 72 ; decompression force of torsion spring 74 pivots back lever 72 preventing sole 64 from falling off detachable shoe 63 . lever 72 is pivoted by a user again when sole 64 shall be removed or replaced ( fig1 e ). it might be necessary to increase height and / or footprint of support platform 18 using expanders 80 attachable between support elements 20 and shoes 63 ( fig1 a - 14c ). shape of expanders 80 depicted in fig1 a - 16 is chosen for demonstrative purposes only ; other shapes may be used , if desired . top end of expander 80 comprises a female assembly 84 . bottom end of support element 20 comprises male assembly 86 . bottom end of expander 80 also comprises male assembly 86 . attaching and detaching elements using assemblies 84 and 86 is described in paragraph [ 0127 ]. fig2 - 23 depict embodiment demonstrated in fig1 a - 20 but with handle 100 flexibly connected to support platform 18 with a ball joint 102 , release lever 104 pivotally connected to support platform 18 by an axis 106 . ladder support device 10 is balanced about handle 100 in such way that gravity force keeps work area 26 horizontal regardless of orientation of handle 100 held by a user when support elements 20 are not touching a solid surface . this way user error when orienting support platform 18 horizontally and time required for the orientation are eliminated . in addition , an inclinometer is no longer necessary . fig2 - 33 depict another embodiment of ladder support device 15 . support platform 19 comprises handle 23 fixed to its upward side , a release lever 25 , a work area 27 , and three guides 29 . although , for demonstrative purposes , support platform 19 is chosen to be triangular , it can be circular , square , or have any other shape ; and the number of guides 29 can be more than three , if desired . work area 27 is a ladder - supporting area incorporating vertical stopping elements 35 limiting the horizontal movement of a ladder lower end on the ladder - supporting area . each guide 29 ( fig3 ) comprises a hydraulic cylinder 37 , a piston 39 movable within hydraulic cylinder 37 along guides 77 , piston 39 is sealed by o - ring 41 ( although other sealing means , known in the art , for hydraulic applications can be used ). piston 39 is rigidly connected to a support element 33 . support element 33 ends with a shoe 69 identical to shoe 62 depicted in fig1 a and 11b and described in paragraph [ 0126 ]. lower end of support element 33 is connected to hydraulic cylinder 37 by a dust cover 65 . ladder support device 15 further comprises a hydraulic valve 43 ( see fig3 a and 31b ) comprising outer casing 49 and inner member 51 located inside of outer casing 49 . outer casing 49 is connected to each of hydraulic cylinders 37 by a hydraulic pressure tubes 45 , at least one of hydraulic pressure tubes 45 comprises a fill and bleed access member 71 sealed by a cap 47 . inner member 51 comprises a lever 55 protruding through a channel 57 of outer casing 49 . inner member 51 further comprises three interconnected channels 53 leading to the outside surface of inner member 51 . lever 55 is connected to release lever 25 by a cable 59 and is biased downward by a tension spring 61 keeping hydraulic valve 43 turned off . in the biased position inner member 51 blocks all hydraulic pressure tubes 45 ( fig3 b ) for preventing hydraulic fluid communication between hydraulic cylinders 37 . squeezing release lever 25 toward handle 23 turns hydraulic valve 43 on ( fig2 and 29 ) by raising lever 55 which pulls tension spring 61 and pivots inner member 51 resulting in alignment of channels 53 with hydraulic pressure tubes 45 and hydraulic fluid communication between hydraulic cylinders 37 . releasing lever 25 will allow unrealized force of spring 61 to pivot inner member 51 back to the biased position where channels 53 are not aligned with hydraulic pressure tubes 45 preventing hydraulic fluid communication between hydraulic cylinders 37 . therefore , a user is able to position the bottom ends of all of support elements 33 on the ground quickly , automatically , and regardless of the ground profile ( fig2 ) by squeezing release lever 25 toward handle 23 ( fig2 ) for redirecting the hydraulic liquid from hydraulic cylinders 37 of support elements 33 pressed against solid surface 60 to hydraulic cylinders 37 of support elements 33 which are not touching solid surface 60 until all of support elements 33 reach solid surface 60 equalizing pressure between hydraulic cylinders 37 where releasing lever 25 by the user fixates the position of support platform 19 about solid surface 60 since hydraulic liquid redirection between hydraulic cylinders 37 is no longer permitted . fig3 - 59 depict another sample embodiment of a ladder support device 110 . ladder support device 110 ( fig3 ) is used with a ladder 12 having spaced side rails 14 connected by spaced rungs 16 . ladder support device 110 comprises a flexible bar 112 ( best seen in fig3 ), two short support elements 114 ( fig3 ), two long support elements 116 , and a generally rectangular frame 120 formed by a support platform 118 at the bottom , by a rib 122 on the top , and by two guide pairs 124 on the sides . for demonstrative purposes , each of support elements 114 and 116 is depicted as a square bar , although others shapes can be chosen . each of short support elements 114 is longitudinal and comprises a cap 115 at the top and teeth 128 along the longitudinal dimension . each of long support elements 116 is longitudinal and comprises a cap 115 at the top and teeth 128 along the longitudinal dimension . support platform 118 comprises a release pedal 130 and a work area 132 . work area 132 is a ladder - supporting area incorporating vertical stopping elements 134 limiting the horizontal movement of a ladder lower end on the ladder - supporting area . each guide pair 124 comprises an inner guide 136 and an outer guide 138 connected to each other by two arms 140 at the bottom ends and pivotally connected to each other at the upper end with an axis 142 . arms 140 are pivotal about axes 144 . user folds each guide pair 124 for storage ( fig3 ) by rotating outer guides 138 toward inner guides 136 about axis 142 and rotating simultaneously arms 140 about axes 144 . user unfolds each guide pair 124 ( fig3 ), when preparing ladder support device 110 , by rotating outer guides 138 from inner guides 136 about axis 142 and rotating simultaneously arms 140 about axes 144 . each of inner guides 136 comprises a u - shaped bar 146 ( fig3 ), a latch 148 ( fig3 ), a cover 150 ( fig5 ) enclosing latch 148 and short support element 114 , and a dust cover 204 connecting the lower end of short support element 114 to the bottom of cover 150 ( only fig5 - 59 fully depict cover 150 and dust cover 204 where fig3 - 44 , and 49 - 51 depict cover 150 with some of the walls removed for clarity ). cover 150 is removable and attached to u - bar 146 , for instance , with fasteners ( not shown ). each of outer guides 138 ( fig3 ) comprises a u - shaped bar 156 , latch 148 , a cover 160 ( fig5 ) enclosing latch 148 and long support element 116 , and a dust cover 204 connecting the lower end of long support element 116 to the bottom of the cover 160 ( only fig5 - 59 fully depict cover 160 and dust cover 204 where fig3 - 42 , 44 , and 49 depict cover 160 with some of the walls removed for clarity ). u - shaped bar 156 comprises a limiting member 162 ( fig3 ). cap 115 limits movement of long support element 116 along the longitudinal dimension of u - bar 156 when cap 115 meets limiting member 162 . each cover 160 comprises a handle 126 ( fig5 and 58 ). cover 160 is removable and attached to u - bar 156 , for instance , with fasteners ( not shown ). latch 148 is identical to latch 38 of ladder support device 10 depicted in fig1 a - 23 . latch 148 comprises a tooth 164 ( best seen in fig4 and 48 ). latch 148 is pivotally connected to its guide with an axis 166 and by a tension spring 152 . release pedal 130 comprises bottom axis 170 and top axis 172 ( best seen in fig5 ). release pedal 130 is pivotally connected to inner guides 136 with bottom axis 170 . both ends of top axis 172 are positioned inside of arc - shaped channels 168 ( best seen in fig4 b ) of inner guides 136 limiting rotational movement of release pedal 130 about bottom axis 170 . release pedal 130 is biased upward by two tension springs 174 connected to opposite ends of top axis 172 with one end ( only one end of top axis 172 is shown in fig5 and 51 for clarity ) and to inner guides 136 with the other end . each end of top axis 172 is also connected to both latches 148 of its own guide pair 124 by cable 176 routed by pulleys 178 ( fig4 , 48 , 50 , and 51 ) installed between ribs 180 ( shown partially in fig5 and 51 for clarity ). tension springs 152 , when not pulled , ( fig4 and 47 ) keep teeth 164 of latches 148 engaged with teeth 128 of support elements 114 and 116 preventing movement of support elements 114 and 116 about support platform 118 ( see also fig1 b and 1d ). flexible bar 112 is attached to the bottom side of rib 122 by a ball joint 182 and to frame 120 by a spring latch 184 ( best seen in fig5 and 53 ). frame 120 further comprises two holders 190 ( fig3 ) and an inclinometer 192 . each inner guide 136 further comprises a laser guide 194 ( fig3 ). in use , a user unfolds guide pairs 124 , pulls bottom portion of flexible bar 112 from spring latch 184 , positions the ladder support device 110 on solid surface 60 at a desired location using , for instance , handles 126 , and levels it using reading of inclinometer 192 and laser beams of laser guides 194 indicating a location the top end of ladder 12 is about to be leaned on when ladder 12 is positioned on work area 132 ; next , the user presses upper portion of release pedal 130 ( fig4 b ); as a result , release pedal 130 is pivoted about bottom axis 170 extending tension springs 174 and pulling all cables 176 which , in turn , cause simultaneous pivotal movement of latches 148 and disengagement of all teeth 164 ( fig4 ) from teeth 128 while pulling all tension springs 152 ; since support elements 114 and 116 are no longer fixated respectively to guides 136 and 138 with teeth 164 , support elements 114 and 116 move simultaneously toward solid surface 60 under force of gravity ; when all of support elements 114 and 116 meet solid surface 60 , user stops pressing release pedal 130 ; as a result , release pedal 130 is pivoted by decompression force of springs 174 releasing all cables 176 which , in turn , allows the release force of springs 152 to pivot teeth 164 until they engage with teeth 128 fixating the positions of support elements 114 and 116 about solid surface 60 regardless of the profile of solid surface 60 . if any tooth 164 is not engaged right away with teeth 128 , tension spring 152 is not fully released keeping tension spring 174 from being released by cable 176 and resulting in partial return of release pedal 130 exposing markings 158 ( fig4 c ); exposed markings 158 indicate to the user that the ladder support device is not ready ; unrealized force of spring 152 will engage tooth 164 with teeth 128 as soon as the support element 114 ( 116 ) is moved slightly about support platform 118 , for instance , when the user pushes support platform 118 toward solid surface 60 to make sure that markings 158 are hidden ( fig4 a ). the hidden markings 158 indicate to the user that all teeth 164 are engaged with teeth 128 completely and that ladder support device 110 is ready ( deployed ) for ladder placement . markings 158 are located on inner sides of inner guides 136 ( only one marking 158 is shown in fig4 b and 43c for clarity ). if pushing ladder support device 110 toward solid surface 60 does not make it ready , the user is able to examine the guides 136 and 138 through transparent plates 200 for the reason ( an embodiment of ladder support device 110 with transparent plates 200 is shown , for instance , in fig3 , 41 , and 43 a - 43 c ). after orientating ladder support device 110 , user pivots flexible bar 112 about ball joint 182 and positions lower end of flexible bar 112 behind frame 120 onto solid surface 60 to support the orientation of ladder support device 110 when user leaves for a ladder 12 ( therefore , support elements 114 , 116 and flexible bar 112 , due to their relative arrangement , provide a means for supporting orientation of the deployed ladder support device 110 without ladder 12 when unattended ); lastly , user lowers ladder on support platform 118 in such way that predetermined rung 16 is lowered onto holders 190 until bottom ends of ladder 12 stand on work area 132 ( fig3 ). placing ladder 12 on work area 132 and using ladder 12 may cause temporary deformation of flexible bar 112 but , at this point , orientation of ladder support device 110 is supported by ladder 12 leaned on a vertical surface with upper ends of rails 14 . flexible bar 112 will flex back as soon as ladder 12 is lifted off work area 132 regaining its function to support orientation of ladder support device 110 without the user when ladder is not positioned on work area 132 . fig3 depicts a variation of the embodiment of ladder support device 110 where frame 120 comprises locking holders 208 for securing ladder 12 to ladder support device 110 when ladder 12 is positioned on work area 132 . as seen in fig5 - 56c , locking holder 208 comprises a latch 210 biased out of a cutout 212 of u - shaped bar 146 by a torsion spring 214 and a pivoting member 220 which pivots about an axis 222 . the pivoting member 220 , when pivoted down toward the latch 210 ( fig5 b ), forces latch 210 to go inside of cutout 212 compressing torsion spring 214 . when pivoting member 220 goes below threshold 216 of latch 210 ( fig5 c ), latch 210 goes out of cutout 212 under decompression force of torsion spring 214 locking ladder rung 16 by pivoting member 220 kept in position by threshold 216 ( fig5 and 56c ). at this point , the user is able to carry and to position ladder 12 and ladder support device 110 simultaneously . this embodiment has advantages and disadvantages when compared to previous embodiments depicted in fig1 a - 23 . for instance , previous embodiments provide only vertical support to ladders , where this embodiment provides not only vertical support with short support elements 114 and long support elements 116 but also sidewise support with long support elements 116 . as far as a disadvantage , if an angle between unfolded outer guides 138 is too big , then reducing height of work area 132 above solid surface 60 when long support elements 116 stand on solid surface 60 may not be possible by simply pushing frame 120 toward solid surface 60 when pressing release pedal 130 . if such angle is chosen intentionally by a designer for increased stability sidewise , one of the solutions is to press pedal 130 when frame 120 is turned upside down to allow support elements 114 and 116 to fall down simultaneously under force of gravity inside of their respective guides 136 and 138 before moving to other location . a user carries ladder support device 110 to a new location using handles 126 without ladder 12 or with ladder 12 when ladder 12 is locked to leveling device 110 with locking holders 208 . since each of support elements 114 and 116 is moving independently toward solid surface 60 when pedal 130 is pressed , the support platform 118 can be leveled above even or uneven solid surface 60 ( fig4 and 59 ). in order to improve stability of ladder support device 110 and preserve integrity of solid surface 60 , each of support elements 114 and 116 comprises a non - detachable shoe 62 described in paragraph [ 0126 ]. fig6 - 69 depict a ladder support device 300 which is a modified embodiment of a ladder support device depicted in fig2 - 33 ( although the embodiments depicted in fig1 a - 23 can be used as prototypes as well ). the difference between the embodiments is that ladder support device 300 further comprises foldable members 304 and 306 . foldable members 304 and 306 are pivotal about top side of support platform 19 by hinges 308 and 310 correspondingly . foldable member 304 comprises a rigidity rib 312 , a cutout 302 , and two holes 314 . foldable member 306 comprises a rigidity rib 313 , cutout 302 , and hole 314 . fig6 depicts a leveler 316 comprising inner telescopic part 317 and outer telescopic part 318 . inner telescopic part 317 goes inside of outer telescopic part 318 . each of telescopic parts 317 and 318 comprises an inclinometer 320 on the top side and a protruding member 321 on the bottom side . inclinometers 320 and protruding members 321 are positioned at the far ends of leveler 316 . relative movement of telescopic parts 317 and 318 is prevented by tightening a wing screw 322 . inner telescopic part 317 also comprises measurement marks 324 indicating distance between protruding members 321 when aligned with an edge of outer telescopic part 318 . when foldable members 304 and 306 of ladder support devices 300 are unfolded up about hinges 308 and 310 ( fig6 ), they get secured in the up positions by latches 350 . latches 350 , located on the top of ladder support devices 300 , secure foldable members 304 and 306 in unfolded ( up ) positions ( fig6 ); and latches 350 , located on the sides of ladder support devices 300 , secure foldable members 304 and 306 in folded ( down ) positions ( fig6 ). latch 350 ( best seen in fig6 ) comprises a body 352 and a locking member 356 biased out of body 352 by a compression spring 358 . locking member 356 comprises an inclined side 360 . foldable member 304 or foldable member 306 , when pressing against inclined side 360 of locking member 356 ( fig6 ), drives locking member 356 inside of body 352 compressing spring 358 . when foldable member 304 or foldable member 306 passes completely over inclined side 360 , the decompression force of spring 358 causes locking member 356 out of body 352 securing position of foldable member 304 or foldable member 306 ( fig6 ). in order to release foldable member 304 or foldable member 306 , user moves locking member 356 out of the way by pressing on inclined side 360 ( fig6 ). in use , when foldable members 304 and 306 of any two ladder support devices 300 are unfolded ( fig6 , and 63 ), user inserts protruding members 321 of leveler 316 into holes 314 of both ladder support devices 300 ; then , the user positions , for instance , foldable members 306 of both ladder support devices 300 at the same height using reading of inclinometers 320 and levels work areas 27 ( as previously described herin ). if a certain distance between any two holes 314 of two ladder support devices 300 is desired , user adjusts leveler 316 to the distance first by relaxing wing screw 322 , adjusting relative position of telescopic parts 317 and 318 using measurement marks 324 , and tightening back wing screw 322 . the above described process can be repeated to bring a plurality of ladder support devices 300 to the same height regardless of ground profile where each pair of ladder support devices 300 is located at a predetermined distance from each other . such ability allows a user to position , for example , a step ladder , a table top , a scaffold 330 ( fig6 ) on two ladder support devices 300 or a temporary floor on more than two ladder support devices 300 . in addition , a seat 340 ( fig6 ) can be positioned on top of a single ladder support devices 300 converting it to a chair . objects positioned on top of ladder support devices 300 may be secured using holes 314 . scaffold 330 ( fig6 ) and seat 340 ( fig6 ), for instance , comprise bolts 332 . bolts 332 go inside of holes 314 and can be secured by wing nuts or other similar means known in the art . in addition , the described embodiments which use ordinary cables and pulleys for controlling the latches , may use instead bowden cables or any other such means known in the art . those who are skilled in the art will readily perceive how to modify the invention . therefore , the appended claims are to be construed to cover all equivalent structures which fall within the scope and spirit of the invention .
| 4 |
the 5 ′ utr and beginning of orf from cd3299 gene of c . difficile 630 , accession number am180355 is as follows : seq id no : 1 : ttacagctttctgattttgataaatttaaaacttaccatctaatactaataacaggt taattttatctaattattatagattctcatactgtgccttattctatctataaatac aatttaagtgtccatattgaaatatttgtattgtaatacagctggatattacttaaa tccaattgtttccattataattttatgttaaaataatattacaaaatacatct gttt ttcttcataaac gggtg aaattccctatcggcggtaaaagcccgcgagccttatg gcataatttggtcatattccaaagccaacagtaaaatctggatggtagaagaaa ata gtatatgagtacctttatgtaattttacatgagtaatctatacaaatccttcaa ctaccgtatttattcatgaaattagacacattcaag tt tttttgttgtttattttacaattatatcgtacttataaaatctattaagattggagt gttatc aatggatagtattgattatcatctgtattggtgtatttatg tctactcttgatggaagtatactaaatatcgcaaa in the above depiction of the sequence , the riboswitch is highlighted in bold , and is the 0rf start site in the above sequence is downstram from the riboswitch and is depicted in italics and is : the hairpin can form a loop having a structure as depicted in formula 1 : a possible antiterminator has a structure as depicted in formula 2 : in one embodiment , compounds binding to and activating the cd3299 riboswitch are compounds of formula iv from pct application pct / us 09 / 04576 : ( i ) alk is c 1 - 8 alkyl ( e . g ., ethyl or n - butyl ); ( ii ) r a and r b are independently h , — c 1 - 4 alkyl ( e . g ., methyl ), —( ch 2 ) 3 c ( nh 2 )( cooh ) chf 2 , —( ch 2 ) 3 n ( h ) c (═ nh ) nh 2 , —( ch 2 ) 5 nh 2 , —( ch 2 ) 2 c ( h )( oh ) cooh , — c ( o )( ch 2 ) 2 cooh , — c 1 - 4 alkyl - c ( o ) or s ( e . g ., — ch 2 ch 2 ch 2 ch 2 c ( o ) or 9 , — ch 2 ch 2 ch 2 c ( o ) or 9 , — ch 2 ch 2 c ( o ) or 9 or — ch 2 c ( o ) or 9 , — c ( ch 3 )( ch 3 ) c ( o ) or 9 ), — c ( o ) ch 3 , aryl ( e . g ., phenyl ), — c ( o )- aryl , aryl - c 1 - 4 alkyl ( e . g ., benzyl , naphtha - 1 - ylmethyl , naphth - 2 - ylmethyl , phenylethyl , phenylpropyl , naphtha - 1 - ylethyl ), heteroaryl , heteroaryl - c 1 - 4 alkyl ( e . g ., pyrid - 2 - ylmethyl , pyrid - 3 - ylmethyl or quinoxalinyl ), wherein said aryl and heteroaryl groups are optionally substituted with one or more groups selected from — c ( o ) or 9 , — nh 2 , — s ( o ) 2 nh 2 , — ch 2 nh 2 , halo ( e . g ., chloro ), c 1 - 4 alkoxy ( e . g ., methoxy ), c 1 - 4 alkyl ( e . g ., methyl ); ( iii ) r 1 is h , c 1 - 8 alkyl ( e . g ., methyl ); ( iv ) r 2 is h , halo ( e . g ., chloro ), — o — c 3 - 7 cycloalkyl ( e . g ., — o - cyclopentyl ), — n ( r 4 )( r 5 ), c 3 - 7 cycloalkyl ( e . g ., cyclopropyl ), c 1 - 8 alkyl ( e . g ., methyl or ethyl ) or — o — c 1 - 8 alkyl wherein the alkyl group is optionally substituted with one or more halo or hydroxyl groups ( e . g ., trifluoromethyl , — o — ch 2 ch 2 oh ); ( v ) r 4 and r 5 are independently h , c 3 - 7 cycloalkyl ( e . g ., cyclopropyl or cyclopentyl ), c 1 - 8 alkyl ( e . g ., methyl ) wherein said alkyl is optionally substituted with one or more hydroxy groups ( e . g ., 2 , 3 - dihydroxypropyl , 2 , 3 , 4 , 5 , 6 - pentahydroxyhexyl ); ( vi ) r 9 is h or c 1 - 4 alkyl ( e . g ., t - butyl , isopropyl , methyl ); ( vii ) r 12 is c 1 - 8 alkyl ( e . g ., methyl , ethyl , t - butyl ) or — oc 1 - 8 alkyl ( e . g ., methoxy , ethoxy , t - butoxy ), the words “ treatment ” and “ treating ” are to be understood accordingly as embracing prophylaxis and treatment or amelioration of symptoms of disease as well as treatment of the cause of the disease . the compounds useful in the methods described herein may be administered orally , parentally ( e . g , intravenously ), topically , rectally or by other means depending on the nature and location of the infection . preferably the compounds are administered orally . dosages employed in practicing the present invention will vary depending , e . g . on the particular disease or condition to be treated , the age and size of the patient , the particular active compound used , the mode of administration , and the therapy desired . for example , in one embodiment , daily oral dosages for a 70 kg human suffering from diarrhea and colitis caused by c . difficile may be from 10 - 2000 mg . administration of a therapeutically active amount of the therapeutic compositions is defined as an amount effective , at dosages and for periods of time necessary to achieve the desired result . dosage regimens may be adjusted to provide the optimum therapeutic response . for example , several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation . the compound may administered as monotherapy or in combination with one or more antibiotics , for example in combination with metronidazole ( flagyl ®), vancomycin ( vancocin ®), linazolid , ramoplanin , and / or fidaxomicin , and / or in combination with one or more antibiotics selected from fluoroquinolones , cephalosporins , clindamycin and penicillins . the patient may receive anti - toxin therapy , for example monoclonal antibodies to c . difficile toxins , or anti - toxoid vaccine . the patient may receive probiotics , such as bacteria and yeast , which help restore a healthy balance to the intestinal tract , e . g ., saccharomyces boulardii ( florastor ®), and / or be undergoing fecal bacteriotherapy . pharmaceutical compositions comprising compounds as described herein may be prepared using conventional diluents or excipients and techniques known in the galenic art . thus oral dosage forms may include tablets , capsules , solutions , suspensions and the like . the term “ pharmaceutically acceptable carrier ” as used herein is intended to include diluents such as saline and aqueous buffer solutions , as well as solid carriers such as microcrystalline cellulose , hydroxypropylmethyl cellulose , or lactose . an in - line probing assay , as described in regulski and breaker , “ in - line probing analysis of riboswitches ”, ( 2008 ), methods in molecular biology , vol 419 , pp 53 - 67 , the contents of which are incorporated by reference , is used to estimate the dissociation binding constants for the interaction of each of the ligands described herein with a cd3299 riboswitch amplified from clostridium difficile . precursor mrna leader molecules are prepared by in vitro transcription from templates generated by pcr and [ 5 ′- 32 p ]- labeling using methods described previously ( regulski and breaker , in - line probing analysis of riboswitches ( 2008 ), methods in molecular biology vol 419 , pp 53 - 67 ). approximately 5 nm of labeled rna precursor is incubated for 41 hours at 25 ° c . in 20 mm mgcl 2 , 50 mm tris / hcl ( ph 8 . 3 at 25 ° c .) in the presence or absence of a fixed concentration of each ligand . binding to the cd3299 riboswitches are measured 100 m . in - line cleavage products are separated on 10 % polyacrylamide gel electrophoresis ( page ), and the resulting gel is visualized using a molecular dynamics phosphorimager . the location of products bands corresponding to cleavage are identified by comparison to a partial digest of the rna with rnase t1 ( g - specific cleavage ) or alkali ( nonspecific cleavage ). in - line probing exploits the natural ability of rna to self - cleave at elevated ph and metal ion concentrations ( ph ≈ 8 . 3 , 25 mm mgcl 2 ) in a conformation - dependent manner . for self - cleavage to occur , the 2 ′- hydroxyl of the ribose must be “ in - line ” with the phosphate - oxygen bond of the internucleotide linkage , facilitating a s n 2p nucleophilic transesterification and strand cleavage . typically , single - stranded regions of the riboswitch are dynamic in the absence of an active ligand , and the internucleotide linkages in these regions can frequently access the required in - line conformation . binding of an active ligand to the riboswitch generally reduces the dynamics of these regions , thereby reducing the accessibility to the in - line conformation , resulting in fewer in - line cleavage events within those regions . these ligand - dependent changes in rna cleavage can be readily detected by denaturing gel electrophoresis . the relative binding affinity of each ligand is expressed as i max , wherein i max represents the percent inhibition of in - line cleavage at selected internucleotide ligands in the presence of a fixed ligand concentration ( 100 m for the cd3299 riboswitch ) normalized to the percent inhibition in the absence of ligand and the percent inhibition in the presence of a saturation concentration of a control ligand . 100 m of compound a ( which is a compound identified as having high affinity to the cd3299 riboswitch ) is used as a control ligand for estimating binding to the cd3299 . the experiments show that compounds 1 and 2 have a binding affinity to the cd3299 switch with an i max value of 45 - 90 compared to the control at 100 m . the mic assays are carried out in a final volume of 100 μl in 96 - well clear round - bottom plates according to methods established by the clinical laboratory standards institute ( clsi ). briefly , test compound suspended in 100 % dmso ( or another suitable solubilizing buffer ) is added to an aliquot of media appropriate for a given pathogen to a total volume of 50 μl . this solution is serially diluted by 2 - fold into successive tubes of the same media to give a range of test compound concentrations appropriate to the assay . to each dilution of test compound in media is added 50 l of a bacterial suspension from an overnight culture growth in media appropriate to a given pathogen . final bacterial inoculum is approximately 10 5 - 10 6 cfu / well . after growth for 18 - 24 hours at 37 ° c ., the mic is defined as the lowest concentration of antimicrobial agent that completely inhibits growth of the organism as detected by the unaided eye , relative to control for bacterial growth in the absence of added antibiotic . ciprofloxacin is used as an antibiotic - positive control in each screening assay . each of the bacterial cultures that are available from the american type culture collection ( atcc , www . atcc . org ) is identified by its atcc number . the experiments show that compounds 1 and 2 have a minimum inhibitory concentration ( mic ) of 64 μg / ml or less against c . difficile strains atcc 700057 ( mmx 4381 ) and mmx3581 ( clinical ). all references indicated herein are incorporated by reference for any patent application in the united states .
| 0 |
[ 0030 ] fig1 shows an automatic dental flosser 100 , in accordance with the present invention . the automatic dental flosser 100 consists of a disposable floss holder 200 attached onto a driving handle 400 . the disposable floss holder 200 holds a loop of dental floss 210 between two tines 220 and 230 . as described below , a driving mechanism housed inside the driving handle 400 drives a driving shaft 411 to oscillate from side to side . the driving shaft 411 then drives a rotatable element 250 to swing back and forth with respect to the disposable floss holder 200 . as a result , the loop of dental floss 210 is drag to slide back and forth between the two tines 220 and 230 for dental flossing , while the disposable floss holder 200 stays stationary with respect to the driving handle 400 . [ 0031 ] fig2 shows a first embodiment of a disposable floss holder 200 , in accordance with the present invention . the disposable floss holder 200 is shown in front , side , and back view . the disposable floss holder 200 consists of a holder body 201 , a rotatable element 250 , and a loop of dental floss 210 . the rotatable element 250 is rotatable with respect to the holder body 201 via a pin - and - hole structure 251 . one point 255 of the rotatable element 250 is tied to the loop of dental floss 210 . the rotatable element 250 is affixed with an engagement element 254 that has a notch 253 , which can be engaged with the tip of a driving shaft 411 from the driver handle 400 , as shown in fig1 . there is an opening 256 on the holder body 201 to receive the engagement element 254 and to allow the engagement element 254 to rotate within a range around the pin - and - hole structure 251 . as the driving shaft 411 of the driving handle 400 oscillates from side to side , it drives the rotatable element 250 to swing back and forth with respect to the holder body 201 . the pin - and - hole structure 251 has two possible configurations . the first configuration is to have a hole on the holder body 201 and a pin on the rotatable element 250 to insert into the hole . the other configuration is to have a pin on the holder body 201 and a hole on the rotatable element 250 to receive the pin . this way the rotatable element 250 is rotatable around the pin - and - hole structure 251 . the loop of dental floss 210 is held between the two tines 220 and 230 through holding slots 202 , 203 , 207 , and 206 . the loop of dental floss 210 is free to slide back and forth around these holding slots 202 , 203 , 207 and 206 . when the rotatable element 250 swings back and forth around the pin - and - hole structure 251 , it drags the loop of dental floss 210 to move back and forth between the two tines 220 and 230 . the implement of the rotatable element 250 with the engagement element 254 is for two advantages . first , it can enlarge the travel of the dental floss 210 between the two tines 220 and 230 , in comparison with the displacement of the driving shaft 411 . second , it provides a simple engagement to transfer the oscillation of the driving shaft 411 to the back - and - forth movement of the dental floss 210 with the floss holder remaining stationary . preferably , the first end 412 of the driving shaft 411 has a peak - to - peak oscillation of approximately 2 to 3 mm and the dental floss 410 has a back - and - forth travel of about 4 to 8 mm . there is a mounting hole 240 on the second end of the holder body 201 . this hole 240 is used to attach and to secure the floss holder 200 onto the driving handle 400 . there is also a hole 241 connecting between the mounting hole 240 and the opening 256 . as shown in fig1 this hole 241 enables the driving shaft 411 of driving handle 400 to engage with the notch 253 of the engagement element 254 and thus to drive the rotatable element 250 to swing back and forth around the pin - and - hole structure 251 . [ 0037 ] fig3 shows a second embodiment of a disposable floss holder 300 , in accordance with the present invention . the disposable floss holder 300 is shown in front , side , and back view . this disposable floss holder 300 has similar structure as the disposable floss holder 200 except that the pin - and - hole structure 251 is replaced with a narrow bridge structure 351 and the rotatable element 350 is modified from the rotatable element 250 accordingly . the rotatable element 350 is connected and rotatable with respect to the holder body 301 via this narrow bridge structure 351 . the material chosen for the disposable floss holder 300 shall be durable for bending back and forth over such a narrow bridge structure 351 . materials suitable for this purpose are known to those skilled in the art . as shown in fig3 the rotatable element 350 is coupled with an engagement element 354 that has a notch 353 to engage with the driving shaft 411 . an opening 356 on the holder body 301 receives the engagement element 354 and allows the engagement element 354 to swing within a range with respect to the narrow bridge structure 351 . the holder body 301 with the rotatable element 350 can then be made with a single piece of plastic through mold injection process . such a design simplifies the production process and reduces the production cost . as a result , the floss holder 300 can be better justified as a disposable item . [ 0041 ] fig4 shows a first embodiment of a driving handle 400 of the automatic dental flosser 100 , in accordance with the present invention . the driving handle 400 consists of a handle body 440 and a driving shaft 411 . the handle body 440 houses a motor 420 , a driving mechanism , and a battery or charger that is not shown in the figure . the handle body 440 has an elongate shape and is such shaped to allow the user to grasp comfortably for dental flossing . the first end 441 of the handle body 440 is sized to fit into the hole 240 of the disposable floss holder 200 . the first end 412 of the driving shaft 411 is shaped to fit with the notch 253 of the engagement element 254 of the disposable floss holder 200 . in operation , the driving shaft 411 oscillates from side to side to drive the rotatable element 250 to swing back and forth with respect to the holder body 201 and to drag the loop of dental floss 210 to slide back and forth between the two tines 220 and 230 . as shown in fig4 the driving mechanism includes a gear 421 , a wheel 430 , and a bar 419 . the motor 420 drives the gear 421 , which is coupled to the wheel 430 rotating around a shaft 431 . the power coupling is through a layer of deformable material 436 , e . g . rubber or soft plastic . such a design is for its simplicity and low noise in comparison with typical gear coupling . the wheel 430 is concentric and affixed with a smaller wheel 432 . a pin 437 is mounted on the smaller wheel 432 with an offset from the wheel &# 39 ; s center , i . e ., the shaft 431 . the bar 419 has a slot 418 at its first end and extends to the driving shaft 411 at its second end . the slot 418 is engaged into the pin 437 of the wheel 432 . as the wheel 432 rotates , the pin 437 drives the bar 419 to swing back and forth around a pin 413 , which is affixed on the handle body 440 . consequently , the bar 419 transfers the continuous rotation of the wheel 430 to a side - to - side oscillation of the driving shaft 411 . preferably , the rotation speed of motor 420 , the size of the gear 421 , and the size of the wheel 430 are such chosen that the oscillation rate of the driving shaft 411 is about 30 to 50 hz . the length of the driving shaft 411 , the length of the bar 419 , and the offset of pin 437 are such designed that the tip 412 of the driving shaft 411 has a side - to - side travel of about 2 to 3 mm . [ 0045 ] fig5 shows a second embodiment of a driving handle 500 of the automatic dental flosser 100 , in accordance with the present invention . the construction of the driving handle 500 is similar to that of the driving handle 400 except the driving mechanism that couples the continuous rotation of the motor 520 to the side - to - side oscillation of the driving shaft 511 . as shown in fig5 the driving mechanism includes a first disk 521 , a second disk 531 , and a bar 519 . the first disk 521 is affixed on the motor &# 39 ; s shaft and is mounted with an off - center pin 522 . the second disk 531 is affixed on a first end of the bar 519 and is embedded a slot 532 . the motor 520 rotates the first disk 521 continuously . the off - center pin 522 slides inside the slot 532 and pushes the bar 519 to swing back and forth around a pin 513 . consequently , the driving mechanism transfers the continuous rotation of the motor 520 to a side - to - side oscillation of the driving shaft 511 . preferably , the rotation speed of motor 520 is such chosen that the oscillation rate of the driving shaft 511 is about 50 to 100 hz . the length of the driving shaft 511 , the length of the bar 519 , and the offset of pin 522 are such designed that the tip 512 of the driving shaft 511 has a side - to - side travel of about 2 to 3 mm . [ 0049 ] fig6 shows an automatic dental flosser 600 with the driving shaft 411 at different angle positions . the automatic dental flosser 600 is shown in a back view of the floss holder 200 . the driving shaft 411 is engaged with the notch 253 on the engagement element 254 . as the driving shaft 411 oscillates from side to side , it drives the engagement element 254 and thus the rotatable element 250 to swing back and forth with respect to the floss holder 200 . the rotatable element 250 drives in turn the loop of dental floss 210 to slide back and forth between the two tines 220 and 230 . the size of the rotatable element 250 and the distance from the notch 253 to the rotation center 251 shall be such chosen that the dental floss 210 has a side - to - side travel of about 4 to 8 mm . [ 0051 ] fig7 shows a first embodiment of a toothbrush head 700 , in accordance with the present invention . the toothbrush head 700 is shown in front , side , and back view . the toothbrush head 700 consists of a toothbrush head body 701 and a rotatable bristle holder 750 . toothbrush bristles 730 are implanted on the rotatable bristle holder 750 , which is in turn mounted on the first end of the toothbrush head body 701 and is operationally rotatable around a pin - and - hole structure 751 . as shown in the back view of the toothbrush head 700 , the rotatable bristle holder 750 is affixed with an engagement element 754 , which has a notch 753 to engage with the driving shaft 411 . there is an opening 756 on the toothbrush head body 701 to receive the engagement element 754 and to allow the engagement element 754 to rotate within a range around the pin - and - hole structure 751 . there is a mounting hole 740 in the second end of the toothbrush head body 701 . this hole 740 is used to attach the toothbrush head 700 onto the driving handle 400 . there is also a hole 741 connecting between the mounting hole 740 and the opening 754 . this hole 741 enables the driving shaft 411 of driving handle 400 to engage with the notch 753 of the engagement element 754 so as to drive the rotatable bristle holder 750 . when the rotatable bristle holder 750 is driven to rotate back and forth around the pin - and - hole structure 751 , the bristles 730 wipes back and forth for tooth brushing . [ 0054 ] fig8 shows an automatic toothbrush 800 with a toothbrush head 700 at different angle positions of the driving shaft 411 . the automatic toothbrush 800 is shown in a front view of the toothbrush head 700 . the driving shaft 411 is engaged with the notch 753 on the engagement element 754 . as the driving shaft 411 oscillates from side to side , it drives the rotatable bristle holder 750 to rotate and thus the bristles 730 to wipe back and forth for tooth brushing . the size of the rotatable disk 750 and the distance from the notch 753 to the rotation center 751 shall be such chosen that the toothbrush bristles 730 have a back and forth travel distance up to 4 to 8 mm . [ 0056 ] fig9 shows a third embodiment of a disposable floss holder 900 , in accordance with the present invention . the floss holder 900 has on its first end two tines 920 and 930 securing a piece of dental floss 910 and on its second end a mounting hole 940 . the two tines 920 and 930 are such shaped and bent to hold the piece of dental floss 910 perpendicular to and about 5 to 20 mm away from an axis 942 of the mounting hole 940 . the two tines 920 and 930 are further bent and spaced to have the piece of dental floss 910 a length of about 10 to 20 mm . the mounting hole 1040 is sized to fit the driving shaft 411 of the driving handle 400 . [ 0057 ] fig1 shows an automatic dental flosser 1100 with a disposable floss holder 900 , in accordance with the present invention . the automatic dental flosser 1100 consists of a disposable floss holder 900 fastened onto the driving shaft 411 of a driving handle 400 . as the driving shaft 411 swings from side to side around the pin 413 , the floss holder 900 moves back and forth for dental flossing . the length of the disposable floss holder 900 is chosen such that the travel distance of the floss 910 is up to preferably 4 to 6 mm . for a preferred embodiment , the peak - to - peak oscillation amplitude of the tip 412 of the driving shaft 411 is about 2 to 3 mm and the length of the driving shaft 411 is about 40 mm , the length of the disposable floss holder 900 is approximately 50 mm . [ 0059 ] fig1 shows a second embodiment of an attachable toothbrush head 1000 , in accordance with the present invention . the toothbrush head 1000 has bristles 1030 implanted on its first end and a mounting hole 1040 on its second end . the mounting hole 1040 is sized to fit the driving shaft 411 of the driving handle 400 . [ 0060 ] fig1 shows an automatic toothbrush with a toothbrush head 1000 , in accordance with the present invention . the automatic toothbrush 1200 consists of a detachable toothbrush head 1000 fastened onto the driving shaft 411 of a driving handle 400 . as the driving shaft 411 swings from side to side around the pin 413 , the toothbrush head 1000 wipes back and forth for tooth brushing . the length of the detachable toothbrush head 1000 is such chosen that the travel distance of the toothbrush bristles 1030 is preferably 4 to 6 mm . for a preferred embodiment , the peak - to - peak oscillation amplitude of the tip 412 of the driving shaft 411 is about 2 to 3 mm and the length of the driving shaft 411 is about 40 mm , the length of the detachable toothbrush head 1000 is approximately 50 mm . the floss holder 900 , as well as the floss holders 200 and 300 , adapts the shape of the tines from a popular manual floss holder that is relatively easy to manipulate . the floss holder 900 is simple and easy to make , and it is thus better justified to be a disposable item . the automatic toothbrush 800 adapts a circular oscillation of the toothbrush bristles 730 . such a circular oscillation has been well accepted in the market . the driving handles 400 and 500 implement a side - to - side oscillation of the driving shaft to enable the automatic dental flossers 100 and 1100 and automatic toothbrushes 800 and 1200 . any combination of these automatic dental flossers and toothbrushes can be a useful product . it is understood that floss holder 200 and toothbrush head 700 adapt a similar circular oscillation of a rotatable member . therefore , other driving mechanism or coupling mechanism that can provide a circular oscillation to a toothbrush head can also be used to drive a floss holder with a rotatable element . it is also understood that dental flosser 1100 and toothbrush 800 adapt a hybrid motion , of which the floss holder is driven to swing side to side while the toothbrush bristles are driven to oscillate rotationally . other than the driving shafts and driving mechanisms described in fig4 and 5 , there are driving mechanisms that can provide similar hybrid motion or provide movements including such a hybrid motion . for example , fig1 shows a third embodiment of a driving handle 1300 that is suitable to provide a hybrid motion for dental flossing and tooth brushing , in accordance with the present invention . the construction of the driving handle 1300 is similar to that of the driving handle 400 except the driving mechanism that couples the continuous rotation of the motor 1320 to a side - to - side swing oscillation of the driving shaft 1311 . as shown in fig1 , the driving mechanism includes a disk element 1321 , an arm element 1331 , and a bar 1319 . the disk 1321 is affixed on the motor &# 39 ; s shaft and is mounted with an off - center pin 1322 . the arm element 1331 is affixed on a first end of the bar 1319 and is embedded a slot 1332 . the motor 1320 rotates the disk element 1321 continuously . the off - center pin 1322 slides inside the slot 1332 and pushes the bar 1319 to rotate back and forth around a bearing 1313 . consequently , the driving mechanism transfers the continuous rotation of the motor 1320 to a rotational oscillation of the driving shaft 1311 around an axis 1315 . when a floss holder 900 is fastened on the driving shaft 1311 , the driving handle 1300 can drive the floss holder 900 to swing from side to side around an axis 1315 of the driving handle 1300 . when a toothbrush head 700 is attached onto the driving handle 1300 , the driving shaft 1311 can drive the toothbrush bristles 730 to oscillate rotationally with respect to the toothbrush head 700 . consequently , the driving handle 1300 provides a hybrid motion for dental flossing and tooth brushing . therefore , it is further understood that , the present disclosure includes only a few embodiments , other modifications and variations may be made without departing from the following claims . u . s . pat . no . 6 , 178 , 579 jan . 30 , 2002 blaustein et al . electric toohbrush u . s . pat . no . 6 , 047 , 711 apr . 11 , 2000 wagner method and apparatus for converting a power - driven toothbrush into a power - driven flossing device u . s . pat . no . 6 , 000 , 083 dec . 14 , 1999 blaustein et al . electric toothbrush u . s . pat . no . 5 , 975 , 296 nov . 2 , 1999 dolan et al . dental floss holder u . s . pat . no . 5 , 944 , 033 aug . 31 , 1999 robinson dental flossing device and method therefor u . s . pat . no . 5 , 860 , 435 jan . 19 , 1999 hippensteel dental floss holder with an automatic floss tensioning means u . s . pat . no . 5 , 827 , 064 nov . 27 , 1998 bock orbitally or reciprocally vibrating method for interproximal plaque removal u . s . pat . no . 5 , 606 , 984 mar . 4 , 1997 gao automatic dental flossing device u . s . pat . no . 5 , 579 , 786 dec . 3 , 1996 wolk et al . automatic dental flossing device u . s . pat . no . 5 , 573 , 020 nov . 12 , 1996 robinson dental flossing device and method therefor u . s . pat . no . 5 , 400 , 811 mar . 28 , 1995 meibauer power driven tooth flosser u . s . pat . no . 5 , 353 , 460 oct . 11 , 1994 bauman power driven toothbrush u . s . pat . no . 5 , 343 , 883 sep . 6 , 1994 murayama sonic dental device and method u . s . pat . no . 5 , 341 , 534 aug . 30 , 1994 serbinski et al . electric toothbrush u . s . pat . no . 5 , 323 , 796 jun . 28 , 1994 urso automated dental flosser u . s . pat . no . 5 , 279 , 314 jan . 18 , 1994 poulos et al . electronic dental flosser u . s . pat . no . 5 , 267 , 579 dec . 7 , 1993 bushberger oscillating flossing implement u . s . pat . no . 5 , 253 , 382 oct . 19 , 1993 beny power operated toothbrush u . s . pat . no . 5 , 217 , 031 jan . 8 , 1993 santoro motor - driven apparatus for cleaning spaces between teeth by dental floss u . s . pat . no . 5 , 188 , 133 dec . 23 , 1993 romanus dental flossing tool u . s . pat . no . 5 , 186 , 191 feb . 16 , 1993 loubier motor driven dental floss applicator u . s . pat . no . 5 , 170 , 809 dec . 15 , 1992 imai et al . powered dental floss u . s . pat . no . 5 , 085 , 236 feb . 4 , 1992 odneal et al . dental floss machine u . s . pat . no . 5 , 060 , 681 oct . 29 , 1991 westbrook et al . dental flossing device u . s . pat . no . 5 , 033 , 150 jul . 23 , 1991 gross et al . motor - driven toothbrush u . s . pat . no . 5 , 016 , 660 may 21 , 1991 boggs automatic flossing tool u . s . pat . no . 4 , 880 , 382 nov . 14 , 1989 moret et al . integrated oral hygiene system u . s . pat . no . 4 , 830 , 032 may 16 , 1989 jousson power driven flossing device u . s . pat . no . 4 , 605 , 025 aug . 12 , 1986 mcspadden power dental flossing device u . s . pat . no . 4 , 586 , 521 may 6 , 1986 urso multi - motion dental flosser u . s . pat . no . 4 , 245 , 658 jan . 20 , 1981 lecouturier automatic flossing apparatus u . s . pat . no . 4 , 235 , 253 nov . 25 , 1980 moore electric dental flosser u . s . pat . no . 4 , 014 , 354 mar . 29 , 1977 garrett dental flossing tool u . s . pat . no . 3 , 156 , 936 nov . 17 , 1964 hartman et al . electric toothbrushes u . s . pat . no . 3 , 029 , 651 apr . 17 , 1962 flatt electrically operated apparatus for producing oscillatory motion of a toothbrush u . s . pat . no . 2 , 372 , 731 apr . 3 , 1945 nalbach et al . power operating means for tooth brushes
| 0 |
reference is first made to fig2 a to 2f to describe the processing steps for manufacturing an ic package in accordance with an embodiment of the present invention . fig2 a shows a cross - sectional side view of a copper ( cu ) panel substrate which forms the raw material of the leadframe strip indicated generally by the numeral 100 . as discussed in greater detail in applicants &# 39 ; u . s . pat . no . 6 , 229 , 200 , the leadframe strip is divided into a plurality of sections , each of which incorporates a plurality of leadframe units in an array ( e . g . 3 × 3 array , 5 × 5 array , etc .). only one such unit is depicted in the cross - sectional view of fig2 a . as shown in fig2 a , the copper strip is coated with a silver ( ag ) plating on a bottom surface thereof and a solder plating on a top surface thereof . in one embodiment , the plating is a eutectic solder composition . this coating is added to enhance lamination and provide and surface for soldering . solder flux is added to a portion of the leadframe 100 ( fig2 b ) and a second leadframe 102 with solder plating on both a top and a bottom surface thereof is laminated onto the first leadframe 100 using a proximity placement and thermal solder reflow technique to form a single pocket - type leadframe ( fig2 c ). in an alternative embodiment the second leadframe is laminated onto the first leadframe using a hot roller thermo - compressive cladding process . next , the semiconductor die is mounted to the leadframe using known techniques . in the present embodiment , solder paste is dispensed on another portion of the first leadframe 100 in fig2 d and the semiconductor die is attached to the first leadframe 100 by solder reflow technique ( fig2 e ). the semiconductor die is coated with a suitable surface for soldering , such as titanium ( ti ), tungsten ( w ), or gold ( au ) for mounting via solder reflow . in an alternative embodiment , the die is attached using a silver - filled epoxy , as will be understood by those of skill in the art . next , solder ball contacts 106 are mounted on a vapor deposited layer referred to as “ under bump metallurgy ” or ubm on the semiconductor die 104 , as will be understood by those of skill in the art ( fig2 f ). fig3 a to 3f show the processing steps for manufacturing the ic package of fig2 f in accordance with an alternative embodiment of the present invention . the order of the process steps in the present embodiment is different from the order of the steps of the embodiment of fig2 a to 2f . fig3 a shows a cross - sectional side view of the copper ( cu ) panel substrate which forms the raw material of the leadframe strip indicated generally by the numeral 100 . similar to the embodiment of fig2 a , the copper strip is coated with a silver ( ag ) plating on a bottom surface thereof and a solder plating on a top surface thereof . solder paste is dispensed on a portion of the leadframe 100 in fig3 b and the semiconductor die 104 is attached to the leadframe 100 by solder reflow technique ( fig3 c ). the semiconductor die 104 is coated with a suitable surface for soldering , such as titanium ( ti ), tungsten ( w ), or gold ( au ) for mounting via solder reflow . this is a solderable vapor deposit structure made in layers of three . next , solder flux is added to another portion of the first leadframe ( fig3 d ) and a second leadframe 102 with solder plating on both a top and a bottom surface thereof is laminated onto the first leadframe 100 using a solder reflow technique to form a single pocket - type leadframe ( fig3 e ). the solder ball contacts 106 are then mounted on the semiconductor die 104 as shown in fig3 f . fig4 a to 4f show the processing steps for manufacturing an alternative ic package in accordance with another embodiment of the present invention . the steps of fig4 a to 4f are similar to the steps of fig2 a to 2f except that the second leadframe 102 of the embodiment of fig4 a to 4f is a different shape than the second leadframe 102 of the embodiment of fig2 a to 2f . as shown in fig4 b to 4f , the second leadframe 102 provides a pocket in the center of each unit in which the semiconductor die 104 is mounted , when laminated on the first leadframe 100 . fig5 a to 5f show the processing steps for manufacturing the ic package of fig4 f in accordance with an alternative embodiment of the present invention . the steps of fig5 a to 5f are similar to the steps of fig3 a to 3f except that the second leadframe 102 of the embodiment of fig3 a to 3f is a different shape that the second leadframe 102 of the embodiment of fig3 a to 3f . again , the second leadframe 102 provides a pocket in the center of each unit in which the semiconductor die 104 is mounted when laminated on the first leadframe 100 . fig6 a to 6g show the processing steps for manufacturing an ic package in accordance with another embodiment of the present invention . fig6 a shows a cross - sectional side view of a copper ( cu ) panel substrate which forms the raw material of the leadframe strip indicated generally by the numeral 100 . the copper strip is coated with a silver ( ag ) plating on a bottom surface thereof and a solder plating on a top surface thereof , as shown . next a solder flux is added to a portion of the first leadframe 100 ( fig6 b ) and a second leadframe 102 with solder plating on both a top and a bottom surface thereof is laminated onto the first leadframe 100 using a solder reflow technique to form a single pocket - type leadframe ( fig6 c ). solder paste is then dispensed on a portion of the first leadframe 100 ( fig6 d ) and the semiconductor die is attached to the first leadframe 100 by solder reflow technique ( fig6 e ). the semiconductor die is coated with a suitable surface for soldering , such as titanium ( ti ), tungsten ( w ), or gold ( au ) for mounting via solder reflow . next , portions of the semiconductor die are coated with solder flux ( fig6 f ) and a third leadframe 108 with solder plating on both top and a bottom surfaces thereof is laminated to coated contact pads or i / o pads on the surface of the semiconductor die ( fig6 g ) via solder reflow technique . in an alternative embodiment the third leadframe 108 is laminated to the coated contact pads of the semiconductor die by epoxy . the contact pads are coated with , for example , ti , w , or au , for compatibility with the solder or with epoxy . fig7 a to 7g show the processing steps for manufacturing the ic package of fig6 g in accordance with an alternative embodiment of the present invention . the order of the process steps in the present embodiment is different from the order of the steps of the embodiment of fig6 a to 6g . fig7 a shows a cross - sectional side view of the copper ( cu ) panel substrate , which forms the raw material of the leadframe strip , indicated generally by the numeral 100 . similar to the embodiment of fig6 a , the copper strip is coated with a silver ( ag ) plating on a bottom surface thereof and a solder plating on a top surface thereof . solder paste is dispensed on a portion of the leadframe 100 ( fig7 b ) and the semiconductor die 104 is attached to the leadframe 100 by solder reflow technique ( fig7 c ). the semiconductor die 104 is coated with a suitable surface for soldering , such as titanium ( ti ), tungsten ( w ), or gold ( au ) for mounting via solder reflow . next , solder flux is dispensed on another portion of the leadframe 100 ( fig7 d ) and a second leadframe 102 having solder plating on both a top and a bottom surface thereof is laminated onto the first leadframe 100 using a solder reflow technique to form a single pocket - type leadframe ( fig7 e ). solder flux is then dispensed onto portions of the semiconductor die 104 ( fig7 f ) and a third leadframe 108 with solder plating on both top and bottom surfaces is laminated on the surface of the semiconductor die . fig8 a to 8g show the processing steps for manufacturing an alternative ic package in accordance with another embodiment of the present invention . the steps of fig8 a to 8g are similar to the steps of fig6 a to 6g except that the second leadframe 102 of the embodiment of fig8 a to 8g is a different shape than the second leadframe 102 of the embodiment of fig6 a to 6g . as shown in fig8 b to 8g , the second leadframe 102 provides a pocket in the center of each unit in which the semiconductor die 104 is mounted , when laminated on the first leadframe 100 . fig9 a to 9g show the processing steps for manufacturing the ic package of fig8 g in accordance with an alternative embodiment of the present invention . the steps of fig9 a to 9g are similar to the steps of fig7 a to 7g except that the second leadframe 102 of the embodiment of fig9 a to 9g is a different shape that the second leadframe 102 of the embodiment of fig7 a to 7g . again , the second leadframe 102 provides a pocket in the center of each unit in which the semiconductor die 104 is mounted when laminated on the first leadframe 100 . alternative embodiments and variations are possible . for example , in an alternative embodiment , the semiconductor die is attached to the leadframe by reflow of the solder plated on the copper of the first leadframe 100 rather than by the addition of solder paste to the leadframe and subsequent reflow . in yet another alternative embodiment , the semiconductor die is mounted on the leadframe via silver epoxy . other embodiments and variations will occur to those of skill in the art . all such embodiments and variations are believed to be within the scope and sphere of the present invention as defined by the claims appended hereto .
| 7 |
represented in fig1 is a block diagram for a circuit arrangement according to the invention for starting and operating discharge lamps . at connection terminals j , a line voltage from a line voltage source can be fed to the circuit arrangement . the line voltage is initially fed into a block fr . on the one hand , this block includes known means for filtering disturbances . on the other hand , this block includes a rectifier , which rectifiers the line voltage , which is an ac voltage . usually , a bridge - connected full - wave rectifier is used for this purpose . important for the function of a charge pump realized in the circuit arrangement is the property of the rectifier that it does not permit any current that allows an energy flow from the circuit arrangement to the line voltage source . the rectified line voltage is fed to an electronic pumping switch uni , a pumping node n 1 being produced at the connecting point between the rectifier fr and the electronic pumping switch uni . in the simplest case , the electronic pumping switch uni comprises a pumping diode , which only allows a current flow that flows from the pumping node n 1 to the pumping diode . it is also possible , however , to use any desired electronic switch , such as for example a mosfet , for the electronic pumping switch uni that performs the function of the pumping diode . the current which the electronic pumping switch uni allows through feeds a main energy store sto . the main energy store sto is usually configured as an electrolytic capacitor . however , other types of capacitors are also possible . in principle , the dual form of energy storage with respect to the capacitor is also possible . in the dual case , the main energy store sto is configured as a coil . because of the lower costs and the better efficiency , a capacitor is preferred as the main energy store sto . there are also configurations of charge pumps with a number of so - called pumping branches . in this case , a number of electronic pumping switches uni are connected in parallel . this produces a number of pumping nodes n 1 . for the mutual decoupling of the pumping nodes , a diode is connected in each case between the rectifier and the pumping node . an exemplary embodiment with two pumping branches is represented in fig2 . the main energy store sto provides its energy to an inverter inv . the inverter inv generates an alternating variable , usually an ac voltage , which is fed to a block , which is designated by mn and pn . mn designates the function of the block as a matching network . with respect to this function , the block mn / pn can be connected to a discharge lamp l . pn designates the function of the block as a pumping network . with respect to this function , the block mn / pn is connected to the pumping node n 1 . the connecting line between the pumping node n 1 and the block mn / pn is provided in fig1 with an arrow at both ends . this is intended to indicate that energy flows in an alternating manner from the pumping node n 1 to the block mn / pn and back . the functions of the matching network and of the pumping network are combined in the block mn / pn because embodiments of the invention in which individual components can be assigned both to one and the other function are possible . a controller cont , which uses a manipulated variable to act on the inverter inv , is provided for controlling a desired first operating variable . consequently , a parameter of the alternating variable delivered by the inverter , for example the operating frequency or the pulse width , is changed in such a way that changing of the first operating variable is counteracted . the first operating variable is fed to a first input of the controller via the terminal b 1 . the first operating variable is a variable which determines the operation of the lamp . therefore , in fig1 the terminal b 1 originates from the block for the discharge lamp l . the first operating variable is , for example , the lamp current or the lamp power . these variables to not have to be recorded directly on the discharge lamp l , but can also be taken from the block mn / pn . according to the invention , the controller cont has a second input . a second operating variable is fed to the second input via a threshold switch th . according to the invention , the second operating variable is a measure of the reactive energy that resonates in a resonant circuit contained in the block mn / pn . the tapping of the second operating variable by means of the terminal b 2 therefore takes place at the block mn / pn . it is also possible , however , to obtain a measure of said reactive energy from lamp operating variables , such as for example the lamp voltage . for igniting the discharge lamp l , reactive energy is built up in the resonant circuit . the reactive energy provides information on the energy imbalance of the charge pump and the loading of components . if the second operating variable exceeds the threshold of the threshold switch , according to the invention the rectifier is influenced by the controller cont in such a way that the reactive energy does not increase any further . this can take place by the operating frequency of the inverter inv being raised . the controller cont may include an adder , which adds the signals present at the controller inputs . it must be ensured that the signal at the first controller input does not clamp the signal at the second controller input . if the signal at the second controller input exceeds the signal at the first controller input , the signal at the second controller input must be the decisive controller signal . represented in fig2 is an exemplary embodiment of a circuit arrangement according to the invention for starting and operating discharge lamps . a line voltage can be connected to the terminals j 1 and j 2 . the line voltage is fed via a filter , comprising two capacitors c 1 , c 2 and two coils l 1 , l 2 , to a full - bridge rectifier comprising the diodes d 1 , d 2 , d 3 , d 4 . the full - bridge rectifier provides the rectified line voltage at its positive output , a node n 21 , with respect to a reference node n 0 . the rectified line voltage is fed via the diodes d 5 and d 6 to two pumping nodes n 22 and n 23 . the exemplary embodiment in fig2 accordingly has two pumping branches . the diodes d 5 and d 6 are necessary for decoupling the pumping branches from each other . when there is only one pumping branch , a pumping node can be connected directly to the rectifier output , the node n 21 . in this case , however , it must be ensured that the diodes used in the rectifier can switch quickly enough to follow the inverter frequency . if this is not the case , a high - speed diode must be connected between the rectifier output and the pumping nodes even when there is only one pumping branch . in the exemplary embodiment in fig2 the pumping nodes are coupled to the positive output of the rectifier . charge pump topologies in which pumping nodes are coupled to the negative output of the rectifier are also known from the literature . leading from the pumping nodes n 22 and n 23 to the node n 24 there is respectively an electronic pumping switch , configured as diodes d 7 and d 8 . connected between n 24 and no is the main energy store , which is configured as electrolytic capacitor c 3 . c 3 feeds the inverter , which is configured as a half bridge . other converter topologies , such as for example a flyback converter or full bridge , can also be used , however . a half bridge is advantageously used for lamp powers of between 5 w and 300 w , since it represents the lowest - cost topology . the half bridge essentially comprises a series connection of two half - bridge transistors t 1 and t 2 and a series connection of two coupling capacitors c 4 and c 5 . both series connections are connected in parallel with c 3 . a connecting node n 25 of the half - bridge transistors and a connecting node n 26 of the coupling capacitors form the inverter output at which a square - wave inverter voltage with an inverter frequency is present . connected between n 25 and a lamp voltage node n 27 is a lamp inductor l 3 . connected at n 27 is the terminal j 3 , at which the series connection of two discharge lamps lp 1 and lp 2 is connected in the exemplary embodiment . however , the present invention can also be configured with one or more lamps . the current through the discharge lamps lp 1 and lp 2 flows via a terminal j 8 , through a winding w 1 of a measuring transformer to the node n 26 . consequently , the inverter voltage is essentially applied to a series connection of two discharge lamps lp 1 , lp 2 and the lamp inductor l 3 . the current fed into j 3 flows not only through the gas discharge of the discharge lamps lp 1 , lp 2 but also through an outer filament of the first discharge lamp lp 1 to a terminal j 4 . from there , it continues through a winding w 4 of a heating transformer , on through a variable resistor r 1 and on through a winding w 3 of the measuring transformer to the terminal j 7 . connected to the terminal j 7 is an outer filament of the second discharge lamp lp 2 , the other end of which leads to the terminal j 8 . two inner filaments of the discharge lamps lp 1 and lp 2 are respectively connected via the terminals j 5 and j 6 to the winding w 5 of the heating transformer . by the arrangement described in this paragraph , the inverter voltage brings about not only a current through the gas discharge of the discharge lamps lp 1 , lp 2 but also a heating current through the outer filaments and , via the heating transformer , also a heating current through the inner filaments of the discharge lamps lp 1 , lp 2 . if only one discharge lamp is to be operated , it is possible to dispense with the heating transformer . the heating current is essentially required before the ignition of the discharge lamps lp 1 , lp 2 , during a preheating phase as a preheating current for the preheating of the filaments . the value of the heating current is determined largely by the variable resistor r 1 . during the preheating phase , the value of r 1 is so low that a heating current prescribed by lamp data is achieved . after the preheating phase , the value of r 1 increases , so that negligible heating current flows in comparison with the current through the gas discharge of the discharge lamps lp 1 , lp 2 . in the exemplary embodiment , r 1 is realized by a so - called ptc or positive temperature coefficient thermistor . this is a resistor which in the cold state has a low resistance . the ptc thermistor is heated up by the heating current , making its resistance value increase . r 1 may also be realized by an electronic switch which is closed in the preheating phase and then open . a resistor with a constant resistance value may be connected in series with the switch . consequently , a rapid transition from the preheating phase to the igniting phase is possible . the described arrangement for preheating the filaments has the effect that , during the preheating phase , the resonant frequency of a resonant circuit described in the next paragraph is lower than its natural frequency , due to damping . an inverter frequency which lies below the natural frequency is advantageously chosen during the preheating phase , in order to obtain a high heating current , and consequently a short preheating phase . the lamp voltage node n 27 is connected to the pumping node n 23 via a first resonant capacitor c 6 . connected between n 23 and no is a second resonant capacitor c 7 . c 6 and c 7 form with the lamp inductor l 3 a resonant circuit . for fixing the natural frequency of the resonant circuit , c 6 and c 7 are viewed as connected in series . the effective capacitance value of c 6 and c 7 with respect to the natural frequency is consequently the quotient of the product and the sum of the capacitance values of c 6 and c 7 . if the resonant circuit is stimulated close to its natural frequency , an ignition voltage that leads to the ignition of the discharge lamps is produced across the lamps . after the ignition , l 3 acts together with c 6 and c 7 as a matching network , which transforms an output impedance of the inverter into an impedance necessary for the operation of the discharge lamps . the connection of c 6 and c 7 to the pumping node n 23 has the effect , however , that the combination of l 3 , c 6 and c 7 acts not only as a resonant circuit and matching network but at the same time as a pumping network . if the potential at n 23 is lower than the momentary line voltage , the pumping network l 3 , c 6 , c 7 draws energy from the line voltage . if the potential at n 23 exceeds the voltage at the main energy store c 3 , the energy accepted from the line voltage is delivered at c 3 . the choice of the ratio of the capacitance values of c 6 and c 7 allows the effect of the network l 3 , c 6 , c 7 as a pumping network to be adjusted . the greater the capacitance value of c 7 is chosen to be , the less the network l 3 , c 6 , c 7 acts as a pumping network . a further pumping effect is produced by a capacitor c 8 , which is connected between n 23 and the connecting node n 25 of the half - bridge transistors t 1 , t 2 . c 8 also not only acts as a pumping network but at the same time performs the task of a snubber capacitor . snubber capacitors are generally known as a measure for switch relief in inverters . the pumping network for the second pumping branch comprises the series connection of a pumping inductor l 4 and a pumping capacitor c 9 . this pumping network is connected between the connecting node n 25 of the half - bridge transistors t 1 , t 2 and the pumping node n 22 . in the case of the present exemplary embodiment , two pumping branches are used , in order that the pumped energy is divided between a number of components . lower - cost dimensioning of the components is consequently possible . it also provides a degree of freedom in the design of the dependence of the pumped energy on operating parameters of the discharge lamps . however , the invention can also be realized with only one pumping branch . the half - bridge transistors t 1 , t 2 are designed as mosfets . other electronic switches may also be used for this . for activating the gates of t 1 and t 2 , an integrated circuit ic 1 is provided in the exemplary embodiment . ic 1 is in the present example a circuit of the type ir2153 from the company international rectifier . alternative circuits of this type are also available on the market ; for example l6571 from the company stm . the circuit ir2153 includes a so - called high - side driver , with which the half - bridge transistor t 1 can also be activated , although it has no connection at the reference potential n 0 . a diode d 10 and a capacitor c 10 are necessary for this purpose . the operating voltage supply of the ic 1 takes place via the terminal 1 of the ic 1 . in fig2 a voltage source vcc is provided for this purpose between terminal 1 of the ic 1 and no . several possible ways in which this voltage source vcc can be realized are generally known . in the simplest case , the ic can be supplied via a resistor from the rectified line voltage . apart from the driver circuits for the half - bridge transistors , ic 1 includes an oscillator , the oscillating frequency of which can be set via the terminals 2 and 3 . the oscillating frequency of the oscillator corresponds to the inverter frequency . connected between the terminals 2 and 3 is a frequency - determining resistor r 3 . connected between terminal 3 and n 0 is the series connection of a frequency - determining capacitor c 11 and the emitter - collector path of a bipolar transistor t 3 . connected in parallel with the emitter - collector path of t 3 is a diode d 9 , in order that c 11 can be charged and discharged . the inverter frequency can be set by a voltage between the base terminal of t 3 and n 0 and consequently forms a manipulated variable for the control circuit . the base terminal of t 3 is connected to a manipulated - variable node n 28 . t 3 , ic 1 and their wiring can consequently be regarded as a controller . the functions of the ic 1 and its wiring can also be realized by any desired voltage - controlled or current - control oscillator which brings about the activation of the half - bridge transistors via driver circuits . the control circuit in the exemplary embodiment records as a controlled variable the current through the gas discharge of the discharge lamps lp 1 , lp 2 . for this purpose , the measuring transformer has a winding w 2 . the winding direction in the measuring transformer is designed such that the heating current in the winding w 3 is subtracted from an overall current in winding w 1 , so that in winding w 2 there flows a current which is proportional to the current through the gas discharge of the discharge lamps lp 1 , lp 2 . a full - bridge rectifier , formed by diodes d 11 , d 12 , d 13 and d 14 , rectifies the current through winding w 2 and leads it via a low - resistance measuring resistor r 4 to n 0 . the voltage drop across r 4 is consequently a measure of the current through the gas discharge of the discharge lamps lp 1 , lp 2 . passing via a low - pass filter for averaging , which is formed by a resistor r 5 and a capacitor c 13 , the voltage drop across r 4 reaches the input of a noninverting measuring amplifier . the measuring amplifier is realized in a known way by an operational amplifier amp and the resistors r 6 , r 7 and r 8 . in the exemplary embodiment , a gain of the measuring amplifier of about 10 is set . in the event that the voltage drop across r 4 has values which can be used directly as a manipulated variable , it is possible to dispense with the measuring amplifier or replace it with an impedance converter , such as for example an emitter follower . the output of the measuring amplifier is connected via a diode d 15 to the manipulated - variable node n 28 . consequently , the control circuit for controlling the current through the gas discharge of the discharge lamps lp 1 , lp 2 is closed . the diode d 15 is necessary in order that the potential of n 28 can be raised to a value that lies above the value prescribed by the measuring amplifier . the anode of d 15 represents a first controller input . the threshold switch according to the invention is realized in fig2 by a varistor mov . it lies in a series connection with a capacitor c 12 , a resistor r 2 and a diode d 17 , which connects the voltage node n 27 to the manipulated - variable node n 28 . the anode of d 17 represents a second controller input . n 28 is connected via the parallel connection of a resistor r 9 and a capacitor c 14 to n 0 . at n 27 there is with respect to n 0 a voltage which is a measure of the reactive energy resonating in the resonant circuit , formed by l 3 , c 6 and c 7 . if this voltage exceeds the threshold voltage of the varistor mov , a current flows through r 9 , and c 14 is charged . the voltage at the manipulated - variable node n 28 is consequently raised . this brings about an increase in the inverter frequency , and the reactive energy resonating in the resonant circuit is reduced , since the inverter frequency shifts further away from the natural frequency of the resonant circuit . connected between no and the connecting point of r 2 and d 17 is the diode d 16 . consequently , acting together with c 12 , the sum of the positive amplitude and negative amplitude of the voltage which the varistor mov allows to pass is applied to n 28 . instead of the varistor mov , any other desired threshold switch may be used , such as can be constructed for example by zener diodes or suppressor diodes . the threshold value of the varistor mov is chosen in the application example as 250 vrms . a higher value has the effect that more reactive energy is allowed in the resonant circuit , which leads to a higher ignition voltage at the discharge lamps lp 1 , lp 2 , but also leads to a greater loading of components . consequently , a desired optimum can be set by means of the threshold value of the varistor mov . the value of the resistor r 2 influences the intensity of the effect of the intervention according to the invention on the control circuit at the manipulated - variable node n 28 . a nonlinear relationship between the voltage at the manipulated - variable node n 28 and the inverter frequency is also advantageous . this nonlinear relationship is realized in the application example by the nonlinear characteristic of t 3 . moreover , it is influenced by the dependence of the frequency of the oscillator in the ic 1 on the voltage at the terminal 3 of the ic 1 . due to the nonlinearity , a strong increase in the voltage at n 27 leads to a disproportionate increase in the inverter frequency , whereby overloading of components , such as for example the voltage loading of c 3 or the current loading of t 1 and t 2 , is prevented . instead of the voltage , the current in the resonant circuit could also be used as a measure of the reactive energy resonating in the resonant circuit . an additional winding on l 3 could serve this purpose , for example .
| 8 |
fig1 depicts an apparatus for automatically powering up and powering down an electrical device in accordance with the invention . an automatic power - up , power - down circuit 100 is shown optionally connected to bus 180 over optional bus interface 175 . the automatic power - up , power - down circuit connects a source of power 105 to an output terminal 106 powering the electrical device as described more hereinafter . a self - powered motion detector 110 , detects motion in the vicinity of the electrical device . when motion is detected a bistable device 115 is set to close switch 120 to power - up proximity detector 125 and ir detector 130 . with these detectors powered up , if the motion detected by motion detector 110 is within a certain proximity of the electrical device and if the amount of infra - red radiation emitted by the object detected is adequate , that is , above a certain threshold , both inputs to and gate 135 are activated , setting bistable 140 which then closes switch 145 permitting power from source 105 to go to electrical device over terminal 106 . with the application of power , power - down timer 150 begins timing , counting down from a certain value . any motion in the vicinity of the electrical device will trigger a motion detector periodically resulting in reset of the power - down timer . however , when a period of time goes by with no motion detected , one may assume that a user has left the area and eventually power - down timer 150 will time out , resetting bistables 140 and 115 , thus turning off power to the electrical device at terminal 106 and turning off power to the proximity detector 125 and the infra - red detector 130 . as the user walks back toward the electrical device , the motion detector will first sense the presence and power - up proximity detector and infra - red detectors 125 and 130 respectively and the cycle begins again . motion detector 110 can not distinguish between motion caused by a large object at a far distance or a small object at a close distance . proximity detector 125 can distinguish how close an object is and also whether or not the object is closer than a particular threshold . the infra - red detector detects whether or not the moving object within a certain proximity is a living object or not , and , based on the amount of infra - red radiation , can determine the approximate size of the object . by using all three of these detectors , one may ensure that a human operator is close enough to the electrical device to want to use it . under those conditions , the electrical device is powered - up . the optional bus interface 175 and the optional computer bus 180 are used as discussed hereinafter for activating computer display screens . the infra - red detector can also be utilized to distinguish the situation in which the computer is being carried by a person from one in which a motion results from a person approaching . if a person is approaching , the ir intensity will be increasing , whereas if the device is being carried , the ir levels will remain constant . fig2 a is an illustration of a computer which is selectively battery powered and suitable for use with the invention . the illustration of the computer corresponds to any one of a variety of standard battery powered portable computers 200 . such computers typically have a keyboard 210 which is exposed when open , a disc drive 215 , a mouse 220 , which may be incorporated into the keyboard , and a display 225 for displaying output from the processor . in one embodiment , the display is a touchscreen display . in accordance with the invention , an eyetracker sensor is shown at 230 , positioned so as to be able to view the user &# 39 ; s eyes . the use of the eyetracker sensor will be described more hereinafter . fig2 b is a block diagram of the internal hardware of the computer of fig2 a . a bus 250 serves as the main information highway interconnecting the other components of the computer . cpu 255 is the central processing unit of the system , performing calculations and logic operations required to execute a program . read only memory ( 260 ) and random access memory ( 265 ) constitute the main memory of the computer . disk controller 270 interfaces one or more disk drives to the system bus 250 . these disk drives may be floppy disk drives , such as 273 , internal or external hard drives , such as 272 , or cd rom or dvd ( digital video disks ) drives such as 271 . a display interface 275 interfaces display 220 and permits information from the bus to be displayed on the display . communications with external devices can occur over communications port 285 . an automatic power - up / power - down circuit 100 is connected to the bus 250 over bus interface 175 . power from power source 105 is utilized to power - up the computer and the bus structure over terminal 106 . the outputs from the motion detector , proximity detector and ir detector of the automatic power - up / power - down circuit 100 are connected to the bus and are utilized as more fully described hereinafter . an eyetracker 290 is interfaced to the bus over interface 289 and provides information for control of the power and described more hereinafter . the display 220 is interfaced to the computer bus over display interface 275 . a separate control line 276 is shown between the display interface 275 and the display 220 . this line is utilized to control the intensity of illumination of images on the surface of the display . it effectively serves as a power control for the display device . fig2 c illustrates an exemplary memory medium which can be used with drives such as 273 in fig2 b or 210 a in fig2 a . typically , memory media such as a floppy disk , or a cd rom , or a digital video disk will contain , inter alia , program information for controlling the computer to enable the computer to perform its testing and development functions in accordance with the invention . fig3 is a state transition diagram showing the control processes used in accordance with the invention . the process begins with a power save state 310 which is described more in detail in fig4 . from the power save state , the state can transition either to a power - up state 320 or return to itself . from power - up state 320 , the invention can transition to a power - down state shown more in detail in fig5 ( 330 ) or return to itself . turning to fig4 if motion detector 110 shown in fig1 detects motion ( 410 ), the proximity detector and the ir detector are activated ( 420 ). if they are both activated , then a check is made to determine if proximity of the object whose motion is detected is less than the threshold ( 430 ) and then a check made to see if the ir level is greater than a threshold ( 440 ). if it is , switch 145 shown in fig1 is closed and power is applied to terminal 106 to power - up the external device thus entering the power - up state 320 shown in fig3 . states 430 and 440 can transition to “ set timer ” state 450 if their conditions are not met . after timer 450 times out , it will transition to state 460 where the proximity detector and the ir detectors will be deactivated . state 460 will transition back to state 410 and the process begin again . state 460 may also be entered externally from the power - down state 330 shown in fig3 . fig5 shows more in detail the power - down state transition diagram 330 of fig3 . when entered from the power - up state 320 of fig3 a set timer state 520 is entered which corresponds to power - down timer 150 shown in fig1 . if motion is detected ( state 530 ) timer 520 is reset . if no motion is detected , state 540 results from a timeout which triggers a power - down device state 550 . this corresponds to resetting of flip - flops 140 and 115 if fig1 . state 550 transitions back to power save state 300 shown in fig3 and more specifically to state 460 within that state . fig6 is a flow chart of a one power control process used as part of the invention . eyetracker 290 , shown in fig2 b is utilized to control the illumination of images on the display 220 . how this is done is shown in fig6 . the eyetracker outputs are processed to distinguish four conditions shown in fig6 namely : 1 . whether the eyes are fixed at a point on the screen , 3 . whether the eyes are approaching the screen from a position off the screen , and these four cases are distinguished by separate processing branches shown in fig6 . when the eyetracker determines that the eyes are fixed on the screen , case 1 ( 610 ) obtains and the display intensity is set at normal illumination ( 615 ). in case number 2 ( 620 ), when the eyes move from the screen to a point off the screen , a time interval of , preferably , { fraction ( 1 / 10 )} of a second ( 625 ) is set . if that time expires without the eyes returning to the screen , the screen will slowly fade the display intensity to black ( 626 ). in the embodiment shown in fig6 once the eyes have been off the screen for a period of time greater than the time set in item 625 , cases 3 and 4 are treated identically . that is , whether the eyes are approaching the screen or moving across the screen without fixing on the screen , the display intensity will resume normal illumination as quickly as possible . normal illumination will thus continue until such time as the eyes leave the screen again . in one embodiment , step 626 includes steps shown in fig8 . in step 830 , power to the eyetracker is removed when it is determined in step 827 that the user has not looked at the display for a predetermined period of time . in step 840 , power to the sep eyetracker is restored after the user has not looked at the display for a predetermined period of time by a user input . if the display is a touchscreen display , the user input is provided by touching the touchscreen display . the embodiment shown in fig7 is identical for cases 1 and 2 as that shown in fig6 . however , cases 3 and 4 are treated separately . in case 3 , where the eyes are approaching the on - screen condition , in this embodiment , nothing happens . that is , the screen remains blank . however , case 4 results in measurement of the time that the eyes are on the screen . if the time the eyes are on the screen exceeds some threshold , the display intensity is resumed at normal illumination as quickly as possible . thus , in accordance with the invention , electrical devices powered by energy sources of finite capacity can utilize the energy available to the maximum extent possible and reduce energy waste to a minimum . in this disclosure , there is shown and described only the preferred embodiment of the invention , but , as aforementioned , it is to be understood that the invention is capable of use in various other combinations and environments and is capable of changes or modifications within the scope of the inventive concept as expressed herein .
| 8 |
fig1 represents a first embodiment of a suspended soffit , canopy or like static structure 10 that is exposed to up - lift wind loading . the structure or system 10 includes a rectangular grid 11 , of generally known , conventional construction . the grid 11 includes main runners 12 in the form of inverted tees and cross runners 13 shown as flanged u - shaped channels . the main runners 12 are preferably formed of sheet metal , as is conventional , and have a hollow reinforcing bulb 14 at an upper edge , a double web 16 extending from the bulb and flange portions 17 extending from opposite sides of the web . the flange portions 17 can be covered at a lower face of the main runner 12 by a sheet metal strip that forms a cap 18 with its longitudinal edges 19 folded over the longitudinal digital edges of the flange portions 17 . together the flange portions 17 and cap 18 form a flange proper 20 . typically , the overall height of the bulb 14 is 1½ ″, its width is ¼ ′ and the flange 20 is 15 / 16 ″ or 1½ ″ wide . preferably , the cross runners 13 are formed of sheet metal and have ends that overlie the main runner flange portions 17 and cap edges 19 . the cross runners 13 include tabs 21 that extend through slots in the web 16 of the main runner 12 . suitable rigid water - resistant or waterproof panel material is secured to the lower faces of the main and cross runners 12 and 13 . this panel material 23 can be sheet rock ® brand exterior ceiling board , fiber rock ® brand sheeting , aqua - tough ™ and durock ® brand cement board , such being trademarks of usg corporation . the panels 23 are attached in a conventional manner with self - drilling and tapping screws , for example . the main runners 12 are suspended from overlying structure , i . e . superstructure , by hanger wires 26 . the hanger wires 26 , made of 12 gauge steel suitably coated , are typically used in suspension ceilings , as well as soffits , and offer an inexpensive , quick and reliable way of hanging a suspended ceiling - like structure . the wires 26 , while affording adequate tensile force to support the weight of a ceiling or soffit , afford essentially no compression strength . the soffit installation 10 includes compression post assemblies 31 spaced along the lengths of the main runners 12 to hold the soffit down against wind up - lift forces that can exceed the weight of the soffit itself . the compression post assemblies 31 transfer the up - lift wind load on the soffit to the superstructure from which the soffit is hung . a compression post assembly 31 includes a main strut shaft or post 32 and a saddle fitting 33 . the main shaft 32 is preferably made of round tube stock and , in particular , can be made from thin wall electrical conduit or electrical metal tubing ( e . m . t .). in fig1 and 2 , the main shaft 32 is made of nominal ½ ″ e . m . t . the main post 32 , ordinarily , can be cut to length at the location where the soffit 10 is constructed . the length of the main post is slightly less than the distance between the top of the bulb 14 of the particular main runner 12 being supported from the superstructure directly above the main tee . ordinarily , the compression post assembly is installed after the grid 11 is in place so that appropriate measurements can be made to determine the suitable length of the main post 32 . fig5 - 7 , discussed below , show how a compression post assembly 31 may be located on a superstructure . the saddle fitting 33 can be made from tubing stock such as ¾ ″ e . m . t . cut to a length somewhat greater than the height of a main runner ; for instance , with a length 1½ to two times the height of a main runner . the tube stock of the saddle fitting 33 is formed with diametrally opposite slots 34 extending from a lower end 36 lengthwise or axially for a distance at least equal to the height of an upper surface 37 of the main runner bulb 14 to the flange 20 of the main runner represented by the folded - over edges 19 of the cap 18 . the length of the slots 34 preferably enables the lower end 36 of the fitting 33 to rest against and bear upon the main runner flange 20 , formed by the cap edges 19 , without interfering or being obstructed by the reinforcing bulb 14 . in assembly , the saddle fitting 33 is telescoped with the main post 32 by slipping it over the main post . depending in part on the manner by which the main shaft is located on the superstructure , the saddle fitting 33 can be slipped up over the main post 32 , aligned over a bulb 14 of a main runner 12 and dropped down against the main runner flange 20 . alternatively , the saddle fitting 33 can be placed on the main runner flange 20 and the main shaft or post 32 can thereafter be telescoped into the fitting 33 . with the fitting 33 resting on and abutted against the upper flange surface 37 , the fitting can be fixed to the main runner 12 with a self - drilling , self - tapping screw fastener 38 . the main post 32 received in telescoping relation with the saddle fitting 33 abuts or can be raised to abut the overlying superstructure and in this position is fixed to the saddle fitting by a self - drilling , self - tapping screw fastener 39 which can be identical to the screw 38 holding the fitting to the main runner 12 . with the fitting 33 screwed or otherwise fixed to the tee 12 and the post or shaft 32 screwed or otherwise fixed to the fitting , these elements form a rigid structure . the compression post assembly 31 is easily used with any common superstructure . fig5 illustrates use of the compression post assembly 31 with a wood truss or joist 41 forming the superstructure . a suitable screw , e . g . a wood screw or heavy drywall screw 42 is partially driven into the joist 41 directly above a main runner 12 where the saddle fitting 33 is located or will eventually be located . fig6 illustrates an example of an installation of the compression post assembly 31 where the superstructure includes a steel bar joist 46 . the upper end of the main shaft 32 is secured to the bar joist 46 by cross - drilling the main post and affixing it to the bar joist with a wire 47 . it will be seen that the upper post end 43 is abutted against the lower face of the bar joist 46 . fig7 illustrates installation of the compression post assembly 31 with a superstructure formed of a concrete beam or slab 51 . a powder driven anchor 52 , known in the art , is driven into the concrete 51 and the upper end 43 of the main post 32 is abutted against the lower face of the concrete 51 . fig3 illustrates the lower area of a compression post assembly 56 that has a larger load bearing capacity and / or a longer strut or post length limitation than that of the compression post assembly 31 illustrated in fig1 and 2 . the compression post assembly includes a strut or post 57 which can be made from ¾ ″ e . m . t . a saddle fitting 58 can be made of a short length of 1 ″ e . m . t . that is slotted in the same manner as the earlier described fitting 33 . fig4 illustrates still another form of a compression post assembly 61 . the assembly 61 comprises a main post or shaft 62 , made for example of ¾ ″ e . m . t ., a splice segment 63 made from ½ ″ e . m . t . and a saddle segment or fitting 64 made of ¾ ″ e . m . t . as before , the saddle fitting or element 64 is slotted to straddle the bulb 14 and web 16 to enable the lower end of the saddle to abut the upper flange surface 37 . the splice segment 63 is telescoped within the shaft or post 62 and saddle 64 . as in the earlier embodiments , the saddle is fixed by a screw 38 to the main runner 12 and the splice segment 63 is fixed to the saddle 64 and post 62 by separate screws 39 . fig8 and 9 illustrate a saddle fitting 70 in compression post assemblies 71 and 72 . the saddle fitting 70 is a tubular member having different diameters at respective ends 73 , 74 . each end 73 , 74 is provided with slots 76 adapted to receive the bulb and web 14 , 16 of a main runner 12 . fig1 illustrates a modified form of a compression post assembly 76 . the assembly comprises a rectangular channel that forms the main shaft 77 or strut and a saddle fitting 78 . the compression post assembly 76 is analogous to the previous circular tube arrangements shown in the previously described figures . the saddle fitting 78 has a u or c - shaped configuration in a horizontal cross - section and includes a slot 79 sized to enable it to be assembled over the bulb 14 and web 16 of a main runner 12 . the fitting 78 is proportional to slide in telescoped relation to the main shaft 77 . the fitting 78 is fixed with its lower end abutting the upper side of the tee flanges by a screw 38 to the main tee 12 and the main shaft 77 by a screw 39 . as described in connection with the previous embodiments , the main shaft 77 has its upper end abutted against a downwardly facing surface of an overlying superstructure or is otherwise suitably fixed or anchored to the same in a vertical position . the compression post assembly of the invention is characterized by a sliding , preferably telescoping fit between a main post and a saddle element . the saddle element is arranged to surround the bulb and web of an inverted t - shaped main runner and to stabilize the main runner by contacting the lower flange of the main runner on both sides of the web . with the saddle fitting fixed both to the main runner and to the main shaft , the main runner is prevented from prematurely buckling by twisting about its longitudinal axis . the telescoping relation between the saddle fitting and main shaft or strut is very dimensionally tolerant of variations between the ideal length of a main post in relation to the actual distance between a main runner and its overlying superstructure . while the invention has been shown and described with respect to particular embodiments thereof , this is for the purpose of illustration rather than limitation , and other variations and modifications of the specific embodiments herein shown and described will be apparent to those skilled in the art all within the intended spirit and scope of the invention . accordingly , the patent is not to be limited in scope and effect to the specific embodiments herein shown and described nor in any other way that is inconsistent with the extent to which the progress in the art has been advanced by the invention .
| 4 |
embodiments described herein relate to methods for providing an authenticatable storage area for installing or executing software in a storage - capable device . the principles and operation for providing an authenticatable storage area , s according to embodiments described herein , may be better understood with reference to the accompanying description and the drawings . according to an example embodiment , the secure software silo is an ieee 1667 silo that implements the proposed ast specification . while it is assumed that the sss contains a single application and a certificate , extension to multiple applications ( and associated certificates ) is possible ( e . g . using indexing based on either stids or silo indices ). an application consists of one or more executable packages ( e . g . archive files ) providing , for example : support for another silo , a device capability not fully supported by the host os , a user application , other executable content , or silo specific data such as license certificates or configuration information . if the executable package is an archive , the format of the archive can be selected based on the host os as provided by the probe command ( e . g . cab for windows or rpm for red hat linux ). the sss may contain a “ flat ” file system , a hierarchical file system , or a storage area without a file system . the certificate associated with the sss attests to the validity of the contents of the sss ( e . g . using a signature ), and serves to create a “ chain of trust ” as will be explained with regard to fig1 . referring now to the drawings , fig1 is a simplified block diagram of the operational scheme for the implementation of a secure software silo , according to preferred embodiments described herein . the operational scheme of fig1 relates to a write / update process . a similar scheme would apply to a read process as well . a storage device 10 ( e . g . tsd ) is first operationally connected to a host system 12 ( block a ). host system 12 is operationally connected to a server 14 . host system 12 then executes a probe command ( e . g . 1667 probe command ) ( block b ). the probe command returns a list of dfus ( e . g . stid list ) ( block c ). the sss then requests the necessary device certificate from host system 12 ( block d ). once the sss receives the device certificate ( block e ), host system 12 creates a secure session with server 14 using the device certificate ( block f ). server 14 can , at its discretion , reject the session connection , or select specific software according to the provided device certificate , which would prevent unlicensed propagation of the software to other devices . server 14 then provides a server certificate to host system 12 , establishing the chain of trust ( block g ). server 14 encrypts the content image ( i . e . image of the enabling software ) with a key agreed upon via the key exchange ( i . e . public - key exchange ) using the server certificate and the device certificate . the device certificate enables the association of the software in the sss with storage device 10 , preventing unlicensed propagation of the software to other devices . coupling between the software loaded from the sss and the specific unique instance of storage device 10 may be provided , if desired , by ( 1 ) signing the application using a device - specific public key such as that retrievable via the 1667 authentication silo manufacturer certificate ( ascm ), ( 2 ) including the device serial number in a tamper - resistant manner , or ( 3 ) using an additional component such as a digital - rights management ( drm ) dfu . the sss then begins to update its content image using the server certificate ( block h ). server 14 can , at its discretion , reject an update for specific software that is not considered trusted . for example , the device might reject linux drivers signed with a microsoft certificate , even though microsoft windows drivers are trusted from the same certificate . acknowledgement of the update is sent from storage device 10 to host system 12 ( block i ), and from host system 12 to server 14 ( block j ). server 14 then updates the content image of the sss on storage device 10 ( block k ). content transfer to the sss is atomic , meaning that if the update fails , then the sss “ rolls back ” to the previous image . alternatively , instead of encrypting the software , once the device certificate is received , the software can be signed and then sent to storage device 10 without encryption , but with a signature that can be confirmed by storage device 10 . once the update is complete , the content image is validated by storage device 10 ( block l ). the sss then retrieves the associated application via an application loader ( block m ), and updates the application ( block n ). the application loader uses the sss commands to read the application and certificate from the sss . the application contents are verified using a signature contained in the certificate , and the certificate itself is verified by the signature , creating a chain of trust to a certificate in an os certificate store . the sss can have a fixed or variable storage capacity for applications . verified and trusted applications ( e . g . drm applications ) are installed for use by the os of host system 12 . these applications can be installed independent of the user privileges . the applications are removed when storage device 10 is removed , or when the os shuts down . more than one sss can be provided to allow “ locked ” software ( i . e . software locked to the device ) and “ unlocked ” software to provide different levels of functionality . a bootstrap may also be stored in a partition ( e . g . a compact disc ( cd ) partition ) of storage device 10 . such a bootstrap could contain code required to support the ps and sss interfaces in ieee 1667 for host systems that do not natively support the ieee 1667 protocol . the use of the sss avoids the problem of updating a cd partition . furthermore , the use of the sss eliminates the need to have a cd partition to protect the software associated with storage device 10 . applications do not need to be protected from deletion or modification by the user as the sss is not visible to the user . furthermore , the application does not need to be protected from modification by software , since any change will be rejected when the application is validated using the signature in the certificate . the certificate is itself validated and cannot be replaced due to the chain of trust required for application certificates . an optional updater can be used to retrieve application updates from server 14 ( as in block h ). the updater may be loaded from the sss or the bootstrap . server 14 is a source of updates for the applications stored in the sss . to securely update the sss , a secure session must be established with server 14 using the chain of trust . server 14 for the sss can be tied to the vs ( e . g . as in ieee 1667 standard ) or via a native interface in the sss ( depending on whether the vs is linked to the sss ). optionally , the updater requires certificates signed by the same signer of the device certificate in the sss , in order to prevent installation of software from any other source . optionally , the updater requires certificates signed by the same signer as a provisioning certificate in a vs associated with the same dfu . optionally , the sss may contain multiple locations . for example , one location can require a certificate signed by the signer of a manufacturer certificate ( ascm ), another location can require a certificate signed by the signer of an vs provisioning certificate ( xcp ), and another location can require a certificate signed by the signer of an vs host certificate used to authenticate host system 12 ( hch ). as will be understood by one of ordinary skill in the art , other sets of multiple locations may be implemented in the sss . fig2 is a simplified flowchart of the process steps for enabling software functionality via a secure software silo , according to preferred embodiments described herein . fig2 differs from fig1 in part in that fig2 shows how the software functionality is enabled through the sss without showing the certification procedure through the server . as mentioned above with regard to fig1 , fig2 relates to a write / update process . a similar scheme would apply to a read process as well . the process starts with a tsd being operationally connected to a host system ( step 20 ). the host system executes a probe command ( step 22 ). the probe command then returns the list of silos present ( step 24 ). the silos are functional units implemented in the storage device including the sss . the host system loads the software from the sss ( step 26 ). the software is then validated ( step 28 ) and installed ( step 30 ). the validated software may then provide an interface to silos in the storage device ( step 32 ). the interface enables the device - functionality software to be loaded . the host system then loads the device - functionality software from the sss ( step 34 ), and the device - functionality software is validated ( step 36 ). validation is generally performed using secret codes carried by the device . once validated , the device - functionality software is executed ( step 38 ), and the silo functionality is enabled with software support ( step 40 ). the host system then checks whether there are more silos to process ( step 42 ). if there are more silos to process , then the host system loads additional software from the sss ( step 32 ), and continues the process . if there are no more silos to process , then the process ends ( step 44 ). the presence of the sss minimizes the support required from the os to just the probe command and the sss commands . even authentication can be performed by an application loaded from the sss . the probe command , which identifies the host os and version , may be used to provide support for more than one os . this step can be performed in the ps , the host system , or the sss . the ps can be configured to return a list of only silos for which applications usable with the host os reside in the sss . this can be performed by providing a single silo that shows different content depending on the host os . if the probe command returns more than one sss , the host system can choose the silo containing the application most compatible with the host os . this can be performed by allocating different stids for the sss for each host os ( e . g . windows sss or mac os sss ), or by implementing a command on the sss that returns host - os compatibility to the probe command . the sss can also have a command that returns a list of compatible host - os identifiers . alternatively , such an identifier - list command can be included in the device certificate . in the case that the host os is identified to the sss , the sss can return a list of applications specific to the host os . if such applications do not exist , a failure notification can be returned . the sss can also be implemented with multiple host - os - specific storage areas . in the case that the host os is identified to the sss , the sss selects the storage area specific to the host os . if such a storage area does not exist , a failure notification can be returned . fig3 is a simplified flowchart of the process steps for various scenarios or outcomes in the implementation of a secure software silo , according to preferred embodiments described herein . the process starts with a tsd being operationally connected to a host system ( step 50 ). the host system executes a probe command ( step 52 ). the host system then searches for enabling software ( step 54 ). the host system checks whether enabling software was found ( step 56 ). if enabling software was found , the host system checks whether the user authorizes the use of the enabling software ( step 58 ). if the user authorizes the use of the enabling software , then the approved enabling software is installed or executed ( step 60 ). the enabling software provides interfaces to the sss in the tsd ( step 70 ). if no enabling software is found in step 56 , or the user does not authorize the use of the enabling software in step 58 , the process continues with step 63 . if the user is running an operating system such as windows that supports autorun functionality , the os may then detect the autorun functionality as specified in a user - accessible file such as autorun . inf ( step 64 ), and checks whether autorun is enabled ( step 66 ). if autorun is enabled , then the autorun functionality is executed ( step 68 ). the host system then checks whether the device - functionality software is installed ( step 70 ). if the device - functionality software is installed , then silo functionality is enabled with software support ( step 72 ). if the device - functionality software is not installed , then software support is enabled , but the silo is unusable ( step 74 ). if autorun is not available or enabled in step 66 , then the host system checks whether the device - functionality software is installed ( step 76 ). if the device - functionality software is installed , then silo functionality is enabled without software support ( step 78 ). if the device - functionality software is not installed , then no functionality is enabled ( step 80 ). the initiation of the application stored in the sss is performed by the ieee 1667 support of the host os independently of the autorun mechanism . host systems with the autorun mechanism and full 1667 support can still provide full functionality even when the autorun mechanism is disabled . prior - art methods for installation of device - specific applications or drivers are limited by the trust placed in the user as indicated by the user &# 39 ; s privileges . this prevents the use of new devices or new device functionality until a limited - privileges user can have a higher - privilege user install the required applications or drivers . the sss allows the removal of such privilege restrictions by providing a basis of trust that depends on the provider of the applications or drivers , independent of the user privileges . as an example , the windows update process utilizes a similar approach to provide temporary device - specific updates to the os . if the sss is only visible when the tsd has been authenticated by a specific host system , un - authenticated host systems will see a different sss that has support only for reduced functionality . the full functionality of the tsd cannot be ascertained by a host system that has not been authenticated , since even the interface required to access the functionality is stored in an inaccessible sss , and such interfaces can differ from device to device . while the invention has been described with respect to a limited number of embodiments , it will be appreciated that many variations , modifications , and other applications of the invention may be made . the invention is not limited except by the scope of the appended claims .
| 6 |
[ 0025 ] fig1 is a cross - sectional view of a wellbore 100 prepared to accept an expandable liner assembly ( not shown ) that includes an upper and lower sealing apparatus ( not shown ) of the present invention . as depicted , wellbore 100 does not contain casing . an uncased wellbore is known in the industry as an open - hole wellbore . it should be noted that this invention is not limited for use with uncased wellbore , but rather can be also be used with a cased wellbore . in a cased wellbore , the casing is typically perforated at a predetermined location near a formation to provide a flow path for hydrocarbons from the surrounding formation . thereafter , the perforations may be closed by employing the present invention in a similar manner as described below for an open - hole wellbore . as shown in fig1 the wellbore 100 is a vertical well . however , it should be noted that the present invention may also be employed in horizontal or deviated wellbores . as illustrated in fig1 a prepared section 105 has an enlarged diameter relative to the wellbore 100 . typically , the prepared section 105 is enlarged through the use of an under - reamer ( not shown ). however , other methods of enlarging the wellbore 100 may be employed , such as a bi - center bit , so long as the method is capable of enlarging the diameter of the wellbore 100 for a predetermined length . in a typical under - reaming operation , the wellbore 100 is enlarged past its original drilled diameter . the under - reamer generally includes blades that are biased closed during run - in for ease of insertion into the wellbore 100 . the blades may subsequently be activated by fluid pressure to extend outward and into contact with the wellbore walls . prior to the under - reaming operation , the under - reamer is located at a predetermined point in the wellbore 100 . thereafter , the under - reamer is activated , thereby extending the blades radially outward . a rotational force supplied by a motor causes the under - reamer to rotate . during rotation , the under - reamer is urged away from the entrance of the wellbore 100 toward a downhole position for a predetermined length . as the under - reamer travels down the wellbore , the blades on the front portion of the under - reamer contact the diameter of the wellbore 100 , thereby enlarging the diameter of the wellbore 100 to form the prepared section 105 . [ 0028 ] fig2 a and 2b are cross - sectional views illustrating the expandable liner assembly 150 and a running assembly 170 being lowered into the wellbore 100 on a work string 120 . additionally , the work string 120 acts as a conduit for hydraulic fluid that is pumped from the surface of the wellbore 100 to the various components on the running assembly 170 . as shown , the work string 120 extends through the entire length of the running assembly 170 and connects to a drillable plug 190 at the lower end of the running assembly 170 . during the run - in operation , the drillable plug 190 prevents wellbore fluid from entering an annulus 165 created between the expandable liner assembly 150 and the running assembly 170 . as depicted , the plug 190 includes an aperture 195 to allow hydraulic fluid to exit the work string 120 during the expansion operation . the running assembly 170 further includes an upper torque anchor 160 to provide a means to secure the running assembly 170 and expandable liner assembly 150 in the wellbore 100 . as shown on fig2 a , the upper torque anchor 160 is in a retracted position to allow the running assembly 170 to place the expandable liner assembly 150 in the desired location for expansion of the liner assembly 150 in the prepared section 105 . the upper torque anchor 160 illustrates one possible means of securing the running assembly 170 and expandable liner assembly 150 in the wellbore 100 . it should be noted , however , that other securing means well known in the art may be employed so long as they are capable of securing the running assembly 170 and expandable liner assembly 150 in the wellbore 100 . additionally , a lower torque anchor 125 , which is disposed below the upper torque anchor 160 , is used to attach the expandable liner assembly 150 to the running assembly 170 . at the lower end of the torque anchor 125 , a motor 145 is disposed to provide the rotational force to turn the expansion tool 115 . [ 0030 ] fig2 a depicts the expansion tool 115 with rollers 175 retracted , so that the expansion tool 115 may be easily moved within the expandable liner assembly 150 and placed in the desired location for expansion of the liner assembly 150 . when the expansion tool 115 has been located at the desired depth , hydraulic pressure is used to actuate the pistons ( not shown ) and to extend the rollers 175 so that they may contact the inner surface of the liner assembly 150 , thereby expanding the liner assembly 150 . generally , hydraulic fluid ( not shown ) is pumped from the surface to the expansion tool 115 through the work string 120 . additionally , the expansion tool includes blades 155 to cut the liner assembly at a predetermined location . as illustrated in fig2 a , the expandable liner assembly 150 includes an upper tubular 180 . the upper tubular 180 includes a plurality of slots 140 formed on the surface of the upper tubular 180 . generally , the slots 140 are a plurality of longitudinal slots in the upper tubular 180 to provide a point where an upper and lower portion of the liner assembly 150 may separate after the expansion process is complete . the expandable liner assembly 150 further includes the upper sealing apparatus 200 and the lower sealing apparatus 300 . generally , the upper and lower sealing apparatus 200 , 300 are used in conjunction with a lower tubular 185 to seal off a portion of the prepared section 105 in order to isolate a zone of the wellbore 100 . as shown in fig2 a and 2b , the components for the sealing apparatus 200 , 300 are identical . therefore , the following paragraphs describing the components in the upper sealing apparatus 200 will also be applicable to the lower sealing apparatus 300 . as depicted on fig2 a , the expandable liner assembly 150 also includes the lower tubular 185 disposed between the upper and lower sealing apparatus 200 , 300 . generally , the lower tubular 185 is expanded into the prepared section 105 by the expansion tool 115 . in the embodiment shown , the lower tubular 185 is an expandable liner that works in conjunction with the upper and lower sealing apparatus 200 , 300 to isolate a portion of the prepared section 105 from other portions of the wellbore 100 . however , other forms of expandable tubulars may be employed , such as expandable screens or metal skin , so long as they are capable of isolating a zone of the wellbore 100 . [ 0033 ] fig3 a and 3b are cross - sectional views illustrating the upper sealing apparatus 200 partially expanded into contact with the wellbore 100 by the expansion tool 115 . as shown on fig3 b , the upper sealing apparatus 200 includes an expandable tubular 205 . the expandable tubular 205 has an inner surface 245 and an outer surface 255 . the expandable tubular 205 further includes a plurality of apertures 260 that are equally spaced around the circumference of the expandable tubular 205 and act as passageways between the inner surface 245 and the outer surface 255 . in the embodiment shown , the apertures 260 are tapped and plugged by a plurality of plug members 210 to initially prevent communication between the inner surface 245 and the outer surface 255 . additionally , a plurality of fine mesh screens 275 are disposed on outer surface 255 around the plurality of apertures 260 . in another embodiment , the apertures 260 remain unplugged , thereby allowing communication between the inner surface 245 and the outer surface 255 . the upper sealing apparatus 200 further includes an upper end member 215 and a lower end member 240 disposed around the outer surface 255 of the expandable tubular 205 . the upper and lower end members 215 , 240 are machined out of a composite material which allows the end members 215 , 240 to expand radially outward while maintaining a clamping force and structural integrity . however , other types of material may be used to machine the end members 215 , 240 , so long as they are capable of expanding radially outward while maintaining a clamping force and structural integrity . the upper end member 215 is disposed at the upper end of the sealing apparatus 200 . the primary function of the upper end member 215 is to secure one end of a plurality of upper ribs 220 and an upper end of a sealing element 225 to the expandable tubular 205 . preferably , the upper ribs 220 are equally spaced around the outer surface 255 of the expandable tubular 205 . the upper ribs 220 are embedded in the sealing element 225 to provide support during the expansion of the upper sealing apparatus 200 . the upper ribs 220 are fabricated out of deformable material such as aluminum . however , other types of deformable material may be employed , so long as the material is capable of providing support while deforming due to pressure . additionally , the lower end member 240 secures one end of a plurality of lower ribs 235 and the lower end of sealing element 225 to the tubular 205 in the same manner as the upper end member 215 . the upper sealing apparatus 200 further includes the sealing element 225 . the sealing element 225 is disposed around the tubular 205 to increase the ability of the sealing apparatus 200 to seal against an inner surface of the wellbore 100 upon expansion . in the preferred embodiment , the sealing element 225 is fabricated from an elastomeric material . however , other materials may be used , so long as they are suitable for enhancing the fluid seal between the expanded portion of the sealing apparatus 200 and the wellbore 100 . the sealing element 225 is secured at the upper end of the sealing apparatus 200 by the upper end member 215 and the lower end by the lower end member 240 . another function of the sealing element 225 is to contain a swelling elastomer 230 that is disposed between the outer surface 255 of the expandable tubular 205 and the sealing element 225 . the swelling elastomer 230 is a cross - linked polymer that will swell multiple times its initial size upon activation by an activating agent . generally , the activating agent stimulates the polymer chains to expand the swelling elastomer 230 both radial and axially . in the preferred embodiment , an activating agent such as a proprietary fluid or some form of water - based liquid activates the swelling elastomer 230 . however , other embodiments may employ different types of swelling elastomers that are activated by other forms of activating agents . in the preferred embodiment , the swelling elastomer 230 is wrapped around the outer surface 255 of the expandable tubular 205 in an inactivated state . the plug members 210 disposed in the apertures 260 act as a fluid barrier to prevent any fluid or activating agent from contacting the swelling elastomer 230 during the run - in procedure . further , the swelling elastomer 230 is contained laterally by the upper and lower end members 215 , 240 and contained radially by the deformable sealing element 225 and the deformable upper and lower ribs 220 , 235 . in this manner , the swelling elastomer 230 is substantially enclosed and maintained within a predefined location in an inactivated state and thereafter , within a controlled location in an activated state . as depicted on fig3 a , the upper torque anchor 160 is energized to ensure the running assembly 170 and the expandable liner assembly 150 will not rotate during the expansion operation . thereafter , at a predetermined pressure , the pistons ( not shown ) in the expansion tool 115 are actuated and the rollers 175 are extended until they contact the inner surface 245 of the expandable tubular 205 . the rollers 175 of the expansion tool 115 are further extended until the rollers 175 plastically deform the expandable tubular 205 into a state of permanent expansion . the motor 145 rotates the expansion tool 115 during the expansion process , and the tubular 205 is expanded until the outer surface of the sealing element 225 contacts the inner surface of the wellbore 100 . as the expansion tool 115 translates axially downward during the expansion operation , the rollers 175 knock off an upper portion of the plug members 210 , thereby removing the fluid barrier to allow fluid in the annulus 165 to travel through the apertures 260 and the fine mesh screen 275 into contact with the swelling elastomer 230 . as the fluid or activating agent contacts the swelling elastomer 230 , the polymer chains change positions , thereby expanding the swelling elastomer 230 laterally and radially to create a pressure energized seal with one or more adjacent surfaces in the wellbore 100 as shown in fig3 b . [ 0039 ] fig3 b is an enlarged cross - sectional view illustrating the expansion of the swelling elastomer 230 in the upper sealing apparatus 200 . as shown in the upper portion of the sealing apparatus 200 , the tubular 205 has been plastically deformed and the plug members 210 removed by the expansion tool 115 . additionally , fluid in the annulus 165 has entered the apertures 260 and activated an upper portion of the swelling elastomer 230 . as the swelling elastomer 230 continues to expand , the upper and lower end members 215 , 240 limit any lateral expansion while the fine mesh screen 275 limits any expansion through the apertures 260 , thereby causing the majority of the expansion forces to act radially outward to deform the upper and lower ribs 220 , 235 and the sealing element 225 . as both the tubular 205 and the swelling elastomer 230 are expanded , the sealing element 225 engages the surrounding wellbore 100 and creates a pressure energized seal . after the entire upper sealing apparatus 200 is expanded radially outward , the expansion tool 115 continues laterally downward expanding the lower tubular 185 . [ 0040 ] fig4 is a cross - sectional view illustrating the lower sealing apparatus 300 expanded into contact with the wellbore 100 by the expansion tool 115 . as shown , the expansion tool 115 has expanded the lower tubular 185 and the lower sealing apparatus 300 in the same manner as described in the previous paragraph regarding the upper sealing apparatus 200 . thereafter , the expansion tool 115 is moved to a predetermined point near the slots 140 as illustrated on fig5 . [ 0041 ] fig5 is a cross - sectional view illustrating the blades 155 on the expansion tool 115 cutting an upper portion of the expandable liner assembly 150 . as shown , the expansion tool 115 has moved laterally upward to a predetermined point below the slots 140 on the upper tubular 180 . as further shown , the rollers 175 have been retracted and the blades 155 have been extended outward until they contact the inner surface of the upper tubular 180 . as the motor 145 rotates the expansion tool 115 during the cutting operation , the lower ends of the slots 140 are cut to create finger - like members . [ 0042 ] fig6 is a cross - sectional view illustrating the removal of the upper tubular 180 from the wellbore 100 . for clarity , the running assembly 170 has been removed in fig6 . as shown , the lower end slots 140 have been cut by the expansion tool 115 . upon upward movement , as shown by arrow 198 , the finger - like members collapse radially inward to allow the upper portion of the tubular 180 to be removed from the wellbore 100 . [ 0043 ] fig7 is a cross - sectional view of the liner assembly 150 fully expanded into contact with the surrounding wellbore 100 . as depicted , a portion of the upper tubular 180 , lower tubular 185 and the upper and lower sealing apparatus 200 , 300 of this present invention are expanded into the prepared section 105 of the wellbore 100 . as shown , the inner diameter of liner assembly 150 is comparable to the inner diameter of the wellbore 100 above and below the liner assembly 150 . in this manner , the liner assembly 150 may isolate a zone within the wellbore 100 without restricting the inner diameter of the wellbore 100 , thereby allowing further exploration or unrestricted drilling of the wellbore 100 . in operation , the running assembly and liner assembly are lowered by the workstring to a predetermined point in the wellbore . thereafter , the upper torque anchor on the running assembly is energized to secure the running assembly and expandable liner assembly in the wellbore . subsequently , at a predetermined pressure , the pistons in the expansion tool are actuated and the rollers are extended until they contact the inner surface of the liner assembly . the rollers of the expansion tool are further extended until the rollers plastically deform the liner assembly into a state of permanent expansion . the motor rotates the expansion tool during the expansion process , and the liner assembly is expanded until the outer surface of the sealing element on the sealing apparatus contacts the inner surface of the wellbore . as the expansion tool translates axially downward during the expansion operation , the rollers knock off the upper portion of the plug members , thereby removing the fluid barrier to allow fluid in the annulus to travel through the apertures into contact with the swelling elastomer . as the fluid or activating agent contacts the swelling elastomer , the polymer chains change positions , thereby expanding the swelling elastomer laterally and radially to create a pressure energized seal with one or more adjacent surfaces in the wellbore . the expansion tool continues to move axially downward expanding the entire length of the liner assembly . thereafter , the expansion tool moves laterally upward to a predetermined point below the slots on the upper tubular . subsequently , the blades on the expansion tool extend radially outward until they contact the inner surface of the upper tubular . as the motor rotates the expansion tool during the cutting operation , the lower ends of the slots are cut to create finger - like members on a portion of the upper tubular . thereafter , the running assembly and the portion of the upper tubular are removed from the wellbore . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .
| 8 |
as indicated previously , it is one object of this invention to provide an expansible device ( 1 ) of medical use for thorax specific compression which is applied on and around a patient &# 39 ; s thoracic cage under conditions that make it possible to regulate their positioning and the pressure that is to be made thereby on osteocartilaginous deformations due to growth defects , especially those known as pectus carinatum , using their components themselves . this expansible device ( 1 ) of medical use for thorax specific compression comprises a framework that supports the means whereby the compressing action is to be made and , basically , comprises a belt ( 2 ) comprising two sections , a front one ( 3 ) and a back one ( 4 ), faced by their concave internal side , said sections ( 3 , 4 ) being preformed similarly to the basic virtual configuration of the cross section of a patient &# 39 ; s thoracic cage around which they are to be suspended jointly from the patient &# 39 ; s shoulders by wide belts ( 5 , 5 ′) that can be regulated according to and for the purposes that are explained later . both sections of the belt ( 3 , 4 ) shall be designated herein below , for the purposes of a better understanding , as the front arc ( 3 ) and back arc ( 4 ), which are connected to each other by their adjacent ends ( 6 , 7 and 7 ′) to be laterally located relative to the patient &# 39 ; s thoracic cage , i . e . at either side thereof . at the first end ( 6 ), this connection is created in an articulated way by a hinge ( 8 ), the turning shaft of which , preferably a pin passing through the respective articulated plate hole ( 14 and 17 ), is oriented perpendicular to the plane on which both arcs ( 3 , 4 ) extend and are articulated . everything is to be able to open the belt ( 2 ) in order to make their application around the patient &# 39 ; s thoracic cage easier . while at the second end ( 7 , 7 ′), this connection is achieved by means of an adjustable closure ( 9 ) which , in general , can be made according to any of the arrangements foreseen by the art regarding fastening that can be regulated between both ends of a belt . since a relevant matter , as is the fact that the pressure that is applied on the deformity , although it is the result from the side adjustment referred to above between the second ends ( 7 , 7 ′) of one ( 3 ) or another arc ( 4 ), is not made directly through the aforementioned connections , but this happens indirectly on the section of the thoracic cage wall being treated by the compressing plate ( 10 ) acting directly on the deformity , which is fixed to the front arc ( 3 ) lightly protruding from their inner side . thus , it is about achieving a compressing action strictly localized on the region embraced by the compressing plate ( 10 ) with direct incidence on the protrusion or deformity of the patient &# 39 ; s thoracic cage wall . in this way any undue pressure that could be cause respiratory dysfunctions is avoided . on the other hand , the adjustable connection between both arcs ( 3 , 4 ) centralized on one single side section of the aforementioned belt ( 2 ) of the device ( 1 ) allows to create an even continuity along its entire contour so that the adjusting action made between their connecting single outer ends ( 6 , 7 , 7 ′) is translated practically into a perfect localization of the pressure applied on the treatment region through said compressing plate ( 10 ) without running any risk of destabilizing the belt ( 2 ) relative to the supporting points on the patient &# 39 ; s thoracic cage . the size and position of the compressing plate ( 10 ) can be adapted specifically to the basic characteristics of the deformation of the thoracic cage to which the expansible device ( 1 ) is applied . the expansible device ( 1 ) according to this invention does not comprise a back plate on the spine like the prior art device . thus , the device ( 1 ) described herein makes a distributed pressure on the patient &# 39 ; s entire rib arc , whereby it comprises necessarily an effective cushion ( 11 ), especially on their back portion whereto an additionally protecting cushion layer is added . removal of the back plate tolerates a better adaptation of the patient to the belt ( 2 ) and the pains that are found with the prior art device are avoided . in the preferred embodiment of this invention , the belt ( 2 ) of the device ( 1 ) of this invention comprises the connection of at least six bent plates ( 12 , 13 , 14 , 15 , 16 , 17 ), wherein the front ( 3 ) and back ( 4 ) arcs forming the belt ( 2 ) comprise each at least three bent plates ( 12 , 13 , 14 y 15 , 16 , 17 ) the ends of which overlap , the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) are connected to each other by adjustable fixing means ( 18 ). the aforementioned ends of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) that constitute the front ( 3 ) and back ( 4 arcs have sets of complementary holes ( 19 ) which obviously allow to vary the width of the arc of the belt ( 2 ) closing or opening it depending on the needs of each case and depending on the evolution of the treatment . the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) form the arcs ( 3 , 4 ) being rigidly connected by sets of screws ( 18 ), for example of allen type , so that they keep the structural continuity of the belt ( 2 ). at least two pairs of sets of screws ( 18 ) re preferably used by each connection , wherein each pair is disposed to fix each of the ends of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) which overlap each other . the structure of the belt ( 2 ) of the device ( 1 ) of this invention permits regulations in every plate ( 12 , 13 , 14 , 15 , 16 , 17 ) that comprise them . these regulations allow to adapt the shape and size of the belt ( 2 ) to a given patient and then , during the treatment , to adapt it accompanying his physical development and the evolution of the protrusion by compression , in such a way that with the same and single expansible device ( 1 ), the patient completes his treatment integrally . this is required since , when the treatment starts to be effective , the thorax deformation is corrected causing thoracic widening . for that reason , the shape of the belt ( 2 ) must be changed in order to compensate for the changes in the thorax that has occurred , since the front back diameter is reduced and the side diameter is widened . on the contrary , taking into account that the treatment is applied to children at growth age , should the patient grow , the belt ( 2 ) must be widened in order to avoid an excessive compression . these regulations allow to use the same device ( 1 ) during the entire treatment that extends until growth is completed . if eventually growth is excessive , the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) of the belt ( 2 ) can be changed by longer ones and compensate for the patient &# 39 ; s development . in the preferred embodiment of the expansible device ( 1 ) of this invention , the front arc ( 3 ) comprises three front bent plates ( 12 , 13 , 14 ) and the back arc ( 4 ) comprises three back bent plates ( 15 , 16 , 17 ). the three front bent plates ( 12 , 13 , 14 ) are the right front plate or pdd ( 12 ), the middle front plate or pdc ( 13 ) and the left front plate or pdi ( 14 ). the three back bent plates ( 15 , 16 , 17 ) are : the right back plate or ptd ( 15 ), the middle back plate or ptc ( 16 ) and the left back plate or pti ( 17 ). preferably , the pdd ( 12 ) has length between 7 and 10 cm , the pdc ( 14 ) has a length between 16 and 32 cm and the pdi ( 14 ) has a length between 7 and 12 cm . also preferably , the ptd ( 15 ) has a length between 7 and 10 cm , the ptc has a length between 16 and 32 cm and the pti ( 17 ) has a length between 7 and 12 cm . the sizes of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) corresponding to a given size of a patient &# 39 ; s thorax are obtained through a mathematical formula that as a function of pressure correction , the circumference of the thorax before the correction and the height of the protrusion , determines the size of the belt ( 2 ). said formula is : mc is the size of the belt ( 2 ) expressed in cm ; mta is the thorax size taken at the height of the protrusion expressed in cm ; wherein , the sizes of each of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) result from a possible combination that allows to achieve the size of the belt ( 2 ) mc calculated . this possible combination of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) can be obtained from tables or by means of a computer program ( software ) that allows to obtain the best combinations for each mc . preferably , the width of the front ( 12 , 13 , 15 ) and back plates ( 15 , 16 , 17 ) is between 30 and 40 mm . in a preferred embodiment , adjustable fixing means ( 18 ) connect in a rigid and removable to the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) at their ends by means of screws ( 18 ) applied to cooperating hole rows ( 19 ) that can allow to vary the coupling distance between said plates ( 12 , 13 , 14 , 15 , 16 , 17 ) and concomitantly , the diameter of the belt ( 2 ). preferably , while the device ( 1 ) is being used by the patient , the compressing plate ( 10 ) comprises a compact measuring apparatus ( 20 ) mounted thereon that comprises an electronic pressure measuring equipment . an electronic temperature measuring equipment associated with at least one sensor is suitable for detecting the patient &# 39 ; s body temperature , and an associated time measuring circuit , in order to determine for how much time the patient , is effectively under the pressure selected by the physician , storing the recorded values in a memory to be transferred to a computer comprising a program suitable for that evaluation . in this preferred embodiment , the electronic pressure measuring equipment averages the values obtained by at least four sensors consisting of interconnected loading cells (“ strain gage ”) that convert the reading made by them to pressure values by means of an electronic converting circuit . in the preferred embodiment , the measuring equipment ( 20 ) comprises a digital screen for displaying the values recorded . preferably , the recorded values are sent to an interface , wherein the interface is connected to a computer that receives said value and processes it via an appropriate software . additionally , the recorded values can be sent to an interface in a wireless way . additionally , through a pressure measuring apparatus ( 21 ) with suitable sensors , the physician determines the effective compression pressure for compressing the deformity to be treated . at the same time , this pressure measuring apparatus ( 21 ) can be inserted in suitable anchorages in the compressing plate ( 10 ) of the expansible device ( 1 ) of medical use for the thorax specific compression in order to control in situ the pressure made by said expansible device ( 1 ) while being used by the patient as a result of the closure between the second ends ( 7 and 7 ′) of both arcs ( 3 , 4 ). the pressure measuring apparatus ( 21 ) is independent from the expansible device ( 1 ) and different from the compact measuring equipment ( 20 ) that can be mounted on the compressing plate ( 10 ). this apparatus ( 21 ) is normally found in the physician &# 39 ; s hands . when measuring pressure is required , it is inserted in the compressing plate ( 10 ) by using the anchorages comprised therein for that purpose . in this way , they can achieve reliable measurements and , in turn , the measuring device can be calibrated against possible failures . consequently , the thickness of the compressing plate ( 10 ) is considerably reduced , which means that it is not noticed under the patient &# 39 ; s clothes . the prior art device comprised a pressure measuring apparatus with one single sensor connected to the single pressure cell . this means that the value measured varied depending on where and how pressure was made on the compressing plate . whether it is used independently or that it is fixed at the corresponding anchorages of the compressing plate ( 10 ), the pressure measuring apparatus ( 21 ) comprises at least four sensors ( 22 ) consisting of interconnected loading cells (“ strain gage ”) that provide and / or record the pressure resulting from directly compressing the protrusion during diagnosis or the pressure caused by adjustment between both second outer ends ( 7 and 7 ′) of the belt ( 2 ). said sensors ( 22 ) provide pressure amount data by measuring it in suitable units ( for example , pa , hpa , kg / cm2 , psi ) so as to make only the required pressure , no more no less , required as a function of the degree of correction that is sought to be obtained at each treatment session . the pressure reading is obtained by means of an electronic circuit which converts the readings of the sensors ( 22 ) as an average of the readings of all the sensors ( 22 ) distributed throughout the surface of the compressing plate ( 10 ), thereby providing a value that is much more adjusted to reality estimating that the values that are obtained are at least 95 % reliable . the pressure measuring apparatus ( 21 ) preferably allow to display the pressure value on a digital screen ( 23 ), for example a liquid crystal display , wherein the determined pressure value can be seen in the suitable ( for example , pa , hpa , kg / cm 2 , psi ) and / or more preferably send such value to an interface in a wireless way , wherein the interface is connected to a computer that receives and processes such value via at least one appropriate computer program ( software ). this program allows to store all data from patients being treated and additionally different statistics can be obtained regarding the effectiveness of the treatment . since the equipment is wireless , it works with power provided by a battery . as its capacity decreases due to its use , measurements might be affected , therefore the measuring equipment comprises a low battery warning for replacement whereof . preferably , each sensor ( 22 ) can determine pressures ranging from 0 to 10 . 4 × 10 − 4 pa ( equivalent to 0 to 1 . 06 kg / cm 2 , or between 0 and 15 psi , being 1 psi = 1 pound / square inch ), pressures being made once the device has been placed , preferably ranging below about 172 . 4 kpa ( equivalent to 0 . 176 kg / cm 2 , or 2 . 5 psi ). should it be required , these preferred ranges can be changed and adapted depending on the patient without changing the scope of this invention . as already indicated , the expansible device ( 1 ) so constituted according to its basic general features , is completed by a suspension means arrangement ( 5 , 5 ′) developed for the purposes of supporting the device from the belt ( 2 ) in such a way that its plates ( 12 , 13 , 14 , 15 , 16 , 17 ) can be arranged at the required height from the time when they are applied to the patient and during all the time that correcting action is made , with the possibility of easily regulating said height while adjustment is carried out until the proper positioning of the compressing plate ( 10 ) on the deformity is achieved . these means ( 5 , 5 ′) preferably comprise classic traces or wide belts of an adjustable length , preferably with protecting shoulder reinforcements on the patient &# 39 ; s shoulders , and both wide belts start , for example , from respective engagements on the back arc ( 4 ) or from the ring applied on the middle plate ( 16 ) of the back arc and relative to which they open going up the patient &# 39 ; s back up to his shoulders from which they go down substantially parallel up to their connection to the front arc ( 3 ), on either side of the patient &# 39 ; s thorax in such a way that when they are extended they leave a broad free space for proper operation of the compressing plate ( 10 ) and the apparatus for measuring the pressure made and the patient &# 39 ; s body temperature as a function of time . regarding the aforementioned lateral adjustment means between the outer second ends ( 7 and 7 ′) of both arcs ( 3 , 4 ), it has been foreseen , by way of example , to adopt an arrangement of the means equivalent to the classic closure ( 9 ) of a belt by a flexible tab with a buckle catch which obviously can be substituted by any other kind of closure ( 9 ) which permits an effective control of the tension made between both ends ( 7 , 7 ′) and , at the same time , a firm removable interlocking at the degree of adjustment determined in each case , so as to make its graduation depending on the evolution of the correction sure and possible . a closure ( 9 ) by engagement between two adjustable buckles at respective flexible tabs at both ends ( 7 , 7 ′), or a closure ( 9 ) with an engagement and tension , could also be used . as described above , the expansible device ( 1 ) of this invention preferably comprises a closure ( 9 ) created between the second ends ( 7 and 7 ′) of both arcs ( 3 , 4 ) by respective flexible tabs connected by an adjustable closure ( 9 ), comprising , additionally , a latch for preventing its involuntary opening . additionally and if required , planetary gearings or additional compressing plates fixed in the belt of the device ( 1 ) of the invention by respective sheets that keep them on eventual thoracic deformations that are shown in compressing the primary thoracic malformation that is corrected . the thoracic contour is thereby integrally shaped . the different front ( 12 , 13 , 14 ) and back plates ( 15 , 16 , 17 ) of the belt ( 2 ) of the device ( 1 ) according to this invention can be made from any material that allows to apply pressure on a thoracic malformation to be corrected and to keep it constant and effective enough during the entire treatment , allowing the patient to breathe comfortably . the proper materials for making the aforementioned plates ( 12 , 13 , 14 , 15 , 16 , 17 ) are aluminum , plastics laminated with pressure - resistant fibers , etc ., which allow to apply high pressures without deforming . it is suitable to indicate that the inner side of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) comprising both arcs ( 3 , 4 ) like that of the compressing plate ( 10 ) are conveniently coated by protections , which are made up of suitable protecting coatings ( 11 ) in the sections of the thoracic cage wall and the deformity on which they are contact while using the device ( 1 ). said internal protections ( 11 ) are selected from cushions , inflatable pads , silicone pads and their combinations . preferably , the materials used in their construction are hypoallergenic . more preferably , the materials of the protections do not comprise latex . a portable system useful in the treatment of pectus carinatum , comprising : an expansible device ( 1 ) of medical use for thorax specific compression comprising the aforementioned inventive characteristics , comprising a series of plates ( 12 , 13 , 14 , 15 , 16 , 17 ) of different lengths and curvatures that can be exchanged until they form the belt ( 2 ) of a compressing device meant for a given patient , wherein the compressing plate ( 10 ) comprises mounted thereon a compact measuring apparatus ( 20 ) comprising an electronic pressure measuring equipment , an electronic temperature measuring equipment associated with at least one sensor suitable for detecting the patient &# 39 ; s body temperature and an associated time measuring circuit for continuously measuring the patient &# 39 ; s body temperature during the time that compression force is applied effectively , storing in a memory the values and times recorded ; a pressure measuring apparatus ( 21 ) with suitable sensors ( 22 ) for determining the suitable compression pressure for the malformation to be treated and that at the same time can be inserted in the compressing plate ( 10 ) of the expansible device ( 1 ) of medical use for thorax specific compression for compressing the pressure made in situ by the expansible device ( 1 ) once applied to the patient ; an apparatus for measuring ( 24 ) the patient &# 39 ; s thorax size ; an apparatus for molding / bending ( 25 ) the straps that form the expansible device in order to adapt them to the patient &# 39 ; s thorax profiles ; and additionally , a portable computer comprising at least one computer program ( software ) suitable for evaluation and follow - up of the patient &# 39 ; s evolution . eventually , the computer can be installed in the physician &# 39 ; s consulting room and that must comprise at least one suitable computer program . the apparatus for measuring ( 24 ) a patient &# 39 ; s thorax size comprising the graduated ruler ( 26 ) and a sliding cursor ( 27 ) thereon wherein the length of the distance between the ends of both the ruler ( 26 ) and the cursor ( 27 ) is indicated by the latter on the former . in another embodiment , the thorax size can be obtained by a cursor comprising a spherical or circular sliding element associated to an electronic circuit which , in describing the perimeter to be determined , allows to obtain the values required for suitably sizing the belt ( 2 ) of the expansible device ( 1 ) of medical use for the thorax specific compression . additionally , the data can be sent to a computer and are loaded to the program via the same interface . preferably , the data are sent in a wireless way . the expansible compressing device ( 1 ) of medical use , the compact measuring apparatus ( 20 ) mounted on the compressing plate ( 10 ) comprising a pressure measuring apparatus , at least one suitable sensor for detecting the patient &# 39 ; s body temperature and an associated time measuring circuit , and the pressure measuring equipment ( 21 ) of the portable system of medical use in the treatment of thoracic deformations , preferably of pectus carinatum type , are complemented by an apparatus ( 25 ) for changing the curvature of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) that form the belt ( 2 ) when required by the circumstances . since the apparatus ( 25 ) for changing the curvature of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) is portable , it allows to make corrections of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) directly in the physician &# 39 ; s consulting room during patient &# 39 ; s attention rapidly and saving time as required . this apparatus form molding / bending ( 25 ) the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) consists of a motoreducer ( 28 ) associated to an electronic circuit allowing to make large forces with the equipment of reduced size . in effect , the apparatus for molding / bending ( 25 ) the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) is an electromechanical device comprising a motoreducer ( 28 ) that pulls a shaft ending in a wedge ( 29 ) acting on an apparatus ( 30 ) that is between two facing fixed stops ( 31 , 31 ′). the wedge ( 29 ) presses the plate ( 12 , 13 , 14 , 15 , 16 , 17 ) arranged resting on said stops ( 31 , 31 ′) for molding / bending changing its curvature and adapting it to the patient &# 39 ; s needs . all the components of the system , especially the apparatus for measuring the thorax size ( 24 ), the pressure measuring apparatus ( 21 ) with sensors ( 22 ) ad hoc and the bending apparatus ( 25 ) of the plates ( 12 , 13 , 14 , 15 , 16 , 17 ) are portable . from the operation point of view , the physician determines firstly what pressure must be applied to the deformity to be treated for its correction by the device of the invention . once it is verified that the deformation is sensitive to the pressure applied , it is also verified whether the correction does not lead to side deformations in making such pressure . the pressure is determined by the corresponding measuring apparatus . then , the patient &# 39 ; s thorax size is measured by a suitable tool or cursor by loading it on the memory of the measuring equipment and with the pressure values obtained the required adaptations to the device for a particular case to be treated are made . once the arc is adjusted to the patient &# 39 ; s thoracic contour , the regulation of the height is made by adjusting the wide belts with buckles and tracks for that purpose , positioning the belt compression plate at the height of the deformation to be corrected . then , the belt end closure of the device is adjusted in the proper position and the pressure made by the corresponding measuring equipment is verified . the required corrections are made until the suitable pressure on the deformity to be corrected is achieved . then , periodical controls are made in order to see the evolution of the correction and to implement the adjustments that may be required as sought results are achieved . during these evaluations it is also verified for how much time the patient used the device and at what compressing pressure , which is relevant when evaluating the effectiveness of the treatment . this is done by a compact measuring apparatus mounted on the compressing plate comprising an electronic pressure measuring equipment , an electronic temperature measuring equipment associated to at least one sensor suitable for detecting the patient &# 39 ; s body temperature and an associated time measuring circuit for continuously measuring the patient &# 39 ; s body temperature during the time that the compressing force is effectively applied , storing on a memory the values and times recorded . these temperature values can be derived to a computer having a suitable software . the measuring apparatus used in obtaining these values is compact and comprises a chip of a memory that allows to store the data obtained of the compressing pressure made , the body temperature and the time during which the pressure made was effective , until they are transferred to a computer . eventually , the measuring apparatus comprises a screen that allows to see the values accumulated in the memory . additionally and should this be required , the curvature of the plates of the belt can be corrected by using a plate molding equipment that is portable and allows an effective response during the patient &# 39 ; s visits to the attending physician in order to evaluate the effectiveness of the treatment . all that has been described herein corresponds to the best mode of carrying out the invention , bearing in mind that variations that are apparent for a person skilled in the art must be considered within the scope of this invention .
| 0 |
an anion exchange column is subjected to foulant buildup from photographic waste waters . an attempt is made to regenerate the column by treatment with ammonium chloride . however , the column has a limited reuse life because the ions that are not removed by the regenerant are retained on the column and thus reduce the column &# 39 ; s exchange capacity on subsequent cycles . use of stronger solutions and counterions fail to remove these compounds believed to be polythionates and quinone / quinoneoid products . for example , the use of sodium hydroxide , the most common of the regenerants , results in the formation of solids in the resin pores resulting from the reaction of the foulant ions with the sodium hydroxide . when an attempt is made to decompose the foulants using a three percent aqueous solution of hydrogen peroxide it is successful . that is , when such a treating agent is added to the column , the polythionates and quinone / quinoneoids are converted to sulfate , water , and carbon dioxide according to the reactions : ## str1 ## and these reaction products are easily removed from the column by conventional techniques and the column recovers its original capacity . thus , in the method of this invention , ions which remain on the column after conventional resin regeneration are converted to components which are very easily removed from the column . while conventional techniques are limited in their ability to return the column to its original condition , the on column or in situ destruction of foulants of this invention allows the return of the ion exchange resin to its original capacity . the method of the invention is not only applicable to all ion exchange columns but also to the other forms in which ion exchange resins are found such as in a membrane , in batch form , as a belt , etc . the method of the invention further works equally well with cation exchange resins or anion exchange resins . furthermore , there are currently many ion exchange applications where the use of the resin is limited by compounds irreversibly bound to the resin active sites . current techniques require pretreatment of the effluent to remove these compounds . in many of these cases , as for example in the organic fouling of anion exchange resins used to reduce the total dissolved solids of municipal waters , the use of on column conversion of the fouling molecules could be a desirable alternative to pretreating large quantities of water . i wish it to be understood that i do not desire to be limited to the exact details as described for obvious modifications will occur to a person skilled in the art .
| 1 |
referring to fig1 a to 1 e there is shown an apparatus which is generally identified by reference numeral 1 . the apparatus 1 comprises a clamp 2 for retaining a tubular 3 . the clamp 2 is suspended on wires 4 , 5 which are connected thereto on opposing sides thereof . the wire 5 passes through an eye 6 in lug 7 which is attached to a spherical bearing in arm 8 of a suspension unit 9 at the point at which the arm 8 is connected to a hydraulic motor . the wire is connected to the hydraulic motor 10 in a corresponding manner . the suspension unit 9 is of a type which enables displacement of the tubular 3 when connected to a tool 17 ( see below ), relative to a top drive 13 , along a number of different axes . the wires 4 , 5 pass across the suspension unit 9 and over pulley wheels 11 which are rotatably arranged on a plate 12 . the plate 12 is fixed in relation to a top drive generally identified by reference numeral 13 . the wires 4 , 5 then pass over drums 14 to which the wires 4 , 5 are also connected . the drums 14 are rotatable via a hydraulic winch motor 15 . in use , the clamp 2 is placed around a tubular below a box 16 thereof . the hydraulic winch motor 15 is then activated , which lifts the tubular 3 ( conveniently from a rack ) and towards a tool 17 for gripping the tubular 3 ( fig1 b ). the tubular 3 encompasses the tool 17 at which point the hydraulic winch motor 15 is deactivated ( fig1 c ). during this operation the elevator 18 is held away from the tool 17 by piston and cylinders 19 , 20 acting on bails 21 and 22 . the suspension unit 9 allows the hydraulic motor 10 and the arrangement depending therebelow to move in vertical and horizontal planes relative to the top drive 13 . the eyes 6 in lugs 7 maintain the wires 4 and 5 in line with the tubular 3 during any such movement . the tool 17 may now be used to connect the tubular to the tubular string . more particularly , the tool may be of a type which is inserted into the upper end of the tubular , with gripping elements of the tool being radially displaceable for engagement with the inner wall of the tubular so as to secure the tubular to the tool . once the tool is secured to the tubular , the hydraulic motor 10 is activated which rotates the tool 17 and hence the tubular 3 for engagement with a tubular string held in a spider . the clamp 2 is now released from the tubular 3 , and the top drive 13 and hence apparatus 1 is now lifted clear of the tubular 3 . the elevator 18 is now swung in line with the apparatus 1 by actuation of the piston and cylinders 19 and 20 ( fig1 d ). the top drive 13 is then lowered , lowering the elevator 18 over the box 16 of the tubular 3 . the slips in the elevator 18 are then set to take the weight of the entire tubular string . the top drive is then raised slightly to enable the slips in the spider to be released and the top drive is then lowered to introduce the tubular string into the borehole . referring to fig2 a to 2 d there is shown an apparatus which is generally identified by reference numeral 101 . the apparatus 101 comprises an elevator 102 arranged at one end of bails 103 , 104 . the bails 103 , 104 are movably attached to a top drive 105 via axles 106 which are located in eyes 107 in the other end of the bails 103 , 104 . piston and cylinders 108 , 109 are arranged between the top drive 105 and the bails . one end of the piston and cylinders 108 , 109 are movably arranged on axles 110 on the top drive . the other end of the piston and cylinders 108 , 109 are movably arranged on axles 111 , 112 which are located in lugs 113 , 114 located approximately one - third along the length of the bails 103 , 109 . the elevator 102 is provided with pins 115 on either side thereof and projecting therefrom . the pins 115 are located in slots 116 and 116 g . a piston 117 , 118 and cylinder 119 , 120 are arranged in each of the bails 103 , 104 . the cylinders are arranged in slot 121 , 122 . the piston 117 , 118 are connected at their ends to the pins 115 . the cylinders 119 , 120 are prevented from moving along the bails 103 , 104 by cross members 123 and 124 . a hole is provided in each of the cross members to allow the pistons to move therethrough . in use , a tubular 125 is angled from a rack near to the well centre . the tubular may however remain upright in the rack . the clamp 102 is placed around the tubular below a box 126 ( fig2 a ). the top drive is raised on a track on a derrick . the tubular is lifted from the rack and the tubular swings to hang vertically ( fig2 b ). the piston and cylinders 108 , 109 are actuated , extending the pistons allowing the bails 103 , 104 to move to a vertical position . the tubular 125 is now directly beneath a tool 127 for internally gripping and rotating the tubular 125 ( fig2 c ). the pistons 117 , 118 and cylinders 119 , 120 are now actuated . the pins 115 follow slot 116 and the clamp 102 moves upwardly , lifting the tubular 125 over the tool 127 ( fig2 d ). the tool 127 can now be actuated to grip the tubular 125 . at this stage the elevator 102 is released and the top drive 105 lowered to enable the tubular 125 to be connected to the string of tubulars in the slips and torqued appropriately by the top drive 105 . the pistons 117 , 118 and cylinders 119 , 120 are meantime extended so that after the tubular 125 has been connected the top drive 105 can be raised until the elevator 102 is immediately below the box . the elevator 102 is then actuated to grip the tubular 125 firmly . the top drive 105 is then raised to lift the tubular string sufficiently to enable the wedges in the slips to be withdrawn . the top drive 105 is then lower to the drilling platform , the slips applied , the elevator 102 raised for the tubular 125 and the process repeated . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .
| 4 |
the oxidizable material layer in this invention is utilized for forming an oxide layer as an element isolation layer by means of selective oxidation . as materials for such oxidizable material layer , polycrystalline silicon doped with high concentration of impurities such as phosphorus , arsenic and boron , non - monocrystalline silicon , such as polycrystalline silicon , containing substantially no impurities and metal silicides such as molybdenum silicide , tungsten silicide and tantalum silicide may be useful . such an oxidizable material layer may be formed on a semiconductor substrate with or without an oxide layer interposed therebetween . by disposing an oxide layer between the semiconductor substrate and the oxidizable material layer , it is possible to prevent the impurities in the oxidizable material layer from diffusing into the substrate at the time of selective oxidation . such a construction is effective , particularly when polycrystalline silicon layer of high impurity concentration is employed . as the diffusion of impurities in an oxidizable material layer is mainly dependent upon the time period of and temperature of the selective oxidation step , a deposition of an oxide layer between the substrate and the oxidizable material layer sometimes may not be sufficient to prevent the impurities in the oxidizable material layer from diffusing . therefore , if the temperature at the time of the selective oxidation is rather high or the duration of selective oxidation is long , it is advisable to make thicker the oxide layer , thereby securely preventing the diffusion of the impurities . to be more specific , when performing a selective oxidation for 200 minutes at 1 , 000 ° c . on a polycrystalline silicon layer with the phosphorous concentration of 1 × 10 16 / cm 3 , it is desirable to make the oxide layer more than 1 , 500 å thick . as such an oxide layer , a thermally oxidized layer or a cvd - sio 2 may be used . also , when an impurity - doped polycrystalline silicon layer is employed as an oxidizable material layer and etching of the polycrystalline silicon remaining on the substrate after selective oxidation is to be carried out the aforementioned oxide layer works as an etching stopper for protecting the substrate . with this invention , it is possible to considerably suppress a growth of so - called bird &# 39 ; s beak which is a phenomenon in which an oxide layer thrusts into below an oxidation - proof mask and at the same time to prevent a formation of an oxynitride layer on the surface of oxidizable material layer covered by the mask during the selective oxidation step by disposing the oxidation - proof mask consisting of for example silicon nitride directly upon the oxidizable material layer . as a result of a considerable suppression of the growth of the bird &# 39 ; s beak , the oxidizable material layer remaining along the perpendicularly etched surface after an anisotropic etching is rather small in size and it becomes possible to easily and completely oxidize it . the fact that any oxynitride layer is not produced has the following effects . generally , a thick oxide layer is formed through selective oxidation in the region of the exposed portion of the oxidizable material layer and then the mask is removed . subsequently , the remaining oxidizable material layer is also eliminated . in eliminating the remaining oxidizable material layer , the spatter ion etching technique is employed in order to prevent that the element isolation layer to be formed takes an overhung structure . however , if a ribbon - like oxynitride layer is produced and left as it is at the time of etching , the oxynitride layer acts as an etching mask to leave a portion of the oxidizable material layer to remain along the edges of the thick oxide layer . if the oxidizable material layer thus left is thermally oxidized to convert into an oxide layer , the element isolation layer will get larger , i . e ., the size conversion difference will get larger to obstruct the production of finer semiconductor elements . it is therefore highly beneficial from the standpoint of making semiconductor elements finer that no oxynitride layer is formed on the surface of oxidizable material layer convered by the oxidation - proof mask at the time of selective oxidation . it is desirable to limit the thickness of this oxidation - proof mask to more than three times of the thickness of the oxide layer formed between the oxidizable material layer and the semiconductor substrate and less than 4 , 000 å . a mask to prevent a diffusion of impurities may be placed upon this oxidation - proof mask . by disposing such a mask , consisting of for example cvd sio 2 , to prevent a diffusion of impurities in the oxidation - proof mask , it is possible to prevent an erroneous formation of a channel stopper on the semiconductor surface below the oxidation - proof mask at the time of ion implantation for forming a channel stopper . especially if it is necessary to create channel stoppers separately on p well and on the n - type substrate as in the case of complementary mos ic , a resist mask made of for example rubber which is previously used to create lamination layers cannot be used again as it is , so that another resist mask pattern has to be formed for providing a channel stopper after removing the resist mask previously formed , and also when in this case it is desired to form a channel stopper in self - alignment by making use of the resist mask used for making the lamination layers , it is inevitable that the prevention of an erroneous implantation of impurities in an element region is effected only with the resist mask which has been used to create the lamination layers . thus a formation of an impurities diffusion preventing layer on the oxidation - proof layer as an ion implantation mask is very important in the sense that the application of this invention can be extended to the production of complementary mos ic . after an ion implantation to form a channel stopper , it is necessary to eliminate the ion implantation preventing mask consisting of cvd sio 2 prior to selective oxidation , because it is not possible to selectively remove only cvd sio 2 after selective oxidation as oxidizable materials such as polysilicon in the region not covered by the oxidation - proof mask also change to silicon dioxides . as means to eliminate oxidizable material layers remaining after the selective oxidation in this invention , it is desirable to adopt one of anisotropic etching techniques like the reactive spatter ion etching and the ion beam etching with which it is possible to perform a perpendicular etching on the remaining oxidizable material layers on the substrate and to prevent a formation of an overhung structure of the thick oxide layer edges . in this invention , it is also possible to employ , as a semiconductor substrate , a laminated structure comprising a p - type silicon substrate , a n - type silicon substrate or a compound substrate such as gaas , and a monocrystalline semiconductor layer epitaxially grown on any one of aforementioned substrates such as p - type silicon substrate and etc . also , a monocrystalline insulation substrate such as sapphire substrate or spinel substrate , each superposed with a monocrystalline semiconductor may be used as a semiconductor substrate . as means to deposit a monocrystalline semiconductor layer on a monocrystalline insulation substrate , ( 1 ) a vapor epitaxial growth process ; or ( 2 ) a process in which polycrystal or amorphous semiconductor layer is first deposited on the insulation substrate by means of a vapor growth method such as cvd method or pvd ( physical vapor deposition ) method , and then the irradiation of an energy beam such as laser beam is effected to monocrystalize the polycrystal or amorphous semiconductor layer with the insulation substrate been utilized as a seed nucleus ; may be adapted . an application of this invention to produce n channel mos ic will be explained below using fig1 through 6 . ( i ) first , a p - type monocrystalline silicon substrate 1 is thermally oxidized to grow on its main surface a thermally oxidized layer 2 of 1 , 000 å thick . then , a polycrystalline silicon is vapor - grown on the thermally oxidized layer 2 within pocl 3 atmosphere to deposit a 4 , 000 å of phosphorus - doped or impurity - nondoped polycrystalline silicon layer 3 which oxidizes faster than the substrate 1 ( fig1 ). then , a 2 , 000 å silicon nitride layer is deposited through vapor - growth process directly on the polycrystalline silicon layer to form a number of silicon nitride patterns 4 of 2 μm wide ( w ) and 2 μm pattern pitch ( p ) through patterning by photo - etching process using reactive spatter ion etching . then , using the silicon nitride pattern 4 as a mask , boron ions are implanted under the conditions of 180 kev output and 4 × 10 13 / cm 2 dose and then activated to form a p + - type channel stopper 5 on the substrate 1 ( fig2 ). in this case , the photo - resist pattern used in the formation of the silicon nitride pattern may also be used as a mask in the boron ion implantation step . ( ii ) then , the selective oxidation of the polycrystalline silicon layer 3 is carried out for 200 minutes at 1 , 000 ° c . with the silicon nitride pattern 4 been used as an oxidation - proof mask . in so doing , the exposed portions of the polycrystalline silicon layer 3 are oxidized to form a 8 , 000 å oxide layer for element isolation with 0 . 15 μm dimention - conversion difference ( fig3 ). any oxynitride layer is not recognized to be formed on the surface of the remaining polycrystalline silicon layer 3 &# 39 ; along the thick oxide layer 6 below the silicon nitride pattern 4 . also , in the selective oxidation , the thermally oxidized layer 2 is found to be effective in preventing the phosphorus in the polycrystalline silicon layer 3 &# 39 ; from diffusing into the silicon substrate 1 . ( iii ) then , after removing the silicon nitride pattern 4 by means of cf 4 dry etching , the remaining polycrystalline silicon layer 3 &# 39 ; is eliminated by means of ccl 4 reactive spatter etching . in so doing , as no oxynitride layer exists upon the remaining polycrystalline silicon layer 3 &# 39 ;, the polycrystalline silicon 3 &# 39 ; is etched with self - alignment substantially in perpendicular to the thick oxide layer 6 , and a minute polycrystalline silicon layer 3 &# 34 ; is left , as shown in fig4 on the overhung section of the thick oxide layer 6 . then , the exposed thermal oxide layer 2 is eliminated with ammonium fluoride to expose part of the substrate 1 surface and then to perform thermal oxidation . in this process , a 400 å gate oxide layer 7 is formed on the exposed part of the monocrystalline silicon substrate 1 and at the same time the polycrystalline silicon layer 3 &# 34 ; remaining on the overhung portion is oxidized to become an oxide layer thereby creating together with the oxidized silicon layer 3 &# 34 ; an element isolation layer 8 without a overhung like the aforementioned thick oxide layer 6 ( fig5 ). using the element isolation layer 8 as a mask , boron is ion - implanted into the channel part of the substrate 1 below the gate oxide layer 7 under the conditions of 40 kev output , 3 × 10 11 / cm 2 dose to form a p + - type impurities region 9 for the control of threshold value ( fig5 ). ( iv ) then , following the conventional process , a gate electrode 10 consisting of polycrystalline silicon is formed on the gate oxide layer 7 , and using the gate electrode 10 as a mask , arsenic is ion - implanted and activated to produce a n + - type source and drain ( not shown ). after the formation of a cvd - sio 2 layer and al wiring , thermal treatment is effected for 60 minutes at 1 , 000 ° c . to produce a n channel mos ic with about 0 . 8 v of threshold value ( fig6 ). according to this method , therefore , as an element isolation layer is formed by means of selective oxidization of the polycrystalline silicon layer 3 which is oxidized faster than the monocrystalline silicon substrate 1 on which it is disposed , thermal effects upon the substrate 1 could be suppressed and thermally caused defects and rediffusion of impurities can be reduced . also as an element isolation layer 8 is formed by means of selective oxidization of the polycrystalline silicon 3 on the substrate 1 instead of producing an element isolation layer by directly oxidizing the substrate 1 as seen in the conventional method , a considerable stress upon the substrate 1 could be avoided . moreover , in the case of selective oxidation using as a mask a silicon nitride pattern 4 which is deposited directly upon the polycrystalline silicon layer 3 , no oxynitride layer is created not only on part of the polycrystalline silicon layer 3 but also on the substrate 1 . thus , the monocrystalline silicon substrate 1 thus produced has very few defects and has excellent electrical characteristics to make it possible to produce highly reliable n channel mos ic . also , when selectively oxidizing the polycrystalline silicon layer 3 , the thrusting of the oxide layer into the polycrystalline silicon layer 3 below the silicon nitride pattern 4 , i . e ., bird &# 39 ; s beak ( a ) ( fig4 ) could be controlled to less than 0 . 15 μm in length ( less than one fourth of the thickness of the oxide layer ( b ) 0 . 8 μm ) and no oxynitride layer is formed on the remaining polycrystalline silicon layer 3 &# 39 ; and it is thus possible to etch in perpendicular to the thick oxide layer 6 the said polycrystalline silicon layer 3 &# 39 ; with self - alignment . it is therefore possible to produce a fine element isolation layer 8 of small dimension - conversion difference and to obtain mos ic comprising fine elements . ( i ) after forming a p - well 11 on the n - type monocrystalline silicon substrate 1 , the substrate 1 is thermally oxidized to produce a 1 , 000 å thermally oxidized layer 2 on its main surface . then , a polycrystalline silicon is vapor - grown upon the thermally oxidized layer 2 to deposit a 4 , 000 å polycrystalline silicon layer 3 ( fig7 ). next , a 2 , 000 å silicon nitride layer 14 and then a 5 , 000 å silicon dioxide layer 13 are deposited directly upon the polycrystalline silicon layer 3 to create a pattern consisting of a plurality of silicon nitride 14 , sio 2 13 , of 2 μm wide ( w ) and 2 μm pattern pitch ( p ) by means of patterning through photo etching process using reactive spatter ion etching . after disposing a resist mask 15 to block the new p - mos side , an ion - implantation of boron is effected under the conditions of 180 kev output and 4 × 10 13 / cm 2 dose , using the laminated patterns comprising silicon nitride 14 and sio 2 13 , and activated in order to create a p + - type channel stopper 5 in p - well 11 ( fig8 ). ( ii ) next , cvd sio 2 13 is removed by ammonium fluoride solution to selectively oxidize the polycrystalline silicon layer 3 using the silicon nitride pattern 14 as an oxidation - proof mask . in this process , the exposed parts of the polycrystalline silicon layer 3 are oxidized to form a thick oxide layer 6 of 8 , 000 å thick for element isolation with the dimension - conversion difference being 0 . 15 μm ( fig9 ). no oxynitride layer is recognized to be created on the surface of the remaining polycrystalline silicon layer 3 &# 39 ; along the silicon nitride pattern 14 . ( iii ) then , after removing the silicon nitride pattern 14 by means of cf 4 dry etching , the remaining polycrystalline silicon layer 3 &# 39 ; is eliminated by means of ccl 4 reactive spatter etching . in so doing , as no oxynitride layer exists upon the remaining polycrystalline silicon layer 3 &# 39 ;, the said polycrystalline silicon layer 3 &# 39 ; is etched with self - alignment in perpendicular to the thick oxide layer 6 . as a result , a polycrystalline silicon layer 3 &# 34 ; is , as shown in fig1 , remained beneath the each overhung portion of the thick oxide layer 6 . then , the thermally oxidized exposed layer 2 is eliminated with ammonium fluoride to expose part of the substrate 1 surface and then thermal oxidation is performed . in this process , a 400 å gate oxide layer 7 is formed on the exposed part of the monocrystalline silicon substrate 1 and at the same time the polycrystalline silicon layer 3 &# 39 ; remaining on the overhung is oxidized to become an oxide layer to create together with the thick oxide layer 6 an element isolation 8 without an overhung like the aforementioned thick oxide layer ( fig1 ). using an ion implantation mask 15 such as cvd - sio 2 and the element isolation layer 8 as a mask , boron is ion - implanted into the channel part of the p - well 11 below the gate oxide layer 7 under the conditions of 40 kev output and 3 × 10 11 / cm 2 dose to form a p + - type impurities region 9 for the control of threshold value ( fig1 ). ( iv ) then , following the conventional process , a gate electrode 10 consisting of polycrystalline silicon is formed on the gate oxide layer 7 , and using the gate electrode 10 as a mask , arsenic is ion - implanted and activated to produce a n + - type source and drain ( not shown ). after the formation of a cvd - sio 2 layer and al wiring , thermal treatment is effected for 60 minutes at 1 , 000 ° c . to produce cmos ic ( fig1 ). an application of this invention to produce n channel mos ic will be explained using fig1 through 18 . ( i ) first , a p - type monocrystalline silicon layer 22 of 10 ωcm in specific resistance and 15 μm thick is grown by means of vapor growth on the surface of a p - - type monocrystalline silicon substrate 21 of 0 . 005 ωcm in specific resistance . after thermally treating this silicon layer to form a 1 , 000 å thermally oxidized layer 23 on its main surface , a polycrystalline silicon layer is vapor - grown in pocl 3 atmosphere on the thermally oxidized layer 23 to deposit a 4 , 000 å phosphorus - doped polycrystalline silicon layer 24 as an oxidizable material layer ( fig1 ). next , a 2 , 000 å silicon nitride layer is deposited by means of vapor growth directly upon the polycrystalline silicon layer 24 and a plurality of silicon nitride patterns 25 of 2 μm wide ( w ) and 2 μm pattern pitch ( p ), for instance , are formed by means of patterning through photo etching process using reactive spatter ion etching . then , using the silicon nitride pattern 25 as a mask , boron is ion - implanted under the conditions of 180 kev and 4 × 10 13 / cm 2 dose and then activated to form a p + - type channel stopper 26 on the p - type monocrystalline silicon layer 22 ( fig1 ). in this process , boron may be ion - implanted by using as a mask the photo resist pattern used in the formation of the silicon nitride pattern . ( ii ) next , using the silicon nitride pattern 25 as a oxidation - proof mask , the polycrystalline silicon layer 24 is selectively oxidized . in the process , the exposed portions of the polycrystalline silicon layer 24 is oxidized to form a 8 , 000 å oxide layer 27 for element isolation ( fig1 ). no oxynitride layer is recognized to be formed on the surface of the remaining polycrystalline silicon layer 24 &# 39 ; along the thick oxide layer 27 below the silicon nitride pattern 25 . in the selective oxidation , moreover , the thermally oxidized layer 23 has prevented the phosphorus in the polycrystalline silicon layer 24 from diffusing into the p - type monocrystalline silicon layer 22 . ( iii ) then , after removing the silicon nitride pattern 25 by means of cf 4 dry etching , the remaining polycrystalline silicon layer 24 &# 39 ; is removed by means of ccl 4 reactive spatter ion etching . in the process , as no oxynitride layer exists on the surface of the remaining polycrystalline silicon layer 24 &# 39 ;, the said polycrystalline silicon layer 24 &# 39 ; is perpendicularly etched with self - alignment against the thick oxide layer 26 and a polycrystalline silicon layer 24 &# 34 ; is left beneath the overhung of the thick oxide layer 27 as shown in fig1 . next , the thermally oxidized exposed layer 23 is removed by ammonium fluoride solution to expose part of the polycrystalline silicon layer 22 and thermal oxidation treatment is carried out . in the process , a 400 å gate oxide layer 28 is grown on the exposed surface of the polycrystalline silicon layer 22 and at the same time the polycrystalline silicon layer 24 &# 34 ; remaining beneath the overhung is oxidized to become an oxide layer to form , together with the thick oxide layer 27 , an element isolation layer 29 without an overhung like the aforementioned thick oxide layer ( fig1 ). using the element isolation layer 29 as a mask , boron is ion - implanted into the channel part of the p - type monocrystalline silicon layer below the gate oxide layer 27 under the conditions of 40 kev output and 3 × 10 11 / cm 2 to produce a p + - type impurities region 30 for the control of threshold value ( fig1 ). ( iv ) then , following the convention process , a gate electrode 31 consisting of polycrystalline silicon is formed on the gate oxide layer 28 , and using the gate electrode 31 as a mask arsenic is ion - implanted and then activated to produce a n + - type source and drain ( not shown ). after the formation of a cvd - sio 2 layer and al wiring , thermal treatment is carried out for 60 minutes at 1 , 000 ° c . to produce n channel mos ic with about 0 . 8 v in threshold value ( fig1 ). in this invention , as an element isolation layer is formed by means of selective oxidation of the phosphorus - doped polycrystalline silicon layer 24 disposed on the monocrystalline silicon layer 22 which is superposed on the monocrystalline silicon layer 21 , thermal effects upon the monocrystalline silicon layer 22 can be suppressed and thermal effects to cause defects in the monocrystalline silicon layer 22 and diffusion of impurities into the layer 22 could be reduced . also , as the element isolation layer is produced by means of selective oxidation of the phosphorus - doped polycrystalline silicon layer 24 on the said silicon layer 22 instead of forming it by means of direct oxidation of the monocrystalline silicon layer 22 as in the conventional selective oxidation method , stress upon the monocrystalline silicon layer 22 can be avoided and thus problems of slipping dislocation and defects due to stress could be avoided . except for the use of a monocrystalline sapphire substrate instead of the p - type monocrystalline silicon substrate 21 , the exactly same process as example 3 is employed to produce n channel mos ic . fig1 through 18 may be referred to explain example 4 , assuming that a sapphire substrate is used instead of the p - type monocrystalline silicon substrate . as a phosphorus - doped polycrystalline silicon layer disposed on the sapphire substrate 21 is selectively oxidized , an element isolation layer 29 of sufficient thickness ( 8 , 000 å ) can be formed in a considerably shorter time in comparison with selective oxidation of the monocrystalline silicon layer 22 . as a result , thermal effects upon the sapphire substrate 21 and the monocrystalline silicon layer 22 can be suppressed . it is also possible to reduce stress due to difference in thermal expansion coefficient and in lattice distance between the sapphire substrate 21 and the silicon layer 22 and at the same time to reduce the diffusion of impurities into the silicon layer 22 . this invention can be applied not only to the production of n channel mos ic and cmos ic as discussed above but also to the production of p channel mos ic , bipolar ic , i 2 l and ccd . as discussed above , it is possible with this invention to produce an element isolation layer , without giving rise to various defects on a semiconductor substrate , by means of selective oxidation of an oxidizable material layer disposed on a semiconductor substrate . it is also possible to control the formation of bird &# 39 ; s beak below an oxidation - proof mask during selective oxidation and to produce a finer element isolation layer as no oxynitride layer which behaves as an etching mask is present in the step of removing the oxidizable material layers remaining after the selective oxidation . this invention , therefore , offers a method to produce semiconductor devices having excellent electrical characteristics and which is suitable for making finer semiconductor elements .
| 8 |
referring now more particularly to fig1 through 8 , there is provided pasta cooker 10 including container 12 which is adapted to receive an amount of water for cooking pasta . preferably the cooking apparatus is made of stainless steel . the water is normally placed in container 12 through a water inlet line 14 which is coupled to hose guide 16 which is attached to the back wall 18 of container 12 . water line 14 may be a pvc nylon reinforced flexible hose . a standard pasta cooker cage is normally hung on the back wall 18 and is filled with pasta ( not shown ) which becomes submerged in the water within the container . container 12 is adapted to be received over an ordinary single stove burner 13 for heating the water . the top surface of the water is indicated as 22 in fig4 and 5 . the pasta cooker 10 includes handles 24 and 26 to make the pasta cooker more portable . there is a hole 28 through wall 30 of container 12 . a discharge pipe 32 is received in hole 28 and is welded to the periphery surfaces of the hole . discharge pipe 32 is l - shaped and may be connected to drain hose 34 through connector 36 , or it may be simply aligned with a funnel ( not shown ). the drain hose may also be a pvc nylon reinforced flexible hose . the pasta cooker also includes drain pipe 38 . drain pipe 38 is l - shaped having opening 46 for receiving water nipple 43 in the embodiment of fig7 and nipple 44 in the embodiment of fig8 . the nipple is located at the opposite end of the drain pipe from opening 46 . elbow 41 generally separates the submerged portion 40 of the drain pipe 38 from the nipple portion 43 . opening 46 of drain pipe 38 permits water to drain therethrough at a rate depending on its position which will be explained in more detail below . referring now to fig7 nipple 43 of drain pipe 38 is received inside of discharge pipe 32 . the end 50 of nipple 43 abuts against shoulder 52 located inside the discharge pipe . nipple 43 includes three grooves 54 about the outer periphery surface thereof . for illustration purposes , only one of the grooves 54 is shown . resilient o - rings 56 , 58 and 60 are received in the three grooves 54 . when the nipple 43 is pressed into the discharge pipe , the o - rings rest against the inside wall 62 of the discharge pipe , thereby providing a watertight seal . more importantly , however , the o - rings 56 , 58 and 60 enable drain pipe 38 to be rotated , as indicated by arrows 64 shown in fig6 so that the drain rate of the water container 12 may be varied . by using these resilient o - rings , the position of the drain pipe and thus the elevation of opening 46 may be established such as shown in fig4 and 5 . the position of the drain pipe is maintained in place by the o - rings until the user wants to change the position , and thus the water drain rate , by again rotating the drain pipe . in order to rotate the drain pipe , sufficient rotational force must be applied to overcome the frictional force of the o - rings and the inside surfaces of the discharge pipe . normally the drain pipe must be rotated using a utensil such as a tong or other implement which is available in the kitchen because the water in the container is normally very hot . fig8 shows an alternative embodiment to that of fig7 . in fig8 nipple 44 includes a plurality of shallow holes 66 drilled therein in a line about the outer peripheral surface of the nipple . in addition , a channel 68 is cut about the outer peripheral surface of the nipple 44 adjacent to the aligned holes 66 . a pair of spring - loaded ball plungers 70 and 72 , which are commercially available and are known to those skilled in the art , are received in recesses 74 and 76 in the inside wall of the discharge pipe . the balls , which form part of the ball plungers 72 and 74 , are in contact with groove 68 . in addition , there is a ball plunger 78 of the type referred to above , received in recess 80 of the discharge pipe . a portion of the ball plunger 78 is selectively received in holes 66 which stabilize the portion of the drain pipe while permitting it to be rotated when sufficient rotational force is applied to overcome the spring tension . thus , the drain pipe 38 may be rotated and held in discrete positions utilizing the ball plunger and hole arrangement . o - ring 82 abuts against the end 84 of the nipple and against shoulder 86 of discharge pipe 32 , thereby providing a water seal . as can be seen from fig4 when the rotatable drain pipe 38 is positioned in its upright position its opening 46 will somewhat align with the top surface 22 of the water in the container , thereby slowly draining the water from the container . however , when the drain pipe 38 is rotated as shown in fig5 opening 46 is submerged and the water from the container is drained rapidly . using the embodiments of either fig7 or 8 , drain pipe 38 may be set in many positions to fine tune the rate of discharge of the water from the container depending on the needs of the cook . thus , the cook is able to cause a fresh clean supply of water to come in contact with the pasta at all times , thereby providing a high quality of cooked pasta . the drain pipe opening is normally placed at a height so as to permit the incoming water to move across the cooking pasta to carry away the starch enriched waters to move out the drain . because the starch is lighter in water , it moves toward the surface where it is carried to the top of the drain pipe and skimmed out . using this apparatus , the cook may rotate the drain pipe toward the bottom of the container to permit one to make a rapid partial discharge of water without having to manually dip out the water or , worse , having to carry the container to the sink for draining . by eliminating the need to empty or dip out the water , one greatly reduces the possibility of burns . in addition , this cooking apparatus is always ready to use once the water is boiling . there is no reason to carry the container off line to empty and refill it for future use . the apparatus permits the drain pipe to rotate at least a full 90 ° or more to permit complete draining of the container without the inherent dangers set forth above . furthermore , starch buildup is prevented and a superior pasta product is provided without the need to purchase expensive electronic equipment . in addition , this apparatus may be used on a single burner of an ordinary stove and is easy to hook up to fresh water sources and to the water drain . from the foregoing description of the preferred embodiments of the invention , it will be apparent that many modifications may be made therein . it is understood that all such modifications which are embodied in the accompanying claims come within the true spirit and scope of this invention .
| 8 |
the present inventors have discovered that the addition to an aqueous slurry of electrostatic printed wastepaper of specific solvent / surfactant blends significantly enhances the aggregation of electrostatic toner particles , allowing for their separation from fiber through centrifugal cleaning and / or screening . this aggregation takes place at ph levels ranging from 5 . 0 to 11 . 0 , with no significant deposition of ink present on pulping equipment . ( a ph higher than 11 . 0 or lower than 5 . 0 is also believed to be effective ). the formulations allow for aggregation at an ambient ph , alleviating the need for caustic or acid tanks in the mill environment . during initial testing , the phenomenon was termed agglomeration ( i . e ., a bringing together of particles , the surface area of the whole remaining the sum of each individual part ). the inventors now feel that a more accurate term to describe the phenomenon is aggregation ( i . e ., a changing of surface area , the total surface area being less than the sum of the individual particles ). aggregation is a result of this densification , or reduction of void areas . the aliphatic petroleum distillates ( a ) are saturated hydrocarbons having carbon numbers in the range of c9 - c12 . the chemical structures of the remaining raw materials are as follows : ## str1 ## for the application of electrostatic toner particle aggregation , the effective hydrophile - lipophile balance of the tested surfactants is from about 0 . 5 to 10 , preferably from about 0 . 5 to 5 . it is believed that the effective temperature range for the aggregation of electrostatic toner particles is from about 110 °- 190 ° f . a beaker test method was utilized to determine the impact of various raw materials on toner aggregation without the presence of fiber . this method allowed for the visual evaluation of toner configuration after treatment and permitted the particles to be sized using the brinkmann particle size analyzer . when raw materials were screened using this method , those demonstrating significant particle aggregation were advanced to the deinking / repulping apparatus ( the pulper ) for an evaluation of performance in the presence of fiber . the experimental procedure was as follows : approximately 0 . 01 grams of toner was added to a beaker containing 100 milliliters of deionized water . each solution of toner and water was mixed on a magnetic stirrer at a ph of 7 . 0 , a temperature of 150 ° f . and a contact time of 60 minutes . about 514 parts of raw material per million parts of solution was added to the beaker . upon completion of contact time , particle configurations were noted , and solutions were filtered and held for size evaluation using the brinkmann particle size analyzer . the pulper was then used to evaluate selected raw materials . this apparatus consists of a waring blender jar with the blades reversed to provide a mixing action of the fibers . the stirring of the blender is controlled by a motor connected to a servodyne controller . temperature of the pulp in the blender is provided by a heating mat attached to a temperature controller . the typical furnish consistency in the laboratory pulper is 5 %, and a stirring speed of 750 rpm is used to simulate the mechanical action of a hydropulper . electrostatic printed wood - free fiber was used as the furnish . twenty pounds of raw material per ton of fiber were added to the pulper ( 5 - 20 pounds material / ton of fiber the preferred range , 10 - 20 pounds / ton most preferred ) at a temperature of 150 ° f ., a ph of 7 . 0 , and a pulping time of 60 minutes . the laboratory results found in table 1 demonstrate the effectiveness of the present invention . a nonylphenoxypoly ( ethyleneoxy ) ethanol with a molecular weight of 286 and an ethoxylated polyoxypropylene glycol with a molecular weight of 3800 are preferred components . table 1______________________________________pulper results at 150 ° f ., ph 7 . 0 , 60 minute pulping timecondition particle size ( mm . sup . 2 ) ______________________________________untreated control 0 . 479aliphatic solvent ( a ) 6 . 162nonylphenoxypoly - 16 . 299 ( ethyleneoxy ) ethanol ( b , mol . wt . = 286 , hlb = 4 . 6 ) ethoxylated polyoxypropylene glycol 18 . 463 ( c , mol . wt . = 3800 , hlb = 1 . 0 ) formulation 48 . 947 ( 60 % a : 10 % b : 30 % c ) ______________________________________ note the effectiveness of each material ( e . g ., b and c ) in increasing electrostatic toner particle size , as compared to the untreated control . however , the experimental formulation in its preferred ratios ( 60 % a / 10 % b / 30 % c ) showed a significant increase in particle size as compared to individual components . additional testing was carried out on furnish blends of various dry toner electrostatic printing copy types . the laboratory repulping / deinking apparatus was used to evaluate the performance of two component and three component material blends on electrostatic toner particle aggregation . pulping conditions were : 150 ° f ., 20 pounds of material per ton of fiber , 45 minutes of pulping time , and phs of 5 . 0 , 8 . 0 and 11 . 0 . particle size ( diameter in microns ) and density ( grams / cc ) were then determined , based on the mean of 10 particles . a particle density greater than that of water ( approximately 1 g / cc ) is needed for any separation of material from water and paper fiber . for particles of equal density , the particle with a larger diameter has a greater chance of being removed with cleaning . the performance of a cleaner may be measured in terms of its ability to remove dirt particles : ## equ1 ## a plot of mean particle density versus percent cleaning efficiency for previous pilot cleaner runs and the resulting equation of the curve were used to predict the percent cleaning efficiency expected for the particles generated in each run . the following results demonstrate the effectiveness of the present invention , in terms of the synergistic effect achieved by combining various components . note that synergistic results may not always be achieved depending on changes in e . g ., ph , furnish , etc . components a , b and c are the same as used in table 1 . table 2______________________________________effect of treatment on particle size , density andpredicted % cleaning efficiency at ph 5 . 0 particle size predicted diameter density % cleaningtreatment ( microns ) ( g / cc ) efficiency______________________________________control 432 0 . 92 49 . 74aliphatic solvent ( a ) 1368 1 . 02 77 . 63nonylphenoxypoly - 2422 1 . 03 80 . 42 ( ethyleneoxy ) ethanol ( b ) ethoxylated polyoxypropylene 494 1 . 00 72 . 05glycol ( c ) 50 % a / 50 % b 1086 1 . 06 88 . 7950 % a / 50 % c 2186 1 . 04 83 . 2116 . 7 % a / 66 . 7 % b / 16 . 7 % c 1578 1 . 05 86 . 0030 % a / 40 % b / 30 % c 1326 1 . 06 88 . 7925 % a / 25 % b / 50 % c 732 1 . 08 94 . 37______________________________________ table 3______________________________________effect of treatment on particle size , density andpredicted % cleaning efficiency at ph 8 . 0 particle size predicted diameter density % cleaningtreatment ( microns ) ( g / cc ) efficiency______________________________________control 364 0 . 87 35 . 79aliphatic solvent ( a ) 1513 1 . 02 77 . 63nonylphenoxypoly - 2714 1 . 03 80 . 42 ( ethyleneoxy ) ethanol ( b ) ethoxylated polyoxypropylene 494 0 . 88 38 . 58glycol ( c ) 50 % a / 50 % b 718 1 . 08 94 . 3750 % a / 50 % c 2634 1 . 06 88 . 7950 % b / 50 % c 772 1 . 04 83 . 2116 . 7 % a / 16 . 7 % b / 66 . 7 % c 1024 1 . 07 91 . 5816 . 7 % a / 66 . 7 % b / 16 . 7 % c 1986 1 . 04 83 . 2130 % a / 40 % b / 30 % c 1736 1 . 04 83 . 2125 % a / 25 % b / 50 % c 646 1 . 08 94 . 37______________________________________ table 4______________________________________effect of treatment on particle size , density andpredicted % cleaning efficiency at ph 11 . 0 particle size predicted diameter density % cleaningtreatment ( microns ) ( g / cc ) efficiency______________________________________control 268 0 . 84 27 . 43aliphatic solvent ( a ) 1296 1 . 02 77 . 63nonylphenoxypoly - 3425 1 . 01 74 . 84 ( ethyleneoxy ) ethanol ( b ) ethoxylated polyoxypropylene 632 1 . 02 77 . 63glycol ( c ) 50 % a / 50 % b 893 1 . 03 80 . 4230 % a / 40 % b / 30 % c 3384 1 . 05 86 . 0125 % a / 25 % b / 50 % c 1331 1 . 07 91 . 59______________________________________ ( note : a different furnish was used at ph 11 . 0 then at ph &# 39 ; s of 5 . 0 and 8 . 0 . combinations of components tested with the original furnish at ph 11 . 0 did not produce synergistic results ; the inventors feel that factors such as e . g ., toner type used may have contributed to this outcome ). while this invention has been described with respect to particular embodiments thereof , it is apparent that numerous other forms and modifications of this invention will be obvious to those skilled in the art . the appended claims and this invention generally should be construed to cover all such obvious forms and modifications which are within the true spirit and scope of the present invention .
| 3 |
in accordance with one embodiment of the present invention , an automotive diesel engine is provided with means for de - activating one or more cylinders during low load and / or moderate load conditions , and with means for re - activating some or all of the deactivated cylinders under greater or full load . in accordance with the invention , the number of operative cylinders of an automotive diesel engine for example , but not limited to a diesel engine similar to , but not limited to a general motors 5 . 7 liter v - 8 diesel engine is reduced under low load , and / or intermediate load operating conditions by not providing diesel fuel to selected cylinders , under light and / or intermediate load conditions , and then under heavy load conditions , more cylinders , or all cylinders are activated and provided with fuel for combustion . in accordance with another embodiment of the present invention , prior to restoring fuel to inactive cylinders if the inactive cylinders have become below minimum operating temperature , as determined by a temperature sensor , the computer activates the respective glow plugs of the previously inactive cylinders to heat up the cylinders prior to re - introducing fuel . as an example , when the engine is subject to low load , such as cruising on relatively flat highway or going down hill , two or four cylinders may be deactivated , preferably four . if four cylinders are deactivated under moderate load such as encountering a hill with a small incline , then two additional cylinders are activated by the computer as the hill is encountered . the shut down of selected cylinders under light load and reactivation under moderate and / or heavy load is computer controlled including control of reactivation of the respective glow plugs prior to reintroduction of fuel into the previously deactivated cylinders to insure that the previously inactive cylinders are sufficiently warm for the combustion process . in accordance with another embodiment of the present invention , means are provided for maintaining closed during deactivation one or both of the inlet and exhaust valves of each cylinder which is deactivated . in accordance with another embodiment of the invention , the computer controls selection of cylinders to be operated at low and intermediate load , to alternate and / or switch operative cylinders , so that cylinder , piston , plug , valve and other parts wear is generally even , whereby cylinder repair is reduced and maintenance cost is reduced . in accordance with another embodiment of the present invention , the computer controls cylinder selection during low and intermediate load conditions to select cylinders to be operated whereby the temperature of the inactive cylinders is prevented from becoming sufficiently cool to cause significant stress between cylinders due to contraction and / or expansion of cylinder , piston , plug or other parts in the engine . in accordance with another embodiment of the invention , in applications where it is not possible to vary the specific cylinders to not be given fuel , the computer reactivates some additional , or all additional cylinders if the temperature of one or more inactive cylinders , or other parts of the engine become sufficiently cool to cause significant stress between cylinders or between other engine parts due to contraction and or expansion of engine parts . in one specific embodiment of he invention , a general motors eight cylinder , 5 . 7 liter diesel engine is provided with means to deactivate two or four cylinders during periods of light or moderate engine load . as an example , the means to deactivate the cylinders may comprise generally a modulated displacement system utilized in the 1981 cadillac 6 . 0 liter 4 - 6 - 8 gasoline engine , modified to the extent necessary , or desirable to adapt to , and computer control the 5 . 7 liter general motors diesel engine . information about the two engines , the modulated system , and the computer system are publicly available , for example in the 1981 cadillac service information manual , including appended electrical and mechanical wiring diagrams , available from general motors , cadillac motor division , detroit mich . 48232 ; many public libraries , and haynes publishing co . hereby incorporated into the present application by this reference . the engines are similar in size as to block , bore , stroke and displacement , with the diesel displacement , slightly smaller . however , because of the similar engine size , the modulated displacement principles and computer control utilized in 6 . 0 liter v - 8 may be utilized in the general motors 5 . 7 liter diesel engine to deactivate four and / or two cylinders with relatively small modifications in principle . in a preferred embodiment temperature sensors are provided in at least the cylinders to be deactivated , and preferably in all cylinders to monitor the temperature of the deactivated cylinders , and preferably the temperature of the cylinders which remain active . if the computer senses that the temperature of deactivated cylinders has become lower than the temperature necessary for spontaneous combustion , in one embodiment , the glow plug for that or those cylinders are turned on to enable spontaneous combustion if load conditions change , such as encountering a hill , or a need to accelerate . after proper operating temperature is reached , if the load does not change , the glow plugs are turned off until the temperature again drops below operating temperature range , or an increased load occurs , and the cylinders are again activated . in accordance with another embodiment of the invention , after the computer turns on the glow plug or plugs of cylinders deactivated , such cylinders are reactivated until the the cylinder temperature again reaches a desired operating temperature , even if the load condition does not increase . in accordance with another embodiment , temperature sensors for each cylinder are not provided , and the computer senses lowering of temperature in the cooling fluid , and activates glow plugs of deactivated cuylinders after a pre - determined temperature drop and optionally reactivates such deactivated cylinders even if load conditions do not increase . while the later embodiment , which does not require adding additional sensors is less expensive , it does not provide for as accurate control of cylinder temperature and optimum conditions for spontaneous combustion of previously deactivated cylinders . as described on pages 6a - 37a of the 1981 cadillac service information manual the md system senses engine revolutions per minute , coolant temperature , throttle position , and absolute pressure in the intake manifold . in accordance with one or more previous embodiments the md system is modified to sense and process in a computer engine control system other variables including , but not limited to , indivigual cylinder temperature , and the presence or absence of the operation of the glow plugs for given cylinders . information obtained from sensors is sent to a suitable electronic computer processing unit ( ecp ) containing one or more computer programs to assimilate and process the data obtained from the sensors . the ecp processes the data and determines the number of operating cylinders required for he given load condition . in accordance with one embodiment , four valve selectors are utilized to deactivate either four or two cylinders to enable the engine to operate on either four or six cylinders , after start up on eight cylinders , and operation on eight cylinders on heavy load condiions . in another embodiment four valve selectors are used to deactivate four cylinders , and operation of four cylinders occurs on low or moderate load conditions , and eight cylinder operation occurs on start up and heavy load conditions . while this embodiment causes somewhat more operation on eight cylinders , and a small increase in fuel consumption , under both four and eight cylinder operation , the engine loads are relatively balanced and engine vibration is reduced as compared to 4 - 6 - 8 operation when some engine vibration occurs in the six cylinder operation mode . in one embodiment , valve selectors are installed on cylinders 1 , 4 , 6 and 7 . in the four cylinder mode , cylinders 1 , 4 , 6 and 7 are deactivated . in the six cylinder mode , only cylinders 1 and 4 are deactivated . in accordance with another embodiment of the present invention , the valve system utilized in the general motors 4 - 6 - 8 gasoline engine is utilized to control the active cylinders in a 5 . 7 liter diesel engine illustrated in fig1 and 2 . fig1 illustrates a 5 . 7 liter diesel engine 10 including a lower block 12 having cylinders therein 14 to receive pistons ( not shown ). block 12 receives a head 16 and a gasket 17 . inlet valves 18 and exhaust valves 19 are controlled by a rocker arm assembly 20 including push rods 22 , rocker arms 24 , a rocker arm pivot 26 , bolts 27 , a pedestal 28 , and springs 29 . temperature sensors are shown at 15 . fig4 is a view illustrating a cam shaft 42 , having a cam 44 , with a cam lobe 46 which causes movement in the push rod 20 which causes pivotal movement of the rocker arm 24 and opening and closing of the valve 18 . specifically , as shown in fig3 valve selector assemblies 30 are mounted on the intake and exhaust rocker arms 24 above the rocker arm fulcrum point 26 . the valve selector assemblies 30 include a solenoid valve 34 which activates a piston 36 which is connected to a blocking plate 38 . during conventional active operation fig3 a , the rocker arm 24 pivots near the center fulcrum point 26 , of the rocker arm . as the operative cam 42 reaches it &# 39 ; s highest point 46 , fig4 the valve 18 is open allowing the fuel and air mixture to enter cylinders 14 . as shown in fig3 b , when the solenoid valve 34 is activated , and the piston 36 is moved from the position shown in fig3 a left to right to the position illustrated in fig3 b , wherein the blocking plate 38 has been moved from the position shown in fig2 a to the position shown in fig2 b . in this position the pivot point has been moved to the position shown in fig2 b at 32 , whereby when the cam is again at its high point the valves will not open because the rocker arm does not pivot at the center point 26 , but rather at the pivot point 32 . this allows the rocker arm to slide up and down on its mounting stud 40 . the valve selector operation is not limited to a v8 engine and may be utilized generally for example in a diesel v6 engine . furthermore , the cam shaft for the diesel engine may be located above the valves and a valve selector operation utilized as described in detail in u . s . pat . nos . 4 , 546 , 734 , and 4 , 615 , 307 , hereby incorporated into the present application by this reference . moreover , the diesel engine may be an overland truck engine , a train locomotive engine , a marine diesel engine for ships and / or barges , or a diesel engine for industrial power plant applications , including , but not limited to heating and air conditioning of office buildings or plants . for many applications the computer is programmed not to activate the valve selector operation until a high or overdrive gear is reached by the transmission . for heavy load applications all cylinders should be activated in low gears . the number of cylinders to be deactivated will vary with the type of engine . for example , six cylinder in line - overland truck engines may deactivate either three or preferably two cylinders at light load . v - 8 , v - 12 , and v - 16 engines will be programmed to deactivate more cylinders in light or even moderate load applications . proper computer programming and control is necessary to achieve successful operation . the particular valve selector arrangement will also vary with the application . for appropriately sized v type engines , selectors of the type used by general motors in the 4 - 6 - 8 gasoline engine may be used . for other applications dimensions and load carrying members in the selector assemblies may be modified to meet particular applications . moreover the particular valve selector design will depend upon dimensions of the engine , loads to be encountered , and projected life before overhaul . as an example , the cummins m11 ( brochure attached and hereby incorporated into this application by this reference ) is a computer controlled six cylinder engine which could readily be provided with valve selectors , and the computer programs modified to achieve valve selector operation , and operation , and even greater fuel economy , and perhaps less wear and longer life between overhauls . fig5 illustrates an in - line six cylinder m11 computer controlled cummins diesel engine 50 including a high strength cylinder block 52 having cylinders 54 having cylinder liners 56 receiving pistons 58 with rings 60 having ring inserts 62 . the pistons 58 are connected to connecting rods 64 which are in - turn connected to an induction hardened crank shaft 66 . a gear train 68 drives a cam shaft 70 having lobes 72 which control movement of push rods 74 which pivot rocker arms 76 to move valve stem 78 and open and close valves 80 . two or more valve selectors 82 constructed in the same manner as valve selector 30 including a solenoid valve 84 , a piston 86 and a blocking plate 88 , appropriately dimensioned for the m11 engine are then installed to deactivate two or three cylinders under low or moderate load conditions when the transmission is in high and / or overdrive gear under the control of the celect plus computer 90 whose program 92 is modified to include a deactivation - activation program 94 to control deactivation and activation of selected cylinders 54 , and control operation of glow plugs . alternatively the valve selector operation described in u . s .. pat . nos . 4 , 546 , 734 and / or 4 , 615 , 307 may be utilized under the control of computer 90 and a deactivation - activation program 94 &# 39 ; may be used . fig6 illustrates a computer 7 controlling cylinders 1 , 2 , 3 in an n cylinder diesel engine with the sensors 1s , 2s , 3s , glow plugs 1gp , 2gp , and 3gp , injectors 1i , 2i , 3i , intake valves 1vi , 2vi , 3vi , exhaust valves 1ve , 2ve , 3ve , and valve actuators / deativators 1va , 2va , 3va , for all cylinders . the computer 7 receives the cylinder temperatures from sensors 1s , 2s , 3s , the load l from a load sensor ls , data from other sensors sx , sy , and computes which cylinders should be deactivated and activated , when the glow plugs of various cylinders are to activated prior to activating cylinders , and sends electrival signals to to the valve actuator / deactivators 1va , 2va , 3va , glow plugs 1gp , 2gp , 3gp , and fuel injectors 1i , 2i , 3i to activate and deactivate various cylinders , depending on the load , the temperature of the indivigual cylinders , and other commonly computer controlled variables . the computer as an example may be the electronic diesel control ( edc ) processing unit described in diesel fuel injection , bosh , 1994 eref tj 797 d55 , pp 186 - 191 . the control of the various cylinders is monitored and controlled in a manner illustrated in fig7 and 8 . fig7 and 8 illustrates a summary of the computer glow plug and cylinder activation sequence used by the computer in controlling activation and deactivation of cylinders and glow plugs during operation . a sample computer program is found in the application appendix in psuedo code . the program 500 includes a first step 502 of turning on the engine which is activated by the ignition key and includes the step of activating the program 600 in fig8 which activates the glow - plugs for all cylinders and heating up all cylinders prior to ignition . at step 504 when minimum operating temperature is in each cylinder the starter motor for the engine is turned on at step 506 . at step 508 the program obtains the temperature and loads for all cylinders . in some embodiments it may be activated by reaching a selected transmission gear such as after the engine reaches high gear for an automotive embodiment . at step 510 , if any cylinders are below a minimum operating temperature the cylinder flags for operating the glow plugs in the program 600 in fig8 are activated . at step 512 the program determines whether the load l is less than a selected load l1 . if the load is less than l1 at step 514 this program calls the program 600 to activate glow plugs to warm up any cold cylinders . at step 516 cylinders are deactivated and remain deactivated until the load exceeds l1 . if the answer to the load evaluation step 512 is negative at step 518 the program determines if the load is less than a larger load l2 . if the answer is affirmation at step 520 , cylinders are deactivated which are not needed for medium loading . after cylinders have been deactivated at 520 , step 522 calls program 600 to warm up any cold cylinders . if the answer , to the question at step 5 - 18 is negative , in step 5 - 24 it is determined whether or not 6 cylinders are running with the start cylinder program 600 . at step 5 - 26 , the program asks if the load is greater than load l3 . if the answer is affirmative , then additional cylinders are turned on with the program at 600 . it is to be noted hat if the load is less than l1 at step 512 and , for example , only 4 cylinders are operated , nonetheless at 5 - 14 the program calls the start cylinder program 600 to be certain that all cylinders are at a minimum operating temperature and , if they are not , they are warmed up in accordance with program 600 . the same applies to a situation where the load is less than l2 , but a time period has elapsed and it is necessary to check at step 520 to make sure that deactivated cylinders are nonetheless at a minimum temperature to avoid thermal stress of the engine . in program 600 in the first step , 602 , the program orders that the temperature for a given cylinder be read at 604 . at step 606 if the temperature of the cylinder is less than a predetermined temperature t1 then at step 608 the glow plug for that cylinder is activated . if the answer to the question at step 606 is in the affirmative , the cylinder is activated at step 610 . at step 612 if the cylinder temperature was initially below t1 so that the glow plug was activated at step 608 , at step 612 the cylinder will be required to operate for at least 10 minutes to warm - up the cylinder to avoid thermal stress in the engine . after these steps are taken this program for a given cylinder is deactivated at step 614 , and the same steps are taken for another cylinder , until all cylinders are so processed . it is thus to be understood that the program 600 continuously operates for each of the cylinders in the engine . fig9 illustrates an automobile embodiment 120 in which an automobile 122 is powered by a variable displacement diesel engine of the present invention 124 having electrical wires 126 connecting the engine cylinders 127 to a computer 128 for controlling the operation , activation and deactivation of the cylinders in accordance with the present invention . fig1 and 10a illustrate a building 100 having floors 102 which may be used for manufacturing and / or office work such as administration . the building 100 including floors 102 is heated and cooled during the seasons of the year by a variable displacement diesel engine 104 constructed and operated according to the principles of the present invention which drives a load comprising a heating and air conditioning unit 106 by means of shaft 108 . during evenings , weekends , and holidays the load experienced by unit 106 may be significantly reduced , allowing deactivation of cylinders in the diesel engine 104 in accordance with the present invention by computer 109 . fig1 b illustrates an overland truck embodiment in which an overland truck 130 having a trailer 132 is powered by a variable displacement diesel engine of the present invention 134 having electrical wires 136 connecting the engine cylinders 137 to a computer 138 for controlling the operation , activation and deactivation of the cylinders in accordance with the present invention . fig1 illustrates a train - locomotive embodiment in which a train 140 having a locomotive 142a and cars 142b , 142c , 142n , is powered by a variable displacement diesel engine of the present invention 144 having electrical wires 146 connecting the engine cylinders 147 to a computer 148 for controlling the operation , activation and deactivation of the cylinders in accordance with the present invention fig1 illustrates a marine embodiment in which a tug boat 150 having a cargo deck 152 is powered by a variable displacement diesel engine of the present invention 154 having electrical wires 156 connecting the engine cylinders 157 to a computer 158 for controlling the operation , activation and deactivation of the cylinders in accordance with the present invention .
| 5 |
fig2 shows an annulus filler assembly in accordance with a first aspect of the invention . the annulus filler assembly comprises a frame 40 having a first hook element 42 and a second hook element 44 for attachment to correspondingly shaped hook elements on a disc ; for example the hooks 12 , 14 shown in fig1 . the frame 40 comprises a pair of upstanding members 50 extending substantially from the first and second hook elements 42 , 44 and a bridging member 52 which joins the first and second hook elements 42 , 44 together . the frame 40 is constructed from sheet metal and therefore the bridging member 52 provides a degree of flexibility between the first and second hook elements 42 , 44 which allows the first and second hook elements 42 , 44 to engage with the hooks of the disc . the frame 40 comprises three connection portions 46 which are supported above the first and second hook elements 42 , 44 . two of the connection portions 46 are supported on the pair of upstanding members 50 and the third is supported by the bridging member 52 . although three connection portions 46 are shown in fig2 , any appropriate number of connection portions 46 and a correspondingly arranged frame may be provided , in alternative applications . each connection portion 46 has a cross - section which forms one half of an interlocking connection . for example , as shown in fig2 , each connection portion 46 has two shoulders 48 and a recess 49 therebetween , forming a female half of a dovetail joint . an arm 54 extends axially from the first hook element 42 . the arm 54 is connected to or abuts with a thrust ring , such as the nose cone support ring 16 shown in fig1 , which acts to position the annulus filler axially and to maintain engagement of the first and second hook elements 42 , 44 with the hooks of the disc . the width w of the frame 40 is narrower than the gap between adjacent blades . this allows the frame 40 to be engaged with the disc prior to fitting of the blades and subsequent disassembly can be performed without removal of the frame 40 from the disc . as a result , it is possible to visually inspect the first and second hook elements 42 , 44 and confirm whether they are correctly engaged with the hooks of the disc prior to fitting of the blades . in service , this also allows the blade flanks to be inspected without completely removing the annulus fillers and thrust ring . alternatively , the frame 40 may be connected after fitting of the blades . since the frame 40 is narrower than the gap between adjacent blades , there is a gap either side of the frame 40 which again allows visual inspection of the first and second hook elements 42 , 44 to confirm that they are correctly engaged with the hooks of the disc . it should be appreciated that not all of the frame 40 need be narrower than the gap between adjacent blades and that alternatively only those elements which would otherwise restrict the view of the first and second hook elements 42 , 44 may be narrower , particularly the pair of upstanding members 50 and the bridging member 52 . as can be seen in fig2 , the connection portions 46 do not directly overlie the first and second hook elements 42 , 44 and therefore the first and second hook elements could be visible even if the connection portions 46 were of comparable width to the gap between adjacent blades . referring now to fig3 , the annulus filler assembly is shown in a second stage of assembly . an annulus lid 56 is provided , which is constructed from a carbon - fibre reinforced plastic composite material and having a radially outwardly facing surface 58 for forming the inner wall of the flow annulus . the annulus lid 56 comprises three apertures 60 extending therethrough and a channel 62 running axially through the radially outwardly facing surface 58 . each axial end of the annulus lid 56 is provided with a tongue 64 which is received under a lip portion of an adjacent casing component , such as the cover portion 28 and rotating seal element 34 as shown in fig1 . in other embodiments the annulus lid may alternatively be made from a metallic material . the annulus lid 56 is located onto the frame 40 such that the three connection portions 46 are received through the apertures 60 . the shoulders 48 of each connection portion 46 sit substantially flush with the radially outwardly facing surface 58 and a base of the recess 49 of the connection portion sits substantially flush with a base of the channel 62 . alternatively , each aperture 60 may comprise two distinct openings 66 on either side of the channel 62 for receiving each of the shoulders 48 of a connection portion 46 . in this configuration the base of the recess 49 is separated from the channel 62 by the base of the channel . to compensate for the offset in the radial position of the base of the recess 49 , the shoulders 48 are radially taller so that they again sit flush with the radially outwardly facing surface 58 . in either configuration , the shoulders 48 and optionally the base of the recess 49 of the frame 40 are visible from radially outwards of the surface 58 , thus providing a visual confirmation that the connection portions 46 are correctly located in the apertures 60 . referring now to fig4 , the annulus filler assembly is shown in a final stage of assembly . an elongate slider element 68 which is sized to be received in the channel 62 is introduced into the channel 62 by sliding the slider element 68 from an axially foremost end of the annulus lid 56 towards an axially rearmost end of the annulus lid 56 , as indicated by arrow 70 . the slider element 68 has a degree of flexibility which allows the slider element to form to the curvature of the annulus lid 56 . as the slider element 68 is slid through the channel 62 it passes through the shoulders 66 of each connection portion in turn . the slider element 68 has a male dovetail cross - section , such that when the slider element 68 is received in the connection portion 46 the two elements interlock to prevent the connection portion 46 from being withdrawn through the aperture 60 . each axial end of the slider element 68 is provided with a bifurcated tongue 72 . similarly to the tongues 64 of the annulus lid 56 , the tongues 72 are received under a lip portion of an adjacent casing component , such as the cover portion 28 and rotating seal element 34 as shown in fig1 . the cover portion 28 and rotating seal element 34 fix the axial position of the slider element 68 in relation to the annulus lid 56 and thus prevent movement during operation . as discussed previously , when correctly located , the shoulders 48 of the connection portions 46 sit substantially flush with the radially outwardly facing surface 58 . this therefore allows visual inspection before sliding the slider element 68 through the channel 62 . where the connection portions 46 are not maintained in the correct position as the slider element 68 is slid through the channel 62 , depending on the degree of misalignment , the following outcomes will result : if misalignment is minor , the slider element 68 will be received sufficiently within the connection portion 46 and thus force the connection portion 46 radially outwards ( or the annulus lid 56 radially inwards ) through contact between the shoulders 48 of the connection portion 46 and the slider element 68 , particularly the tongue 72 of the slider element 68 , and thus any misalignment will be corrected ; if misalignment is moderate , the tongue 72 of the slider element 68 will contact the shoulders 48 and prevent the slider element 68 from sliding further ; if the misalignment is severe , an interlocking connection will not be formed and instead the slider element 68 will pass over the connection portion 46 withdrawing the connection portion 46 and shoulders 48 out of the aperture 60 . in the latter case where an interlocking connection is not formed , it is immediately evident from a visual inspection of the radially outwardly facing surface 58 that this is the case since the shoulders 48 are not visible , or if they are visible they are clearly not flush with the radially outwardly facing surface 58 . a visual inspection of the radially outwardly facing surface 58 therefore confirms whether the annulus lid 56 is correctly connected to the frame 40 and the assembly is not put into service unless all of the shoulders 48 of the connection portions 46 are visible and flush with the radially outwardly facing surface 58 . the slider element 68 is also provided with three recessed portions 74 spaced across the axial length of the slider element 68 . the spacing between the recessed portions 74 corresponds to the spacing between both the apertures 60 and the connection portions 46 . the recessed portions are offset from both the apertures 60 and the connection portions 46 when the slider element 68 is in its operative position wherein the tongues 72 of the slider element are axially aligned with the tongues 64 of the annulus lid 56 . by sliding the slider element 68 out of the annulus lid 56 ( in the opposite direction to arrow 70 ) by a distance equal to the offset , the recessed portions 74 can be aligned with the connection portions 46 and apertures 60 . the recessed portions 74 have the shoulders of the dovetail cross - section removed so that the slider element 68 is narrower along these portions than the distance between the shoulders 48 of the connection portion 46 . therefore , when the recessed portions 74 are aligned in this manner , the slider portion does not interlock with the connection portion 46 and the connection portion 46 can be withdrawn through the aperture 60 , thus allowing the removal of the annulus lid 56 from the frame 40 without having to fully extract the slider element 68 from the channel 62 . the reversed technique can also be used to connect the annulus lid 56 to the frame 40 . here , the connection portion 46 is introduced into the aperture 60 when the recessed portions 74 are aligned with the apertures 60 and then the slider element is slid into the operative position to lock the connection portions 46 and prevent subsequent withdrawal . when correctly located , the shoulders 48 of the connection portions 46 sit substantially flush with the radially outwardly facing surface 58 . if the shoulders 48 of the connection portions 46 are not visible when the slider element 68 is in the operative position , it is clear that the annulus lid 56 is not correctly connected to the frame 40 . therefore the requirement for visual inspection during all stages of assembly is satisfied with this technique also . fig5 shows an alternative embodiment of a frame 140 for an annulus filler in accordance with a first embodiment of the invention . in contrast to the frame 40 shown in fig2 , the frame 140 has five connection portions 146 supported above the first and second hook elements 42 , 44 ( which are essentially identical to those of the frame of fig2 ). it will be understood that the slider and lid of this annulus filler , though not shown in the drawings , will be appropriately configured to interlock with the five connection portions 146 , in a similar manner to that described for the embodiment of fig2 . because the slider and lid are supported in more places , the stresses and strains in the lid will be reduced , compared with the embodiment having three connector portions . fig6 shows the underside of an alternative embodiment of a lid 156 for an annulus filler in accordance with a first aspect of the invention . as with the lid 56 shown in fig3 , the lid 156 comprises three apertures 60 extending therethrough , and a channel 62 running axially . in contrast to the lid 56 of fig3 , the lid 156 comprises longitudinal ribs 180 , which add stiffness to the lid and thereby lower the stresses therein . it will be understood that in other embodiments , different numbers or configurations of ribs or corrugations may be provided to achieve the same result . fig7 shows an alternative embodiment of an annulus filler in accordance with a first aspect of the invention . in most respects , this embodiment is similar to that shown in fig4 , but the frame 240 of the annulus filler , instead of having first and second hook elements 42 , 44 as in fig4 , has first and second mounting features 282 , 284 comprising holes 286 , 288 . in use , radial bolts ( not shown ) extend through the holes 286 , 288 to secure the frame 240 to the fan disc . these radial bolts could form part of an axial retention system as described in our pending european patent application ep10168820 . 2 . it will be appreciated that variations and modifications may be made to the specific arrangement described , without departing from the invention . for instance , the securing hooks 42 , 44 may face each other . the interaction of the slider 68 and the annulus lid 56 and the connection portion 48 may be used to ‘ lock ’ the slider and lid in position through centrifugal force . in another arrangement ( not shown in the drawings ) the hooks 42 , 44 face away from each other and the lip 54 becomes a secondary locking mechanism .
| 8 |
the following detailed description is presented to enable any person skilled in the art to make and use the invention . for purposes of explanation , specific details are set forth to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that these specific details are not required to practice the invention . descriptions of specific applications are provided only as representative examples . various modifications to the preferred embodiments will be readily apparent to one skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the scope of the invention . the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest possible scope consistent with the principles and features disclosed herein . referring to the drawings , fig1 illustrates an exemplary embodiment of the crowned roll measuring arm as mounted on a crowned roll 1 . although a crown roll with a sharp degree of tapering is illustrated , the invention works well even on crown rolls with slight tapering , as found in most process lines .. the body 3 of the crowned roll measuring arm is made of a straight bar that is close in length to the length of the crowned roll 1 being leveled . the body 3 can be made from any hard material , but machined aluminum is preferred because it results in a lower overall weight of the crowned roll measuring arm compared to other metals . end roll positioning plates 5 are mounted on both ends of body 3 . these end roll positioning plates 5 are made of a machined hard metal or alloy , such as steel , and are shaped to include an extended portion 6 that is longer than the difference between the diameter of crowned roll 1 at the crown and the diameter of the crowned roll 1 at its ends . the end roll positioning plates 5 are mounted on the bar such that the distance between the extended portions 6 is just great enough to accommodate the length of crowned roll 1 . when the crowned roll measuring arm is placed along the top of the crowned roll 1 , the extended portions 6 of end roll positioning plates 5 should fit snugly against the edge of the crowned roll 1 . the crowned roll measuring arm includes top - center levels 11 located close to the ends of the body 3 . these levels are bubble levels that allow the operator to locate the top - center of each side of crowned roll 1 . as used herein , the top - center of a roll is located vertically above the central axis of a roll . at both ends of the crowned roll measuring arm are locking magnets 4 . these locking magnets 4 help hold the device in place after the top - centers of each side of crowned roll 1 are located . the locking magnets 4 may optionally be engaged by use of a switch that activates the locking magnets 4 by pushing them closer to the crowned roll 1 . when the locking magnets 4 are not engaged , the operator can freely move the crowned roll measuring arm to position it at the top - center of the crowned roll 1 . when the locking magnets 4 are engaged , the crowned roll measuring arm is harder to move . once the crowned roll measuring arm has been positioned such that both ends are at top - center of the crowned roll 1 , the crowned roll 1 can be leveled . the crowned roll measuring arm includes a machined - out slot 15 at the top of body 3 in which primary level 16 can be placed . primary level 16 may be supplied by the operator , or may be provided with the crowned roll measuring arm . level keepers 7 held in place by screws may be used to secure the primary level 16 to the body 3 . to level the crowned roll 1 , the operator would simply lift the ends of the crowned roll 1 until the primary level 16 indicates that the crowned roll 1 is level . shims would be placed under the roll shaft bearing blocks to level the crowned roll 1 , and the bearing foot bolts of the crowned roll 1 would be tightened to secure the assembly . once the leveled crowned roll 1 has been secured , the operator would disengage the locking magnets 4 and lift the crowned roll measuring arm off of the crowned roll 1 . in one embodiment , the crowned roll measuring arm can accept end roll positioning plates 5 of varying lengths in order to accommodate rolls of varying lengths . the end roll positioning plates 5 may be attached with bolts 10 so that they can easily be interchanged with end roll positioning plates 5 that properly accommodate the length of the crowned roll 1 . because the crowned roll measuring arm may be very heavy , it may optionally includes handles 13 that are secured with handle bolts 12 . the handles 13 allow the crowned roll measuring arm to be maneuvered with greater ease as the operator locates top - center of the crowned roll 1 . the terms “ comprising ,” “ including ,” and “ having ,” as used in the claims and specification herein , shall be considered as indicating an open group that may include other elements not specified . the terms “ a ,” “ an ,” and the singular forms of words shall be taken to include the plural form of the same words , such that the terms mean that one or more of something is provided . the term “ one ” or “ single ” may be used to indicate that one and only one of something is intended . similarly , other specific integer values , such as “ two ,” may be used when a specific number of things is intended . the terms “ preferably ,” “ preferred ,” “ prefer ,” “ optionally ,” “ may ,” and similar terms are used to indicate that an item , condition or step being referred to is an optional ( not required ) feature of the invention . the invention has been described with reference to various specific and preferred embodiments and techniques . however , it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention . it will be apparent to one of ordinary skill in the art that methods , devices , device elements , materials , procedures and techniques , other than those specifically described herein , can be applied to the practice of the invention as broadly disclosed herein without resort to undue experimentation . all art - known functional equivalents of methods , devices , device elements , materials , procedures and techniques described herein are intended to be encompassed by this invention . whenever a range is disclosed , all subranges and individual values are intended to be encompassed . this invention is not to be limited by the embodiments disclosed , including any shown in the drawings or exemplified in the specification , which are given by way of example and not of limitation . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims . all references throughout this application , for example patent documents , including issued or granted patents or equivalents , patent application publications , and non - patent literature documents or other source material , are hereby incorporated by reference herein in their entireties , as though individually incorporated by reference , to the extent each reference is at least partially not inconsistent with the disclosure in the present application ( for example , a reference that is partially inconsistent is incorporated by reference except for the partially inconsistent portion of the reference ).
| 6 |
the present invention provides a system , methodology , and software to create and operate an e - mail registry service ( hereinafter referred to as the “ registry ”). the registry is a “ web service ” that is provided to companies to authenticate the sources of e - mail messages arriving in their e - mail servers . the e - mail servers may be configured to receive messages based upon a registry class , status , and industry field of the source domain included in the incoming e - mail messages . the registry provides a database of registered users , which functions as a centralized repository of information on each registered e - mail server and the domains that operate within . the database is shared , and computer readable code is separated from internal e - mail servers in order to enable usage of the database in all computing environments . when a company is registered , the company can then access the services of the registry from the company &# 39 ; s registered e - mail servers . the registry only acknowledges messages from registered servers . the registry provides the requesting e - mail server with validation that the source of an incoming e - mail is a registered e - mail server and domain , and provides additional information on the source domain &# 39 ; s country , class , and industry . e - mails from source e - mail servers and / or domains that are not registered , or from domains that are not of a designated country , class , or industry , are not delivered to the destination e - mail server . for example , a registered user may designate that he does not want to receive any e - mails from domains having a “ retail sales ” class . a registered user may also designate that he only wants to receive e - mails from corporate business domains . this provides companies with the ability to define what types of e - mail enter their servers , allowing them to eliminate e - mail from sources that are not applicable to their daily business . the class of an e - mail domain is a field returned to the requesting e - mail server that defines the class of business that the source corporation provides . class is defined at the domain level . the following is a list of exemplary classes defined by the registry and is not to be considered inclusive : corporate business . this class defines a domain that does not originate messages that contain advertisements or solicitations . this class is used for corporate business only with its employees or business partners . retail sales . this class defines a domain that sends solicitations for the purpose of retail sales . corporate sales . this class defines a domain that sends solicitations for the purpose of product sales to other business entities ( not to individual consumers ). corporate professional services . this class defines a domain that sends solicitations for the purpose of advertising its services to other businesses . consumer professional services . this class defines a domain that sends solicitations for the purpose of advertising its services to individual consumers . other classes may include , for example , political groups , governmental entities , educational entities such as universities or other “. edu ” domains , adult entertainment businesses , family entertainment businesses , gambling businesses , travel industry businesses , and the like . the status of an e - mail domain is a field returned to the requesting e - mail server that provides the current registration status of the originating server and / or domain . possible statuses are : the industry of an e - mail domain is a field indicating the industry in which the registrant business operates . standard industry codes ( sic ) as defined by the occupational safety & amp ; health administration ( osha ) of the united states department of labor may be utilized , but are not preferred because , in many cases , they are too detailed . in one embodiment , the present invention utilizes industry codes as defined by the north american industry classification system because these codes provide both generalized and detailed codes . to obtain entry into the registry , a company must provide information about its business and its use of e - mail communications . a company can register multiple e - mail servers , each having multiple associated domains , and domains of different class , status , and industry designations . an individual cannot register . each registrant must have a federal tax identification number ( in the united states ) or international equivalent that identifies the registrant as a legitimate business operating in the country of origin . the registry enables registered e - mail servers to notify the registry electronically of e - mail from registered e - mail servers and domains that are sending spam or suspected violations of the service class . if an e - mail from a registered e - mail server / domain does not pass the company &# 39 ; s spam filter , the e - mail can be sent to the registry for review . the registry reviews all suspect messages received by its members to determine whether the originating server / domain , if registered , should be suspended . once a verified suspect message is received about a registered server , the server owner and the domain owner are notified . the status of the suspect server / domain is changed from “ good ” status to “ review ”. if the questionable practice does not cease within 72 hours after notification from the registry , the server / domain status is changed to “ suspended ”. once a server / domain entry is “ suspended ”, the status can only be changed if the domain registrant accepts fines for each instance of additional suspect e - mails or spam that originates from the suspended server . if this condition is accepted , then the suspect server / domain is placed in “ review ” status again for one week . if no further complaints occur for the review period , then the server regains a “ good ” status within the registry . regardless of the servers being utilized by a domain , if the domain has excessive infractions , the domain is suspended without the ability for renewal . once a server is in “ suspended without renewal ” status , the server &# 39 ; s internet protocol ( ip ) address is not honored until another corporate entity applies for registration and can prove that it is not associated with the previous owner of that ip address . fig1 a - 1c are portions of a flow chart illustrating the steps of the preferred embodiment of the e - mail registry method of the present invention . referring to fig1 a , processes are shown that occur in an e - mail server or front - end computing resource . at step 100 , an external e - mail server has contacted the registry service to send an e - mail . the registry receives the smtp requests and at step 102 , the message headers are interrogated to retrieve the server &# 39 ; s ip address and the sender &# 39 ; s domain . at step 103 , it is determined whether the data is complete ( i . e ., both identifiers are available ). if not , the test fails and the method moves to step 104 where then the e - mail message is rejected , an error code is returned , and the action is logged . at step 105 , the method terminates the session with the source e - mail server , thus rejecting the message , and the registry service is ended . however , if the data is complete , the method moves from step 103 to step 106 , where an authentication request message is formatted that includes the source e - mail server identification and domain . the message includes information that authenticates the receiving e - mail server as a member of the registry . at step 107 , the destination of the e - mail request is determined . if a local registry image is on the e - mail server , or front - end computing resource , then an application programming instruction ( api ) is executed to provide authentication . if not , then an authentication request message is sent using secure sockets layer ( ssl ) to the registry server ( s ) configured during program installation or ongoing maintenance . the method then moves to fig1 b , step 108 . fig1 b illustrates the steps performed by the registry server upon receiving the authentication request message from the e - mail server or front - end computing resource . the registry server may be local , or may be geographically distant from the e - mail server or front - end computing resource . at step 108 , the authentication request is received at the registry server , and the registry authentication process begins , either local to the computing resource receiving the e - mail , or external and receiving the message as a “ web service ”. when the process is external and the “ web service ” access is used , it is important to note that the authenticating server could be anywhere on the internet or on a private intranet . at step 109 , the message source is tested using the source ip address to determine whether the authentication request originated from a registered e - mail server . the source ip address of the request message is checked against the registry database to determine if the requesting e - mail server is registered . if not , the method moves to step 110 where an error code is set . the method then moves to step 120 . however , if the requesting e - mail server is registered , the method moves from step 109 to step 111 where the ip address of the source e - mail server ( i . e ., the server that originated the incoming e - mail message ), which was captured and sent from the requesting e - mail server , is checked against the registry database to determine whether the source e - mail server is registered . if not , the method moves to step 112 where an error code is set . the method then moves to step 120 . however , if the ip address of the source e - mail server is registered , the method moves from step 111 to step 113 where it is determined whether the status of the source e - mail server &# 39 ; s registration is in good standing . this status is used to suspend a registered server from the registry . if the status is not “ good ”, the method moves to step 114 where an error code is set . the method then moves to step 120 . however , if the status of the source e - mail server &# 39 ; s registration is in good standing , the method moves from step 113 to step 115 where it is determined whether the domain from which the message originated ( i . e ., the source domain ) is registered with the registry as being associated with the ip address of the source e - mail server . if not , the method moves to step 116 where an error code is set . the method then moves to step 120 . however , if the source domain is registered as being associated with the source e - mail server , the method moves from step 115 to step 117 where it is determined whether the source domain &# 39 ; s registration is in good standing . this status is used to suspend a registered domain from the registry . if not , the method moves to step 118 where an error code is set . the method then moves to step 120 . however , if the status of the source domain is in good standing , the method moves from step 117 to step 119 where the accepted e - mail is logged ( i . e ., recorded on a digital medium ). source , time of day , source address , and destination address are logged . the method then moves to step 120 where an authentication response message is formatted to include information regarding the domain ( country code , industry code , status , and class ). at step 121 , the authentication response message is sent to the requesting e - mail server . the method then moves to fig1 c , step 122 . fig1 c illustrates the steps performed by the e - mail server or front - end computing resource upon receiving the authentication response message from the registry server . at step 122 , the authentication response message is received at the requesting e - mail server or front - end computing resource . the message may be checked for completeness , timeouts , and errors . if any errors are detected , the server flags the status of the authentication as “ incomplete ”, and logs the result in a notification log . at step 123 , the status field in the authentication response message is tested . the status is compared to the user &# 39 ; s desired action . if the status is incorrect , or if the response message is incomplete or contains errors , the method moves to step 127 where the incoming e - mail message is denied . however , if the status is good , or if the user has configured the software to allow unauthenticated or incomplete messages to continue , the method moves from step 123 to step 124 where it is determined whether the country code in the response message is acceptable . the country code from the e - mail source domain is compared against configuration parameters to determine if e - mails from this country are acceptable for the requesting e - mail server . if the country is not acceptable ( i . e ., blocked ), the method moves to step 127 where the incoming e - mail message is denied . however , if the country code is acceptable , the method moves from step 124 to step 125 where it is determined whether the industry code in the response message is acceptable . the industry code from the e - mail source domain is compared against configuration parameters to determine if e - mails from this industry are acceptable for the requesting e - mail server . if the industry code is not acceptable , ( i . e ., blocked ), the method moves to step 127 where the incoming e - mail message is denied . however , if the industry code is acceptable , the method moves from step 125 to step 126 where it is determined whether the class code in the response message is acceptable . the class code from the e - mail source domain is compared against configuration parameters to determine if e - mails from this class are acceptable for the requesting e - mail server . if the class code is not acceptable , ( i . e ., blocked ), the method moves to step 127 where the incoming e - mail message is denied . however , if the class code is acceptable , the method moves from step 126 to step 128 where basic information about the incoming e - mail message , such as for example , the source ip address , the source e - mail address , the destination e - mail address , the date , and the time , is logged . the incoming e - mail message is then delivered to the e - mail server that it is performing the front - end processing . the registry service then ends at step 129 . fig2 is a simplified block diagram illustrating the communications between registry servers primarily operating in different countries and exchanging registry entries . a network is shown in which registry servers 200 , 210 , and 220 share information over secure communication links using the internet as the network . the registry servers control entries for a specific country and then share that information with other registry servers in other countries . as shown , registry server 200 controls entries for the united states ( us ); registry server 210 controls entries for mexico ( mx ); and registry server 220 controls entries for canada ( ca ). the servers then share this information by transmitting entries to each other so that each registry server remains current . fig3 is a message flow diagram illustrating the flow of messages between a registered e - mail server 300 and a registry server 305 during download procedures to update the registered e - mail server &# 39 ; s local directory of registered servers . this process enables private e - mail server environments to locally authenticate other e - mail servers that are sending e - mails to their servers . this process utilizes software - implemented processes at the registry server and the private e - mail server environment . the registered e - mail server 300 may be , for example , a private corporate e - mail server or a government server or other certified e - mail server . the registered e - mail server 300 first sends a registry download request 310 to the registry server environment 305 . the download may be requested as an initial download or a refresh download . the request includes download parameters , which specify the last download date and time , desired countries , and the registered e - mail server &# 39 ; s certification information . the registry server receives the request message , authenticates the registered server , and sends a reply message 315 that provides information about the download session . this information may include , for example , how many entries are to be downloaded ( deletes and insertions ) and the total size of the download . the registered server receives the download reply message and saves the session information for validity checking at the end of the download . the registered server then sends a download confirmation message 320 back to the registry server with an indication that the registered server is either ready for the download or has terminated the download due to resource restrictions . if the download has been terminated , the registry server returns a download complete message , and the session is terminated . if the confirmation message indicates that the registered server 300 is ready for the download , the registry server 305 starts the download process by sending an initial or refresh registry download reply message 325 containing initial information or updates to the registered server &# 39 ; s local registry database . the downloaded information contains entries that have been either updated , added , or deleted since the registered server last completed a download , as indicated in the download request message 310 . the registered server receives the download reply message and verifies that a complete transmission was received using a field that serves as a download validity check . the registered server then updates its local registry database with the information sent by the registry server . the registered server then sends a download confirmation message 330 that includes an indication of the success or failure of processing the information in the download reply message 325 . a second indicator field may be used to instruct the registry server to either resend the download reply message or abort the download . if the download is aborted , the registry server notes this fact in an operation log . if the download was successful , the registry server verifies that the download has ended , and sends a download complete message 335 to the registered server . the download complete message may include a positive or negative result code and the date and time of the last entry . fig4 is a simplified block diagram of networked e - mail servers 400 , 405 , and 410 accessing the registry through the internet 420 . the e - mail servers may be corporate 400 , government 405 , or isp 410 environments . these server environments are modified in accordance with the teachings of the present invention , and have registry software installed on their e - mail servers or on front - end computers that relay registered e - mail to the e - mail servers . it should be noted that the network may be configured with more than one registry site for fail safe processing . at the registry site , router 425 is connected to the internet , and provides access to and from the site . the router is connected to a hub 430 , which is connected to a plurality of servicing registry servers 435 - 450 . it should be noted that a firewall may be installed between the router and the registry servers . utilizing load balancing techniques , an available registry server such as registry server 440 may receive and process a request from one of the e - mail servers 400 , 405 , and 410 either to begin an upload process or for immediate certification of an e - mail message . there is no limit as to how many registry servers may be installed at any specific site . registry servers are added to sites as processing demand dictate . requests for data are forwarded to registry database servers 470 and 480 through a second network attached to the registry servers via a second network card or hub 460 . the second network further isolates the registry database servers . this decreases the likelihood that the database servers can be violated ( hacked into ). the database servers maintain the registry of the e - mail servers and domains that have been registered in the registry as a whole . thus , all entries from over the globe are recorded in each registry database server , and there are registry database servers for each registry site around the globe . fig5 a - 5e are portions of a flow chart illustrating the download procedures between a registry server and an e - mail server or another computer that provides a local registry database for processing . fig5 a - 5e illustrate the download process in further detail than fig3 . descriptions are provided for the processes at each end , i . e ., the e - mail server environment and the registry confirmation environment . it is important to note that the architecture of the present invention allows several different configurations of the invention to be implemented . the method of the present invention , as illustrated in fig5 a - 5e , could occur on a single computer , or could involve a second computer that stores the local registry database and provides registry certification to one or more e - mail servers in the environment . referring to fig5 a , processes are shown that occur in an e - mail server or front - end computing resource . the method begins at step 500 when the e - mail server receives an incoming e - mail . at step 501 , the e - mail server checks a local registry database 502 , and then formats a download request for the registry . at step 503 , the registry certification data are encrypted , and at step 504 , a download request message is sent to the registry server . the method then moves to fig5 b , step 505 . referring to fig5 b , processes are shown that occur in the registry server . the registry server receives the download request at step 505 , and determines at step 506 whether the request is from a registered e - mail server . if not , the session is ended at step 507 . if the request is from a registered server , the method moves from step 506 to step 508 where the registry certification data are decrypted . at step 509 , it is determined whether the source of the incoming e - mail is a certified source . if not , the method moves to step 512 and formats a download reply message denying the incoming e - mail . at step 515 , this denial is sent back to the requesting e - mail server . however , if it is determined at step 509 that the source of the incoming e - mail is a certified source , the method moves instead to step 510 where updated registry information is retrieved from the registry database 511 . the size of the download is determined utilizing the last timestamp for the requesting e - mail server . the method then moves to step 513 where a download reply message is formatted . the download segment is encrypted at step 514 , and the download reply and updated registry information are sent to the requesting e - mail server at 515 . the method then moves to fig5 c , step 516 . referring to fig5 c , processes are shown that occur in the requesting e - mail server or front - end computing resource . the requesting e - mail server receives the download reply message at step 516 . at step 517 , it is determined whether the reply message is authorized . if not , the method moves to step 518 where the reply is logged and sent to a notification device . the session then ends at step 519 . however , if the reply message was authorized , the method moves from step 517 to step 520 where it is determined whether there is any data to download . if not , the method moves to step 521 where the reply is logged and sent to the notification device . the session then ends at step 522 . however , if there is data to download , the method moves from step 520 to step 523 where a download table is prepared . at step 524 , the e - mail server determines whether it has sufficient resources available for the download . if not , a download confirmation failure message is formatted at step 525 indicating that the download is terminated . the confirmation failure is encrypted at step 527 , and is sent to the registry server at step 528 with an indication that the registered server has terminated the download due to resource restrictions . however , if it is determined that the e - mail server has sufficient resources available for the download , the method moves from step 524 to step 526 where a confirmation success message is formatted . the confirmation success is encrypted at step 527 , and is sent to the registry server at step 528 with an indication that the registered server is ready for the download . the method then moves to fig5 d , step 529 . referring to fig5 d , processes are shown that occur in the registry server upon receiving the download confirmation message . the registry server receives the download confirmation message at step 529 and decrypts the message at step 530 . at step 531 , the registry server determines from the indication in the confirmation message whether the requesting e - mail server is ready . if not , a download complete message is formatted at step 532 , and the download complete message is returned to the requesting e - mail server at step 539 . however , if it is determined that the requesting e - mail server is ready , the method moves from step 531 to step 533 where the registry server finds the download position and retrieves the next “ n ” registry updates from the registry database 534 . at step 535 , the registry server determines whether there is more data to be downloaded . if not , a download complete message is formatted at step 536 , and the download complete message is returned to the requesting e - mail server at step 539 . however , if it is determined that there is more data to download , the method moves from step 535 to step 537 where a download reply message is formatted . the download reply message is encrypted at step 538 , and is sent to the requesting e - mail server at step 539 . the method then moves to fig5 e , step 540 . referring to fig5 e , processes are shown that occur in the requesting e - mail server or front - end computing resource upon receiving the download complete or download reply message from the registry server . the requesting e - mail server receives the message at step 540 and determines at step 542 whether the message is a download complete message . if so , the method moves to step 543 where the local registry table and database 546 are updated . the method then ends at step 544 . however , if the received message is not a download complete message , then it is a download reply message containing updated registry information . the method moves to step 545 where the local registry database is updated with the new registry information . the method then determines at step 547 whether the update was completed . if complete , the method returns to step 526 ( fig5 c ) where a positive download confirmation message is formatted , and then encrypted and sent to the registry server . if it is determined at step 547 that the update was not completed , the method moves to step 548 where an error code is set . the method then returns to step 526 ( fig5 c ) where a negative download confirmation message is formatted , and then encrypted and sent to the registry server . as will be recognized by those skilled in the art , the innovative concepts described in the present application can be modified and varied over a wide range of applications . accordingly , the scope of patented subject matter should not be limited to any of the specific exemplary teachings discussed above , but is instead defined by the following claims .
| 7 |
the following detailed description will present an apparatus for generating tracking error signals in accordance with a first preferred embodiment with reference to the accompanying drawings . fig1 is a block diagram of an apparatus for generating tracking error signals in accordance with a first preferred embodiment of the present invention . referring to fig1 , an apparatus for generating tracking error signals includes first and second adders 21 , 22 , first and second comparators 41 , 42 , an error correction unit 50 , a phase - difference detection unit 60 , and a subtractor 80 . the first adder 21 outputs signals resulting from the mutual adding of the first and third light receiving elements p 1 , p 3 , which are placed in one diagonal direction of the quarterly - divided optical detector 11 . the signals from the first adder 21 correspond to signals of a first group . the second adder 22 outputs signals resulting from the mutual adding of the second and fourth light receiving elements p 2 , p 4 , which are placed in another diagonal direction of the quarterly - divided optical detector 11 . the signals from the second adder 22 correspond to signals of a second group . a first gain control amplifier 31 controls the output signals from the first adder 21 to a predetermined amplitude . a second gain control amplifier 32 controls the output signals from the second adder 22 to a predetermined amplitude . the first comparator 41 outputs signals from the first gain control amplifier 31 as binary signals after comparing them with a reference level . the second comparator 42 outputs signals from the second gain control amplifier 32 as binary signals after comparing them with a reference level . an error correction unit 50 compares signals from the first comparator 41 with signals from the second comparator 42 , determines if there are any signal distortions , corrects the signals if there are any distortions , and outputs the resulting signals . a phase - difference detection unit 60 compares signals corresponding to the first group from the error correction unit 50 with signals corresponding to the second group and outputs signals corresponding to the phase - difference by each group . a first and a second low pass filter 71 , 72 convert signals from the phase - difference detection unit 60 into voltage signals proportional to the phase - difference and output the resulting signals . a subtractor 80 subtracts signals mutually from the first and second low pass filters 71 , 72 and outputs the resulting signals as tracking error signals ( tes ). when signal distortions occur in the apparatus for generating tracking error signals , an error correction unit 50 will correct them . the diagram of fig2 describes the process in which tracking error signals are generated by disclosing waveforms of each unit . fig2 teaches waveforms a 1 , a 2 from the first and second adders 21 , 22 , respectively . in addition , the waveform from the second adder 22 illustrates that reduced and abnormal signals are output in the section ( x ) where signal distortions are assumed to occur . in this case , the error correction unit 50 decides that the section x , where signals b 2 from the second comparator 42 compared to signals b 1 from the first comparator 41 maintains a low level for more than a predetermined time , has errors due to signal distortions , and outputs the signal level for the related section after converting them into the same level . as a result , even though signal distortions take place , it is possible to generate normal tracking error signals . a desirable example of this error correction unit 50 is shown in fig4 . also , output waveforms of some of the elements of fig4 are shown in fig5 . referring to fig4 and 5 , the error correction unit 50 includes a first mux 51 , a second mux 52 , a xor gate 53 , an or gate 54 , and a pulse comparator 55 . the first and second muxs 51 , 52 output signals in accordance with controlling signals from the pulse comparator 55 . specifically , either signals b 1 , b 2 from the first and second comparator 41 , 42 are output unchanged or low signals are output , which are the set first reference signals . the xor gate 53 performs an exclusive logical adding operation on the signals b 1 from the first comparator 53 and the signals b 2 from the second comparator b 2 , and outputs the results to the pulse comparator 55 . the or gate 54 performs a logical adding operation on the signals b 1 from the first comparator 41 and the signals b 2 from the second comparator 42 , and outputs the results to the pulse comparator 55 . the pulse comparator 55 compares signals ( k ) from the xor gate 53 with signals ( l ) from the or gate 54 . as a result , when the signals ( k ) and ( l ) correspond to the mutually same level , the pulse comparator controls the first mux 51 and the second mux 52 , which are the first and second switching units , according to the first reference signals . for example , when the signals ( k ) and ( l ) correspond to the mutually same level , low signals are output . the pulse comparator 55 includes two serial - parallel converters 55 a , 55 b and a parallel comparator 55 c . the serial - parallel converter 55 a converts signals ( k ) from the xor gate 53 and the serial - parallel converter 55 b converts signals ( l ) from the or gate 54 , where signals ( k ) and signals ( l ) are input in series . a shift register can be applied to the serial - parallel converters 55 a , 55 b . a parallel binary comparator 55 c compares signals which are made to be parallel in the serial - parallel converter 55 a , 55 b . in the section where two signals correspond to the same level , the parallel binary comparator 55 c outputs signals for controlling muxs 51 , 52 so that the first reference signals are output . in comparing signals , the number of bits compared by the parallel binary comparator 55 c corresponds to the number of bits contained in the section x . according to this error correction unit , if mutual logical adding or exclusive logical adding is performed on the signals from each comparator 41 , 42 , the signals which have distortions , as illustrated in fig2 and fig5 , can be converted into the same waveforms of signals . fig2 and fig5 illustrate waveforms from each unit in fig4 and the section ( x ), which has signal distortions as seen through sections marked with s 1 and s 2 . so errors can be corrected in the phase - difference detection process later . fig6 illustrates another preferred embodiment where the output signals from light receiving elements of an optical detection unit are grouped . however , the error correction method on signal distortions of the error correction unit 50 is applied in the same way . referring to fig6 , an apparatus for generating tracking error signals includes first to fourth comparators 141 - 144 , an error correction unit 150 , a phase - difference detection unit 160 , and a subtractor 180 . in fig6 , the first group signal corresponds to signals from the first and second light receiving elements p 1 , p 2 placed closely together on opposite sides in the clockwise direction of the signals from a quarterly - divided optical detector 111 , and the second group signal corresponds to signals from the third and fourth light receiving elements p 3 , p 4 . first to fourth gain control amplifiers 131 - 134 control and output signals from light receiving elements p 1 to p 4 of the optical detector 111 , respectively , in a predetermined amplitude . the first to fourth comparators 141 - 144 compare signals from corresponding gain control amplifiers 131 - 134 with reference levels , and output them as binary signals . an error correction unit 150 includes a first error correction unit 151 which corrects the first group signal and a second error correction unit 152 which corrects the second group signal . the first error correction unit 151 corrects and outputs signals from the first light receiving element p 1 and the second light receiving element p 2 of the optical detector 111 by means of the signal correction method described in fig4 . the second error correction unit 152 corrects and outputs signals from the third light receiving element p 3 and the fourth light receiving element p 4 of the optical detector 111 by means of the signal correction method described in fig4 . in other words , the same circuit in fig4 is applied to the first error correction unit 151 , but the input signals are the signals b 1 from the first comparator 141 and the signals b 2 from the second comparator 142 . similarly , the same circuit in fig4 is applied to the second error correction unit 152 , but the input signals are the signals b 3 from the third comparator 143 and the signals b 4 from the fourth comparator 144 . a phase - difference detection unit 160 includes the first phase - difference detection unit 161 which processes the signals of the first group and the second phase - difference detection unit 162 which processes the signals of the second group . the first phase - difference detection unit 161 compares signals corresponding to the first light receiving element p 1 and second light receiving element p 2 which are output from the first error correction unit 151 , and outputs each signal corresponding to the phase - difference to correspond to each light receiving element . the second phase - difference detection unit 162 compares signals corresponding to the third light receiving element p 3 and fourth light receiving element p 4 which are output from the second error correction unit 152 , and outputs each signal corresponding to the phase - difference to correspond to each light receiving element . a first or gate 221 performs a mutual logical adding of the signals from the first phase - difference detection unit 161 corresponding to the first light receiving element p 1 and the signals from the second phase - difference detection unit 162 corresponding to the third light receiving element p 3 , and outputs the result into a subtractor 180 . a second or gate 222 performs a mutual logical adding of the signals from the first phase - difference detection unit 161 corresponding to the second light receiving element p 2 and the signals from the second phase - difference detection unit 162 corresponding to the fourth light receiving element p 4 , and outputs the result into the subtractor 180 . a subtractor 180 performs a mutual subtraction of the signals from the first or gate 221 and signals from the second or gate 222 , and outputs the resulting signals . signals from the subtractor 180 go through a low pass filter ( lpf ) 270 and are output as tracking error signals ( tes ). while the invention has been shown and described with reference to certain preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . for example , while the invention has been described in the specific content of an apparatus for generating tracking error signals , it has an advantage that it has simple circuit construction as it is made to perform a correction of signal distortions by using signals from comparators which convert signals from light receiving elements into binary signals . the embodiments and advantages are merely exemplary and are not to be construed as limiting the present invention . the present teaching can be readily applied to other types of apparatuses . the description of the present invention is intended to be illustrative , and not to limit the scope of the claims . many alternatives , modifications , and variations will be apparent to those skilled in the art . in the claims , means - plus - function clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents but also equivalent structures .
| 6 |
the present invention methodology uses a mathematical model to represent a continuous or semi - continuous manufacturing facility . this mathematical model is a matrix of algorithms comprised of the following modules : units : in the invention , model units are basic elements , which represent major and critical process equipment that are modeled as single unit ‘ black boxes ’, converting inputs to outputs using the equipment &# 39 ; s required utilities . specifically , units are modeled as sets of linear equations , which depict the energy and material balances around them . each unit has a minimum number of characteristics such as : maximum and minimum operating limits , preferred operating rates , alternative modes of operation , associated input and output flows , forced open and forced closed flags . a representation of a typical unit is seen in fig1 . departments : in the invention model , departments are also basic model entities that represent an area of the process which consists of a number of units that perform a specific task and can be modeled as single black boxes in a similar way as the units . departments are modeled as sets of linear equations , which depict the overall energy and material balances around the department . each department has a minimum number of characteristics such as : maximum and minimum operating limits , preferred operating rates , alternative modes of operation , input and output flows associated with it , forced open and forced close flags , and internal flows between the different equipment within the department . an illustration of a typical department is also seen in fig1 . flows : in the invention model , flows are model entities that represent the actual material movement and material transformation between the different units and departments of the model . flows can be classified into three categories : input flows , output flows , and internal flows . there is also one subcategory for inventoried flows . input flows : in the invention model , input flows are models of all the raw material and utilities that are being used by the facility . each input flow has a minimum number of characteristics such as minimum and maximum available quantity and corresponding cost . output flows : in the invention model , output flows are models of all the products and by - products of the facility as well as any material that leaves the facility &# 39 ; s boundaries . each output flow has a minimum number of characteristics such as minimum and maximum demand , quantity and corresponding price . internal flows : in the invention model , internal flows are models of all the material flows that start and end within the boundaries of the facility . each internal flow has a minimum number of characteristics such as minimum and maximum flow quantity . inventory flows : in the invention model , the inventory flows are models of all the input , output , and internal flows , that can be inventoried . each inventory flow has , in addition to its inherited characteristics , an additional number of minimum characteristics such as minimum and maximum storage capacity . operating practices : in the invention model , mathematical expressions are included to account for actual operating practices such as lead / lag times for bringing a unit or department on - line or off - line , monetary costs associated with unit or department start - ups and shut - downs , preferred operating rates , operating ratios , product recipes , etc . periods : in the invention model , the optimization time horizon is divided into time increments called periods . its start time and its length define each period . during each period the facility is considered to operate at steady - state conditions and flows characteristics do not change . division of the optimization time horizon into periods is done though a tool termed period wizard . special contract terms : in the invention model , special contract terms for purchasing and / or selling raw materials , energy , products , etc ., are expressed as mathematical equations to accurately reflect each particular contract term and condition . these equations are incorporated into the overall optimization model . optimization model : in the invention model , all the aforementioned modules , i . e ., units , departments , flows , periods , operating practices , and special contract terms are configured together to create an optimization model ( mathematical programming matrix ) accurately representing the entire manufacturing facility production process . a detailed description of the invention model is presented in fig5 . once a manufacturing facility is set up as the mathematical model it is populated with the default attributes ( characteristics ) for each modeled unit , department , and flow . a significant element of a unit or department is its efficiency , i . e ., quantity of outputs as a function of inputs . these efficiencies are included as mathematical expressions based on actual performance . since efficiencies will vary over time due to unit / department deterioration , maintenance , cleaning , replacement , reconfiguration , upgrade , etc ., the present invention includes an on - line self - learning function to monitor and automatically adjust the associated mathematical expressions over time . the present invention includes an electronic data transfer interface termed mis link . the mis link interface takes its name from the acronym of management information system ( mis ) which most manufacturing facilities have available and which records data about processes and usages of all furnish materials and energy necessary in the facility &# 39 ; s manufacturing process . the mis link interface is therefore linked with the mis system and allows downloading / uploading of the appropriate data on a real - time basis . in the preferred form of the invention required final product quantities by type , inputs for raw material and purchased utility costs , current operating rates / inventories , and temporary constraints imposed on the manufacturing facility process are automatically downloaded to the application via the mis link . alternatively these can be entered manually through the application &# 39 ; s graphical user interface . in the preferred form of the invention , an update routine is also included . this routine downloads the facility &# 39 ; s real - time data to the application , runs the application &# 39 ; s generic linear optimizer engine and uploads the optimized decisions automatically at fixed ( adjustable ) time intervals . in the preferred form of the invention , a trigger routine is also included . this routine downloads the facility &# 39 ; s real - time data to the application , runs the application &# 39 ; s optimization engine and uploads the optimized decisions automatically whenever the actual facility data changes by a pre - determined ( adjustable ) amount , either as a discrete value or as a percentage change . period wizard : in the present invention , the period wizard is a tool that implements an automated process of dividing the optimization time horizon into smaller time increments called periods . two options are available in the period wizard for dividing the time horizon . in the first one , the user defines a default length for each period and a number of equal - length periods is automatically created covering the whole time horizon ; the last period &# 39 ; s length could be truncated in order to adjust to the end of the time horizon . in the second option , the user introduces events that will take place during the optimization time horizon and the application then automatically creates the periods in such a way that neither the start nor the end of any event lie within a period but coincide with period edges , i . e ., the they set the period time boundaries . this is shown in fig2 . gap analysis : in the present invention , the gap analysis is a function that makes a real - time comparison between the optimized production decisions against the actual production operation , determines the comparison gap ( difference ), analyses the lost opportunities in terms of cost , and outputs the cost penalties together with a recommendation for corrective actions to the facility &# 39 ; s mis for a real - time user awareness of the penalty associated with not following the optimized production decisions . an example of this is illustrated in fig3 . application system structure : in the present invention , the application system structure consists of a database used for data storage , a graphical user interface facilitating data communication between the user and the storage device and the optimization components , optimization model , the optimization model solver , and the mis link electronic data transfer interface to link the invention software application with the facility &# 39 ; s mis system on a real - time basis . this is depicted is fig4 . the invention optimization parameters will have many manifestations , including product units , labor , raw materials , energy , unit costs , etc . in these manifestations this software application is customized to cover any optimization variable in any manufacturing facility . although other modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art .
| 6 |
fig1 is a generalized block diagram of a system , generally designated by reference number 1 , for removing carbon dioxide from an atmosphere according to an exemplary embodiment of the present invention . the system 1 includes an air extraction system 40 and a sequestration system 50 . the air extraction system 40 preferably incorporates any known or later - discovered co 2 extraction method , including methods which use a medium to absorb and / or bind co 2 from the atmospheric air by exposing the medium to chemical , electrical and / or physical interaction with the co 2 in the captured air . the medium may be liquid , gaseous or solid , or a combination of liquid , gaseous and solid substances , where in the case of solids , the substance is preferably porous . the medium is preferably recyclable so that after the co 2 is captured by the medium and separated from the medium for sequestration , the medium can be reused for absorption / binding of additional co 2 . however , in other embodiments the medium may be sequestered along with the captured co 2 . as shown in fig1 , the separation of the co 2 from the medium , as well as other processes such as the absorption / binding of co 2 and the sequestration of the co 2 performed by the sequestration system 50 , may be made more efficient by the addition of heat to the air extraction system 40 . in the present invention , the heat is process heat generated by a fossil fuel power plant , to be described in further detail below . the term “ process heat ” as used herein refers to the lower temperature heat remaining after the higher temperature heat has been used to generate electricity . more generally , the term “ process heat ” refers to any low temperature heat remaining after a primary process or that is added by the process itself , such as , for example , exothermic carbonation reactions in which carbon dioxide is stored as a mineral . fig2 is a block diagram of a system , generally designated by reference number 2 , for removing carbon dioxide from an atmosphere according to an exemplary embodiment of the present invention . the system 2 includes a fossil fuel power plant 30 , an air extraction system 42 and a sequestration system 50 . each of these components of the system 2 are explained in detail below . the fossil fuel power plant 30 may be any known or later discovered facility that relies on the burning of fossil fuels , such as , for example , coal , fuel oil , natural gas and oil shale , for the generation of electricity . the thermal energy produced by the fossil fuel power plant 30 is used to produce electricity and the residual thermal energy ( i . e ., process heat ) may be used to drive the air extraction system 42 and / or the sequestration system 50 . for example , the process heat from the fossil fuel power plant 30 may be used to improve the efficiency of chemical and / or physical reactions used in the air extraction system 42 to absorb co 2 from the air and / or to drive off the co 2 from the medium . the residual heat provided by the fossil fuel power plant 30 may be supplemented by energy generated by a supplemental energy source . for example , the supplemental energy source may be a waste incineration plant or a renewable energy source , such as , for example , solar , nuclear , biomass , and geothermal energy sources , which provides additional thermal energy to drive the air extraction system 42 and / or the sequestration system 50 . process heat from the supplemental energy source may also be used to drive the air extraction system 42 and / or the sequestration system 50 . fig3 is a block diagram of the air extractor system 42 useable with the system 2 according to an exemplary embodiment of the present invention . the air extractor system 42 includes an air contactor 41 , a causticizer 43 , a slaker 45 , a calciner 47 and a capture unit 49 . the air contactor 41 may use a sorbent material to selectively capture co 2 from the air , and may be composed of any known or later - discovered contactor structures , such as , for example , large convection towers , open , stagnant pools , and packed scrubbing towers . in the present embodiment , the sorbent material may be sodium hydroxide ( naoh ), which readily absorbs co 2 from the air . it should be appreciated that other known or future - discovered capture methods may be used , such as , for example , chemical absorption , physical and chemical adsorption , low - temperature distillation , gas - separation membranes , mineralization / biomineralization and vegetation . as a further example , as known in the art , aqueous amine solutions or amine enriched solid sorbents may be used to absorb co 2 . preferably , the sorbent material is regenerated and the capture method requires less than about 100 - 120 ° c . heat to regenerate the sorbent material . in this embodiment , at the air contactor 41 , co 2 may be absorbed into an naoh solution forming sodium carbonate ( na 2 co 3 ). of course , other known or future - developed absorbers may also be used as an alternative or in addition to an naoh solution . the generated na 2 co 3 is then sent to the causticizer 43 , where the naoh is regenerated by addition of lime ( cao ) in a batch process . the resulting caco 3 solid is sent to the calciner 47 where it is heated in a kiln to regenerate the cao , driving off the co 2 in a process known as calcination . the regenerated cao is then sent through the slaker 45 , which produces slaked lime ca ( oh ) 2 for use in the causticizer 43 . the capture unit 49 captures the co 2 driven off at the calciner 47 using any know or later - discovered co 2 capturing method that is effective in the low concentrations in which co 2 is present in the atmosphere and that needs only low temperature heat for regeneration . for example , the capture unit 49 may use an amine based capture system , such as the system described in u . s . pat . no . 6 , 547 , 854 , incorporated herein by reference . the capture unit 49 may also compress the captured co 2 to liquid form so that the co 2 may be more easily sequestered . the sequestration system 50 may use any known or future - discovered carbon storing technique , such as , for example , injection into geologic formations or mineral sequestration . in the case of injection , the captured co 2 may be sequestered in geologic formations such as , for example , oil and gas reservoirs , unmineable coal seams and deep saline reservoirs . in this regard , in many cases , injection of co 2 into a geologic formation may enhance the recovery of hydrocarbons , providing the value - added byproducts that can offset the cost of co 2 capture and sequestration . for example , injection of co 2 into an oil or natural gas reservoir pushes out the product in a process known as enhanced oil recovery . the captured co 2 may be sequestered underground , and according to at least one embodiment of the invention at a remote site upwind from the other components of the system 2 so that any leakage from the site is re - captured by the system 2 . in regards to mineral sequestration , co 2 may be sequestered by a carbonation reaction with calcium and magnesium silicates , which occur naturally as mineral deposits . for example , as shown in reactions ( 1 ) and ( 2 ) below , co 2 may be reacted with forsterite and serpentine , which produces solid calcium and magnesium carbonates in an exothermic reaction . ⅓mg 3 si 2 o 5 ( oh ) 4 + co 2 = mgco 3 + ⅔sio 2 + ⅔h 2 o + 64 kj / mole ( 2 ) both of these reactions are favored at low temperatures . in this regard , both the air capture and air sequestration processes described herein may use electricity and / or thermal energy generated by the fossil fuel power plant 30 to drive the necessary reactions and power the appropriate system components . in an exemplary embodiment of the present invention , a high temperature carrier may be heated up to a temperature in a range of about 400 ° c . to about 500 ° c . to generate steam to run a generator for electricity , and the lower temperature steam that exits from the electrical generating turbines can be used to drive off the co 2 and regenerate the sorbent ( e . g ., naoh ). the temperature of the high temperature heat , the generated electricity and the temperature of the lower temperature process heat remaining after electricity production can be adjusted to produce the mix of electricity production and co 2 removal that is considered optimal for a given application . in addition , in exemplary embodiments , still lower temperature process heat that emerges out of the capture and sequestration steps may be used to cool equipment used in these steps . one or more systems for removing carbon dioxide from an atmosphere may be used as part of a global thermostat according to an exemplary embodiment of the present invention . by regulating the amount of carbon dioxide in the atmosphere and hence the greenhouse effect caused by carbon dioxide and other gas emissions , the system described herein may be used to alter the global average temperature . according to at least one exemplary embodiment of the present invention , several carbon dioxide capture and sequestration systems may be located at different locations across the globe so that operation of the multiple systems may be used to alter the co 2 concentration in the atmosphere and thus change the greenhouse gas heating of the planet . locations may be chosen so as to have the most effect on areas such as large industrial centers and highly populated cities , or natural point sources of co 2 each of which could create locally higher concentrations of co 2 that would enable more cost efficient capture . for example , as shown in fig4 , multiple systems 1 may be scattered across the globe , and international cooperation , including , for example , international funding and agreements , may be used to regulate the construction and control of the systems 1 . in this regard , greenhouse gases concentration can be changed to alter the average global temperature of the planet to avoid cooling and warming periods , which can be destructive to human and ecological systems . during the past history of our planet , for example , there have been many periods of glaciation and rapid temperature swings that have caused destruction and even mass extinctions . such temperature swings in the future could be a direct cause of massive damage and destabilization of human society from conflicts resulting from potential diminished resources . the global thermostat described herein may be the key to preventing such disasters in the decades to come . preferably , the air extraction system 42 and the sequestration system 50 are located at a facility that is separate from the fossil fuel power plant 30 . thus , the overall system 2 functions to remove from the atmosphere carbon dioxide produced by sources other than the fossil fuel power plant 30 . it should also be appreciated that in an embodiment of the invention , the air extraction system 42 and the sequestration system 50 may be used to remove the equivalent amount of co 2 generated by the fossil fuel power plant , so that the entire facility may be considered “ carbon neutral ”. also , removing co2 from the atmosphere , rather than directly from the flue gases , is advantageous in that it avoids the pollutants in the flue gases that would poison the adsorbent and otherwise negatively effect costs and operations . while this invention has been described in conjunction with the exemplary embodiments outlined above , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , the exemplary embodiments of the invention , as set forth above , are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the invention .
| 8 |
an optical apparatus using a semiconductor laser as applied to an optical reader for an audio or video disc player according to the first embodiment of the present invention will now be described with reference to fig2 to 4 . note that the axes of coordinates in fig2 and 3 coincide with those shown in fig1 . a semiconductor laser 1 as a light source is of the gain guiding type , which is one type of double heterojunction semiconductor laser . as has been described earlier , the focal point within the junction plane ( x - y axis plane ) of the light rays radiated from the semiconductor laser 1 lies at a point slightly deeper inside the resonator from a mirror surface 2 . however , the focal point in the vertical plane ( x - z axis plane ) perpendicular to the junction plane of the light rays from the semiconductor laser 1 lies on the mirror surface 2 , thus causing an astigmatism . the diverging light rays from the semiconductor laser 1 become incident on a plane - parallel glass body 4 having a predetermined thickness t 1 and disposed in the optical path of these light rays . the plane - parallel glass body 4 may be either transparent or translucent , and is surrounded by air . the plane - parallel glass body 4 is arranged such that a normal vector a 1 thereof is inclined by a predetermined angle u p1 within the junction plane ( x - y plane axis ) with respect to the optical axis . the light rays emerging from the plane - parallel glass body 4 then become incident on a beam splitter 5 which divides the incident light rays into transmitted light rays and reflected light rays . the transmitted light rays from the beam splitter 5 are converted into parallel light rays by a collimator lens 6 having a predetermined na and disposed to guide light rays parallel to each other . these parallel light rays are focused by an objective lens 7 onto the reading surface of an optical disc 8 to form a small spot at the focal point of the lens 7 . signals modulated by one or both of video and audio data are recorded on the reading surface of the optical disc 8 in the form of pit rows defining spiral or concentric tracks . the light rays reflected from the reading surface of the optical disc 8 and modulated by the recorded signals or the pit rows then become incident on the objective lens 7 and are converted into parallel light rays . the reflected light rays , now converted into parallel light rays , propagate along the same optical path in the reverse order to become incident on the beam splitter 5 through the collimator lens 6 . those reflected light rays which are further reflected by the beam splitter 5 become incident on the light - receiving surface of a photosensor 9 . the photosensor 9 produces reproduction data signals , tracking error signals and the like . the mechanism for correction of the astigmatism by means of the plane - parallel glass body 4 will now be explained with reference to fig4 . assume that a plane - parallel glass body 4 &# 39 ; ( thickness t 1 &# 39 ;, and refractive index n 1 ) is positioned on the optical path ( na = sin u 1 ) of focused light rays to be inclined by an angle of u p1 &# 39 ; with respect to the optical axis . then , an astigmatism a s1 arising in this optical system may be given by the following relation according to , for example , w . j . smith , modern optical engineering , mcgraw - hill , n . y ., 1966 : ## equ1 ## where l t &# 39 ; is the distance to the focal point in the plane ( meridian plane ) including the normal line and the optical axis , and l s &# 39 ; is the distance to the focal point in the plane perpendicular to the above plane . it is therefore possible to generate an astigmatism of the same magnitude but of the opposite algebraic sign to that of the astigmatism of the semiconductor laser 1 by selecting a predetermined thickness t 1 &# 39 ; and a predetermined angle u p1 &# 39 ; for a predetermined na , for example , na = sin u 1 = 0 . 2 , in accordance with relations ( 1 ) and ( 2 ) above , and at the same time to suppress the coma to the minimum . for any u p1 &# 39 ;≠ 0 , the astigmatism a s is given by : it can , therefore , be seen from the above that the astigmatism of the semiconductor laser 1 may be corrected if the meridian plane is made to coincide with the junction plane of the semiconductor laser 1 . if t 1 &# 39 ;= 0 . 1 mm , u p1 &# 39 ;= 45 ° and n 1 = 1 . 5 , the astigmatism a s1 may be calculated to be : as has been mentioned earlier , the astigmatism of the current semiconductor laser 1 of the gain guiding type is about 20 to 25 μm . thus , an astigmatism of such a magnitude may be corrected by the astigmatism a s1 above . in addition , the cam which may be produced in this case is only about 0 . 02 ( λ ) expressed by the rms value of the wave front aberration and is thus negligible . the astigmatism and the coma are both proportional to the thickness t 1 &# 39 ; of the plane - parallel glass body 4 &# 39 ;. the astigmatism is of the order of a second power of the angle u p1 &# 39 ;, and the coma is proportional thereto . therefore , the coma may be reduced to the minimum if the thickness t 1 &# 39 ; is smaller and the angle u p1 &# 39 ; of the plane - parallel glass body 4 &# 39 ; is greater for generating the astigmatism . the astigmatism of the semiconductor laser 1 may be corrected by the plane - parallel glass body 4 which has the predetermined thickness t 1 , and the normal vector a 1 of which is inclined by the predetermined angle u p1 with respect to the optical axis within the junction plane ( x - y axis plane ) of the semiconductor laser 1 . the small spot formed on the reading surface of the optical disc 8 by the objective lens 7 becomes substantially circular as a result of the correction of the astimatism by the plane - parallel glass body 4 . accordingly , even if the na of the collimator lens 6 is selected to be relatively great , the otf characteristics may not allow interference between adjacent tracks . even if an optical apparatus requires a high s / n ratio and a high light intensity , desired otf characteristics may be obtained without requiring an increase in laser output . since the optical element for correcting the astigmatism is the plane - parallel glass body 4 , the surface of the element is easy to form . since the optical element does not have power ( refraction capacity ), it only needs angular adjustment of the normal vector a 1 thereof with respect to the optical axis within the junction plane of the semiconductor laser 1 . the optical element of the present invention only requires simple positioning . in the first embodiment described above , the plane - parallel glass body 4 is disposed in the optical path of the diverging light rays . however , as may be seen from the mechanism for correcting the astigmatism described above , the plane - parallel glass body 4 may be disposed in the optical path of the focused light rays , for example , between the objective lens 7 and the reading surface of the optical disc 8 . in the first embodiment , only one plane - parallel glass body 4 is used . however , the only requirement is that a predetermined thickness t 1 be provided , which allows correction of a given astigmatism . therefore , two or more plane - parallel glass bodies 4 may be provided which have a total thickness t 1 . it is also possible to use a half mirror as the plane - parallel glass body 4 . the half mirror may be obtained by forming a deposition film by coating on the surface of the glass body opposite to the semiconductor laser 1 . the normal vector of the half mirror or the glass body 4 is inclined by the angle u p1 = 45 ° with respect to the optical axis . then , the plane - parallel glass body 4 provides a function of correcting the astigmatism and also a function of beam splitting . in this case , the beam splitter 5 may be omitted . furthermore , the plane - parallel glass body 4 may also serve as a cap window of the semiconductor laser 1 . in the first embodiment described above , correction of the astigmatism is performed by the plane - parallel glass body 4 . however , the optical element for performing this function may be a plane - parallel sapphire body ; the optical element need only transmit the light rays from the semiconductor laser 1 . the second embodiment of the present invention will now be described with reference to fig5 to 7 . the same reference numerals in fig2 to 4 denote the same parts in fig5 to 7 , and a detailed description thereof will be omitted . the axes of coordinates shown in fig5 coincide with those shown in fig1 . diverging light rays from a semiconductor laser 1 of the gain guiding type as a light source become incident on a biprism 10 which is disposed in the optical path of these light rays . the biprism 10 comprises two triangular prisms 10a and 10b having the same refractive index n h and the same vertex angle u p θ , as shown in fig6 . a transparent film 10d , as the plane - parallel body of the present invention and having a refractive index n l smaller than the refractive index n h and a predetermined thickness t 2 , is formed by deposition on an inclined surface 10c of the prism 10a . a translucent reflecting film 10f is formed by deposition on an inclined surface 10e of the prism 10b . both these inclined surfaces 10c and 10e are adhered together by a known adhering means such that the transparent film 10d and the translucent reflecting film 10f are sandwiched therebetween , thereby completing the biprism 10 . therefore , the translucent reflecting film 10f is formed on one surface of the transparent film 10d . the biprism 10 provides the function of correcting the astigmatism by means of the transparent film 10d and also provides the function of beam splitting by means of the translucent reflecting film 10f . the biprism 10 is so arranged that a normal vector a 2 of the transparent film 10d as the plane - parallel layer is inclined by a predetermined angle u p2 (= u p θ ) with respect to the optical axis within the plane ( x - z axis plane ) which is perpendicular to the junction plane ( x - y axis plane ) of the semiconductor layer 1 and which extends along the optical axis thereof . the light rays transmitted through the biprism 10 are focused to form a small spot on the reading surface of an optical disc 8 through a collimator lens 6 and an objective lens 7 . the light rays reflected by the reading surface of the optical disc 8 and modulated by the signals recorded on the reading surface then propagate along the same optical path in the reverse order through the objective lens 7 and the collimator lens 6 to become incident on the biprism 10 . those reflected light rays which are reflected by the translucent reflecting film 10f of the biprism become incident on the light - recovering surface of a photosensor 9 . the mechanism of correction of the astigmatism by the transparent film 10d as the plane - parallel layer of the biprism 10 will now be described . the astigmatism a s2 of the diverging light rays transmitted through the film 10d of the biprism 10 is given by : a . sub . s2 =-{( n . sub . r . sup . 2 - 1 ) sin . sup . 2 u . sub . p2 /( n . sub . r . sup . 2 - sin . sup . 2 u . sub . p2 ). sup . 3 / 2 }·( a . sub . 2 / n . sub . h ) ( 3 ) for n r = n l / n h and u p2 = u p θ , where n r is a refractive index ratio which is obtained by dividing the refractive index n l of the transparent film 10d by the refractive index n h of the prisms 10a and 10b . from consideration of relations ( 1 ) and ( 3 ), we can conclude the following : ( 1 ) both relations may be the same if n h = 1 when n 1 = n r , u p1 &# 39 ;= u p2 , and t 1 &# 39 ;= t 2 . ( 2 ) if the refractive index ratio n r is greater than 1 , the polarity of the astigmatism is the same as the albebraic sign of relation ( 1 ). however , if n r is smaller than 1 , the polarity of the astigmatism is inverted . ( 3 ) if n r is smaller than 1 , the denominator approximates to zero . therefore , the astigmatism becomes greater than the absolute value of that when n r is greater than 1 , assuming that the angle u p2 and the thickness d 2 remain the same . a sensitivity coefficient s for the angle u p2 = 45 ° is given by : fig7 shows the sensitivity coefficient s as a function of the refractive index ratio n r . accordingly , n r is preferably smaller than 1 , since then the thickness of the transparent film 10d may then be made thinner and the deposition cost of the film 10d may be reduced to the minimum . however , in this case , s - polarized light must be obtained as shown in fig5 in order to correct the astigmatism of the semiconductor laser . in other words , the normal vector a 2 of the transparent film 10d must be inclined with respect to the optical axis within the plane ( x - z axis plane ) which is perpendicular to the junction plane ( x - y axis plane ) of the semiconductor laser 1 and which extends along the optical axis , so that the junction plane ( x - y axis plane ) of the semiconductor laser may be perpendicular to the plane of incidence defined by the optical axis and the normal vector a 2 of the transparent film 10d . if n r is greater than 1 , p - polarized light must be obtained . in other words , the biprism 10 must be arranged such that the normal vector a 2 of the transparent film 10d is inclined with respect to the optical axis within the junction plane ( x - y axis plane ) of the semiconductor laser 1 . if the prisms 10a and 10b comprise sf11 prisms having vertex angles (= inclined angles ) u p θ = 45 ° and a refractive index n h = 1 . 766 ( λ = 780 nm ), and the transparent film 10d is formed by electron beam deposition of a deposition glass having a refractive index n l = 1 . 52 to a thickness of t 2 = 0 . 03 mm ( including the thickness of an adhesive having the same refractive index ), the maximum astigmatism a s2 which may be corrected may be calculated from relation ( 3 ) above to be 18 . 6 μm . the small spot formed on the reading surface of the optical disc 8 by the objective lens 7 becomes substantially circular since the astigmatism has been corrected . furthermore , since the translucent reflecting film 10f is deposited on the inclined surface 10e of the prism , the surface precision of the reflecting surface of the translucent reflecting film 10f remains high , thereby providing desired otf characteristics . since the biprism 10 provides the function of correcting the astigmatism and also the function of beam splitting , desired otf characteristics may be obtained without requiring an increase in the number of parts involved . in the first embodiment described earlier , it is also possible to provide desired otf characteristics without requiring an increase in the number of parts involved by coating a deposition film on one surface of the plane - parallel glass body 4 to provide the beam splitting function . however , if u p1 = 45 ° and n 1 = 1 . 5 , the thickness t 1 required for generating a correcting astigmatism of 20 μm is calculated by relation ( 1 ) to be : if a translucent reflecting film or a polarization reflecting film is deposited on such a thin plane - parallel glass body 4 , the surface of the glass body 4 may be bent upon deposition of the film . this results in a large astigmatism and coma on the reflecting wave front , which impairs detection of the focus error signals and does not provide desired otf characteristics . in other words , reproduction fidelity of the data signals may be impaired . in the second embodiment , the transparent film 10d as the plane - parallel layer is deposited on the inclined surface 10c of one prism 10d . therefore , unlike the case of the plane - parallel glass body 4 of the first embodiment , polishing and cleaning are not required , resulting in low manufacturing cost . in the second embodiment , the biprism 10 is arranged in the optical path of the diverging light rays . however , as in the case of the first embodiment , the biprism 10 may be disposed in the optical path of the focused light rays , for example , between the objective lens 7 and the reading surface of the optical disc 8 . a polarization reflecting film may be deposited in place of the translucent reflecting film 10f . in this case , a 1 / 4 wave plate or the like must be arranged in the optical path of the light rays . in the first and second embodiments described above , the semiconductor laser 1 is a heterojunction semiconductor laser of the gain guiding type . however , the present invention may be similarly applied to any semiconductor laser which has different focal points in the junction plane and in a plane perpendicular thereto , to generate an astigmatism . it is noted that the present invention may also be similarly applied to distance measuring devices , object movement measuring devices , data recording devices ( master optical audio or video disc recording devices or the like ), data transmission devices , and the like .
| 6 |
embodying the principles of the present invention is a system comprising a pyrolysis unit having concentric , or generally concentric , intercommunicating chambers in which biomass is pyrolysized to recover bio - oil and other products . a preferred embodiment of the system is depicted in fig1 - 4 and designated generally by reference numeral 10 . referring now to fig1 , the concentric - chambered pyrolysis system 10 includes a biomass feed bin 20 for receiving and delivering biomass 12 that is to be pyrolysized . the biomass feed bin 20 is generally enclosed to provide greater control over the channeling of exhaust 18 ( shown as an arrow ) from pyrolytic reactions that is fed into the feed bin 20 , as described below with reference to fig1 . the biomass 12 is fed through a top 21 of the feed bin 20 using a rotary air lock 70 . the biomass 12 is delivered from the feed bin 20 by an auger 68 attached to a lower portion 22 of the biomass feed bin 20 , as described below with reference to fig1 and 2 . in this way , the biomass feed bin 20 continually cycles new biomass 12 through the system 10 . continuing with fig1 , the biomass feed bin 20 accepts raw biomass 12 . the present embodiment envisions receiving this biomass 12 primarily from sawmills , particularly chip and saw facilities . the biomass 12 will typically not need to be ground to a smaller size because it will already be of a size suitable for use in the system 10 . if the biomass 12 does need to be ground , however , the biomass 12 will be ground prior to placing the biomass 12 in the biomass feed bin 20 . note that in the present embodiment , an optimal size for particles of biomass 12 used in the concentric - chambered pyrolysis system 10 are envisioned to be particles 12 having no side generally greater than one - quarter inch in length . in alternate embodiments , however , items of biomass 12 having substantially larger dimensions are possible . note also that in the present embodiment , items of biomass 12 are envisioned to consist generally of wood chips , sawdust , bark , wood shavings , and the like . note further that in alternate embodiments , the use of biomass 12 of varying types received from numerous different sources is possible . note in addition that in other alternate embodiments , carbonizable material other than just biomass can be used as input to the system 10 . still referring to fig1 , some biomass 12 fed into the system 10 might require drying prior to undergoing pyrolysis . biomass 12 with a moisture content of approximately fifteen percent or less by weight can be subjected to pyrolysis without prior drying . green biomass 12 , however , will generally have a moisture content of about fifty percent by weight , as opposed to dry biomass 12 that generally will have a moisture content of about ten percent . the green biomass 12 can be blended with the drier biomass 12 to achieve a combined moisture content of fifteen percent or less . if such blending of the biomass 12 is insufficient to achieve a fifteen percent moisture content by weight , then the biomass 12 will need to be dried prior to subjecting the biomass 12 to pyrolysis . optimally , the biomass 12 subjected to pyrolysis will have a moisture content of no more than twelve percent by weight . note that in some cases the biomass 12 could be too dry , in which case moisture might need to be added . referring now to fig2 , the concentric - chambered pyrolysis system 10 also includes a pyrolysis unit 30 . the pyrolysis unit 30 is made up of a burn enclosure 44 , an igniter 49 , a combustion chamber 31 , an inner pyrolysis chamber 35 , and an outer pyrolysis chamber 39 . the burn enclosure 44 is in the general shape of an elongated tube open at opposing ends 45 . a fuel - air input duct 74 is attached to the end 45 of a forward portion 46 of the burn enclosure 44 , while the igniter 49 is attached proximate to the end 45 of the forward portion 46 . insulation 72 ( see fig1 ) is installed around the burn enclosure 44 to reduce the amount of heat lost to the surrounding environment . continuing with fig2 , the combustion chamber 31 , the inner pyrolysis chamber 35 , and the outer pyrolysis chamber 39 are each also in the general shape of an elongated tube , with the three chambers 31 , 35 , 39 arranged generally concentrically . the combustion chamber 31 is innermost , the inner pyrolysis chamber 35 surrounds the combustion chamber 31 , and the outer pyrolysis chamber 39 is outermost , surrounding both the combustion chamber 31 and the inner pyrolysis chamber 35 . an end 45 of a rearward portion 47 of the burn enclosure 44 is connected to a proximate end 32 of the combustion chamber 31 , while an opposing distal end 32 of the combustion chamber 31 extends into but is not attached to a proximate end 36 of the inner pyrolysis chamber 35 . an opposing distal end 36 of the inner pyrolysis chamber 35 extends into but is not attached to a proximate end 40 of the outer pyrolysis chamber 39 . regarding fig2 , note that in alternate embodiments it is possible for a pyrolysis unit 30 to comprise as few as two chambers , for example a combustion chamber 31 and a pyrolysis chamber . in other alternate embodiments , it is possible that a pyrolysis unit 30 will have additional chambers , for example chambers in addition to a combustion chamber 31 , an inner pyrolysis chamber 35 , and an outer pyrolysis chamber 39 . note also that the inventor recognizes that chambers of a pyrolysis unit can be arranged in a generally eccentric configuration , as opposed to a generally concentric configuration , even though it is likely that the eccentric configuration would be less efficient . referring now to fig3 , each of the three chambers 31 , 35 , 39 of the pyrolysis unit 30 shares a wall 33 , 37 with one other chamber 31 , 35 , 39 . a common wall 33 forms the wall 33 of the combustion chamber 31 as well as the inner wall 33 of the inner pyrolysis chamber 35 . another common wall 37 forms the outer wall 37 of the inner pyrolysis chamber 35 and also the inner wall 37 of the outer pyrolysis chamber 39 . in this way , the three chambers 31 , 35 , 39 function as a heat exchanger , promoting heat transfer in three ways . first , conductive heat transfer through the common walls 33 , 37 of the chambers 31 , 35 , 39 . second , concurrent flow heat transfer is effected by the combusted gas stream 28 , 29 ( shown as arrows in fig2 ) and char 14 to the biomass undergoing pyrolysis , as described below with reference to fig1 and 2 . third , countercurrent flow heat transfer is effected by the gas stream 28 , 29 flowing throughout the chambers 31 , 35 , 39 . insulation 72 ( see fig1 ) is installed adjacent an interior surface 42 ( see fig2 ) of an outer wall 41 of the pyrolysis unit 30 to reduce the amount of heat lost to the surrounding environment . note that the generally concentric configuration of the pyrolysis unit 30 allows for reuse of heat that would otherwise be lost to the surrounding environment through an outer wall of a single - chambered pyrolysis unit . referring now to fig1 , fuel 17 ( shown as an arrow ), along with outside air 16 ( shown as an arrow ) propelled by a blower 66 , are introduced into the burn enclosure 44 under pressure through the fuel - air input duct 74 . combustion of the fuel - air 17 , 16 mixture produces heat and removes oxygen from the burn enclosure 44 and the attached combustion chamber 31 . note that a variety of fuels 17 can be used for this purpose , such as fuel oil or bio - oil 15 . continuing with fig1 , the char 14 along with air 16 are also introduced into the burn enclosure 44 . the air 16 need not necessarily be preheated . the char 14 is fed from a char bin 24 by a first auger 68 attached to a middle portion 25 of the char bin 24 . the first auger 68 conveys the char 14 out of the char bin 24 and into a proximate rotary air lock 70 . a second auger 68 receives the char 14 from the rotary air lock 70 and delivers the char 14 into a char - air input duct 78 that leads into the burn enclosure 44 . the preheated air 16 comes from a cooling duct 83 ( see fig4 ) of a cyclone separator 80 that is used to separate entrained char 14 from the exhaust 18 ( shown as an arrow ) of previous pyrolytic reactions , as described below with reference to fig4 . the cooling duct 83 connects to the char - air input duct 78 to convey the preheated air 16 to the burn enclosure 44 . an end of the char - air input duct 78 is attached to a top 48 of the burn enclosure 44 . the char - air 14 , 16 mixture exits the end of the duct 78 and enters the burn enclosure 44 through the top 48 . note that a key function of the char - air 14 , 16 mixture is to burn off any excess oxygen that would otherwise remain in the burn enclosure 44 and combustion chamber 31 following combustion of the fuel - air 17 , 16 mixture . still referring to fig1 , the igniter 49 ignites the fuel - air 17 , 16 mixture . the ignited fuel - air 17 , 16 mixture , in turn , ignites the char - air 14 , 16 mixture . combustion begins generally in the burn enclosure 44 and continues into the combustion chamber 31 where the fuel - air 17 , 16 and char - air 14 , 16 mixtures are substantially fully combusted . note that although it is preferable that all of the oxygen remaining in the burn enclosure 44 and combustion chamber 31 be consumed , it is not required . note also that feeding of the fuel - air 17 , 16 and char - air 14 , 16 mixtures , along with ignition of the mixtures , is done in a continual sequence during system 10 operation . continuing with fig1 , to burn off any excess oxygen that would otherwise remain in the burn enclosure 44 and combustion chamber 31 following ignition of the fuel - air 17 , 16 mixture requires that a certain minimum amount of char 14 be present in the burn enclosure 44 . during typical system 10 operation , however , more than this minimum amount of char 14 is introduced into the burn enclosure 44 . this results in excess char 14 being present in the combustion chamber 31 following combustion of the fuel - air 17 , 16 and char - air 14 , 16 mixtures . individual particles of this excess char 14 are greatly heated by the combustive reaction . these particles of excess char 14 radiate heat to their surroundings as the char 14 travels through the combustion 31 , inner pyrolysis 35 , and outer pyrolysis chambers 39 . eventually , the excess char 14 becomes entrained within exhaust 18 of a new pyrolysis reaction , with the excess char 14 mixing with newly - pyrolysized char 14 , as described below with reference to fig1 and 2 . note that in alternate embodiments , a gas turbine can be used as a combustion source for providing heat and deoxygenation in addition to , or in place of , a burn enclosure 44 . referring now to fig2 , the substantially deoxygenated , continuous heated gas stream 28 , 29 ( shown as arrows ) produced from the continual combustion of the fuel - air 17 , 16 and char - air 14 , 16 mixtures ( see fig1 ) flows out of the rearward portion 47 of the burn enclosure 44 and throughout the combustion chamber 31 . the continual production of the heated gas stream 28 , 29 from the burn enclosure 44 and the combustion chamber 31 , together with an impetus provided by injection of the fuel - air 17 , 16 mixture into the burn enclosure 44 under pressure , propels the heated gas stream 28 , 29 in a first direction 28 through the combustion chamber 31 and into the inner pyrolysis chamber 35 . in the inner pyrolysis chamber 35 , the heated gas stream 28 , 29 changes to a second direction 29 that is opposite to that of the first direction 28 of the stream 28 , 29 through the combustion chamber 31 . the heated gas stream 28 , 29 exits the distal end 36 of the inner pyrolysis chamber and enters the outer pyrolysis chamber 39 . in the outer pyrolysis chamber 39 , the stream 28 , 29 changes back to the first direction 28 , which is opposite to that of the second direction 29 of the stream 28 , 29 through the inner pyrolysis chamber 35 . continuing with fig2 , in addition to heat radiating from the flow of the heated gas stream 28 , 29 through the pyrolysis unit 30 , heat from the heated gas stream 28 , 29 is also conducted among the three generally concentric chambers 31 , 35 , 39 through the common walls 33 , 37 of the three chambers 31 , 35 , 39 . in this way , the chambers 31 , 35 , 39 operate as a countercurrent flow heat exchanger . note that the temperature of the combustion chamber 31 during operation of the system 10 is typically in excess of six - hundred - fifty degrees celsius . referring now to fig1 and 2 , biomass 12 ( see fig1 ) is fed from the biomass feed bin 20 ( see fig1 ) by the auger 68 ( see fig1 ) attached to the lower portion 22 ( see fig1 ) of the biomass feed bin 20 . the auger 68 conveys the biomass 12 out of the feed bin 20 and into a proximate rotary air lock 70 ( see fig1 ). the rotary air lock 70 , in turn , introduces the biomass 12 into the pyrolysis unit 30 at the distal end 32 ( see fig2 ) of the combustion chamber 31 , where the combustion chamber 31 is in communication with the proximate end 36 ( see fig2 ) of the inner pyrolysis chamber 35 . continuing with fig1 and 2 , the continuous heated gas stream 28 , 29 ( shown as arrows in fig2 ) captures the biomass 12 in its flow and carries the biomass 12 along through the inner pyrolysis chamber 35 toward the distal end 36 ( see fig2 ) of the inner pyrolysis chamber 35 , opposite the proximate end 36 of the inner pyrolysis chamber 35 where the biomass 12 entered . as the heated gas stream 28 , 29 moves the biomass 12 along , heat radiating from the stream 28 , 29 fast pyrolysizes the biomass 12 . ( optimally , pyrolysis of a particle of biomass 12 takes no more than two seconds .) exhaust 18 ( shown as an arrow ) resulting from the pyrolytic reaction comprises primarily non - condensing gases ( not shown ), bio - oil vapor ( bio - oil not shown in vapor form ), and entrained char 14 ( see fig1 ). note that the non - condensing gases are substantially made up of carbon dioxide , carbon monoxide , and nitrogen . note also that the entrained char 14 might include excess , non - combusted char 14 from the char - air 14 , 16 mixture ( see fig1 ) that was introduced into the burn enclosure 44 , as described above with reference to fig1 . note further that in alternate embodiments , various forms of inert material might be employed to assist in the transfer of heat to biomass that is to be pyrolysized . still referring to fig1 and 2 , the exhaust 18 from the pyrolytic reaction , along with any remaining non - pyrolysized biomass 12 , reaches the distal end 36 of the inner pyrolysis chamber 35 , where the inner pyrolysis chamber 35 communicates with the proximate end 40 ( see fig2 ) of the outer pyrolysis chamber 39 . as the exhaust 18 and remaining biomass 12 enter the outer pyrolysis chamber 39 , the exhaust 18 and remaining biomass 12 change from flowing in the second direction 29 ( see fig2 ) to flowing in the first direction 28 ( see fig2 ) opposite to that of the second direction 29 . as the remaining non - pyrolysized biomass 12 is swept through the outer pyrolysis chamber 39 , the remaining biomass 12 is fast pyrolysized by heat from the gas stream 28 , 29 . exhaust 18 from this pyrolytic reaction combines with the existing exhaust 18 in the outer pyrolysis chamber 39 . note that in some instances it is possible that a small quantity of oxygen will remain in one or both of the pyrolysis chambers 35 , 39 at the time of pyrolysis . in this event , a small amount of the biomass 12 will react with the oxygen and combust rather than pyrolysize . this limited amount of combustion does not present a significant problem , although it might reduce the efficiency or yield of the pyrolysis unit 30 somewhat . continuing with fig1 and 2 , an exhaust duct 54 is fitted to the pyrolysis unit 30 proximate the distal end 40 ( see fig2 ) of the outer pyrolysis chamber 39 , opposite the proximate end 40 of the outer pyrolysis chamber 39 where the outer pyrolysis chamber 39 communicates with the inner pyrolysis chamber 35 . the exhaust 18 exits the outer pyrolysis chamber 39 and rises along the exhaust duct 54 . the exhaust duct 54 leads from the pyrolysis unit 30 and attaches to the cyclone separator 80 ( see fig1 ), as described below with reference to fig4 . referring now to fig4 , the cyclone separator 80 comprises a body 84 with a collection cone portion 86 , a central exhaust pipe 81 , an inflow pipe 82 , and the cooling duct 83 . the collection cone portion 86 is in the general shape of a cone having an upwardly facing mouth 87 and an opposing open end 88 for collecting and distributing char 14 separated from the exhaust 18 ( shown as an arrow ) of pyrolysis reactions . the exhaust pipe 81 resides in the approximate center of the body 84 with the collection cone portion 86 located beneath a lower end of the exhaust pipe 81 . the exhaust pipe 81 is used for carrying the exhaust 18 out of the cyclone separator 80 following separation of the entrained char 14 from the exhaust 18 . the inflow pipe 82 and cooling duct 83 are aligned parallel with each other and share a common wall 85 , with the inflow pipe 82 located inwardly of the cooling duct 83 . the common wall 85 promotes heat transfer from the exhaust 18 in the inflow pipe 82 to the cooler air 16 in the cooling duct 83 . the inflow pipe 82 and cooling duct 83 spiral downwardly together around the central exhaust pipe 81 , beginning near an upper portion 89 of the exhaust pipe 81 and descending to a point just above the mouth 87 of the collection cone portion 86 . continuing with fig4 , the exhaust duct 54 ( see fig1 ) connects to an end of the inflow pipe 82 that is near the upper portion 89 of the central exhaust pipe 81 . the cyclone separator 80 draws the exhaust 18 downwardly through the inflow pipe 82 toward the mouth 87 of the collection cone portion 86 . a blower 66 ( see fig1 ) is attached to an end of the cooling duct 83 that is near the mouth 87 of the collection cone portion 86 . the blower 66 forces outside air 16 ( shown as an arrow ) upwardly through the cooling duct 83 . the cooler outside air 16 inside the cooling duct 83 absorbs some of the heat of the hotter exhaust 18 inside the inflow pipe 82 through the common wall 85 between the inflow pipe 82 and the cooling duct 83 , thereby heating the air 16 and cooling the exhaust 18 . the char - air input duct 78 ( see fig1 ) connects to an opposing end of the cooling duct 83 that is near the upper portion 89 of the exhaust pipe 81 . the now - heated air 16 flows through the char - air input duct 78 until the air 16 is eventually vented into the burn enclosure 44 along with the char 14 to be combusted , as described above with reference to fig1 . note that in alternate embodiments , preheated air 16 from a cooling duct 83 is routed to a fuel - air input duct 74 or to both a char - air input duct 78 and a fuel - air input duct 74 . still referring to fig4 , as the exhaust 18 spirals downwardly through the inflow pipe 82 toward the mouth 87 of the collection cone portion 86 , centrifugal force drives the particles of char 14 entrained within the exhaust 18 toward the common wall 85 between the inflow pipe 82 and the cooling duct 83 . as the particles of char 14 exit the end of the inflow pipe 82 , the char 14 falls into the mouth 87 of the collection cone portion 86 and exits the open end 88 of the collection cone portion 86 . connected to the open end 88 is a rotary air lock 70 ( see fig1 ). the rotary air lock 70 feeds the char 14 into the char bin 24 ( see fig1 ). continuing with fig4 , a given amount of the char 14 from the char bin 24 will be fed into the burn enclosure 44 , as described above with reference to fig1 . since the char bin 24 is continually filling with char 14 from the cyclone separator 80 , it is possible that some amount of the char 14 will also need to be removed from the char bin 24 to keep the char bin 24 from overflowing . this excess char 14 is removed as an end product of the system 10 . still referring to fig4 , at this point substantially all of the char 14 will have been removed from the exhaust 18 . the substantially char - free exhaust 18 now principally comprises non - condensing gases ( not shown ) and bio - oil vapor ( bio - oil not shown in vapor form ). this generally char - free exhaust 18 flowing from the end of the inflow pipe 82 rises and exits the cyclone separator 80 through an end of the upper portion 89 of the central exhaust pipe 81 and enters a second exhaust duct 56 ( see fig1 ) attached to the end of the upper portion 89 . referring now to fig1 , the exhaust duct 56 transports the exhaust 18 ( shown as an arrow ) through a bio - oil condensing system 62 that cools the exhaust 18 to a temperature of below one - hundred degrees celsius . at this temperature , substantially all of the bio - oil vapor ( bio - oil not shown in vapor form ) condenses out of the exhaust 18 while the non - condensing gases ( not shown ) in the exhaust 18 remain in a gaseous state . the exhaust duct 56 leads from the bio - oil condensing system 62 to a bio - oil storage tank 52 . the now - liquid bio - oil 15 and the bio - oil - free exhaust 18 empty into the bio - oil storage tank 52 . the liquid bio - oil 15 collects in the storage tank 52 and is dispensed from the tank 52 as an end product of the system 10 . continuing with fig1 , a third exhaust duct 58 leads from the bio - oil storage tank 52 to the biomass feed bin 20 . the biomass feed bin 20 is generally enclosed to provide greater control over the channeling of the exhaust 18 fed into the feed bin 20 , as described above with reference to fig1 . the exhaust 18 leaves the third exhaust duct 58 and passes through the biomass feed bin 20 . the biomass 12 in the feed bin 20 acts as a filter for the exhaust 18 , filtering out of the exhaust 18 any liquid or solid matter still entrained . the non - condensing gases of the exhaust 18 then exit the biomass feed bin 20 through an exhaust vent 60 leading to the outer environment . note that in alternate embodiments , an exhaust vent 60 is attached to a char - air input duct 78 to channel a portion of the cleansed non - condensing gases exiting a biomass feed bin 20 into a burn enclosure 44 to join char 14 that is to be combusted , as described above with reference to fig1 . fig5 depicts a second preferred embodiment of a concentric - chambered pyrolysis system , designated generally by reference numeral 110 , in accordance with the present invention . in the present embodiment , substantially an entire amount of char 14 produced from pyrolytic reactions in a pyrolysis unit 30 is fed back into the system 110 to help fuel further pyrolytic reactions . referring now to fig5 , as particles of char 14 ( see fig4 ) exit an open end 88 of a collection cone portion 86 of a cyclone separator 80 , the char 14 enters a rotary air lock 70 attached to the open end 88 . the rotary air lock 70 feeds the char 14 directly into a char feed duct 123 . the char feed duct 123 leads to a char - air input duct 78 . the char - air input duct 78 , in turn , leads to a burn enclosure 44 of a pyrolysis unit 30 . in this way , virtually all of the char 14 produced from pyrolysized biomass 12 is fed back into the system 110 and used to power further fast pyrolytic reactions . additional fuel 17 ( shown as an arrow ), such as fuel oil or bio - oil 15 , is added to the burn enclosure 44 as needed to ensure the system 110 continues to effect efficient fast pyrolytic reactions . regarding fig5 , note that unlike the concentric - chambered pyrolysis system 10 of the first preferred embodiment ( see fig1 - 4 ), the system 110 of the present embodiment does not require a char bin 24 or augers 68 to convey char 14 from the char bin 24 to the char - air input duct 78 . while the invention has been described with respect to certain specific embodiments , it will be appreciated that many modifications and changes may be made by those skilled in the art without departing from the spirit of the invention . it is intended , therefore , that the appended claims cover all such modifications and changes as fall within the true spirit and scope of the invention .
| 2 |
fig1 shows an exploded view of a connector 20 including the pull - to - release in - plane latch of the present invention . connector 20 includes at least one of housing members 22 , 24 , contacts 26 securable in a housing member and at least one latch 28 , 30 . when connector 20 is a shielded connector , such shielding elements as lower backshell 32 , upper backshell 34 and connector front shell 36 may be included . outer boot 38 provides a latch actuation means . inner boot 40 covers the rear portion of the lower and upper backshells at the cable egress and envelopes the cable 44 which may be shielded , the individual conductors 46 of which are terminated to respective contacts 26 in any known manner . in the preferred embodiment , conductors 46 are terminated to contacts 26 by any suitable method known in the art . contacts 26 are secured in housing members 22 and 24 . inner boot 38 is passed over the end of a prepared cable 46 to which the connector will be terminated ; the cable does not form part of the connector . conductors 46 are terminated through respective ones of contacts 26 . lower and upper backshells 32 and 34 are hingedly secured to front shell 36 with tabs 48 received in respective apertures 50 , such as in accordance with the teaching of u . s . pat . no . 4 , 585 , 292 or u . s . patent application ser . no . 766 , 984 filed sep . 27 , 1991 , the disclosures of which are hereby incorporated by reference . housing members 22 and 24 are positioned in lower and upper backshells 32 and 34 with mating portions 52 of contacts 26 extending forwardly to within front shell 36 . cable 44 is positioned to exit through cable egress 54 in lower and upper backshells 32 and 34 . as lower and upper backshells 32 and 34 are hingedly pivoted toward each other , sidewalls of one of the backshells will typically be received between or inside sidewalls of the other backshell . in the preferred embodiment , the sidewalls of the upper backshell 34 are received between the sidewalls of lower backshell 32 . alternatively , the sidewalls could alternate if the backshells were hermaphroditic or the edges of the backshells could abut as disclosed in u . s . pat . no . 4 , 689 , 723 , the disclosure of which is hereby incorporated by reference . tabs 56 of lower backshell 32 are crimped into recess 58 on upper backshell 34 to secure the two backshells together with the cable 44 , including cable shielding if present , clamped securely therebetween , as taught by u . s . patent application ser . no . 662 , 587 filed feb . 28 , 1991 , the disclosure of which is hereby incorporated by reference . as best seen in the partial side perspective view of fig2 sidewall 60 of upper shell 34 is received inside sidewall 62 of lower shell 32 . near the rear of sidewall 62 a latch spring retention member 64 , comprising a portion of sidewall 62 , is formed outwardly to be normal to sidewall 62 . retention member 64 has a spring receiving aperture 66 therein sized to receive a spring portion of latch 28 or 30 . a boot slide position limit aperture 70 is also formed in sidewall 62 . aperture 70 defines rearward facing forward stop surface 72 and forward facing rearward stop surface 74 . rearward stop surface 74 , in the preferred embodiment , is formed by displacing a portion of sidewall 62 outwardly normal to sidewall 62 in the process of forming aperture 70 . the function of aperture 70 and stop surfaces 72 , 74 will be discussed in greater detail below . latch pivot member 80 formed in sidewall 62 is also positioned near the front shell . latch pivot member 80 , in the preferred embodiment , is stamped from sidewall 62 then formed outwardly to be normal thereto . latch pivot member 80 has a base 82 providing a pivot section 84 cooperable with an aperture on the latch having a diameter slightly greater than dimension 86 to permit the latch to rotate thereabout . two spaced arcuate latch retention members 88 extend base 82 beyond the distance 86 to provide a distance 90 between sidewall 62 and the latch retention members . distance 90 is slightly greater than the thickness of latch 28 or 30 . the latch retention members provide retention for a latch once it is positioned on latch pivot member 80 . latches 28 and 30 are identical and therefore only one will be described in detail . a side view of latch 28 is shown in fig4 and a perspective view , mounted on a lower backshell 32 , is shown in fig5 . latch 28 in the preferred embodiment is stamped from steel , but other materials and methods of formation are within the scope of the invention . latch 28 has a rearwardly extending spring member 98 , an upwardly extending cam arm 100 , a forwardly extending latch arm 102 and a central aperture 104 . the distal end of spring member 98 is receivable in aperture 66 of spring retention member 64 as best seen in fig5 . in a preferred embodiment , spring member 98 is in the same plane as latch arm 102 . the distal end of spring member 98 , in the preferred embodiment , is slidable within aperture 66 . cam arm 100 provides a forwardly facing cam surface 106 the function of which will be described below . latch arm 102 extends forwardly along side and spaced from front shell 36 . extending downwardly and rearwardly from the forward end is a lead - in surface 108 extending from above the plane of latch limit surface 110 to a latch protrusion 112 which extends below latch limit surface 110 . the rear surface 114 of latch protrusion 112 can take on any angle from an acute angle ( fig4 ) relative to surface 110 which provides a reverse angle as shown in phantom in fig4 to being perpendicular to surface 110 , to an oblique angle with respect to surface 110 as shown in fig4 and 5 . the angle of rear surface 114 can be varied to achieve a desired threshold retention force such that when the cable 44 is pulled with a force up to the threshold , connector 20 will remain latched , however , when the force exceeds the thrush hold the latch will yield and connector will be unlatched . front shell 36 may have laterally extending polarization protrusions 116 forward of latch arm 102 , as best seen in fig5 . polarization protrusions 116 extend laterally beyond front shell 36 to prevent connector 20 from being receivable in aperture 122 upside down . polarization protrusions 116 thus assure that connector 20 is oriented correctly before passing through aperture 122 for mating with connector 118 . in this manner , the polarization protrusions protect the latch arms 102 by preventing a condition in which the latch arms could engage or stub against the panel if connector were not properly oriented for reception in aperture 122 . fig6 shows a top sectional view of a connector 20 having a pair of latches 28 , 30 . latches 28 and 30 function independently of each other . latches 28 and 30 may be actuated by a common actuation mechanism , such as outer boot 38 . connector 20 is aligned to be mated with a complimentary connector 118 through panel 120 and aperture 122 therein . complimentary connector 118 is mounted on panel 120 having aperture 122 to receive a forward portion of connector 20 , such as front shell 36 , and latch engaging surfaces 124 , 126 . as best seen in fig7 and 8 , outer boot 38 includes a tapered stop 130 extending inwardly from mirror image opposed inside walls 132 . tapered stop 130 extends toward the opposed inside wall from surface 134 thereby defining a forward facing forward stop surface 136 . at the rear of tapered stop 130 where stop 130 blends into surface 134 , an offset in the inside wall 32 forms a rearward facing rearward stop surface 138 . channels 140 accommodate latch arms 102 and the pivoting motion thereof . as best seen in fig8 and 10 , the distal end of cam arm 100 is received in a channel 140 on the inside upper surface of outer boot 38 . the forward end of channel 140 terminates in a rearward facing surface 142 that engages cam surface 106 when outer boot 38 is positioned over the subassembly shown in fig5 . connector 20 is assembled in the manner described above . in the assembly process , the sidewalls of outer boot 38 expand outwardly as outer boot 38 approaches the final position on the assembly shown in fig6 until tapered stop 130 is received in boot slide position limit aperture 70 , whereupon the sidewalls of outer boot 38 resile inwardly . inner boot 40 may be pushed forward along cable 44 and secured in position in any known manner either after or , preferably , before outer boot 38 is positioned over the subassembly shown in fig5 . fig1 shows a connector 20 , partly in cross section , terminated to conductors of a cable 44 , mated with a complimentary connector 118 and latched to a panel 120 . outer boot 38 is in the forward position with rearward surface 142 engaging cam surface 106 . spring member 98 is in a de - energized state . this is the position latch 28 and boot 38 assume when connector 20 is mated with complimentary connector 118 and with connector 20 latched to panel 120 , or when a connector 20 is unmated and free of panel 120 . fig1 is a top view of connector 20 , terminated to conductors of a cable , with outer boot 38 in the same position as in fig1 . with outer boot 38 in the forward latched or released position , forward stop surface 136 of tapered stop 130 engages stop surface 72 , on both sides of connector 20 , to secure outer boot 38 on connector 20 and to prevent outer boot 38 from sliding off of the subassembly shown in fig5 . as depicted in fig1 and 13 , outer boot 38 has been moved or pulled rearward as indicated by arrow 150 . in moving rearward , outer boot 38 moves axially along sub - assembly 68 , or connector 20 , through a limited distance , away from the mating face of connector 20 . outer boot 38 is utilized as a latch actuation during a pull - to - release operation and also may be used prior to mating connectors 20 and 118 to pivot latch arm 102 clear of panel 120 . as boot 38 is slid rearward over subassembly 68 , surface 142 presses on cam surface 106 causing cam arm 100 and latch arm 102 to rotate about pivot aperture 104 and latch pivot member 80 clockwise ( as shown in fig1 ) as indicated by arrow 152 . due to the rotation of a portion of latch 28 , spring member 98 is energized or biased . in addition , latch limit surface 110 and latch protrusion 112 are rotated away from respective latch engaging surfaces 124 or 126 . the distal end of latch protrusion 124 rotates to a position above latch engaging surfaces 124 or 126 so that connector 20 can be unmated from complimentary connector 118 . as best seen in fig1 , the travel of inner boot 38 is limited . with inner boot 38 in the rearmost position , rearward stop surface 138 engages rearward stop surface 74 limiting the rearward movement of boot 38 . when inner boot 38 is released from the position shown in fig1 and 13 , the energy stored in spring member 98 rotates latch arm 102 and cam arm 100 , counterclockwise as shown in fig1 , such that latch arm 102 latches to panel 120 if proximate thereto and concomitantly causes outer boot 38 to slide forward toward the mating face of connector 20 . while outer boot 38 may be pulled rearward to pivot latch arm 102 of latches 28 and 30 , and specifically latch protrusion 112 , above latch engaging surfaces 124 , 126 as connector 20 is being mated with connector 118 , similar to when the connectors are being unmated , it is not necessary . connector 20 , properly oriented , can be aligned with aperture 122 and connector 118 for mating . connector 20 may be held by boot 38 . connector 20 is then moved toward aperture 122 and connector 118 . as the leading edge of front shell 36 passes into and through aperture 122 , lead - in surfaces 108 on latches 28 , 30 engage latch engaging surfaces 124 , 126 respectively . as connector 20 continues moving toward connector 118 , surfaces 108 ride up , causing the latch arms and cam arms to rotate and concomitantly spring member 98 to energize , until the distal ends of respective latch protrusions 112 ride over latch engaging surfaces 124 , 126 . continued movement of connector 20 will permit rear surfaces 114 to ride down latch engaging surfaces 124 , 126 as spring member 98 releases energy and causes the latch arms and cam arms to rotate in the opposite direction . this continues until latch limit surface 110 is seated against respective latch engaging surfaces 124 , 126 , thereby latching connector 20 to panel 120 with connectors 20 and 118 mated . fig1 shows a perspective view of connector 20 properly oriented to be received in aperture 122 to mate with complimentary connector 118 and to latch to panel 120 with connector 20 mated to connector 118 . while the preferred embodiment discloses a pull - to - release in - plane latch wherein the latch is secured to a shield member , the invention can be used with an unshielded connector . the latch could be pivotally mounted or secured on a non - shielding housing member . in addition , while the preferred embodiment discloses a pull - to - release in - plane latch that latches to a panel adjacent to which the mating connector is mounted , the latch could latch onto structure of a mating connector of appropriate design . although the spring member is shown as having a distal end slidable in an aperture in the preferred embodiment , it is recognized that other spring configurations could have a distal end that is secured .
| 7 |
the present invention overcomes the prior art limitations and provides a concealed elevated irrigation system . turning to fig1 , the system of the present invention generally installs upon a lawn or proximate a garden , either flower or vegetable . the system has a plurality of upright slats s contained within two mutually parallel and spaced apart rails r . the rails then secure upon posts 2 of the present invention . though slats and rails are shown , the posts may stand alone in a landscape , as columns or pillars , as shown in later figures . in fig1 , the left post 2 a receives irrigation water from an underground line u . the line u connects directly to the bottom of the post . opposite the left post , fig1 shows a right post 2 b that has its irrigation water delivered by a hose h or other temporary water supply . both the underground line u and the hose h supply irrigation water into the posts 2 for delivery by the present invention to the nearby landscape . additionally , the present invention includes a low pressure drain valve , or sometimes called a king &# 39 ; s valve , in the underground line u or the hose h before the post . the low pressure drain valve releases water from the system when the water supply is ceased as during maintenance or cold weather shutdown of the system . the low pressure drain valve can also be located proximate a backflow prevention device as further protection for the water supply system . in an alternate embodiment , the upper of the rails r includes a lateral line 9 a that conveys water between two posts 2 . the posts 2 are generally embedded within a horizontal surface , or ground g , beneath the lower of the rails r . each post has a top 3 generally locating opposite the ground . the top has a centered opening that receives a water dispensing fitting , here a rotor 4 on the left post 2 a and a sprayhead 5 on the right post 2 b . each fitting receives the water supplied to the invention and dispenses the water outwardly from the post as directed by the user . each post is generally elongated and slender to blend into the landscape architecture . to avoid nearby shrubbery and maximize the range of water dispensed by the fittings , each post locates a water dispensing fitting at least three feet above the nearby ground surface . the range of the water dispensed from a head remains governed by projectile motion . as the head is elevated , the range increases as the water dispensed falls back to the ground at an elevation below the sprinkler . the range , r , of the water is determined by a solution for time , t , in the following equations : where the maximum range governed by the pressure and angle of the water dispensing head is augmented by the elevation of the water dispensing head as the water descends below the water dispensing head elevation at an approximately 45 ° angle . fig2 shows a post of the present invention , generally like post 2 a . here , the post has a generally rectangular cross section with four sides though round and other cross sections are foreseen . the post is generally hollow and has a base 6 for insertion into the ground opposite the top 3 . one of the sides of the post is an interior face 7 that extends for the length of the post . near the base , the interior face has a first slot 8 that extends through the thickness of the interior face . the slot has a shape to receive a rail r as previously shown in fig1 . the slot 8 also shows the riser 9 that extends within the post from near the base upwardly to the top and its fitting 4 , 5 . the riser is generally an elongated tube secured within the post . in the preferred embodiment , the riser is formed integrally with the post on present day extrusion machinery . the riser and interior face continue upwardly from the base towards the top 3 . below the top , the interior face has a second slot 10 . the second slot also receives a rail r as previously shown . the second slot also shows the termination of the riser into the fitting 4 , 5 . in an embodiment of the invention with a single panel of slats and rails , the interior face has the first slot and the second slot locating thereon . turning the post of fig2 , fig3 shows a post of the present invention , generally like post 2 b . the post also has a generally rectangular cross section with four sides though other cross sections are anticipated such as round . the hollow post has a base 6 for insertion into the ground opposite the top 3 . opposite the interior face 7 , another side of the post is the end face 11 that extends for the length of the post . near the base , the end face has an aperture 12 with a lower connection 13 for connecting to a hose h . the aperture is generally smaller in dimension that the first slot on the interior face . the end face then continues upwardly towards the top without interruption . the end face generally has a smooth appearance visible outside of the installed embodiment . within this post and extending upwardly from the lower connection 13 , this post also has the riser 9 . the riser continues upwardly to the top and its fitting , here shown in phantom . the riser is generally an elongated tube secured within the post . in the preferred embodiment , the riser is formed integrally with the post on present day extrusion machinery . the riser and end face continue upwardly from the base towards the top 3 . in an embodiment of the invention with a single panel of slats and rails , the end face is shown outwardly of the panel of slats , presenting a clean appearance . in an alternate embodiment with multiple panels of slats , the end face has a pattern of knockouts for providing slots in similar locations as upon the interior face . thus the post can be used in a sequence of panels such as along a line of fencing . in more detail , fig4 shows the head 4 near the top 3 of a post 2 . the head rests upon the finished top and then extends into the post to approximately the slot 10 for the upper rail r . the slot is in the interior face 7 of the post and shows the head 4 connecting to the riser 9 . the head connects to the riser axially using a fitting 4 a , such as a union . the embodiment shown allows for a connection to one head only . in an alternate embodiment , the fitting is a tee that allows for a head connection and a connection to a lateral that extends through a rail to the next post . the alternate embodiment allows for usage of two heads upon a panel . in a further alternate embodiment , the fitting is a double tee that has a connection for a head and also connections for two coaxial laterals . the further alternate embodiment allows for the posts and panels to assemble into a fence where multiple posts have heads for dispensing water . in the alternate embodiments , the various heads along a line of laterals may have reduced range of dispensing water . opposite fig4 , fig5 shows the base 6 of a post 2 and its connection for a supply line u or hose h . the post has the interior face 7 and a slot 8 locating towards the base that generally receives the lower rail r . the slot shows the riser 9 extending parallel to the length of the post towards the base . at the base , the post has its generally hollow rectangular cross section . the riser connects to its fitting 6 a and the fitting extends to a lower connection 6 b that passes through an aperture in the end face 11 . turning the base , fig6 provides a view of the base 6 of a post 2 . the riser 9 descends through the post and at the base connects with a fitting 6 a here through an elbow 6 c . the fitting then positions the lower connection 6 b through the end face 11 and away from the post for connection to a hose or supply line of an irrigation system . though posts with risers have been described , the inventor anticipates that the posts and risers can be extruded simultaneously as a single unit during manufacture , particularly using plastic resins . the posts would then have integral risers for ready installation and connection . the posts may be extruded with multiple risers therein and preferably four risers within a rectangular cross section post . a round post may preferably have three risers extruded therein for stability of the post though up to four risers are also foreseen by the applicant . the present invention locates the risers within the posts primarily and alternately as laterals within the rails so that water reaches the rotors , heads , and water dispensing fittings without being seen . from the aforementioned description , a concealed elevated irrigation system has been described . this irrigation system is uniquely capable of sprinkling , or delivering water from a height above the ground while concealing the risers of water within pleasing structural elements , primarily a post . this irrigation system and its various components may be manufactured from many materials , including but not limited to , polymers , polyvinyl chloride , high density polyethylene , polypropylene , nylon , steel , ferrous and non - ferrous metals , their alloys , and composites . as such , those skilled in the art will appreciate that the conception , upon which this disclosure is based , may readily be utilized as a basis for the designing of other structures , methods and systems for carrying out the several purposes of the present invention . therefore , the claims include such equivalent constructions insofar as they do not depart from the spirit and the scope of the present invention .
| 1 |
fig1 is a block diagram illustrating the architecture of applicants &# 39 ; invention . to illustrate the most general case , in this example , the server 1 is connected to a switch 8 , other than a mobile switching center , and accesses a mobile switching center through the public switched telephone network , ( pstn ) 9 . the facility between the server and switch 8 can be an integrated services digital network ( isdn ) facility using a basic rate interface ( bri ) or primary rate interface ( pri ); advantageously , the control channel of the isdn interface can be used to transmit digital control messages . the mobile switching center 3 , then accesses a home location register 6 , a visitor location register 7 , and a cell site 10 . the cell site 10 is for communicating with a customer &# 39 ; s wireless device 2 . the mobile switching center ( msc ) includes a core switch 4 , and an interworking function ( iwf ) block 5 . the purpose of the interworking function of the msc serving the wireless device 2 is to interface with a public switched telephone network ( pstn ) signal on one side , and a wireless data signal on the other side . the wireless data signal is converted at the cell site into a digital code division multiple access ( cdma ) signal , or a digital time division multiple access ( tdma ) signal , sent by radio to the wireless device . the server 1 , switch 8 , pstn 9 , msc 3 , cell site 10 , hlr 6 , vlr 7 , and iwf 5 are all well known in the prior art . the device is similar to devices used with respect to suppressed ringing telemetry except that they do not need functions for cutting off transmission in response to an off - hook by the customer ( since they can transmit and receive while the customer is using a voice telephone ), but need the circuits required to make outgoing and / or receive incoming wireless communications . a wireless device can also be used as a gateway to access other devices identified by a sub - address in messages to and from the server . for a call from a server to a wireless device , the server sends a set - up request message 40 over an isdn connection or analog data connection to its serving switch 8 . the message has been enhanced to include a call type 41 , and an imsi 42 ( if available ), of the wireless device 2 . these parameters are passed on transparently by the switch 8 which serves the server . the called directory number 43 , which is part of every set - up request message 40 , is used by the switch to route the call over pstn 9 to msc 3 . the pstn passes message 50 to msc 3 . message 50 contains a call type 51 and the imsi 52 , which is a trigger to the msc to indicate that this is a call to a particular device rather than a conventional wireless station . msc 3 examines the parameters it has received , and it recognizes that one of the parameters is an imsi . thus , a single called directory number can be used to route multiple calls to multiple end points in the wireless network . the end points are differentiated via the unique imsi identifiers . msc 3 uses the imsi to access information about wireless device 2 via home location register ( hlr ) 6 ; it does so by sending a request message 30 , which includes the imsi 31 . the hlr which has tables for translating between an imsi and data associated with that imsi , returns its information to msc 3 . ( the hlr is required to have such translation tables in order to handle registration events originated by a wireless station ; such events do not supply a mobile device directory number , but only supply a mobile device imsi ). hlr 6 then accesses a vlr 7 to receive additional information about , for example , the location and status of the wireless device . msc 3 , ( or if necessary , another msc such as msc 12 , connected to msc 3 via the pstn , in case the wireless device 2 is not in its home location ), then pages wireless device 2 , and controls establishment of a radio connection between cell site 10 , ( or cell site 11 if msc 12 controls call ), and wireless device 2 . the wireless device receives a message 20 containing a call type 21 and the imsi for the accessed device . the call type can indicate to the device that , for example , the call is a no - ring telemetry data call , which indication can trigger a pre - defined sequences of actions , ( e . g ., supply telemetering data ). the call type also indicates to the msc that this is a no - ring call , that certain features , ( such as call waiting , call blocking ), are to be by - passed , that a different type of alerting , i . e ., to activate a device , is to be used , and that special billing procedures may be applied . if the wireless device is a mobile one , and has moved outside its home area , then in conformance with wireless standards , that device has been provided with a temporary local directory number ( tldn ), associated with the imsi of the device , by the serving vlr / msc . in accessing the hlr 6 , message 60 is used to provide the hlr with the tldn 61 , as well as the imsi 62 . the tldn is sent through the hlr to the msc 3 to route calls destined for the mobile device to the serving msc . in alternate implementations , wherein the server is not provided with the imsi of the called wireless device , the server sends a message 70 that includes a call type 71 , and a directory number 72 for that device . the hlr is then accessed using the call type and directory number which it uses to identify the destination imsi . the calling directory number can be used for billing the call , or the number to be billed can be obtained by a table look - up based on the call type and imsi . in another alternate embodiment , the server simply provides , as it does for all calls , a message 80 including a calling directory number 81 , and a called directory number 82 . the hlr 6 is queried using both calling and called directory number , and uses the combination of these two parameters to identify the imsi of the called wireless device . this embodiment allows for multiple devices , ( gas , water , etc . ), at a single location , to be accessed via one directory number without requiring the server to know or the network ( pstn ), to transport the imsi of its device . note that , in all of these cases , in contrast to the processing of normal voice calls , the final translation information required for establishing the call is provided by the hlr on the basis of the imsi of the called wireless device . fig2 is a flow diagram , illustrating the process of setting up a call in accordance with the principles of this invention . the application server sends a set - up message which includes both a directory number and a mobile identifier such as an imsi , to a central office , ( action block 101 ). this message would be sent over an isdn facility , such as a primary rate interface ( pri ), or a basic rate interface ( bri ), over the control channel , or the message could be directly sent as an isup message if there is an isup trunk between the server and the central office . the message is received in the central office , and forwarded as an isup initial address message ( lam ) 3 , to a mobile switching center , ( action block 103 ). the msc sends a location request message to the hlr , ( action block 105 ). this hlr is associated with the device identified by the imsi . the hlr contains data for the device identified by the imsi , which identifies the msc currently serving the destination cellular station . the hlr can also specify a call type associated with that imsi if the call type is not provided in the call set - up messages . the hlr then sends a route request to the identified msc serving the cellular destination , which routing request includes the imsi and a call type , ( action block 107 ). the serving msc provides a temporary local directory number ( tldn ), to the msc serving the server , ( action block 109 ). the tldn is allocated only during the call set - up and then de - allocated . the tldn is transmitted from the serving msc / vlr through the hlr to the requesting msc . the two mscs do not communicate directly for ansi - 41 signaling . the hlr does not record the tldn because this number only exists during the call set - up . the msc does store the call type . the msc then sends a trunk set - up request message to the msc serving the cellular destination using the tldn to identify the destination , ( action block 111 ). the serving msc routes the call through its iwf to the wireless device identified by the imsi and the call type , ( action block 113 ). the above description is of one preferred embodiment of applicants &# 39 ; invention , plus several specific alternatives . many other alternative embodiments will be apparent to those of ordinary skill in the art , without departing from the scope of the invention . the invention is only limited by the attached claims .
| 7 |
in the production of the polylactic acid resin foams the present invention , extruders are used . thermoplastic polylactic acid resins are melted under an elevated pressure in the extruders and the molten resins are extruded through die into a low - pressure zone to produce foams . in the production of the polylactic acid resin foams of the present invention , dual functional reactive agents are added to the resins to improve the relevant properties of the melt and thus , the resultant foam . this is achieved by the reaction of the gent with two polymer chains and increase viscosity of the mix , thereby improving the viscoelastic properties of the thermoplastic polylactic acid resins during extrusion , whereby gasified blowing agents can be retained in the interiors of closed cells and uniformly dispersed fine cells can be formed using extruders . in the present invention , a blend of a thermoplastic polylactic acid resin and a dual functional reactive agent is molten in an extruder , a blowing agent is generally injected into the molten blend and the resulting molten blend is extruded through the die of the extruder for foaming into a low - pressure zone to produce a foam . alternatively , the dual functional reactive agent and blowing agent can be added simultaneously with the extrusion . any of the aromatic acid anhydrides , cyclic aliphatic acid anhydrides , fatty acid anhydrides , halogenated acid anhydrides , etc . can be used as the dual functional reactive agent , so long as they have at least two acid anhydride groups per molecule . further , mixtures thereof and modified compounds thereof can be used . preferred examples of the compounds include pyromellitic dianhydride , benzophenonetetracarboxylic dianhydride , cyclopentanetetracarboxylic dianhydride , diphenyl sulfone tetracarboxylic dianhydride and 5 -( 2 , 5 - dioxotetrahydro - 3 - furanyl )- 3 - methyl - 3 - cyclohexen - 1 , 2 - dicarboxylic dianhydride . among them , pyromellitic dianhydride is more preferred . the dual functional reactive agent are used in an amount of preferably 0 . 25 - 1 . 0 parts by weight per 100 parts by weight , more preferably 0 . 25 - 0 . 50 parts by weight per 100 parts by weight of the thermoplastic polylactic acid resin . more preferably the amount is 0 . 25 - 0 . 50 parts by weight per 100 parts by weight of the thermoplastic polylactic acid resin . a large variety of dissolved gaseous agents , also called blowing agents , can be used in the production of the thermoplastic polylactic acid resin foams of the present invention , so long as they are easily vaporizable liquids or thermally decomposable chemicals . easy vaporizable blowing agents such as inert gases , saturated aliphatic hydrocarbons , saturated alicyclic hydrocarbons , aromatic hydrocarbons , halogenated hydrocarbons , ethers and ketones are preferred . examples of these easy vaporizable blowing agents include carbon dioxide , nitrogen , methane , ethane , propane , butane , pentane , hexane , methylpentane , dimethylbutane , methylcyclopropane , cyclopentane , cyclohexane , methylcyclopentane , ethylcyclobutane , 1 , 1 , 2 - trimethylcyclopropane , trichloromonofluoromethane , dichlorodifluoromethane , monochlorodifluoromethane , trichlorotrifluoroethane , dichlorotetrafluoroethane , dichlorotrifluoroethane , monochlorodifluoroethane , tetrafluoroethane , dimethyl ether , 2 - ethoxy , acetone , methyl ethyl ketone , acetylacetone dichlorotetrafluoroethane , monochlcrotetrafluoroethane , dichloromonofluoroethane and difluoroethane . also suitable are thermally decomposable materials such as azodcarbonamide , dinitropentamethylenetetramine , hydrazocarbonamide , and sodium hydrogencarbonate . usually , the blowing agent is injected into the molten blend of the thermoplastic polylactic acid resin , along with the compound having two or more acid anhydride groups per molecule and other additives , prior to the extruder . the amount of the blowing agent to be injected is from 1 . 0 - 5 . 0 by weight based on the amount of the molten blend . the preferred amount of the blowing agent is 1 . 3 percent by weight based on the amount of the molten blend . in the production of the thermoplastic polylactic acid resin foams of the present invention , stabilizer , expansion nucleating agent , pigment , filler , flame retarder and antistatic agent may be optionally added to the resin blend to improve the physical properties of the thermoplastic polylactic acid resin foams and molded articles thereof . such agents are well known in the art in the production of the thermoplastic polylactic acid resin foams of the present invention , foaming can be carried out by any of blow molding process and extrusion process using single screw extruder , multiple screw extruder and tandem extruder . in the production of the polylactic acid resin foams of the present invention , the dual functional reactive agent thermoplastic polylactic acid resin can be mixed with the thermoplastic resin and other additives by any of the following methods . ( a ) the thermoplastic resin is mixed with the compound dual functional reactive agent at a low temperature ( e . g ., a temperature below the melting point of the thermoplastic resin ). ( b ) the dual functional reactive agent is previously melt - mixed with a thermoplastic resin , the mixture is pelletized and the pellet is mixed with the thermoplastic polylactic acid resin ( this thermoplastic resin may be the same as or different from the thermoplastic polylactic acid resin , but is preferably one compatible with the thermoplastic polylactic acid resin ). ( c ) the thermoplastic polylactic acid resin is previously fed to an extruder hopper to melt it and the dual functional reactive agent is fed through a feed opening provided at the cylinder of the extruder to effect mixing . when the pre - expanded foam is cooled , it may crystallize so that thermoforming such material into useful articles becomes impossible . the crystallized material will , upon thermoforming , retain the memory of the crystallized shape and consequently distort at low temperatures . the crystallinity varies depending on the degree of cooling . for example , the crystallinity varies depending on the type and temperature of cooling media and the contact conditions of the foam with the cooling media . in order to conduct effectively the cooling of the pre - expanded foam , it is desirable that the foam has a large surface area in comparison with its volume . namely , it is desirable that the foam is in the form of a sheet , if possible and its thickness is not more than 10 mm , preferably not more than 3 mm . when the sheet is cylindrical , a mandrel is put into the inside of the cylinder , the sheet is allowed to proceed along the mandrel which is cooled with water and the length of the mandrel should be as long as possible . on the other hand , when the sheet is a flat sheet , the sheet is put between a pair of rollers and allowed to proceed while cooling and at the same time , the rollers are cooled with water and the diameters of rollers should be as large as possible . the foam sheets can then be thermoformed into useful articles as may be desired by thermoforming techniques which are well known in the art . the thermoformed articles can be used in a variety of applications , but are especially useful in food containers due to the improved thermal performance as compared with non - foamed pla solid containers . the following examples illustrates certain preferred embodiments of the instant invention , but is not intended to be illustrative of all embodiments . comparison of properties for the foamed polymer produced with and without the dual functional reactive material in this example , foamed polylactic acid polymer was prepared under nearly identical conditions ( as set forth in table 1 ), except that sample 2 contained a multifunctional additive , specifically cesa - extend 1588 manufactured by the clariant corporation . the resultant foamed polymers had the presented in table 2 . as seen , when sample 1 was run , cooling conditions were run that almost resulted in freezing of the material . no additional melt strength could be realized by thermal manipulation . at this condition of maximum cooling , the foam had insufficient melt strength to retain the blowing agent and within seconds of exiting the die would collapse forming plastic “ patties ” on the floor . no stable cell structure was obtained and any reduction in specific gravity was purely a function of “ voids ” formed during the collapsing process . the extrudate had insufficient melt strength to stretch over the sizing mandrel to produce sheet . with sample 2 was run with the addition of the dual functional reactive additive , cesa - extend 1588 , was included in the extrusion process at an additive level of 0 . 25 % of the total feed rate . increase in melt strength was evidenced immediately upon one full residence period of the process ( about 20 minutes ). the increase was observed visually in the extrudate as well as in process conditions as the amperage of the secondary drive increased from 80 amps to 127 amps . it is known in the art that the secondary extruder drive amps are a direct reflection of the viscosity and melt strength of the material being processed . in this particular case , the extrudate was stretched over the sizing mandrel with no problems and pulled to the winder . sheet was successfully produced at a specific gravity that is expected for the amount of blowing agent fed to the mixture . this sheet was later thermoformed using equipment well known in the art and designed for production of polystyrene foam articles . with minor heat and cycle speed adjustments , useful articles were formed . thus it can be seen that the addition of a dual functional reactive agent into the melt resulted in a foamed polylactic acid polymer of desirable properties for the formation of extruded articles . this example illustrates the improvement in thermal performance attained through production of reduced density articles according to the methods of this invention . in this example , a bowl ( made from pla polymer foam produced by the methods of this invention ) approximately 9 inches long by 6 inches wide by 2 inches deep was filled to a level of 1 inch deep with water . the specific gravity of the container was 0 . 4 grams per cubic centimeter . the water is used to simulate an aqueous food . the water was gradually heated and observations were made . this data is presented in table 3 . it can be seen that the thermal conductivity improvement of the foam keeps the exterior of the container significantly lower in temperature than the interior . as a result , the useful temperature range of the product is increased by approximately 20 degrees f ., exhibiting a detectable softening at 140 degrees f . while a solid ( non foamed ) pla product will deform at or below 120 degrees f . it is apparent that many modifications and variations of this invention as hereinabove set forth may be made without departing from the spirit and scope thereof . the specific embodiments described are given by way f example only , and the invention is limited only by the terms of the appended claims .
| 2 |
in this detailed description , reference is made to well - understood fluid dynamics concepts , including , for example , “ boundary layer ” and “ flow separation ” theory . since such concepts are well - known to those skilled in the art , they will not be defined or discussed herein . fig1 depicts a portion of deposition apparatus 1 a in accordance with the present teachings . the portion of apparatus 1 a depicted in fig1 includes a region of powder - charging feed tube 416 , flow straightener 517 , diff - user 518 , and deposition station 550 . fig1 also shows substrate 8 , electrostatic chuck 302 and receiver 272 all engaged to deposition station 550 . powder - laden gas leaves powder - charging feed tube 416 and enters flow straightener 517 , wherein turbulence in the powder - laden gas is reduced . as described in further detail later in this specification , the flow straightener can be used to tailor the flow profile within the diffuser . from the flow straightener 517 , the powder - laden gas enters diffuser 518 . the cross - sectional area of diffuser 518 increases in the direction of flow . as such , average fluid velocity decreases as the powder - laden gas 540 moves through diffuser 518 . as the powder - laden gas flows through the diffuser , it eventually encounters a region wherein the gas velocity slows to the extent that electrostatic forces generated by the spacecharge of the powder , electrostatic chuck 302 and optional focusing electrode ( see fig1 and 17 ) dominate the motion of the powder . this region is referred to herein as “ particle drift zone 534 .” the specific location of particle drift zone 534 is dictated by flow parameters and electrostatic - field strength . by way of illustration , in some embodiments , the particle drift zone may occupy as much or more than the latter one - half of the diffuser . diffuser 518 is formed from a material that is compatible with the deposition process being used . for example , in the illustrated embodiments , the diffuser is used in conjunction with an electrostatic deposition process . as such , the interior surface of wall 521 of diffuser 518 must be capable of accepting an electrical charge and maintaining it . moreover , the material must be compatible with the charging characteristic of the powder and the charging method ( e . g ., if the powder is positively charged , the material comprising wall 521 must not change the positive charge to a negative charge ). furthermore , to the extent that the diffuser is used in conjunction with a process that is producing pharmaceuticals , the material must satisfy pertinent fda regulations . as will be apparent to those skilled in the art , when the present diffuser is used in conjunction with an electrostatic deposition process , the diff - user should be formed from a dielectric material , such as any one of a variety of plastics , including , without limitation , acrylic and polycarbonate plastics . to the extent that the present diffuser is used in conjunction with other types of powder deposition processes , or more generally , in other types of powder - delivery systems , other materials requirements may be controlling . charged powder 544 is moved through the diffuser under the control of aerodynamic forces of the flowing fluid until it enters particle drift zone 534 . in the particle drift zone , electrostatic forces control powder movement , since , in this region of the diffuser , such forces dominate aerodynamic forces . in other words , in particle drift zone 534 , the powder does not follow the flow streamlines of the gas . gas 542 , substantially sans powder , is withdrawn from diffuser 518 at annular slit 530 . the gas is ultimately withdrawn via several circumferentially - located outlets 526 . the annular slit 530 is advantageously well rounded , as depicted at region 532 , to avoid introducing turbulence into the uniform flow profile established by diffuser 518 . powder 544 is deposited on substrate 8 at regions overlying the collection zones ( not shown ) of electrostatic chuck 302 . in some embodiments , one or more flow - control features are advantageously used in conjunction with diffuser 518 . a first flow control feature is the injection of gas 548 into the “ boundary layer ” flow within the diffuser . the injected gas , which can be , for example , nitrogen , should have a greater momentum than the powder - laden gas flowing in the boundary layer ( such momentum calculations are readily performed by those skilled in the art ). the injected gas is introduced through a boundary - layer gas injector , which comprises one or more annular slits in diffuser 518 . in the embodiment depicted in fig1 , gas is injected into the boundary - layer at two locations : a first injection slit 520 disposed near the inlet of diffuser 518 and a second injection slit 522 disposed near the mid - point of the diffuser . the boundary - layer injection gas is injected into the diffuser in the form of a thin stream , and is “ directed ” to flow along wall 521 . in one embodiment , the gas is directed toward wall 521 by having the injection slits ( e . g ., 520 and 522 ) inject the gas towards wall 521 . in a second embodiment , the injection slit is substantially perpendicular to wall 521 of the diffuser ( ie ., nominally directing injected gas away from nearby wall 521 and towards the central flow region ). in the second embodiment , the “ upstream ” wall of the slit ( i . e ., the slit wall nearest the diffuser inlet ) is provided with a sharp edge , and the “ downstream ” wall of the slit is provided with a well - rounded edge . as a result of this arrangement , the injected gas turns the rounded edge to remain near wall 521 . this effect , known as the coanda effect , is known to those skilled in the art . the boundary - layer gas injection improves flow uniformity . in particular , such injection reduces or prevents flow separation at the interior surface of wall 521 of diffuser 518 . moreover , gas injection effects a “ shaping ” or “ steering ” of powder - laden gas 540 toward central axis 519 ( see fig1 ) of diffuser 518 . such steering counteracts the tendency of the charged particles to move away from the central axis due to the mutual repulsion of such similarly - charged particles . additionally , such gas injection provides a “ gas curtain ” effect , wherein powder contained in the gas 540 is kept away from the interior surface of diffuser wall 521 , thereby reducing the tendency for powder to accumulate thereon . further embodiments of illustrative boundary - layer gas injectors are described in conjunction with fig1 - 19 . fig1 depicts an “ enlargement ” of the region near injection slit 520 of diffuser 518 depicted in fig1 . in the embodiment depicted in fig1 , the boundary - layer gas injector further comprises two nozzles 660 a and 660 b , annular channel 662 , and fasteners ( received by bores 664 a and ). the gas that is to be injected into the boundary layer is delivered to annular channel 662 from nozzles 660 a and 660 b . fasteners , such as screws or the like ( not shown ), that are received by bores 664 a and 664 b control the size of slit 520 . in particular , tightening one of the fasteners ( e . g ., the fastener in bore 664 a ) more than the other fastener ( e . g ., the fastener in bore 664 b ) causes the slit to be slightly larger at one region ( e . g ., near bore 664 b ) than at another region ( e . g ., near bore 664 a ). when the flow rate of injection gas into nozzles 660 a and 660 b is equal , the flow of injection gas through injection slit 520 will be relatively greater at a region at which the injection slit is relatively larger . it has been found that such a variation in the boundary layer gas injection will affect flow distribution near the outlet of diffuser 518 and can ultimately affect the powder distribution on substrate 8 . in a further embodiment of a diffuser in accordance with the present teachings , boundary layer gas injection is regionally varied by introducing additional injection nozzles , as is depicted in fig1 . fig1 depicts a top - cross sectional view of the annular channel 662 . as shown in fig1 , four nozzles 660 a - 660 d deliver injection gas to annular channel 662 . by individually varying the flow of injection gas through nozzles 660 a - 660 d , the flow distribution near the outlet of diffuser 518 can be affected ( e . g ., a greater amount of powder can be directed to a particular region of the substrate ). while four nozzles are depicted in fig1 , a greater number of nozzles can be used , thereby providing an even greater measure of control over the downstream powder distribution . fig1 depicts yet a further embodiment wherein annular channel 762 is segmented into regions via dividers 766 . the flow of injection gas within a particular region of the channel is thus dictated via the nozzle feeding that region . such an arrangement is expected to provide a greater measure of control over downstream powder distribution than continuous annular channel 662 depicted in fig1 . as described earlier in this specification , “ charge ” sensors ( which actually measure current ) disposed on or near electrostatic chuck 302 can be used to determine the amount of powder being deposited on a regional basis on the substrate . in some embodiments , sensors are provided at each collection zone cz such that the powder distribution is known at each point across substrate 8 . such information can be used as the basis for a closed - loop control system ( feedback or feedforward ) wherein the boundary - layer gas injection flow is adjusted to correct any deviations in the powder distribution . fig1 depicts a manual control scheme wherein the output from the charge sensors cs is delivered to processing electronics pe , and an indication of the powder distribution is provided to an operator ( e . g ., displayed on a display device dd ). the operator can then manually adjust the boundary - layer gas injection via flow - control means , such as mass - flow controllers mfc , that individually control the flow of injection gas through each nozzle 660 . fig1 depicts an automatic control loop wherein the output of the charge sensors cs is delivered to appropriate processing electronics pe including a suitably - programmed processor pp that determines how the boundary layer flow should be adjusted to correct deficiencies in the powder distribution . one or more signals rs are generated that reset the set - point of a controller fc that controls the operation of a flow - control valve cv feeding each nozzle 660 . controllers fc generate a control signal cs that causes the controlled valve to incrementally open or close thereby increasing or decreasing flow therethrough . a second flow control feature that is used in conjunction with some embodiments of the present diffuser comprises a “ boundary layer ” gas suction , wherein gas is withdrawn from the slowly - moving boundary layer ( not depicted ) adjacent interior surface of wall 521 through a boundary - layer gas aspirator . the boundary - layer gas aspirator comprises one or more openings in wall 521 for withdrawing gas 546 , and a pressure - differential - generating means that creates a pressure differential across such openings to draw gas 546 therethrough . in the embodiment depicted in fig1 , the boundary - layer gas aspirator comprises multiple rows of slots 524 disposed in wall 521 . as depicted in fig1 , slots 524 are advantageously offset , on a row - by - row basis , from slots 524 in an adjacent row . in other embodiments , an annular slit configured in the manner of injection slits 520 and 522 can be used for the boundary layer gas suction . in the illustrated embodiment , the pressure - differential - generating means includes a pressure - tight shell / enclosure 528 and a suction flow generating means ( not shown ) that is in fluid communication with shell 528 . the suction flow generating means creates a flow 550 out of said enclosure 528 . flow 550 establishes the pressure differential across holes 524 that withdraws gas 546 from the boundary layer . flow 550 can be generated in a variety of well - known ways , such as , for example , by using a piston or diaphragm - type vacuum pump or a jet ejector . in some embodiments of the present invention , “ vanes ” ( not shown ) are disposed within the diffuser . in one of such embodiments , the vanes are arranged radially about central longitudinal axis 519 . in another of such embodiments , the vanes are configured as a multiplicity of concentric rings that are centered about longitudinal axis 519 . the vanes flatten the velocity profile of powder - laden gas 540 , forestalling flow separation . such vanes may , however , have a tendency to collect powder from powder - laden gas 540 . it should be understood that the aforementioned flow - control features ( i . e ., boundary - layer gas injection , boundary - layer gas suction and vanes ) are used individually in some embodiments , and in various combinations in other embodiments . the “ cone angle ” of the diffuser , which is expressed as 2 θ ( see fig2 ), affects diffuser performance . while well - known equations express relationships between cone angle and performance parameters , suitable cone angles for the diffuser are best determined by fabricating sample diffusers and then evaluating their performance . the flow - control features described herein facilitate use of greater cone angles , which results in relatively “ shorter ” diffusers . a cone angle of about 15 ° has been found to be suitable for a diffuser that does not rely on the additional flow - control features described above . more generally , it is expected that a cone angle within the range of about 10 ° to about 17 ° is suitable for such an application . use of such flow - control features , and ensuring smooth , well rounded surfaces in transition regions ( e . g ., axial slits , boundary between flow straightener and diffuser , etc .) allows for a significantly greater cone angle . specifically , in such circumstances , it is expected that satisfactory performance can be obtained with a diffuser cone angle as great as about 25 ° to about 30 °. illustrative diffuser 518 has a constant cone angle ( e . g . 15 degrees ). in a further embodiment depicted in fig2 , first portion 870 of diffuser 818 has a constant cone angle and second portion 876 of the diffuser 818 has an increasing cone angle . compare cone half - angle θ 1 at location 882 on the surface of the diffuser nearer beginning 878 of second portion 876 with cone half - angle θ 2 at location 884 on the surface of the diffuser nearer outlet 880 of second portion 876 . in first portion 870 , a relatively moderate cone angle ( e . g ., 10 °- 17 °) aids in establishing the desired flow profile in diffuser 818 . once established , the cone angle can be progressively increased while maintaining the desired flow profile . increasing the cone angle reduces the length of the diffuser ( given a target diameter near the outlet of the diffuser ). since abrupt transitions at the wall of the diffuser will disrupt the flow profile , the cone angle at beginning 878 of second portion 876 is advantageously equal to the cone angle at end 874 of first portion 870 . selecting cone angles for the first and second portion of the diffuser is an application specific task . more particularly , the cone angle is dependent on the gas feed rate , the powder feed rate and the electric charge . by way of illustration , not limitation , the cone angle for first portion 870 is typically in the range of about 10 ° to about 17 °. the cone angle at beginning 878 of second portion 876 is typically in the range of about 10 ° to about 17 ° and the cone angle near end 880 of second portion 876 is typically in the range of about 25 ° to about 35 °. it was previously stated that in some embodiments of the present invention , a flow straightener is used in conjunction with the diffuser to “ tailor ” or adjust the flow profile within the diffuser . fig2 and 23 depict embodiments of a flow straightener suitable for tailoring the flow profile of powder - laden gas 540 in the diffuser . fig2 depicts flow straightener 917 engaged to diffuser 518 . transitional region 920 between the flow straightener and the diffuser reduces the likelihood of flow instabilities ( e . g ., powder settling out of powder - laden gas 540 , etc .). flow straightener 917 comprises a plurality of tubes 922 . tubes 922 have a length - to - diameter ratio ( l / d ) in the range of about 10 / 1 to 60 / 1 . passing powder - laden gas 540 through such tubes results in a relatively flat flow profile as the powder - laden gas 540 enters diffuser 518 . it has been discovered that the flow profile of the powder - laden gas near the outlet of the diffuser is dependent , to some extent , on the flow profile of the powder - laden gas before such gas enters the diffuser . therefore , in some embodiments , flow straightener 917 is advantageously used to tailor the flow profile of the powder - laden gas 540 , as desired . in one embodiment , the flow profile of powder - laden gas 540 is tailored by providing a variation in the diameter of tubes 922 within flow straightener 917 . fig2 , which shows a cross - sectional end view of a flow straightener 1017 , depicts an embodiment wherein the diameter of tubes 922 increase with increasing radial distance from the central axis of the flow straightener . thus , tube 922 d , aligned with the central axis , has the smallest diameter , six tubes 922 c have a somewhat larger diameter than tube 922 d , six tubes 922 b have a larger diameter than tubes 922 c , and six tubes 922 a near wall 924 of the flow straightener have the largest diameter . the arrangement depicted in fig2 generally increases the velocity of the gas near wall 521 as compared to a flow straightener having tubes of equal diameter . thus , such an approach can be used to flatten the flow profile across the diffuser if a particular diffuser design exhibits an unacceptable radial velocity gradient . in other embodiments , other arrangements of tubes of unequal diameter are used to cause other changes in the flow profile in the diffuser as desired . it was previously indicated that a “ focusing electrode ” is advantageously used in conjunction with the electrostatic chuck to deposit powder on substrate 8 . an embodiment of such a focusing electrode 1152 is depicted in fig2 ( side view ) and fig2 ( bottom view of electrostatic chuck ). in the embodiment depicted in fig2 , focusing electrode 1152 is located near substrate 8 . the focusing electrode is configured for easy removal , such as for cleaning , etc . in the embodiment shown in fig2 , focusing electrode 1152 comprises a dielectric material coated with a conductor , such as copper . electrode 1152 includes a plurality of openings 1154 aligned with the collection zones ( not shown ) of electrostatic chuck 302 . electrode 1152 is in contact with a controlled voltage source ( not shown ) operable to place a charge on the conductor that has the same polarity as the charge on the powder . powder is thus “ steered ” away from the conductor and through holes 1154 to substrate 8 . it is to be understood that the above - described embodiments are merely illustrative of the invention and that many variations may be devised by those skilled in the art without departing from the scope of the invention . it is therefore intended that such variations be included within the scope of the following claims and their equivalents .
| 8 |
a game apparatus according to this invention comprises a playing board 10 as shown in fig1 and 2 . fig1 illustrates the entire playing board , which consists primarily of a movement grid 12 . the movement grid comprises a plurality of nodes or intersections 14 joined by a plurality of segments 16 . a substantial portion of the nodes 14 and segments 16 have been omitted from fig1 for purposes of clarity . the upper right hand portion of fig1 is shown in enlarged scale in fig2 fig2 including substantially all of the nodes or intersections 14 and segments 16 . the nodes and segments define a plurality of selectable player movement paths . the movement grid 12 is divided into a first or outer annular playing zone 18 , a second or middle annular zone 20 , and an inner zone 22 . the boundary between the first and second zones 18 and 20 is marked by boundary line 24 . the boundary between the second and third zones 20 and 22 is marked by boundary line 26 . the playing grid 12 has depicted thereon a plurality of unique indicia , in the form of uniquely colored squares , diamonds and triangles . the choice of color as unique indicia is merely illustrative . there are a plurality of yellow indicia 28 , orange indicia 30 , red indicia 32 , green indicia 34 , blue indicia 36 and black indicia 38 . at least some of the indicia are disposed in the first zone 18 and at least some of the indicia are disposed in the third zone 22 . players are accordingly forced to cross the first and second boundary lines 24 and 26 a plurality of times during the course of play in order to reach at least one of each of the unique indicia 28 through 38 . in the presently preferred embodiment , none of the unique indicia are disposed in the middle zone 20 , but some of the unique indicia may be so disposed in the middle zone 20 , if desired . each playing board 10 also includes a plurality of starting blocks , which in the presently preferred embodiment , provide for up to eight players . starting blocks 42 , 44 , 46 , 48 , 50 , 52 , 54 and 56 are disposed around the outer perimeter of the playing board 10 , opposite and outside of the outer edge 40 of the movement grid 12 . each of the starting blocks includes indicia in the form of an arrow or the like , which points to a corresponding starting node along the outer edge 40 . three such starting nodes 58 , 60 and 62 are illustrated in fig2 and correspond respectively to starting blocks 48 , 50 and 52 respectively . hash marks 72 , 74 , 76 , 78 , 80 , 82 , 84 and 86 define home territories corresponding to each of the starting blocks 42 through 56 . for example , the home territory for starting block 48 is defined between hash marks 76 and 78 , whereas the home territory for starting block 50 is between hash marks 78 and 80 . chance means may be utilized as an alternative to determine the starting node for each player . the definition of such home territory may also be utilized in various alternative embodiments of playing the game . the direction of movement for each player during the course of play is determined by a set of movement direction markers , each defining at least one direction of movement on the grid , from which sets of movement direction markers can be accumulated by each player by random selection for subsequent use . in the presently preferred embodiment , the set of movement direction markers are embodied in a set or deck of cards 88 , each of which is provided with indicia 90 corresponding to one or more arrows defining at least one direction of permissible movement , or a legend . each node or intersection 14 has eight segments 16 connected thereto , except for those nodes disposed along outer edge 40 . accordingly , the direction cards of set 88 include arrows enabling movement corresponding to one or more of each of the eight possible directions of movement which can be made at most , although not all of the nodes . in addition , certain legends may be utilized as instructions instead of arrows . for example , some of the cards may state : &# 34 ; reverse direction &# 34 ;; &# 34 ; move in any direction &# 34 ;; or , &# 34 ; change seats with anyone &# 34 ;. it will be appreciated that the various players perception of up , down , left , right , and the four diagonal directions will change depending upon a player &# 39 ; s orientation . changing one &# 39 ; s position has the effect of rotating each of the direction cards which a player has collected . alternatively , a relative sense of a forward direction can be defined by each playing piece , or position marker . typical grid position markers 94 are shown in fig4 . a grid position marker 94 is provided for each of the players . depending upon the various formats in which the game may be embodied , the grid position markers might correspond to horses , rocket ships , airplanes , trucks , boats or any other form of typical transportation . each of these embodiments will , by reason of its inherent design , shape or configuration , clearly define a front and rear . for purposes of illustrating a generic grid position marker , markers 94 are provided with indicia in the form of arrows 96 and legend 98 to clearly denote the front of each grid position marker . each of the grid position markers 94 is provided with a plurality of holes 100 , for accommodating complete sets 102 of progress markers . the progress markers are embodied in the illustrated embodiment as pegs having colors corresponding to the unique indicia 28 through 38 shown on the movement grid 12 . each set 102 of progress markers includes a yellow progress marker 104 , an orange progress marker 106 , a red progress marker 108 , a green progress marker 110 , a blue progress marker 112 and a black progress marker 114 . a set of progress markers is provided for each of the players . the holes 100 and correspondingly dimensioned pegs of set 102 provide a means in each grid position marker for holding a set of progress markers , whereby the relative competitive position of each player may be easily ascertained during the course of play . the magnitude of movement for repositioning each grid marker in turn is determined by a first chance means , shown in fig5 as a typical pair of dice 116 and 118 . a second chance means is an indicia die 120 shown in fig6 a and 6b . in order to provide a means by which players may , under certain circumstances , seize one or more of the progress markers which have been collected by another player , each of the six faces of indicia die 120 corresponds to one of the unique indicia of the progress markers and of the corresponding unique indicia depicted on the movement grid . in the presently preferred embodiment , the unique indicia correspond to colors . accordingly , each of the faces 122 , 124 , 126 , 128 , 130 and 132 of indicia die 120 correspond to one of the colors yellow , orange , red , green , blue and black . the only special indicia depicted on the movement grid 12 and not yet described , is center or finish star 136 . in the presently preferred embodiment , finish star 136 represents that specific node which each player must land on , by exact count , after collecting a complete set of progress markers . the game apparatus as described above can be utilized to practice a method for competing as a player in a game , according to a general or generic set of rules . the following set of rules correspond to an embodiment of the game set in the context of six differently colored parcels which must be collected by each player , each player having a grid position marker in the form of a motor vehicle . each of the motor vehicles is provided with means for holding one each of the six differently colored parcels . the object of the game is for a player to collect all six of the differently colored parcels and return to the center star 136 first . at the beginning of play , each player is provided with a grid position marker 94 in the form of a truck and three movement direction cards . each player starts at a respective starting block , one of 42 through 52 . the numbered dice 116 and 118 may be rolled to determine which player goes first , play proceeding clockwise thereafter . for purposes of these generic instructions , starting nodes for each of the starting blocks are also specified in the design of the grid on the playing board . the grid position markers 94 must always move in a forward direction . the movement direction cards are used only to change direction , and may be used only prior to each player rolling the numbered dice . each of the dice 116 and 118 is treated individually . before a player rolls the numbered dice , the player may choose a movement direction card and thereafter may roll a five , two ( 5 , 2 ). the player may move five spaces and then two spaces in the chosen direction ; or , the player may move two spaces , change direction in accordance with the card , and then move five spaces in the new direction . each space corresponds to one of the segments 16 , connecting two nodes or intersections 14 . alternatively , the player might move two spaces in the first direction , change directions , and then move five spaces in the second direction . movement is in the nature of a vector , including both direction of movement and magnitude of movement . once a player has used a movement direction card , it is placed in a discard pile . the management of the movement direction cards is complicated by the use of boundary lines 24 and 26 to divide the movement grid 12 into the first , second and third zones 18 , 20 , and 22 . each time a player &# 39 ; s grid position marker crosses the first boundary line 24 , that player may select another movement direction card from the deck 88 . if a player is able to cross boundary line 24 twice in the same move that player can take two additional movement direction cards . this may be accomplished by cutting across a corner of the second zone 20 or by using an existing movement direction card to cross over and back . moreover , each time a player is successfully in collecting a parcel , that player may select a movement direction card . on the other hand , each time a player &# 39 ; s grid position marker crosses the second boundary line 26 , that player must forfeit a movement direction card . if a player crosses both boundary lines in the same move the player must select and forfeit movement direction cards , respectively , the order depending upon which boundary line was crossed first and which boundary line was crossed second . each player must collect one of each differently colored parcel , must collect such parcels in a predetermined order , and must thereafter land on the center or finish star before any other player does so . in the presently preferred embodiment , the parcels are to be picked up in the following order : yellow , orange , red , green , blue and black . in order for a player to collect a parcel , that player must conclude a move , with either die , directly on one of the nodes or intersections 14 forming a corner of the geometrical pattern of the unique indicia . for example , with reference to the upper right hand corner of the movement grid 12 as shown in fig2 unique indicia 34 is a green triangle which can be accessed by landing on any one of three nodes or intersections 14 . moving to the left along outer edge 40 , indicia 38 is a black triangle , smaller than the green triangle 34 , and formed in such a way as to be accessed only by landing on one of two nodes or intersections 14 . moving downwardly somewhat , and slightly to the right , indicia 28 is a yellow square which can be accessed by any one of four nodes or intersections 14 . this can be contrasted with the square or diamond - shaped indicia 32 , at the lower right hand corner of grid 12 shown in fig2 which is so oriented as to be accessed only by two nodes or intersections 14 . the center star , which is not technically in the precise center of the movement grid , can be accessed only by landing on one node or intersection 14 . if , for example , a player is two spaces away from an indicia , and rolls two , four ( 2 , 4 ) the player may move two spaces , collect the parcel , collect an additional movement direction card , and then move four additional spaces . if a player is traveling in a certain direction , and is unable to change that direction , that player eventually will travel off of the movement grid 12 entirely . this is more likely when players try to access the indicia on or near outer boundary 40 . any such player must risk a penalty by rolling the indicia die 120 , and forfeiting whichever parcel corresponds to the unique indicia indicated by the die . it will be appreciated that players having few or no parcels are at less risk than players having many or all parcels . players leaving the movement grid entirely must return to one of the starting blocks , the determination of which starting block being made by means of the hash marks 72 through 86 . players are then required to collect a parcel of the very same color which was lost before picking up any additional parcels , in order to follow the basic rule of picking up the parcels in a predetermined order . it will also be appreciated that proper placement of the indicia in two or more of the playing zones will substantially increase the complexity of play , and substantially increase the difficulty of managing the collection of movement direction cards , as the number of times players must cross the boundary lines 24 and 26 can be maximized . occasionally , a player may land on a node or intersection 14 which is already occupied by another player . whenever this occurs , the second player landing on the node or intersection 14 may roll the indicia die 120 and seize a parcel from the first player corresponding to the unique indicia shown on the die . if the second player already has that particular parcel the first player simply forfeits the parcel and must collect that parcel again . if the first player does not have the indicated parcel , the first player loses nothing . this procedure provides an interesting offensive opportunity for each of the players . players rolling doubles on the numbered dice are preferably afforded the choice of proceding in the normal fashion ; or , selecting two additional movement direction cards , and rolling the dice again . after a player has retrieved all six differently colored parcels , that player must proceed to , and land on the center or finish star by exact count as the result of rolling both dice , not merely one of the dice . even after a player has collected all six parcels in a set , it may be necessary to cross the first boundary line many times in order to accumulate sufficient movement direction cards to successfully land on the center or finish star 136 . it will be appreciated by those skilled in the art that the foregoing directions are appropriate not only for the collection of parcels , but are appropriate for a wide variety of game formats and contexts such as described above , and many others as well . the invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof . accordingly , reference should be made to the appended claims , rather than to the foregoing specification , as indicating the scope of the invention .
| 0 |
before explaining the disclosed embodiment of the present invention in detail it is to be understood that the invention is not limited in its application to the details of the particular arrangement shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . to better understand this invention as set forth , recall that the fluorene ring is a δ - conjugated system which allows for facile synthetic manipulation , yielding dyes with tailored spectral properties . efforts directed towards preparing reactive fluorescent dyes have been initiated with the synthesis of an amine - reactive dye for labeling , e . g ., lysine residues on proteins . a model dye - adduct exhibiting high fluorescence quantum yield ( qy = 0 . 74 ) was also prepared by reacting an amine - reactive dye with n - butyl - amine to test its reactivity as an amine - reactive fluorescent label and determine its spectroscopic properties . additionally , a model protein bioconjugate was prepared with the reactive fluorophore and bovine serum albumin . finally , a hydrophilic derivative of an amine - reactive dye was prepared to obtain a more water - soluble dye . the foregoing will become apparent upon reading the following experimental discussion . reference should now be made to fig1 . the synthesis of an amine reactive fluorescent dye ( 1 ) was prepared as a biological labeling probe ( scheme 1 ). intermediate compounds a - f have been described previously in the literature . preparation of reactive probe 1 , from aminofluorene f , was performed quantitatively , following the literature protocol . the procedure for preparation of reactive probe 1 is shown in fig1 . compound ( 1 ) was prepared as an amine - reactive fluorescent dye , containing the isothiocyanate functionality that can react with primary amine groups present on protein molecules . a model dye - adduct ( 2 ) was also prepared by reacting ( 1 ) with n - butyl - amine to test its reactivity as an amine - reactive fluorescent label ( fig1 ). preparation of the model adduct allowed for facile single - and two - photon spectroscopic characterizations that more closely resembles the bioconjugate than that of the reactive fluorophore alone . the amine - reactive fluorescent dye ( 1 ) was used to prepare a bioconjugate ( 3 ) with bovine serum albumin ( bsa ) protein as a model biomolecule ( which is shown in fig2 ). the use of bsa , an inexpensive protein that has been extensively characterized , is ideal for establishing optimal conditions to obtain a model bioconjugate allowing for subsequent spectroscopic characterization . the amine reactive reagent ( isothiocyanate functional group ) reacts with non - protonated aliphatic amine groups , including the n - terminus of proteins and the ε - amino groups of lysines ( pka ≈ 10 . 5 ). a typical protocol for the conjugation was followed in an amine - free buffer with a slightly basic ph ( ph = 9 . 0 ). the amine reactive dye ( 1 ) was dissolved in dmso , immediately prior to addition into the stirring bsa protein solution . the reaction mixture was allowed to stir at room temperature , after which it was passed through a sephadex g - 25 gel filtration column pre - swollen with water and equilibrated with phosphate buffer saline ( pbs , ph 7 . 2 ) solution . small fractions , eluted with the pbs solution were collected into sterile plastic tubes , and the uv - visible absorption and steady - state fluorescence emission spectra of the bioconjugate were obtained . two different molar ratios of the reactive dye to protein were performed to assess the reactivity of the dye for its degree of labeling ( dol ) ( table 1 ). the degree of labeling was estimated using average values from standard equations obtained from reference 25 . the normalized uv - visible absorption and steady - state fluorescence emission spectra of the free reactive fluorophore ( 1 ) and the dye adduct ( 2 ) in dmso are shown in fig4 . the free reactive fluorophore exhibits two absorption maxima at approximately 357 and approximately 375 nm , along with two emission maxima at approximately 384 and approximately 404 nm . the dye adduct instead exhibits a single absorption maximum at approximately 363 nm with an emission maximum at approximately 403 nm , and is well resolved from that of its absorption spectrum , with minimal spectral overlap . the fluorescence quantum yield ( rhadamine 6g in ethanol as a standard ) of the reactive fluorophore in dmso was approximately 0 . 02 , while that of the dye adduct in dmso increased significantly to approximately 0 . 74 , indicating the fluorescence of the reactive dye should be restored upon conjugation to a biomolecule . the two - photon absorption cross sections ( from two - photon fluorescence measurements ) for the dye adduct in dmso was obtained under femtosecond ( fs ) near ir irradiation ( fig5 a ). the linear , single photon absorption spectrum is shown as the line profile , while the two - photon absorption cross sections were measured at wavelengths that were twice that of the linear absorption , and are shown as the data points . the y - axis is shown as two near - ir photons used to obtain the cross section converted to an equivalent single photon wavelength . the two - photon absorption cross section at the energy of the linear absorption maximum near 370 nm is approximately 25 gm units . interestingly , while the linear absorption spectrum for the compound does not display any significant absorption at the shorter wavelengths , the value of the two - photon absorption cross section increases . to ensure the dye adduct undergoes 2 pa , a log - log plot of the fs pump power to that of the integrated fluorescence was constructed . as can be seen from fig5 b , the slopes from the measurements confirm the quadratic dependence characteristic of fluorescence obtained from two - photon absorption . fig5 a - 5 b show the two - photon cross section of the dye adduct in fig5 a , and the log - log plot of its integrated fluorescence as a function of pump power variation at two different fs excitation wavelengths in fig5 b . the normalized absorption and steady - state fluorescence emission spectra of the bsa - dye bioconjugate ( 3 ) in pbs buffer ( ph 7 . 2 ) is shown in fig6 . for reference , the absorption spectrum of the free bsa protein in pbs solution is also shown . the bsa - dye conjugate displays absorption peaks corresponding to that of the bsa protein in the shorter wavelength range ( δ max = 280 nm ), as well as that of the fluorescent dye in the longer absorption range ( 67 maxuma = 360 nm and 380 nm ). the fluorescence emission of the bioconjugate is broad and exhibits an appreciable stoke &# 39 ; s shift . an appreciable bathochromic shift in the fluorescence emission was observed in the bsa - dye conjugate relative to that of the free reactive fluorophore , and with a similar broadening observed in the absorption profile , the fluorescence emission was also broader than that of the free fluorophore . the observed stoke &# 39 ; s shift in the free dye was about 45 nm , while that of the bsa - dye conjugate was much greater ( stoke &# 39 ; s shift = 73 nm upon δ ex = 360 nm , and 53 nm upon δ ex = 380 nm ). the fluorescence emission profile of the bsa - dye conjugate upon excitation at δ ex = 360 nm and δ ex = 380 nm yielded similar fluorescence intensities . the spectroscopic profiles of the bsa - dye conjugate validate the use of the reactive dye ( 1 ) to form bioconjugates with protein biomolecules for fluorescence imaging applications . however , attempts to conjugate the dye onto an anti - bsa antibody ( molecular probes ) were unsuccessful . the two hydrophobic alkyl chains on the fluorene ring may have interfered with efficient conjugation onto the higher molecular weight of the antibody (˜ 150 kda ) relative to that of the smaller protein (˜ 65 kda ). hence , a more hydrophilic derivative of an amine - reactive dye was prepared ( compound 4 of fig3 ). substitution of the alkyl groups on the fluorene ring with carboxylates should enhance the water solubility of the reactive de , and is expected to improve its conjugation to a wider range of biomolecules in aqueous media . the ft - ir spectrum of the hydrophilic reactive dye ( 4 ) displayed a strong ncs stretch at 2118 cm - 1 , indicating the presence of the amine - reactive functionality . efforts to prepare appropriate adducts and bioconjugates with the hydrophilic dye ( 4 ) are currently underway . a new series of reactive fluorophores have been prepared to covalently label biomolocules for multiphoton imaging . these fluorophores are based upon the fluorene ring system and exhibit high fluorescence quantum yields upon bioconjugation (˜ 0 . 7 ). they have been functionalized with moieties to act , e . g ., as efficient amine - reactive fluorescent probes for the covalent attachment onto , e . g ., proteins and antibodies . a bovine serum albumin ( bsa ) conjugate with a new reactive probe has been demonstrated . additionally , a hydrophilic reactive fluorophore has been prepared , expected to be more efficient for labeling biomaterials in aqueous media . these efficient two - photon absorbing reactive dyes are expected to be versatile probes for multiphoton bio - imaging applications . in summary , there is disclosed numerous structures and the preparation provided by the teachings of this invention : the dye adduct the dye adducts that are hydrophilic and have the structural formulae r 1 , r 2 , x , and y are all functionality tailored for specific applications wherein r 1 and r 2 are selected from the group : r 1 and r 2 , at each occurrence , are independently c 1 - c 16 alkyl , c 1 - c 10 haloalkyl , —( ch 2 ) 1 - 9 co 2 h , —( ch 2 ) 1 - 9 co 2 ( c 1 - c 6 alkyl ), —( ch 2 ch 2 o ) 1 - 10 h , —( ch 2 ch 2 o ) 1 - 10 ( c 1 - c 6 alkyl ); —( ch 2 ch 2 o ) 1 - 10 ( co 2 c 1 - c 6 alkyl ); — ch 2 ch 2 o ) 1 - 10 ( co 2 h ); or —( ch 2 ch 2 o ) 1 - 10 ( co 2 — n - succinimidyl ); — n ═ c ═ s , — n ═ c ═ o , co 2 h , — n - succinimidyl , — p (═ o )( oh ) 2 , — p (═ o )( oh )( o — c 1 - c 6 alkyl ), — p (═ o ) cl 2 , p (═ o ) f 2 , — p (═ o )( f )( o — c 1 - c 6 alkyl ), — p (═ o )( cl )( o — c 1 - c 6 alkyl ), p (═ o ) br 2 , or — p (═ o )( br )( o — c 1 - c 6 alkyl ); — nh 2 , — nh ( c 1 - c 6 alkyl ), — n ( c 1 - c 6 alkyl ), — n ( c 1 - c 6 alkyl ) 2 , — nh ( aryl ), — n ( aryl ) 2 , — nhco ( c 1 - c 4 alkyl ), 2 - thiazolyl substituted with 0 - 2 r 3 ; 2 - oxazolyl substituted with 0 - 2 r 3 ; 2 - benzothiazolyl substituted with 0 - 4 r 3 ; 2 - styrlbenzothiazolyl ; 2 - benzoxazolyl substituted with 0 - 4 r 3 ; and 2 - or 4 - pyridyl substituted with 0 - 4 r 3 , and n - carbazolyl substituted with 0 - 4 r 3 ; and r 3 is independently amino , hydroxy , halogen , c 1 - c 6 alkoxy , c 1 - c 10 alkyl , c 1 - c 6 haloalkyl , sh , sch 3 , — nh ( c 1 - c 6 alkyl ), — n ( c 1 - c 6 alkyl ) 2 , — nh ( aryl ), — n ( aryl ) 2 , — nhco ( c 1 - c 4 alkyl ), — n ═ c ═ s , — nh ( c ═ s )— o ( c 1 - c 6 alkyl ), — nh ( c ═ s )— nh ( c 1 - c 6 alkyl ), — nh ( c ═ s )— n ( c 1 - c 6 alkyl ) 2 , — co 2 h , or — co 2 ( c 1 - c 6 alkyl ). fig7 and the example below are further illustrative of the scope of this invention as an amine reactive two - photon fluorescent probe . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .
| 2 |
hereinafter , each embodiment of the present invention will be described in detail with reference to the drawings as necessary . in each embodiment , means having the same functions are denoted by the same reference numeral and description thereof is omitted . as illustrated in fig1 , a content providing system 1000 according to an embodiment of the present invention provides content ( i . e ., an image ) and includes an encoding device 1 and a decoding device 2 . in this content providing system 1000 , the encoding device 1 and the decoding device 2 are connected to each other via a network n . this network n is an ip packet transmission path , such as the internet and an intranet . in the present embodiment , it is supposed that the content providing system 1000 includes one encoding device 1 and one decoding device 2 . hereinafter , a configuration of the encoding device 1 will be described . the encoding device 1 encodes an image signal as an input signal and provides the encoded image signal to the decoding device 2 . therefore , the encoding device 1 includes an encoder 11 , a time stamp calculation means 12 , an encapsulation determination means 15 and an encapsulation means 16 . the encoder 11 generates an access unit with ( to ) which a cts and a dts are correlated ( added ) by encoding an image signal input from outside according to an encoding scheme in which the cts and the dts are used . here , the encoder 11 encodes the input image signal using an image encoding scheme , such as mpeg ( moving picture experts group )- 2 video or mpeg - 4 avc ( advanced video coding ), and generates an access unit of an image . here , in a case in which a decoding order and a presentation order of the access unit differ as in the case of the image signal , the cts and the dts are correlated with each access unit . the encoder 11 sequentially outputs , to the time stamp calculation means 12 , the access unit correlated with the cts and the dts . the cts ( composition time stamp ) is information indicating time at which presentation or reproduction is performed , and the cts and the pts are sometimes used with the same meaning . the dts is information indicating time at which decoding is performed . the access unit is a collection of codes ( i . e ., input signals ) having identical dts . the input signals are signals to be encoded and decoded , such as image signals and audio signals . the time stamp calculation means 12 calculates a time stamp to be added to a media unit ( i . e ., a differential value of the dts and an offset value ) and includes a differential value calculation means 13 and an offset value calculation means 14 . the differential value calculation means 13 calculates a differential value between the dts of the access unit input from the encoder 11 and a dts of another access unit encoded immediately before this access unit . here , in a case in which the access unit is the head access unit , since no preceding access unit exists immediately before the head access unit , the differential value calculation means 13 calculates the differential value as ‘ 0 .’ at this time , since the differential value calculation means 13 sequentially performs processing to the access units which are continuous in the time direction , the differential value calculation means 13 temporarily stores in an unillustrated memory , as a dts of another access unit , the dts of the access unit for which differential value has been calculated . further , in a case in which the access unit is the second access unit or thereafter , the differential value calculation means 13 calculates a differential value between the dts of the input access unit and the dts of another access unit which is stored temporarily . the offset value calculation means 14 calculates an offset value which is a difference between the dts and the cts of the access unit input from the encoder 11 . that is , the offset value calculation means 14 calculates , as an offset value , a difference between the dts and the cts which are correlated with an identical access unit . then , the time stamp calculation means 12 sequentially outputs , to the encapsulation determination means 15 , the access unit input from the encoder 11 , the differential value calculated by the differential value calculation means 13 and the offset value calculated by the offset value calculation means 14 . the encapsulation determination means 15 determines , as an encapsulation unit , one or more access units which satisfy a later - described determination condition within predetermined determination time among the access units input from the time stamp calculation means 12 . this determination condition is a condition in which the differential values become identical and , at the same time , the offset values become identical . further , the encapsulation unit indicates an access unit that can be encapsulated in the same media unit . that is , the encapsulation determination means 15 determines whether sequentially input access units satisfy a determination condition while counting a timer . the encapsulation determination means 15 then determines , as an encapsulation unit , one or more access units which satisfy the determination condition when determination time elapsed on the timer . for example , in a case in which two access units input within the determination time satisfy the determination condition , the encapsulation determination means 15 determines the two access units as the identical encapsulation unit . on the other hand , in a case in which two access units input within the determination time do not satisfy the determination condition , the encapsulation determination means 15 determines the two access units as separate encapsulation units . then , the encapsulation determination means 15 outputs , for each encapsulation unit , a differential value , an offset value and an access unit included in the encapsulation unit . the encapsulation means 16 encapsulates ( i . e ., stores ), in a media unit , one or more access units determined as an encapsulation unit by the encapsulation determination means 15 and describes ( i . e ., adds ) the identical differential value and the identical offset value in ( to ) the media unit . with reference to fig2 ( a ) , a media unit 100 in which one access unit 200 is encapsulated will be described . the encapsulation means 16 describes an input differential value in a dts field 101 . further , the encapsulation means 16 describes an input offset value in a cts field 102 . then the encapsulation means 16 describes in an encapsulation determination information field ( length_flag ) 103 , as encapsulation determination information , a value indicating that size information is not included ( for example , ‘ 0 ’). this encapsulation determination information field 103 is secured , for example , as 2 bit width . the encapsulation means 16 encapsulates one access unit 200 into the media unit 100 ( au of fig2 ( a ) ). although the media unit 100 includes fields for a time stamp flag , an extension header flag , a random access point flag and the like , these fields are not directly related to the present invention and , therefore , description and illustration thereof will be omitted . further , details of the media unit 100 are described , for example , in a reference “ media transport system in hybrid broadcasting ” information processing society of japan research report , vol . 2011 - avn - 72 no . 1 2011 / 3 / 11 . next , as illustrated in fig2 ( b ) , the media unit 100 in which two access units 200 are encapsulated will be described . in this case , the encapsulation means 16 describes an input differential value in the dts field 101 . further , the encapsulation means 16 describes an input offset value in the cts field 102 . further , the encapsulation means 16 describes in the encapsulation determination information field 103 , as encapsulation determination information , a value indicating that size information is included ( for example , other than ‘ 0 ’). at this time , the encapsulation means 16 may describe , in the encapsulation determination information field 103 , different values for each media unit 100 so that the maximum size can be expressed among one or more access units 200 included in the same media unit 100 . for example , in a case in which the size of the access unit 200 exceeds 0 byte and is equal to or smaller than 64 kb ( i . e ., an expression range of 16 bits ), the encapsulation means 16 describes ‘ 1 ’ in the encapsulation determination information field 103 . at this time , the encapsulation means 16 secures a 16 bit width for a size information field ( au1_length , au2_length ) 104 . further , for example , the size of the access unit 200 exceeds 64 kb and is equal to or smaller than 16 mb ( i . e ., an expression range of 24 bits ), the encapsulation means 16 describes ‘ 2 ’ in the encapsulation determination information field 103 . further , the encapsulation means 16 secures a 24 bit width for the size information field 104 . further , for example , the size of the access unit 200 exceeds 16 mb and is equal to or smaller than 4 gb ( i . e ., an expression range of 32 bits ), the encapsulation means 16 describes ‘ 3 ’ in the encapsulation determination information field 103 . further , the encapsulation means 16 secures a 32 bit width for the size information field 104 . then the encapsulation means 16 describes size information of each access unit 200 in the size information field 104 secured by the predetermined bit width . further , the encapsulation means 16 encapsulates a plurality of access units 200 into the media unit 100 ( au1 and au2 of fig2 ( b ) ). next , with reference to fig3 , the differential values and the offset values described in the media unit 100 will be described ( see fig1 as necessary ). in this fig3 , it is supposed that six access units 200 1 to 200 6 have been generated continuously ( au1 to au6 of fig3 ). further , it is supposed that the access unit 200 1 is encapsulated in a first media unit 100 1 and the access units 200 2 and 200 3 are encapsulated in a second media unit 100 2 . further , it is supposed that the access units 200 4 and 200 5 are encapsulated in a third media unit 100 3 and the access unit 200 6 is encapsulated in a fourth media unit 100 4 . in the media unit 100 1 , since no other preceding access unit exists immediately before the access unit 200 1 , a differential value ‘ 0 ’ is described in a dts field 101 1 . further , in the media unit 100 1 , an offset value indicating a difference between a dts and a cts of the access unit 200 1 is described in a cts field 102 1 . in the media unit 100 2 , a differential value of a dts of the access unit 200 2 and the dts of the access unit 200 1 is described in a dts field 101 2 . further , in the media unit 100 2 , an offset value between the dts and a cts of the access unit 200 2 is described in a cts field 102 2 . here , the differential value between a dts of the access unit 200 3 and the dts of the access unit 200 2 is identical to the differential value between the dts of the access unit 200 2 and the dts of the access unit 200 1 . further , the offset value between the dts and a cts of the access unit 200 3 is identical to the offset value of the access unit 200 2 . therefore , in the media unit 100 2 , the dts field 101 2 and the cts field 102 2 can be shared by the access units 200 2 and 200 3 . in other words , since the dts field 101 and the cts field 102 are shared in the media unit 100 , the media unit 100 is not able to encapsulate access units 200 which have different differential values and offset values . in the media unit 100 3 , a differential value between a dts of the access unit 200 4 and the dts of the access unit 200 3 is described in a dts field 101 3 ( α of fig3 ). in the media unit 100 4 , a differential value between a dts of the access unit 200 6 and a dts of the access unit 200 5 is described in a dts field 101 4 ( β of fig3 ). in addition , since the media units 100 3 and 100 4 are similar to the media units 100 1 and 100 2 , description thereof will be omitted . further , in fig3 , since a part of the fields of the media unit 100 is not directly related to the present invention , illustration thereof is omitted . then , the encoding device 1 transmits , by a transmitting means ( not illustrated ), the media unit 100 generated by the encapsulation means 16 to the decoding device 2 via the network n . for example , the transmitting means converts the media unit 100 into ip packets , performs transmission path encoding processing and modulation processing in accordance with the network n , and transmits the generated ip packets . returning to fig1 , a configuration of the decoding device 2 will be described ( see fig2 and fig3 as necessary ). the decoding device 2 extracts one or a plurality of access units 200 from the media unit 100 transmitted by the encoding device 1 and decodes the extracted access units 200 . therefore , the decoding device 2 includes a multicapsule determination means 21 , a reverse encapsulation means ( i . e ., a media unit extraction means ) 22 , a time stamp reverse calculation means 23 and a decoder 26 . here , the decoding device 2 receives , by a reception means ( not illustrated ), a media unit 100 from the encoding device 1 via the network n . for example , the reception means performs demodulation processing and transmission path decoding processing in accordance with the network n and receives the ip packets . then the reception means extracts a media unit 100 from the received ip packets and sequentially outputs the extracted media unit 100 to the multicapsule determination means 21 . the multicapsule determination means 21 determines whether a plurality of access units 200 have been encapsulated into the media unit 100 based on the input encapsulation determination information field 103 of the media unit 100 . here , in a case in which the value of the encapsulation determination information field 103 is other than ‘ 0 ’ ( for example , ‘ 1 ’ to ‘ 3 ’), the multicapsule determination means 21 determines that a plurality of access units 200 have been encapsulated into the media unit 100 . on the other hand , in a case in which the value of the encapsulation determination information field 103 is ‘ 0 ,’ the multicapsule determination means 21 determines that a plurality of access units 200 have not been encapsulated into the media unit 100 . then the multicapsule determination means 21 sequentially outputs , to a reverse encapsulation means 22 , the determination result indicating whether a plurality of access units 200 have been encapsulated and the media unit 100 . when the determination result of the multicapsule determination means 21 shows that a plurality of access units 200 have not been encapsulated , the reverse encapsulation means 22 extracts ( i . e ., reverse encapsulates ) one access unit 200 from the input media unit 100 . in this case , since one access unit 200 can be extracted when the entire media unit 100 is read , it is not necessary for the reverse encapsulation means 22 to refer to the size information field 104 . the entire size of the media unit 100 can be specified by the reception means described above from a length information field included in a udp header of the ip packet , for example . further , when the determination result of the multicapsule determination means 21 shows that a plurality of access units 200 have been encapsulated , the reverse encapsulation means 22 extracts a plurality of access units 200 from the input media unit 100 . in this case , it is necessary for the reverse encapsulation means 22 to specify , with reference to the size information field 104 , a data field of the media unit 100 into which each access unit 200 is encapsulated . then the reverse encapsulation means 22 extracts , from the media unit 100 , the differential value described in the dts field 101 and the offset value described in the cts field 102 . then the reverse encapsulation means 22 sequentially outputs , to the time stamp reverse calculation means 23 , the access unit 200 , the differential value and the offset value extracted from the media unit 100 . the time stamp reverse calculation means 23 reversely calculates the dts and the cts of the access unit 200 from a time stamp ( i . e ., a differential value and an offset value ) and includes a dts reverse calculation means 24 and a cts reverse calculation means 25 . the dts reverse calculation means 24 performs reverse operation of the differential value calculation means 13 . the cts reverse calculation means 25 performs reverse operation of the offset value calculation means 14 . returning to fig3 , the reverse calculation of the dts by the dts reverse calculation means 24 and the reverse calculation of the cts by the cts reverse calculation means 25 will be described ( see fig1 as necessary ). in the first media unit 100 1 , since no other preceding access unit exists immediately before the access unit 200 1 and , therefore , ‘ 0 ’ is described in the dts field 101 1 as the differential value . therefore , the dts reverse calculation means 24 performs the reverse calculation with an absolute value of the dts of the access unit 200 1 being ‘ 0 ’. at this time , since the dts reverse calculation means 24 performs processing to the access units 200 which are continuous in the time direction , the dts reverse calculation means 24 temporarily stores the value of reversely calculated dts in an unillustrated memory as a dts of the latest access unit ( i . e ., another access unit ) 200 1 . the cts reverse calculation means 25 adds the offset value described in the cts field 102 1 as it is to the value of the reversely calculated dts in the access unit 200 1 and then reversely calculates as a cts of the access unit 200 1 . in the second media unit 100 2 , the differential value between the dts of the access unit 200 2 and the dts of the access unit 200 1 is described in the dts field 101 2 . therefore , the dts reverse calculation means 24 reversely calculates , as the dts of the access unit 200 2 , a value obtained by adding the dts of the access unit 200 1 temporarily stored in the memory and the differential value described in the dts field 101 2 . then the dts reverse calculation means 24 temporarily stores , in the memory described above , the value of the reversely calculated dts of the access unit 200 2 and updates memory content . that is , in this memory , each time the dts of the latest access unit 200 included in the media unit 100 is reversely calculated , the temporarily stored dts is updated . further , the cts reverse calculation means 25 reversely calculates , as the cts of the access unit 200 2 , a value obtained by adding the offset value described in the cts field 102 2 and the dts of the access unit 200 2 reversely calculated by the dts reverse calculation means 24 . here , the second media unit 100 2 further includes the access unit 200 3 . therefore , the dts reverse calculation means 24 and the cts reverse calculation means 25 reversely calculate the dts and the cts of the access unit 200 3 , respectively . that is , the dts reverse calculation means 24 adds the differential value described in the dts field 101 2 to the value of the dts temporarily stored in the memory ( i . e ., the value of the dts of the access unit 200 2 ) and reversely calculates the dts of the access unit 200 3 . further , the cts reverse calculation means 25 adds the value of the dts reversely calculated by the dts reverse calculation means 24 to the offset value described in the cts field 102 2 and reversely calculates the cts of the access unit 200 3 . since processing in the media units 100 3 and 100 4 is similar to that of the media units 100 1 and 100 2 , description thereof will be omitted . then the time stamp reverse calculation means 23 correlates the dts reversely calculated by the dts reverse calculation means 24 and the cts reversely calculated by the cts reverse calculation means 25 with the access unit 200 and outputs the correlated result to the decoder 26 . returning to fig1 , description about the configuration of the decoding device 2 will be continued . the decoder 26 decodes the access unit 200 input from the time stamp reverse calculation means 23 according to an image decoding scheme corresponds to the encoder 11 ( for example , mpeg - 2 video or mpeg - 4 avc ). since both the cts and the dts are correlated with the access unit 200 , this access unit 200 can be decoded according to the image decoding scheme described above . an operation of the encoding device 1 will be described with reference to fig4 ( see fig1 to fig3 as necessary ). the encoding device 1 encodes , by the encoder 11 , an image signal input from outside to generate an access unit 200 correlated with a cts and a dts ( step s 11 ). the encoding device 1 calculates , by the differential value calculation means 13 , a differential value of the dts for each access unit 200 . further , the encoding device 1 calculates , by the offset value calculation means 14 , an offset value between the dts and the cts for each access unit 200 ( step s 12 ). the encoding device 1 determines , by the encapsulation determination means 15 , whether a plurality of access units 200 satisfy a determination condition within determination time ( step s 13 ). here , in a case in which a plurality of access units 200 satisfy a determination condition ( step s 13 : yes ), the encoding device 1 determines these plurality of access units 200 as an encapsulation unit and proceeds to a process of step s 14 . the encoding device 1 describes , by the encapsulation means 16 , a differential value and an offset value in the media unit 100 . further , the encoding device 1 encapsulates , by the encapsulation means 16 , a plurality of access units 200 included in the encapsulation unit into the media unit 100 . further , the encoding device 1 describes , by the encapsulation means 16 , encapsulation determination information ( for example , any of ‘ 1 ’ to ‘ 3 ’) and size information in the media unit 100 ( step s 14 ). on the other hand , in a case in which one access unit 200 satisfies the determination condition ( step s 13 : no ), the encoding device 1 determines this one access unit 200 as an encapsulation unit and proceeds to a process of step s 15 . the encoding device 1 describes , by the encapsulation means 16 , a differential value and an offset value in the media unit 100 . further , the encoding device 1 encapsulates , by the encapsulation means 16 , one access unit 200 included in the encapsulation unit into the media unit 100 . the encoding device 1 describes , by the encapsulation means 16 , encapsulation determination information ( for example , ‘ 0 ’) in the media unit 100 ( step s 15 ). an operation of the decoding device 2 will be described with reference to fig5 ( see fig1 to fig3 as necessary ). the decoding device 2 determines , by the multicapsule determination means 21 , whether a plurality of access units 200 are encapsulated into the media unit 100 based on encapsulation determination information described in the media unit 100 input from the encoding device 1 ( step s 21 ). here , in a case in which a plurality of access units 200 are encapsulated ( step s 21 : yes ), the decoding device 2 proceeds to a process of step s 22 . the decoding device 2 extracts , by the reverse encapsulation means 22 , a plurality of access units 200 from the input media unit 100 based on size information ( step s 22 ). on the other hand , in a case in which a plurality of access units 200 are not encapsulated ( step s 21 : no ), the decoding device 2 proceeds to a process of step s 23 . the decoding device 2 extracts , by the reverse encapsulation means 22 , one access unit 200 from the input media unit 100 ( step s 23 ). the decoding device 2 reversely calculates , by the dts reverse calculation means 24 , a dts of the access unit 200 . further , the decoding device 2 reversely calculates , by the cts reverse calculation means 25 , a cts of the access unit 200 ( step s 24 ). the decoding device 2 decodes , by the decoder 26 , the access unit 200 of which dts and cts have been reversely calculated ( step s 25 ). as described above , in the encoding device 1 and the decoding device 2 according to the first embodiment of the present invention , even in a case in which a plurality of access units 200 are encapsulated , only one field indicating decoding timing ( for the differential value of the dts ) and only one field indicating decoding timing ( for the offset value ) are included in the media unit 100 ( fig2 ( b ) ). further , in a case in which one access unit 200 is encapsulated , the encoding device 1 and the decoding device 2 include no size information field in the media unit ( fig2 ( a ) ). in this manner , since no redundant field is included in the media unit 100 , the encoding device 1 and the decoding device 2 can reduce overheads in this media unit 100 and encapsulation can be performed in an optimum format . especially the encoding device 1 and the decoding device 2 can substantially reduce overheads in the media unit 100 compared with a case in which the fields of the dts and the cts are simply added to each access unit 200 . further , the encoding device 1 secures the size information field 104 with the number of bits in accordance with the size of the access unit 200 . therefore , the encoding device 1 can avoid a situation in which this size information field 104 becomes redundant and a situation in which the number of bits of the size information field 104 becomes insufficient . further , even in a case in which a plurality of access units 200 are encapsulated , the decoding device 2 can correctly specify a data field of each access unit 200 encapsulated into the media unit 100 by referring to the size information field 104 . therefore , the decoding device 2 can prevent data missing during extraction of the access unit 200 . with reference to fig6 , a content providing system 1000 a according to a second embodiment of the present invention will be described with respect to a difference from the first embodiment . the content providing system 1000 a provides content ( i . e ., audio ) and includes an encoding device 1 a and a decoding device 2 a . the encoding device 1 a encodes an audio signal as an input signal and provides the encoded audio signal to the decoding device 2 a . therefore , the encoding device 1 a includes an encoder 11 a , a time stamp calculation means 12 a , an encapsulation determination means 15 a and an encapsulation means 16 a . the encoder 11 a generates an access unit correlated with a cts by encoding an audio signal input from outside according to an encoding scheme in which the cts is used . here , the encoder 11 a encodes the input audio signal using an audio encoding scheme , such as mpeg - 2 aac ( advanced audio coding ), and generates an audio access unit . here , in a case in which a decoding order and a presentation order of the access unit are identical to each other as in the case of the audio signal , only the cts is correlated with each access unit . then the encoder 11 a outputs , to the time stamp calculation means 12 a , the access unit correlated with the cts . the time stamp calculation means 12 a calculates a time stamp to be added to a media unit ( i . e ., a differential value of the cts ) and includes a differential value calculation means 13 a . the differential value calculation means 13 a calculates , for each access unit , a differential value between the cts of the access unit and the cts of another access unit encapsulated in the immediately preceding media unit . since the differential value calculation means 13 a is similar to the differential value calculation means 13 of fig1 except that the cts is used instead of the dts , detailed description of the differential value calculation means 13 a will be omitted . the encapsulation determination means 15 a determines , as an encapsulation unit , one or more access units which satisfy a later - described determination condition within determination time among the access units input from the time stamp calculation means 12 a . since the encapsulation determination means 15 a is similar to the encapsulation determination means 15 of fig1 except that a determination condition in which differential values are the same is used , detailed description of the encapsulation determination means 15 a will be omitted . the encapsulation means 16 a encapsulates ( i . e ., stores ), in a media unit , one or more access units included in the encapsulation unit determined by the encapsulation determination means 15 a and adds the same differential values to the media unit . in the present embodiment , since the audio signal is encoded , the dts is not correlated with the access unit 200 but only the cts is correlated with the access unit 200 . therefore , as illustrated in fig7 ( a ) and 7 ( b ) , no dts field exists in the media unit 100 a output by the encapsulation means 16 a but only a cts field 102 exists in that media unit 100 a . then , as illustrated in fig8 , a differential value of the cts calculated by the differential value calculation means 13 a is described in the cts field 102 of this media unit 100 a . in addition , since the encapsulation means 16 a is similar to the encapsulation means 16 of fig1 , detailed description of the encapsulation means 16 a will be omitted . hereinafter , a configuration of the decoding device 2 a will be described . the decoding device 2 a extracts one or a plurality of access units 200 from the media unit 100 a transmitted by the encoding device 1 a and decodes the extracted access units 200 . therefore , the decoding device 2 a includes a multicapsule determination means 21 , a reverse encapsulation means ( i . e ., a media unit extraction means ) 22 , a time stamp reverse calculation means 23 a and a decoder 26 a . the time stamp reverse calculation means 23 a reversely calculates a cts corresponding to the access unit 200 from a time stamp ( i . e ., a differential value of the cts ) and includes a cts reverse calculation means 25 a . the cts reverse calculation means 25 a reversely calculates , as a cts of this access unit 200 , a value obtained by adding a differential value added to the media unit 100 a and a cts of another access unit located immediately before the access unit 200 . since the cts reverse calculation means 25 a is similar to the dts reverse calculation means 24 of fig1 except that the cts is used instead of the dts , detailed description of the cts reverse calculation means 25 a will be omitted . the decoder 26 a decodes the access unit 200 input from the time stamp reverse calculation means 23 a according to an audio decoding scheme corresponding to the encoder 11 a ( for example , mpeg - 2 aac ). since the cts is correlated with the access unit 200 , this access unit 200 can be decoded according to the audio decoding scheme described above . since the dts is not correlated with the decoder 26 a , the decoder 26 a performs decoding considering that the dts and the cts are identical to each other . as described above , in the encoding device 1 a and the decoding device 2 a according to the second embodiment of the present invention , the same effect as that of the first embodiment can be obtained for the audio content . with reference to fig9 , commonization of a media unit 100 b and switching of transmission paths will be described . as illustrated in fig9 , a content providing system 1000 b provides content ( i . e ., images ) and includes a ground distribution station ( i . e ., an encoding device ) 1 b , two receivers ( i . e ., decoding devices ) 2 b 1 and 2 b 2 , and a broadcasting satellite 92 . the ground distribution station 1 b transmits a media unit 100 b in which the content is stored to the receivers 2 b 1 and 2 b 2 via a network n . the receivers 2 b 1 and 2 b 2 receive the media unit 100 b from the ground distribution station 1 b via the network n and reproduce the content . further , the receivers 2 b 1 and 2 b 2 receive the media unit 100 b from the broadcasting satellite 92 via a broadcast wave w and reproduce the content . the broadcasting satellite 92 receives ( i . e ., uplinks ) the media unit 100 b from an unillustrated uplink station . then the broadcasting satellite 92 transmits ( i . e ., downlinks ) the received media unit 100 to the receivers 2 b 1 and 2 b 2 via the broadcast wave w . in this manner , a transmission path by the network n is established between the ground distribution station 1 b and the receiver 2 b 1 and between the ground distribution station 1 b and the receiver 2 b 2 . further , a transmission path by the broadcast wave w is established between the broadcasting satellite 92 and the receiver 2 b 1 and between the broadcasting satellite 92 and the receiver 2 b 2 . first , commonization of the media unit 100 b will be described . a case in which the same content is provided from the ground distribution station 1 b to both the receivers 2 b 1 and 2 b 2 in a conventional system will be considered . in the conventional system , a dts and a cts are included in each media unit in the form of absolute time . therefore , in the conventional system , there has been a problem that it is necessary to prepare media units corresponding to each of the receivers 2 b 1 and 2 b 2 and thus processing load becomes high . next , switching of the transmission paths will be described . for example , a case will be considered in which , when the broadcasting satellite 92 is transmitting the media unit to the receiver 2 b 1 , the transmission path is switched from the broadcast wave w to the network n due to rainfall attenuation and the media unit 100 b is transmitted from the ground distribution station 1 b . in the conventional system , the dts and the cts are included in the media unit in the form of the absolute time . therefore , in the conventional system , there has been a problem that it is necessary to prepare media units for each transmission path , such as the broadcast wave w and the network n , and thus the processing load becomes high . then , an object of the invention of this application is to solve the problems described above and to provide a ground distribution station ( i . e ., an encoding device ), a receiver ( i . e ., a decoding device ) and programs therefor that are capable of encapsulating in an optimum format . in view of the problem described above , the content providing system 1000 b adopts a format to add the base absolute time of the dts and the cts to a control signal ( not illustrated ) and to add a dts relative value and a cts relative value to an access unit ( not illustrated ). thus , in the content providing system 1000 b , if control signals corresponding to each of the receivers 2 b 1 and 2 b 2 are prepared , the same media unit 100 b can be used in common by the receivers 2 b 1 and 2 b 2 . that is , the media unit 100 b can be used as the minimum usage unit of the image medium and the audio medium . further , in the content providing system 1000 b , since the format described above is adopted , if the control signals are prepared for each transmission path , the same media unit 100 b can be transmitted to the receiver 2 b 1 while switching the transmission paths . a configuration of an encoding device 1 b will be described with reference to fig1 . the encoding device 1 b encodes an image signal as an input signal and provides the encoded image signal to a decoding device 2 b . therefore , the encoding device 1 b includes an encoder 11 , a time stamp calculation means 12 b , an encapsulation determination means 15 b , and an encapsulation means 16 b and a transmitting means 19 . although a network n is illustrated as the transmission path in this fig1 , the transmission path may instead be a broadcast wave w . the encoder 11 generates an access unit with ( to ) which a cts and a dts are correlated ( added ) by encoding an image signal input from outside according to an encoding scheme in which the cts and the dts are used . then the encoder 11 sequentially outputs , to the encapsulation determination means 15 b , the access unit correlated with the cts and the dts . the encapsulation determination means 15 b determines , as encapsulation unit , one or more access units input from the encoder 11 on a predetermined encapsulation condition . then the encapsulation determination means 15 b outputs the access units to the time stamp calculation means 12 b in an order in which the access units have been encoded for each encapsulation unit . this encapsulation condition is a condition which can be set arbitrarily : for example , a predetermined number of access units are defined as an encapsulation unit , or access units encoded within predetermined time are defined as an encapsulation unit . for example , if a delay is to be reduced , the encapsulation condition is set in advance with one access unit being defined as an encapsulation unit . further , the encapsulation condition may be set in advance with , in the case of image signals , the number of access units corresponding to gop ( group of picture ) ( for example , 15 ) being defined as an encapsulation unit . the time stamp calculation means 12 b calculates time stamps ( i . e ., the dts relative value and the cts relative value ) for each access unit and includes a dts relative value calculation means 17 and a cts relative value calculation means 18 . the dts relative value calculation means 17 calculates ‘ 0 ’ as a dts relative value of the access unit which is encoded first . further , the dts relative value calculation means 17 calculates , as a dts relative value of the access unit which is encoded second or thereafter , a difference between the dts of this access unit and the dts of another access unit encoded immediately before this access unit . the cts relative value calculation means 18 calculates , as the cts relative value of the access unit , a difference between the cts of this access unit and the cts of another access unit encoded immediately after this access unit . details of the dts relative value calculation means 17 and the cts relative value calculation means 18 will be described later . then , the time stamp calculation means 12 b outputs , to the encapsulation means 16 b , the access units input from the encapsulation determination means 15 b , the dts relative value calculated by the dts relative value calculation means 17 , and the cts relative value calculated by the cts relative value calculation means 18 in an order of encoding in each encapsulation unit . the encapsulation means 16 b encapsulates the access units input from the time stamp calculation means 12 b into the media unit 100 b in an order of encoding in each encapsulation unit . further , the encapsulation means 16 b adds the dts relative value and the cts relative value to each access unit and outputs the encapsulated media unit 100 b to the transmitting means 19 . the transmitting means 19 transmits the media unit 100 b input from the encapsulation means 16 b and a control signal 300 to the decoding device 2 b via the network n . the control signal 300 includes absolute time which indicates the head of the media unit 100 b . for example , the control signals 300 is information indicating a configuration of content and an acquisition source of a necessary component , and start - up control meta data in which absolute time is described ( see the reference ). as the absolute time , for example , the time of utc ( coordinated universal time ) or elapsed time based on the head of the content is set in advance . reference : aoki et al ., “ media transport system in hybrid broadcasting ” information processing society of japan research report , 2011 . here , it is desirable that the transmitting means 19 adds an id ( identifier ) and a sequence number to the media unit 100 b and the control signal 300 corresponding to the media unit 100 b . that is , an id is set in advance in each transmission path and the transmitting means 19 adds , to the media unit 100 b and to the control signal 300 , an id in accordance with the transmission path along which the media unit 100 b is transmitted . further , transmitting means 19 includes a management table ( not illustrated ) with which a sequence number already added to the media unit 100 b is managed . then the transmitting means 19 increments the sequence number of this management table and adds the incremented sequence number as a sequence number of a new media unit 100 b . the id is identification information which is common in predetermined media units 100 b . for example , since the same value is given to the media unit 100 b of the same transmission path , the id is a unique value which neither overlaps other distribution environments nor depends on the distribution environment . the sequence number is identification information specific to each media unit 100 b . that is , each media unit 100 b can be uniquely identified by a set of the id and the sequence number . with reference to fig1 , a concrete example of encapsulation by the encoding device 1 b will be described . in fig1 , the cts field 102 is illustrated as an “ au display period ” and a sequence number field 106 is illustrated as “ seq_no .” in this fig1 , it is supposed that six access units 200 1 to 200 6 have been generated continuously ( au1 to au6 of fig1 ). further , in fig1 , it is supposed that an encapsulation condition has been set with three access units 200 being defined as an encapsulation unit . therefore , the encapsulation determination means 15 b determines the encapsulation unit of the first media unit 100 b 1 as the access units 200 1 to 200 3 and determines the encapsulation unit of the second media unit 100 b 2 as the access units 200 4 to 200 6 . further , in fig1 , it is supposed that the media units 100 b 1 and 100 b 2 and control signals 300 1 and 300 2 corresponding to these media units 100 b 1 and 100 b 2 are transmitted along the same transmission path . the dts relative value calculation means 17 calculates ‘ 0 ’ as the dts relative value of the head access unit 200 1 and describes ‘ 0 ’ in the dts field 101 1 . further , the dts relative value calculation means 17 calculates , as the dts relative value of the second access unit 200 2 , a difference between the dts of this access unit 200 2 and the dts of the head access unit 200 1 , and describes the calculated value in the dts field 101 2 . further , the dts relative value calculation means 17 calculates , as the dts relative value of the third access unit 200 3 , a difference between the dts of this access unit 200 3 and the dts of the second access unit 200 2 , and describes the calculated value in the dts field 101 3 . here , the dts relative value calculation means 17 calculates a dts relative value between the access units 200 3 and 200 4 encapsulated in the different media units 100 b 1 and 100 b 2 if these media units 100 b 1 and 100 b 2 have the same id . that is , the dts relative value calculation means 17 calculates , as a dts relative value of the fourth access unit 200 4 , a difference between the dts of this access unit 200 4 and the dts of the third access unit 200 3 and describes the calculated difference in the dts field 101 4 . further , the dts relative value calculation means 17 calculates , as a dts relative value of fifth access unit 200 5 , a difference between the dts of this access unit 200 5 and the dts of the fourth access unit 200 4 and describes the calculated value in a dts field 101 5 . further , the dts relative value calculation means 17 calculates , as a dts relative value of sixth access unit 200 6 , a difference between the dts of this access unit 200 6 and the dts of the fifth access unit 200 5 and describes the calculated value in a dts field 101 6 . that is , the dts relative value calculation means 17 calculates the dts relative values as illustrated in following expression ( 1 ) to ( 6 ) and describes the calculated dts relative values in the dts field 101 . the cts relative value calculation means 18 calculates , as a cts relative value of the head access unit 200 1 , a difference between the cts of this access unit 200 1 and the cts of the second access unit 200 2 and describes the calculated value in the cts field 102 1 . further , the cts relative value calculation means 18 calculates , as a cts relative value of the second access unit 200 2 , a difference between the cts of this access unit 200 2 and the cts of the third access unit 200 3 and describes the calculated value in the cts field 102 2 . here , the cts relative value calculation means 18 calculates a cts relative value between the access units 200 3 and 200 4 encapsulated in the different media units 100 b 1 and 100 b 2 if these media units 100 b 1 and 100 b 2 have the same id . that is , the cts relative value calculation means 18 calculates , as a cts relative value of the third access unit 200 3 , a difference between the cts of this access unit 200 3 and the cts of the fourth access unit 200 4 and describes the calculated value in a cts field 102 3 . further , the cts relative value calculation means 18 calculates , as a cts relative value of the fourth access unit 200 4 , a difference between the cts of this access unit 200 4 and the cts of the fifth access unit 200 5 and describes the calculated value in a cts field 102 4 . further , the cts relative value calculation means 18 calculates , as a cts relative value of the fifth access unit 200 5 , a difference between the cts of this access unit 200 5 and the cts of the sixth access unit 200 6 and describes the calculated value in a cts field 102 5 . further , the cts relative value calculation means 18 calculates , as a cts relative value of the sixth access unit 200 6 , a difference between the cts of this access unit 200 6 and the cts of a seventh access unit 200 ( not illustrated ) and describes the calculated value in a cts field 102 6 . in a case in which the sixth access unit 200 6 is the last access unit , it is only necessary for the cts relative value calculation means 18 to consider any of the time when the input signal is interrupted , when the encoder 11 stops its operation and when time is out as the cts of the seventh access unit 200 and to calculate a cts relative value . that is , the cts relative value calculation means 18 calculates the cts relative values as expressed in the following expressions ( 7 ) to ( 12 ) and describes the calculated cts relative values in the cts field 102 . the transmitting means 19 describes an id common in the media units 100 b 1 and 100 b 2 and the control signals 300 1 and 300 2 ( for example , ‘ 1 ’) in id fields 105 1 and 105 2 of the media units 100 b 1 and 100 b 2 and in id fields 301 1 and 301 2 of the control signals 300 1 and 300 2 . further , the transmitting means 19 describes a sequence number of the media unit 100 b 1 ( for example , ‘ 1 ’) in a sequence number field 106 1 of the media unit 100 b 1 and in a sequence number field 302 1 of the control signal 300 1 corresponding to the media unit 100 b 1 . further , the transmitting means 19 describes absolute time indicating the head of the media unit 100 b 1 ( i . e ., absolute time indicating the head of mu1 ( t_mu1 )) in an absolute time field 303 1 of the control signal 300 1 . further , the transmitting means 19 describes a sequence number of the media unit 100 b 2 ( for example , ‘ 2 ’) in a sequence number field 106 2 of the media unit 100 b 2 and in a sequence number field 302 2 of a control signal 300 2 corresponding to the media unit 100 b 2 . further , the transmitting means 19 describes absolute time indicating the head of the media unit 100 b 2 ( i . e ., absolute time indicating the head of mu2 ( t_mu2 )) in an absolute time field 303 2 of the control signal 300 2 . although not illustrated in fig1 , the media units 100 b 1 and 100 b 2 may include an encapsulation determination information field 103 and a size information field 104 ( fig2 ) as in the case of the first embodiment . in this case , the encapsulation means 16 b describes in the encapsulation determination information field 103 , as encapsulation determination information , a value indicating that size information is included ( for example , other than ‘ 0 ’). further , the encapsulation means 16 b describes size information of each access unit 200 in the size information field 104 . with reference to fig1 , additional explanation on a relationship between the absolute time “ t_mu ” and the cts relative value will be given ( see fig1 and fig1 as necessary ). the cts of the head access unit 200 1 and the absolute time are the same . in other words , the cts and the dts of the head access unit 200 1 become identical . the cts of the second access unit 200 2 is a value obtained by adding δt_au1 to the cts of the head access unit 200 1 . in other words , δt_au1 represents a difference between the cts of the second access unit 200 2 and the cts of the head access unit 200 1 . therefore , this δt_au1 is described in the cts field 102 1 as the cts relative value of the head access unit 200 1 . the cts of the third access unit 200 3 is a value obtained by adding δt_au2 to the cts of the second access unit 200 2 . in other words , δt_au2 represents a difference between the cts of the third access unit 200 3 and the cts of the second access unit 200 2 . therefore , this δt_au2 is described in the cts field 102 2 as the cts relative value of the second access unit 200 2 . since the fourth access unit 200 4 or thereafter are similar to those described above , description will be omitted . returning to fig1 , a configuration of the decoding device 2 b will be described . the decoding device 2 b extracts one or more access units 200 from the media unit 100 b transmitted by the encoding device 1 b and decodes the extracted access units 200 . therefore , the decoding device 2 b includes a reverse encapsulation means ( i . e ., a media unit extraction means ) 22 b , a time stamp reverse calculation means 23 b , a decoder 26 and a receiving means 27 . the reception means 27 receives a media unit 100 b and a control signal 300 from the encoding device 1 via the network n or the broadcast wave w . then the reception means 27 sequentially outputs the received media unit 100 b and the control signal 300 to the reverse encapsulation means 22 b . the reverse encapsulation means 22 b extracts ( i . e ., reverse encapsulates ) one or more access units 200 from the media unit 100 b input from the receiving means 27 . here , the reverse encapsulation means 22 b specifies , with reference to the size information field 104 , a data field of the media unit 100 b into which each access unit 200 is encapsulated . then the reverse encapsulation means 22 b outputs the access units 200 to the time stamp reverse calculation means 23 b in an order in which the access units 200 have been extracted from the media unit 100 b . further , the reverse encapsulation means 22 b outputs the control signal 300 input from the receiving means 27 to the time stamp reverse calculation means 23 b . the time stamp reverse calculation means 23 b reversely calculates the dts and the cts of the access unit 200 from a time stamp ( i . e ., the dts relative value and the cts relative value ) and includes a dts reverse calculation means 24 b and a cts reverse calculation means 25 b . the dts reverse calculation means 24 b reversely calculates absolute time of the control signal 300 corresponding to the media unit 100 b as the dts of the access unit 200 located at the head . further , the dts reverse calculation means 24 b reversely calculates , as a dts of the access unit 200 located at the second place or thereafter , a value obtained by adding the dts relative value of the access unit 200 and the dts of another access unit located immediately before the access unit 200 . the cts reverse calculation means 25 b reversely calculates , as a cts of another access unit located immediately after the access unit 200 , a value obtained by adding absolute time of the control signal 300 corresponding to the media unit 100 b and a sum of the cts relative values of from the access unit 200 located at the head to this access unit 200 . with reference to fig1 , a concrete example of reverse encapsulation by the decoding device 2 b will be described ( see fig1 as necessary ). the dts reverse calculation means 24 b obtains a correlation between the media unit 100 b and the control signal 300 with reference to the id and the sequence number . in the example of fig1 , the dts reverse calculation means 24 b correlates a media unit 100 b 1 of which id =‘ 1 ’ and sequence number =‘ 1 ’ with the control signal 300 1 . further , the dts reverse calculation means 24 b correlates a media unit 100 b 2 of which id =‘ 1 ’ and sequence number =‘ 2 ’ with the control signal 300 2 . further , the dts reverse calculation means 24 b reversely calculates , as the dts of the head access unit 200 1 , absolute time described in the absolute time field 303 1 of the control signal 300 1 . further , the dts reverse calculation means 24 b reversely calculates , as a dts of the second access unit 200 2 , a value obtained by adding the dts relative value described in the dts field 101 2 of this access unit 200 2 and the already obtained dts of the head access unit 200 1 . further , the dts reverse calculation means 24 b reversely calculates , as a dts of the third access unit 200 3 , a value obtained by adding the dts relative value described in the dts field 101 3 of this access unit 200 3 and the already obtained dts of the second access unit 200 2 . here , the dts reverse calculation means 24 b reversely calculates a dts between the access units 200 3 and 200 4 encapsulated in the different media units 100 b 1 and 100 b 2 if these media units 100 b 1 and 100 b 2 have the same id . that is , the dts reverse calculation means 24 b reversely calculates , as a dts of the fourth access unit 200 4 , a value obtained by adding the dts relative value described in the dts field 101 4 of this access unit 200 4 and the already obtained dts of the third access unit 200 3 . further , the dts reverse calculation means 24 b reversely calculates , as a dts of the fifth access unit 200 5 , a value obtained by adding the dts relative value described in the dts field 101 5 of this access unit 200 5 and the already obtained dts of the fourth access unit 200 4 . further , the dts reverse calculation means 24 b reversely calculates , as a dts of the sixth access unit 200 6 , a value obtained by adding the dts relative value described in the dts field 101 6 of this access unit 200 6 and the already obtained dts of the fifth access unit 200 5 . that is , the dts reverse calculation means 24 b reversely calculates the dts as expressed in the following expressions ( 13 ) to ( 17 ). the cts reverse calculation means 25 b obtains a correlation between the media unit 100 b and the control signal 300 with reference to the id and the sequence number as in the case of the dts reverse calculation means 24 b . further , the cts reverse calculation means 25 b reversely calculates , as a cts of the head access unit 200 1 , absolute time described in the absolute time field 303 1 of the control signal 300 1 . further , the cts reverse calculation means 25 b reversely calculates , as a cts of the second access unit 200 2 , a value obtained by adding absolute time of the control signal 300 1 and the cts relative value of the head access unit 200 1 . further , the cts reverse calculation means 25 b calculates a sum of the cts relative values of the access units 200 1 and 200 2 . then the cts reverse calculation means 25 b reversely calculates a value obtained by adding absolute time to this sum as a cts of the third access unit 200 3 . here , the cts reverse calculation means 25 b reversely calculates a cts between the access units 200 3 and 200 4 encapsulated in the different media units 100 b 1 and 100 b 2 if these media units 100 b 1 and 100 b 2 have the same id . that is , the cts reverse calculation means 25 b calculates a sum of the cts relative values of the access units 200 1 to 200 3 . then the cts reverse calculation means 25 b reversely calculates a value obtained by adding absolute time to this sum as a cts of the fourth access unit 200 4 . further , the cts reverse calculation means 25 b calculates a sum of the cts relative values of the access units 200 1 to 200 4 . then the cts reverse calculation means 25 b reversely calculates a value obtained by adding absolute time to this sum as a cts of the fifth access unit 200 5 . further , the cts reverse calculation means 25 b calculates a sum of the cts relative values of the access units 200 1 to 200 5 . then the cts reverse calculation means 25 b reversely calculates a value obtained by adding absolute time to this sum as a cts of the sixth access unit 200 6 . here , additional explanation on the absolute time “ t_mu2 ” of the control signal 300 2 will be given . in a case in which a broadcast wave w is used , decoding devices 2 b which begin receiving at various timings exist in the content providing system 1000 b . here , a case in which a certain decoding device 2 b has not been able to receive a control signal 300 1 will be considered . in this case , the decoding device 2 b receives a subsequent control signal 300 2 and reversely calculates , using absolute time “ t_mu2 ” of this control signal 300 2 , the dts and the cts of the access units 200 4 to 200 6 encapsulated into the media unit 100 b 2 . in this manner , the decoding device 2 b begins reproduction of content starting at the media unit 100 b 2 corresponding to the control signal 300 2 which the decoding device 2 b has been able to receive . that is , in the content providing system 1000 b , in order that the decoding device 2 b may begin receiving at arbitrary timing , it is desirable to periodically transmit , to the decoding device 2 b , the control signal 300 to which absolute time is added . further , in a case in which the decoding device 2 b receives the media units 100 b continuously , absolute time of the control signal 300 2 is not necessary if the fourth access unit 200 4 is promptly displayed after the third access unit 200 3 . however , in the content providing system 1000 b , a clock frequency of the encoding device 1 b and a clock frequency of the decoding device 2 b do not necessarily coincide precisely . therefore , in the content providing system 1000 b , there is a possibility that an error ( i . e ., a clock drift ) occurs in absolute time if the cts relative value of each access unit 200 is accumulated . therefore , in the content providing system 1000 b , mapping to absolute time is performed at relatively short intervals to prevent serious errors from occurring . that is , in the content providing system 1000 b , in order to reduce errors in the cts in the access unit 200 , it is desirable to periodically transmit , to the decoding device 2 b , the control signal 300 to which absolute time is added . then the time stamp reverse calculation means 23 b sequentially outputs , to the decoder 26 , the access units 200 for which the dts and the cts have been reversely calculated . returning to fig1 , description about the configuration of the decoding device 2 b will be continued . the decoder 26 decodes the access unit 200 input from the time stamp reverse calculation means 23 b according to an image decoding scheme corresponding to the encoder 11 . since both the cts and the dts are correlated with the access unit 200 , this access unit 200 can be decoded according to the image decoding scheme described above . an operation of the encoding device 1 b will be described with reference to fig1 ( see fig1 to fig1 as necessary ). the encoding device 1 b encodes , by the encoder 11 , an image signal input from outside to generate an access unit 200 correlated with a cts and a dts ( step s 31 ). the encoding device 1 b determines , by the encapsulation determination means 15 b , one or more access units as an encapsulation unit on a predetermined encapsulation condition ( step s 32 ). the encoding device 1 b calculates the dts relative value by the dts relative value calculation means 17 ( step s 33 ). the encoding device 1 b calculates the cts relative value by the cts relative value calculation means 18 ( step s 34 ). the encoding device 1 b encapsulates , by the encapsulation means 16 b , the access units 200 into the media unit 100 b and adds the dts relative value and the cts relative value to each access unit 200 ( step s 35 ). the encoding device 1 b transmits , by the transmitting means 19 , the encapsulated media unit 100 b and the control signal 300 corresponding to this media unit 100 b to the decoding device 2 b via the network n ( step s 36 ). an operation of the decoding device 2 b will be described with reference to fig1 ( see fig1 to fig1 as necessary ). the decoding device 2 b receives , by the receiving means 27 , the media unit 100 b and the control signal 300 from the encoding device 1 b via the network n or the broadcast wave w ( step s 41 ). the decoding device 2 b extracts , by the reverse encapsulation means 22 b , one or more access units 200 from the media unit 100 b ( step s 42 ). the decoding device 2 b reversely calculates the dts by the dts reverse calculation means 24 b ( step s 43 ). the decoding device 2 b reversely calculates the cts by the cts reverse calculation means 25 b ( step s 44 ). the decoding device 2 b decodes , by the decoder 26 , the access units 200 of which the dts and the cts are reversely calculated ( step s 45 ). as described above , in the encoding device 1 b and the decoding device 2 b according to the third embodiment of the present invention , a format in which the base absolute time of the dts and the cts are added to a control signal 300 and in which the dts relative value and the cts relative value are added to the access unit 200 is adopted . therefore , the encoding device 1 b and the decoding device 2 b can easily change the time when the access unit 200 is decoded and the time when the access unit 200 is presented or reproduced only by rewriting the absolute time of the control signal 300 . further , the encoding device 1 b and the decoding device 2 b can easily implement commonization of the media unit 100 b and switching of the transmission paths . with reference to fig1 to fig1 , a content providing system 1000 c according to a fourth embodiment of the present invention will be described with respect to a difference from the third embodiment . the content providing system 1000 c provides content ( i . e ., audio ) and includes an encoding device 1 c and a decoding device 2 c . the encoding device 1 c encodes an audio signal as an input signal and provides the encoded audio signal to the decoding device 2 c . as illustrated in fig1 , since a configuration of the encoding device 1 c is similar to that of the encoding device 1 b of fig1 except that an encoder 11 a is provided instead of the encoder 11 and that the dts relative value calculation means 17 is excluded , detailed description of the configuration of the encoding device 1 c will be omitted . further , as illustrated in fig1 , since an operation of the encoding device 1 c is similar to that illustrated in fig1 except that step s 33 is not performed , detailed description of the operation of the encoding device 1 c will be omitted . the decoding device 2 c extracts an access unit 200 from a media unit 100 c transmitted by the encoding device 1 c and decodes the extracted access unit 200 . as illustrated in fig1 , since a configuration of the decoding device 2 c is similar to that of the decoding device 2 b of fig1 except that a decoder 26 a is provided instead of the decoder 26 and that the dts reverse calculation means 24 b is excluded , detailed description of the configuration of the decoding device 2 c will be omitted . further , as illustrated in fig1 , since an operation of the decoding device 2 c is similar to that illustrated in fig1 except that step s 43 is not performed , detailed description of the operation of the decoding device 2 c will be omitted . as illustrated in fig1 , since the media unit 100 c and the control signal 300 are similar to those illustrated in fig1 except that the dts field 101 is not included in the media unit 100 c , detailed description of the media unit 100 c and the control signal 300 will be omitted . as described above , in the encoding device 1 c and the decoding device 2 c according to the fourth embodiment of the present invention , the same effect as that of the third embodiment can be obtained for the audio content . functions of the encoding device and the decoding device according to each embodiment may be implemented by a computer . in that case , the present invention may implement the functions by recording a program for implementing these functions on a computer - readable recording medium , and causing a computer system to read and execute the program recorded on the recording medium . the “ computer system ” here should include an os and hardware , such as peripheral equipment . further , the “ computer - readable recording medium ” should include a portable medium , such as a flexible disk , a magnetic - optical disk , a rom and a cd - rom , and a storage device , such as a hard disk incorporated in a computer system . further , the “ computer - readable recording medium ” may include a medium which dynamically retains a program for a short time , such as a communication line on which the program is transmitted like a network , such as the internet , and a communication line , such as a telephone line , and a medium which retains a program for a certain period of time , like a volatile memory incorporated in a computer system used as a server or a client in the case described above . further , the program described above may be for implementing a part of the function described above and , moreover , may implement the function described above in combination with a program already recorded on a computer system . although each embodiment of the present invention has been described , the present invention is not limited to the same and can be implemented in a range without changing the purport thereof . modification of the embodiments will be described below . although the image is handled by the content providing system 1000 and the audio is handled by the content providing system 1000 a in the foregoing description , the present invention may also handle both the image and the audio . in this case , in the content providing side , the encoding device 1 of fig1 generates a media unit of the image and the encoding device 1 a of fig6 generates a media unit of the audio . then , in the content providing side , the media unit of the image and the media unit of the audio are multiplexed and transmitted to the content receiving side . further , in the content receiving side , the multiplexed media unit is divided into the media unit of the image and the media unit of the audio . then , in the content receiving side , the media unit of the image is decoded by the decoding device 2 of fig1 and the media unit of the audio is decoded by the decoding device 2 a of fig6 . further , the content providing systems 1000 and 100 a may include two or more encoding devices 1 and 1 a and two or more decoding devices 2 and 2 a . further , in the content providing systems 1000 and 100 a , the media unit generated by the encoding devices 1 and 1 a may be recorded on a magneto - optical recording medium and may be provided to the decoding devices 2 and 2 a in an offline manner , such as mailing . further , in the content providing systems 1000 and 100 a , the encoding devices 1 and 1 a and the decoding devices 2 and 2 a may be provided in the same device , the media units generated by the encoding devices 1 and 1 a may be accumulated , and the accumulated media units may be provided to the decoding devices 2 and 2 a .
| 7 |
reference will now be made in detail to exemplary embodiments of the present invention , examples of which are illustrated in the accompanying drawings . given the rapidly increasing processing power of mobile devices and the availability of mobile sdks , a hosted application browser of the related art , such as a hosted voicexml browser , may be moved directly to an end user &# 39 ; s mobile device . in other words , an application browser , such as a voicexml browser , and other , associated components may be deployed as a mobile application and implemented on the mobile device to allow a voicexml application to be processed directly on the mobile device . this concept may also be known as mobile direct self service ( mdss ). mdss may provide the benefit of reduced cost or , in the case of simple applications , no hosting cost to companies , for example . in addition , the end - user features that mdss provides may allow applications to become more user - friendly . fig2 illustrates a mdss system in accordance with an exemplary embodiment of the present invention . as shown in fig2 , a mobile device 205 communicates with client systems 210 and media resource systems 215 of a vendor . the mobile device 205 may include an application browser 220 that interacts with a cti manager 225 and a media resource gateway 230 . the cti manager 225 and the media resource gateway 230 may also be included in the mobile device 205 . these components may utilize the mobile device &# 39 ; s 205 mobile broadband or wireless connection to communicate with the client systems 210 or the service vendor &# 39 ; s media resource systems 215 . the mobile device 205 may be , for example , a cellular phone , a pda , or an iphone , and may operate , for example , in a cdma or gsm network . the mobile device 205 may also include a gps component 235 to provide , for example , location - based services to the user of the mobile device 205 . as is the case in the related art , the client systems 210 may include a voicexml application server 240 and a cti management server 245 . the vendor &# 39 ; s media resources systems 215 may include an mrcp speech recognition server 250 , a media resource gateway 255 , and a mrcp tts server 260 . the application browser 220 of the mobile device 205 may be a voicexml 2 . 1 compliant browser with a minimal memory footprint and minimal processing overhead . unlike the voicexml browsers used in a hosted environment in the related art , the application browser or voicexml browser 220 may only need to be able to handle one call . therefore , the required processing power is significantly reduced . in addition , the voicexml browser 220 may be able to handle a majority of the call flow required to provide an ivr application to the user of the mobile device 205 . the voicexml browser 220 may send application requests to the voicexml application server 240 , and the requested voicexml application may be delivered from the voicexml application server 240 to the voicexml browser 220 . the cti manager 225 may communicate important telephony events to the client systems 210 , in particular to the cti management server 245 . such telephony events may include , for example , set up , deliver ( ringing ), establish ( answer ), clear ( hang up ), end , hold , retrieve from hold , conference , transfer , forward , etc . when a legitimate call is being processed on the mobile device 205 , the cti data provided by the cti manager 225 may be used , in conjunction with data of the voicexml application server 240 , to authorize access to advanced mrcp features . the advanced mrcp features may include automatic speech recognition ( asr ) that may be provided by the mrcp speech recognition server 250 or text - to - speech ( tts ) that may be provided by the mrcp tts server 260 , for example . proper authentication may be important because mrcp features may be charged per transaction by the vendor . also , the cti manager 225 may be important with respect to transfers . transfers that usually depend on a carrier &# 39 ; s advanced features may need to be implemented by other means , so it may be necessary for user - to - user information ( uui ) and other call data to be transferred out - of - band . the media resource gateway 255 may provide advanced services , such as asr or tts to the application , by bridging communication between the voicexml browser 220 and the mrcp services . as part of authorizing communication to media resources , mrcp requests from the voice xml browser 220 may be directed through the media resource gateway 255 . the gateway layer may handle authentication and then host the mrcp communication through the established channel . if the mobile device 205 is capable of processing speech or generating tts on its own , resources not requiring vendor - specific handling may be passed off to the mobile device 205 by the media resource gateways 230 , 255 , thereby saving the application provider additional advanced service fees . to facilitate the configuration of mdss components prior to running a vxml document , a mobile direct self service file (. mdss ) may be used . this file may be an xml - based configuration file that contains the configuration settings of the media resource gateways 230 , 255 and the cti manager 225 as well as the url of the intended voicexml target . having a unique file type for voice applications targeted to mobile devices may also be useful in allowing seamless integration of mdss into a web environment . a mobile device may automatically launch the mdss application when the user follows a link that provides mdss content . the format of such a file may be defined , published and validated via standard xml validation methods . simple blind transfers may be accomplished by allowing the mdss application to access the phone &# 39 ; s system apis ( application programming interfaces ) to simply dial the transfer number . more complicated transfers may require functions that may be unavailable within the realm of the mobile device &# 39 ; s capabilities on the mobile carrier &# 39 ; s network . to implement these transfers may require dialing a toll - free number that has carrier - advanced features and then utilizing cti data to execute the transfer . the following may be exemplary applications of mdss that may be advantageous to , for example , the end users , vendors , service providers , companies and clients involved . with respect to access to ivr applications , in the case of mdss , the user may be allowed to access applications via web urls rather than phone numbers . a client &# 39 ; s site may list individual urls for each subsection of their application , giving the user direct access to billing or technical support features , without the need for the client to have individual phone numbers for each service . having direct access to the voicexml interpretation allows the user to easily “ pause ” the ivr , and it may be relatively simple to provide a complete range of controls a user would normally be accustomed to with other media , such as fast forward , rewind , etc . instead of having to rely on the application &# 39 ; s menu repeat options , the user may interact with the browser instructing it to scan through a prompt in reverse , go back to the beginning of the current prompt or menu , or even go to a previous menu and either accept the user &# 39 ; s original response again or provide new input . to support such features , when it comes to application reporting , it may be beneficial to create new voicexml events that the browser can handle , so reporting can accurately reflect the user &# 39 ; s navigation . fig3 shows an exemplary illustration of mdss voicexml navigation . having direct access to the call flow data may allow implementing user - defined hotkeys or “ bookmarks ” in a voicexml application . if the user would like to return to a portion of an application at a later time , he or she may press a hotkey capture button , which may then suspend the running voicexml application . the mdss browser may store the current state and the input required to reach that state . after speaking or entering a bookmark identifier , the application may resume normally . at a later time , the user may request access to the bookmark , and this may instruct mdss to run load the application and automatically proceed to the bookmarked state if modifications to the applications do not prevent it . in the case where the application has been modified , mdss may provide a message to the user indicating the bookmark needs to be updated ; present the user with the prompt where the application changed ; and wait for the user to indicate that he or she has once again reached the point in the application the user wishes to bookmark . location - based services is another area in which having the mdss browser running directly on the mobile device may be of advantage . providing location - based information to customers may mean to add more value in the mobile realm . rather than relying on complicated data exchanges to determine the location of the caller , the browser may directly access the device &# 39 ; s gps coordinates and pass them on to the application server . this may all be done as part of the initial request to the application server . self - service applications may then be catered for the caller &# 39 ; s current location prior to even the first prompt . multimedia resources , as illustrated , for example , in fig4 , may be referenced within the voicexml application , allowing the mobile device to display supplemental data during the progress of the call . this may be utilized by providing an image of the caller &# 39 ; s current billing statement when the caller requests payment information ; by providing a video clip of the steps required to reset a satellite receiver when the caller is requesting technical support ; or even by launching a web page with a registration form when the caller wants to enroll in some special program . there may also be the branding aspect that may be important to many companies , so a company logo , customer notifications , or advertising may be displayed on the mobile device while working with their ivr . in the voip world , it may be common for a conference call to be presented along with video conferencing or a shared desktop for a presentation . mdss may add functionality in the voice self - service world because the multimedia may also interact back with the ivr . for example , if the caller has a question about their bill , mdss may display the caller &# 39 ; s recent billing statement on the screen and allow the user to select the billing line - item the caller has a question about and say “ what is this charge ”? again , due to the fact that the voicexml interpretation is happening locally on the caller &# 39 ; s phone , the act of selecting an item on the screen may be passed to the browser as input without complex data exchanges . this sort of interaction may be simplified because mdss is just a single application that accepts multiple forms of input . mdss may be an industry standard that may be implemented by mobile device builders as part of their devices &# 39 ; core features . there may be several versions of mdss to support various mobile device architectures . open development environments like j2me may aid in that sort of development , but each device may require its own special development for its unique features or hardware . fig5 illustrates a method in accordance with an exemplary embodiment of the present invention . in step 510 , an application browser that is implemented on an mdss mobile device may request an application from an application server . the application browser may be a voicexml browser ; the application may be a voicexml application ; and the application server may be a voicexml application server . in step 520 , a cti manager may provide cti data . the cti manager may also be implemented on the mdss mobile device . the cti data , in conjunction with data from the application server , may authorize access to advanced mrcp services such as asr or tts . in step 530 , the advanced mrcp services may be provided to the application that was requested by the application browser . the advanced mrcp services may be provided by a media resource gateway . fig6 illustrates another method in accordance with an exemplary embodiment of the present invention . in step 610 , a mdss mobile device displays a representation of at least one contact device on a display of the mdss mobile device . in step 620 , a user of the mdss mobile device may select one or more of the contact devices from the displayed representation . further , at step 630 , a communication link may be established between the mdss mobile device and the selected contact devices . once the communication link has been established , at step 640 , the user of the contact device may be presented with a multimedia presentation . this may include , for example , a telephone voice recording , or even a video . in step 650 , the user of the contact device may be solicited for input regarding the content of the multimedia presentation . this can include , for example , any number of solicited responses known in the art . further , the results of the solicitation may also be collected . as will be recognized by those skilled in the art , the innovative concepts described in the present application can be modified and varied over a wide range of applications . accordingly , the scope of patented subject matter should not be limited to any of the specific exemplary teachings discussed above , but is instead defined by the following claims .
| 7 |
generally stated , the non - limitative illustrative embodiment of the present disclosure provides a system and a method for improving the quality of images obtained from an imaging system , such as an ultrasound imaging system , through the application of an image restoration process in order to recover clinically important image details , which are often masked due to resolution limitations . in common ultrasound imaging systems , the spatial resolution is severely limited due to the effects of both the finite aperture and overall bandwidth of ultrasound transducers and the non - negligible width of the transmitted ultrasound beams . this low spatial resolution remains the major limiting factor in the clinical usefulness of medical ultrasound images . to this end , an estimation of the point spread function ( psf ) of the imaging system is required . the image restoration process is a novel , original , reliable , and fast maximum likelihood ( ml ) approach for recovering the psf of an ultrasound imaging system . this new psf estimation method is based on an additional constraint , namely that the psf to be estimated is of known parametric form . under this constraint , the parameter values of its associated modulation transfer function ( mtf ) are then efficiently estimated using a homomorphic filter , a denoising step , and an expectation - maximization ( em ) based clustering algorithm . consequently , this amounts to estimating , in the low - pass - filtered cepstral domain , a mixture of two identical gaussian distributions whose parameters are automatically estimated , in a maximum likelihood sense , by an iterative expectation - maximization ( em ) [ 11 ] based clustering algorithm . given this psf estimate , a deconvolution algorithm can then be efficiently used , in a subsequent stage , in order to improve the spatial resolution of ultrasound images , to obtain an estimate of the true tissue reflectivity function , which is then independent of the properties of the imaging system . referring to fig1 , the image restoration system 10 includes a processor 12 with an associated memory 14 having stored therein processor executable instructions 16 for configuring the processor 12 to perform various processes , namely image restoration process , which process will be further described below . the image restoration system 10 further includes an input / output ( i / o ) interface 18 for communication with an imaging system 20 and a display 30 . the image restoration system 10 obtains images , for example ultrasound images , from the imaging system 20 and executes the image restoration process 16 on the acquired images . the resulting restored images are then displayed on the display 30 and may be saved to the memory 14 , to other data storage devices or medium 40 , or provided to a further system via the i / o interface 18 . referring to fig2 , the image restoration system 10 may be remotely connected to one or more imaging systems 20 and / or remotely operated through a remote station 62 via a wide area network ( wan ) such as , for example , ethernet ( broadband , high - speed ), wireless wifi , cable internet , satellite connection , cellular or satellite network , etc . the remote station 62 may also have associated data storage devices or medium 64 for locally storing restored images provided by the image restoration system 10 . referring now to fig3 , there is shown a flow diagram of an illustrative example of the image restoration process 100 executed by the processor 12 ( see fig1 ). steps of the process 100 are indicated by blocks 102 to 110 . the process 100 starts at block 102 where an image , for example an ultrasound image , is obtained from the imaging system 20 and , at block 104 , subdivided . then , at block 106 , a deconvolution factor is determined for the image and , at block 108 , the deconvolution factor is applied to the subdivided image resulting in a restored image . finally , at block 110 , the restored image is provided , for example through the display 30 and / or stored in a data storage device or medium 40 . the various steps of process 100 will be further detailed below . in ultrasound imaging , the psf happens to exhibit spatial dependency due , among other things , to the non - uniformity of focusing , the dispersive attenuation and the heterogeneity of the different interrogated tissues . nevertheless , a relatively low spatial variability of these phenomena makes it possible to divide the obtained acoustic image into a predefined number of small enough ( possibly overlapping ) images , for which the data within each such smaller image can be considered to be quasi - stationary , with a different psf . it is then assumed that , the entire image can be easily recovered by combining all the local results obtained in this manner . assuming space invariance and linearity , the resolution capabilities of an ultrasound imaging system can be expressed in terms of the psf , h ( x , y ), i . e . the image of a point reflector , by the following classical linear model : g ( x , y )= f ( x ,)* h ( x , y )+ n * x , y ) equation 1 where f ( x , y ) is the spatial reflectance distribution of internal organs of the human body to be imaged , g ( x , y ) is the degraded ultrasound image of the object f ( x , y ), h ( x , y ) is the psf function of the imaging system 20 , which counts for the finite aperture and bandwidth of the transducer , n ( x , y ) describes the additive quantization and electronic noise and finally * designates the 2d discrete linear convolution operator . assuming that the noise term n ( x , y ) is temporarily ignored for the sake of simplicity , equation 1 is more easily described in frequency domain as a simple product and sum where the capital letters indicate the fourier transforms of the corresponding spatial functions : an homomorphic transformation is simply the complex logarithmic transformation of both side of equation 2 . the real ( re ) and the imaginary ( im ) parts of the resultant relation are given correspondingly by : re : log | g ( u , v )|≅ log | f ( u , v )|+ log | h ( u , v )| equation 3 im : g ( u , v )≅ f ( u , v )+ h ( u , v ) equation 4 where the symbols |.| and denote , respectively , the amplitude and the phase of the complex functions . the basic idea for cepstrum - based methods of estimating the psf spectrum h ( u , v ) relies on the fact that log | h ( u , v )| is typically a much smoother function than log | f ( u , v )| and the same holds for the functions h ( u , v ) and f ( u , v ). consequently , in this context , the log - spectrum of the degraded ultrasound image ( amplitude and phase ) is considered to be a noisy version of the complex log - spectrum of the psf to be estimated and in this setting , in which log | f ( u , v )| and f ( u , v ) are considered to be sources of noise to be rejected , the problem of recovering log | h ( u , v )| and h ( u , v ) is thus essentially a denoising problem in the cepstral domain . in order to ensure both an automatic procedure and also a reliable denoising step allowing a good estimate of the psf spectrum , h ( u , v ), without ( ringing or blocking ) artifacts , a two - stage denoising scheme is proposed ; namely a discrete cosine transform ( dct )- based denoising step using a hard thresholding rule followed by a em - based regression model . in addition , since the psf model relies on an even function in x and y , the phase spectrum is assumed to be null . algorithmically [ 12 ], the dct - based denoising procedure consists in applying iteratively , until a maximal number of iterations is reached or until convergence is achieved , frequential filtering based on the dct transform of each 8 × 8 sub - image extracted from the current version of the image to be denoised ( initially , this current image estimate is the noisy image itself ). for the filtering operation in the dct domain , the easily - implemented hard thresholding rule [ 13 ] is used , also classically used in wavelet based denoising approaches , where ε is a threshold level and ω is one of the coefficients obtained by the dct transform of the block ( of size 8 × 8 pixels ) extracted from the current image to be denoised . in order to reduce blocky artifacts across block boundaries , a standard approach is adopted where this transform is made translation - invariant , by using the dct of all ( circularly ) translated version of each channel of the image ( herein assumed to be toroidal ) [ 14 ] ( this implies computing a set of 8 horizontal shifts and 8 vertical shifts transformed images ) which is then averaged at each step of this iterative denoising procedure . in order to speed up the procedure , an overlap of three pixels is used for the sliding 8 × 8 window . this iterative denoising procedure , illustrated in procedure 1 , is applied on the noisy version of log h ( u , v ), i . e ., log g ( u , v ) ( amplitude and phase ) and allows us to obtain a first rough estimate of log h ̂( u , v ) which will be refined in the next step . for all ( 8 horizontal and 8 vertical ) shifts of i [ n ] do for all 8 x 8 blocks extracted from i [ n ] do hard ε = o if | | ≦ ε , otherwise in order to refine the estimation given by the above - mentioned denoising step , the estimation method now relies on an additional constraint , namely that the psf to be estimated has the following parametric form : which is the psf model used in [ 15 ], i . e . asymmetric ( across the x - axis and y - axis ) cosine modulated by a gaussian envelope whose the fourier spectrum , i . e . its mtf ( in fact a band - pass filter ), namely h ( u , v ) can be written in the fourier domain : h ( u , v )= πσ x σ y exp (− 2π 2 σ x 2 u 2 ){ exp (− 2π 2 σ y 2 ( v − f o ) 2 )+ exp (− 2π 2 σ y 2 ( v + f o ) 2 )} equation 6 under this constraint , the regression model that gives , for the set of amplitude values of | h ( u , v )|, the best fit , in the least square sense , of two equally weighted gaussian distributions ( with the constraints that these two distributions are centered at u = 0 and symmetric with respect to v ) can now be considered . in that respect , this latter regression model can be efficiently addressed by considering the parameter statistical estimation problem of a ( noisy ) gaussian distribution mixture of two ( equally weighted ) gaussian component in r 2 by considering nf 2 - dimensional vectors v =( u , v ), v ={ vi , 1 ≦ i ≦ nf }, taking their values in r 2 and whose cardinality of each v is given by the amplitude value h ( u , v ). finally , it is assumed that v = v1 , . . . , vn f is a realization in , ir 2 , of v whose density takes the form of the following 2 - component mixture : in which , the 2 components pv / ci ( v / ck , ψk ) are , in the present application ( see equation 5 ) assumed to be two equally weighted ( p1 = p2 = 0 . 5 ) bi - variate gaussian distributions with mean vector μk and identical covariance matrix σ ( ψk =( μk , σ )), i . e . : in this setting , the identification of the parameters of the psf spectrum modulus h ( uv ) amounts to estimate the parameters ( ψ1 and ψ2 with the constraints that these two distributions are centered at u = 0 ( μ1 =( u = 0 , v1 ) t and μ2 =( u = 0 , v2 )) and v1 and v2 symmetric with respect to v = 0 , i . e . of opposite signs . this 2 - component gaussian mixture model is estimated thanks to a em - based clustering algorithm [ 11 ]. the initial parameters of this iterative procedure are given by the ml estimation on the partition given by a simple k - means clustering procedure . the constraint of identical covariance matrix and mean vector centered at u = 0 are taken into account at the end of the procedure by simply considering the average value of the two covariance matrices and the average absolute value of v1 and v2 . in order to improve the spatial resolution of the ultrasound images and to obtain an estimate of the true tissue reflectivity function , the ultrasound system &# 39 ; s point - spread function can now be deconvolved out . in the present application , an unsupervised bayesian deconvolution approach [ 16 ] is being used ( or a penalized likelihood framework ) exploiting a non - parametric adaptive prior distribution derived from the recent image model proposed by buades [ 17 ]. this prior distribution expresses that acceptable deconvolved solutions are the images exhibiting a high degree of redundancy . in this setting , the deconvolution of ultrasound images leads to the following cost function to be optimized : where the first term expresses the fidelity to the available data g and the second encodes the expected property of the true undegraded image and y [ g ]( f ) designates the non - local means filter in [ 17 ] applied on f , ρ , the regularization parameter controlling the contribution of the two terms ( which is crucial in the determination of the overall quality of the final estimate ), is estimated with the method proposed in [ 16 ]. the psf estimation approach and deconvolution were texted on ultrasound images of several bones acquired using a portable b - mode ultrasound imaging system ( titan ™, sonosite inc ., bothell , wash ., usa ). the echographic appearance of the various tissues ranges from dark ( low - echoic ) to bright ( high - echoic ), depending on their acoustic impedance . fig4 a and 4b show the original ultrasound images of the distal femur , more specifically the medial side , coronal plane ( fig4 a ) and the medial posterior condyle , axial plane ( fig4 b ) fig5 a and 5b show the modulus of h ̂( u , v ) after application of the dct - based denoising step to the images of fig4 a and fig4 b , respectively . it can be seen that two different pass - band filters , related to two different psfs are visible on these images . it can also be seen that there is no aliasing error and this first denoising step allowing the obtainment of the expected shape of a band - pass filter ( see equation 5 ) on which the learning step of the gaussian mixture , exploiting the em procedure , will be achieved . the gaussian mixture , estimated from these two spectrum data by the em algorithm ( without the additional constraint of symmetry ) is shown in fig6 a and 6b . two examples of psf estimation with the present approach are presented in fig7 a to 7d . finally , fig8 a and 8b show examples of deconvolution ultrasound images using the deconvolution scheme presented herein . more specifically , fig6 a and 6b are surface plots of the point - spread function ( psf ) defining a two - component mixture of bivariate gaussian distributions for fig5 a with μ =[ 54 . 18 134 . 21 ; 51 . 82 94 . 88 ] and σ =([ 358 . 66 4 . 18 ; 4 . 18 151 . 00 ], [ 358 . 84 4 . 10 ; 4 . 10 149 . 45 ]), and fig5 a with μ =[ 53 . 05 131 . 53 ; 52 . 94 97 . 40 ] and σ =([ 368 . 94 − 5 . 48 ; − 5 . 48 97 . 40 ], [ 368 . 95 − 5 . 47 ; − 5 . 47 96 . 45 ]); fig7 a to 7d are estimated spectrums of the point - spread function ( psf ) corresponding to fig4 a ( fig7 a and 7c ) and fig4 b ( fig7 b and 7d ), and fig8 a and 8b are deconvolved images corresponding to fig4 a and fig4 b , respectively . using the above - describe image restoration system and method , greater resolution improvement of the deconvolved ultrasound images can be observed with substantially improved definition of the outer contour of biological structures and can easily be used for commercial ultrasound applications due to its spatial resolution improvement or as a prerequisite stage for the segmentation and 3d reconstruction of ultrasound images . it should be noted that although reference has been made to ultrasound images and ultrasound imaging systems throughout the present disclosure , it is to be understood that the image restoration system and method may be applied and / or adapted to other types of images and imaging systems such as , for example , radioscopic , radiographic and echographic images from radioscopic , radiographic and echographic imaging systems , or any other such images and imaging systems . although the present disclosure has been described with a certain degree of particularity and by way of an illustrative embodiments and examples thereof , it is to be understood that the present disclosure is not limited to the features of the embodiments described and illustrated herein , but includes all variations and modifications within the scope and spirit of the disclosure as hereinafter claimed . in the present disclosure , references are made to the following reference documents which are herein incorporated by reference . mignotte , m ., meunier , j ., soucy , j .- p ., and janicki ., c ., “ comparison of deconvolution techniques using a distribution mixture parameter estimation : application in spect imagery .,” journal of electronic imaging 1 , 11 - 25 ( january 2002 ). [ 2 ] ayers , g . and dainty , j ., “ iterative blind deconvolution method and its application ,” optics letters 13 , 547 - 549 ( july 1988 ). [ 3 ] katsaggelos , a . and lay , k ., “ maximum likelihood blur identification and image restoration using the expectation - maximization algorithm ,” ieee trans . on signal processing 39 , 729 - 733 ( march 1991 ). [ 4 ] kundur , d . and hatzinakos , d ., “ blind image restoration via recursive filtering using deterministic constraints ,” in [ proc . international conference on acoustics , speech , and signal processing ], 4 , 547 - 549 ( 1996 ). [ 5 ] benameur , s ., mignotte , m ., soucy , j .- p ., and meunier , j ., “ image restoration using functional and anatomical information fusion with application to spect - mri images ,” international journal of biomedical imaging 2009 , 12 pages ( october 2009 ). [ 6 ] cannon , m ., “ blind deconvolution of spatially invariant image blurs with phase ,” ieee transactions on acoustics , speech and signal processing 24 , 58 - 63 ( february 1976 ). [ 7 ] abeyratne , u ., petropulu , a ., and reid , j ., “ higher order spectra based deconvolution of ultrasound images ,” ieee transactions on ultrasonics , ferroelectrics and frequency control 42 , 1064 - 1075 ( november 1995 ), [ 8 ] taxt , t ., “ restoration of medical ultrasound images using two - dimensional homomorphic deconvolution ,” ieee transactions on ultrasonics , ferroelectrics and frequency control 42 , 543 554 ( july 1995 ), [ 9 ] michailovich , o . and adam , d ., “ a novel approach to the 2 - d blind deconvolution problem in medical ultrasound ,” ieee trans . on medical imaging 24 , 86 - 104 ( january 2005 ). [ 10 ] adam , d . and michailovich , 0 ., “ blind deconvolution of ultrasound sequences using nonparametric local polynomial estimates of the pulse ,” ieee transactions on biomedical engineering 49 , 118 - 131 ( february 2002 ). [ 11 ] dempster , a ., laird , n ., and rubin , d ., “ maximum likelihood from incomplete data via the em algorithm ,” royal statistical society 1 - 38 ( 1976 ). [ 12 ] mignotte , m ., “ fusion of regularization terms for image restoration ,” journal of electronic imaging 19 , 333004 -( july - september 2010 ). [ 13 ] donoho , d . l . and johnstone , i . m ., “ ideal spatial adaptation by wavelet shrinkage ,” biometrika 81 , 425 - 455 ( 1994 ). [ 14 ] coifman , r . and donohu , d ., “ translation in variant denoising ,” in [ wavelets and statistics , lecture notes in statistics ], 103 , 125 - 150 , a . antoniadis and g . oppenheim , eds . new york : springer - verlag ( 1995 ). [ 15 ] kadel , f ., bertrand , m ., and meunier , j ., “ speckle motion artifact under tissue rotation ,” ieee transactions on ultrasonics , ferroelectrics and frequency control 41 , 105 - 122 ( january 1994 ). [ 16 ] mignotte , m ., “ a non - local regularization strategy for image deconvolution ,” journal pattern recognition letters 29 ( 16 ), 2206 - 2212 ( 2008 ). [ 17 ] buades , a ., coll , b ., and morel , j . m ., “ a review of image denoising algorithms , with a new one ,” multiscale modeling and simulation ( siam interdisciplinary journal ) 4 ( 2 ), 490 - 530 ( 2005 ).
| 6 |
fig1 shows the equivalent circuit diagram of a stepping motor . the winding of the motor is represented by a winding 1 of inductance l and with a resistance of zero , and a resistor 2 whose resistance r is equal to the resistance of the winding of the motor . a rotor 1a which is diagrammatically indicated by its bipolar permanent magnet is magnetically coupled to the winding 1 , 2 by a stator ( not shown ). the movement induced voltage , that is to say , the voltage which is induced in the winding of the motor by the rotary movement of the rotor is diagrammatically indicated in fig1 by the voltage source 3 . the value of the induced voltage is indicated by u i . the power supply source for the motor is represented by a source 4 having zero internal resistance and producing an electromotive force v , and a resistor 5 of resistance r * equal to the internal resistance of the real source for supplying the motor . finally , in the circuit diagram shown in fig1 the circuit for controlling the motor is diagrammatically indicated by a first switch 6 for connecting and disconnecting the source 4 , 5 of the winding 1 , 2 of the motor , and a second switch 7 for short - circuiting the winding or eliminating the short - circuited condition thereof . broadly , the currents and voltages involved in operation of the motor are given by the following relationship : in which u m is the voltage at the terminals of the motor and i is the current flowing in the motor winding . when the switch is closed and the switch 7 is open , the voltage u m is equal to v - r *· i . during the drive pulse interrumption periods , the switch 6 is open and the switch 7 is closed . the voltage u m is therefore zero , provided that the internal resistance of the switch 7 is negligible , which is the case under practical circumstances . during the interuption periods , above - indicated equation ( 1 ) can therefore be written as follows : if the interruption periods are of a duration t1 which is much shorter than the time constant τ = l / r of the winding , it may be assumed that ## equ1 ## in which i a and i b are the values of the current i at the beginning and at the end of each interruption period . under these conditions , when l is replaced by r · τ , equation ( 2 ) can be written as follows : ## equ2 ## equation ( 3 ) shows that the voltage u i induced in the motor winding by the rotary movement of the rotor may be determined in each interruption period , that is to say , in each period during which the power supply source is disconnected from the winding and the winding is in a short - circuited condition , by measuring the values i a and i b of the current at the beginning and at the end of each of the interruption periods , with the values r , t1 and τ being known . in practice , there is no need to measure the voltage u i itself and compare it to a threshold voltage u is to determine the time t 1 . it is only necessary for example to determine the value of the term ## equ3 ## in above - indicated equation ( 3 ), and to compare that value to a reference value β = u is · 1 / r · t1 / τ . the value of the term ## equ4 ## may be determined by measuring and storing the value of the current i a at the beginning of the measuring period , multiplying the measured and stored value by a constant ∝= τ - t1 / τ which is known since τ and t1 are known , measuring the current i b at the end of the measuring period , and calculating the difference (∝· i a - i b ). that difference is then compared to the value β , and a signal is produced when the comparison operation shows that (∝· i a - i b )≧ β . that signal indicates that the voltage u i has become equal to or higher than the threshold voltage u is and that therefore the time t 1 has been reached or passed . in order to determine the time t 1 , it is also possible to measure the current i a and calculate the product ∝· i a as above , calculate the difference (∝· i a - β ), measure the current i b , flowing in the winding at the end of the interruption period , and compare that current i b to the difference (∝· i a - β ). when the current i b is equal to or higher than the difference (∝· i a - β ), the voltage u i is equal to or higher than the reference voltage u is . it should be noted that the foregoing considerations remain valid if the calculation and comparison operations are performed by using , in place of the values of the currents i a and i b , the values of two currents i a &# 39 ; and i b &# 39 ; which are measured at the beginning and at the end of a measuring period which is of a duration t1 &# 39 ; that is less than t1 and if of course the value t1 is replaced by that value t1 &# 39 ;. there is no need to wait for the end of the interruption or measuring period to carry out the various calculation and comparison operations referred to above . it is possible continuously to measure the current i flowing in the winding after the beginning of the interruption or measuring period and to use the value of that current , in place of the current i b , to perform the calculation and comparison operations , also on a continuous basis . in the examples which will be described hereinafter , the various currents i a , i b and i are measured by the values of the voltages u a , u b and u which they respectively produce in passing through a measuring resistor connected in series with the winding of the motor during the drive pulse interruption periods . it will be appreciated that the various calculations referred to hereinbefore are then performed on the voltages which represent such currents , and which are proportional thereto . the factor β is then replaced by a factor : β = u is · r m / r · t1 / τ in which r m is the value of the measuring resistor . the timepiece shown by way of example in fig2 comprises a circuit 8 for generating a time base signal h at a frequency for example of 16384 hz . the circuit 8 is formed by a quartz oscillator and a first divider stage for dividing by two , its output being connected to the input of a divider circuit 9 which , on the basis of the time signal h , produces various periodic signals including more particularly a signal i at a frequency equal to 1 / 2 hz , a signal j at a frequency of 1 hz and a signal k at a frequency of 64 hz . the timepiece shown in fig2 further comprises a pulse shaper circuit 15 having an output which produces a signal , designated by means of z , formed by a series of pulses which go to state &# 34 ; 1 &# 34 ; whenever the signal j itself goes to state &# 34 ; 1 &# 34 ;, that is to say , every second ( see fig2 a ). the pulses of the signal z go back to state &# 34 ; 0 &# 34 ; in response to a signal n supplied by a calculating circuit 26 which will be described hereinafter . the moment at which the signal n appears therefore determines the duration of the pulses of the signal z . the pulse shaper circuit 15 also supplies an auxiliary signal indicated at 0 , which is formed by pulses which go to state &# 34 ; 1 &# 34 ; at the same time as the pulses z but which are fixed in duration , being for example 7 . 8 milliseconds in duration . each time that the signal z is at state &# 34 ; 1 &# 34 ;, a drive circuit 12 supplies a drive pulse to the winding 11a of the motor 11 . the voltage measured at the terminals of the winding 11a is indicated at u m in fig2 a . the energy applied to the winding 11a during each drive pulse is supplied by a power supply source 10 . the polarity of the drive pulses is determined by the logic state of the signal i which is alternately at state &# 34 ; 0 &# 34 ; and at state &# 34 ; 1 &# 34 ; for one second . the drive circuit 12 is also so arranged that the drive pulses are chopped in response to a signal m formed by pulses at a high frequency . each time that the signal m is at state &# 34 ; 1 &# 34 ;, for example , the drive circuit 12 interrupts the connection between the power supply source 10 and the winding 11a , and short - circuits the winding . during those interruption periods , the circuit 12 supplies , at an output 12a , a voltage that is proportional to the current flowing in the winding 11a . that voltage is used by a measuring circuit 16 , an example of which will be described hereinafter , to determine the time t 1 at which the voltage u i induced in the winding 11a by the rotary movement of the rotor attains the reference value u is . at time t 1 , the measuring circuit 16 produces , at its output 16e , a signal p which in turn is used by the calculating circuit 26 to produce the signal n at a time t 2 . the calculating circuit 26 , an example of which will be described hereinafter , is so arranged that the time t 2 is separated from the beginning of the drive pulse by a time equal to ( λ · t d + δ ) in which λ and δ are the above - mentioned , experimentally determined constants . that period of time is therefore equal to the optimum duration of the drive pulse . as the signal n causes the signal z to go back to state &# 34 ; 0 &# 34 ;, the signal z and therefore the drive pulse are equal in duration to the above - mentioned optimum duration . the signal m is produced by a circuit 13 , an example of which will be described hereinafter . the duration of each pulse of the signal m and the duration of the period of time which separates those pulses are determined by the content of a memory 14 . fig3 shows the circuit diagram of an example of a first embodiment of the circuit 16 for measuring the induced voltage u i , in the device shown in fig2 . the circuit 16 comprises an input 16a which receives from the circuit 12 the voltage proportional to the current flowing in the winding 11a , a capacitor 18 having one plate connected to earth 19 and the other plate 18a connected to the input 16a by way of a transmission gate 20 and to the non - inverting input of an operational amplifier 21 , the output of which is directly connected to its inverting input . the control electrode of the gate 20 is connected to the output q of a t - type flip - flop 22 whose clock input t receives the signal m by way of the input 16c and whose zero resetting input r receives the signal h by way of the input 16d . a calculating circuit 23 comprises a voltage divider formed by two resistors 231 and 232 which are connected in series between the output of the amplifier 21 and earth , and a differential amplifier 233 whose non - inverting input is connected to the junction between the resistors 231 and 232 . the circuit 23 further comprises two resistors 234 and 235 which are connected in series between the output of the amplifier 233 and a voltage generator 24 . the inverting input of the amplifier 233 is connected to the junction between the resistors 234 and 235 . the output of the amplifier 233 is connected to the noninverting input of another differential amplifier 25 whose inverting input is connected to the terminal 16a by way of a transmission gate 20a . the control electrode of the gate 20a is connected to the output q of a t - type flip - flop 22a whose clock input t receives the signal m by way of an inverter 22b and whose input r receives the signal h . the most of operation of the circuit shown in fig3 is as follows : at the moment that the signal m goes to state 1 , at the beginning of each interruption period , the output q of the flip - flop 22 switches to state &# 34 ; 1 &# 34 ;, which causes the gate 20 to be opened . when the signal h also goes to state &# 34 ; 1 &# 34 ;, about 30 microseconds later , the output q of the flip - flop 22 goes back to state &# 34 ; 0 &# 34 ; and the gate 20 is closed again . while the gate 20 is open , the capacitor 18 is charged up to a voltage u a that is proportional to the current i a flowing in the winding 11a at that time . by way of the amplifier 21 , the voltage u a is applied to the voltage divider formed by the resistors 231 and 232 . the values of those resistors are such that the voltage applied to the non - inverting input of the amplifier 233 is equal to ∝· u a in which ∝ is equal to τ - t1 / τ as above , that is to say , it is proportional to ∝· i a . the resistors 234 and 235 and the voltage supplied by the generator 24 are such that the output of the amplifier 233 produces a voltage equal to (∝· u a - β &# 39 ;), in which β &# 39 ;= u is · r m / r · t1 / τ as above . at the end of the interruption period , the signal m goes to state &# 34 ; 0 &# 34 ; and the output q of the flip - flop 22a goes to state &# 34 ; 1 &# 34 ; for a period of about 30 microseconds . the voltage u b that is proportional to the current i b flowing in the winding 11a at that time is therefore applied to the inverting input of the amplifier 25 which compares it to the voltage (∝· u a - β &# 39 ;) at the output of the amplifier 233 . as long as the voltage u b is higher than the voltage (∝· u a - β &# 39 ;), the output of the amplifier 25 remains at state &# 34 ; 0 &# 34 ;. if the voltage u b is lower than the voltage (∝· u a - β &# 39 ;), the output of the amplifier 25 produces the signal p , going to state &# 34 ; 1 &# 34 ;, which indicates that the voltage u i induced in the winding by the rotary movement of the rotor has exceeded the threshold voltage u is . that going to state &# 34 ; 1 &# 34 ; of the output of the amplifier 25 marks the time t 1 . fig3 a shows the circuit diagram of a second embodiment of the circuit 16 for measuring the induced voltage u i . the components 18 , 20 , 20a , 21 , 22 , 22a , 22b , 24 , 231 and 232 of the illustrated circuit are identical to the components denoted by the same references in fig3 and operate in the same way . the signal ∝· u a present at the junction between the resistors 231 and 232 is applied to the non - inverting input of an amplifier 233 &# 39 ;. two resistors 234 &# 39 ; and 235 &# 39 ; are connected in series between the gate 20a and the output of the amplifier 233 &# 39 ;. the junction between those two resistors is connected to the inverting input of the amplifier 233 &# 39 ;. the output of the amplifier 233 &# 39 ; is connected to the non - inverting input of an amplifier 25 &# 39 ; whose inverting input is connected to the output of the voltage generator 24 . in this case , the output of the amplifier 25 &# 39 ; forms the output 16e of the measuring circuit 16 . the resistors 234 &# 39 ; and 235 &# 39 ; are such that the output of the amplifier 233 &# 39 ; produces a voltage equal to (∝· u a - u b ). the amplifier 25 &# 39 ; compares the voltage to the voltage β &# 39 ; supplied by the generator 24 . the output of the amplifier 25 &# 39 ; produces the signal p , going to state &# 34 ; 1 &# 34 ;: when the voltage (∝· u a - u b ) becomes higher than the voltage β &# 39 ;, that is to say , again when the voltage u i induced in the winding by the rotary movement of the rotor becomes higher than the threshold voltage u is . as already pointed out above , there is no need to wait for the end of the interruption period in order to carry out the different calculation and comparison steps referred to above . the gate 20a , the flip - flop 22a and the inverter 22b may be omitted from the circuits shown in fig3 and 3a , in which case input 16a of the circuit 16 is directly connected to the inverting input of the amplifier 25 and the resistor 235 &# 39 ; respectively . in that case , the calculation and comparison operations are therefore performed on a continuous basis on the voltage u produced in the measuring resistor by the current i flowing in the winding 11a after the beginning of the interruption period . the signal p is then produced as soon as the voltage u falls below the voltage (∝· u a - β &# 39 ;) or as soon as the voltage (∝· u a - u ) is higher than the voltage β &# 39 ;. fig4 shows an embodiment of the calculating circuit 26 shown in fig2 . in that embodiment , the circuit 26 comprises an up - down preselection counter 27 having preselection terminals p1 , p2 , p3 and p4 which are respectively connected to the output terminals m1 , m2 , m3 and m4 of a read only memory 28 . the counter 27 comprises a preselection control input pe for receiving the signal 0 by way of an inverter 29 . the clock input cl of the counter 27 is connected to the output of a nand - gate 30 having two inputs , each connected to the output of a respective nand - gate 31 and 32 , respectively . the circuit 26 further comprises a divider circuit 33 for supplying two signals q1 and q2 at respective frequencies f1 and f2 , in response to the signal h . the signal q1 is applied to one of the inputs of the gate 31 while the signal q2 is applied to one of the inputs of the gate 32 . a second input of the gate 31 is connected to the output q of a t - type flip - flop 34 having its clock input t connected to the input terminal 26a of the circuit 26 . a second input of the gate 32 is connected to the output q of the flip - flop 34 . the input u / d for controlling the direction of counting of the counter 27 is connected to the output q of the flip - flop 34 . the counter 27 also comprises a coincidence output c which goes to state &# 34 ; 1 &# 34 ; for a short time when the content of the counter reaches a value of zero . the output c is connected to the clock input t of a t - type flip - flop 35 whose output q forms the output 26b of the circuit 26 and whose resetting input r is connected to the output q of a t - type flip - flop 101 . the latter flip - flop receives the signal 0 at its clock input t and the signal h at its resetting input r . the output c of the counter 27 is also connected to the resetting input r of the flip - flop 34 . fig4 a illustrates the mode of operation of the circuit 26 shown in fig4 . between the drive pulses , the signal 0 is at state &# 34 ; 0 &# 34 ; and the input pe of the counter 27 is at state &# 34 ; 1 &# 34 ;. the counter 27 is therefore blocked in the condition in which its content corresponds to the content of the memory 28 , which is indicated by no . at time t o which coincides with the beginning of a drive pulse , the signal 0 goes to state &# 34 ; 1 &# 34 ;, setting the input pe of the counter 27 to state &# 34 ; 0 &# 34 ;, whereby the counter 27 is freed and begins to count , in the normal direction , the pulses issuing from the gate 30 , starting from that condition no . that counting operation is performed at a frequency f1 . at time t 1 at which the voltage u i reaches the value u is , the input 26a goes to state &# 34 ; 1 &# 34 ; and the outputs q and q of the flip - flop 34 respectively go to state &# 34 ; 1 &# 34 ; and to state &# 34 ; 0 &# 34 ;. the up - down control input of the counter 27 goes to state &# 34 ; 0 &# 34 ;. from that time , the counter 27 operates in a down - counting mode . the down - counting operation is performed at the frequency f2 . at the time t 2 at which the content of the counter 27 becomes equal to zero , its output c goes to state 1 for a short time , setting the flip - flop 35 to state &# 34 ; 1 &# 34 ;, the output q of which , which was previously at state &# 34 ; 0 &# 34 ;, going to state &# 34 ; 1 &# 34 ;. at the same time , the outputs q and q of the flip - flop 34 go back to state &# 34 ; 0 &# 34 ; and state &# 34 ; 1 &# 34 ; respectively . at the end of the pulse 0 , the input pe of the counter 27 goes back to state &# 34 ; 1 &# 34 ;. the content of the counter 27 therefore resumes the fixed value in the memory 28 and remains at that value until the signal 0 goes to state &# 34 ; 1 &# 34 ; again . the output q of the flip - flop 35 is reset to state &# 34 ; 0 &# 34 ; at the beginning of each drive pulse by the state &# 34 ; 1 &# 34 ; which appears at the output q of the flip - flop 101 in response to the signal 0 . that state &# 34 ; 1 &# 34 ; is suppressed after about 30 microseconds when the signal h goes to state &# 34 ; 1 &# 34 ;. fig4 a shows that the time t which elapses between the beginning t o of the drive pulse and the occurrence , at time t 2 , of the signal n at the output 26b of the circuit 26 , is linked to the time t d which elapses between times t o and t 1 , by the following relationship : ## equ6 ## in which f1 and f2 are the frequencies of the signals supplied by the outputs q1 and q2 of the divider 33 and no is the number contained in the memory 28 and therefore the number contained in the counter 27 at time t o . comparison between that equation and above - mentioned equation t opt = λt d + δ , in which λ and δ are constants that are determined experimentally for each type of motor , makes it possible to choose values for f1 , f2 and no such that the period of time t which elapses between the beginning of the drive pulse and the appearance of the signal n is always equal to the optimum duration t opt of the drive pulse . fig5 shows the circuit diagram of an example of the circuits 12 and 15 in fig2 . the circuit 15 is formed in this embodiment by two t - type flip - flops whose clock inputs t both receive the signal j supplied by the frequency divider 9 in fig2 at a frequency of 1 hz . the resetting input r of the flip - flop 38 receives the signal k which is also supplied by the frequency divider 9 , at a frequency of 64 hz . the output q of the flip - flop 38 therefore goes to state &# 34 ; 1 &# 34 ; every second , at the moment that the signal j goes to state &# 34 ; 1 &# 34 ;, and goes back to state &# 34 ; 0 &# 34 ; about 7 . 8 milliseconds later , when the signal k in turn goes to state &# 34 ; 1 &# 34 ;. the output q of the flip - flop 38 therefore produces the signal 0 . the reset input r of the flip - flop 39 receives the signal n from the calculating circuit 26 shown in fig2 . the output q of the flip - flop 39 therefore also goes to state &# 34 ; 1 &# 34 ; when the signal j goes to state &# 34 ; 1 &# 34 ;, and goes back to state &# 34 ; 0 &# 34 ; when the circuit 26 supplies the signal n at the time t 2 , determined in the above - described manner . the output q of the flip - flop 39 therefore produces the signal z which is equal in duration to the optimum duration of the drive pulse . in this embodiment , the circuit 12 of fig2 comprises a logical circuit 43 formed by four and - gates 431 to 434 , two or - gates 435 and 436 and two inverters 437 and 438 . the winding 11a of the motor is connected into a circuit formed by four transmission gates 44 to 47 which are connected in conventional manner between the terminal + v of the power supply source 10 and earth . two other transmission gates 48 and 49 each connect one of the terminals of the winding 11a to a first terminal of a resistor 17 whose second terminal is connected to the input 16a of the circuit 16 shown in fig2 . the resistor 17 forms the above - mentioned measuring resistor . the control electrodes of the gates 44 to 49 are connected to the outputs of the circuit 43 , the inputs of which respectively receive the signals i , z and m . the circuit 43 will not be described in greater detail herein , as it can be readily seen , by referring to fig5 a , that : when the signal z is at state &# 34 ; 0 &# 34 ;, that is to say , between the drive pulses , the control electrodes of the gates 44 to 49 are all at state &# 34 ; 0 &# 34 ;, irrespective of the state of the signal i and m . the gates 44 to 49 are therefore closed and the winding 11a is separated from the power supply source ; when the signal z is at state &# 34 ; 1 &# 34 ;, that is to say , during the drive pulses , and the signal m is a state &# 34 ; 0 &# 34 ;, the gates 44 and 46 are in a conducting condition if the signal i is at state &# 34 ; 0 &# 34 ;, with all the other gates being in a non - conducting condition , while the gates 45 and 47 are in a conducting condition if the signal i is at state &# 34 ; 1 &# 34 ;, in which case all the other gates are also in a non - conducting condition . the power supply source is therefore connected to the winding 11a by way of the gates 44 and 46 or 45 and 47 , and a current flows in the winding 11a in the direction indicated by the arrow 11b or in the opposite direction . that situation is the situation which occurs between the interruption periods , during the elementary pulses ; and when the signal z is at state &# 34 ; 1 &# 34 ; and the signal m is also at state &# 34 ; 1 &# 34 ;, the gates 47 and 48 or 46 and 49 are in a conducting condition , depending on the state &# 34 ; 0 &# 34 ; or &# 34 ; 1 &# 34 ; of the signal i , with all the other gates then being in a non - conducting condition . the power supply source is therefore disconnected from the winding 11a and the current flowing in the winding 11a also flows in the resistor 17 in which it produces the voltage that is applied to the input 16a of the measuring circuit 16 . that situation is the one which occurs during the drive pulse interruption periods . fig6 shows by way of example , the circuit diagram of an embodiment of the circuits 13 and 14 of the fig2 device . the circuit 13 comprises two up - down preselection counters 131 and 132 . the inputs u / d for controlling the direction of counting of the counters 131 and 132 are permanently at state 1 . the counters 131 and 132 therefore operate in a down - counting mode . their preselection terminals , which are generally denoted by pi , are respectively connected to the outputs , generally denoted by si , of two memories 141 and 142 which form the memory 14 of the circuit shown in fig2 . the memories 141 and 142 may be for example read only memories . the clock inputs cl of the counters 131 and 132 are both connected to the output of the generator 8 ( see fig2 ) which produces the signal h . the counters 131 and 132 each comprise a coincidence output c which produces a short pulse whenever the content of the counters becomes equal to zero . the coincidence outputs c are connected to the inputs of an or gate 133 having its output connected to the clock input t of a t - type flip - flop 134 . the output q of the flip - flop 134 is connected to the preselection control input pe of the counter 131 , by way of an inverter 135 , to the preselection input pe of the counter 132 . the output q of the flip - flop 134 is also connected to the output 13a of the circuit 13 . the mode of operation of the circuit shown in fig6 will now be described with reference to fig6 a . when the output q of the flip - flop 134 is at state &# 34 ; 0 &# 34 ;, the input pe of the circuit 132 is at state &# 34 ; 1 &# 34 ;. the content of the counter 132 therefore assumes a condition corresponding to the content of the memory 142 and the counter 132 remains blocked in that condition , which is indicated by n142 in fig6 a . on the other hand , the input pe of the counter 131 is at state &# 34 ; 0 &# 34 ; and the counter 131 counts the pulses of the signal h , in the down - counting mode . when the counter content reaches zero , its output c produces a pulse which is transmitted to the input t of the flip - flop 134 , by way of the gate 133 . the output q of the flip - flop 134 and the input pe of the counter 131 therefore go to state &# 34 ; 1 &# 34 ;. the content of the counter 131 therefore assumes a condition corresponding to the content of the memory 141 and the counter 131 is blocked in that condition , which is indicated by n141 in fig6 a . at the same time , the input pe of the counter 132 goes to state &# 34 ; 0 &# 34 ;. the counter 132 begins to count the pulses of the signal h , in the down - counting mode . when the counter content reaches zero , the output c of the counter produces a pulse which is transmitted by means of the gate 133 to the input t of the flip - flop 134 . the output q of the flip - flop 134 goes back to state &# 34 ; 0 &# 34 ;, and the above - described procedure begins again . the output q of the flip - flop 134 which produces the signal m therefore goes alternately to state &# 34 ; 0 &# 34 ; and to state &# 34 ; 1 &# 34 ; during periods of time which depend on the frequency of the signal h and the content of the memories 141 and 142 respectively . the duration of the periods of interruption of the drive pulses , which is equal to the period of time for which the signal m is at state &# 34 ; 1 &# 34 ;, and the duration of the elementary pulses which separate the interruption periods , which is equal to the period of time for which the signal m is at state &# 34 ; 0 &# 34 ;, can therefore be determined independently of each other . the above - mentioned durations are determined in any fashion . they may be fixed or they may vary , in a manner which will not be described herein , in dependence on parameters such as the voltage of the power supply source 10 , or the mechanical load driven by the motor , or any other parameter .
| 6 |
referring to the drawings , and more particularly to fig1 there is shown the needle core biopsy instrument or tissue sample extractor 10 embodying the principles of the present invention . the instrument / extractor 10 comprises a first biopsy cannula 12 that is shaped and configured to be coaxially mounted within second cutting cannula 14 . both first biopsy cannula 12 and second cutting cannula 14 have proximal and distal ends , wherein the proximal end of the first biopsy cannula 12 and second cutting cannula 14 have proximal and distal ends , wherein the proximal end of the first biopsy cannula 12 is attached to the first shoulder 16 and the proximal end of the second cutting cannula 14 is attached to second shoulder 18 . the distal ends of first cannula 12 and second cannula 14 are more clearly depicted in fig3 and 6 , respectively . the distal end of first cannula 12 includes a sharpened , beveled cutting tip 44 preferably having a gradual , upwardly extending slope that forms a shovel - type scooped shape . such scoop - like shape advantageously allows for more efficient and less traumatic tissue penetration than other cannula cutting tips currently in use . additionally , first cannula 12 has a hollowed - out biopsy reservoir 46 , also shown in fig5 formed proximal the beveled cutting tip 44 . the biopsy reservoir 46 preferably is formed having a semi - circular shape that advantageously allows for relatively large , generally cylindrically - shaped tissue samples to be extracted from the tissue mass . as will be discussed in more detail infra , the distal ends of the first and second cannulas 12 , 14 cooperate via relative axial movement to cut and contain a tissue sample within the biopsy reservoir 46 . at the rear portion of biopsy reservoir 46 is a lumen or channel 13 which runs the length of first cannula 12 and allows the biopsy reservoir 46 to establish fluid communication with a conventional syringe 22 via connector 76 , as shown in fig1 . such fluid communication between biopsy reservoir 46 and syringe 22 enhances the ability of the extractor 10 to draw in and isolate a tissue sample due to the generation of a vacuum force by the syringe 22 , which shall be discussed below . the distal end of second cannula 14 is preferably formed having a hollow , frusto - conical shape that is designed and configured to allow first cannula 12 to axially pass therethrough . the distal rim 48a of the frusto - conical portion 48 is sharpened so that distal rim 48a may cut and contain a tissue sample disposed within biopsy reservoir 46 when the rim 48a is axially passed across the biopsy reservoir 46 of the first cannula 12 . as shown in fig7 the distal end of first cannula 12 freely passes , via axial movement , through the distal end 48 of second cannula 14 . second cannula 14 also preferably includes a barrel section 50 that serves as a sleeve to protect and contain a biopsy sample contained within a biopsy reservoir 46 when such sample is extracted from a tissue mass . the first and second cannulas may be formed in differing lengths and diameters to be utilized for a wide variety of tissue sampling applications such as beast , prostate , deep body , lung and other soft tissue biopsies . in addition to being coaxially positioned relative to one another , first cannula 12 and second cannula 14 are maintained in an arrangement whereby the second cannula is constantly urged forward by biasing member 20 , more clearly depicted in fig1 . preferably , biasing member 20 comprises a spring that is interposed between the first shoulder 16 formed on the first cannula 12 and second shoulder 18 formed on the second cannula 14 . the distally urging biasing force exerted by spring 20 forces the second shoulder 18 , and hence second cannula 14 , to axially advance upon the first cannula 12 . in order to selectively control the position of the second cannula 14 relative to first cannula 12 , the extractor 10 of the present invention advantageously incorporates the use of introducer 26 . in the preferred embodiment , the introducer 26 is fabricated from polymer and / or metal materials that may be sterilized or disposed of , such materials being well known to those skilled in the art . preferably , the introducer 26 is comprised of two parts , namely a handle and syringe retainer 28 and a plunger retractor member 30 , more clearly depicted in fig1 . the handle and syringe retainer 28 comprises a handle portion as well as structure sized and configured for detachably interconnecting with the conventional syringe 22 . more specifically , the syringe retainer 28 preferably includes first and second syringe support members 58 , 60 and syringe support collar 62 which engage the syringe 22 and firmly hold the syringe 22 in position . additionally , there is provided slot 56 that is designed and configured to detachably engage with rim 22a on syringe 22 so as to further provide secure attachment with syringe retainer 28 . the plunger retractor member 30 of introducer 26 comprises a generally c - shaped member having a trigger member 32 depending therefrom . the rear portion of the plunger retractor member 30 has a slot 52 to receive plunger 24 on syringe 22 . as will be discussed , slot 52 provides means for retracting the plunger 24 such that a vacuum is created in syringe 22 and ultimately in biopsy reservoir 46 via lumen 13 shown in fig3 . mounted adjacent the top portion of the retractor member 30 is a cam bar 34 , which is preferably pivotally mounted 36 thereon . as more clearly illustrated in fig1 , the cam bar 34 includes a first can slot 38 and a second cam abutment shoulder or surface 40 . additionally , cam bar 34 has a groove 42 which allows the coaxially positioned first cannula 12 and second cannula 14 to pass therethrough . as will be discussed , the first cam slot 38 and second cam abutment surface 40 provide means for adjusting the relative axial position of second cannula 14 with respect to first cannula 12 . the handle and syringe retainer 28 and plunger retractor member 30 are preferably connected to one another via a sliding - type engagement . more specifically , the plunger retractor member 30 is removably mounted onto the rear portion of syringe retainer 28 such that surface 30a is received upon upper guideway 64 and flanked by elongate guide members 66 and 68 . additionally , surface 30b is received within lower guideway slot 70 such that trigger member 32 protrudes from the handle and syringe retainer 28 to form a gun - type configuration . in addition , the handle and syringe retainer 28 further include a spring - activated detent or locking member 72 to engage apertures formed on surface 30c of the plunger retractor member 30 , said apertures being more clearly depicted as 74a , b in fig1 , 12 , 13 , and 14 . such spring - activated locking member 72 , when aligned with locking apertures 74a , b , provide means for positioning the handle and syringe retainer 28 with respect to the plunger retractor member 30 such that desired depths and axial positioning of the cannulas 12 , 14 may be more easily attained when using the extractor 10 . importantly , spring - activated locking member 72 , when aligned with locking aperture 74b , maintains the introducer 26 in an orientation that causes second cannula 14 to axially retract about biopsy reservoir 46 in a proximal axial position . having thus described the structure of the biopsy instrument / extractor 10 of the present invention , the operation of the same shall now be described with specific reference to fig1 through 14 . preparatory for use , the first and second cannulas 12 and 14 are coaxially positioned with biasing member 20 interposed between the shoulders 16 and 18 . the proximal end 76 of the first cannula 12 may then be attached to the distal end of the syringe 22 . as shown in fig1 , the syringe 22 is mounted within handle and syringe retainer 28 with plunger 24 being received in slot 52 of the plunger retractor member 30 . additionally , cam bar 34 is positioned such that second shoulder 18 is received within first cam slot 38 . additionally , the spring - activated locking member 72 is received within locking aperture 74a in such a manner that relative orientation or position of the handle 28 and plunger retractor member 30 is maintained unless otherwise manually adjusted . fig1 a depicts the corresponding axial position ( i . e ., the distal axial position ) between first cannula 12 and second cannula 14 while the introducer 26 is maintained in the initial orientation depicted in fig1 . as illustrated , the second cannula 14 is selectively covers biopsy reservoir 46 while beveled cutting tip 44 axially protrudes or extend therebeyond . while the introducer 26 and first and second cannulas 12 , 14 are maintained in the orientation and relative axial position depicted in fig1 and fig1 a , the introducer 26 is then gripped , as shown in fig2 and the first and second cannulas are manually pressed or inserted into a tissue mass from which a sample is to be extracted . as mentioned above , the introducer 26 , namely the combination of handle and syringe retainer 28 and plunger retractor member 30 , is formed to have a gun - like shape that allows the user to manually insert the coaxially positioned cannulas 12 , 14 while maintained in this distal axial position and ultimately extract a sample of tissue using only one hand . such design advantageously allows the physician user to utilize their other hand so as to manipulate the tissue or perform some other function as may be required . during insertion of the first and second cannulas 12 , 14 through the tissue , the user forces both interconnected portions 28 , 30 of the introducer 26 into the tissue in a direction indicated by the arrows &# 34 ; a &# 34 ; in fig1 . as should be noted , locking member 72 is engaged within aperture 74a during such insertion to prevent any relative axial movement between the handle 28 and plunger retractor member 30 . additionally , during such insertion the introducer 26 forces the cannulas 12 , 14 into the tissue whereby the sharpened beveled cutting tip 44 is forced directly into the tissue , and the cutting tip 44 of the first cannula simultaneously cuts the tissue and positions the cut tissue adjacent its periphery so as to overlie the second cannula 14 adjacent the biopsy reservoir 46 . once embedded within the tissue and having cut the tissue sample , the introducer 26 is manipulated such that the handle and syringe retainer 28 of the introducer 26 remains stationary while the plunger retractor member 30 is rearwardly retracted in the direction indicated by &# 34 ; b &# 34 ;. the plunger retractor member 30 is retracted , via manipulation of trigger member 32 , such that spring - activated locking member 72 is released ( i . e ., overcome ) from locking aperture 74a and subsequently engage with locking aperture 74b as shown in fig1 . due to the engagement of the second shoulder 18 with the cam slot 30 of the cam bar 34 , during such rearward movement , the second cannula 14 axially retracts relative the first cannula 12 and is disposed in its proximal axial position wherein the biopsy reservoir 46 is exposed to the tissue mass 82 , as depicted in fig1 a . accordingly , the axial retraction of the frusto - conical end portion 48 of second cannula 14 allows such cut tissue mass 82 to be received within the biopsy reservoir 46 . advantageously , during such retraction of the plunger retractor member 30 relative to handle and syringe retainer 23 , a vacuum is generated in syringe 22 such that the previously cut tissue mass 82 is drawn downwardly into the biopsy reservoir 46 as depicted in fig1 a . having effectively drawn the mass of tissue 82 to be extracted into the biopsy reservoir 46 , the cam bar 34 is manually raised in the direction indicated by the letter &# 34 ; d &# 34 ; in fig1 such that the second shoulder 18 is released from first cam slot 38 . spring member 20 preferably provides sufficient force such that upon release from first cam slot 38 the second cannula 14 rapidly axially advances with sufficient force to cause the sharpened distal end 48a of the second cannula 14 to sever and retain the tissue sample 82a to be extracted within biopsy reservoir 46 . such forward axial movement of the second cannula 12 continues until the second shoulder 18 abuts the second cam abutment surface 40 . the cross - sectional view depicting this distal axial position of the second cannula 14 depicted in fig1 a , which corresponds with the abutment between second shoulder 18 and second cam abutment surface 40 , as shown in fig1 . as shown , in this distal axial position , the second cannula 14 securely captures the cut tissue mass 82a within the biopsy reservoir . having thus isolated the tissue sample 82a from tissue mass 82 , the extractor 10 , and hence first and second cannulas 12 , 14 , may both be removed from the tissue mass by withdrawal of the extractor 10 where the tissue sample 82a may be recovered from the biopsy reservoir 46 and subsequently examined . alternatively , as illustrated in fig1 , the present invention provides that cam bar 34 may be raised even further about pivot 36 to allow second shoulder 18 , and thus second cannula 14 , to remain in place while introducer 26 , syringe 22 , and first cannula 12 may be manually withdrawn in the direction indicated by the arrow &# 34 ; e &# 34 ;. advantageously , by allowing the second cannula 14 to remain stationary within tissue mass 82 , the user , if desired , may make further tissue sample extractions through second cannula 14 in the manner described above . advantageously , by using the extractor 10 of the present invention , the user will not have to make repeated punctures into the tissue which will thus facilitate the extraction of multiple samples while subjecting the subject to a less traumatic experience as compared to other devices known in the art . referring now to fig1 - 17 , a disk guide assembly 98 comprises first 100 and second 102 disk guides having a circular channel 103 formed therein so as to slidably receive the second shoulder 18 . second shoulder 18 is thus prevented from moving side - to - side and upward by the disk guide assembly 98 , particularly during the insertion process . this disk guide assembly allows rotation of the cannula assembly through 360 degrees . as those skilled in the art will appreciate , it is common to exert pressure upon the tissue sample extractor of the present invention during the insertion process which tends to bend the first biopsy cannula 12 and the second cutting cannula 14 upward with respect to the device . such bending of the first biopsy cannula 12 and second cutting cannula 14 is undesirable because it interferes with proper operation of the device . thus , the optional disk guide assembly 98 assures reliable operation of the present invention . the disk guide assembly 98 may either be formed as an integral part of the device or , optionally , may comprise an add - on assembly . those skilled in the art will appreciate that various different configurations of the disk guide assembly 98 are likewise suitable for limiting movement of the second shoulder 18 in a longitudinal direction with respect to the first biopsy cannula 12 and second cutting cannula 14 . referring now to fig1 , an optional seal 110 is disposed about the first biopsy cannula 12 and urged into abutment with the second shoulder 18 such that it prevents vacuum leakage intermediate the first biopsy cannula 12 and the second cutting cannula 14 . the seal 110 preferably has shoulder 112 formed thereon so as to receive the distal end of the spring 120 . those skilled in the art will appreciate that various other configurations of the optional seal 110 are likewise suitable . referring now to fig1 and 20 , the second cutting cannula 14 is preferably formed to have a slanted or beveled cutting tip 135 formed thereon so as to facilitate reliable cutting of the biopsy tissue samples . the biopsy reservoir 46 is preferably formed to have an obstructor 128 disposed at the proximal end thereof so as to prevent vacuum from pulling the cut tissue sample into the lumen 13 of the first biopsy cannula 12 . the obstructor 128 is preferably formed by forming an undercut 126 at the proximal end of the biopsy reservoir 46 and then bending the proximal protruding portion or tab 128 formed thereby in the wall of the first biopsy cannula 12 inward so as to partially obscure the lumen 13 of the first biopsy cannula 12 . the tab 128 is bent sufficiently to assure that the biopsy tissue sample remains within the biopsy reservoir , yet still allows the vacuum to draw the tissue sample into the biopsy reservoir . optionally , similar but shallower undercut 122 may be formed at the distal end of the biopsy reservoir 46 to define distal tab 124 . the tip 120 of the first biopsy cannula 12 is preferably formed by machining a solid plug 132 , preferably via electron discharge machining , i . e ., either standard or wire electron discharge machining , so as to form a scooped out portion 134 which defines a sharp point 136 . the solid plug 132 may either first be attached to the first biopsy cannula 12 , so as to facilitate handling thereof during the machining process , or alternatively , may be formed at the end of an elongate bar and then cut therefrom prior to insertion into the first biopsy cannula 12 . the solid plug 132 is preferably attached to the first biopsy cannula 12 via forming at least one crimp 123 in the first biopsy cannula 12 , which is pressed into a corresponding cut - out or dimple formed in the solid plug 132 or by being press fit into the first biopsy cannula 12 . alternatively , those skilled in the art will appreciate that various other different means , as discussed above , may be utilized to attached the solid plug 132 to the first biopsy cannula 12 . further , various different combinations of such means may be utilized . the cross - sectional area or profile defined by the scooped out portion 134 of the solid plug 132 facilitates easy insertion into tissue , while maintaining sufficient strength to prevent premature dulling or deformation of the sharp point 136 . the diameter of the solid plug 132 may either be approximately equal to the outer diameter of the first biopsy cannula 12 , so as to provide a substantially flush fit therewith , or alternatively may similarly be approximately equal to the outer diameter of the second cutting cannula 14 . according to the preferred embodiment of the present invention , the cannula assembly , comprised of the first biopsy cannula 12 , the second cutting cannula 14 , and preferably the spring 20 , seal 110 , and second shoulder 18 as well , may be formed so as to be disposable . thus , these items are preferably formed of comparatively inexpensive materials , which is made possible due to their limited expected life . by making the cannula assembly disposable , a high degree of convenience is achieved . thus , the cannulas do not need to be sterilized between uses , rather a new cannula assembly is installed for each use . there has thus been disclosed a tissue sample extractor , with various preferred embodiments thereof , having been described in detail with the various advantages being set forth . it is understood , however , that equivalents are possible and that variations in structure may be made that fall within the underlying principles of the present invention .
| 0 |
the compounds of formula i may be prepared as described in the following reaction schemes and discussions . unless otherwise indicated , x , y , r1 , r2 , r3 , r4 , r5 , r6 , r7 and structural formulae ii , iii , iv , v , vi , vii , viii , ix , x , xi , xii , xiii , xiv and xv in the reaction schemes and discussion that follow are defined as above . according to scheme 1 , a ketone of the general formula ii , wherein x , y , r 1 and r 2 are as previously defined , may be converted directly into the corresponding compound of the formula i , via an intermediate of the general formula iv , by reacting it with one or more equivalents of an primary amine of the general formula iii in the presence of a reducing reagent . reducing reagents that may be used include sodium cyanoborohydride , sodium triacetoxyborohydride , sodium borohydride , lithium aluminum hydride , hydrogen plus a metal catalyst , zinc plus hydrochloric acid , and formic acid . this reaction is typically conducted in a reaction inert solvent at a temperature from about 0 ° c . to about 150 ° c ., but may be conducted in the absence of solvent . suitable reaction inert solvents include lower alcohols ( e . g ., methanol , ethanol , isopropanol ), 1 , 2 - dichloroethane , acetic acid and tetrahydrofuran ( thf )). preferably the reaction is conducted with an excess of the corresponding amine iii , in the absence of additional solvent , at a temperature of about 110 ° c ., and using the reducing agent sodium cyanoborohydride . alternatively , the reaction of a compound of formula ii with an amine compound of the formula iii may be carried out in the presence of a dehydrating agent ( e . g ., titanium tetrachloride ) or by using an apparatus designed to azeotropically remove the water generated , to produce an imine of the formula iv . this imine may then be converted to the title product of formula i by reduction of the c = n bond with a reducing agent as described above , preferably with sodium cyanoborohydride in the presence or absence of a suitable , reaction inert solvent as described in the preceding paragraph at a temperature of about 0 ° c . to about 150 ° c . and preferably at about 110 ° c . other suitable dehydrating agents / solvent systems include titanium tetrachloride in dichloromethane , titanium isopropoxide in dichloromethane and activated molecular sieves in toluene or in dichloromethane . when a secondary amine of the general formula v ( i . e ., hnr3r4 ) is used , an alternative method involves the formation of an enamine of general formula vi , which can be reduced to the title product of formula i through the use of a selective reducing agent or selective reduction conditions known to one familiar with the art of organic synthesis . using this procedure , as shown in scheme 2 above , the intermediate enamine vi may be isolated and purified if it is stable , or it may be used directly in the reduction step to generate the diamine of general formula i . selective reducing agents and reagents to facilitate the conversion of intermediate vi to the compounds of formula i include : formic acid , hydrogen gas and a metal catalyst ( e . g ., pd on carbon , pt on carbon ). in another method ( scheme 3 ) for the preparation of the compounds of the present invention , an intermediate oxime ( vii ) can be prepared through reaction of the starting ketone i and hydroxylamine . synthesis of such oximes is well precedented in the chemical literature ( e . g ., see lamattina j l , et al , synthesis ( 1980 ) 329 - 330 ), and it is also known that intermediate oximes like vii are capable of forming two different isomers , denoted as z - and e - oximes . these isomers may or may not react differently in their subsequent conversion to intermediates of general formulae viii ( i . e ., i , r3 , r4 = h ), and one of the oxime isomers may be less reactive or resistant to reduction to intermediate viii . the reduction to viii can be achieved using one of a variety of reagents and procedures , including zn — acoh , na and c 2 h 5 oh , bh 3 , and nabh 3 cn — ticl 3 . in the next step , compound viii can be converted to a compound of general formula x by subjecting it to a reductive amination with an aldehyde of general formula ix ( for examples , see jerry march , “ advanced organic chemistry : reactions , mechanisms and structure ”, 4 th ed ., john wiley & amp ; sons , new york , n . y . ( 1992 ) pp 898 - 900 ) followed by alkylation of the nitrogen atom of the intermediate of general formula x with a reagent of general formula r9 - l , where l is a leaving group ( e . g ., cl , br , mesylate ) and r9 is c 1 - c 3 alkyl . procedures for these reactions are readily available in the chemical literature and familiar to chemists with skill in the art of organic synthesis . the starting ketone for the above processes , compound ii , may be obtained from commercial sources or may be synthesized as described in the chemical literature ( scheme 4 ). such compounds may exist as racemic mixtures or as the individual (+)- and (−)- isomers . in general , 1 - bromo - cyclopentane is converted to a grignard reagent ( xi ) by reaction with magnesium metal in an inert solvent , typically in ethers like diethyl ether or tetrahydrofuran ( thf ). the grignard reagent so formed is then reacted with an appropriately substituted arylnitrile ( xii ), in an inert solvent such as hexane , and stirred at room temperature until the reaction is determined to have been completed . the product , the arylketone ( xiii ), dissolved in a suitable solvent ( e . g ., chloroform ) is then treated with one equivalent of bromine ( br 2 ), and the resulting α - bromo - ketone ( xiv ) is isolated by filtration . compound xiv is then added to a primary amine of general formula r2 — nh 2 in an inert solvent ( e . g ., toluene ) and the mixture is heated to reflux . the solvents are subsequently removed under vacuum to obtain the crude α - hydroxy - imine ( xv ). this intermediate is then heated , typically in a high - boiling , inert solvent ( e . g ., decalin ) wherein the compound undergoes a thermal rearrangement to produce the α - amino - ketone ( ii ). specifically , the compound ii in which x is 2 - chloro , y is h , r1 is hydrogen and r2 is methyl is commonly referred to as ketamine . ketamine is a central nervous system active drug that may interact with nmda ( i . e ., n - methyl - d - aspartate ) receptors in the brain and has been associated with a variety of behavioral disorders in human and animal studies . the synthesis and utility of ketamine and related analogs as nmda receptor modulators and disease treatments are described by t . g . gant and s . sarshar in u . s . patent application 2008 / 109958 ( apr . 25 , 2008 ). the compounds of the present invention may have optical centers and therefore may occur in different enantiomeric configurations . formula i , as depicted above , includes all enantiomers , diastereomers , and other stereoisomers of the compounds depicted in structural formula i , as well as racemic and other mixtures thereof . individual isomers can be obtained by known methods , such as optical resolution , optically selective reaction , or chromatographic separation in the preparation of the final product or its intermediate . where cis - and trans - isomers are possible ( i . e ., at positions “ a ” and “ b ” in structure formula i ), for an embodiment of the inventive compounds of formula i , both cis - and trans - isomers ( i . e ., diastereomers ) are within the scope of this invention . the present invention also includes isotopically labeled compounds , which are identical to those recited in formula i , but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature . examples of isotopes that can be incorporated into compounds of the present invention include isotopes of hydrogen , carbon , nitrogen , oxygen , sulfur , phosphorus , fluorine , and chlorine , such as 2 h , 3 h , 11 c , 13 c , 13 n , 15 n , 18 o , 35 s , 31 p , 33 p , 18 f and 37 cl , respectively . compounds of the present invention , prodrugs thereof , and pharmaceutically acceptable salts of said compounds , or of said prodrugs which contain the aforementioned isotopes and / or other isotopes of other atoms are within the scope of this invention . certain isotopically labeled compounds of the present invention , for example , those into which radioactive isotopes such as 3 h and 14 c are incorporated , are useful in drug and / or substrate tissue distribution assays . tritiated , i . e ., 3 h , and carbon — 14 , i . e ., 14 c , isotopes are particularly preferred for their ease of preparation and detectability . further , substitution with heavier isotopes such as deuterium , i . e ., 2 h , can afford certain therapeutic advantages resulting from greater metabolic stability , for example increased in vivo half - life or reduced dosage requirements and , hence , may be preferred in some circumstances . isotopically labeled compounds of formula i of this invention and prodrugs thereof can generally be prepared by carrying out the procedures disclosed in the schemes and / or in the examples and preparations below , by substituting a readily available isotopically labeled reagent for a non - isotopically labeled reagent . the term “ alkyl ” refers to straight or branched chains of carbon atoms . exemplary alkyl groups are c 3 - c 10 alkyl groups which include methyl , ethyl , propyl , isopropyl , butyl , isobutyl , pentyl , isopentyl , hexyl and the like , including all regioisomeric forms thereof , and straight and branched chain forms thereof . the term “ alkyl ” is also used to denote straight or branched chains of carbon atoms having one or more carbon - carbon double bonds , such as vinyl , allyl , butenyl and the like , as well as straight and branched chains of carbon atoms having one or more carbon - carbon triple bonds , such as ethynyl , propargyl , butynyl , and the like . the term “ aryl ” denotes a cyclic , aromatic hydrocarbon . examples include phenyl , naphthyl , anthracenyl , phenanthracenyl . such aryl groups may further be substituted at available positions with h , f , cl , br , i , cn , oh , alkoxy , no 2 , nh 2 , nh - alkyl or n - dialkyl . the terms “ alkoxy ” and “ aryloxy ” denote “ o - alkyl ” and “ o - aryl ”, respectively . the term “ cycloalkyl ” denotes a cyclic group of carbon atoms , where the ring formed by the carbon atoms may be saturated or may comprise one or more carbon double bonds in the ring . examples of cycloalkyl groups include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , and the like as well as cyclopentenyl , cyclopentadienyl , cyclohexenyl , cyclohexadienyl , and the like . as used herein , the term “ cycloalkyl ” is also intended to denote a cyclic group comprising at least two fused rings , such as adamantyl , decahydronaphthalinyl , norbornanyl , where the cyclic group may also have one or more carbon - carbon double bonds in one or more rings , such as in bicyclo ( 4 . 3 . 0 ) nona - 3 , 6 ( 1 )- dienyl , dicyclopentadienyl , 1 , 2 , 3 , 4 - tetrahydro - naphthalinyl ( i . e ., tetralinyl ), indenyl , and the like . the term “ heteroaryl ” denotes a monocyclic or bicyclic aromatic group wherein one or more carbon atoms are replaced with heteroatoms selected from the group consisting of nitrogen , oxygen , and sulfur . if the heteroaryl group contains more than one heteroatom , the heteroatoms may be the same or different . preferred heteroaryl groups are five - to fourteen - member rings that contain from one to three heteroatoms independently selected from oxygen , nitrogen , and sulfur . examples of preferred heteroaryl groups include , but are not limited to , benzo [ b ] thienyl , chromenyl , furyl , imidazolyl , indazolyl , indolizinyl , indolyl , isobenzofuranyl , isoindolyl , isoquinolinyl , isothiazolyl , isoxazolyl , napthylidinyl , oxadiazolyl , oxazinyl , oxazolyl , phthalazinyl , pteridinyl , purinyl , pyranyl , pyrazinyl , pyrazolyl , pyridazinyl , pyridinyl , triazolyl and tetrazolyl , said heteroaryl groups may be further substituted as described above in the definition of aryl . a “ unit dosage form ” as used herein is any form that contains a unit dose of the compound of formula i . a unit dosage form may be , for example , in the form of a tablet or a capsule . the unit dosage form may also be in liquid form , such as a solution or suspension . the compositions of the present invention may be formulated in a conventional manner using one or more pharmaceutically acceptable carriers . thus , the active compounds of the present invention may be formulated for oral , buckle , intranasal , parenteral ( e . g ., intravenous , intramuscular or subcutaneous ) or rectal administration or in a form suitable for administration by inhalation or insufflations . for oral administration , the pharmaceutical compositions may take the form of , for example , tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents ( e . g ., pre - gelatinized maize starch , polyvinylpyrrolidone or hydroxypropyl methylcellulose ), fillers ( e . g ., lactose , microcrystalline cellulose or calcium phosphate ); lubricants ( e . g ., magnesium stearate , talc , or silica ); disintegrants ( e . g ., potato starch or sodium starch glycolate ); or wetting agents ( e . g ., sodium lauryl sulfate ). the tablets may be coated by methods well known in the art . liquid preparations for oral administration may take the form of , for example , solutions , syrups or suspensions , or they may be presented as a dry product for constitution with water or other suitable vehicle before use . such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents ( e . g ., sorbitol syrup , methyl cellulose or hydrogenated edible fats ); emulsifying agents ( e . g ., lecithin or acacia ); non - aqueous vehicles ( e . g ., almond oil , oily esters or ethyl alcohol ); and preservatives ( e . g ., methyl or propyl p - hydroxybenzoates or sorbic acid ). for buccal administration , the composition may take the form of tablets or lozenges formulated in conventional manner . the active compounds of the invention may be formulated for parenteral administration by injection , including using conventional catheterization techniques or infusion . formulations for injection may be presented in unit dosage form , e . g ., in ampoules or in multi - dose containers , with an added preservative . the compositions may take such forms as suspensions , solutions or emulsions in oily or aqueous vehicles , and may contain formulating agents such as suspending , stabilizing and / or dispensing agents . alternatively , the active ingredient may be in powder form for reconstitution with a suitable vehicle , e . g ., sterile pyrogen - free water , before use . the active compounds of the invention may also be formulated in rectal compositions such as suppositories or retention enemas , e . g ., containing conventional suppository bases such as cocoa butter or other glycerides . for intranasal administration by inhalation , the active compounds of the invention are conveniently delivered in the form of a solution or suspension from a pump spray container that is squeezed or pumped by the patient or as an aerosol spray presentation from a pressurized container or a nebulizer , with the use of a suitable propellant , e . g ., dichlorodifluoromethane , trichloro - fluoromethane , dichlorotetrachloroethane , carbon dioxide or other suitable gas . in the case of a pressurized aerosol , the dosage unit may be determined by providing a valve to deliver a metered amount . the pressurized container or nebulizer may contain a solution or suspension of the active compound . capsules and cartridges ( made , for example , from gelatin ) for use in an inhaler or insulator may be formulated containing a powder mix of a compound of the invention and a suitable powder base such as lactose or starch . a proposed dose of the active compounds of the invention for oral , parenteral or buccal administration to the average adult human for the treatment of the conditions referred to above is from about 0 . 1 mg / kg to about 100 mg / kg of the active ingredient per unit dose which could be administered , for example , one to four times per day . toxicity concerns at the higher level may restrict intravenous ( i . v .) dosages to a lower level , such as up to 10 mg / kg . a dose of about 0 . 1 mg / kg to about 100 mg / kg may be employed for oral ( p . o .) administration . typically , a dosage from about 0 . 1 mg / kg to about 10 mg / kg may be employed for intramuscular ( i . m .) injection . preferred dosages are in the 1 . 0 mg / kg to about 100 mg / kg range , and more preferably in the 5 mg / kg to about 50 mg / kg range for i . v . or p . o . administration . the duration of the treatment is usually once per day for a period of one days to three weeks , or until the condition is essentially brought under control . aerosol formulations for treatment of the conditions referred to above in the average human are preferably arranged such that each metered dose or “ puff ” of aerosol contains 0 . 1 micrograms to 100 micrograms of the active compound of the invention . the overall daily dose with an aerosol will be within the range of 0 . 1 mg / kg to about 100 mg / kg , and preferably in the range of 1 . 0 mg / kg to about 25 mg / kg . administration may be several times daily , for example 2 , 3 , 4 or 8 times , giving for example 1 , 2 or 3 doses each time . as an example , the mammal in need of treatment or prevention may be a human . as another example , the mammal in need of treatment or prevention may be a mammal other than a human . a compound of formula i which is basic in nature is capable of forming a wide variety of different salts with various inorganic and organic acids . the acid additions salts are readily prepared by treating the base compounds with a substantially equivalent amount of the chosen mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent such as methanol or ethanol . upon careful evaporation of the solvent , the desired solid salt is obtained . the acids which are used to prepare the pharmaceutically acceptable acid salts of the active compound used in formulating the pharmaceutical composition of this invention that are basic in nature are those which form non - toxic acid addition salts , e . g ., salts containing pharmacologically acceptable anions . non - limiting examples of the salts include the acetate , benzoate , beta - hydroxybutyrate , bisulfate , bisulfite , bromide , butyne - 1 , 4 - dioate , caproate , chloride , chlorobenzoate , citrate , dihydrogen phosphate , dinitrobenzoate , fumarate , glycollate , heptanoate , hexyne - 1 , 6 - dioate , hydroxybenzoate , iodide , lactate , maleate , malonate , mandelate , metaphosphate , methanesulfonate , methoxybenzoate , monohydrogen phosphate , naphthalene - 1 - sulfonate , naphthalene - 2 - sulfonate , oxalate , phenyl butyrate , phenyl propionate , phosphate , phthalate , phenylacetate , propanesulfonate , propiolate , propionate , pyrophosphate , pyrosulfate , sebacate , suberate , succinate , sulfate , sulfite , sulfonate , tartrate , xylenesulfonate , acid phosphate , acid citrate , bitartrate , succinate , gluconate , saccharate , nitrate , methanesulfonate , and pamoate { i . e ., 1 , 1 ′- methylene - bis -( 2 - hydroxy - 3 - naphthoate )] salts . also included within the scope of this invention are solvates and hydrates of compounds of formula i and their pharmaceutically acceptable salts . the present invention includes within its scope all possible stoichiometric and non - stoichiometric forms . in the examples that follow , the abbreviations used in this document are intended to have the following , general meaning : bm : broad multiplet ( nmr ) bs : broad singlet ( nmr ) d : doublet ( nmr ) dd : doublet of doublets ( nmr ) d . e . : diatomaceous earth , filtering agent calcd . : calculated value j : coupling constant ( nmr ) lc : high pressure liquid chromatography ( hplc ) m : multiplet ( nmr ) min : minute ( s ) m / z : mass to charge ratio ( mass spectroscopy ) obsd : observed value rf : retention factor ( chromatography ) rt : retention time ( chromatography ) rt : room temperature ( typically 25 ° c .) s : singlet ( nmr ) t : triplet ( nmr ), t : temperature tlc : thin layer chromatography tfa : trifluoroacetic acid thf : tetrahydrofuran solvents were purchased and used without purification . yields were calculated for material judged to be homogeneous by thin layer chromatography and nmr . thin layer chromatography was performed on kieselgel plates eluting with the indicated solvents , visualized by using a 254 nm uv lamp , and stained with either an aqueous kmno 4 solution or an ethanolic solution of 12 - molybdophosphoric acid . nuclear magnetic resonance ( nmr ) spectra were acquired on a 400 mhz nmr spectrometer . chemical shifts for proton 1 h — nmr spectra are reported in parts per million ( ppm ) relative to the singlet of cdcl 3 at 7 . 24 ppm . instrument : lachrom hplc system ( merck - hitachi ) for uv - directed purification and waters hplc / ms for mass directed purification , both equipped with rp c 18 column ( phenomenex gemini nx 5 μ 150 mm x 30 mm ). a : acetonitrile - h 2 o = 5 : 95 , 10 mm nh 4 hco 3 buffer , ph 8 . 0 b : acetonitrile - h 2 o = 80 : 20 10 mm nh 4 hco 3 buffer , ph 8 . 0 a : acetonitrile - h 2 o = 5 : 95 , 20 mm hcoonh 4 / nh 4 oh buffer , ph 7 . 4 b : acetonitrile - h 2 o = 80 : 20 , 20 mm hcoonh 4 / nh 4 oh buffer , ph 7 . 4 a : acetonitrile - h 2 o = 5 : 95 , 20 mm ch 3 coonh 4 / ch 3 cooh buffer , ph 6 b : acetonitrile - h 2 o = 80 : 20 , 20 mm ch 3 coonh 4 / ch 3 cooh buffer , ph 6 a : h 2 o with 0 . 1 % tfa , ph 2 . 2 b : acetonitrile with 0 . 1 % tfa , ph 2 . 2 column : zorbax rrhd eclipse xdb ( agilent ) c 18 , 1 . 9 micron , 50 mm x 2 . 1 mm . a : acetonitrile - h 2 o = 5 : 95 , 20 mm hcoonh 4 / nh 4 oh buffer , ph 7 . 4 b : acetonitrile - h 2 o = 80 : 20 , 20 mm hcoonh 4 / nh 4 oh buffer , ph 7 . 4 a : h 2 with 0 . 1 % tfa , ph 2 . 2 b : acetonitrile with 0 . 1 % tfa , ph 2 . 2 gradient program : adjusted according to the compound properties ; typically , start : 0 % b to 100 % b in 1 minute , 0 . 8 minute isocratic b . a mixture of 2 -( 2 - chlorophenyl )- 2 -( methylamino ) cyclohexanone hydrochloride ( ketamine hcl ) ( 423 mg , 1 . 54 mmol ) and n 1 , n 1 - dimethylethane - 1 , 2 - diamine ( 1 . 6 ml , 19 . 2 mmol ) was heated at 110 ° c . for 20 h . the mixture was cooled to room temperature and sodium cyano - borohydride ( 490 mg , 7 . 8 mmol ) was added . the mixture was then heated at 110 ° c . overnight . the cooled reaction mixture was quenched with saturated nahco 3 , extracted with ch 2 cl 2 ( 75 ml ), dried ( na 2 so 4 ) and concentrated to dryness to give 500 mg of crude product ( m / z 310 [ m + + h ]). this material was further purified by column chromatography , as described in method a above . a .) the product fractions , ( rt = 0 . 50 ) were combined , the solvents were removed and the trans - isomer was isolated as a trifluoroacetate salt , 0 . 149 g . ms : calcd . for c 17 h 28 cin 2 : 309 . 9 ; obsd . : 309 . 2 ( m + 1 ). 1 h — nmr ( dmso — d 6 , 400 mhz , t = 30 ° c .) δ 1 . 4 - 1 . 7 ( m , 3h ), 1 . 75 - 2 . 0 ( m , 3h ), 2 . 10 - 2 . 35 ( m + s , 5h ), 2 . 40 - 2 . 50 ( m + s , 6h ), 2 . 75 - 2 . 85 ( m , 2h ), 2 . 92 ( m , 1h ), 3 . 15 ( m , 1h ), 7 . 40 - 7 . 50 ( m , 2h ), 7 . 55 - 7 . 65 ( m , 2h ), 8 . 5 ( bs , 1h ). b .) the more polar fractions ( rt = 0 . 64 ) were separately combined and , after removal of the solvents , the cis - isomer was isolated as a solid , 0 . 078 g . ms : calcd . for c 17 h 28 cin 3 : 309 . 9 ; obsd . : 309 . 19 ( m + 1 ). the following compounds were also prepared using the general procedure a , as described above for the title compounds of examples 1 : trans - 1 -( 2 - chlorophenyl ) - n 2 - cyclopropylmethyl - n 1 - methylcyclohexane - 1 , 2 - diamine ( 2 a ), and the title compounds of example 2 were prepared according to general procedure a using cyclopropylmethanamine and ketamine . a .) lc ( rt = 0 . 55 )/ mass spectrum ( m / z ) calcd . for c 17 h 25 cin 2 : 292 . 8 ; obsd . : 293 ( m + 1 , 100 %), 295 ( m + 1 , 37cl , 30 %), 262 ( 28 %). 1 h — nmr ( dmso — d 6 , 400 mhz , t = 30 ° c .) δ 0 . 1 ( m , 2h ), 0 . 2 ( m , 2h ), 0 . 5 ( m , 2h ), 0 . 85 ( m , 1h ), 1 . 50 ( m , 2h ), 1 . 65 ( d , 1h ), 1 . 85 - 2 . 10 ( m , 2h ), 2 . 05 ( s , 3h ), 2 . 15 ( m , 2h ), 2 . 30 - 2 . 55 ( m , 2h ), 2 . 70 ( dd , 1h ), 4 . 45 ( s , 1h ), 7 . 40 - 7 . 65 ( m , 4h ). b .) lc ( rt = 0 . 72 )/ ms : calcd . for c 17 h 25 cin 2 : 292 . 8 ; obsd . : 293 ( m + 1 ). 1 h — nmr ( dmso — d6 , 400 mhz , t = 30 ° c .) δ 0 . 30 ( m , 2h ), 0 . 55 ( dd , 2h ), 1 . 0 ( m , 1h ), 1 . 2 ( m , 1h ), 1 . 40 - 1 . 85 ( m , 5h ), 2 . 05 ( m + s , 4h ), 2 . 80 ( m , 3h ), 4 . 20 ( m , 1h ), 6 . 5 ( bs , 2h ), 7 . 35 - 7 . 50 ( m , 2h ), 7 . 52 ( dd , 1h ), 7 . 64 ( d , 1h ). the title compounds of example 3 were prepared according to general procedure a using cyclopentylamine and ketamine . a .) lc ( rt = 0 . 58 )/ ms : calcd . for c 18 h 27 cin 2 : 306 . 9 ; obsd . : 306 . 19 ( m + 1 ). b .) lc ( rt = 0 . 96 )/ ms : calcd . for c 18 h 27 cin 2 : 306 . 9 ; obsd . : 306 . 19 ( m + 1 ). the title compounds of example 4 were prepared according to general procedure a using 3 - methoxypropylamine and ketamine . a .) lc ( rt = 0 . 59 )/ ms : calcd . for c 17 h 27 cin 2 o : 310 . 9 ; obsd . : 310 . 18 ( m + 1 ). b .) lc ( rt = 0 . 67 )/ ms : calcd . for c 17 h 27 cin 2 o : 310 . 9 ; obsd . : 310 . 18 ( m + 1 ). the title compounds of example 5 were prepared according to general procedure a using 2 - aminomethyl - 2 , 3 , 4 , 5 - tetrahydrofuran and ketamine . a .) lc ( rt = 0 . 63 )/ ms : calcd . for c 18 h 27 cin 2 o : 322 . 9 ; obsd . : 322 . 18 ( m + 1 ). b .) lc ( rt = 0 . 70 )/ ms : calcd . for c 18 h 27 cin 2 o : 322 . 9 ; obsd . : 322 . 18 ( m + 1 ). the title compound of example 6 was prepared according to general procedure a using 3 -( n , n - dimethylamino )- propylamine and ketamine . lc ( rt = 0 . 66 )/ ms : calcd . for c 18 h 30 cin 36 : 323 . 9 ; obsd . : 323 . 21 ( m + 1 ). the title compounds of example 7 were prepared according to general procedure a using benzylamine and ketamine . a .) lc ( rt = 0 . 66 )/ ms : calcd . for c 20 h 25 cin 2 : 328 . 9 ; obsd . : 328 . 17 ( m + 1 ). b .) lc ( rt = 1 . 01 )/ ms : calcd . for c 20 h 25 cin 2 : 328 . 9 ; obsd . : 328 . 17 ( m + 1 ). the title compound of example 8 was prepared according to general procedure a using 4 -( aminomethyl )- pyridine and ketamine . lc ( rt = 0 . 70 )/ ms : calcd . for c 19 h 24 cin 3 : 329 . 9 ; obsd . : 329 . 17 ( m + 1 ). the title compound of example 9 was prepared according to general procedure a using 3 -( aminomethyl )- pyridine and ketamine . lc ( rt = 0 . 56 )/ ms : calcd . for c 19 h 23 cin 3 : 329 . 9 ; obsd . : 329 . 17 ( m + 1 ). the title compound of example 10 was prepared according to general procedure a using ( r )- α - methyl - benzylamine and ketamine . lc ( rt = 1 . 05 )/ ms : calcd . for c 21 h 27 cin 2 : 342 . 9 ; obsd . : 342 . 19 ( m + 1 ). the title compound of example 11 was prepared according to general procedure a using ( s )- α - methyl - benzylamine and ketamine . lc ( rt = 0 . 81 )/ ms : calcd . for c 21 h 27 cin 2 : 342 . 9 ; obsd . : 342 . 19 ( m + 1 ). the title compounds of example 12 were prepared according to general procedure a using 3 -( 1 - imidazolyl )- propylamine and ketamine . a .) lc ( rt = 0 . 70 )/ ms : calcd . for c 19 h 27 cin 4 : 346 . 9 ; obsd . : 346 . 19 ( m + 1 ). 1 h — nmr ( dmso — d6 , 400 mhz , t = 30 ° c .) δ 1 . 35 - 1 . 55 ( m , 2h ), 1 . 60 - 1 . 75 ( m , 1h ), 1 . 80 - 2 . 00 ( m , 4h ), 2 . 05 - 2 . 35 ( m + s , 6h ), 2 . 45 - 2 . 70 ( m , 2h ), 3 . 95 - 4 . 25 ( m , 3h ), 7 . 40 - 7 . 50 ( m , 3h ), 7 . 55 ( m , 1h ), 7 . 60 ( m , 1h ), 7 . 70 ( s , 1h ), 8 . 95 ( s , 1h ). b .) lc ( rt = 0 . 54 )/ ms : calcd . for c 19 h 27 cin 4 : 346 . 9 ; obsd . : 346 . 19 ( m + 1 ). 1 h — nmr ( dmso — d6 , 400 mhz , t = 30 ° c .) δ 1 . 25 ( bs , 1h ), 1 . 40 ( bs , 1h ), 1 . 50 - 1 . 80 ( m , 4h ), 1 . 90 ( m , 1h ), 2 . 00 - 2 . 25 ( m + s , 5h ), 2 . 55 ( m , 1h ), 2 . 70 - 2 . 95 ( m , 2h ), 3 . 90 ( bs , 1h ), 4 . 20 - 4 . 35 ( m , 2h ), 6 . 50 ( bs , 2h ), 7 . 40 - 7 . 45 ( m , 2h ), 7 . 52 ( m , 1h ), 7 . 65 ( m , 1h ), 7 . 70 ( m , 1h ), 7 . 75 ( m , 1h ), 9 . 10 ( s , 1h ). the title compounds of example 13 were prepared according to general procedure a using n - ethyl - 2 -( aminomethyl )- pyrrolidine and ketamine . a .) lc ( rt = 0 . 55 )/ ms : calcd . for c 20 h 32 cin 3 : 349 . 9 ; obsd . : 349 . 23 ( m + 1 ). b .) lc ( rt = 0 . 70 )/ ms : calcd . for c 20 h 32 cin 3 : 349 . 9 ; obsd . : 349 . 23 ( m + 1 ). the title compounds of example 14 were prepared according to general procedure a using n -( 3 - aminopropyl )- pyrrolidine and ketamine . a .) lc ( rt = 0 . 50 )/ ms : calcd . for c 20 h 32 cin 3 : 349 . 9 ; obsd . : 349 . 23 ( m + 1 ). b .) lc ( rt = 0 . 68 )/ ms : calcd . for c 20 h 32 cin 3 : 349 . 9 ; obsd . : 349 . 23 ( m + 1 ). the title compounds of example 15 were prepared according to general procedure a using 3 - aminopropylbenzene and ketamine . a .) lc ( rt = 0 . 71 )/ ms : calcd . for c 22 h 29 cin 2 : 356 . 9 ; obsd . : 356 . 19 ( m + 1 ). b .) lc ( rt = 0 . 77 )/ ms : calcd . for c 22 h 29 cin 2 : 356 . 9 ; obsd . : 356 . 19 ( m + 1 ). the title compounds of example 16 were prepared according to general procedure a using n -( 3 - aminopropyl )- morpholine and ketamine . a .) lc ( rt = 0 . 49 )/ ms : calcd . for c 20 h 32 cin 3 o : 365 . 9 ; obsd . : 365 . 22 ( m + 1 ). b .) lc ( rt = 0 . 86 )/ ms : calcd . for c 20 h 32 cin 3 o : 365 . 9 ; obsd . : 365 . 22 ( m + 1 ). the title compounds of example 17 were prepared according to general procedure a using n 1 - methyl - n 2 -( 3 - aminopropyl )- piperazine and ketamine . a .) lc ( rt = 0 . 48 )/ ms : calcd . for c 21 h 35 cin 4 : 378 . 9 ; obsd . : 378 . 26 ( m + 1 ). b .) lc ( rt = 0 . 69 )/ ms : calcd . for c 21 h 35 cin 4 : 378 . 9 ; obsd . : 378 . 26 ( m + 1 ). the title compounds of example 18 were prepared according to general procedure a using cyclohexylamine and ketamine . a .) lc ( rt = 1 . 55 )/ ms : calcd . for c 19 h 29 cin 2 : 320 . 9 ; obsd . : 320 . 19 ( m + 1 ). b .) lc ( rt = 1 . 05 )/ ms : calcd . for c 19 h 29 cin 2 : 320 . 9 ; obsd . : 320 . 19 ( m + 1 ). the title compound of example 15 b ( 110 mg ) was purified using high pressure liquid chromatography ( hplc ) under the following conditions : instrument : jasco - sfc ( supercritical fluid chromatography ) semi - prep hplc ( jasco inc ., easton , md . usa ). fraction 1 ( 19 a ): 35 mg . rt = 7 . 187 min , ee & gt ; 99 %, purity & gt ; 98 %. fraction 2 ( 19 b ): 30 mg . rt = 8 . 347 min , ee & gt ; 99 %, purity & gt ; 95 %. mass spectrum : ( esi + scan ) 357 . 2 ( m 35cl + h ) + , 359 ( m 37cl + h ) + . the title compound of example 16 b ( 60 mg ) was purified using high pressure liquid chromatography ( hplc ) under the conditions described in example 19 above . fraction 1 ( 20 a ): 17 mg . rt = 10 . 192 min , ee & gt ; 99 %, purity & gt ; 99 %. mass spec ( esi +, acquisition time = 2 . 546 min ): m / z = 366 . 23 ( 100 %, ( m + h ) + ), 368 ( 33 %, ( m + h ) + for cl 37 ) fraction 2 ( 20 b ): 18 mg . rt = 12 . 783 min , ee & gt ; 99 %, purity & gt ; 99 %. mass spec ( esi +, acquisition time = 2 . 548 min ): m / z = 366 . 23 ( 100 %, ( m + h ) + ), 368 ( 33 %, ( m + h ) + for cl 37 ). the compounds from the above examples were tested for activity vs . kappa opioid receptors ( kor ) and for sigma - 1 activity . ki determinations were generously provided by the national institute of mental health &# 39 ; s psychoactive drug screening program ( pdsp ), contract # hhsn - 271 - 2013 - 00017 - c ( nimh pdsp ). the nimh pdsp is directed by bryan l . roth md , phd at the university of north carolina at chapel hill and project officer jamie driscoll at nimh , bethesda md . u . s . a . procedures employed by the pdsp are described in the nimh pdsp assay protocol book , version ii .
| 2 |
fig1 a and 11b illustrate an electrolysis apparatus for use in carrying out the process of the present invention , wherein fig1 a is a longitudinal sectional diagram and fig1 b is a plane diagram . each of a anode 13 and a cathode 14 , immersed in an electrolysis bath 12 , is a plate - shaped electrode . two anodes 13 are arranged to confront the cathode 14 on both sides thereof with the cathode 14 in the center . where the cathode 14 is formed of iron , the bottom side 15 of the cathode is tapered to have a projection at the center for dropping an nd / fe alloy from one point . the upper side of the electrolysis bath 12 is open to the air 16 , and the inner wall face 17 of the cell is composed of austenitic stainless steel . the outside of the cell is constructed by an external heating furnace 18 having a heating element 19 . reference numeral 20 represents an insulating plate . the temperature of the electrolysis bath 12 is detected by a thermocouple 21 and the heating element 19 is controlled by an external heating furnace - controlling apparatus ( not shown ) to adjust the temperature of the electrolysis bath 12 . the plate - shaped electrodes 13 and 14 are suspended from above and supported on an electrode - attaching stand 24 through an electrode distance - adjusting apparatus 22 and an electrode lifter 23 . the electrode distance - adjusting apparatus 22 and electrode lifter 23 are of the worm gear system , and the electrodes 13 and 14 are moved horizontally and vertically by rotation of the worm gears . a receiver 25 for collecting nd or an nd alloy is arranged in the electrolytic cell , and the inner surface of the receiver 25 is lined with tantalum . in this apparatus , the upper side of the electrolysis bath is open to the air . alternatively , the upper side of the electrolysis bath may be covered so that an atmosphere having a specific oxygen concentration can be located above the bath and utilized . in this electrolysis apparatus , ndf 3 is used as the starting material and the electrolysis is carried out under predetermined bath composition , bath temperature , current and voltage conditions , and nd or an nd alloy is dropped from the cathode 14 and collected in the receiver 25 . during the electrolysis , the electrodes are consumed and the distance between the electrodes is changed . accordingly , by using the distance between the distance - adjusting apparatus 22 , the electrodes are moved while taking the electrolysis conditions into consideration , so that the distance between the electrodes is kept constant , whereby desirable electrolysis conditions can be maintained . the present invention will now be described with reference to the following examples . in these examples , the electrolysis test was carried out in an electrolytic cell as shown in fig1 . referring to fig1 , a fused salt 31 is charged in a lower cell 32 composed of iron , and a anode 33 and a cathode 34 are arranged to confront each other . the distance between the electrodes 30 is maintained at 30 mm and the depth of the electrolysis bath is adjusted to 20 cm . the upper side of the electrolytic cell 32 is covered with a lid 35 and an atmosphere gas is introduced from a gas inlet 36 ( the gas can be discharged from a gas outlet 37 , if necessary ) to maintain a predetermined atmosphere 38 . note , the test in the open air is carried out while the lid 35 is removed . note also , in fig1 , reference numeral 39 represents a material feeder , reference numeral 40 represents a receiver proper , and reference numeral 41 represents an inner liner ( formed of tantalum ) of the receiver . by this electrolysis , nd is obtained in the form of a needle crystal , and an nd alloy reacts with the cathode to form a liquid drop . the nd or nd alloy is deposited in the receiver 40 by the difference of the specific gravity or the current flow in the needle crystal ( in fig1 , reference numeral 42 represents a liquid drop of nd or an nd alloy and reference numeral 43 represents nd or an nd alloy ). for comparison , a fused salt comprising 80 mole % ( 34 . 1 % by weight ) of lif an 20 mole % ( 65 . 9 % by weight ) of ndf 3 was used , the upper portion of the electrolysis cell was filled with argon gas , and the electrolysis was carried out by using a rod - shaped graphite electrode ( the graphitization ratio was 98 %) as the anode and a rod - shaped electrolytic iron electrode ( the carbon content was 0 . 02 %), whereby an nd / fe alloy was prepared . other electrolysis conditions and the results of the analysis of the obtained nd / fe alloy are shown in table 1 . for comparison ( not the prior art ), the electrolysis was carried out under the same conditions as described in example 1 except that plate - shaped electrodes were used as the anode and cathode . the results are shown in table 1 . by using the plate - shaped electrodes , the critical current value was improved and the carbon content in the nd / fe alloy was slightly reduced . but , the current and voltage of the electrolysis bath were still unstable and the bath surface was fully covered with powdery carbon , and it was confirmed that the carbon content ( 1500 ppm ) in the obtained nd - fe alloy was not suitable for using the alloy directly a the starting material ( below 400 ppm ) of a permanent magnet . to examine the effect of the oxygen gas concentration in the atmosphere , the electrolysis was carried out under the same conditions as described in example 2 except that a mixture of nitrogen and oxygen was used as the atmosphere gas and the oxygen concentration was changed . as apparent from the results shown in table 1 , with an increase of the oxygen gas concentration in the atmosphere , powdery carbon on the bath surface was prominently reduced , and at an oxygen gas concentration of 20 %, 40 % or 50 %, no powdery carbon was observed on the bath surface . correspondingly , the carbon content in the obtained nd / fe alloy was reduced with an increase of the oxygen gas concentration in the atmosphere . although the carbon concentration was 2000 ppm in the prior art process , at an oxygen gas concentration of 20 %, 40 % or 50 % in the atmosphere , the carbon content was reduced to 40 ppm and the nd / fe alloy could be directly used as the starting material ( below 400 ppm ) for a permanent magnet . furthermore , at an oxygen gas concentration of , for example , 20 % in the atmosphere , the critical current value ( 7 times ) and the current efficiency ( 2 . 7 times ) were greatly improved over the values obtained in the prior art process , the current , voltage , and critical current value were very stable , and the amount recovered of the nd / fe alloy was increased and 21 times the amount of the alloy recovered in the prior art process . the above - mentioned effects were not prominent when the oxygen gas concentration in the atmosphere was low . on the other hand , it was confirmed that , if the oxygen gas concentration was increased beyond 30 %, consumption of the carbon electrode became conspicuous and falling of the anode was accelerated . the electrolysis was carried out at an oxygen concentration of 20 % in the atmosphere while changing the shape and arrangement of the electrodes . in example 8 , rod - shaped electrodes were used , and in example 9 , a pair of plate - shaped electrodes were used , as the anode and cathode . in example 10 , a plate - shaped cathode was arranged at the center , and plate - shaped anodes were arranged in parallel to each other on both sides of the cathode . if the shape of the electrode was changed to the plate ( example 9 ) from the rod ( example 8 ), the critical current value ( 4 . 7 times ) and the current efficiency ( 1 . 3 times ) were increased , and as a result , the amount of recovered nd / fe alloy was synergistically increased ( 7 . 2 times ). furthermore , if plate - shaped anodes were arranged on both sides of the plate - shaped cathode to confront the cathode , the critical current value was doubled and the current efficiency was slightly increased , compared with the case where one plate - shaped anode was used , and as a result , the amount of the recovered nd / fe alloy was increased more than 2 times . moreover , by using plate - shaped electrodes , the carbon content in the nd / fe alloy was reduced . still further , from the results of examples 8 through 10 , it was found that , if the oxygen concentration was adjusted to an appropriate level , the current and voltage could be stabilized during the electrolysis , regardless of the shape of the electrodes . if example 10 was compared with the prior art process ( example 1 ), in example 10 , the critical current value was increased 14 times , the current efficiency was increased 2 . 8 times , the amount of the recovered nd / fe alloy was increased 45 times , and the carbon content in the nd / fe alloy was reduced to 1 / 50 . the electrolysis was carried out under the same conditions as described in examples 1 and 10 except that an electrolysis bath comprising 80 mole % ( 33 . 4 % by weight ) of lif , 20 mole % ( 64 . 6 % by weight ) of ndf 3 and 2 % by weight of nd 2 o 3 was used . the results are shown in table 2 . it was seen that there was no difference in the effect of the present invention between the bath of the lif - ndf 3 system and the bath of the lif - ndf 3 - nd 2 o 3 system . the electrolysis was carried out under the same conditions as described in examples 1 and 10 except that a graphite electrode was used as the cathode . the results are shown in table 2 . it was confirmed that , in the production of nd , the same effect as attained in the production of the nd / fe alloy was attained . the electrolysis was carried out under the same conditions as described in example 10 except that the upper side of the electrolysis bath was opened to the air and a graphite electrode ( example 15 ) or an iron electrode ( example 16 ) was used as the cathode . the results are shown in table 2 . it was confirmed that , even in the air , the effect of the present invention was attained . the electrolysis was carried out under the same conditions as described in example 10 except that a rod - shaped electrode ( 5φ × 10 h ) was used as the cathode . the results are shown in table 2 . it was confirmed that , even if a plate - shaped electrode was used only as the anode , a desired effect was attained . the comparative experiments were carried out under the same conditions as described in example 10 except that plate - shaped electrodes having a width of 70 mm ( example 18 ) or 140 mm ( example 19 ) were used . the results are shown in table 2 . from the results shown in table 2 , it was found that if the effective area of the electrodes was increased , the current value and the output of the nd / fe alloy were proportionally increased . therefore , it is understood that the present invention is superior to the prior art process using rod - shaped electrodes , in that electrodes having a larger effective area can be used in the same electrolytic cell . fig1 shows current - voltage curves at the electrolysis , obtained in examples 18 and 19 . from fig1 , it is understood , at the same current value , the voltage in example 19 was lower than the voltage in example 18 . table 2effect by production of metallic nd production of nd / fe plate - shaped effect by electrode area lif -- ndf . sub . 3 -- nd . sub . 2 o . sub . 3 system by graphite cathode and nd in air anode example 11 example 12 example 13 example 14 example 15 example 16 example 17 example 18 example 19 electrolysis atmos - phere ar ( vol %) 100 0 100 0 0 0 0 n . sub . 2 ( vol %) -- 80 -- 80 in air in air 80 80 80 o . sub . 2 ( vol %) -- 20 -- 20 20 20 20 shape and material of electrode anode graphite , graphite , graphite , graphite , graphite , graphite graphite , graphite , graphite , ( a ) rod plate rod plate plate plate plate plate plate cathode iron , rod iron , plate graphite , graphite , graphite , iron , plate iron , rod iron , plate iron , plate rod plate plate anode not graphite , not graphite , graphite , graphite , not graphite , graphite , ( b ) plate plate plate plate plate plate size of electrode ( portion in bath ) anode 5φ × 10 . sup . h 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 7φ × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d ( a ) ( cm ) cathode 5φ × 10 . sup . h 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 5φ 10 . sup . h 7φ × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d ( cm ) anode not 14 . sup . w × 10 . sup . h × 2 . sup . d not 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d not 7φ × 10 . sup . h × 2 . sup . d 14 . sup . w × 10 . sup . h × 2 . sup . d ( b ) ( cm ) size of electrolytic 18φ × 25 . sup . h 18φ × 25 . sup . h 18φ × 25 . sup . h 18φ × 25 . sup . h 18φ × 25 . sup . h 18φ × 25 . sup . h 18φ × 25 . sup . h 18φ × 25 . sup . h cell ( cm ) composition of fused salt lif ( mole %) 80 80 80 80 80 80 80 80 80 ndf . sub . 3 ( mole %) 20 20 20 20 20 20 20 20 20 nd . sub . 2 o . sub . 3 (% by weight ) 2 2 0 0 0 0 0 0 0 electrolysis temper - 880 880 880 880 880 880 880 880 880 ature ( c .) results of elec - trolysis critical current 40 560 45 600 600 560 250 280 560 value ( a ) electrolysis time 5 5 5 5 5 5 5 5 5 ( hr ) average voltatge ( v ) 6 8 6 7 7 8 7 6 8 average current ( a ) 30 480 35 510 510 480 200 240 480 average anode ( 0 . 2 ) 1 . 7 ( 0 . 2 ) 1 . 8 1 . 8 1 . 7 ( 1 . 4 ) 1 . 7 1 . 7 current desnity ( a / cm . sup . 2 ) average cathode ( 0 . 2 ) 3 . 4 ( 0 . 2 ) 3 . 6 3 . 6 3 . 4 ( 1 . 3 ) 3 . 4 3 . 4 current density ( a / cm . sup . 2 ) stability of cur - unstable stable unstable stable stable stable stable slightly stable rent and voltage unstable generation of very large not very large not not not not not not carbon on bath surface consumption of not some but no not some but no some but no some but no some but no some but no some but no carbon above bath problem problem problem problem problem problem problem stability of unstable stable unstable stable stable stable slightly stable stable critical current unstable value amount of re - -- -- 79 3460 3460 -- -- -- -- covered nd ( g ) amount of received 95 4296 -- -- -- 4296 1474 2148 4296 nd -- fe ( g ) nd content (%) 85 85 99 99 99 85 85 85 85 current efficiency 30 85 25 75 75 85 70 85 85 (%) c concentration 2000 40 40 40 40 40 ( ppm ) o concentration 2400 70 70 70 70 70 ( ppm ) others no isola - no isolation no isolation no isolation no isolation no isolation no isolation no isolation no isolation tion of of anode of anode of anode of anode of anode of anode of anode of anode anode various materials as the material for the fused salt bath cell were subjected to the corrosion test . fig1 shows an apparatus used for the corrosion test of various materials ( carbon steel , and sus - 304 , sus - 316 , sus - 310s and sus - 430 of jis standards ) in the fused salt . the results are shown in fig1 . as shown in fig1 , the material 53 to be tested was placed into the fused salt 52 . the sum of the corrosion quantities in the fused salt , on the interface between the fused salt and the open air and above the fused bath was examined with the lapse of time . the results are shown in fig1 . the experiment was conducted in the open air by using a bath cell 54 formed of sus - 304 and maintaining the bath temperature at 880 ° c . without supplying an electric current . a fused salt of the lif - ndf 3 system comprising 80 mole % of lif and 20 mole % of ndf 3 and a fused salt of the lif - ndf 3 - nd 2 o 3 system formed by adding 2 % by weight of nd 2 o 3 to the lif - ndf 3 system comprising 80 mole % of lif and 20 mole % of ndf 3 were used as the fused bath 52 . similar results were obtained . from fig1 , it is seen that , in ordinary carbon steel and ferritic stainless steel ( sus - 430 ), the corrosion quantity was larger than in austenitic stainless steels ( sus - 304 , sus - 316 and sus - 310s ), and austenitic stainless steels were excellent . furthermore , it is seen that , among austenitic stainless steels , sus - 310s ( comprising 25 % by weight of cr and 20 % by weight of ni ) had the best corrosion resistance . based on the results obtained in example 18 , an electrolytic cell shown in fig1 was fabricated and the test of the continuous operation of preparing nd / fe was carried out . referring to fig1 , an electrolytic cell 63 for containing a fused salt 62 was fabricated by using sus - 310s based on the above - mentioned test results ( example 21 ), and for comparison , the electrolytic cell was fabricated by using ordinary carbon steel ( example 22 ). in fig1 , the inner side of a metal - receiving vessel 64 composed of sus - 310s was lined with ta 65 because of high alloying reactivity of nd with other metals . when a cathode 66 of iron and an anode 67 of graphite were arranged and an electric current was supplied , nd formed by the electrolysis reacted with the cathode 66 to form an nd / fe alloy liquid drop 68 , the liquid drop was received in the metal - receiving vessel 64 , and an nd / fe alloy 69 was deposited . note , the electrolysis was conducted in air 70 . in each of the two electrolysis baths , that is , the lif - ndf 3 system comprising 80 mole % of lif and 20 mole % of ndf 3 and the lif - ndf . su b . 3 - nd 2 o 3 system formed by adding 2 % by weight of nd 2 o 3 to the lif - ndf 3 system comprising 80 mole % of lif and 20 mole % of ndf 3 , the operation was carried out at an electrolysis temperature of 880 ° c . no substantial difference was brought about by the difference of the bath composition . the results are shown in table 3 . the operation was continuously conducted , and the thickness of the material used for the electrolytic cell was reduced . the number of the operation days means the elapsing days until the thickness was reduced to a small value such that the electrolysis bath would flow out as the electrolysis operation continued . in each run , the thickness of the used cell material was 5 mm . table 3______________________________________ example 21 example 22______________________________________material used ordinary sus - 310s carbon steelatmosphere in air in aircomposition of fused saltlif ( mole %) 80 80ndf . sub . 3 ( mole %) 20 20nd . sub . 2 o . sub . 3 (% by weight ) 0 - 2 0 - 2electrolysis temperature (° c .) 880 880average current ( a ) 240 240average voltage ( v ) 7 7number of continuous use days 15 150 ( days ) ______________________________________ from the results shown in table 3 , it was confirmed that the number of continuous use days was drastically increased by using sus - 310s , i . e ., austenitic stainless steel .
| 2 |
referring now to fig1 an exhaust gas sensor probe 10 , according to the present invention , is illustrated . probe 10 includes an electrical terminal means 12 , a housing sleeve means 14 , and support member 16 . electrical terminal means 12 includes a plurality of electrical contact members 18 which are operative to communicate the exhaust gas sensor probe 10 with , for example , a remotely located source of electrical energy and a remotely located sensor utilization means . by way of example , copending commonly assigned patent application ser . no . 375 , 993 , now u . s . pat . no . 3 , 868 , 846 , -- &# 34 ; circuit for converting a temperature dependent input signal to a temperature independent output signal &# 34 ;, filed in the names of toshimoto kushida et al ., illustrates one such electrical energization and sensor utilization means . as illustrated , the electrical terminal means 12 is the well known jones plug and in this embodiment represents a form of electrical terminal means suited to laboratory use . electrical terminal means for automotive vehicle usage are generally well known and any such means may be employed and such implemention is contemplated . support member 16 is here illustrated as a ceramic material and is preferably alumina , al 2 o 3 . as illustrated , support member 16 extends in a longitudinal direction substantially from the terminal end of housing sleeve means 14 to the opposite , sensor , end 17 of housing sleeve means 14 . support member 16 is provided with a central passage 20 and a plurality of surrounding electrical conduit passages 22 . the sensor end of support member 16 is provided with a generally cup - shaped end portion 24 which is arranged to receive and support a wafer 26 of exhaust gas sensor material , principally of the variable resistive type , which responds electrically to changes in the partical pressure of oxygen . as illustrated in fig1 and as further described hereinbelow with reference to fig3 the interior void of the cup - shaped portion 24 is arranged to communicate directly with central passage 20 and , through the diagonal passages 28 , with the surrounding electrical conduit passages 22 . referring now to fig1 and 2 , and in particular to fig2 sensor wafer 26 is provided with a pair of sensor conductors 30 , 32 which communicate through diagonal passages 28 and electrical conduit passages 22 with selected ones of the electrical contact members 18 . the outer surface of cup - shaped end portion 24 is provided with a relatively continuous groove 34 which extends along substantially the entire outer surface of cup - shaped portion 24 . a heating means 36 is provided in the form of a winding of heater wire disposed within groove 34 . the heater wire 36 may be , for example , platinum and is arranged to communicate through others of the plurality of electrical conduit passages 22 with other of the terminal members 18 . the interior surface of cup - shaped end portion 24 may be provided with a pair of generally longitudinally directed confronting slots into which wafer 26 may be inserted . in order to retain heater wire 36 within the groove 34 and to shield the heater wire from any catalytic heating effects and corrosion which may be caused by exposure to the exhaust gases an inorganic potting compound 38 such as , for example , saureisen cement no . 33 , available from saureisen corporation or other suitable refractory cement may be used . other suitable cements include a1 23 cement , an aluminum oxide cement available from ventron corporation and ceramabond cement available from aremco products , incorporated . referring now to fig2 and 3 , and particularly to fig3 an end view of probe 10 is shown . as can be seen from these views , the wafer of sensor material 26 is received within a pair of slots 40 formed in the side wall 42 of the cup - shaped end portion 24 . sensor conductors 30 , 32 are shown ( in phantom lines in fig3 ) extending from two of the electrical conduit passages 22 ( shown in fig3 in phantom line ) into the sensor wafer 26 . the heating coil 36 is shown ( in phantom line in fig3 ) in surrounding relationship to wafer 26 and is situated within groove 34 . heater wire 36 is shown communicating with a further pair of surrounding passages 22 . due to the truncated wedge shape of wafer 26 and the matching taper of slots 40 , the sensor conductors 30 , 32 may be slightly deformed during insertion of the wafer 26 within slots 40 by wedging action . this slight deformation may serve to retain wafer 26 with the slots 40 . furthermore , during the life of the probe 10 , the ceramic materials of the wafer 26 and support member 16 will fuse and fracture producing a large plurality of interlocking fingers of ceramic material to further assist in holding wafer 26 within the cup - shaped end portion 24 . referring now to fig4 a sectional view of a portion of the support member 16 taken along section line 4 -- 4 of fig1 is shown . the plurality of connecting passages 28 are shown to extend through the narrowed portion 44 of support member 16 . it will be apparent that passages 28 need not be complete and may be simple grooves in the neck of the narrowed portion 44 of support member 16 . the potting compound 38 is shown in place between support member 16 and housing sleeve means 14 . referring now to fig5 an alternative embodiment of an exhaust gas sensor probe 110 according to the present invention , intended for use with an exhaust gas sensor ceramic operative at higher temperature is illustrated . the probe 110 includes an electrical terminal means 112 , a housing sleeve means 114 and support member 116 . as with the probe 10 of fig1 the electrical terminal means 112 includes a plurality of electrical contact members 118 and is fixedly attached to the housing sleeve means 114 . support member 116 is received within sleeve means 114 . a slight gap is provided between the outer surface of support member 116 and the inner surface of sleeve means 114 to provide for differential rates of expansion in the presence of heating . support member 116 is provided with a central passage 120 and a plurality of longitudinally extending electrical conduit passages 122 surrounding central passage 120 . support member 116 is also provided with a generally cup - shape end portion 124 which is arranged to open longitudinally away from the main body of support member 116 . as illustrated in fig5 and 6 , a wafer 126 of ceramic exhaust gas sensor material is received within the cup - shaped end portion 124 . a plurality of diagonal connecting passages 128 are illustrated diagonally interconnecting the interior of cup - shaped portion 124 with the electrical conduit passages 122 . as is more clearly illustrated in fig6 the sensor wafer 126 is provided with a pair of electrical leads 130 , 132 which communicate the wafer 126 with selected ones of the electrical contact members 118 through connecting passages 128 and electrical conduit passages 122 . with reference to fig5 and 6 , and in particular to fig6 the outer surface of cup - shaped end portion 124 is provided with a relatively continuous groove 134 . a heating means in the form of heater wire 136 is situated within the groove 134 . an inorganic potting compound or refractory cement 138 , such as one of the previously mentioned cements , is situated in generally surrounding relationship to the heater wire 136 and is operative to maintain the heater wire in proper relation with respect to cup - shaped end portion 124 while protecting heater wire 136 from handling damage and from the effects of direct exposure to the exhaust gases . referring now to fig6 and 7 , wafer 126 can be seen to be inserted within a pair of confronting , longitudinally extending grooves 140 placed in the side wall 142 of cup - shaped portion 124 . electrical leads 130 , 132 are shown to extend into , and terminate within , the wafer 126 by phantom lines . referring again to fig5 the housing sleeve means 114 are shown to extend a substantial distance in the longitudinal direction along support member 116 but to terminate well short of the cup - shaped end portion 124 . a cap member 144 is positioned over the end portion 124 so as to engage a shoulder 146 of support member 116 . cap member 144 is provided with an aperture 148 which is arranged so as to expose the interior of cup - shaped portion 124 to a portion of the exhaust gas stream . cap member 144 is preferably formed of a ceramic material having a coefficient of expansion compatible with that of the ceramic material selected for support member 116 and may be formed of the same ceramic material . cap member 144 is operative to inhibit radiation and conduction heat losses from potting compound 138 and heater wire 136 and , to accomplish this objective , may be coated with a thin layer of metallic material having a dielectric constant substantially different from that of the end cap material . for example , a platinum paste having a dielectric constant differing significantly from that of the ceramic end cap 144 will cause infrared reflection to occur at the interface layer between cap 144 and the metallic coating and substantial quantities of heat will be retained . the layer may be provided on either the interior or the exterior surface of end cap 144 depending upon the material selected and its reaction to the exhaust gas environment . in the embodiment illustrated in fig5 aperture 148 is formed to open in a transverse direction such that an exhaust gas stream flowing in the direction of arrow of 150 will force a small stream of gas to enter aperture 148 and to flow across the surface of wafer 126 . this flow of exhaust gases will enter central passage 120 and may be exhausted from central passage 120 by one or more cross passages such as at 152 . the cross passages 152 may be arranged at generally right angles to exhaust flow 150 and may extend through support member 116 intermediate the ends of sleeve means 114 and end cap 144 . by being generally perpendicular to the exhaust flow , an aspirating effect will occur to facilitate the flow of exhaust gases across the surface of wafer 126 . referring now to fig1 and 5 , sleeve means 14 , 114 are provided with a plurality of fin members 54 , 154 . these fin members provide for radiation of heat energy to protect the electrical terminal means 12 , 112 while providing a convenient mechanism to control the depth of penetration of the probe , 10 , 110 within the associated exhaust system of an internal combustion engine so that sensor wafers 26 , 126 will be properly positioned at the approximate center of the associated exhaust gas conduit . while sleeve means 14 , 114 are shown as comprising a threaded cylindrical member , it will be appreciated that other housing configurations are contemplated . for example , a conventional spark plug sleeve may also be utilized . referring now to fig8 a sectional view taken along section line 8 -- 8 of fig5 is shown . this view illustrates the diagonal connecting passages 128 which extend through narrowed portion 156 of support member 116 . end cap 144 is illustrated in this view as including a thin metallic coating as at 158 . the support members 16 , 116 according to the present invention are quite similar and may be fabricated in identical fashion . as illustrated in fig5 support member 116 is provided with an abutment shoulder 146 for receipt of the cap member 144 and this abutment shoulder may be provided by an additional machining step in manufacturing support members 16 , 116 . in fabricating support members 16 , 116 , for example support member 16 , a relatively liquid body of raw ceramic material which may be for example alumina is extruded through a proper extrusion die to form a multi - passaged , generally cylindrical , rod or tube of raw ceramic material . the ceramic material of the support members 16 , 116 is selected to be compatible with the temperature environment of the probe and relatively inert with respect to the exhaust gas constituents and the ceramic of wafers 26 , 126 . alumina ceramic is presently preferred on the basis of compatability and cost . this rod or tube may be provided with a length which is substantially equal to that required for probe 10 . the elongated tube of ceramic material is then prefired at an elevated temperature for a period of time sufficient , considering the magnitude of the elevated temperature , to produce a machinable green ceramic . the green ceramic tube is thereafter placed in a machining fixture and the diameter of one end of the tube is reduced from the starting diameter , which may be just slightly larger ( to allow for a predictable shrinkage on the order of about fifteen percent ) than the inner diameter of sleeve means 14 , to provide for the formation of narrowed portion 44 and of the outer surface of cup - shaped portion 24 while the machining of cup - shaped portion 24 is being accomplished . the inner surface of cup - shaped portion 24 may be provided , for example , by drilling to expand the size of central passage 20 . alternatively , both the interior of cup - shaped portion 24 and the central passage 20 may be formed by a drilling process and the electrical conduit passages 22 may also be so formed . preferably , the interior of cup - shaped portion 24 is a truncated cone . the next step may comprise forming the transversely disposed , confronting , longitudinally extending sensor receiving slots 40 on the inner wall of cup - shaped portion 24 by use of a suitable cutting tool . these slots 40 should be angled so as to intersect , if extended , at central passage 20 interiorly of support member 16 . connecting passages 28 may be drilled through the side wall of support member 16 to intercommunicate the conduit passages 22 with the interior of cup - shaped portion 24 . at the completion of the various machining and drilling steps to provide for the desired configuration of the cup - shaped portion 24 and the various passages communicating therewith , the tube , now comprising a green ceramic version of support member 16 , may be committed to final firing . thereafter , probe 10 may be assembled by inserting the sensor wafer 26 in slots 40 and the conductors 30 , 32 in the appropriate passages , situating heater wire 36 in groove 34 , bonding support member 16 in the sleeve means 14 and making the necessary electrical connection within electrical terminal means 12 . the potting compound 38 may then be added . in addition , a small amount of potting compound 38 may be added to the outer portion of slots 40 to close the slots to further assist in holding the wafer 26 in place . in those instances where the ceramic selected for support members 16 , 116 is alumina ( al 2 o 3 ), the prefiring may occur at a temperature of about 1300 ° f for a period of about 1 hour and the final firing may be conducted at a temperature of about 2700 ° f for about 2 hours . where it is desired to form a support member 116 for use in the higher temperature environment required by a sensor wafer 126 formed of cobalt monoxide ceramic material , the machining step may also include machining of the main body of support member 116 to form the shoulder 146 for receipt of cap member 144 and the step of drilling may also include the step of drilling the cross passages 152 . it will thus be seen that the present invention readily accomplishes its stated objectives . a support member for supporting an exhaust gas sensor is formed which may be used with either a titania or cobalt monoxide based sensor material and which only requires very slight configuration modifications depending on its intended usage . the support member may be readily formed by conventional ceramic and ceramic machining techniques . by providing edge support along two edges of the sensor ceramic material , a thinner sensor ceramic may be fabricated thereby improving the potential response time for the ceramic material by assuring an increase in the gas transport time to enter and fill the various pores of the ceramic material . furthermore , the wedging action of the wafer in the slots avoids the need for cementing while , in combination with the support provided along opposed edges of the sensor , inhibiting any vibration induced motion or flexing of the electrical leads . the heating means may also be removed from the wafer 26 without exposing it to the deleterious effects of exposure to the exhaust gases . while the heater means is now more remote from the variable resistance zone of primary interest , it is situated so as to be of substantially greater extent so that the heating function is not seriously or adversely effected and the sensor wafer may be of reduced mass and thickness . by providing a ceramic support construction which places the ceramic material at the center of , and not in contact with , a generally helically formed heater wire , the ceramic may be maintained at the desired elevated temperature with lower expenditures of heater wire energization energies and the need for additional wires formed in the sensor ceramic is avoided . furthermore , by providing the end cap using well known refractory techniques for retaining heat , a wafer of sensor material may be maintained at a greatly elevated temperture with far less expenditure of electrical energy in the heater wire .
| 6 |
according to the fig1 and 4 , a rotor 1 according to the invention of a supercharging device 2 which is otherwise merely schematically hinted , in particular of an exhaust gas turbocharger , comprises a compressor wheel 3 and a turbine wheel 4 which is indirectly fastened thereon . between the compressor wheel 3 and the turbine wheel 4 a sealing disc 5 with multiple annular sealing fins or labyrinths 6 is arranged . the sealing disc 5 is preferentially produced from a titanium material , which minimises the heat transfer from the turbine wheel 4 to the compressor wheel 3 . on the turbine wheel side a pot - shaped bearing bush 7 for the radial air bearing is provided , which comprises at least one hollow space 8 and multiple stiffening ribs 9 extending into this hollow space . on its face wall 10 , the bearing bush 7 can have an axial bearing surface in particular a grooved axial air bearing . through the hollow design of the bearing bush 7 , the same can be formed comparatively light , i . e . with little weight , which in particular is of special advantage for using the rotor 1 in a supercharging device 2 in a motor vehicle . because of the additionally provided stiffening ribs 9 , the strength of the bearing bush 7 , in particular in radial direction , can be significantly increased which likewise has a positive effect on a rotor natural frequency of the rotor 1 . in the case of the rotor 1 according to the invention , the rotor natural frequency can be increased via the rotational speed of the rotor 1 so that the same during the operation of the exhaust gas turbocharger is never reached and accordingly no natural frequency problems occur . in order to further increase the rotor natural frequency , the weight at the rotor ends can be reduced , by way of which a deformation of the bearing bush 7 through the stiffening is prevented . according to the fig1 and 2 , the bearing bush 7 in this case is merely provided on the turbine side , wherein it is obviously also conceivable that such a bearing bush 7 is exclusively provided on the compressor side or on both sides . looking at a face wall 10 of the bearing bush 7 , it is evident with the bearing bush 7 shown according to fig1 that the same has a convex bulge and is thereby reinforced which likewise has a positive effect on the strength and stiffness of the bearing bush 7 . the stiffening ribs 9 shown according to fig1 are annular in design and project towards the interior into the hollow space 8 collar - like . generally , the bearing bush 7 according to fig1 merely has a single hollow space 8 . in contrast with the bearing bush 7 according to fig1 , the bearing bush 7 according to fig2 comprises multiple hollow spaces 8 and multiple stiffening ribs 9 , which are produced through axially parallel bores 11 ( see in particular fig3 ). in addition to producing the hollow spaces 8 by drilling , these can obviously be produced also by erosion processes . looking once more at the fig1 and 2 it is evident that the compressor wheel 3 and the turbine wheel 4 each have a central recess 12 facing one another , just like the sealing disc 5 located between the compressor wheel 3 and the turbine wheel 4 . all three components of the rotor 1 , i . e . the compressor wheel 3 , the turbine wheel 4 and the sealing disc 5 in this case are screwed together , i . e . fastened to one another by a central screw 13 . by unscrewing the central screw 13 , disassembly of the rotor 1 , in particular for example for replacing individual components , such as for example the sealing disc 5 , is easily possible . tightening of the screw 13 in this case is performed from the compressor side , for the purpose of which the bearing bush 7 is removed . the bearing bush 7 is connected annularly sealingly to the turbine wheel 4 , in particular for example welded , soldered , upset or glued . the sealing disc 5 has two annular steps 14 and 14 ′ located opposite , wherein the compressor wheel 3 with an annular edge 15 ′ engages in one of these , whereas the turbine wheel 4 with an annular edge 15 engages in the other annular step 14 . according to fig4 an embodiment is shown in which the bearing bush 7 is screwed to the turbine wheel 4 . for this purpose , the bearing bush 7 comprises an external thread 16 and the turbine wheel 4 a complementarily associated internal thread 17 ( see also fig5 ). accordingly , to disassemble the rotor 1 , the bearing bush 7 has to be first unscrewed in order to make possible access to the screw 13 . to save weight , the bearing bush 7 shown according to the fig4 and 5 also has hollow spaces 8 . in a further embodiment , the screw 13 and the bearing bush 7 in fig4 can be formed in one piece so that the three components of the rotor 1 , i . e . the compressor wheel 3 , the turbine wheel 4 and the sealing disc 5 are screwed to one another by attaching the bearing bush 7 , i . e . fastened to one another . with the rotor 1 according to the invention it is possible to realise a radial air bearing at the rotor 1 with high strength in radial direction . for this purpose , the radial bearing element , i . e . concretely the bearing bush 7 comprises multiple stiffening ribs 9 , which engage in at least one hollow space 8 of the bearing bush 7 or delimit multiple of these hollow spaces 8 . because of the stiffening ribs 9 , a deformation tendency of the bearing bush 7 in the case of high rotor rotational speed can additionally be reduced . the stiffening ribs 9 likewise have an advantageous effect on the rotor natural frequency of the rotor 1 . with the rotor 1 according to the invention , the rotor natural frequency in particular can be raised above the rotational speed of the rotor 1 , so that the same exclusively rotates in a sub - critical range . this is mainly achieved through the bearing located outside and the increased stiffness .
| 5 |
most vehicles could achieve substantial improvements in aerodynamic efficiency by adding light - weight fairings for the purpose of smoothing the flow of air under the vehicle . such fairings would be optimized if they were located just beneath the floor of the vehicle and were more or less horizontally flat or slightly curved , and strengthened with shallow creases or corrugations oriented parallel to the direction of movement of the vehicle . however , some elements of the drive train , steering , and suspension systems protrude too far below the floor of the vehicle to be practically covered by such flat fairings . such protruding elements include cross members ; control arms ; trailing arms ; axle beams , tubes or housings ; sway or stabilizer bars ; toe links and tie rods . in many vehicles , and especially in trailers , among the most prominent of those elements are the axles . the present invention , in addition to disclosing flat fairings to streamline broad areas of the undersides of vehicles , also discloses airfoil - shaped fairings to streamline protruding elements such as axles . in preferred embodiments of this invention , where practical , these airfoils pivot on the protruding elements , and at least one independently pivoting airfoil is located adjacent to each wheel , so that , in addition to reducing aerodynamic drag on the elements , the airfoils also stabilize the vehicle by adaptively generating downward or upward force on the adjacent wheel , as appropriate to counter any tendency for the wheel to lift off the surface of the roadway or be squashed against the roadway as the vehicle negotiates sharp bends in the road or is buffeted by cross winds . accordingly , when downward force is not needed for stability , these airfoils are capable of automatically providing lift , reducing rolling resistance and reducing wear on the tires . fig1 illustrates the stabilizing action of an airfoil 1 mounted on one side of the axle 2 adjacent to a wheel 8 of a vehicle such as a trailer . the three views are diagrammatic cross sections of the airfoil in three situations : ( a ) the vehicle is lightly loaded and the airfoil is in a neutral orientation , providing a streamlining effect , but exerting no upward or downward force ; ( b ) the vehicle is heavily loaded or this wheel 8 of the vehicle is pressed down by cross winds or by centrifugal force as the vehicle negotiates a tight curve in the road with this wheel 8 on the outside of the turn ; in these circumstances the angle of attack of the airfoil adjusts automatically to provide lift , countering the additional load on the wheel and thereby reducing rolling resistance ; ( c ) this wheel of the vehicle tends to lift off the surface of the road due to cross winds or centrifugal force experienced during a tight turn with this wheel on the inside of the turn ; in these circumstances the angle of attack is automatically adjusted to exert force downward , countering the tendency for the vehicle to overturn . fig2 shows a side view cross section of one airfoil 1 mounted on one side of an axle 2 by means of bushing 3 , which minimizes wear and friction as the airfoil pivots around the axle , automatically responding to varying loads on wheel 8 . the airfoil is linked to spring hanger 4 by means of turnbuckle 5 , providing for automatic adjustment of the angle of attack of the airfoil . for clarity of illustration , the turnbuckle is depicted here in front of spring 6 , with the lower end of the turnbuckle connected to the sectioned face of the airfoil ; this is a stylistic representation of a more practical and effective embodiment in which the airfoil extends to the outer edge of the spring , and the turnbuckle is attached to the outer edge of the spring hanger 4 and the outer end of the airfoil as shown in fig3 but where it would be largely out of view from the perspective of this figure ( looking from under the vehicle outward toward one side of the vehicle ). in the embodiment shown in fig2 , the airfoil is largely hollow , to minimize weight . it may be made of a light - weight material such as extruded aluminum . fig3 shows the underside of a trailer having two airfoils 1 mounted on the two sides of the axle 2 . in this view , both airfoils are in the same ( neutral ) position , as in fig1 a , although they independently pivot . a flat fairing 11 covers frame cross members . fig4 shows how the present invention may be applied to cross - wise protruding elements of a vehicle &# 39 ; s frame or suspension system other than axles and axle tubes . such elements are commonly not tubular ; rather , often they are i - beams or inverted u - beams ( a ). the aerodynamics of the underside of the vehicle would be markedly improved if these elements were redesigned as rigid airfoil - shaped beams ( b ). alternatively , the additional stabilizing advantages of the present invention may be realized if these elements are redesigned as tubular beams around which airfoils pivot ( c ) or , if design constraints preclude such tubular beams , then the beams of prior art , such as i - beams and u - beams , may be enclosed within cylindrical sleeves around which airfoils pivot ( d ). unlike typical airplane wings , airfoils such as those appropriate for the present invention are designed to produce routinely downward force as well as lift . therefore , they may have little or no camber , being symmetric or nearly symmetric about the plane passing through the leading and trailing edges , as shown in the above figures . an example of such an airfoil shape is naca 0012 ( jacobs et al . 1932 ) used in the wing of the lockheed c - 5 galaxy aircraft and the rotor blades of helicopters . to minimize the force required to automatically adjust and maintain the angle of attack , each airfoil preferentially pivots around its aerodynamic center , about ¼ the distance from the leading edge of the airfoil to the trailing edge , approximately as illustrated in the above figures . airfoils may be provided with endplates at the lateral ends for the purpose of reducing induced drag caused by wingtip vortices at the lateral ends of the airfoils . when traveling over bumpy roads , the pivoting airfoils disclosed here have two additional beneficial effects apart from streamlining and stabilizing the vehicle . because in such conditions , the trailing edges of the airfoils flap up and down continuously , the airfoils effectively provide a sculling effect , somewhat like the propulsive action of an avian wing , transforming into forward propulsion some of the energy that would otherwise be expended in bouncing the vehicle . in doing so , the airfoils dampen some of the bounce , effectively serving as shock absorbers that are more efficient than typical hydraulic shock absorbers , which translate bouncing energy into waste heat rather than propulsion . although the figures and description above contain many specific details , these merely provide illustrations and examples of some embodiments of this invention . various other manifestations , variations , and modifications are possible within its scope . the particular arrangements herein disclosed are meant to be illustrative only and are not to be construed as limiting the scope of the invention , which includes any and all applications , variations , modifications and equivalents within the spirit and scope of the appended claims .
| 8 |
exemplary embodiments of devices consistent with the present invention include one or more of the novel mechanical and / or electrical features described in detail below . for example , one or more of the exemplary embodiments of the invention disclosed include auto - monitoring or , self - test , features . some self - test features and capabilities with respect to gfci devices have been disclosed previously , for example , in u . s . pat . nos . 6 , 807 , 035 , 6 , 807 , 036 , 7 , 315 , 437 , 7 , 443 , 309 and 7 , 791 , 848 , and u . s . patent application ser . no . 13 / 422 , 790 , filed on mar . 16 , 2012 , all which are commonly assigned to the same assignee of this application and the entire respective contents of which are incorporated herein by reference for all that is taught . an auto - monitoring feature consistent with the present invention disclosed herein is more robust than that which has been previously disclosed and reduces the probability of false or nuisance tripping by the device . for example , additional features are provided that relate to the determination of an end - of - life ( eol ) condition and actions taken subsequent to such determination . further exemplary novel electrical and mechanical features consistent with the invention are described herein below with reference to the figures . referring to fig1 , a gfci receptacle 10 according to an exemplary embodiment of the invention includes a front cover 12 having a duplex outlet face 14 with phase 16 , neutral 18 and ground 20 openings . face 14 also has opening 22 accommodating reset button 24 adjacent opening 26 accommodating test button 28 and six respective circular openings , 30 - 35 . in accordance with this exemplary embodiment openings 30 , 33 accommodate two respective indicators , such as different colored leds , openings 32 , 34 accommodate respective bright leds used , for example , as a nightlight , opening 31 accommodates a photoconductive photocell used , for example , to control the nightlight leds , and opening 35 provides access to a set screw for adjusting a photocell device in accordance with this and other exemplary embodiments . rear cover 36 is secured to front cover 12 by eight fasteners 38 — four fasteners 38 are shown in fig1 and four additional fasteners are provided on the side of receptacle 10 obscured from view in fig1 . for example , each fastener 38 may include a barbed post 50 on front cover 12 and corresponding resilient hoop 52 on rear cover 36 , similar to that which is described in detail in u . s . pat . no . 6 , 398 , 594 , the entire contents of which are incorporated herein by reference for all that is taught . ground yoke / bridge assembly 40 having standard mounting ears 42 protrudes from the ends of receptacle 10 . referring to fig2 , front cover 12 has been removed to expose manifold 126 , which provides support for printed circuit board 390 and yoke / bridge assembly 40 . according to the embodiment shown , manifold 126 includes four dovetail interconnects 130 that mate with corresponding cavities 132 along the upper edge of rear cover 36 . one dovetail - cavity pair is provided on each of the four sides of manifold 126 and rear cover 36 , respectively . fig3 is a side elevation view of core assembly 80 . core assembly 80 includes circuit board 82 that supports most of the working components of the receptacle , including the circuit shown in fig4 , sense transformer 84 and grounded neutral transformer 85 ( not shown ). line contact arms 94 , 96 pass through transformers 84 , 85 with an insulating separator 98 therebetween . line contact arms 94 , 96 are cantilevered , their respective distal ends carrying phase and neutral line contacts 102 , 104 . load contact arms 98 , 100 are also cantilevered with their respective distal ends carrying phase and neutral load contacts 101 , 103 . the resiliency of the cantilevered contact arms biases the line contacts 102 , 104 and load contacts 101 , 103 away from each other . load contact arms 98 , 103 rest on a movable contact carriage 106 , made of insulating ( preferably thermoplastic ) material . fig4 is a schematic drawing of the electrical and mechanical components of a gfci receptacle device consistent with one or more of the exemplary embodiments of the present invention . the circuit shown in fig4 can be employed in a gfci device as described above with respect to various embodiments of the invention . the circuit of fig4 is consistent with the mechanical operation of the exemplary embodiments described above ; however , a gfci device consistent with embodiments of the invention need not employ the precise electrical circuit depicted in fig4 and those of ordinary skill in the art , after viewing fig4 and / or reviewing the description set forth below , would be able to modify certain aspects of the circuit to achieve similar overall results . such modifications are contemplated and believed to be within the scope of the invention set forth herein . fig4 is a schematic drawing of an electrical circuit in accordance with an exemplary embodiment of the invention . the circuit shown in fig4 , or various sub - circuits thereof , can be implemented in a variety electrical wiring devices , however , for purposes of description here the circuit of fig4 is discussed in conjunction with its use in the gfci receptacle device shown in fig1 - 3 . the circuit of fig4 includes phase line terminal 326 and neutral line terminal 328 for electrical connection to an ac power source ( not shown ), such as a 60 - hertz , 120 volt rms power source as used in the united states for mains power . the circuit of fig4 and the software resident on and implemented therewith , can be modified to accommodate other power delivery systems as well . such modifications and the resultant circuit and wiring device in which the circuit and software are would ultimately be used are contemplated by the inventor and considered to be within the spirit and scope of the invention described herein . for example , power delivery systems that use different voltages and frequencies are within the scope of the invention . referring to fig4 , phase conductor 330 and neutral conductor 332 are respectively connected to the phase and neutral line terminals and each pass through sense transformer 334 and grounded neutral transformer 336 , which are part of a detection circuit described below . by way of example , phase and neutral line terminals correspond to input terminal screws 326 , 328 in fig1 above and phase and neutral line conductors 330 , 332 represent line contact arms 94 , 96 , respectively , as described above with respect to fig3 . each of line conductors 330 , 332 has a respective fixed end connected to the phase and neutral line terminals and each includes a respective movable contact , e . g . contacts 102 , 104 from the embodiment described above . face phase and face neutral conductors 338 , 340 , respectively , include electrical contacts ( not shown ) fixed thereto . the face conductors are electrically connected to and , in the embodiment shown are integral with , respective face terminals 342 , 344 , to which plug blades from a load device ( not shown ), such as an electrical appliance , would be connected when the electrical receptacle device is in use . the circuit shown in fig4 according to this embodiment also includes optional load phase and load neutral terminals 346 , 348 , respectively , which electrically connect to a downstream load ( not shown ), such as one or more additional receptacle devices . load terminals 346 , 348 are respectively connected to cantilevered load conductors 277 , 278 , each of which includes a movable contact ( not shown in fig4 ) at its distal end . the load contacts are disposed below respective phase and neutral line contacts and phase and neutral face contacts and are coaxial with them such that when the line conductors are moved toward the load and face conductors , the three sets of contacts mate and are electrically connected together . when the device is in this condition it is said to be “ reset ” or in the reset state . with continued reference to fig4 , detector circuit 352 includes transformers 334 , 336 as well as a gfci integrated circuit device ( gfci ic ), 350 . in accordance with the present embodiment gfci ic 350 is the well - known 4141 device , such as an rv4141 device made by fairchild semiconductor corporation . other gfci ic devices could also be used in the circuit of fig4 instead of the 4141 and such a modification is within the spirit and scope of the invention . gfci ic device 350 receives electrical signals from various other circuit components , including transformers 334 , 336 , and detects one or more kinds of faults , such as a real fault , a simulated fault or self - test ground fault , as well as a real or simulated grounded neutral fault . for example , when a sufficient current imbalance in line conductors 330 , 332 occurs , a net current flows through the transformers 334 , 336 , causing a magnetic flux to be created about at least transformer 334 . this magnetic flux results in electrical current being induced on conductor 333 , which is wound around sense transformer 334 . respective ends of conductor 333 are connected to the positive and negative inputs to the sense amplifier of gfci ic device 350 at input ports v - ref and vfb , respectively . the induced current on conductor 333 causes a voltage difference at the inputs to the sense amplifier of gfci ic 350 . when the voltage difference exceeds a predetermined threshold value , a detection signal is generated at one or more of outputs of gfci ic 350 , such as the scr trigger signal output port ( scr_out ). the threshold value used by gfci ic 350 is determined by the effective resistance connected between the op - amp output ( op_out ) and the positive input to the sense amplifier ( vfb ). the current imbalance on line conductors 330 , 332 results from either a real ground fault , a simulated ground fault or a self - test ground fault . a simulated ground fault is generated when test switch 354 in fig4 closes , which occurs when test button 28 ( fig1 ) is pressed . as described in further detail below , a self - test fault occurs when auto - monitoring circuit 370 initiates an auto - monitoring test sequence that includes an electrical current being generated on independent conductor 356 . according to the present embodiment , when test switch 354 closes , some of the current flowing in line conductors 330 , 332 and load conductors 338 , 340 is diverted from the phase face conductor 338 ( and phase load conductor 277 when the device is in the reset state ) around sense transformer 334 and through resistor 358 to neutral line conductor 332 . by diverting some of the current through resistor 358 in this manner , an imbalance is created in the current flowing through conductor 330 and the current flowing in the opposite direction through conductor 332 . when the current imbalance , i . e ., the net current flowing through the conductors passing through the sense transformer , exceeds a threshold value , for instance 4 - 5 milliamps , this simulated ground fault is detected by detector circuit 352 and the scr output of gfci ic 350 ( scr_out ) is activated . when the scr output of gfci ic 350 is activated , the gate of scr 360 is turned on allowing current to flow from the phase line conductor 330 through diode 359 and scr 360 . the current flowing through scr 360 turns on the gate of scr 361 and scr 369 . when scr 361 is turned on , current flows from phase line conductor 330 through secondary coil 363 of dual - coil solenoid 362 , fuse 365 , diode 367 and scr 361 . further , when scr 369 is turned on , current flows from phase line conductor 330 through primary coil 364 of dual - coil solenoid 362 , fuse 372 , diode 374 and scr 369 . the current flowing through both coils 363 , 364 generates a magnetic field that moves an armature within solenoid 362 . when the solenoid armature moves , it unlatches a contact carriage , ( e . g ., 106 in fig3 ) which is part of interrupting device 315 , and the carriage drops under the natural bias of line conductors 330 , 332 , that is , away from the face conductors 338 , 340 and load conductors 277 , 278 . the device is now said to be “ tripped ,” as a result of the successful manual simulated fault test sequence , and the device will not deliver power to a load until it is reset . the time it takes from the instant switch 354 closes until the device is tripped and current no longer flows from phase line conductor 330 to either the face and load conductors and through solenoid coils 363 , 364 , is so short that fuses 365 , 372 remain intact . with continued reference to fig4 , closing reset switch 300 , e . g ., by pressing reset button 24 ( fig1 ), also initiates a test operation . specifically , when reset switch 300 closes , a voltage supply output , vs , of gfci ic 350 is electrically connected to the gate of scr 360 through conductor 308 , thus , turning on scr 360 . when scr 360 is turned on , current is drawn from line conductor 330 through diode 359 and scr 360 and ultimately to ground . similar to when scr 360 is turned on by pressing the test button , as discussed previously , turning on scr 360 by pressing the reset button results in scr 361 and scr 369 also being turned on and current flowing through solenoid coils 363 , 364 . the current flowing through coils 363 , 364 of solenoid 362 generates a magnetic field at the solenoid and the armature within the solenoid is actuated and moves . under typical , e . g ., non - test , conditions , the armature is actuated in this manner to trip the device , such as when an actual fault occurs . when reset switch 300 closes , however , the device is likely already in the tripped condition , i . e ., the contacts of the line , face and load conductors are electrically isolated . that is , the reset button is usually pressed to re - latch the contact carriage and bring the line , face and load contacts back into electrical contact after the device has tripped . if the armature of solenoid 362 fails to fire when the reset button is pressed , and the reset mechanism , including the contact carriage , fails to engage the reset plunger on its return after the reset button is released , the device will not reset . accordingly , if , for example , the device has not been wired to the ac power lines , or it has been mis - wired , that is , the device has been wired with the ac power not connected to the line terminals , 326 , 328 , no power is applied to the gfci ic 350 . if no power is applied to gfci ic 350 , the gate of scr 360 cannot be driven , either by the scr output of gfci ic 350 or when the rest button is pressed . under this condition the device will not be able to be reset . the mis - wire condition is prevented in accordance with a wiring device consistent with the present embodiment by ensuring the device is shipped to the user in the tripped condition . because the device cannot be reset until ac power is properly applied to the line terminals , the mis - wire condition is prevented . with continued reference to the exemplary circuit schematic shown in fig4 , auto - monitoring circuit 370 includes a programmable device 301 . programmable device 301 can be any suitable programmable device , such as a microprocessor or a microcontroller , which can be programmed to implement the auto - monitoring routine as explained in detail below . for example , according to the embodiment shown in fig4 , programmable device 301 is implemented by an atmel ™ microcontroller from the attiny 10 family . it could also be implemented by a microchip microcontroller such as a pic10f204 / 206 . according to one exemplary auto - monitoring , or automatic self - testing , routine in accordance with the embodiment shown in fig4 , microcontroller 301 initiates the auto - monitoring routine approximately every three ( 3 ) seconds by setting a software auto - monitoring test flag . the auto - monitoring test flag initiates the auto - monitoring routine within the circuit interrupting device and confirms that the device is operating properly or , under certain circumstances , determines that the circuit interrupting device has reached its end - of - life ( eol ). when the auto - monitoring routine runs with a positive , i . e ., successful , result , the auto - monitoring circuit enters a hibernation state until microcontroller 301 sets the test flag again and initiates another auto - monitoring routine . if the auto - monitoring routine runs with a negative result , e . g ., it cannot be determined that the circuit interrupting device is functioning properly or it determines that it is , in fact , not operating properly , a failure counter is incremented and microcontroller 301 initiates another auto - monitoring routine when instructed by the software program stored in memory within the device . in addition to the failure count being incremented , a temporary indication of the failure is also provided . for example , according to the present embodiment , when such a failure occurs , i / o port gp 0 of microcontroller 301 is controlled to be an output and light emitting diode ( led ) 376 is controlled to flash , e . g ., one or more times , to indicate the failure to a user . if the failure counter reaches a predetermined value , i . e ., the auto - monitoring routine runs with a negative result a certain number of times , the number being stored and implemented in software , the auto - monitoring routine invokes an end - of - life ( eol ) sequence . the eol sequence includes one or more of the following functions ; ( a ) indicate that eol has been reached , for example , by continuously flashing or illuminating an indicator light and / or generating an audible sound , ( b ) attempt to trip the device , ( c ) prevent an attempt to reset the device , ( d ) store the eol event on non - volatile memory , e . g ., in the event there is a power failure , and ( e ) clear the eol condition when the device is powered down . in accordance with this embodiment , when the auto - monitoring software determines it is time to run the auto - monitoring routine , i . e ., based on the auto - monitor timer , a stimulus signal 302 is turned on at i / o port gp 1 of microcontroller 301 . when the stimulus signal is turned on , electrical current flows through resistor 303 and a voltage is established at the base of transistor 304 , turning the transistor on . when transistor 304 is turned on , current flows from dc voltage supply 378 through resistor 305 , which is , for example , a 3 k - ohm resistor , and continues through electrical conductor 356 and transistor 304 to ground . regarding dc voltage source 378 , according to the present embodiment the value of this voltage source is designed to be between 4 . 1 and 4 . 5 volts dc , but the value of this voltage supply can be any other suitable value as long as the value used is adequately taken into account for other circuit functionality described below . according to this exemplary embodiment , electrical conductor 356 is a wire , but it could also be a conductive trace on a printed circuit board . conductor 356 is connected at one end to resistor 305 , traverses through sense transformer 334 and is looped approximately ten ( 10 ) times around the core of the transformer and connected at its other end to the collector of transistor 304 . thus , when the software auto - monitoring test flag is set in microcontroller 301 and transistor 304 is turned on , current flows through conductor 356 which comprises an independent conductor separate from phase line conductor 330 and neutral line conductor 332 , which also traverse through the center of sense transformer 334 . if the circuit interrupting device according to the present embodiment is functioning properly , as current flows through conductor 356 and through the sense transformer a magnetic flux is generated at sense transformer 334 . the flux generates a signal on conductor 333 which is detected by detection circuit 352 , including gfci ic device 350 . in accordance with this embodiment , when device 350 detects the flux created at sense transformer 334 , a voltage level is increased at one of the i / o ports of device 350 , for example at the output port labeled cap in fig4 , thus increasing the voltage on conductor 306 . according to this embodiment , capacitor 307 is connected between the cap i / o port of microcontroller 301 and ground . as is known in the art , attaching a capacitor directly between the cap output of a 4141 gfci ic device and ground causes the scr trigger signal ( scr_out ) output from gfci ic device 350 to be delayed by a predetermined period of time . the amount of time the trigger signal is delayed is typically determined by the value of the capacitor . according to the present embodiment , however , capacitor 307 is not connected directly between the cap output and ground . instead , capacitor 307 is also connected to the adc i / o port gp 0 of microcontroller 301 via a circuit path that includes diode 310 in series with resistor 311 , e . g ., 3 m - ohm , which completes a voltage divider circuit with resistor 312 , e . g ., 1 . 5 m - ohm . this additional circuitry connected to the capacitor at the cap output of gfci ic device 350 drains current from the delay capacitor . by measuring the value of the signal at adc i / o port ( gp 0 ) and confirming it is above a certain level , it can be determined whether or not the self - test fault signal generated on conductor 356 was properly detected by detection circuit 352 and it can further be confirmed whether gfci ic device 350 is capable of generating the appropriate scr trigger signal . also , to avoid tripping the device during a self - test auto - monitoring fault , the voltage at capacitor 307 is measured and proper self - test fault detection is confirmed before a drive signal is output at scr_out of gfci ic device 350 . if the current drain on capacitor 307 is too high , gfci ic device 350 may not operate properly . for example , if as little as 3 - 4 microamps of current is drained from capacitor 307 , grounded neutral conditions , which are also intended to be detected by gfci ic device 350 , may not be accurately detected , e . g ., pursuant to ul requirements , because the scr trigger signal ( scr_out ) will not fire within the necessary amount of time . according to the present embodiment , less than about 1 . 3 microamps , or about 5 % of the specified delay current for the gfci ic device 350 , is drained for the adc i / o port gp 0 of microcontroller 301 . this small current drain from capacitor 307 has no effect on the ability of the device to properly detect real ground faults and / or real grounded neutral faults . according to this embodiment , approximately 50 nanoamps of current is drawn off of capacitor 307 . parallel resistors 311 and 312 connected to the adc i / o port gp 0 of microcontroller 301 create a 4 . 5 megaohm drain which limits the current pulled from capacitor 307 to a maximum of 1 . 0 microamp . gfci ic device 350 uses approximately 40 microamps of current to generate the scr trigger but microcontroller 301 only requires approximately 50 nanamps to read the scr trigger signal off of capacitor 307 before the scr trigger signal is output from scr_out . accordingly , by selecting the proper value for capacitor 307 , in conjunction with appropriate value selections for resistors 311 and 312 , as well as diode 310 , it is possible to maintain the correct delay for the scr trigger signal ( scr_out ) from gfci ic device 350 and use the adc in microcontroller 301 to measure the signal at adc input ( gp 0 ) to determine whether the test signal on conductor 356 has been properly detected by detection circuit 352 . it should also be noted that in the embodiment shown in fig4 , led 376 is also connected to adc i / o port ( gp 0 ) of microcontroller 301 . accordingly , whether or not led 376 is conducting or not will affect the drain on capacitor 307 , as well as the delay of the scr trigger signal and the ability of microcontroller 301 to properly measure the signal output from the cap i / o port of gfci ic device 350 . thus , in regard to the circuit shown in fig4 , led 376 is selected such that it does not turn on and begin conducting during the time microcontroller 301 is measuring the signal from the cap output of gfci ic device 350 . for example , led 376 is selected such that its turn - on voltage is about 1 . 64 volts , or higher which , according to the circuit shown in fig4 , can be measured at i / o port gp 0 . additionally , to prevent any signal adding to capacitor 307 when led 376 is being driven , diode 310 is provided . according to this embodiment , the circuit path that includes diode 310 and the voltage divider , 311 , 312 , is connected to i / o port gp 0 of microcontroller 301 , which serves as an input to an analog - to - digital converter ( adc ) within microcontroller 301 . the adc of microcontroller 301 measures the increasing voltage established by the charging action of capacitor 307 . when a predetermined voltage level is reached , microcontroller 301 turns off the auto - monitoring stimulus signal 302 which , in turn , turns off transistor 304 , stopping the current flow on conductor 356 and , thus , the flux created at sense transformer 334 . when this occurs , it is determined by microcontroller 301 that a qualified auto - monitoring event has successfully passed and the auto - monitoring fail counter is decremented if the present count is greater than zero . in other words , according to this embodiment an auto - monitoring routine is repeated by microcontroller 301 on a predetermined schedule . based on the software program stored in memory within microcontroller 301 , the auto - monitoring routine is run , as desired , anywhere from every few seconds to every month , etc . when the routine is initiated , the flux created at sense transformer 334 occurs in similar fashion to the manner in which flux would be created if either an actual ground fault had occurred or if a simulated ground fault had been manually generated , e . g ., by pressing the test button as described above . there is a difference , however , between an auto - monitoring ( self - test ) fault generated by the auto - monitoring routine and either an actual ground fault or a simulated fault generated by pressing the test button . when either an actual or simulated ground fault occurs , a difference in the current flowing in the phase and neutral conductors , 330 and 332 , respectively , should be generated . that is , the current on conductor 330 should be different than the current on conductor 332 . this differential current flowing through sense transformer 334 is detected by gfci ic device 350 , which drives a signal on its scr_out i / o port to activate the gate of scr 360 and turn it on . when scr 360 turns on , current is drawn through coils 363 , 364 which causes interrupting device 315 to trip , causing the contact carriage to drop which , in turn , causes the line , face and load contacts to separate from each other . thus , current is prevented from flowing through phase and neutral conductors 330 , 332 to the phase and neutral face terminals 342 , 344 , and the phase and neutral load terminals 346 , 348 , respectively . in comparison , when the auto - monitoring routine is performed in accordance with the present invention , no differential current is created on the phase and neutral conductors 330 , 332 and the interrupting device 315 is not tripped . instead , during the auto - monitoring routine , the flux generated at sense transformer 334 is a result of current flowing through conductor 356 , which is electrically separated from phase and neutral conductors 330 , 332 . the current generated on conductor 356 is present for only a brief period of time , for example , less than the delay time established by capacitor 307 , discussed previously . if the voltage established at the input to the adc input ( gp 0 ) of microcontroller 301 reaches a programmed threshold value within this predetermined period of time during an auto - monitoring routine , it is determined that the detection circuit 352 successfully detected the current flowing through the core of sense transformer 334 and the auto - monitoring event is deemed to have passed . microcontroller 301 , thus , determines that detection circuit 352 , including gfci ic device 350 , is working properly . because the current flowing through sense transformer 334 during the auto - monitoring routine is designed to be substantially similar in magnitude to the differential current flowing through the transformer during a simulated ground fault , e . g ., 4 - 6 milliamps , it is determined that detection circuit 352 would be able to detect an actual ground fault and provide the proper drive signal to scr 360 to trip interrupter 315 . alternatively , auto - monitoring circuit 370 might determine that the auto - monitoring routine failed . for example , if it takes longer than the predetermined period of time for the voltage at the adc input at gp 0 of microcontroller 301 to reach the given voltage during the auto - monitoring routine , it is determined that the auto - monitoring event failed . if this occurs , an auto - monitoring fail tally is incremented and the failure is indicated either visually or audibly . according to one embodiment , the adc port ( gp 0 ) of microcontroller 301 is converted to an output port when an auto - monitoring event failure occurs and a voltage is placed on conductor 309 via i / o port gp 0 , which is first converted to a output port by the microcontroller . this voltage at gp 0 generates a current on conductor 309 that flows through indicator led 376 and resistor 380 to ground . subsequently , adc i / o port ( gp 0 ) of microcontroller 301 is converted back to an input port and remains ready for the next scheduled auto - monitoring event to occur . according to this embodiment , when an auto - monitoring event failure occurs , indicator led 376 illuminates only for the period of time when the i / o port is converted to an output and an output voltage is generated at that port ; otherwise led 376 remains dark , or non - illuminated . thus , if the auto - monitoring routine is run , for example , every three ( 3 ) seconds , and an event failure occurs only a single time or sporadically , the event is likely to go unnoticed by the user . if , on the other hand , the failure occurs regularly , as would be the case if one or more of the components used in the auto - monitoring routine is permanently disabled , indicator led 376 is repetitively turned on for 10 msec and off for 100 msec by microcontroller 301 , thus drawing attention to the device and informing the user that critical functionality of the device has been compromised . conditions that cause the auto - monitoring routine to fail include one or more of the following , open circuited differential transformer , closed circuited differential transformer , no power to the gfci ic , open circuited solenoid , scr trigger output of the gfci ic continuously high , and scr output of the gfci ic continuously low . according to a further embodiment , if the auto - monitoring fail tally reaches a predetermined limit , for example , seven ( 7 ) failures within one ( 1 ) minute , microcontroller 301 determines that the device is no longer safe and has reached its end - of - life ( eol ). if this occurs , a visual indicator is activated to alert the user that the circuit interrupting device has reached the end of its useful life . for example , when this eol state is determined , the adc i / o port ( gp 0 ) of microcontroller 301 is converted to an output port , similar to when a single failure is recorded as described above , and a signal is either periodically placed on conductor 309 via gp 0 , i . e ., to blink led 376 at a rate of , for example , 10 msec on and 100 msec off , or a signal is continuously placed on conductor 309 to permanently illuminate led 376 . the auto - monitoring routine is also halted at this time . in addition to the blinking or continuously illuminated led 376 , according to a further embodiment when eol is determined , an optional audible alarm circuit 382 on printed circuit board ( pcb ) 390 is also activated . in this situation the current through led 376 establishes a voltage on the gate of scr 384 such that scr 384 is turned on , either continuously or intermittently , in accordance with the output signal from gp 0 of microcontroller 301 . when scr 384 is on , current is drawn from phase line conductor 330 to activate audible alarm 386 ( e . g ., a buzzer ) providing additional notice to a user of the device that the device has reached the end of its useful life , i . e ., eol . for example , with respect to the present embodiment , audible alarm circuit 382 includes a parallel rc circuit including resistor 387 and capacitor 388 . as current is drawn from phase line conductor 330 , capacitor 388 charges and discharges at a rate controlled by the value of resistor 387 such that buzzer 386 sounds a desired intermittent alarm . a further aspect of this embodiment includes dimmable led circuit 396 . circuit 396 includes transistor 398 , leds , 400 , 402 , light sensor 404 ( e . g ., a photocell ) and resistors 406 - 408 . when the ambient light , e . g ., the amount of light in the vicinity of the circuit interrupting device according to the present embodiment , is rising , light sensor 404 reacts to the ambient light level to apply increasing impedance to the base of transistor 398 to dim the leds as the ambient light increases . alternatively , when the ambient light decreases , e . g ., as night begins to fall , the current flowing through sensor 404 increases , accordingly . as the ambient light level decreases , leds 400 and 402 illuminate brighter and brighter , thus providing a controlled light level in the vicinity of the device . a further embodiment of the invention shown in fig4 includes a mechanism for providing microcontroller 301 with data related to whether the device is tripped or in the reset condition . as shown in fig4 , opto - coupler 392 is connected between phase and neutral load conductors 277 , 278 and i / o port ( gp 3 ) of microcontroller 301 . microcontroller 301 uses the value of the signal ( voltage ) at port gp 3 to determine whether or not gfci ic device 350 is being supplied with power and whether the device is tripped or in the reset condition . when gfci ic device 350 is powered , e . g ., via its voltage input port ( line ), which occurs when ac power is connected to line terminals 326 , 328 , a voltage is generated at the output port ( vs ). this voltage is dropped across zener diode 394 , which is provided to maintain the voltage supplied to the microcontroller within an acceptable level . diodes 366 , 368 , connected between the phase line conductor and power supply input port ( line ) of gfci ic 350 ensures that the voltage level supplied to gfci ic and the vs output remain below approximately 30 volts . the voltage signal dropped across zener diode 394 is connected to input port gp 3 of microcontroller 301 . if microcontroller 301 does not measure a voltage at gp 3 , it determines that no power is being supplied by gfci ic device 350 and declares eol . alternatively , if microcontroller 301 measures a voltage at gp 3 , it determines whether the device is tripped or in the reset state based on the value of the voltage . for example , according to the circuit in fig4 , if the voltage at gp 3 is measured to be between 3 . 2 and 4 . 0 volts , e . g ., between 76 % of vcc and 100 % of vcc , it is determined that there is no power at the face ( 342 , 344 ) and load ( 346 , 348 ) contacts and , thus , the device is in the tripped state . if the voltage at gp 3 is between 2 . 4 and 2 . 9 volts , e . g ., between 51 % of vcc and 74 % of vcc , it is determined that there is power at the face and load contacts and the device is in the reset state . according to a further embodiment , when eol is determined , microcontroller 301 attempts to trip interrupting device 315 in one or both of the following ways : ( a ) by maintaining the stimulus signal on third conductor 356 into the firing half - cycle of the ac wave , and / or , ( b ) by generating a voltage at an eol port ( gp 2 ) of microcontroller 301 . when eol has been declared , e . g ., because the auto - monitoring routine fails the requisite number of times and / or no power is being supplied from the supply voltage output ( vs ) of gfci ic device 350 , microcontroller 301 produces a voltage at eol port ( gp 2 ). optionally , microcontroller 301 can also use the value of the input signal at gp 3 , as described above , to further determine whether the device is already in the tripped state . for example , if microcontroller 301 determines that the device is tripped , e . g ., the load and face contacts are not electrically connected to the line contacts , microcontroller 301 may determine that driving scr 369 and / or scr 361 in an attempt to open the contacts and trip the device is unnecessary and , thus , not drive scr 369 and scr 361 via gp 2 . the voltage at gp 2 directly drives the gate of scr 369 and / or scr 361 to turn scr 369 and / or scr 361 on , thus , enabling it to conduct current and activate solenoid 362 . more specifically , when scr 369 and / or scr 361 are turned on , current is drawn through coil 364 of dual coil solenoid 362 . for example , dual coil solenoid 362 includes inner primary coil 364 , which comprises an 800 turn , 18 ohm , 35 awg coil , and outer secondary coil 363 , which includes a 950 turn , 16 . 9 ohm , 33 awg coil . further details of the construction and functionality of dual coil 362 can be found in u . s . patent application ser . no . 13 / 422 , 797 , assigned to the same assignee as the present application , the entire contents of which are incorporated herein by reference for all that is taught . as described above , when it is determined via the auto - monitoring routine that detection circuit 352 is not successfully detecting ground faults , e . g ., it does not detect the flux resulting from current flowing in conductor 356 , or it is not otherwise generating a drive signal at the scr_out output port of gfci ic device 350 to drive the gate of scr 360 upon such detection , microcontroller 301 determines eol and attempts to trip interrupting device 315 by methods mentioned above . specifically , microcontroller 301 attempts to directly trip directly driving the primary coil 364 , by the back - up path gp 2 to scr 369 and scr 361 . there is at least one difference , however , between the signal on conductor 356 when the auto - monitoring routine is being run normally , and the signal on conductor 356 generated when eol is determined . that is , under eol conditions , gp 2 energizes both scr 361 and scr 369 to be triggered and coil 362 and coil 363 to be energized , thus activating solenoid 362 and 369 to trip interrupting device 315 . if interrupting device 315 is opened , or if interrupting device 315 was otherwise already open , power - on indicator circuit 321 will be off . for example , in the embodiment shown in fig4 , power - on indicator circuit 321 includes led 322 in series with resistor 323 and diode 324 . the cathode of led 322 is connected to the neutral load conductor 278 and the anode of diode 324 is connected to phase load conductor 277 . accordingly , when power is available at the load conductors , that is , the device is powered and in the reset state , current is drawn through the power - on circuit on each alternating half - cycle of ac power , thus , illuminating led 322 . if , on the other hand , power is not available at the load conductors 277 , 278 , for example , because interrupting device 315 is open , or tripped , or the device is reset but no power is being applied , led 322 will be dark , or not illuminated . additional embodiments and aspects thereof , related to the auto - monitoring functionality consistent with the present invention , as well as further discussion of some of the aspects already described , are provided below . the sinusoidal ac waveform discussed herein is connected to the phase and neutral line terminals 326 , 328 when the self - test gfci device is installed correctly . according to one embodiment the ac waveform is a 60 hz signal that includes two half - cycles , a positive 8 . 333 millisecond half - cycle and a negative 8 . 333 millisecond half - cycle . the so - called “ firing ” half - cycle refers to the particular half - cycle , either positive or negative , during which a gate trigger signal to scr 360 results in the respective gates of scr 361 and scr 369 being driven and the corresponding respective solenoid coils 363 , 364 conducting current , thus , “ firing ” solenoid 362 and causing the armature of the solenoid to be displaced . a “ non - firing ” half - cycle refers to the alternate half - cycle of the ac waveform , i . e ., either negative or positive , during which current does not flow through the scr or its respective solenoid coil , regardless of whether or not the scr gate is triggered . according to the present embodiment , whether the positive or negative half - cycle is the firing half - cycle is determined by a diode , or some other switching device , placed in series with the respective solenoid coil . for example , in fig4 , diodes 359 , 374 and 367 are configured such that the positive half - cycle is the “ firing ” half - cycle with respect to scrs 360 , 369 and 361 , respectively . according to a further embodiment of a circuit interrupting device consistent with the invention , microcontroller 301 optionally monitors the ac power input to the device . for example , the 60 hz ac input that is electrically connected to the phase and neutral line terminals 326 , 328 is monitored . more particularly , a full 60 hz ac cycle takes approximately 16 . 333 milliseconds to complete . thus , to monitor and confirm receipt and stabilization of the ac waveform , a timer / counter within microcontroller 301 is implemented . for example , within the three ( 3 ) second auto - monitoring window the 60 hz input signal is sampled once every millisecond to identify a leading edge , i . e ., where the signal goes from negative to positive values . when a leading edge is detected a flag is set in the software and a count is incremented . when the three ( 3 ) second test period is finished , the count result is divided by 180 to determine whether the frequency is within a specified range . for example , if the frequency is stable at 60 hz , the result of dividing by 180 would be 1 . 0 because there are 180 positive edges , and 180 cycles , in three ( 3 ) seconds worth of a 60 hz signal . if the frequency is determined to not be within a given range , for example , 50 - 70 hz , the auto - monitoring self - test fault testing is stopped , but the monitoring of gp 3 continues . accordingly , a premature or errant power failure determination is avoided when a circuit interrupting device in accordance with the invention is connected to a variable power source , such as a portable generator , and the power source exhibits a lower frequency at start - up and requires a stabilization period before the optimal frequency , e . g ., 60 hz , is achieved . if the frequency is not stable at the optimal frequency , or at least not within an acceptable range , initiation of the auto - monitoring routine is delayed until the frequency is stabilized . if the frequency does not achieve the optimal frequency , or a frequency within an acceptable range , within a predetermined time , a fail tally is incremented . similar to the fail tally discussed previously with respect to the auto - monitoring routine , if the tally reaches a given threshold , microcontroller 301 declares eol . as described above , according to at least one exemplary embodiment , programmable device 301 is implemented in a microcontroller . because some microcontrollers include non - volatile memory , e . g ., for storing various data , etc ., in the event of a power outage , according to a further embodiment , all events , timers , tallies and / or states within the non - volatile memory are cleared upon power - up of the device . accordingly , if the fail tally or other condition resulted from , improper device installation , inadequate or improper power , or some other non - fatal condition with respect to the circuit interrupting device itself , the fail tally is reset on power - up , when the tally incrementing event may no longer be present . another way of avoiding this potential issue in accordance with the invention is to utilize a programmable device that does not include non - volatile memory . while various embodiments have been chosen to illustrate the invention , it will be understood by those skilled in the art that other modifications may be made without departing from the scope of the invention as defined by the appended claims .
| 7 |
the present invention may be further understood with reference to the following description and the appended drawings , wherein like elements are referred to with the same reference numerals . the present invention relates to devices for the transfer of fluids to and from a target structure within a patient &# 39 ; s body over an extended period of time . in particular , exemplary embodiments of the present invention describe a venous access device that includes a branched distal tip for improved mobility , flexibility and flow . as shown in fig1 - 3 , a venous access device 100 according to an exemplary embodiment of the present invention comprises an indwelling catheter portion 102 a proximal end 108 of which is connected to a port device 104 . it will be understood by those of skill in the art that , although the device 100 is described as a port catheter system with a port device 104 , the device 100 may be any venous access device , such as piccs , central venous catheters ( cvcs ), dialysis catheters , and midline infusion catheters . for example , the catheter portion 102 may extend out of the skin to any known port connectable to external devices as desired and which may be sealed between uses such as , for example , a drainage bag for a drainage catheter system . as shown in fig1 , the catheter portion 102 includes a shaft 106 extending from the proximal end 108 to a distal end 110 which , in an operative position , is inserted into a target structure within a patient &# 39 ; s body . a proximal portion 118 of the shaft 106 includes a single first lumen 114 extending therethrough . a thickness 115 of a wall 117 of the shaft 106 around a circumference thereof may be selected as would be understood by those of skill in the art to achieve the desired properties ( e . g ., burst strength , flexibility , etc .) while the first lumen 114 is shaped to maximize its cross - sectional area without compromising these properties . at a distal end 110 , the shaft 106 splits into a plurality of branches 112 at which the first lumen 114 opens to two lumens 116 each of which extends through a corresponding one of the branches 112 . in a preferred embodiment , an outer diameter of each of the plurality of branches 112 is smaller than an outer diameter of the proximal portion 118 of the shaft 106 . in alternate embodiments , each branch 112 has substantially the same diameter or greater diameters as compared to that of the proximal portion 118 . in yet other embodiments , each branch 112 has a different size ( e . g ., length and / or diameter ) from other branches , and / or a different cross sectional configuration ( e . g ., round , oval , trapezoid , d - shaped , etc .) from other branches . in a preferred embodiment , the shaft 106 splits into two branches 112 , although it will be understood by those of skill in the art that the shaft 106 may split into any number of branches 112 . fig3 shows an embodiment of the catheter portion 102 in which the cross - section of lumens 116 are substantially d - shaped in the same manner as a lumen of a standard dual - lumen catheter . however , as shown in fig4 , either or both of the lumens 116 may be substantially round . in another embodiment as shown in fig5 , the venous access device of the present invention includes a dual - lumen catheter portion 102 . such dual - lumen devices are known in the art , and include devices such as dual - lumen ports ( as shown in fig5 ), piccs , and other implantable devices that include separate lumens that can be used to deliver different or the same materials such as therapeutic agents or contrast agents , or can be used to aspirate blood or other bodily fluids . in accordance with the present invention , the catheter portion 102 is divided into two sections 150 , 151 at the distal end 110 , with each section including one of the lumens that extend from the proximal end 108 to distal end 110 . each such section 150 is thereafter split into multiple branches 112 as described with reference to fig1 - 4 , above . the inventors have found that the use of branches 112 enhance the mobility and flexibility of the indwelling portion of the catheter portion 102 as compared to a single tube catheter . for example , in embodiments where the outer diameter of each of the branches 112 is smaller than the outer diameter of the proximal portion 118 , it will be understood by those of skill in the art that the distal end 110 of the device is more flexible than the proximal portion 118 . this enhanced flexibility allows for greater movement of the device 100 at its distal end 110 while implanted , such as with normal cardiovascular flow and pulse . the added flexibility and motion of the branches 112 inhibits fibrin sheath adherence and encrustation by blood or other bodily fluids , as sometimes encountered with single tube catheters . in use , fluid flowing distally through the first lumen 114 splits into the lumens 116 as it leaves the proximal portion 118 and enters the distal end 110 of the device 100 . in one embodiment , one or all of the lumens 116 taper toward the distal end 110 ( i . e ., a cross - sectional area of the lumen may grow gradually smaller from the proximal end of the corresponding branch 112 toward the distal end thereof ). in addition , any or all of the branches 112 may be angled relative to one another , depending upon a desired performance aspect . that is , longitudinal axes of the branches 112 may be set at any desired angle relative to a longitudinal axis of a distal end of the proximal portion of the shaft 106 to achieve a desired orientation of the branches 112 relative to one another . preferably , this angle is minimized to between 0 and 45 degrees , and more preferably between 0 and 15 degrees , such that the branches are in - line with the catheter longitudinal axis . as an example , the proximal portion 118 near the distal end 110 can define a first longitudinal axis and the first and second branches 112 can define second and third longitudinal axes , respectively . the a preferred embodiment , the second axis extends at an angle of less than 45 degrees from the first axis and the third axis is substantially co - axial with the first axis . those skilled in the art will understand that , for a catheter portion 102 including more than two branches 112 , the various branches 112 may be located in a single plane or a plurality of planes . the length of each branch is preferably less than about eight centimeters from most venous access applications . the distal end 110 , including the branches 112 may be delivered to a target area of the body in the same manner used for conventional split tip catheters as will be understood by those skilled in the art . the branches 112 may be temporarily bonded to one another or held together by an insertion device to facilitate the passage of the catheter portion 102 through intervening tissue with a minimum of trauma thereto . it will be understood by those skilled in the art that a catheter according to the present invention may include multiple lumens through a proximal part thereof so long as at least one of these proximal lumens opens to a plurality of lumens in separate distal branches of the catheter . that is , a catheter having a proximal part including two lumens will include at least three branches at a distal end thereof with each branch including a lumen open to one or more of the lumens of the proximal part . it will be apparent to those skilled in the art that various modifications and variations can be made in the structure and methodology of the present invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided that they come within the scope of the appended claims and their equivalents .
| 0 |
referring in particular to fig1 an improved marsh case 10 constructed in accordance with the principles of the invention is seen . the marsh case 10 provides a cap 20 and a body 50 that are threadedly connected . the body provides a chamber suitable for housing a geophone 100 in a secure manner . either a short spike 80 or a long spike 90 is attached to the body , allowing the marsh case to be inserted into the ground . the cap provides adjacent chambers for housing a stress anchor 40 , in contact with the geophone , and a grommet 65 , which protects the wiring of the geophone . referring in particular to fig1 , 12 and 13 , a hollow body 50 is formed from aluminum , partially enclosing a geophone chamber 62 . in the preferred embodiment the body 50 has an overall length of 2 . 5 inches and a width of 1 . 31 inches . the body 50 has an annular upper rim 51 which is sized to mate with an annular seat 32 of the cap 20 . adjacent to the upper rim 51 is an upper mating surface 52 which forms a narrow annular cavity against cap 20 , where adhesive may be used , if desired , to create a stronger bond between the cap 20 and body 50 . in the preferred embodiment , threaded surface 53 , adjacent to the upper mating surface 52 , provides 13 / 8 &# 34 ;- 16 unf external threads , which are much finer for this diameter than the standard 13 / 8 &# 34 ;- 12 unf threads typically associated with threaded fasteners of similar diameter . adjacent to the threaded surface 53 is an annular flare 54 , which extends radially from the body . the annular flare 54 forms an annular upper shoulder 55 on its upper surface . the annular upper shoulder 55 is sized to mate and provide a tight seal with the lower rim 36 of the cap 20 . adjacent to the annular flare 54 is a cylindrical body portion 56 . a tapered nose portion 57 , adjacent to the cylindrical body portion 56 , provides opposed wrench cutouts 58 . the tapered nose portion terminates in a spike attachment socket 59 having a short internal channel 60 and a threaded very slightly conical surface 61 , which mates with the threaded cylindrical surface 81 , 91 of the upper end of either spike 80 , 90 . the threaded conical surface 61 is typically tapered at the rate of 3 / 4 &# 34 ; per foot , ntp . the taper of the threaded conical surface 61 results in less shearing forces on the threads , and less likelihood of damage of the spike or body . a locking washer is not required , due to this design . as seen particularly in fig1 , 7 , and 8 , a cap 20 is releasably attachable to the body 50 by means of a threaded connection . an upper cylindrical body portion 22 having an upper hole 21 defines an axial channel 23 , a grommet chamber 24 and a stress anchor chamber 27 . the grommet chamber 24 provides an annular grommet support shoulder 25 . a flared body portion 26 , adjacent to the upper cylindrical body portion 22 , defines the stress anchor chamber 27 and a stress anchor seat 28 . a lower cylindrical body portion 29 , adjacent to the flared body portion 26 , provides an inner surface defining a quad ring seal chamber 30 and a quad ring seal seat 31 . an annular seat 32 , adjacent to the quad ring seal chamber , is sized to mate with the annular upper rim 51 of the body 50 . an adhesive mating surface 33 is adjacent to the annular seat 32 , and allows the application of an adhesive immediately prior to attachment of the cap 20 and the body 50 . the adhesive mating surface provides a narrow annular ring where a thin film of adhesive may be allowed to harden after the cap and body are threaded together , thereby making a very strong bond between the two . an internal threaded surface 34 , adjacent to the adhesive mating surface , is sized to mate with the threaded surface 53 of the body 20 . in the preferred embodiment , the thread size is 13 / 8 &# 34 ;- 16 unf , considerably finer than the 13 / 8 &# 34 ;- 12 unf that is commonly used . an o - ring seat 35 , adjacent to the threaded surface 34 , is sized to accept an o - ring , which provides a moisture - tight seal . a rim 36 , adjacent to the o - ring seat , is sized to mate with the annular upper shoulder 55 of the body 50 when the cap and body are connected . a key notch 37 , defined on an inside surface of the flared body portion 26 engages the key 49 of the stress anchor 40 , as will be seen , preventing rotation of the stress anchor , and therefore twisting of the wiring 101 associated with the geophone 100 , when the cap and body are threaded together . a soft rubber grommet 65 defining an axial chamber 66 is carried by the grommet chamber 24 of the cap 20 . the axial chamber 66 provides a passageway for wiring 101 of the geophone to exit from the marsh case 10 . the grommet functions to reduce the stress on the wiring 101 of the geophone 100 , and also to provide a more moisture resistant seal in the upper hole 21 of the cap . the grommet may be made of stiff but slightly flexible plastic , rubber or similar synthetic material . the grommet 65 generally provides a lower cylindrical body 67 having a shoulder 68 . the shoulder 68 is sized to mate with the grommet support shoulder 25 of the cap 20 . the interaction between the grommet shoulder 68 and support shoulder 25 prevents the grommet from being removed from the marsh case by means of upper hole 21 . the grommet also provides an upper cylindrical body 69 , adjacent to the lower cylindrical body 67 . the diameter of the upper cylindrical body 69 is slightly less than the diameter of the lower cylindrical body 67 . adjacent to the upper cylindrical body , a tapered end 70 provides an upper opening 71 . large o - rings 72 , small o - rings 73 and internal o - rings 74 all contribute to a tighter seal . a stress anchor 40 , formed of hard plastic and carried in the stress anchor chamber 27 of the cap 20 , keeps the geophone 100 securely in place and secures the rat - tail wires 102 exiting the geophone . the grommet 65 tends to apply a slight pressure on the stress anchor 40 , which in turn applies a slight pressure on the geophone . the stress anchor provides a hollow partially cylindrical body 41 having a first and second portion 41a , 41b ; the body defining an upper cavity 42 and a lower cavity 43 separated by a floor 44 . the floor is carried by the cylindrical body and defines first and second rat - tail holes 45 , 46 . the rat - tail holes allow the rat - tails 102 to pass through the floor 44 . first and second brass inserts 47 , 48 , are carried by the first and second rat - tail holes , thereby providing a surface that is not adversely effected by solder , which is used to make the electrical connection between the wiring 101 and the rat - tails 102 . a key 49 , defined on an external surface of the hollow and otherwise cylindrical body 41 , and sized to engage key notch 37 of the cap 20 , prevents any rotation of the stress anchor which might otherwise occur when the cap and body are threaded together . a quad ring seal 75 is carried by the annular quad ring seal chamber 30 of the cap 20 , thereby sealing between the cap and the body , and additionally providing pressure against the geophone , keeping the geophone immobile . the quad ring seal 75 is made of a material that is resiliently compressible . the resilient compressibility quality prevents damage to the geophone where temperature causes the cap and body to contract . in this circumstance , pressure by the geophone against the quad rind seal would cause the quad ring seal to compress , thereby reducing stress on the geophone . this resilient quality also prevents damage to the geophone where temperature causes the cap and body to expand . in this circumstance , the quad ring seal would expand slightly , causing a continuous gentle pressure against the geophone , preventing the geophone from moving within the geophone chamber 62 , which could damage the electronics contained within the geophone . an o - ring 76 , carried by the o - ring seat 35 of the cap 20 , prevents moisture from entering the marsh case . either of two spikes 80 , 90 are releasably carried by the body 50 . a short spike 80 and a long spike 90 are similarly constructed typically of aluminum compatible zinc plated steel . a threaded cylindrical surface 81 , 91 on the upper end of each spike is engageable with the threaded conical surface 61 of the spike attachment socket 59 of the tapered nose portion 57 of the body 50 . each spike carries wrench flats 83 , 93 , separated by a narrow cylindrical section 82 , 92 from the threaded cylindrical surface on the upper end , for use with a wrench in turning the spike relative to the body 50 . each spike provides a conical body 84 , 94 , adjacent to the wrench flat , having a lower tip 85 , 95 . the overall length of the short spike it typically 2 &# 34 ;, from the tip , up to and including , the wrench flats . the overall length of the long spike is typically 3 &# 34 ;. to use the marsh case , the geophone is inserted into the geophone chamber , allowing for the wiring to exit through the axial channel 66 of the grommet 65 and for the rat - tails to be soldered onto the brass inserts 47 , 48 of the stress anchor 40 . the wiring 101 is soldered to the rat - tails 102 , which are carried by the brass inserts 47 , 48 . a thin film of adhesive glue may be spread , if desired , on the threaded surfaces 34 , 53 of the cap and body . the cap is then threaded onto the body , causing the adhesive to collect on mating surfaces 33 , 52 , where it hardens . as the cap and body are threaded together , the stress anchor is prevented from rotation by key 49 and key notch 37 . quad ring seal 75 and grommet 65 are compressed slightly , applying a slight pre - load pressure to the geophone . the wrench cutouts may be used to tighten the body against the cap . the spike is then threaded into place , using the wrench flats 83 , 93 on the spike along with the wrench cutouts 58 on the body to deliver about 50 lbs . of torque . at the same time that the spike is being tightened , the cap and body are tightened . during the tightening of the spike and the marsh case , the top portion of the case may be held in a v - shaped device so that torque can be applied to tighten the case . the previously described versions of the present invention have many advantages , including a primary advantage of providing a novel marsh case for housing a geophone having a threaded slightly conical surface within a spike attachment socket for connecting to the cylindrically threaded spike . the use of a threaded conical surface within the spike attachment socket tends to prevent stripping and shearing of the threads , eliminates the need for a locking washer and tends to ensure that the spike does not release during insertion into the ground . another advantage of the present invention is to provide a novel marsh case for housing a geophone having superior resistance to thermal expansions and contractions , having means to prevent crushing pressure being applied to the geophone during contractions , and leakage resulting in electrical shorts and movement resulting in metal fatigue and damage when the case expands due to increased temperature . a still further advantage of the present invention is to provide a novel marsh case for housing a geophone having slightly recessed solid mating surfaces available for carrying a thin coating of adhesive adjacent to the threads connecting the cap and body , thereby creating a superior moisture barrier and seal . although the present invention has been described in considerable detail and with reference to certain preferred versions , other versions are possible . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred versions disclosed . in compliance with the u . s . patent laws , the invention has been described in language more or less specific as to methodical features . the invention is not , however , limited to the specific features described , since the means herein disclosed comprise preferred forms of putting the invention into effect . the invention is , therefore , claimed in any of its forms or modifications within the proper scope of the appended claims appropriately interpreted in accordance with the doctrine of equivalents .
| 7 |
descriptions are provided hereinafter regarding embodiments of the present invention . first of all , with reference to fig1 , descriptions are provided for a basic structure of a cellular telephone device 1 according to an embodiment of the portable electronic device of the present invention . fig1 is a perspective view showing an appearance of the cellular telephone device 1 according to the present embodiment . the cellular telephone device 1 includes a body 2 . a touch panel 10 , a microphone 13 and a speaker 14 are disposed on a front face portion of the body 2 . the touch panel 10 includes a display unit 11 and a detecting unit 12 ( see fig2 ). the display unit 11 is a liquid - crystal display panel , an organic el ( electroluminescence ) display panel , or the like , and displays text and images . the detecting unit 12 is a sensor that detects a touch by an object , such as a finger or stylus of a user of the cellular telephone device 1 , on the display unit 11 . for example , a sensor that employs a capacitive sensing method or a resistive film method can be utilized as the detecting unit 12 . the microphone 13 is used for inputting sound produced by the user of the cellular telephone device 1 during a telephone call . the speaker 14 is used for outputting sound produced by the other party whom the user of the cellular telephone device 1 is talking with during a phone call . functional arrangements of the cellular telephone device 1 according to the first embodiment of the electronic device of the present invention will be described with reference to fig2 . fig2 is a block diagram showing the functional arrangement of the cellular telephone device 1 . the cellular telephone device 1 includes the touch panel 10 ( the display unit 11 and the detecting unit 12 ), the microphone 13 , and the speaker 14 , as described above . in addition , the cellular telephone device 1 includes a communication unit 15 , a storage unit 16 , and a control unit 17 . the communication unit 15 includes a main antenna ( not illustrated ) and an rf circuit unit ( not illustrated ), and makes an outgoing call to and performs communication with a predetermined contact entity . the contact entity , to which the communication unit 15 makes an outgoing call , is an external device that performs a telephone call or mail transmission / reception with the cellular telephone device 1 , or an external device or the like such as an external web server , with which the cellular telephone device 1 establishes internet connections . the communication unit 15 performs communication with an external device via a predetermined usable frequency band . more specifically , the communication unit 15 executes demodulation processing of a signal received via the main antenna , and transmits the processed signal to the control unit 17 . in addition , the communication unit 15 executes modulation processing of a signal transmitted from the control unit 17 , and transmits the signal to an external device ( base station ) via the main antenna . the storage unit 16 includes , for example , working memory , and is utilized for arithmetic processing by the control unit 17 . furthermore , the storage unit 16 stores a single or plurality of applications or databases that are operated inside the cellular telephone device 1 . it should be noted that the storage unit 16 may also serve as detachable external memory . the control unit 17 controls the entirety of the cellular telephone device 1 , and performs control of the display unit 11 and the communication unit 15 . the cellular telephone device 1 according to the first embodiment has a function to start an application using , for example , text and images , displayed on the display unit 11 . the arrangement for performing the function will be described hereafter with reference to fig2 - 4 . as shown in fig2 , the control unit 17 has a starting unit 171 and an application control unit 172 . the starting unit 171 starts an application which performs various kinds of functions by using displayed text . examples of the application include an electronic mail application , a memo pad application , a text editing application , and a browser application ( browser application capable of inputting text for searching ). in a state where text is displayed on the display unit 11 , when text is selected by contact to a region , where at least one text is displayed , being detected by the detecting unit 12 , the application control unit 172 displays on the display unit 11 an application starting display with which an application is associated . here , text according to the present embodiment may include a number , an alphabetic character , or a symbol , in addition to hiragana text , katakana text , and kanji text . in addition , text includes not only a single character but also a character string . specifically , the control unit 17 performs the following processing . fig3 is a diagram showing an example of the screen transfer displayed on the display unit 11 according to the first embodiment . it should be noted that when contact to a region where text is displayed is detected by the detecting unit 12 , the control unit 17 according to the first embodiment specifies text displayed on a position where the contact is detected and selects the specified text . then , the selected text is displayed as differentiated from other text that is not selected , by , for example , an inverse display . in screen d 1 of fig3 , a browser application has been started and the browser application displays on the display unit 11 the text “ hello ! the following site is interesting : http :// shocera . co . jp ”. in a state where screen d 1 is displayed , the application control unit 172 selects the text “ http :// shocera . co . jp ” by contact being detected by the detecting unit 12 in a region where “ http :// shocera . co . jp ” is displayed among the text displayed on screen d 1 . it should be noted that , the text selected in the display unit 11 is inversely displayed . then , when the text “ http :// shocera . co . jp ” is continuously selected for more than or equal to a predetermined time by the detecting unit 12 and when the contact is released ( the finger of the user moves away ) ( screen d 2 ), the application control unit 172 displays on the display unit 11 an application starting menu m 1 with which applications are associated ( screen d 3 ). here , a plurality of items of the application starting menu m 1 for performing functions , such as text editing , internet search , e - mail body text , e - mail attachment , decoration mail insertion , c mail text , and map search , is displayed in screen d 3 . in screen d 3 , when one application starting menu item is selected among the plurality of items of the application starting menu m 1 thus displayed , the application control unit 172 makes the starting unit 171 start an application ( for example , text editing application ) associated with the application starting menu item thus selected ( screen d 4 ). in addition , as shown in screen d 4 , when an application starting menu is selected , the application control unit 172 makes the starting unit 171 start an application associated with the application starting menu thus selected , and inputs the text selected in screen d 2 , “ http :// shocera . co . jp ”, into the text input region of the application thus started . it should be noted that the application starting menu and the application are associated with each other , and are stored in the storage unit 16 . in addition , a text input region is a region ( for example , a region in which text can be input in the document preparation screen in a text editing application ) in an application where text can be input . in addition , when the started application is ended ( when a state where the started application is running ends ), the application control unit 172 makes a browser application display on the display unit 11 a web page including text that has been displayed immediately before when contact to the region where the text , “ http :// shocera . co . jp ” is displayed is detected by the detecting unit 12 . that is , a web page including the text that has been displayed in screen d 1 or d 2 , “ hello ! the following site is interesting . http :// shocera . co . jp ” is displayed on the display unit 11 . thus , according to the first embodiment , in a state where text is displayed on the display unit 11 , when text is selected by contact to a region , where at least a part of the displayed text is displayed , being detected by the detecting unit 12 , the cellular telephone device 1 displays on the display unit 11 an application starting display with which an application is associated . thereby , since the cellular telephone device 1 displays the application starting menu m with which an application is associated when the text displayed on the display unit 11 is selected , it is possible to start an application simply by using the text displayed on the display unit 11 . in addition , according to the first embodiment , when text is continuously selected for more than or equal to a predetermined time by the detecting unit 12 and the contact is discontinued , the cellular telephone device 1 displays on the display unit 11 the application starting menu m 1 with which an application is associated . thereby , the cellular telephone device 1 can perform a function for displaying the application starting menu m 1 differentiated from other functions ( for example , a link to a url , or a simple copy ) that executes by selecting text . in addition , according to the first embodiment , when the application starting menu is selected , the cellular telephone device 1 starts , by the starting unit 171 , text input application associated with the application starting menu item thus selected , and inputs the selected text input into the application . thereby , since the cellular telephone device 1 inputs the selected text into the started application , it is possible to improve usability of the started application . it should be noted that “ the cellular telephone device 1 starts , by the starting unit 171 , a text input application associated with the application starting menu item thus selected , and inputs the selected text input into the application ” may be done by inputting the selected text into the started application and saving it as a draft . in addition , the screen of the application may be displayed after inputting the selected text into the started application . in addition , according to the first embodiment , when the started state of the started application is ended , the cellular telephone device 1 displays on the display unit 11 text that has been displayed immediately before , when contact to the region , where text is displayed , is detected by the detecting unit 12 . thereby , since the text displayed immediately before the contact is detected , is displayed also after the started state of the application is ended , the cellular telephone device 1 can improve the usability for the user . in addition , according to the first embodiment , the cellular telephone device 1 displays on the display unit 11 a plurality of items of the application starting menu m 1 associated with a plurality of applications , respectively , and starts , by the starting unit 171 , an application associated which the selected item among the plurality of items of the application starting menu m 1 . thereby , since the cellular telephone device 1 can start a desired application from the plurality of items of the application starting menu m 1 , it is possible to further improve the usability for the user with respect to the application . it should be noted that although the application control unit 172 displays the plurality of items of the application starting menu m 1 on screen d 3 in fig3 , the control unit 172 may be done so as to display one item of the application starting menu , and then , when the application starting menu is selected , display the plurality of items of the application starting menu m 1 . next , processing in a case where an application starts using an image displayed on the display unit 11 will be described with reference to fig4 . fig4 is a diagram showing an example of the screen transfer displayed on the display unit 11 according to the first embodiment . in screen d 11 of fig4 , a browser application has been started and an image f 1 is displayed on the display unit 11 by the browser application . in a state where screen d 11 is displayed , the application control unit 172 selects the image f 1 by detecting , by the detecting unit 12 , contact to a region where the image f 1 displayed on screen d 11 is displayed . subsequently , when the image f 1 is continuously selected for more than or equal to a predetermined time and the contact is released ( the finger of the user moves away ) as detected by the detecting unit 12 ( screen d 12 ), the application control unit 172 displays on the display unit 11 an application starting menu m 2 with which applications to be started are associated ( screen d 13 ). here , in the application starting menu m 2 , functions of text editing , internet search , e - mail body text , c mail text , and map search are displayed as being grayed out and cannot be executed , and only functions of e - mail attachment and decoration mail insertion are executable . that is , the application control unit 172 displays on the display unit 11 the application starting menu m 2 in a state where only an application that can use the selected image f 1 is executable . in screen d 13 , when one item is selected among the displayed plurality of items of application starting menu m 2 , the application control unit 172 starts , by the starting unit 171 , the application associated with the application starting menu thus selected and inserts into an image insertion region of the application thus started , the image f 1 selected in screen d 12 as an attachment file ( screen d 14 ). an image insertion region is a region where an image in the application can be inserted ( for example , a region where an image in an electronic mail application can be attached , and a region where an image in a mail creation screen in an electronic mail application can be inserted ). in addition , when the started application is ended , that is , when a state in which the started application is executed ends , the application control unit 172 displays on the display unit 11 , by a browser application , a web page including the image f 1 that has been displayed immediately before the contact is detected by the detecting unit 12 . as described above , the application control unit 172 displays on the display unit 11 an application starting menu m 1 or m 2 depending on the selected text or image ( refer to screen d 3 of fig3 and screen d 13 of fig4 ). thereby , since the cellular telephone device 1 displays the application starting menu according to the selected text or image , it is possible to further improve the usability for the user with respect to the application . in addition , although the application control unit 172 inserts only the selected image f 1 into the image insertion region of the started application in the example of the screen transfer in fig4 , the text stored in correspondence with the selected image f 1 ( for example , text data included in a jpeg image ) may be input into the text input region of the started application together with the selected image f 1 . in this case , the text corresponding to the selected image f 1 may be input into an application as text data and may be inserted in the image insertion region of an application as an attachment file . next , processing of the cellular telephone device 1 according to the first embodiment will be described . fig5 is a flow chart showing processing of the cellular telephone device 1 according to the first embodiment . in step s 1 , the control unit 17 displays text or an image on the display unit 11 . in step s 2 , the control unit 17 detects contact to the display unit 11 by the detecting unit 12 . in step s 3 , the control unit 17 determines whether or not the contact to the display unit 11 is continuously detected by the detecting unit 12 for more than or equal to a predetermined time . when the contact is continuously detected for more than or equal to a predetermined time ( yes ), the process proceeds to step s 4 . when the contact is not continuously detected for more than or equal to a predetermined time ( no ), the process ends . in step s 4 , the control unit 17 selects text or an image corresponding to the contacted part as a result of continuously detecting contact to the display unit 11 by the detecting unit 12 for more than or equal to a predetermined time . in step s 5 , as a result of the contact to the display unit 11 being released , the control unit 17 determines the selection of the text or the image . in step s 6 , the application control unit 172 determines whether or not the selected item is text . when the selected item is text ( yes ), the process proceeds to step s 8 . when the selected item is an image ( no ), the process proceeds to step s 7 . in step s 7 , the application control unit 172 displays grayed out functions that cannot use an image as an item of the application starting menu m 2 , and displays only functions that can use an image as an item of the application starting menu m 2 ( screen d 13 in fig4 ). in step s 8 , the application control unit 172 displays on the display unit 11 the application starting menu m 1 with which applications are associated ( screen d 3 in fig3 ). in step s 9 , when the application starting menu is selected , the application control unit 172 starts , by the starting unit 171 , an application associated with the application starting menu thus selected , and inputs the selected text or image into the started application . as described above , since the application starting menu m 1 ( m 2 ) associated with an application is displayed when the text or image displayed on the display unit 11 is selected , the cellular telephone device 1 according to the first embodiment can simply start an application by using the text or image displayed on the display unit 11 . it should be noted that in the first embodiment the text displayed on the display unit 11 may include not only the text that is input by a handwritten text input unit , which will be described later , but also all of , for example , text that is input by using a virtual keyboard displayed on the display unit 11 , and text that is displayed in advance in a browser application or the like . next , a second embodiment according to the electronic device of the present invention will be described . with respect to the second embodiment , features that differ from the first embodiment will mainly be described , similar components are assigned the same reference numerals as the first embodiment and descriptions thereof are omitted . with respect to the features not described in particular for the second embodiment , descriptions as in the first embodiment apply as appropriate . next , a functional arrangement of the cellular telephone device 1 according to the second embodiment will be described with reference to fig6 . fig6 is a block diagram showing the functional arrangement of the cellular telephone device 1 according to the second embodiment . the cellular telephone device 1 has a touch panel 10 ( a display unit 11 and a detecting unit 12 ), a microphone 13 , and a speaker 14 , which will be described later . in addition , the cellular telephone device 1 has a communication unit 15 , a storage unit 16 , and a control unit 17 . the cellular telephone device 1 according to the second embodiment has a function to start an application using , for example , text and an icon , which are displayed on the display unit 11 . hereafter , the arrangement for performing the function will be described . as shown in fig6 , the control unit 17 includes an application control unit 173 , a handwritten text input unit 174 , and a region specification unit 175 . in a state where text is displayed on the display unit 11 , when contact to an icon ( for example , icons 19 a - 19 f , which will be described later ) displayed on the display unit 11 is detected by the detecting unit 12 , after contact to a region where at least a part of the text is displayed , is detected by the detecting unit 12 , causing text to be selected , the application control unit 173 starts an application associated with the icon on which the contact is detected , and inputs the selected text . here , text according to the second embodiment may include not only hiragana text , katakana text , and kanji text but also a number , an alphabetic character , and a symbol . in addition , text may include not only a single character but also a character string . the handwritten text input unit 174 inputs a handwritten text into the display unit 11 by contact to the display unit 11 . specifically , the handwritten text input unit 174 detects by the detecting unit 12 a trajectory drawn with a touch pen 18 . the handwritten text input unit 174 performs pattern matching between the detected trajectory and the text stored in the handwritten text recognizing database by , for example , a handwritten text recognizing application , and converts the text with the highest recognition rate into text data . here , the handwritten text recognizing database is stored in the storage unit 16 and has a variety of information for recognizing the handwritten text . in addition , the handwritten text recognizing application is stored in the storage unit 16 and includes an algorithm for recognizing the handwritten text . the region specification unit 175 specifies a region for inputting the handwritten text into the display unit 11 , by contact to the display unit 11 . specifically , the region specification unit 175 detects , by the detecting unit 12 , the trajectory drawn on the display unit 11 using the touch pen 18 . the region specification unit 175 specifies the region surrounded by the detected trajectory as a region capable of inputting a handwritten text by the handwritten text recognizing application . it should be noted that , the region specification unit 175 does not specify the region for inputting the handwritten text in a case where the trajectory drawn on the display unit 11 using the touch pen 18 does not surround a specific region . in addition , one application and an icon for starting the application are associated with each other and are stored in the storage unit 16 . examples of the application include an electronic mail application , a memo pad application , a text editing application , and a browser application ( for example , a browser application enabled to input text for searching ). fig7 is a diagram showing an example of the screen transfer displayed on the display unit 11 according to the second embodiment . in screen d 21 of fig7 , a browser application has been started and an image f 1 is displayed on the display unit 11 . in screen d 21 of fig7 , when contact to the pictogram region p using the touch pen 18 is detected by the detecting unit 12 ( screen d 21 ), the region specification unit 175 starts a handwritten text recognizing application and detects , by the detecting unit 12 , a trajectory drawn on the display unit 11 using the touch pen 18 ( screen d 22 ). the region specification unit 175 specifies , by the handwritten text recognizing application , a region surrounded by the detected trajectory as the region r 1 enabled for inputting the handwritten text . in such a case where a base point , where the contact to the display unit 11 using the touch pen 18 is detected , is in the pictogram region p , the region may be specified as a region r 1 enabled for inputting the handwritten text by the region specification unit 175 . in addition , when the base point , where the contact to the display unit 11 using the touch pen 18 is detected , is on the edge of the display unit 11 , the region may be specified as the region r 1 enabled for inputting the handwritten text by the region specification unit 175 . thereby , it is possible to avoid conflict with the detection of the contact corresponding to the browser application that has been displayed on screen d 21 . the handwritten text input unit 174 detects by the detecting unit 12 the trajectory drawn using the touch pen 18 in the region r 1 specified by the region specification unit 175 . it should be noted that even in a case where contact other than in the pictogram region p or the edge of the display unit 11 is detected , the region specification unit 175 may detect , by the detecting unit 12 , the region surrounded by the detected trajectory drawn on the display unit 11 using the touch pen 18 by starting the handwritten text recognizing application . in addition , even in a case where the base point , where the contact to the display unit 11 using the touch pen 18 is detected , is in a region other than the pictogram region p or the edge of the display unit 11 , the region may be specified as the region r 1 enabled for inputting the handwritten text by the region specification unit 175 . in addition , when a trajectory drawn on the display unit 11 using the touch pen 18 surrounds a specific range , that is , when the range of the drawn trajectory is determined , the application control unit 173 displays icons 19 a - 19 f for starting applications on the pictogram region p ( screen d 23 ). in screen d 23 , by detecting with the detecting unit 12 contact to the region r 1 where handwritten text “ a i u e ” is input by the handwritten text input unit 174 , the application control unit 173 selects the recognized text “ a i u e ”. the region r 1 specified by the region specification unit 175 is dragged to one of the icons 19 a - 19 f by operating the touch pen 18 under the control of the application control unit 173 ( screen d 24 ). if the detection of contact to one of the icons 19 a - 19 f is determined by the detecting unit 12 ( screen d 24 ) as a result of the detection of the drag using the touch pen 18 being cancelled , the application control unit 173 starts an application ( for example , a memo pad application ) stored by being associated with one of the icons 19 a - 19 f , and inputs the selected text “ a i u e ”. it should be noted that “ starting an application and inputting the selected text ” by the application control unit 173 may include inputting the selected text into the started application and saving as a draft . in addition , the screen of the started application may be displayed after the selected text has been input into the application . in addition , when the started application is ended ( when a state where the started application is executed ends ), the application control unit 173 displays on the display unit 11 with the browser application , a web page including the text displayed immediately before when the contact to the text “ a i u e ” is detected by the detecting unit 12 , that is , the text displayed in screen d 23 , “ a i u e ”, and the image f 1 . thus , according to the second embodiment , the cellular telephone device 1 can input the selected text into an application by starting the application by an intuitive operation that uses icons ( icons 19 a - 19 f ) displayed on the display unit 11 . in addition , since the cellular telephone device 1 inputs the selected text into the started application , it is possible to improve the usability for the user upon starting the application . in addition , when the detection of the contact to the icon 19 a - 19 f by the detecting unit 12 is determined ( that is , when the detection of the drag using the touch pen 18 is cancelled ), the application control unit 173 starts the application stored in a state associated with the icon 19 a - 19 f . thereby , the cellular telephone device 1 can start an application easily by an intuitive operation . in addition , when the application is ended , that is , when the state where the started application is executed is ended , the application control unit 173 displays on the display unit 11 the text displayed immediately before the contact to the text is detected by the detecting unit 12 . thereby , since the cellular telephone device 1 displays the text displayed immediately before the contact is detected after the application is ended also , it is possible to improve the usability for the user . in addition , according to the second embodiment , the text displayed on the display unit 11 is text that is input by the handwritten text input unit 174 . thereby , since the cellular telephone device 1 inputs into the started application the handwritten text that is input by the contact to the display unit 11 , it is possible to start an application with a more intuitive and simpler operation . in addition , since the cellular telephone device 1 inputs the handwritten text into the started application , it is possible to improve the usability for the user upon starting the application . in addition , the handwritten text input unit 174 inputs the handwritten text in a region r 1 specified by the region specification unit 175 . thereby , since the cellular telephone device 1 inputs the handwritten text in the specified region r 1 into the application , it is possible to input text into an application by a more intuitive operation . it should be noted that , in the second embodiment , the text displayed on the display unit 11 may include not only text that is input by the handwritten text input unit 174 but also all of , for example , text that is input using a virtual keyboard displayed on the display unit 11 , and text that is displayed in advance in , for example , a browser application . it should be noted that , in the second embodiment , although the cellular telephone device 1 displays the icons 19 a - 19 f on the pictogram region p , the present invention is not limited to this , and may display the icons 19 a - 19 f on a region other than the pictogram region p , for example . next , processing in the case of starting an application using text displayed on the display unit 11 in the second embodiment will be described with reference to fig8 - 12 . fig8 is a flow chart showing processing for detecting contact to the touch panel 10 using the touch pen 18 by the detecting unit 12 . in step s 11 , the application control unit 173 detects by the detecting unit 12 contact to the touch panel 10 using the touch pen 18 . in step s 12 , the application control unit 173 determines whether or not the contacted position displays the pictogram region p . if the contacted position is the position displaying the pictogram region p ( yes ), the process proceeds to step s 13 . if the contacted position is not the position displaying the pictogram region p ( no ), the process proceeds to step s 14 . in step s 13 , the application control unit 173 transmits an event caused by the touch pen 18 to the application . in step s 14 , the application control unit 173 transmits the event caused by the touch pen 18 to the application that has already been started . fig9 - 12 are flow charts showing processing by the application control unit 173 . in step s 21 , the application control unit 173 receives the event caused by the touch pen 18 that has been transmitted in step s 13 . in step s 22 , the application control unit 173 determines the details of the event caused by the touch pen 18 . specifically , the application control unit 173 determines which of a case where contact of the touch pen 18 is detected , a case where the touch pen 18 is moved on the touch panel 10 while the contact of the touch pen 18 is being detected , and a case where the touch pen 18 is released from the touch panel 10 , is the event caused by the touch pen 18 . then , regarding the application control unit 173 , when contact of the touch pen 18 is detected , the process proceeds to step s 23 ( refer to fig1 ), when the touch pen 18 is moved on the touch panel 10 while the contact of the touch pen 18 is detected ( when sliding is detected ), the process proceeds to step s 39 ( refer to fig1 ), and when the touch pen 18 is released from the touch panel 10 , the process proceeds to step s 45 ( refer to fig1 ). in step s 33 , the application control unit 173 determines whether or not it is in a state where a region is not specified by the region specification unit 175 , that is , whether or not the state of the region specification unit 175 is an initial state . if it is in the initial state ( yes ), the process proceeds to step s 34 . when it is not in the initial state , the process proceeds to step s 35 ( no ). in step s 34 , the application control unit 173 starts the handwritten text recognizing application , and sets the state to a state capable of specifying a region by the region specification unit 175 . in step s 35 , the application control unit 173 determines whether or not the contact of the touch pen 18 is a frame of the region specified by the region specification unit 175 . if it is the frame of the region specified by the region specification unit 175 ( yes ), the process proceeds to step s 37 . when it is not the frame of the region specified by the region specification unit 175 ( no ) and is in the specified region ( step s 36 ( yes )), the process proceeds to step s 38 . in step s 37 , the region specified by the region specification unit 175 and the handwritten text inside the region are set together in a state capable of being moved with a drag of the touch pen 18 . in step s 38 , the application control unit 173 sets the region specified by the region specification unit 175 to a state enabled for inputting the handwritten text by the handwritten text input unit 174 . in step s 39 , the application control unit 173 determines the details of the event caused by the touch pen 18 . specifically , regarding the application control unit 173 , when it is in a state capable of specifying a region by the region specification unit 175 , the process proceeds to step s 40 , and when the region and the handwritten text inside the region are in a state capable of being moved by dragging the touch pen 18 , the process proceeds to step s 43 , and when it is in a state capable of inputting handwritten text by the handwritten text input unit 174 in the specified region , the process proceeds to step s 44 . in step s 40 , the region specification unit 175 starts the handwritten text recognizing application and detects , by the detecting unit 12 , the trajectory drawn on the display unit 11 using the touch pen 18 . then , the region specification unit 175 carries out drawing processing of the region surrounded by the detected trajectory and specifies the region as a region capable of inputting a handwritten text . in step s 41 , the application control unit 173 determines whether or not the range of the region specified by the region specification unit 175 is determined . if the range of the region is determined ( yes ), the process proceeds to step s 42 . if the range of the region is not fixed ( no ), the process ends . in step s 42 , the application control unit 173 maintains the state where the range of the region specified by the region specification unit 175 is determined . in step s 43 , the application control unit 173 makes the handwritten text recognizing application perform drawing processing of an image indicating a state where the region specified by the region specification unit 175 and the handwritten text in the region move according to the drag of the touch pen 18 . in step s 44 , the application control unit 173 carries out the drawing processing of the image of the handwritten text that is input by the handwritten text input unit 174 by the handwritten text recognizing application . in step s 45 , the application control unit 173 determines the details of the event caused by the touch pen 18 . specifically , if it is in a state where a region is specified by the region specification unit 175 , the application control unit 173 makes the process proceed to step s 46 ; if it is in a state where the region and the handwritten text inside the region can be moved by dragging the touch pen 18 , the application control unit 173 makes the process proceed to step s 49 ; and if it is in a state where the handwritten text can be input by the handwritten text input unit 174 in the specified region , the application control unit 173 makes the process proceed to step s 54 . in step s 46 , the application control unit 173 determines whether or not the range of the region specified by the region specification unit 175 is determined . if the range of the region is determined ( yes ), the process proceeds to step s 47 . if the range of the region is not fixed ( no ), the process proceeds to step s 48 . in step s 47 , the application control unit 173 sets the region specified by the region specification unit 175 to a state enabled for inputting the handwritten text by the handwritten text input unit 174 . in step s 48 , the application control unit 173 set a state where a region is not specified by the region specification unit 175 , that is , the application control unit 173 sets the state of the region specification unit 175 to an initial state . in step s 49 , the region specified by the region specification unit 175 is dragged to one of the icons 19 a - 19 f by operating the touch pen 18 , and the application control unit 173 determines whether or not the icon 19 a - 19 f is associated with an application . if the icon 19 a - 19 f is associated with an application ( yes ), the process proceeds to step s 50 . if the icon 19 a - 19 f is not associated with an application ( no ), the process proceeds to step s 53 . in step s 50 , by the handwritten text recognizing application , the handwritten text input unit 174 performs pattern matching between the detected trajectory and the text stored in the handwritten text recognizing database , and converts the text with the highest recognition rate into text data . in step s 51 , the handwritten text input unit 174 transmits the text data that underwent the conversion to an application associated with one of the icons 19 a - 19 f . in step s 52 , the application control unit 173 set a state where a region is not specified by the region specification unit 175 , that is , the application control unit 173 sets the state of the region specification unit 175 to an initial state . in step s 53 , the application control unit 173 sets the region specified by the region specification unit 175 to a state enabled for inputting the handwritten text by the handwritten text input unit 174 . in step s 54 , the handwritten text input unit 174 conclusively fixes the input of the trajectory drawn using the touch pen 18 . as described above , according to the second embodiment , the cellular telephone device 1 can input the selected text into an application by starting the application by an intuitive operation that uses icons ( icons 19 a - 19 f ) displayed on the display unit 11 . next , a third embodiment according to the electronic device of the present invention will be described . with respect to the third embodiment , points that differ from the first and second embodiments will mainly be described , identical reference numerals are assigned , and descriptions omitted for components that are the same as the first or second embodiment . descriptions as in the first and second embodiments apply as appropriate for points that are not described in particular with respect to the third embodiment . the cellular telephone device 1 according to the third embodiment is different from the second embodiment in that it selects text displayed on the display unit 11 after contact to the region , where an image ( for example , an icon ) displayed on the display unit 11 is displayed , is detected . that is , when contact to the region , where an image ( for example , an icon ) displayed on the display unit 11 is displayed , is detected by the detecting unit 12 and text is selected by detecting contact to at least a part of the text displayed on the display unit 11 by the detecting unit 12 , the application control unit 173 inputs the selected text by starting an application that is associated with an icon on which the contact is detected . fig1 and fig1 are diagrams showing an example of the screen displayed on the display unit 11 according to the third embodiment . in fig1 , a browser application has been started and text “ abcdefg ” is displayed on the display unit 11 , and application starting icons 20 a - 20 d that are associated with applications are displayed in the lower part of the display unit 11 by the application control unit 173 . then , in the state shown in fig1 , text is selected by , for example , detecting , with the detecting unit 12 , contact of the user &# 39 ; s thumb 25 a to the icon 20 a , and detecting , with the detecting unit 12 , contact of the user &# 39 ; s index finger 25 b to the text “ abcdefg ” displayed on the display unit 11 ( refer to fig1 ). then , when the detection of the contact to the icon 20 a is determined by the contact of the thumb 25 a to the icon 20 a being released , the application control unit 173 starts an application ( for example , a memo pad application ) associated with the icon 20 a and inputs the selected text “ abcdefg ” into the started application . thereby , as in the second embodiment , the cellular telephone device 1 according to the third embodiment can input the selected text into an application by starting the application by an intuitive operation using images ( icons ) displayed on the display unit 11 . in particular , since the operation involves selecting the text targeted to be input by the index finger 25 b while specifying the application targeted to be started with the thumb 25 a , the operation is carried out smoothly from the index finger 25 b to the thumb 25 a , enabling the cellular telephone device 1 to start the application by an intuitive operation and input the selected text into the application . in addition , since the cellular telephone device 1 starts an application stored by being associated with an icon 20 a when the detection of the contact to the icon 20 a is determined , it is possible to prevent erroneous operations as a result of the operation of selecting text . fig1 is a flow chart showing processing by the application control unit 173 according to the third embodiment . in step s 61 , the application control unit 173 detects contact to the touch panel 10 by the detecting unit 12 . in step s 62 , the application control unit 173 determines whether or not one of the application starting icons 20 a - 20 d is displayed on the contacted position . if one of the icons 20 a - 20 d is displayed ( yes ), the process proceeds to step s 63 . if the icon 20 a - 20 d is not displayed ( no ), the process ends . in step s 63 , the application control unit 173 stores in the storage unit 16 an application associated with one of the icons 20 a - 20 d displayed on a position where the contact is detected in step s 61 . in step s 64 , the application control unit 173 determines whether or not another contact to the touch panel 10 is detected by the detecting unit 12 in a state where contact to the touch panel 10 is detected by the detecting unit 12 . if another contact is detected by the detecting unit 12 ( yes ), the process proceeds to step s 65 . if another contact is not detected by the detecting unit 12 ( no ), processing in step s 64 is repeated again . in step s 65 , the application control unit 173 stores in the storage unit 16 a position where the contact is detected in step s 64 . in step s 66 , the application control unit 173 determines whether or not movement of the contact position in a state where the contact is maintained , is detected by the detecting unit 12 , that is , whether or not sliding is detected by the detecting unit 12 in a state where the contact is maintained . if sliding is detected by the detecting unit 12 ( yes ), the process proceeds to step s 67 . if sliding is not detected by the detecting unit 12 ( no ), processing in step s 66 is repeated again . in step s 67 , the application control unit 173 stores in the storage unit 16 information displayed on a position selected by the sliding , that is , text displayed at a position selected with the sliding . in step s 68 , the application control unit 173 determines whether or not the contact to one of the icons 20 a - 20 d is released . if the contact to one of the icons 20 a - 20 d is released ( yes ), the process proceeds to step s 69 . if the contact to one of the icons 20 a - 20 d is not released ( no ), the process returns to step s 66 . in step s 69 , when the contact to one of the icons 20 a - 20 d is determined by the contact to one of the icons 20 a - 20 d being released , the application control unit 173 starts an application stored as being associated with one of the icons 20 a - 20 d . in step s 70 , the application control unit 173 inputs the text stored in step s 67 into the started application . as described above , according to the third embodiment , the cellular telephone device 1 can input the selected text into an application by starting the application by an intuitive operation using images displayed on the display unit 11 . in addition , although the handwritten text input unit 174 detects a trajectory ( text or image ) drawn by the handwritten text input unit 174 using the touch pen 18 after specifying a region by the region specification unit 175 in the embodiment described above , the region may be stored by the region specification unit 175 after detecting the trajectory ( the text or the image ) drawn by the handwritten text input unit 174 using the touch pen 18 . in addition , although an example where a browser application has been started and an image f 11 is displayed on the display unit 11 in the embodiment described above , the present invention is applicable even for a state where another application is started , and furthermore , the present invention is applicable even for a state where a standby screen is displayed . in addition , embodiments that combine suitably the above - described first , second , and third embodiments are also possible . embodiments of the present invention have been described above , but the present invention is not limited to the embodiments described above and can be modified as appropriate . in addition , in the embodiments described above the cellular telephone device 1 is described as a digital camera , but a phs ( registered trademark : personal handy phone system ), a pda ( personal digital assistant ), a portable navigation device , a personal computer , a notebook pc , or a portable gaming device are also possible .
| 6 |
embodiments of the present application are described in detail below with reference to the accompanying drawings . it should be emphasized that the following descriptions are merely illustrative and are not intended to limit the scope and application of the present invention . fig1 a and fig1 b show a 3 - degrees of freedom model of a continuous span of a to - be - simulation - tested overhead power transmission conductor ; as shown in fig2 , according to embodiments of the present application , a conductor sleet jump simulation measuring and calculating method includes two procedures , namely , static processing and dynamic processing procedures , where the static processing procedure provides a measured and calculated initial value for the dynamic processing procedure ( before t & lt ; 0 , the conductor reaches a state ), that is , an initial state of the conductor before the jump , and the dynamic processing uses the initial state to measure and calculate displacement and tension states of each point of the conductor at a to - be - tested discrete moment . static processing obtains a suspending state ( for example , each point sags ) and a stress state of the conductor under a given meteorological condition and line parameter . the static processing includes : measuring and calculating a conductor stress under a testing meteorological condition by using parameters , such as a static load of the given meteorological condition and a conductor stress , that are measured in advance and measuring and calculating an initial displacement of the conductor according to the load and stress ( a z - y relationship , where an x is consistent and given ). the stress under a given typical meteorological condition i and a testing meteorological condition ii satisfies a state equation : σ i is a conductor allowable maximum stress ( the middle - span ), σ ii is a conductor stress under the testing meteorological condition , e is a comprehensive elastic coefficient of the conductor , α is a coefficient of thermal expansion , t i is a temperature , and l is a representative span of a strain section , which may be calculated by using the equation where i i0 a span of each span of the conductor , γ is a relative load of an overhead conductor ( that is , a ratio of a load withstood by a conductor of a unit length to a sectional area of the conductor ), and where q is a load withstood by the conductor of a unit length , and a is a sectional area of the conductor . the subscripts i and ii represent that the parameters are parameters respectively corresponding to the typical meteorological condition i and the testing meteorological condition ii . a span refers to a projection distance vertical to a load direction between two adjacent suspending points . a designing object of a tension sage of an overhead power transmission line conductor is using a relatively great stress to obtain a relative small conductor sag as much as possible and ensuring that a maximum stress of the conductor under various allowable meteorological condition combinations is smaller than or equal to the allowable maximum conductor stress . preferably , with regard to multiple given typical meteorological condition combinations , a procedure of determining a conductor stress is : first comparing magnitudes of conductor stresses under multiple typical meteorological condition conditions , making a maximum value of the conductor stress in the typical meteorological condition combination reach a conductor allowable maximum use stress , that is , mounting the conductor in this state to tension the conductor , using the group of typical meteorological conditions corresponding to the maximum value as the given typical meteorological condition , and on the basis of the above , obtaining stresses of the conductor in rest meteorological conditions by using the state equation of the equation ( 1 ). since the date of setup , the conductor is subject to load effects such as gravity of the conductor , icing , and wind , which constitute q ( or γ ). a preferable manner of measuring and calculating the static load q of the conductor is as the following table , where q = p : because a distance between suspending points of an overhead power transmission conductor is relatively great , and the stiffness of a conductor material has an excessively small impact on a geometric shape of the conductor , the conductor is generally assumed as a flexible chain that is hingedly connected throughout , that is , the assumption of “ a catenarian ”. the conductor static suspending equation ( namely , a catenary equation of the conductor ) according to the assumption is : z is a known horizontal coordinate ( along a line direction ) of each point in a current testing span , y is a to - be - calculated vertical coordinate of each point , z 0 and y 0 are constant parameters : h is a height difference between two suspending points , and when the suspending point on the right side is higher than the suspending point on the left signal , the height difference is a positive value . the conductor kinetic equation for measuring and calculating conductor displacement and tension states of the conductor at a discrete moment is : m , f c , t , and p are a mass matrix , a damping matrix , a tension matrix , and an external force matrix respectively . x is a displacement , { dot over ( x )} is a speed , and { umlaut over ( x )} is acceleration . an assumption of node unit mass concentration is used , and the mass matrix m is a diagonal matrix ; f c = c { dot over ( x )}, where c is a damping coefficient , which can be selected according to engineering experience ; t = kx , where k a stiffness matrix , which is determined according to a dynamic tension between two adjacent points and a deformation amount thereof , and the deformation may be determined according to the calculation on the displacement of the conductor in the preceding text and includes three directions of x , y , z . the conductor sleet jump is a strongly nonlinear dynamic procedure , preferably , an explicit direct integration algorithm based on a central difference is used , and speed and acceleration vector in the method are : the central difference explicit algorithm is a condition convergence algorithm , and a step length satisfies : ω n is a maximal order inherent vibration frequency of a system . a common conductor dynamic analysis model usually only considers a situation of a single span and considers that a moving unit merely performs a 2 - degrees of freedom of transitional movement within an xy vertical plane . precision of this type of model can basically satisfy requirements in a movement of a small span and a small amplitude , but in a case of a multi - span conductor and in a case that the conductor obviously swings in the z - axis direction , this type of model has a relatively large error . therefore , this type of model cannot satisfy a situation of uneven deicing of a continuous - span conductor . to simulate , measure , and calculate a motion state of a deicing procedure of an overhead power transmission conductor , a following dynamic model of multi - span concentrated mass of the overhead power transmission conductor is established . the conductor is segmented into several conductor elementary sections , the mass of the conductor is concentrated on the node of the conductor , mass points are connected by using an elastic element without mass , that is , connected by using a tension , and its bending and turning stiffness is not taken into consideration . each mass point may transitional move ( 3 degrees of freedom ) in a space ( x , y , and z ), and a series of external forces , such as loads , such as a self weight load , an icing load , and a wind load , distributed on the whole conductor length and a tension of an insulator string at a suspending point , that the conductor may withstand in a running environment are taken into consideration . for each node unit , its dynamic equation , namely , ( equation 4 ), is listed . because of the elastic connection between mass points , the tension matrix t is a non - diagonal matrix ( which is not 0 between adjacent points ). refer to fig3 for conductor sleep amplitude changing curves in simulation measurement and calculation and experimental simulation in a case in which a single span has a span of 235 m and icing of 15 mm and is iced by 100 %. it could be known from fig3 that in the case in which the single span is deiced by 100 %, a digital simulation curve of the conductor jump amplitude is basically consistent with an experimental curve . experimental working conditions of a single span are completely simulated , and under various working conditions of the single span , comparison between conductor jump amplitude simulation calculation results and experimental results is as the table . it could be known from the comparison between the measurement and calculation results and the simulation experiment results that , in a case of a single span , under the condition that the same measurement and calculation conditions and simulation working conditions are used , the measurement and calculation results of the conductor jump amplitude are basically consistent with the simulation experiment results ( the errors are all less than 10 %). the foregoing content is detailed description of the present application with reference to the specific preferred embodiments , but it cannot be considered that the specific implementation of the present application is limited to the description . several simple derivation or replacements made by persons of ordinary skill in the art without departing from the idea of the present application all should be regarded as falling within the protection scope of the present application .
| 6 |
fig1 shows a positive pressure bernoulli - type wand 102 typically used in the processing of semiconductor material . in some embodiments , the device is made primarily of quartz . it has top plates 104 and bottom plates 106 . the plates are joined to form or contain a working gas flow channel 108 that has a smooth , continuously curving path . fig1 also shows several small openings 110 , and bottom plate 106 has underside 112 . small openings 110 allow working gas to flow out of channel 108 through the bottom plate 106 . small outlet orifices should be small enough to maintain a pressure difference of p 1 ( inside wand )& gt ; p 2 ( atmosphere / air ) in order to provide for sufficient mass flow rate to provide lift / suction of the wafer . typically , the diameter of these holes is on the order of hundredths of inches to maintain an appropriate mass flow - rate . fig2 , also , shows top and bottom plates 104 and 106 in a bonded configuration . fig2 also illustrates the underside 112 of bottom plate 106 , not directly shown . in fig2 , small openings 110 are not shown . fig3 shows a top view of wand 102 . this view is looking down through the device . channel 108 is shown in relief . channel 108 is formed into or onto the surface of the bottom plate 106 such as by milling or other technique known to those of ordinary skill in the art . the surface of the bottom plate comprising channel 108 faces or bonds to top plate 104 . the working gas enters channel 108 through air inlet 114 . alternatively , channel 108 is formed into or onto top plate 104 such as by milling or other technique known to those of ordinary skill in the art . in this alternative , the surface of the top plate containing channel 108 bonds to bottom plate 106 . in some embodiments , channel 108 is formed into or onto both top plate 104 and bottom plate 106 . fig4 shows working gas flow is illustrated by vectors . gas flows out of small orifices 110 and generates the bernoulli effect . the indicated gas flow through small orifices 110 in underside 112 of bottom plate 106 is down upon the upper surface of an object beneath wand 102 . this flow of the working gas induces a vacuum above the surface of the object beneath wand 102 . under normal atmospheric pressure , the vacuum above the object beneath wand 102 pulls the object toward wand 102 until it comes in close contact with underside 112 . the downward flow of the working gas ( vectors in fig4 ) prevents the object from contacting wand 102 . this prevents damage to the object that would normally occur if the object contacted a tool . fig5 and 6 depict semiconductor 116 being manipulated by wand 102 . fig5 shows that semiconductor 116 approaches underside 112 , but does not contact it . top and bottom plates 104 and 106 , shown in fig2 may be made of any material suited for use in the semiconductor reactor arena including ; quartz ( sio2 ), silicon carbide ( sic ), magnesium oxide ( mgo ), aluminum oxide ( al2o3 ), titanium carbide ( tic ). in some embodiments , the top and bottom plates 104 and 106 comprise quartz or consist essentially of quartz . the plates may be joined with any adhesive known for use in the semiconductor processing field including materials comprising graphite , alumina , silica , magnesium oxide . in some embodiments , adhesives comprise ceramic or graphite . the plates may be joined with thermally worked frit comprising or consisting essentially of quartz , such as thermally worked solid intermediary quartz , glass , related ceramic , or epoxy . the plates may be joined using other methods commonly used to connect quartz in a heat process known to those in the semiconductor field . in some embodiments , the joint is a bond . a bond is an adhesive , cementing material , or fusible ingredient that combines or unites top plate 104 to bottom plate 106 into a rigid unit . the plates may be bonded using laser bonding , where the laser , such as a co2 laser , is focused at the bond line allowing a weld seam to be created between the plates . those of ordinary skill in the art will recognize that other bonding or heating techniques would suit this invention . this invention uses a smooth and continuously curved channel 108 , as shown in fig1 , and 4 , within wand 102 . channel 108 does not cross back upon or intersect with itself . and channel 108 has no sharp angles or no macroscopic sharp angles , as shown in fig1 and 4 . this smooth and continuous curving of channel 108 reduces potential stress points , which may otherwise occur at the intersection of two channels or in the region of a step of a sidewall within a channel . without wishing to be bound by any theory , using a smooth continuous channel 108 allows wand 102 to be manufactured with fewer built - in stress - crack - initiation points . this may yield fewer stress cracks over time and may yield a more durable wand 102 . in prior art devices , discontinuous or sharply angled changes in the channel &# 39 ; s path can create stress - crack - initiation points . these stress points may help to create or to propagate stress fractures during gas flow . this wand is made in a manner common to the current manufacturing methodology of bernoulli wands in use in the semiconductor processing industry today . two quartz plates , a top plate and bottom plate , are made to specifications common to wand manufacture in the semiconductor field . therefore , they are made to fit commonly used semiconductor reactors . channel 108 is created by milling a groove into either or both plates 104 and 106 before bonding them together . in this embodiment , channel 108 is milled or bonded with a channel width of 6 . 35 mm and an overall length of 470 mm . channel width and length may vary according to the overall dimensions of the wand 102 . the plates are bonded together using thermally worked frit comprising or consisting essentially of quartz , glass , or related ceramic . the bonding of the two plates to each other may be done using epoxy , melted glass or quartz particles or other methods commonly used to bind quartz in a heat process known to those in semiconductor field . the creation of the continuous curved channel groove 108 in the plates 104 and 106 may be done by milling , grinding , drilling or other common methods used in the machining of quartz . this application may be applied to one or both plates that are part of wand 102 .
| 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.